Transcriptional control induced by bcr-abl and its role in leukemic stem cell heterogeneity. Sarah Beatriz de Oliveira Pagliaro
To cite this version:
Sarah Beatriz de Oliveira Pagliaro. Transcriptional control induced by bcr-abl and its role in leukemic stem cell heterogeneity.. Cancer. Université Paris-Saclay, 2020. English. NNT : 2020UPASQ032. tel-03219351
HAL Id: tel-03219351 https://tel.archives-ouvertes.fr/tel-03219351 Submitted on 6 May 2021
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Thèse de doctorat de l'université Paris-Saclay
École doctorale n° 569, Innovation thérapeutique : du fondamental à l'appliqué (ITFA) Spécialité de doctorat : Physiologie, Physiopathologie Unité de recherche : Université Paris-Saclay, Inserm, Modèles de cellules souches malignes et thérapeutiques, 94805, Villejuif, France. Référent : Faculté de pharmacie
Thèse présentée et soutenue à Villejuif, le 14 Septembre 2020, par,
Sarah Beatriz DE O. PAGLIARO
Composition du Jury
Jean Henri BOURHIS Directeur de recherche, Institute Président Gustave Roussy
Pierre SAVATIER Directeur de recherche, INSERM U1208 Rapporteur & Examinateur Paul COPPO Professeur, Hôpital Saint Antoine, AP- Rapporteur & Examinateur HP Jean Claude CHOMEL Praticien hospitalier, Centre Hospitalier Examinateur Universitaire de Poitiers
Ali TURHAN PU-PH, Université Paris-Saclay Directeur de thèse : 2020UPASQ032 NNT Thèse doctorat de
TRANSCRIPTIONAL CONTROL INDUCED BY BCR-ABL
AND ITS ROLE IN LEUKEMIC STEM CELL
HETEROGENEITY
Presented by Sarah B. de O. Pagliaro
Public Discussion (14 september 2020)
Inserm U935
Supervised by Prof A Turhan
Université Paris Saclay
ED 569
Page | 1
1. Chronic Myeloid Leukemia (CML) 9 1.1 Historical background 9 1.2 Philadelphia Chromosome 10 1.3 The Bcr-Abl protein 11 1.3.1 The Bcr-Abl isoforms 11 1.3.2 Consequences of BCR-ABL1 generation in hematopoietic cells 13 1.3.2.1 Signaling pathways 14 1.3.2.1.1 JAK/STAT 14 1.3.2.1.2 PI3K/AKT/CRK 14 1.3.2.1.3 RAS / MEK 15 1.3.2.1.4 SRC KINASES 16 1.3.2.1.5 DEREGULATION OF APOPTOSIS 16 2. Hematopoiesis 18 2.1 Hematopoietic stem cells (HSC) 19 2.1.1 In vitro detection tests 20 2.1.2 In vivo detection tests 21 2.1.3 Progenitors and precursors and mature cells 22 2.2 Regulation of the hematopoiesis 24 2.2.1 The microenvironment 24 2.2.1.1 Osteoblastic niche 25 2.2.1.2 Vascular niche 25 2.2.1.3 Molecular mechanisms within the microenvironment 26 2.2.1.4 Growth factors 27 2.2.1.4.1 Positive regulators of hematopoiesis 28 2.2.1.4.2 Negative regulators of hematopoiesis 28 2.2.1.5 Other stimulating factors for HSCs and progenitors 28 2.2.1.6 Intrinsic regulation 29 2.3 CML Stem Cells vs Hematopoietic Stem Cells 31 3 Modelling CML 32 3.1 Murine models 32 3.1.2 SCLtTA/BCR-ABL transgenic model 32 3.1.3 Xenograft models 33 3.2 Cellular models 35 3.2.1 Cell Lines 35 3.2.2 Primary leukemic cells 35 3.2.3 iPSC 36 4. Diagnosis. 37 4.1 Evolution of the disease and prognosis 37 5. CML Therapy 39 5.1 Treatment History 39 5.1.1 The introduce of TKIs, a turning point in CML history 39 5.1.2 Hematopoietic Stem Cell Transplantation (HSCT) 40 5.2. Conventional therapies 41 5.2.1 Chemotherapy 41 5.2.2 Interferon alpha (IFNα) 41 5.3 Targeted therapies – TKIs 42 5.3.1 1st generation TKI 42 5.3.1.1 Imatinib 42 5.3.2 2nd generation TKIs 43 5.3.2 1 Dasatinib 43 5.3.2.2 Nilotinib 44 5.3.2.3 Bosutinib 45 5.3.3 3rd generation TKI (mutation T315I) 45 5.3.3.1 Ponatinib 45 5.4 Mechanisms of resistance 46 5.4.1 Efflux mechanisms and carrier hOCT1 46 5.4.2 SRC overexpression 47 5.4.3 Increased expression of BCR-ABL1 47 5.4.4 Mutations of the ABL kinase domain 48
5.5 Resistance and mechanisms involved in the persistence of leukemic
Page | 3 stem cells 49 5.5.1 Activation of leukemia stem cell signaling pathways 51 5.5.2 Clonal evolution and gene instability 54 5.5.3 Quiescence phenomenon 55 6. Allogeneic HSCT in a post-TKI era 58 7. Tumor Heterogeneity : Overview 60 7.1 Implications of Heterogeneity 62 7.2 Heterogeneity of leukemic cells in CML 63 8. Transcriptional heterogeneity 64 8.1 Transcriptional heterogeneity in leukemia 64 9. Eukaryotic Elongation 2 Kinase 65 9.1 EEF2K in normal cells 65 9.21 EEF2K in cancer 66 10. Methods of single cell analyses 68 10.1 Single Cells and Computational analysis 72 10.2 Single cell isolation techniques 72 10.2.1 Data Analysis 74 10.3 C1 from Fluidigm 74 10.4 Monocle and Pseudotime 75 11. Single-cell applications in cancer 81 Objectives of the Thesis 82 Paper 1. Summary 83 Paper 1 Summary (in French) 86 Paper 1 – IN PRESS 89 Paper 2 Summary 104 Paper 2 Summary (in French) 107 Paper 2 IN PREPARATION 109 General Discussion 142 References 148
Abbreviations 5-FU 5-Fluorouracil 5-LO 5-lipoxygenase ABL Abelson murine leukemia viral oncogene AHI 1 Abelson Helper Intergration Site 1 AHR aryl hydrocarbon receptor AKT RAC-alpha serine/threonine-protein ALL Acute Lymphoid Leukemia Alox5 Arachidonate 5-lipoxygenase AML Acute Myeloid Leukemia Ang-1 angiopoietin-1 AP Acute Phase ATP adenosine triphosphate B-ALL Acute B Lymphoid Leukemia BCL2 B-cell lymphoma 2 BCL-X1 B-cell lymphoma-extra large BCR Breakpoint Cluster Region BFU burst-forming unit BM Bone Marrow BMDW Bone Marrow Donors Worldwide BMT Bone Marrow Transplantation BP Blastic Phase CAD coronary artery disease CAFC cobblestones Area Forming Cell CCgR complete cytogenetic remission CD(number) Cluster Differentiation (number) CFC Colony Forming Cells CFU Colony Forming Unit CFU-M Colony Forming Unit - Macrophage CLP common lymphoid progenitor
Page | 5
CML Chronic Myeloid Leukemia CMP common myeloid progenitor Col1a1 collagen a1 type 1 CP Chronic Phase CRKL CRK Like Proto-Oncogene CSC cancer stem cells CVA cerebrovascular disease CXCL CXC chemokine ligand CXCR CXC chemokine receptor DNA deoxyribonucleic acid ECM extracellular matrix EPO erythropoietin ERK Mitogen-Activated Protein Kinase ET essential thrombocythemia FACS Fluorescence Activated Cell Sorting FLT3-L Fms-Like Tyrosine kinase 3-ligand G Granulocyte GAB2 Growth Factor Receptor Bound Protein 2 GATA Globin Transcription Factor G-CSF Granulocyte-Colony Stimulating Factor GEF Guanine nucleotide exchange factors GEMM granulocyte, erythrocyte, monocyte, megakaryocyte GM granulo-macrophagic GM-CSF Granulocyte and Macrophage-Colony Stimulating Factor GTP Guanosine-5'-triphosphate HCK Hemopoietic Cell Kinase HOXB4 Homeobox B4 HSC Hematopoietic Stem Cells HSPC Hematopoietic Stem and Progenitor Cell IFN-2b Interferon 2 beta
IFNα Interferon alpha IL-2 Interleukin-2 IL-3 Interleukin-3 IL-4 Interleukin-4 IL-6 Interleukin-6 IM Imatinib IRIS International Randomized Study of Interferon JAK Janus tyrosine kinases KLF4 Kruppel-like factor 4 LIN Lineage Lmo-2 LIM domain only 2 LSC Leukemic Stem Cell LTB4 Leukotriene B4 LTC-IC long-term culture initiating cells MCL-1 Induced Myeloid Leukemia Cell Differentiation Protein M-CSF Macrophage-Colony Stimulating Factor MDR-1 Multi Drug Resistance 1 MEK Mitogen-Activated Protein Kinase MF primary myelofibrosis Mip-1α Macrophage inhibitory protein-1α MK megakaryocyte MMP matrix metalloprotease MMR Major Molecular Response MPP immature multipotent progenitor MR Molecular Response mRNA Message Ribonucleic Acid mTOR Mechanistic Target Of Rapamycin Kinase NANOG Nanog Homeoboc NK Natural Killer NOD-SCID Non-Obese Diabetic -SCID mutation
Page | 7
OCT Organic Cation Transporter OPN osteopontin PAOD peripheral arterial occlusive disease PDFG Platelet-Derived Growth Factor PDX Patient Derived Xenograft PF4 Platelet Factor-4 Ph Philadelphia Chromosome PI3K Phosphatidyl-inositol-3-kinase PML Promyelocytic Leukemia PTEN Phosphatase and Tensin Homolog PTH parathormone PV Polycythemia Vera SCF Stem Cell Factor SDF-1 Stromal Derived Factor-1 SH Src Homology Smo Smoothened SOX2 SRY-Box Transcription Factor 2 SR1 Stem Regenin SRC Sarcoma STAT Signal Transducer and Activators of Transcription STI selective tyrosine kinase inhibitors STIM Stop IMatinib TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin TGFβ Transforming growth factor beta TK Tyrosine Kinase TKI Tyrosine Kinase Inhibitor TNF-α Tumor Necrosis Factor-α TPO thrombopoietin WHO World Health Organization Wnt Wingless-Type MMTV Integration
1 Chronic Myeloid Leukemia (CML)
CML is a myeloproliferative disorder that is currently classified in the context of myeloproliferative neoplasia along with polycythemia vera (PV), primary myelofibrosis (MF) essential thrombocythemia (ET) chronic neutrophil leukemia, chronic eosinophilic 1 leukemia, and unclassifiable myeloproliferative neoplasias.
1.1 Historical background
The first descriptions of clinical cases corresponding to CML have been reported in 19th century. In 1840s, two cases of patients presenting with fever, major splenomegaly, leukocytosis were published, almost simultaneously, by John Hughes Bennett2 in Scotland; and Rudolph Virchow in Germany3. Both papers were preceded from a report published in Paris, by Alfred Donne 4, that had described a possible case of leukemia, although the lack of details did not allow conclusions to be drawn. Virchow described terms as ‘’white blood’’, that became ‘’Leukamie’’ in German, while Bennett created the term of ‘’leucocythaemia’’ or ‘’white cell blood’’5. About 30 years later, the origin of leukemia was finally linked to the bone marrow by Ernest Neumann. CML have been afterwards treated with approaches such as administration of low doses of arsenic and starting from early 20th century by spleen irradiation.
The seminal discovery in the field of CML research occurred in 1960 where that the Philadelphia Chromosome was described by Nowell and Hungerford.6 The presence of the abnormality was later confirmed by other studies and the aberrant chromosome was named as Philadelphia Chromosome (Ph). In 1973, due the evolution of the cytogenetics technology (banding), Janet Rowley was able to demonstrate that the Ph chromosome was formed by a translocation between Chromosome 22 and Chromosome 9 [t(9;22)].7 In the early 1980s, the Abelson gene (ABL) was identified on the Ph chromosome (Chromosome 22) of CML patients, while normally it should be located on chromosome 9. 8In 1984, a group of scientists in Rotterdam unraveled the BCR gene on Chromosome 22.,9 BCR-ABL fusion gene was clones identified by
11,12 scientists from the Weizmann Institute in Israel.
Page | 9
Figure 1. Schematic representation of clinical and biological developments in the field of CML.
1.2 Philadelphia Chromosome
First described by Nowell and Hungerford, the Philadelphia Chromosome (Ph) is the small 9q- chromosome formed from the reciprocal t( 9;22) translocation13. The presence of a translocation between the long arms of chromosomes 9 and 22 - t(9; 22) - was demonstrated in 1974 by Janet Rowley 14 and the BCR-ABL gene could be cloned in 198415 This is the first neoplastic pathology characterized by the specific link between a type of cancer and a biological marker.
The Philadelphia Chromosome is the pathognomic marker of CML, but can also, although it is rare, be detected in AML patients, and its presence is linked to a bad
16 prognosis.
The coexistence of normal HSC along with Ph1+ HSC has been demonstrated even at advanced phases of the disease 17During the process of translocation, the breakpoint cluster region (BCR) gene, normally located on chromosome 22, where the breaks occurs in a small 5Kb region, fuses to the Abelson murine leukemia viral
oncogene homolog 1 (ABL1), normally located on chromosome 9, generating the BCR- ABL fusion gene18. The encoded BCR-ABL protein exhibits an exacerbated tyrosine kinase activity, that plays a central role in the leukemogenesis process19.
1.3 The Bcr-Abl protein
1.3.1 The Bcr-Abl isoforms
While the ABL gene breakpoints highly variate upstream exon a2, there are only three known breakpoints regions in the M-BCR gene (between e13 and e14 or e14 and e15). 20 The BCR breakpoints are responsible for the three principal forms of BCR-ABL: p190, p210 and p230. 21 Generally, the different BCR-ABL forms are linked to different forms of leukemia. 18,22 The P190 form is found in 25% of cases of Ph-positive acute B lymphoid leukemia (B-ALL) and less frequently in acute myeloid leukemia (AML) and very rarely in CML 23,24. The P230 is associated to neutrophilic CML.25 The most common form, P210, is present in hematopoietic cells from CML stable phase and,
26–28 also, in acute lymphoid (ALL) and myeloid leukemias (AML).
29 Figure 3 Bcr-Abl protein isoforms
Page | 11
P210 is present in the most cases of CML, where b2a2 or b3a2 mRNA are produced as a result of a break in the major region of the BCR gene (M-BCR) generating the fusion gene BCR-ABL which in turn generates Bcr-Abl mRNA and p210 Bcr-Abl protein.
The breakpoint occurring the e1 of BCR gene (m-BCR), gives rise to the truncated Bcr- Abl gene which in turn gives rise to p190 protein which is at the origin of Bcr-Abl- positive acute lymphoblastic leukemia (ALL). Finally, the e19a2 mRNA whose breakpoint is located in the micro region of the BCR gene (μ-BCR) gives the p230 protein found in the rare form of chronic neutrophilic leukemia characterized clinically by the proliferation of white blood mature cells (neutrophils) without presence of
21 immature precursors fund in peripheral blood.
Figure 4 Philadelphia Chromosome (Ph), Bcr-Abl protein and its mRNA structure
The p210 Bcr-Abl protein contains more than 10 domains with a serine-threonine kinase domain, a Rho-GEF domain and a coiled-coiled oligomerization domain from Bcr. The coiled-coiled domain allows dimerization of the protein facilitating transphosphorylation of adjacent Bcr-Abl molecules. This part of Bcr is fused with SH domains, Abl DNA and actin binding domains. The SH1 domain has the Abl tyrosine kinase activity with the ATP binding domain and the catalytic phospho-transferase domain 18.
Although the fusion protein contains most of the coding sequences of Abl, the myristoylation site is lacking, contributing to the constitutive kinase activity of Bcr - Abl 29. Indeed, the Abl protein is capable of self-inhibition through this site and via molecular interactions involving its SH2 and SH3 domains.
1.3.2 Consequences of BCR-ABL1 generation in hematopoietic cells
As early as the 1990s, the mouse models demonstrated the oncogenic role of Bcr-Abl. After transplantation of BCR-ABL-expressing stem cells into mice, a phenotype of myeloproliferative type-CML syndrome was developed in these animals but all the features of the disease could not be reproduced. 30,31 In fact, the transplantation of retrovirally transduced 5-FU-enriched stem cells in irradiated mice generates a highly aggressive leukemia leading to rapid death of mice in 2-4 weeks. In parallel, in vitro experiments have demonstrated the oncogenic role of BCR-ABL which induces in hematopoietic cells, growth-factor-independence and resistance to apoptosis 32,33. These experiments suggested therefore strongly that BCR-ABL fusion gene is responsible for the development of the disease.
The Bcr-Abl protein causes abnormal activation of several signaling pathways in leukemic cells, giving them a proliferative and survival advantage. These activated pathways are related to growth factor dependence, apoptosis, proliferation and cell adhesion.
These pathways include Jak/STAT, PI3K/Akt and Ras/MEK, the major players in the pathogenic role.
Page | 13
1.3.2.1 Signaling pathways
The Bcr-Abl is an oncoprotein located mainly in the cytoplasm that has a constitutive tyrosine kinase activity34. The interaction of several cytoplasmic or membrane components such as STATs and RAS respectively, will lead to activation of secondary signaling pathways controlling mitosis and cell survival 35.
1.3.2.1.1 JAK/STAT
Janus tyrosine kinases (JAK) are activated by cytokine receptors. The binding of the ligand on the receptors modifies their conformation allowing their dimerization and the activation of JAK by phosphorylation. These proteins are ubiquitous and play an important role in proliferation, differentiation, cell cycle and apoptosis of hematopoietic
36 cells.
Cellular models of CML have demonstrated that Bcr-Abl kinase activity increases activation of JAK2/STAT allowing proliferation and cell survival.36, activating JAK2 and directly STAT5. JAK2 phosphorylates the tyrosine 177 residue of Bcr-Abl, allowing the 37 activation of STAT5-independent cell signaling pathway
STAT proteins are transcription factors of which only STAT1, STAT3 and STAT5a and STAT5b are found in hematopoietic cells 38. STAT proteins participate in oncogenesis by activating the transcription of target genes coding, for example, for the overexpression of anti-apoptotic proteins (Mcl-1, Bcl-x1, Bcl2) or cell cycle proteins (cyclin D1 or c-Myc). In cell lines or in primary CML cells, STAT5 is constitutively activated. 36,39. However, the use of STAT5 K/O mice model using conditional BCR- ABL expression has shown that STAT5 was essential for the maintenance and
40,41 development of leukemic cells.
It has been proposed that Bcr-abl can directly activate STAT5 and bypass the endogenous regulation of JAK2 to promote oncogenesis 42.
1.3.2.1.2 PI3K/AKT/CRK
The PI3K pathway (Phosphatidyl-inositol-3-kinase) modulates the activation of transcription factors promoting cell growth/survival and inhibition of cell death43.
AKT has multiple targets involved in resistance to apoptosis and proliferation. It is also a proto-oncogene, which has many downstream targets including mTOR. The mTOR pathway is responsible for controlling protein synthesis, cell size and autophagy. It has been observed that Bcr-Abl inhibits autophagy via mTOR and that TKI treatment
44 restores this pathway
The Crk1 adapter protein is constitutively activated in the CML representing a marker whose phosphorylation demonstrates the presence of Bcr-Abl TK activity 45. The other proteins related to Crk1 and Bcr-Abl are: STAT, Cbl, PI3K and Ras.46 Via these interactions, Crkl appears indispensable for oncogenesis mediated by Bcr-Abl. In murine models, this interaction is necessary to obtain the phenotype of the myeloproliferative syndrome 47.
1.3.2.1.3 RAS / MEK
The Ras protein has a GTPase activity and is an initiator of the MEK-1, MEK-2 and ERK pathways.This pathway is activated in several cancers and is involved in proliferation and cell survival 48.
Bcr-Abl1 activates Ras via Grb2/Gab2 which allows the activation of MEK/ERK pathways and the transcription of target genes involved in cell proliferation and a decrease in the expression of genes involved in the cell cycle and apoptosis 49. The Ras pathway is therefore activated constitutively by Bcr-Abl. In mouse models, inactivation of the Ras pathway attenuates the phenotype of CML 50.
Page | 15
50 Figure 5. : RAS Signaling pathway
1.3.2.1.4 SRC KINASES
The family of Src kinases is another group of Bcr-Abl target proteins, playing a major role in cell proliferation and differentiation. They are also involved in the transmission of extracellular signals 51.
In cellular models of CML, activation of some Src kinases is due to Bcr-Abl 52. Other studies have shown that Src kinases are essential for the transformation of BCR-ABL cell lines but also for the signal transduction of Bcr-Abl chimeric protein 51,53. In addition, Src kinases contribute to the activation of STAT5 and AKT by Bcr-Abl 54,55.
However, the importance of these kinases in the pathogenesis of the disease remains uncertain. In fact, mouse models show that Src kinases are not necessary for the initiation of CML but are rather involved in the pathophysiology of acute lymphoblastic leukemia 56.
1.3.2.1.5 Deregulation of apoptosis Bcr-Abl has been shown to inhibit apoptosis in several ways, including stimulating anti-apoptotic pathways or modulating the expression of pro-apoptotic proteins. Bcr-
Abl expression can inhibit apoptosis by increasing the expression of the antiapoptotic proteins Bcl2 and Bcl-x11. The PI3K/Akt and STAT5 pathways are important mediators of apoptotic function. Activation of STAT5 by Bcr-Abl increases the expression of Bcl-X1 39 In addition, the PI3K pathway allows the retention of Bad protein in the cytosol blocking mitochondrial depolarization preventing the activation of caspases required for apoptosis 57.
58 Figure 6. Bcr-Abl signalling pathway
Page | 17
2. Hematopoiesis
Mature blood cells have a limited lifespan and their production during the lifetime of an organism is ensured by the regulated activity of hematopoietic stem cells. In adult mammals, this process designed as hematopoiesis occurs primarily in the bone marrow, where billions of blood cells are produced every day. The different cell types are derived from very immature hematopoietic cells, or hematopoietic stem cells (HSCs), followed by a maturation process before gaining the bloodstream 59. HSCs are multipotent cells that are able to regenerate and sustain complete hematopoiesis when transplanted into myeloablated recipients 60. This special ability is widely explored in cancer treatment and other blood disorders via stem cell transplantation, the only curative approach in several types of leukemias, including CML until the advent of TKI therapies 61.
Hematopoiesis is a hierarchically organized process, departing from the most primitive hematopoietic stem cells, which give rise to lineage-progenitor cells, such as common myeloid and lymphoid progenitors (CMPs and CLPs, respectively) which in turn generate differentiated and cytologically identified blood cells 62,63. However, experimental data giving rise to this classic organization has been obtained by transplantation of cell populations, rather that the analysis of steady state hematopoiesis. Recent technological advances allowed the follow-up up single clonal HSC without the stress induced by transplantation in mice 64 . These studies suggest that in steady-state hematopoiesis, HSCs generate long-lived progenitors which can give rise themselves to differentiated hematopoietic cells 64. In these conditions, the kinetics of this phenomenon has also been suggested to be different from the classical model, with early generation of MK progenitors from HSC then their rise to myeloid cells and lymphocytes 65 66 67 69.The organization of the branches has also been questioned, such as the bifurcation of erythroid/megakaryocytic/myeloid versus lymphoid cell fates, as well as megakaryocytic and/or erythroid lineages 70–72. Furthermore, some groups have being demonstrating that the lineage-commitment may already be determined in primitive HSCs 73–75.
As research technology advances, it becomes increasingly apparent that the hematopoiesis process may be more complex and heterogenous than one thought. However, the elucidation of the clonal dynamics of HSC and their potential will require experimental data like what has been obtained in Wiskott-Adrich patients transplanted
68 with genetically marked cells
2.1 Hematopoietic stem cells (HSC)
HSCs are characterized by 3 fundamental properties:
1 - self-renewal ability, ensuring their durability by giving both an identical daughter cell that keeps all the properties of the mother cell, but also able to differentiate itself. Self- renewal is possible due to the ability of asymmetric divisions probably under the influence of the niche, allowing the stem cells to generate daughter cells engaged in differentiation while remaining pluripotent.
2 – Ability to differentiate into all hematopoietic lineages
3 - Long-term quiescence capacity under the influence of factors related to the niche
60 or intrinsic factors
Hematopoietic stem cells (HSCs) are present in very small quantities in adult bone marrow (estimated at 1/100,000 in the bone marrow) and do not have specific 59 morphological characteristics recognizable in conventional cytology.
The concept of stem cells within hematopoiesis was initially raised by Till and McCulloch76. These authors have demonstrated that the hematopoietic reconstitution of a lethally irradiated mouse receiving a bone marrow transplant passes through a stage of cell colony development in the spleen, each of these colonies coming from a cell called "CFU-spleen" (CFU- s). The presence of a stem cell at the origin of each of these colonies was deduced due to the fact that cytological analysis of CFU-S showed the presence of granulocytic, erythroid and megakaryocytic cells76. These dissected and homogenized CFU-S could then reconstitute the hematopoiesis in other lethally irradiated recipient mice showing their hematopoietic potential which was found to be
Page | 19
heterogeneous in the CFU-S 77 explaining the reduction in the reconstitution capacity of the hematopoiesis after serial grafting78. The formal demonstration of the existence of myelo-lymphoid murine hematopoietic stem cells was subsequently carried out through defective retroviral-labeled stem cell transplantation experiments showing the presence of my same retroviral insertion at the level of myeloid and lymphoid cells. in the recipient mouse79. Since the development of characterization and isolation techniques for stem cells with the discovery of the Sca1 antigen 80, it is currently possible to purify murine stem cells by a combination of markers using Sca1 + cells, Kit + lin- or SLAM markers 7 for the long-term reconstitution of hematopoiesis in mice 81.
The development of in vitro tests made it possible to evaluate the intermediate compartment between the stem cells and the precursor and mature cells that can only be identified by morphological tests.
2.1.1 In vitro detection tests
To identify rare HSCs in the bulk of cells, one of the most frequently used technique is the flow cytometer. There are many surface markers that is currently used in both research and clinical for phenotyping and isolation of HSCs. Along with all the other criteria described above, these markers are also controversial among scientists. The cell surface protein CD34 is, the most important primitive human hematopoietic cell marker 1. It is estimated that only 1-5% of nucleated human bone marrow cells, around 1% of cord blood cells and less than 0.1% of normal peripheral blood cells express CD34 62,63,64. However, CD34 is not exclusively expressed in hematopoietic stem cells, but also in progenitor cells Later the differentiation stage of the progenitor, lower is the expression of CD34. Therefore, despite CD34+ expression measured by flow cytometry is widely uses to isolate hematopoietic stem and immature progenitor cells for clinical engraftment, its expression alone does not guarantee an accurate measure of these populations, demanding a combination of HSC markers 86.
Another widely used strategy for this purpose is the elimination of lineage differentiation markers giving rose to a population designed as Lin-. Lineage antigens are not expressed in HSPCs and combining Lin-/CD34high markers made it possible to
increase HSPCs enrichment up to 200-fold 87. Beyond CD34high/Lin-, it is very common to add CD38 88,89 and CD45RA, which are absent in primitive cells, together with CD90 (Thy-1), which is higher expressed in primitive as compared to differentiated cells 90,90,91. Obviously, more specific the combination of markers, rarer are the cells, consequently, more difficult is to isolate them.
Functional tests have been developed to highlight and to quantify HSCs by long-term culture techniques.92–94. These cultures are based on the concept that the relatively quiescent most primitive cells do not generate clonogenic cells requiring an initial cycling period on a stroma and a suitable culture medium that will allow the differentiation of these cells into progenitors. The long-term culture technique (LTC-IC) remains the only one currently available for the in vitro identification of primitive cells in humans. However, even if this technique makes it possible to quantify and highlight a very immature population, the absence of differentiation markers continues to make HSCs difficult to detect. Another less used technology is the cobblestones generation cell detection technique (CAFC or Cobblestone area Forming cell). In this technique, foci of hematopoiesis are morphologically identifiable in the adherent layer in the form of "cobblestone areas" 95. In limiting dilution, cobblestone areas can be quantified
96 directly
2.1.2 In vivo detection tests
They make it possible to evaluate hematopoietic reconstitution in vivo after hematopoietic cell transplantation in mice in order to demonstrate the presence of stem cells. These are the only tests that formally identify the presence of genuine HSCs. Evaluation of the hematopoietic reconstitution potential of human stem cells has required the development of xenogeneic transplant systems in which immune responses are reduced to extreme. The most commonly used immunodeficient mice are NOD-SCID mice96, which show severe lymphopenia, macrophage deficiency and complement deficiency. These mice have a deficiency of cellular and humoral immune
Page | 21
response. The experimental approach consists in injecting human hematopoietic cells directly into the NOD-SCID mouse, irradiated to destroy the hematopoiesis of the animal. Several months after transplantation, the presence of myeloid and lymphoid B human cells is sought in bone marrow and primary lymphoid organs using FACS
97 analyses.
2.1.3 Progenitors and precursors and mature cells
The commitment of HSCs in a differentiation pathway leads first to the formation of highly clonogenic cells called hematopoietic progenitors. These progenitors are able to
75 ensure hematopoiesis in the short and medium term.
There are several types of progenitors: immature multipotent progenitors (MPPs) with increased proliferative capacity and more mature, lymphoid (LCP) or myeloid (MCP) progenitors with limited proliferation potential. LCP will differentiate B, T and NK progenitors. In the same way, the CMPs will give either erythroid progenitors (BFU-E, then CFU-E), or granulo-macrophagic progenitors (CFU-GM) themselves at the origin of the granular progenitors (CFU-G) and macrophage (CFU-M). These late progenitors
55 are committed to a single cell type.
98 Figure 7.Hematopoiesis and lineage differentiation
Progenitors on a semi-solid medium were described in 1966 99. They are designed under the term of colony forming cells (CFC). Several types of progenitors could currently be characterized: CFU-GEMM capable of generating colonies comprising granulocytic, macrophagic, megakaryocytic and erythroid cells, CFU-GM capable of forming granular and macrophagic colonies and BFU-E capable of forming erythroid
100 colonies of different size depending on their proliferation potential.
Page | 23
Figure 8. Examples of progenitors in a semi-solid medium
The differentiation of the progenitors results in the formation of precursors which are the last stage of maturation of blood cells. Their maturation is done by a morphological evolution (chromatin condensation, nucleoli disappearance and cytoplasm
59 reduction).
2.2 Regulation of the hematopoiesis
2.2.1 The microenvironment
In 1978, Schofield proposed the "niche" hypothesis to describe the physiological microenvironment that allows the survival of hematopoietic stem cells 101. The niche is the microenvironment that protects stem cells from differentiation, apoptosis or other stimuli It is an anatomical structure comprising both cellular and non-cellular components integrating factors controlling the "fate" of stem cells 102. These niche signals regulate the proliferation, survival and differentiation of stem cells, the adhesion of stem cells to stromal cells and/or the extracellular matrix (ECM) anchors stem cells in their niche near signals self-renewal. This specific environment linking stem cells with supporting cells can polarize stem cells into the niche to promote asymmetric cell division. Secreted factors may attract or, on the contrary, repel stem cells for their migration.
The reference model remains to date based on the anatomical location and distinguishes the osteoblastic niche and the vascular niche with the osteoblastic niche specialized in the maintenance and quiescence of long-term HSCs and, on the
contrary, the vascular niche allows the mobilization, the differentiation and proliferation 103 of these
2.2.1.1 Osteoblastic niche The first direct evidence that osteoblast cells are involved in hematopoiesis are studies in which human or murine osteoblast lines have been shown to secrete many cytokines that promote the proliferation of HSCs in culture. The direct role of osteoblasts in the regulation and maintenance of HSCs was shown in 2007 104. In this study, the constitutive expression of PTH (parathormone) and its receptor, an important regulator of calcium homeostasis and bone formation / resorption, was achieved using the Col1a1 promoter (collagen a1 type 1). This activation resulted in a simultaneous increase in the number of osteoblasts and the number of HSCs. In addition, the in vitro maintenance of HSCs was more efficient with the stromal cells of these transgenic mice, presumably due to the increased number of osteoblasts in the stromal cell population compared to wild-type mice 105. The existence of this osteogenic niche has been proven by a transgenic mouse model expressing the Herpes simplex virus thymidine kinase gene under the control of the osteoblast-specific type I collagen promoter, allowing depletion of these cells under the induction of ganciclovir 106. Treatment with ganciclovir resulted in a decrease in spinal cellularity, in the number of HSCs and in progenitors of the different lineages. Discontinuation of the treatment restored the presence of osteoblasts in OM and restored bone marrow hematopoiesis (105)
2.2.1.2 Vascular niche
A close interaction between HSC and endothelial cells is not unexpected because they result from the same common embryonic precursor, the hemangioblast 107. Studies have shown that endothelial cells are able to support HSCs in vitro in the absence of growth factors 108,109. The endothelial cells of the sinuses constitutively express cytokines such as CXCL12 (CXC chemokine ligand 12) or SDF-1 (Stromal Derived Factor-1), adhesion molecules such as E-selectin and VCAM1 (vascular cell adhesion
Page | 25
molecule 1) which are for the mobilization of HSCs and homing 110,111. This "mobilization" towards the vascular niche involves the matrix metalloprotease (MMP) - 9 which induces the release of soluble SCF 112. An essential role of the vascular niche is to assist HSC in migration phenomena during homing or peripheral mobilization. Vascular and / or perivascular cells can also create hematopoietic niches, since many HSCs are found around vessels and factors regulating the maintenance of HSCs 113. The quiescent HSCs are even more numerous in the perivascular zones than in the endosteal zones 114. The Nagasawa group confirmed the importance of vessels in the regulation of hematopoiesis by reporting that primitive HSCs have a very close interaction with reticular cells, strongly expressing SDF-1, found both near endothelial cells and in the body. endosteum 115. It has been proposed that the vascular niche promotes the proliferation and differentiation of hematopoietic cells and progenitors while the osteogenic niche maintains the quiescence of HSCs 116.
2.2.1.3 Molecular mechanisms within the microenvironment
Factors secreted by osteoblasts also play a key role in maintaining HSCs in quiescence. Among these factors are angiopoietin-1 (Ang-1), osteopontin (OPN) and chemokine CXCL12. The binding of Ang-1 to its Tie2 receptor plays an important role in HSCs adhesion and their maintenance in quiescence 116. Ang-1 also increases the expression of N-cadherins on the surface of osteoblasts, and promotes the anchoring of HSCs within the hematopoietic niche 117. The OPN, recognized by the HSC via the CD44 receptor, acts as a negative regulator of their proliferation and ensures their localization, in a quiescent state 118 CXCL12 or SDF-1 (Stromal Derived Factor-1) is produced by the stromal cells of the hematopoietic niche and interacts with the CXCR4 receptor, expressed on the surface of HSCs 103. This chemokine is a chemo-attractant and its secretion regulates the migration and localization of HSCs within the niche 119. CXCL12 is also involved in regulating the
120 number of HSCs present in the bloodstream
2.2.1.4 Growth factors
Growth factors occur at all levels of hematopoiesis regulating the reservoir of HSCs, but also cell expansion and cell differentiation. All these molecules, produced in vivo at low concentrations, interact with each other to modulate their effects. They are secreted either remotely, such as erythropoietin (EPO) or thrombopoietin (TPO) secreted respectively by the liver and kidney, or by the cells constituting the hematopoietic niche, such as G-CSF. The action of these factors necessarily requires their binding to receptors, present on the surface of hematopoietic cells, as well as the activation of signaling pathways. These factors may regulate hematopoiesis positively or negatively 121,122.
123 Figure 9. Growth factors involved in hematopoietic differentiation
Page | 27
2.2.1.4.1 Positive regulators of hematopoiesis
Among these factors, three play an essential role in the self-renewal of HSCs: TPO, SCF (Stem Cell Factor) and Flt3-L (Fms-Like Tyrosine kinase 3-ligand). TPO and its Mpl receptor are involved in maintenance and expansion of adult HSCs. Mpl is expressed on quiescent HSCs and this expression decreases with differentiation 124. The SCF, coupled with its c-kit receptor, is also involved in the survival and / or expansion of HSCs. Finally, the Flt3-L receptor is expressed on primitive hematopoietic progenitors and plays an essential role in their survival, proliferation and differentiation 125. Other cytokines also occur during the early stages of hematopoiesis: IL-3 (Interleukin-3), IL-6 and GM-CSF (Granulocyte and Macrophage-Colony Stimulating Factor) Other cytokines have more restricted action spectra and intervene in late stages of hematopoiesis, or even during the terminal phases of differentiation: EPO, G-CSF (Granulocyte-Colony Stimulating Factor), M-CSF (Macrophage-Colony Stimulating Factor), IL-4, IL-7, IL-5 and IL-2.
2.2.1.4.2 Negative regulators of hematopoiesis
They play a determining role in hematopoietic homeostasis by inhibiting the self- renewal and / or differentiation of HSCs and thereby regulating the number of cells. They include TNF-α (Tumor Necrosis Factor-α), which induces the apoptosis of hematopoietic cells, PF4 (Platelet Factor-4) which inhibits megakaryopoiesis, but whose action also positively regulates viability, survival and adhesion of HSCs and progenitors 126 and Macrophage inhibitory protein-1α (Mip-1α), which restricts the differentiation of primitive hematopoietic cells 127.
2.2.1.5 Other stimulating factors for HSCs and progenitors
Other pathways can be used to simulate the expansion of HSCs and progenitors. Rather than use cytokines, it is also possible to infect HSCs with recombinant retroviruses encoding transcription factors involved in their development, and whose
overexpression is not transformative. This was done in 1995 by G. Sauvageau's team with the gene coding for HOXB4 homeoprotein. The constitutive overexpression of the HoxB4 gene in hematopoietic cells caused a strong and persistent expansion of the stem cell pool in vivo, without inducing their differentiation or malignant transformation, even in the long term 128. In humans, it has also been shown that the infection of HSCs with a retroviral vector containing the coding sequence of the HoxB4 gene made it possible to obtain an expansion of these cells in vitro 129. More recently, Cooke’s team has observed a massive expansion of HSCs and progenitors in all hematopoietic lineages with an AHR antagonist StemRegenin (SR1) 130.
2.2.1.6 Intrinsic regulation
Many transcription factors occur during primitive or definitive hematopoiesis. Some have an important role in the renewal of the hematopoietic stem cell and others allow the differentiation of different lineages.
In a non-exhaustive way, the primitive hematopoiesis at the level of the hemangioblast is regulated by the Stem Cell Leukemia hematopoietic transcription factor (SCL), GATA-2, Lmo-2 and AML-1. The self-renewal of the stem cells is regulated by Ikaros, HOX B4, GATA-2 and Notch1 while the differentiation is done via a variety of factors
131,132 such as the factors PU-1 and GATA1
Page | 29
133 Figure 10. Role of transcription factors in hematopoiesis
2.3 CML Stem Cells vs Hematopoietic Stem Cells
CML is known to affect the most immature hematopoietic cells, called leukemia stem cells (LSCs). During the last 30 years, one of the major challenges in the field of CML has been the possibility to identify LSC from normal HSC using specific markers. Indeed, both share the same surface markers, which makes FACS isolation of LSCs highly difficult and unreliable. In recent years, many studies have shown possible markers that could ultimately be unique to LSC, such as CD33 (Herrmann et al., 2012), CD36 135, CD44, CD47, CD52 136, IL1-RAP 136–139 and, last and most promising so far, CD26 . Dipeptidyl peptidase-4 (DPP4; CD26) could contribute to the release of CML LSCs from bone marrow into the bloodstream 140,141. Studies have also shown that CD26 can be detected in TKI resistant subclones 142. However, at a glance, all these data remain controversial and inconclusive.
Hematopoietic cells maintain their pluripotent characteristics due to a special microenvironment, which is formed by a complex system that involves the presence of different cell types, such as mesenchymal stromal cells, osteoblasts, osteoclasts, endothelial cells, and neural cells combined with signalling pathways and specific metabolic conditions 143–145. It is believed that modifications in this microenvironment may be involved in the development of several hematological pathologies, such as CML. There is much evidence that this same niche that preserves the pluripotency of hematopoietic cells also contributes to the preservation of leukemic stem cells 146.
Many laboratories have been working to unravel the characteristics of the bone marrow niche and understand how they may contribute to the emergence of pathologies. Despite major advances in understanding this issue, there are still many challenges ahead. An important feature of CML is the presence of immature pluripotent leukemic cells in peripheral blood, whereas under normal conditions, HSC remain in the bone marrow 147.
Page | 31
3 Modelling CML
3.1 Murine models
3.1.1 Retroviral transduction/transplantation model
The “gold standard” of murine CML model has been established as early as in 1990 by transplantation of 5-FU-enriched BCR-ABL-transduced bone marrow cells into an irradiated syngeneic recipient. This method leads to the development of CML-like a myeloproliferative disease, which however, is very aggressive as compared to CP CML 30. Subsequent studies have shown successful development of CML like syndrome in 100% of recipients in a very short time (2-4 weeks post transplantation) 148. In addition to the rapid development of disease by recipients, another advantage is that influence of other genes and mutations can also be explored by this model 31. The aggressivity of the leukemia, leading to death of mice in 3-4 weeks, did not allow therefore, the modelling of CP of human CML. This led to the development of inducible leukemia strategies allowing to model more closely the chronic phase.
3.1.2 SCLtTA/BCR-ABL transgenic model
In this model, BCR-ABL expression is modulated by a tetracycline-controlled transactivator (tTA) that specifically regulates BC ABL expression in the murine hematopoietic stem/progenitor cells. This model can develop a CML-like disease clinically similar do human CML (Li et al., 1999). Thus, the progress of the malignancy is done is a slower pace compared to the retroviral models, being more likelihood with human disease 149,150. This is also a better model for studying the endosteal and BM microenvironment, as well as genomic instability 151.
Derivations of this model can be done to better adapt to each experimental profile, such as SCLtTA/BCR-ABL double transgenic model with a transposon-based insertional mutagenesis system, developed by Giotopoulos et al. (REF) In this version, it was possible to mimic the additional chromosomal instability and mutagenesis of blast crisis.
3.1.3 Xenograft models
The xenotransplant model consist in engrafting human leukemic cells into immunocompromised mice and follow up the frequency of LSCs and Ph+ cells 152,153.This methodology which allows quite reproducibly AML in immunodeficient mouse (Bonnet and Dick) has been very difficult to apply to CML as the growth of CML cells and progenitors from CP-CML patients are very difficult to obtain in vivo, requiring the administration of human growth factors to mice . Transplantation of cells from more advanced phases of the disease, such as blast crisis has been found to be more successful.
Methods of generating scaffolds using human mesenchymal cells to mimic the BM 153– niche followed by injection of normal or leukemic cells have also been developed. 155. but not considered to be standard experimental murine models in CML.
Page | 33
Transcriptional control inducedby Bcr
-
Abl andAbl its role in
34
leukemic stem leukemic cell heterogeneity
Figure 11. In vivo models of CML: A) Retroviral transduction/transplantation model B) SCLtTA/BCR-ABL transgenic model and C) Xenograft model 156
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
3.2 Cellular models
3.2.1 Cell Lines
In 1975, the K562 cell line carrying the Ph+ was established by Lozzio's team from a pleural effusion of a patient with blast crisis CML 157. This cell line has been used extensively in the world, but it is not representative of a chronic phase of the disease and obviously cannot be compared to an equivalent without Ph1 chromosome. The extensive experience using this cell line which has been very useful in preclinical studies, showed also the spontaneous establishment of many different cell subclones, with different cytogenetic and molecular characteristics according to different laboratories. Over the years, several BC cells lines have been established from CML patients with different characteristics. The ability to evaluate directly the effects of BCR- ABL in a hematopoietic cell context has been subsequent established using BCR-ABL gene transfer strategies. In both murine and human cell lines, this has been accomplished by retrovirus-mediated BCR-ABL gene transfer. The murine lymphoid BaF/3 cell line the growth of which depends on IL-3, become transformed to IL-3 independence upon BCR-ABL expression. A similar outcome can be generate in humans using the UT7 line 158. Thus, starting from UT7 line, megakaryoblastic and growth factor-dependent leukemic line, UT7-9 and UT7-11 clones were created by BCR-ABL gene transfer. These 2 clones express BCR-ABL RNA and protein and they
158 are GM-CSF independent
3.2.2 Primary leukemic cells
The in vitro models of CML using primary leukemic cells include essentially the techniques of CFC and LTC-IC, which allow the quantification of CML progenitors and stem cells after long-term culture in the presence of permissive stroma such as MS-5 8,159,160
Page | 35
3.2.3 iPSC
IPSCs (induced pluripotent stem cells) result from the reprogramming of adult somatic cells into pluripotent stem cells, in many ways resembling embryonic stem cells. The first reprogrammed cells were derived from murine fibroblasts by the Yamanaka team in Japan 161. Four transcription factors were retained as reprogramming media OCT3 / 4, SOX2, C-MYC and KLF4. In 2007, two other teams reported the derivation of iPSCs from human somatic cells 161,162. They were generated by reprogramming fibroblasts either with retroviral vectors or with lentiviral vectors.
Because of their self-renewal capacity, iPS cell lines can be maintained in an undifferentiated state and, thanks to their pluripotency properties, it is then possible to differentiate them in all possible cell types.
Many iPSC patient-derived lines have been generated to model diseases. The first modelizations were carried out by the team of Park 163. These lines make it possible to dispose of cellular material carrying abnormalities responsible for a pathology, to study them and to create an opportunity for the development of therapeutic strategies. The first CML iPSC lines were generated in 2011 164 and in subsequent years, the use of
165 the iPSC-modelling of CML has been established in the field of CML.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
4. Diagnosis.
The diagnosis is made most frequently in the chronic phase. The main symptoms and the usual signs of the disease are fatigue, anemia and splenomegaly. However, a significant proportion of patients are asymptomatic, the diagnosis being made fortuitously during a routine check-up. There are 600-800 new cases in France per year (Incidence 1/100000). The sex ratio is towards men (H / F = 1.2) and the average age
166 is 53 years.
The BCR-ABL1 fusion gene is present in leukemic cells of all cases of CML but the karyotype and research of the Philadelphia chromosome is still needed during the initial assessment because no test can currently replace the prognostic value of cytogenetic remission complete at 6 months and the karyotype can detect clonal abnormalities
167 associated undetectable by molecular biology.
4.1 Evolution of the disease and prognosis
The natural history of CML, which has been modified by the current TKI therapies, included typically 3 phases:
The chronic phase, lasting from 3 to 5 years, often identified following a systematic assessment showing hyperleukocytosis with significant myelemia. The cytological marrow examination through a bone marrow aspirate is mandatory, showing hyperplastic marrow involving myeloid cells. The diagnosis is confirmed by the karyotype that finds the Philadelphia chromosome and the BCR-ABL transcript.
According to the WHO 2016 classification the accelerated phase is characterized by: one or more of the following criteria:
• Persistence or increase of splenomegaly, not responding to treatment
• Persistent or increased number of leukocytes above 10 G / L, not responding to treatment
• Persistence or increase in thrombocytosis (> 1000 G / L), not responding to treatment
Page | 37
• Persistence of thrombocytopenia <100 G / L, unrelated to treatment
• Presence of at least 20% of basophils in the blood
• Presence of 10-19% in the blood and / or bone marrow
• Presence of clonal cytogenetic abnormalities additional to Ph, including major abnormalities (doubling of Ph, trisomy 8, isochromosome 17q, trisomy 19), or a complex karyotype, or abnormalities in 3q26.
• Any new clonal abnormality in Ph + cells occurring during treatment
The blast phase or blast crisis marked by the presence of more than 20% medullary blasts. In most cases, the blasts are myeloid type and in 30% of cases the crisis is lymphoid type. This phase may be critical due the lack of a truly effective therapy.
This evolution has now been dramatically changed due the use of tyrosine kinase inhibitors since 2001. 167–169170,171.
172 Figure 12. Phases of CML
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
5. CML Therapy
5.1 Treatment History
Initial therapy of CML included, arsenical preparations from 1865 until the beginning of 20th century where splenic radiation has been introduced to therapy (1902). The efficiencies of these therapies were transient and despite many efforts suing antileukasera (1932), benzene (1935), urethane (1950), leukapheresis (1960) and high dose combined chemotherapy ( COAP protocols) the prognosis remained the same with a median survival of 3-5 years, all patients succumbing to an acute leukemia 9. In 1953, David Galton introduced the alkylating agent, Busulfan, into clinics, with evidence of successful cytoreduction but no effect on survival 173. It was only in the 80’s, the introduction of Interferon-α changed the therapeutic strategy as the first remissions with evidence of ph1-negative recovery were obtained with IFN albeit with modest increase in survival 174. The addition of cytarabine IFN-2b was the first therapy with a clear evidence of cytogenetic remissions and survival advantage and this combination remained the standard therapy in patients not eligible for BMT until the introduction of TKI therapies and 175.
5.1.1 The introduce of TKIs, a turning point in CML history
The treatment of CML has undergone an important evolution, particularly in the 2000s with the arrival of targeted therapies: the tyrosine kinase inhibitors (TKIs). CML is the first cancer pathology caused by an acquired genetic abnormality that has benefited from targeted drugs.
After preclinical results showing the efficiency of tyrosine kinase inhibitors called “tyrphostin” in 1999176 CML treatment had its historical turnaround. A tyrosine kinase inhibitor, initially developed to inhibit PDFG-receptor in solid tumors, has shown major efficiency in BCR-ABL-expressing cells. This drug, initially called STI-571 and later Imatinib, developed by Ciba-Geigy was developed into the clinical application by Novartis, has shown to be able to induce major cytogenetic responses. Not only did Imatinib significantly improved the lives of patients with CML, as it was also a pioneer
Page | 39
in target-specific treatment 177,178. Since then, second and third generation of TKIs have been introducing into clinics.
5.1.2. Hematopoietic Stem Cell Transplantation (HSCT)
The first attempt to a human bone marrow transplant was in 1939 to a patient with aplastic anemia 179. Just after the World War II, researchers managed to recovery normal hematopoiesis by marrow transplantation in a mouse model with marrow aplasia caused by radiation 180. In 1956, Barnes et al demonstrated an overcome of acute leukemia in mouse models by bone marrow transplantation 181. In 1958, the first BMT between unrelated donor was performed by Georges Mathé’s team in Paul Brousse hospital in Paris, for Yugoslavian researchers who were accidentally
182 irradiated.
Allogeneic transplants for leukemia between related donors and recipients was first performed in Seattle at Fred Hutchsion Center by E. Donnall Thomas’ team 183. Six patients were pre-treated with radio and chemotherapy and then received an infusion of marrow from a normal donor. At the time, histocompatibility was not considered, and all patient died by 3 months post transplantation. Methods to identify human leukocyte antigens (HLA) in human were developed in the 60’s, allowing physicians to check compatibility between donor and patient. In 1979, despite a previous almost failed experiment reported with 100 transplantations, which only 13 were successful, Donnall Thomas was encouraged to continue and successfully engrafted 50% of 126 leukemic patients, being honoured with a Nobel Prize in 1990 for his discoveries 61,184,185. In 1988, the Bone Marrow Worldwide (BMDW) was funded, currently counting with more than 23 million registered donors in more than 70 countries 186,187.
BMT allows reconstitution of normal hematopoiesis through conditioning and in the allogeneic setting allows the elimination of leukemic cells via a graft versus leukemia (GVL) effect. The use of bone marrow transplants made it possible to understand very early that CML also represented a model of immunotherapy 188. Indeed, in all clinical trials aimed at reducing the GVH-type response by allogeneic graft T-cell depletion,
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
there has been a consistent increase in relapse rates189. These observations have formed the basis of immunologic cellular therapies performed by donor lymphocyte (DLI) transfusion in patients who have relapsed after allogeneic transplant 190,191. Currently the allogeneic transplant is no longer proposed in the first line, but only in case of resistance to TKI. Until a few years ago, HSC allografting could be considered currently the only proven curative therapy for CML. However, recent TKI-discontinuation trials have shown that in some selected patients, long-term remissions without recurrence of CML can be observed. However, it is currently not known if these patients are cured, as late CML relapses have been reported as long as 20-25 years after allogeneic bone marrow transplantation. 192,193.
5.2 Conventional therapies
5.2.1 Chemotherapy In the 1950s, chemotherapy was used to target rapidly dividing cells allowing the normalization of white blood cells in the blood. Chemotherapy does not only target cancer cells but also healthy cells and other dividing tissues with many side effects. The two most commonly used chemotherapeutic agents were busulfan and hydroxyurea. However, neither of these allowed to control the disease and the median survival of the patients did not exceed 5 years 194. These treatments often made it possible to obtain hematologic remission but never cytogenetic with persistence of the Ph chromosome in 100% of the medullary mitoses. Although, hydroxyurea, a cytoreductive agent, is still used to reduce tumor mass while waiting for cytogenetic or genetic confirmation at the time of diagnosis of CML.
5.2.2 Interferon alpha (IFNα) IFN α has been used since the 1980s in the treatment of CML. It is a cytokine with antiproliferative properties. It was the first-line treatment until the arrival of TKIs and this despite a very variable tolerance according to the patients. IFN α has an inhibitory action on the growth of leukemic progenitors. Its action seems to target progenitors already engaged in a certain differentiation but without sparing
Page | 41
the normal cells, explaining its hematological toxicity. Nevertheless, studies carried out in the 1980s have shown that IFNα induces, alone or in combination with chemotherapy (such as cytarabine), hematological remission in 60 to 80% of cases, complete cytogenetic remission in 15 to 35% of cases. patients and a good cytogenetic response (Ph + <35%) in 10 to 20% of additional patients 195,196 Modifications on INF- α formula improved significantly its side effects – flu-like symptoms and severe fatigue 197,198 – and INF-α and its combinations are still used today, in special cases
5.3 Targeted therapies - TKIs 5.3.1 1st generation TKI 5.3.1.1 Imatinib Imatinib, or Glivec®, the first tyrosine kinase inhibitor (TKI) introduced therapeutically since 2001, drastically altered the natural course of the disease by revolutionizing management and prolonging survival. Indeed, in the era of targeted therapies by TKIs, responder patients (but only these) have a life expectancy identical to that of patients
199 of the same age in the general population Imatinib is a 2-phenylamine-pyrimidine derivative that inhibits the kinase activity of Bcr- Abl by competing for the ATP catalytic domain binding site of the chimeric protein 200. In 1996, Druker reported the first in vitro effects of 2-phenylaminopyrimidine Abl1 tyrosine kinase inhibitor, then known as a 571 signal transduction inhibitor (STI) on cell lines derived from CML 177.
The interaction between imatinib and Bcr-Abl is possible in the inactive and dephosphorylated conformation of the oncogene 201. This makes it possible to stabilize the oncogene in its inactive form and thus to block the autophosphorylation of the enzyme and then the transmission of the signal 202. Thus Imatinib is able to reduce the formation of CML CFC by 90% with no inhibitory effect on normal cells 200,202.
Two years after the Phase I study, an international randomized study of interferon / cytarabine against STI (IRIS study) was conducted in 1100 newly diagnosed patients. The results of this study changed the management of patients in view of more than satisfactory results. The superiority of Imatinib was demonstrated in terms of
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
hematological, cytogenetic and molecular responses (97% versus 56% for the RHC, 74% versus 8% for the RCC and 85% versus 22% for the RMC) 203 . An 8 years follow- up study report (IRIS) has shown that patients treated with Imatinib presented an overall survival rate of 85% and only an average of 0.9% (annual rate) progressed from AP to BC. Despite its satisfactory action, imatinib is less potent than the 2nd generation TKI, which may not inhibit the kinase efficiently, allowing the development of secondary resistance and loss of response 107,108.
Figure 13. Mechanism of action of Imatinib.
5.3.2 2nd Generation TKIs
The identification of resistance to Imatinib led to focus research and development efforts on new TKIs effective against several types of acquired mutations.
5.3.2 1 Dasatinib
Similar to imatinib, dasatinib is also an ATP analogue derived from pyrido (2,3-d) pyrimidine. It is a broad-spectrum inhibitor since it targets in addition to Bcr-Abl (in its
Page | 43
active and inactive conformation). ), several proteins of the Src kinase family (such as Src, Lck, Yes, Fyn). 205,206 Dasatinib is active against the majority of kinase domain mutations, except of T315I 207. It has proven 300-fold more potent than imatinib in vitro208.
The phase 1 study of Dasatinib (140 mg / day) was conducted in 84 patients who did not respond to Imatinib. In 35% of patients with chronic or accelerated phase, it has been possible to obtain complete cytogenetic remission and in patients with blast phase a temporary improvement in hematological and cytogenetic responses 209. Phase 2 included 387 chronic phase patients and showed complete 40 and 75% cytogenetic remission rates after 15 months of treatment in cases of imatinib resistance and intolerance, respectively (134). The overall survival of Imatinib- resistant and intolerant patients was 78% and 82% respectively, however only 30- 35% of patients remained for 5 years under Dasatinib 210.
Clinical trials comparing dasatinib versus imatinib have shown that CCgR rates were similar to imatinib (86% and 82%, respectively), while MMR and MR4.5 rates were better with dasatinib than imatinib (64% versus 46% and 17% versus 8%, respectively)
211–213.
5.3.2.2 Nilotinib
Nilotinib is also an aminopyrimidine and it was developed from Imatinib by crystallographic analysis. Like imatinib, it is a competitive inhibitor of ATP, with a higher affinity than imatinib for Bcr-Abl 214. It is able to bind to the inactive conformation of the oncogene. In vitro and in vivo, this TKI prolongs the survival of mice injected with imatinib-resistant Bcr-Abl cells
The phase 1 study was conducted in patients resistant to Imatinib. Complete cytogenetic remission was observed in 35% of these patients 215. The phase 2 study included 321 chronic phase resistant or intolerant patients with Imatinib or both and the results. Complete cytogenetic remission rates were 45% and 78% overall survival at 4 years. As with Dasatinib, only 31% of patients remained on Nilotinib 216.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Nilotinib was approved in 2007 by the U.S FDA as an analogue of imatinib with much higher affinity for the ATP binding site. A clinical trial (ClinicalTrials.gov number, NCT00471497.) comparing imatinib and nilotinib shows that patients treated with nilotinib presented higher CCgR rates by 12 months (80% against 65% with imatinib) and also better MMR rates (44% compared to 22% with imatinib) 204,211,217. However, nilotinib treatment is related to occurrence of vascular events, such as peripheral arterial occlusive disease (PAOD), coronary artery disease (CAD), cerebrovascular disease (CVA), and the risk to develop diabetes. It is also not indicated in case of F359V, E255K/V and Y253H mutations 218,219.
5.3.2.3 Bosutinib
Bosutinib is an oral tyrosine kinase inhibitor that targets Src/Abl activity. In Phases I and II studies including patients who previously had 2 or 3 other TKIs, 24% of patients achieved complete cytogenetic remission. After 2 years of treatment, the progression-free rate was 73% and 83% overall survival. With a median follow-up of 28 months, only 29% of patients remained on Bosutinib 220. Bosutinib was subsequently tested in 286 patients resistant or intolerant to Imatinib, 47% of whom had complete cytogenetic remission. The phase III Bosutinib Efficacy and Safety in Newly Diagnosed CML (BELA) trial compared bosutinib to imatinib in CP-CML. Patients treated with bosutinib reached CCgR and MMR faster than with imatinib, but 12 months CCgR average rates were not different between the two drugs (70%
221,222 versus 68%), while MMR rates were higher with bosutinib (41% versus 27%).
5.3.3 3rd generation TKI (mutation T315I)
5.3.3.1 Ponatinib
Ponatinib is the first and, currently, the unique of 3rd generation TKI class. It is highly potent due its action against a vast spectrum of kinase domains and the only drug able to overcome the T35I mutation problem. Its clinical use was approved by the U.S FDA in 2012 for patients with resistant CML or intolerant of prior TKI therapy. In 2013, due
Page | 45
its serious adverse vascular events, the U.S FDA withdraw ponatinib from the market. In 2014, after additional follow-up studies have showed satisfactory safety results, 223–226 ponatinib marketing has been resumed, with initial lower doses.
5.4 Mechanisms of resistance As early as 2003, it has been shown that resistance to TKI could occur during therapy (or in vitro models, using cell lines or patient cells (Review CML) These studies revealed different mechanisms of resistance including: 1- BCR-ABL independent mechanisms: efflux mechanisms and membrane transporters, the different mechanisms of persistence of leukemic cells (quiescent cells, gene instability and signaling pathways) (described in the next chapter 2- BCR-ABL-dependent mechanisms: BCR-ABL amplification and oncogene mutations
5.4.1 Efflux mechanisms and carrier hOCT1 Efflux transporters are frequently active transporters, belonging to the superfamily of ATP-binding cassette proteins (ABC). This family includes the P-glycoprotein (P-gp or ABCB1), responsible for the expulsion of Imatinib from the cell is encoded by the gene MDR-1 (Multi Drug Resistance 1). The Pgp pump allows the exit of endogenous or exogenous hydrophobic substrates such as therapeutic agents. This transporter is overexpressed in the cells of patients in the transformation phase and involved in resistance to blast phase chemotherapy 227, as well as resistance to Imatinib 228.
The hOCT transporter (human Organic Cation Transporter 1) has been shown to be a significant factor affecting the intracellular bioavailability of the active ingredient 229,230.Overexpression of OCT1 in patients promotes the efficacy of imatinib 231. Indeed, a high rate of OCT1 seems to be predictive of a good response to Imatinib while patients with a low level of OCT1 require higher doses of Imatinib for an optimal response. Neither dasatinib 232 nor nilotinib 233 is affected by OCT1 activity.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
5.4.2 SRC overexpression
The Src kinase family plays a central role in hematopoietic cell membrane receptor signaling and nine of their members are present on myeloid cells (including SRC, LYN and HCK) 234 and can be activated by BCR-ABL1 52. Imatinib resistance and progression of the disease, particularly the lymphoid blast phase, may be mediated by increased expression of LYN and HCK 235,236. The family of Src kinases is also involved in Imatinib resistance because they maintain BCR-ABL1 in its active conformation to which Imatinib cannot bind 237. Similarly, in patients who have failed treatment with Nilotinib, increased expression of LYN has been found 238.
5.4.3 Increased expression of BCR-ABL1 as a mechanism of resistance
Amplification of BCR-ABL1 occurs more generally in advanced stages of the disease 239. This event, which has long been known from the cytogenetic point of view by the duplication of the Ph1 chromosome, was first reported in 3 out of 11 patients in the blast phase of CML who developed acquired resistance to Imatinib 240. It is not established, however, whether this resistance to Imatinib is a direct result of the increased expression of BCR-ABL1 protein 199, or the consequence of other factors involved in the transformation, such as mutations in the Abl kinase domain, or the consequence of increased genomic instability. In a subsequent study of 66 Imatinib- resistant patients, BCR-ABL amplification was only found in 2 patients 241 and overexpression of BCR-ABL1 is thought to be responsible for resistance to Imatinib in a minority of cases. It seems that cells expressing strongly BCR-ABL1 are more rapidly less sensitive to Imatinib because of the earlier appearance of resistant Imatinib mutant subclones 242. In the same way, resistance to Nilotinib in vitro has also been found in
238 connection with overexpression of BCR-ABL1
Page | 47
5.4.4 Mutations of the ABL kinase domain
The appearance of mutations in the kinase domain of BCR-ABL can be associated with resistance to TKI, especially during advanced stages of the disease. The mechanism most frequently described in terms of acquired resistance to Imatinib is the presence of mutations resulting in amino acid substitution in the kinase domain preventing the attachment of the drug and this by affecting residues essential for the attachment of TKI or by preventing BCR-ABL from becoming inactive conformation avoiding fixation of Imatinib. The incidence of mutations is of the order of 40 to 90% depending on the method of detection, the nature of the resistance and the phase of the disease 243.
In 2001, the first mutation described involving BCR-ABL signal transduction was the T315I 240 mutation. Threonine 315 forms a hydrogen bond with Imatinib, this fundamental amino acid is replaced by a larger isoleucine preventing Imatinib fixation in the BCR-ABL ATP pocket. The T315I mutation is found in 4 to 19% of Imatinib- resistant patients 244,245 resulting in resistance to all 2nd generation TKIs. Although the T315I mutation confers resistance to all TKIs and median survival is low (approximately 1 year 246,247, long-lasting cytogenetic responses have been obtained with 2nd generation TKI (162). However, ponatinib is the only effective drug on these mutations, particularly in terms of deep 4.5 grade molecular responses.
Four categories of mutations were recognized in relation to the clinical resistance to Imatinib affecting: the imatinib binding site, the ATP binding site (P loop), the catalytic domain and the activation domain.
P-loop mutations account for approximately 50% of mutations in Imatinib-resistant patients 248. These mutations destabilize the conformation required for Imatinib uptake and appear to be associated with greater blast transformation 249 and a poorer prognosis regardless of their sensitivity to Imatinib 244,248,250P-loop mutations have been reported to be associated with poorer prognosis compared to other categories of mutations (165) (167). However, other studies have not confirmed this prognosis (169), this may be due to the criteria for finding mutations or to the cause of the M224V
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
mutation (with an unfavorable prognosis) that has been variably included in the P loop 251 categories.
However, only 7 amino acid substitutions (M244V, G250E, Y253F / H, E255K / V (P- loop), T315I (Imatinib binding site), M315T and F359V (the catalytic domain)) account
247 for 85% of all mutations associated with therapeutic resistance
Although 2nd generation TKIs (Dasatinib and Nilotinib) offer an alternative for most mutations except T315I, the development of new mutations to the second TKIs is possible.
Sequential selective pressure of TKI therapy has been evaluated in resistant imatinib patients who already have kinase domain mutations. They were subsequently treated by a second TKI or even a third. It has been shown that 83% of patients have relapsed after the onset of an initial response, due to the appearance of new acquired mutations 252. The T315I mutation was most commonly involved with a frequency of 36% 253.
In sum, the identification of a mutation is relevant depending on the stage of the disease and the response to therapy, with greater impact when the disease is advanced. The resistance mechanisms can be overcome with an increase in the dose 253, the transition to 2nd generation TKI 221 at which the mutant is sensitive but also through non-BCR- ABL dependent therapies.
5.5 Resistance and mechanisms involved in the persistence of leukemic stem cells
In 2002, using quiescent HSC identification techniques, the Holyoake team 254 showed that STI (Imatinib mesylate or IM) did not induce apoptosis of quiescent primitive Ph + cells which remained active as this has been shown by phosphorylation of CRK-L ( 242) Inhibition of tyrosine kinase activity only reduces the proliferation of LSCs. Similarly, second generation TKIs do not provide better results on this cell fraction 255,256. Indeed, therapeutic TKIs, however targeted, fail in the elimination of all the LSCs. The microenvironment of the bone marrow thus offers them the niche necessary
Page | 49
to resist the TKIs and to allow the leukemic relapse at the time of the stop of the treatment 257. It has been demonstrated that the level of expression of BCR-ABL was low in the LSC, which may be a cause of some resistance to TKIs 159,258. While LSCs retain some kinase activity they can survive TKIs probably by mechanisms independent of BCR-ABL kinase activity. Several pathways have already been studied because they play a major role in the biology of the stem cell and by targeting them, they can be therapeutic targets for removing LSCs.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Figure 14. Resistance of LSCs259 to TKI
5.5.1 Activation of leukemia stem cell signaling pathways
Several signaling pathways are involved in maintaining self-renewal and differentiation potentials of leukemic stem cells. These pathways may be common to both normal and leukemic cells but in the LSC some are specifically activated that may be the target of therapeutics.
Page | 51
The Wnt / β catenin, Sonic Hedgehog and Notch pathways play important roles in maintaining stem cell function and have therefore been extensively studied as alternative pathways of LSC persistence in CML.
Βcatenin is a protein of the Wnt pathway that is important for the survival and self- renewal of HSCs 260. When Wnt is bound to its receptor, βcatenin is protected from ubiquination and thus from degradation. It can therefore translocate into the nucleus and activate its target genes 261 .Although not essential for the maintenance of HSCs 262 it has been shown that the therapeutic targeting of this signaling pathway in association with TKIs could delay the onset of disease and eliminate more primitive cells in mouse models of CML . During the blast crisis, it is suggested that hematopoietic progenitors could reacquire stem cell properties via activation of β- catenin 239 Hes1 (Notch target gene) has been shown to maintain LSC self-renewal 263 and promote the blast crisis transformation
The hedgehog pathway is an activated signaling pathway during embryogenesis. At adulthood this pathway is conserved physiologically in stem cells and pathologically in tumor cells. This is a dual receiver system, the PTCHD now Smo (Smoothened) in an inhibited state. In the presence of the Hedgehog ligand, the inhibition is raised and the Smo receptor activates the transcription factor Gli with the action of the target genes 264. It has been shown that this pathway was constitutively activated in the leukemic cells of patients with CML and in mouse models of CML. The Smo pathway is more active in leukemic cells compared to normal HSCs, and inhibition of Smo impairs the development and maintenance of leukemic stem cells in murine models of CML 265.
In addition, the hematopoietic niche could regulate Smo and Wnt signaling pathways
104,261
The PML tumor suppressor involved in promyelocytic leukemia via the PML-RARα rearrangement. PML is dysregulated in CML and is highly expressed in the bone marrow of chronic phase patients. It has also been shown to be necessary to maintain LSC 266. Indeed, in the murine model of transduction of the BCR-ABL gene in the invaded mouse for the PML - / - gene, the induction of leukemia is much less efficient compared to the PML + / + mice. These experiments made it possible to consider the
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
use of arsenic derivatives (Arsenic trioxide) to eradicate quiescent stem cells from CML.
FoxO transcription factors in particular FoxO3 are related to stem cell biology. FoxO3 is one of the targets of PI3K / AKT. In mature cells, Akt mediated signaling is more important and allows proliferation of leukemic cells giving them a proliferative benefit. However, in the LSC, the Akt signal is inhibited by PTEN 267 and TGFβ 268. This effect of BCR-ABL1 induces the inactivation of FoxO3, which allows transcription of BCL6 which favors quiescence and self-renewal 269.
A new role for lipid metabolism in the maintenance of CML stem cells has recently emerged. Arachidonate 5-lipoxygenase (Alox5) is part of the 5-LO pathway that synthesizes Leukotriene B4 (LTB4) 269. Alox5 has been shown to be essential for the survival, proliferation and differentiation of LSC. Alox5 expression is increased in BCR- ABL gene transduction models in a manner dependent on Bcr-Abl TK activity. Similar to PML, K / O mice for the Alox5a gene are resistant to leukemia development after BCR-ABL 270 transduced stem cell transplantation. Alox5 has been shown to depend on Msr1 itself regulated by BCR-ABL. Msr1 is an important regulator of PI3K / AKT and β-catenin pathways and thus affecting the functions of LSC 270. Its inhibition only affects LSCs and not normal HSCs 270.
The AHI 1 (Abelson helper integration site 1) oncogene could also be used as a new target because it appears to be overexpressed in the LSCs and appears to have an effect on cell proliferation 271. AHI 1 interacts with BCR-ABL, but also with the JAK2 / STAT5 pathway.
Page | 53
272 Figure 15. LSCs resistance pathways
5.5.2 Clonal evolution and gene instability
Chromosomal abnormalities added to the Philadelphia chromosome (Ph +) cell population define clonal evolution. This marks the transition to a more advanced stage of the disease. The most commonly found chromosomal aberrations are a supernumerary Ph chromosome, trisomy 8 and an isochromosome 17q (195).
Clonal evolution is associated with an escape from TKI treatment with hematologic relapse, a lack of cytogenetic response (196) and a reduction in overall survival197. This evolution reflects the genetic instability of the primitive Ph + highly proliferative
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
population 198. Clonal evolution could be involved in the phenomena of resistance to TKI more important than mutations (58% of patients for 45%) 199. The incidence of clonal evolution is even more pronounced in blast phases (73%) compared to the
273 frequency of kinase domain mutations (30%).
5.5.3 Quiescence phenomenon
Despite the good results obtained with Imatinib, tumor cells persist. Indeed, several clinical trials of Imatinib discontinuation in patients with undetectable residual disease over time have been performed 274–278. In general, these tests show that the disease remains undetectable 40-50% of patients while a molecular relapse occurs very early, in the first 6 months for the majority, in 50 to 60% of patients. The French STIM (Stop IMatinib) study of 2010 was the first to show these results in patients who had an undetectable residual disease of grade MR 4.5 for more than 2 years 279. These clinical trials show the persistence in vivo of LSC leading to a new progressive phase of the disease that can be avoided by resuming treatment with IM.
Therapeutic failures result from the insensitivity of quiescent cells to Imatinib. The CD34 + CD38- leukemic cells, which are in phase G0 of the cell cycle and are by definition quiescent, represent less than 1% of the CD34 + cells 255, it is however this tumor cell fraction which persists and which is the support of residual disease.
Page | 55
272 Figure 16. LSCs resistance in the bone marrow niche
The phenomenon of quiescence is thus at the same time a cell cycle arrest (G0 phase) and a basal metabolic state. In CML, most LSCs appear to be in the cell cycle while HSCs remain quiescent 280. However, the cellular interactions and / or the secretion of soluble factors can modify this state of rest.
BCR-ABL1 specifically inhibits the expression of CXCR4 in CML cells, this expression is restored by Imatinib. The cytokine environment of the bone marrow triggers the expression of CXCR4 by leukemic cells allowing their extravasion and migration through the vascular wall. Interactions with the stroma trigger activation of integrins and cell survival pathways. LSCs interacting with stromal cells return to quiescence
281 and become resistant to TKI
However, quiescent stem cell resistance appears to be multifactorial and includes drug efflux mechanisms 282 and transcription of the larger BCR-ABL gene 255.
Dasatinib, although capable of inducing significant inhibition of Crk1 phophorylation in CD34 + 38- cells, also remains ineffective on the quiescent cell population 77,283. In the same way this cell fraction is also resistant to Nilotinib 256.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Difficulties persist with the concept of quiescent stem cells. Residual disease is usually detected in most patients, but it is not correlated with the number of quiescent leukemic stem cells because of the detection limit of the method.
Nevertheless, therapeutics for targeting this potential disease reservoir continue to be developed and include a cell cycle-inducing growth factor 284 and immunological approaches 285.
AHR activation by TCDD has been shown to result in depletion of the HSC pool via quiescent cell cycle entry 286,287. Later, murine KO models confirmed that AHR had a predominant role in the maintenance of HSC quiescence288,289. The pharmacological inhibition of AHR by a chemical antagonist in 2014 by the Boitano team showed the possibility of using this pathway to induce massive expansion of HSCs, possibly for the purpose of transplantation. These various studies indicate that AHR plays a role in the proliferative and / or quiescent activity of HSCs 130.
Page | 57
Imatinib Dasatinib Nilotinib Bosunitib Ponatinib
Year of 2001/2001 2006/2006 2007/2007 2012/2013 2012/2013 FDA/EMA approval
Kinase BCR-ABL, BCR-ABL, BCR-ABL, c- BCR-ABL, Native/mutant Inhibited PDGF, SCF, SRC, family kit, PDGFR, SRC, family BCR-ABL, c-kit kinases, c-kit, CSF-IR, DDRI kinases, including T315I, EPHA2, Minimal VEGFR, EPH PDGFRβ activity receptors, SRC, against c kit or family kinases, PDGFR KIT, RET, TIE2, FL3
Indication 1st line 1st or 2nd line 1st or 2nd line Resistance or T315I-positive or and usage in intolerance to when no other CML prior therapy TKI is indicated
290 Table 1. TKI comparation in CML treatment
6. Allogeneic HSCT in a post-TKI era
Despite being the only proven curative treatment for CML, after the introduction of TKI treatments, allogeneic transplantation is only recommended for patients who do not respond well or develop treatment resistance. An allogeneic transplant requires a highly skilled team, an especial structure and a previous preparation of the patient and the cells that will be transplanted, which makes the process very expensive. In addition, many patients develop post-transplantation complications 291.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Table 3. Relation between TKI sensitiveness vs CML mutations 292.
Page | 59
7. Tumor Heterogeneity: Overview
In the 21st century, one of the major challenges in oncology is the unravelling of cancer heterogeneity in order to uncover mechanism of progression of cancer cells under the influence of microenvironment, genetic instability inherent to tumor cells and the effects of different therapies. Many patients, who previously responded well to treatment, may develop resistance over time. Patients with the same type of cancer and very close clinical conditions may not have the same sensitivity to therapy. Intra-tumoral heterogeneity is one of the reasons for such events. Tremendous technical challenges are currently being addressed by the development of single cell analyses allowing to establish the clonal architecture of cancer cells as well as their heterogeneity at the level of epigenetics, splicing events, transcriptome and event at the level of protein translation.
Two models, not mutually exclusive, are proposed to explain the origin of this heterogeneity: 1) The cancer stem cells and 2) The clonal evolution 293,294 .
The concept of cancer stem cells (CSC) is ancient, but still unclear. It’s believed that CSC have the same abilities as a normal stem cell, such as self-renewal, quiescent capacity, pluripotency, and capable of regenerate a tumor in health mice when transplanted. In leukemias this concept is clearer, once it concerns directly the hematopoietic stem cells. In solid tumors, despite many evidences, it remains questionable. In both cases, lack of specific biomarkers is one of the greatest barriers for distinguishing CSC from normal stem cells. The heterogeneity in this model is a result of the pluripotency ability of this subpopulation to generate whatever type of cell, providing a cellular diversity 63,295.
Peter Nowell pioneered the first clonal evolution model, in 1976, based on a tumor growth from a single mutated cell, continuously acquiring mutations along it progress. Consequently, it give rise to subpopulations that could have their own characteristics and regulations296. Some of these subclones may behave differently from the bulk population, being less sensitive or even resistant to drug therapy and dominating the tumor environment over time 297,298.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Figure From Ben David et al Nat Rev cancer 2019
Biology of cancer heterogeneity.
Page | 61
Figure 19. Linear clonal expansion vs Branched clonal expansion schemes
7.1 Implications of Heterogeneity
Tumor heterogeneity play an important role from research to clinical application.
Mimicking such diversity in animal experiments is still a challenge. The Patient Derived Xenograft (PDX) model consists of grafting human tumor cells or tissues into immunodeficient mice and is considered the best current model for studies that are directly or indirectly linked to heterogeneity. However, it is not enough to mimic tumor complexity 299.
The use of biomarkers is also impaired as there may be variance between subclones during disease evolution and certain biomarkers may be lost or modified. New single cell technologies have been very useful in finding more specific subpopulation markers
300,301.
Heterogeneity also impairs the therapeutic response. It is believed in the presence of subclones less sensitive to drug treatment than others. In addition, clonal evolution may further cause certain subpopulations to lose their previously present sensitivity. These more resistant clones may eventually dominate the tumor, causing more aggressive disease progression 302,303.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
7.2 Heterogeneity of leukemic cells in CML
The clinical heterogeneity of CML is a fact known to doctors and scientists There is a wide variance among patients in terms of disease course, response to treatment and eventual relapses. In 2003, Gordon et al raised this issue and conducted a comparative study of clonogenicity of healthy patient and donor cells and concluded that the difference in response is due to normal biological differences between people304. However, later, several other studies would show that this variance would go beyond biological differences and perhaps be associated with a molecular difference305.
Since then, many studies involving transcriptomic differences have been published, some extremely relevant, such as Condello et a l306. They discovered over 3,000 genes whose expressions vary as the disease progresses. Wnt pathway, DNA damage, apoptosis, ribosomal functions and glucose metabolism-related genes change their expression depending on the stage of the disease 307. Another study has analyzed CD34+ cells collected at diagnosis from two patients with distinct prognostics, which one progressed early to a blast crisis while the other succeeded to keep chronic phase 134 for more than 7 years.
Recently, with the evolution of single cell technology, some studies on CML have been published, two of which deserve special mention. Giustachinni et al managed to combine high-sensitivity mutation detection with whole-transcriptome analysis single cell techniques in a study that aimed to unravel potential genes that may be involved to blast crisis progression and poor response to TKI 308. Another study, by Warfvinge et al. combined high-throughput immunophenotypic screens with large-scale single- cell gene expression analysis to check the heterogeneity within the LSC population in CP-CML patients at diagnosis and following TKI treatment 142. In our study, we combined single cell analysis with pseudotime and trajectory estimation methods in order to understand the clonal evolution of CML progenitor cells.
Page | 63
8. Transcriptional heterogeneity
During the last 10 years, the major progress obtained in gene expression analyses, allowed an unprecedented evaluation of inter-and intra-tumoral heterogeneity of cancer and leukemia 309 . This heterogeneity which was obvious in terms of phenotype, drug response, genomic abnormalities has also been found at the level of transcription which can now be analyzed at the level of single cells 310. The advances obtained in this filed, can now be used to generate clonal architecture of leukemias and may serve the basis for future personalized therapies as the transcriptional dysregulation could be at the origin of drug resistance 311 .
During the last 10 years, the major progress obtained in gene expression analyses, allowed an unprecedented evaluation of inter- and intra-tumoral heterogeneity of 309 cancer and leukemia.
This heterogeneity, which was obvious in terms of phenotype, drug response, genomic abnormalities has also been found at the level of transcription. Transcriptional regulation have been exhaustively studied at le the level of initiation, but recent studies
312 have been showing the importance of the elongation step as well.
8.1 Transcriptional heterogeneity in leukemia
Epigenetic deregulation acts in conjunction with genetic anomalies, facilitating not only the generation of tumors, but also their maintenance and progress. Studies show that epigenetic processes in stem cells, such as the most primitive hematopoietic cells, a group directly affected by CML, are critical for their development and maintenance. These processes can have direct effects on: (1) transcription regulation, DNA damage/repair and DNA replication, (2) RNA levels and post-transcription stability and (3) protein translation or post-translation protein modifications. Mutations by these mechanisms are relatively rare in the CML at CP. These mutations are more frequently detected during disease progression and the proportions of leukemic cells carrying
313 mutations may be directly related to its response to TKI therapy.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Transcriptional regulations play an important role in leukemia heterogeneity. Transcription factor (e.g. WT1, MLL/ELL, C-MYC in acute myeloid leukemia; PML and RARα in acute promyelocytic leukemia; PU.1 in erythroid leukemia; EZA/PBX1 and TELL/AML1 in acute lymphoblastic leukemia)314 play an important role in transcriptional heterogeneity and their dysregulations can be acquired via mutation (e.g. AML- associated GATA2 mutations, CML-associated BCR-ABL mutations)315–317, by translocation (e.g. RUNX1‐RUNX1T1, RUNX1‐EVI1, CBFB‐MYH11 translocations in AML)8,314, changes in the genes of downstream signaling pathways, among others.
BCR-ABL acting essentially via the phosphorylation of tyrosine containing target proteins, its involvement of the transcriptional pathways has been less studied. We have recently shown that BCR-ABL activates ETS1, a major transcriptional regulator in hematopoietic cells. 318 In a previous study, we transfected the BCR-ABL gene into UT7 cells319 - an acute megakaryoblastic leukemia cell line - and performed a complete transcriptome analysis comparing the parental and transfected cells. We found the transcription factor, ETS1, as the gene most impacted by BCR-ABL expression, having its expression increased by 35.86-fold compared to the control320. In this study we demonstrate that ETS1 is a promoter of another EEF2K, also overexpressed in BCR- ABL positive cells.
9. Eukaryotic Elongation 2 Kinase (EEF2K)
9.1 EEF2K in normal cells
Increased cellular metabolism and resistance to apoptosis are two hallmarks of cell transformation. To sustain viability, cells regulate their proliferation and growth according to modifications acquired in their environment, such as availability of nutrients, for example 321 .
Cells under stress or under nutrient deprivation tend to protect themselves for survival by reducing energy demand. Eukaryotic elongation factor 2 (EEF2K) is responsible for
Page | 65
one of these cytoprotection mechanisms. EEF2K belongs to a family of atypical kinases that reversibly blocks the step of elongation of translation by phosphorylation of elongation factor 2 (eEF2).
9.2 EEF2K in cancer
Cancer is characterized by abnormal expansion of malignant cells. Expansions like this increase the demand for nutrients, generating excessive energy consumption, causing an imbalance in the microenvironment, disrupting DNA repair and facilitating the gain of mutations. Although it seems an unfavorable scenario for cellular expansion progress, tumor cells manage to find a way to overcome nutrient restriction barriers. The mechanisms involved are not fully known.
EEF2K is now known to be overexpressed in a wide range of tumors, such as breast, ovarian, colorectal, for example 322–330. However, nothing is known about the impact of EEF2K on chronic myeloid leukemia.
EEF2K is regulated by nutrient deprivation, energy depletion, Inadequate growth factor signaling and/or hypoxia and DNA damage. Therefore, situations easily identified in tumor environments. The increased expression of a gene that negatively regulates protein synthesis in highly proliferating cells, such as cancer cells, seems paradoxical.
There are possible explanations demonstrated by some published studies, such that the suppression of protein synthesis may be selective, that is, prioritizing the synthesis of certain major proteins. EEF2K depletion in breast cancer was associated with lower levels of pro-oncogene proteins, such as c-MYC and cyclin D1 and higher levels of cell cycle inhibitory protein p27kip1 192,196. In glioma cells, siEEF2K cells had increased levels of apoptosis genes and lower expression of anti-apoptotic proteins. There is also the possibility that EEF2K stimulates autophagy, where cells can catabolize some of their macromolecules for acquiring amino acids 332. Autophagy is linked to EEF2K in many studies, specially involving breast cancer and glioma cells 324,328,330,331,333.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
334 Figure 20. EEF2K mechanism
Page | 67
10. Methods of single cell analyses
Genomics analysis have been widely applied in cancer. Genome sequencing, as well as epigenomics and transcriptomics analysis lead us to better understanding tumor progression and its mechanisms. Such analyses were generally done in the bulk of cells or tissues, giving us a general idea of tumor behavior, however, masking the intratumor heterogeneity due a lack of sensibility and precise “individual” data. Single cell technologies are providing us an important perspective of tumorigeneses, potential
335 biomarkers and clonal expansion models, for example.
Single cell technologies are progressing at an undeniable speed, allowing the most variable type of intratumor heterogeneity analysis. It is possible to evaluate it using 4 distinguished approaches: (1) Genome sequence (2) Transcriptomic analysis (3) 335 Epigenetics analysis (4) Multi-omics analysis.
Intra-tumor genomic and transcriptomic heterogeneity can be measured at single cell level providing ample amounts of DNA/cDNA for subsequent sequencing. Methods such as degenerate oligonucleotide primed PCR (DOP-PCR) 336, specific-to-allele PCR FISH (STAR-FISH) 337, smFISH, SeqFISH 338,339 , combines PCR, FISH, single- cell RNA sequencing and/or qPCR, and have been used in various cancer studies. Gene expression signatures allowed to identify cancer cell types, such as cancer stem cells or contributed for clonal evolution and multi-lineage differentiation in colon cancer, for example 340,341. Epigenetics plays a decisive role in regulating gene expression and the single cell approach is more complicated at this context. However, multiple methods have been adapted for single cell purposes (reviewed in 342). Ideally, in order to have a global perspective of tumor mechanisms, a combination of genomics, transcriptomics, proteomics and epigenetics analysis should be applied. Despite the technical difficulties, science is progressing towards it, such as the scTRIO-Seq method, that simultaneously sequences genome, transcriptome and DNA methylome. 342
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Method type Specific methods Application to cancer genomics
Single-cell whole DOP-PCR, MDA, Used in conjunction with next- genome MALBAC generation sequencing to detect intra- amplification tumor CNVs and SNPs.
Single-cell spatial STAR-FISH Detects the spatial distribution of intra- genomics tumor CNVs and SNPs. Can be combined with longitudinal analysis to reveal migratory cells.
Single-cell Smart-seq, Tang et al. Identifies cancer-specific gene transcriptome method, single-cell expression signatures, cancer cell amplification qPCR types, alternative-splicing events.
Single-cell spatial smFISH, SeqFISH, Can provide spatially resolved gene transcriptomics MERFISH, FISSEQ, expression signatures in tumors. Has TIVA potential applications in tracing cell migratory paths and locating tumor-like stem cells.
Single-cell DNA scRRBS, PBAT Enables the discovery of differential methylomics methylation in cancer cells. Potential for broadening understanding of phenotypic plasticity of cancer cells.
Single-cell ATAC-seq, Pico-Seq Can give insight into the differential chromatin binding of transcription factors in accessibility cancer cells.
Chromosome Hi-C, ChIP-seq Potential for understanding the conformation mechanisms of cancer heterogeneity capture through mapping transcription factor- regulatory element interactions.
Simultaneous G&T-seq, scTrio-seq, Provides an integrated view of intra- multiple single-cell Darmanis et al. method tumoral heterogeneity through omics measuring direct interactions between genomic, transcriptomic, epigenetic, and proteomic variation.
Page | 69 Single-cell spatial Seurat, Achim et al. Infers cell location through scRNA-seq transcriptomic method data and an in situ RNA reference map inference of several landmark genes, enabling mapping of intra-tumor spatial heterogeneity.
Pseudo-time Monocle, TSCAN, Projects gene expression values from ordering Waterfall, SCUBA, a single time-point to a continuous Wanderlust, Wishbone trajectory over cell differentation. Potential use in understanding differentiation from stem-like cancer cell to matured cancer cell.
Rare cell-type RaceID, StemID, Potential use in the detection of detection GiniClust circulating tumors cells and stem-like cancer cells.
Clonal evolution SCITE, OncoNEM Builds lineage trees for understanding inference evolutionary events such as the development of therapy resistance.
335 Table 3. Relevant single-cell methods
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
335 Figure 21. Relevant single-cell applications
343 Figure 22.Single cell analysis of cancer genomes.
Page | 71
10.1 Single Cells and Computational analysis
It is becoming increasingly clear that clonal evolution occurs in a non-synchronized and asymmetric manner, which makes it impossible to accurately analyze this evolution through time points and cell bulk. Unique cell techniques allow the study of significant amounts of cells at a single time point. Within this group there are most likely cells in different states of evolution of the entire continuous process, and their individual assessment associated with computational analysis enables us today to estimate their
344,345 evolutionary trajectories.
10.2 Single cell isolation techniques
Isolation single cell used to be challenging few years ago. Methods such as limiting dilution and micromanipulation were widely used in the past and still applied in the present, but they are inefficient and time-consuming. Sorting cells by FACS are commonly used and very efficient, especially in cases where the marker studied is very low expressed. However, this method requires a large start volume of cells, which can
346,347 be a huge barrier when analyzing rare cells.
With the evolution of single-cell techniques, isolation cells became much easier. The microfluidic technology has decreased significantly the sample volume required while improved substantially the quality of analysis. This method can be applied to a variety of applications, including DNA and protein assays as well as RNA sequencing and other transcriptomic profile assays. 348 Fluidigm pioneered provided a machine (C1) that not only sorts single cells using microfluidic technologies, but also is able to perform cell lysis, RNA extraction and cDNA amplification in a single chip. Their method is convenient for providing lower false positives and less bias than standard tests. However, it still requires a considerable concentration of cells (around 2,5.105 cells/ml), a limited number of cells analyzed in one assay and the homogeneous cell size
349 mandatory requirement.
Another popular technique is the microdroplet-based microfluidics which disperse single cells into aqueous droplets in an oil phase. The even lower volume required by
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
this method, compare to microfluidic ones, allowing the screening of a huge number of cells (thousands to millions), consequently enabling the analysis of rare cell types in a proper heterogeneous environment. On the other hand, this technique is more bias-
350,351 susceptible and has lower resolution than C1
Finally, the isolation of rare circulating tumor cells, precursors of metastasis and potential targets for advanced personalized therapies can be isolated by enumeration using magnet conjugated with antibodies by the CellSearch method, the first to be
349 clinically validated by FDA.
Applications of single-cell RNA transcriptomic analysis
We can use single cell RNA transcriptomic analysis for many purposes, but there are 3 most important ones:
1) Cell type identification
With the advances of technologies, we can identify cell populations once not notice due experimental limitations, such as lower sensibility or specificity. Using single cell analysis, we can access to hidden rare cell populations that were not detected by
352 conventional methods.
2) Inferring regulatory networks
Single cell transcriptome gives us enough information about gene expression a its intracellular variation. Several algorithms that have been developed for the analysis this massive amount of data generated can be applied to address the gene regulatory networks, such as methods based on machine learning, co-expression, modelling or theoretical approaches. This way is possible to estimate the gene expression curves
353,354 and their network inference.
3) Cell trajectory
Each cell undergoes dynamic process and it is affected by its microenvironment, changing its behavior and regulations at its own pace. It is experimentally impossible to time-lapse assay all these changes of a whole cell population, considering their
Page | 73
individual and unique parameters, without artificial intelligence help. Considering that in single-cell assays cells are unsynchronized, providing us different time-points that can be used for a trajectory estimation. This method of analysis, called pseudotime, was first introduced by Monocle algorithm. As the name suggests, the purpose of pseudotime is not to infer a “real time” trajectory, but to put in evidence the cellular
355–357 dynamics and biological evolution along this trajectory.
10.2.1 Data Analysis
There is a wide list of methods that can be used for single-cell data analysis. The most common programming languages are R and Phyton. The choice of the analysis tools may be dependent of its programming language. Popular platforms, such as Seurat 358 359 360 361 , Scater , and Monocle relies on R programming packages while Scanpy offers a Phyton toolkit.
In this study, we used C1® and Biomark® machines from Fluidigm and analysed our data using the monocle method.
10.3 C1 from Fluidigm
The Fluidigm C1 equipment uses microfluidic technology to capture and analyze single cells at the level of their mRNA. Thanks to its integrated fluidic circuit (IFC) chip design and its cDNA preamplification technology (SMARTer), it is possible to distribute the cells individually, lyse them and perform reverse transcription through simple reagent and suspension of cells pipetting. Each IFC has a specific cell size range (5–10, 10– 17, and 17–25 μM) and it is able to capture up to 96 cells. Pre-designed primers are pooled in a solution and injected into the chip at the same time, in a different well, as the pool of cells. Cells must be fresh and viable. To complete the qPCR analysis, the preamplified cDNA must be analyzed by Fluidigm BioMark machine. Results should be analyzed using bioinformatic methods.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Fluidigm©
Figure 23. C1 machine, from Fluidigm© and its worlflow.
10.4 Monocle and Pseudotime
Many methods have been developed to infer trajectories from single cell transcripts (see table x) whose algorithms measure the distance or differences between cells and
Page | 75
position them along a continuous path, placing similar cells close together, thus creating a continuous path. To achieve the final result, the data goes through several steps, gene selection, size reduction, clustering, pseudotime inferences, and finally trajectory built (linear or branched) 362.
Table 4. Existing computational methods for constructing cell lineages from single cell
362 data
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
For our analysis we used the Monocle method (http://cole-trapnell- lab.github.io/monocle-release/), that allow one to order single cells by pseudotime in a trajectory according to their biological process. This order is done by advanced machine learning techniques based in single cell genomics data. The trajectories are built in 3 major steps:
Page | 77
Figure 24. Trajectory construction and analysis steps
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
1. Clustering : In this step, the main goal is to identify subtypes of cells and organize them in different clusters. There are many methods of clustering, such as like Principal Component Analysis (PCA)363, ISOMAP364 and t-distribution Stochastic Neighbor Embedding (t-SNE)365. All are based on the reduction of the high dimension to a low dimension, facilitating the visualization and analysis of the data. In our project, we use t-SNE, which is the latest and best visual method for composing graphics, providing more harmonious images for the human eye366.
2. Constructing Trajectories: Pseudotime, as the name suggests, is an abstract unit of time that calculates the distance of a cellular path based on the transcriptional changes a cell undergoes 367 Monocle uses pseudotime to organize cells and connect clusters, creating a branched trajectory that allow us to study the evolution of cell states 368. This method is particularly special due the asynchrony of clonal evolution and cell differentiation, making it very difficult to study to understand these processes, because in a single sample there are cells in different states of evolution.
3. Differential Expression Analysis: With the aid of trajectory, we can estimate, statistically, which genes have a similar path or may be co-regulated. Monocle assists in the identification of genes that are differentially expressed between trajectory cell groups and infer the statistical significance of these change
Page | 79
Figure 25. Same data visually represented by PCA, ISOMAP and t-SNE methods. https://quantdare.com/tsne/
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
11. Single-cell applications in cancer
The transcriptomic analysis of patients derived cells can reveal a pre-existing heterogeneity. A rare primary tumor subclone could have expanded and dominating the current population. Using this information, we can identify new cell types and cell states. The cell types are identified by clustering and they are designated by a highly distinct cluster among the bulk population. The cell states are related to the dynamics of cells, such as their progression in cell cycle or metabolic differences. Looking into the gene expression profile related to the cell type and cell states and crossing this data with the already published genomic data, it’s possible do distinguish between potential malignant cells from the non-malignant ones.
In the past years of single-cell studies, it is possible to identify some similar patterns among different studies and different cancer types. Several studies have demonstrated an up regulation of cell-cycle related genes and/or genes associate to hypoxia, for example. These cell cycle and stress states confirm their importance in cancer
369 progression and contribution to inter and intra tumor heterogeneity.
Single cell studies have also contributed to uncover nuances previously undetected in specific types of tumor. Jerby-Aron et al has recently published a study using single cell RNA sequencing analysis of 33 melanoma samples, where the cancer cell state that promotes immune evasion and resistance to immune checkpoint inhibitors was identified 370. Malignant cells from head and neck cancer differ in their epithelial differentiation and epithelial-to-mesenchymal transition mechanisms, which may contribute to metastasis.371. These patterns can be used to identify some mechanisms that can be related to specific cancer due the nature of their cells and environment.
The use of single cell approaches can also be applied for understanding the phylogenetic relationship of metastases and primary tumors as well as clarifying the 372 mechanisms of the metastatic process.
In addition, these methods can be used to anticipate a prognostic and treatment response from patients.
Page | 81
Objectives of the Thesis
1—To analyze the heterogeneity of CML stem cells and progenitors using single cell transcriptome analyses at diagnosis before any therapy in order to determine the prevalence of the expression of a panel of genes involved in the quiescence, self- renewal and pluripotency
2- To validate the findings obtained in single cell experiments in CML samples and to evaluate the possibility of identifying druggable targets.
3- To analyze the role of EEF2K expression in CML cells
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
PAPER 1 – Summary
SINGLE CELL TRANSCRIPTOME IN CHRONIC MYELOID LEUKEMIA (CML): PSEUDOTIME ANALYSIS REVEALS EVIDENCE OF EMBRYONIC AND TRANSITIONAL STEM CELL STATES
One of the major reasons of the impossibility of eradication of the most primitive LSC in CML is the heterogeneity of the disease at diagnosis as well as during potentially successive TKI therapies. This phenomenon is certainly due to the genetic instability of BCR-ABL expressing leukemic cells, but it has also been shown that the primitive LSC are not addict to TK activity of BCR-ABL. This has therefore led during the last 10 years to an extensive research for the identification of novel targets involved in the self- renewal of LSC, allowing the identification several important druggable targets such as SMO, ALOX5a, PML and STAT5. However, the identification of these pathways which have been validated in preclinical models and sometimes already tested in clinical trials do not consider the heterogeneity of CML stem cells at single cell level. Single cell transcriptome and more recently single cell RNAseq analyses allow currently unprecedented insights to be made for the pathophysiology of cancer cells.
Studies analysing the heterogeneity of single CML stem cells are limited and there is currently no study evaluating sequential gene expression using Pseudotime analysis.
Recent experimental data suggest that the heterogeneity of CML stem cells can be due not only to their differential BCR-ABL expression but also to the development of unique molecular events generating functional consequences in terms of their stem cell potential. Understanding these events at diagnosis of the disease and during tyrosine kinase inhibitor (TKI) therapies is of major interest as this can explain the clonal evolution and selection explaining resistance and persistence of LSC. In order to explore this phenomenon, we have designed a single cell transcriptome study using Fluidigm technology allowing to evaluate simultaneously the expression of 87 genes. Highly purified CD34+ cells from 3 CML patients at diagnosis and from two cord blood samples were included in the study. Individual 70, 93, 93 cells from three patients were
Page | 83
immobilized in microfluidic chips and the expression of 87 genes was evaluated in each cell. After independent normalization and pre-processing filtration, a merged matrix was built with 256 valid cells and 87 transcripts.
In this work, our first objective was to determine at the single cell level, the profile of gene expression in single leukemic cells using a panel of genes involved in the pathophysiology of CML. We have chosen for this purpose, genes involved in LSC quiescence self-renewal, drug resistance and apoptosis. As some previous data reported the potential involvement of pluripotency genes in CML progression we have included in our analysis, genes such as OCT4, SOX2, KLF4 and NANOG. Single cell Fluidigm technology was used to analyse the simultaneous expression of these genes. For the first time to our knowledge, we have analysed these cells using the bioinformatics tool Pseudotime allowing to class the genes in a trajectory, according to levels of expression in the population analysed. Pseudotime technology is a unique bioinformatics tool allowing to analyse the gene expression patterns in single cells in which a transcriptome has been performed. One of the major advantages of this methodology is to use the Monocle algorithm that allows unprecedented insights into the transcriptome dynamics of data collected at different sequential timepoints. The question of the heterogeneity of CML LSC has been recently studied allowing to identify in a combined mutational and transcriptome analysis, the presence of multiple subclones evolving during therapy. To our knowledge, there is no study evaluating the role of sequential gene expression in single cell in using a panel that we report here.
This analysis identified a group of 13 genes highly connected and enriched in pluripotency genes such as NANOG, POU5F1, LIN28A, SOX2 a «stem cell-like» population represent 8.59% of the cells analyzed. Bioinformatics analysis using corrected matrix and tSNE algorithm were applied for a trajectory inference based on the identification of four distinct clusters. Seven possibly different cell fate decisions were estimated by pseudo time and crossed with the 4 clusters we had found, in order to be validated. Six out of seven cell states overlapped the 4 clusters previously
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
estimated. In in vitro analyses, two genes which were predicted to undergo similar regulation using pseudotime analysis (ALOX5 and FGFR) were found to be similarly inhibited by Ponatinib, a FGFR inhibitor. Finally, using an independent cohort of CML patients we show that pluripotency gene expression is a common feature in CD34+ CML cells at diagnosis. Overall, these experiments allowed to identify individual stem cells expressing high levels of pluripotency genes at diagnosis, in which a continuum of transitional states was identified using pseudotime analysis. These results suggest that LSC persistence in CML is regulated by transitional stem cell states that need to be targeted simultaneously rather than using a single pathway.
Page | 85
L’ARTICLE 1 – Résumé
TRANSCRIPTOME EN CELLULE UNIQUE DANS LA LEUCÉMIE MYÉLOÏDE CHRONIQUE (LMC) : L'ANALYSE DE PSEUDO-MOTIFS RÉVÈLE DES SIGNES D'ÉTATS DE CELLULES SOUCHES EMBRYONNAIRES ET TRANSITOIRES
L'une des principales raisons de l'impossibilité d'éradiquer la CSL la plus primitive dans la LMC est l'hétérogénéité de la maladie au moment du diagnostic ainsi que pendant les traitements de la TKI qui peuvent se succéder. Ce phénomène est certainement dû à l'instabilité génétique des cellules leucémiques exprimant le gène BCR-ABL, mais il a également été démontré que les CSL primitives ne sont pas dépendantes de l'activité TK du gène BCR-ABL. C'est pourquoi, au cours des dix dernières années, des recherches approfondies ont été menées pour identifier de nouvelles cibles impliquées dans l'auto-renouvellement des CSL, ce qui a permis d'identifier plusieurs cibles médicamenteuses importantes telles que SMO, ALOX5a, PML et STAT5. Toutefois, l'identification de ces voies, qui ont été validées dans des modèles précliniques et parfois déjà testées dans des essais cliniques, ne tient pas compte de l'hétérogénéité des cellules souches de la LMC au niveau d'une seule cellule. Les analyses du transcriptome unicellulaire et, plus récemment, de l'ARNseq unicellulaire permettent d'obtenir des informations sans précédent sur la physiopathologie des cellules cancéreuses.
Les études analysant l'hétérogénéité des cellules souches uniques de la LMC sont limitées et il n'existe actuellement aucune étude évaluant l'expression séquentielle des gènes à l'aide de l'analyse des pseudotimes.
Des données expérimentales récentes suggèrent que l'hétérogénéité des cellules souches de la LMC peut être due non seulement à leur expression différentielle BCR- ABL, mais aussi au développement d'événements moléculaires uniques générant des conséquences fonctionnelles en termes de potentiel des cellules souches. La compréhension de ces événements au moment du diagnostic de la maladie et pendant les thérapies par inhibiteurs de la tyrosine kinase (TKI) est d'un intérêt majeur car elle
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
peut expliquer l'évolution et la sélection clonale expliquant la résistance et la persistance de la LSC. Afin d'explorer ce phénomène, nous avons conçu une étude du transcriptome cellulaire unique utilisant la technologie Fluidigm permettant d'évaluer simultanément l'expression de 87 gènes. Des cellules CD34+ hautement purifiées provenant de 3 patients atteints de LMC au moment du diagnostic et de deux échantillons de sang de cordon ont été incluses dans l'étude. Des cellules individuelles de 70, 93, 93 provenant de trois patients ont été immobilisées dans des puces microfluidiques et l'expression de 87 gènes a été évaluée dans chaque cellule. Après normalisation indépendante et filtration préalable, une matrice fusionnée a été construite avec 256 cellules valides et 87 transcrits.
Dans ce travail, notre premier objectif était de déterminer, au niveau de la cellule unique, le profil de l'expression des gènes dans les cellules leucémiques uniques en utilisant un panel de gènes impliqués dans la physiopathologie de la LMC. Nous avons choisi à cette fin, les gènes impliqués dans l'auto-renouvellement de la quiescence de la LSC, la résistance aux médicaments et l'apoptose. Comme certaines données antérieures faisaient état de l'implication potentielle de gènes de pluripotence dans l'évolution de la LMC, nous avons inclus dans notre analyse des gènes tels que OCT4, SOX2, KLF4 et NANOG. La technologie Fluidigm à cellule unique a été utilisée pour analyser l'expression simultanée de ces gènes. Pour la première fois à notre connaissance, nous avons analysé ces cellules en utilisant l'outil bioinformatique Pseudotime permettant de classer les gènes dans une trajectoire, en fonction des niveaux d'expression dans la population analysée. La technologie Pseudotime est un outil bioinformatique unique qui permet d'analyser les modèles d'expression des gènes dans les cellules individuelles dans lesquelles un transcriptome a été effectué. L'un des principaux avantages de cette méthodologie est d'utiliser l'algorithme Monocle qui permet d'obtenir des informations sans précédent sur la dynamique du transcriptome à partir de données recueillies à différents moments de la séquence. La question de l'hétérogénéité de la CSL LMC a été récemment étudiée, permettant d'identifier, dans une analyse combinée des mutations et du transcriptome, la présence de multiples sous-clones évoluant au cours de la thérapie. À notre connaissance, il n'existe pas
Page | 87
d'étude évaluant le rôle de l'expression séquentielle des gènes dans une seule cellule à l'aide d'un panel dont nous rendons compte ici.
Cette analyse a permis d'identifier un groupe de 13 gènes fortement connectés et enrichis en gènes de pluripotence tels que NANOG, POU5F1, LIN28A, SOX2 ; une population de type "cellules souches" représente 8,59% des cellules analysées. L'analyse bioinformatique avec matrice corrigée et algorithme tSNE a permis d'identifier quatre groupes distincts et l'analyse pseudo time a confirmé dans les 4 groupes identifiés, la présence de 7 états cellulaires séparées par 3 branches d'intersection reliant l'expression d'ALOX5 a été associée au groupe de cellules exprimant les marqueurs de pluripotence. Dans les analyses in vitro, deux gènes dont on avait prédit qu'ils allaient subir une régulation similaire par l'analyse des pseudos (ALOX5 et FGFR) se sont révélés être inhibés de manière similaire par le Ponatinib, un inhibiteur du FGFR. Enfin, en utilisant une cohorte indépendante de patients atteints de LMC, nous montrons que l'expression des gènes de la pluripotence est une caractéristique commune des cellules CD34+ de la LMC au moment du diagnostic. Dans l'ensemble, ces expériences ont permis d'identifier des cellules souches individuelles exprimant des niveaux élevés de gènes de pluripotence au moment du diagnostic, dans lesquelles un continuum d'états transitoires a été identifié à l'aide d'une analyse de pseudo-caractères. Ces résultats suggèrent que la persistance des CSL dans la LMC est régulée par des états transitoires des cellules souches qui doivent être ciblées simultanément plutôt que d'utiliser une seule chemin.
ARTICLE IN PRESS
Experimental Hematology 2020;000:1−10
REGULAR SUBMISSION
Single-Cell Transcriptome in Chronic Myeloid Leukemia: Pseudotime Analysis Reveals Evidence of Embryonic and Transitional Stem Cell States Sarah Pagliaroa,b,c, Christoph Desterkea,c, Herve Acloquea, Jean Claude Chomeld, Lucas de Souzaa, Patricia Huguesa, Frank Griscellia,e,f, Adlen Foudig, Annelise Bennaceur-Griscellia,c,e, and Ali G. Turhana,c,e aINSERM UMR-S 935, Villejuif, France; bSciencia Sem Fronteiras, CAPES, Brasilia, Brazil; cUniversite´ Paris Saclay, France; dService de cance´rologie Biologique, CHU Poitiers, Poitiers France; eINGESTEM National iPSC Infrastructure, 94800 Villejuif, France; fUniversite´ Paris Descartes, Faculte´ Sorbonne Paris Cite´, Faculte´ des Sciences Pharmaceutiques et Biologiques, Paris, France; gATIP-Avenir INSERM UMR-S 935, Universite´ Paris Sud, 94800 Villejuif
(Received 10 March 2020; revised 4 April 2020; accepted 8 April 2020)
Recent experimental data suggest that the heterogeneity of chronic myeloid leukemia (CML) stem cells may be the result of the development of unique molecular events generating func- tional consequences in terms of the resistance and persistence of leukemic stem cells. To explore this phenomenon, we designed a single-cell transcriptome assay evaluating simulta- neously the expression of 87 genes. Highly purified CD34+ cells from three CML patients at diagnosis were immobilized in microfluidic chips, and the expression of 87 genes was evaluated in each cell. This analysis identified a group of 13 highly connected genes including NANOG, POU5F1, LIN28A, and SOX2, representing on average 8.59% of the cell population analyzed. Bioinformatics analysis with the corrected matrix and t-distributed stochastic neighbor embedding (tSNE) algorithm identified four distinct clusters, and the pseudotime analysis con- firmed the presence of seven stem cell states in the four clusters identified. ALOX5 expression was associated with the group of cells expressing the pluripotency markers. In in vitro analy- ses, two genes that were predicted to undergo similar regulation using pseudotime analysis (ALOX5 and FGFR) were found to be similarly inhibited by ponatinib, an FGFR inhibitor. Finally, in an independent cohort of CML patients, we found that pluripotency gene expression is a common feature of CD34+ CML cells at diagnosis. Overall, these experiments allowed identification of individual CD34+ cells expressing high levels of pluripotency genes at diagno- sis, in which a continuum of transitional states were identified using pseudotime analysis. These results suggest that leukemic stem cell persistence in CML needs to be targeted simulta- neously rather than using a single pathway. © 2020 ISEH – Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.
Chronic myeloid leukemia (CML) is a clonal hematopoietic ABL oncogene, in a very primitive hematopoietic stem cell [1]. malignancy, characterized by acquisition of the t(9;22) translo- CML is a model of targeted therapies as the proof of con- cept cation leading to Ph1 chromosome and its counterpart BCR- of the feasibility of targeting the tyrosine kinase (TK) activity BCR-ABL using TK inhibitors (TKIs) has been found to lead Offprint requests to: Ali G. Turhan, INGESTEM National IPSC to major responses and remissions [2]. The use of ima- tinib Infrastructure, Avenue Paul Vaillant Couturier, Villejuif 94800, France; E-mail: [email protected] and, later, second-generation [3,4] and third-generation [5] TKI therapies has changed the natural history of the disease Supplementary material associated with this article can be found in the and prolonged overall survival [6] . Moreover, recent results online version at https://doi.org/10.1016/j.exphem.2020.04.005. from CML registries indicate that the overall survival of CML
0301-472X/© 2020 ISEH – Society for Hematology and Stem Cells. Published by Elsevier Inc. All rights reserved.
https://doi.org/10.1016/j.exphem.2020.04.005 2 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 patients responding to TKI therapies could equal that of the Single-cell lysis, reverse transcription, and cDNA pre-amplifi- general population of the same age and sex [7]. However, the cation were performed on the C1 apparatus according to the proto- problems currently encountered in the therapy of patients are col provided by Fluidigm (https://www.fluidigm.com/products/c1- the TKI resistance of primitive leukemic stem cells (LSCs) [8] system). Briefly, the first step of the experiment is on the C1 and the persistence of LSCs [9], which is thought to be related machine (Fluidigm), using the C1 Single-Cell Preamp IFC (10−17 to the heterogeneity of the stem cells at diagnosis, leading to mm; Ref. 100−5479), where a solution of pooled cells and primers can be added along with other reagents from the kit (C1 Single- clonal selection of cells resisting TKI therapies [10]. Cell Reagent Kit, Ref. 100−5319) and pipetted at the same time, Persistence of the most primitive LSCs, even in patients into different wells, for later processing with the equipment. Using in deep molecular responses (DMRs), has been reported a microfluidic system, the C1 machine performs cell lysis, RNA [9,11], explaining the occurrence of rapid relapses caused extraction, reverse transcription, and pre-amplification of cDNA. by the long-term persistence of dor- mant CML stem cells. After pre-amplification, samples were sent to the INRA Institute in Indeed, rapid molecular recur- rences have been reported Toulouse, France, for single-cell quantitative reverse transcription to occur after TKI discontinuation in several clinical trials polymerase chain reaction (RT-qPCR) using the Biomark appara- performed to date [10,12]. tus from Fluidigm. The second major current problem is the resistance to TKI therapies that occurs in 30% of patients requir- ing Bioinformatics analyses TKI switch and leading, in some rare cases, to pro- gression Single-cell bioinformatics analyses were performed in the R toward aggressive-phase CML, for example, accelerated software environment, Version 3.4.3. Unsupervised classifica- phases and blast crisis [9]. tion (Pearson correlation distance and average method) with an The heterogeneity of CML stem cells contributes to expression heatmap was performed with R Bioconductor made4 these two events and is an obstacle to successful eradi- [13]. Unsupervised principal component analysis was performed with the FactoMineR R package [14].Violinplot expression for cation of the disease. To uncover the panel of genes that expression of markers was performed with ggplot2 graphical can contribute to this event, we applied the tech- nology of definition in R software [15]. Leave-one- out with cross- single-cell transcriptome analysis to CML cells using a validation supervised machine learning was realized with the panel of genes involved in embryogenesis, cell quiescence, Stanford algorithm in the pamr R package [16]. Receiver stemness, self-renewal and apoptosis. We then applied the operating characteristic (ROC) curves were drawn with the Epi R technique of trajectory analysis to the gene expression package, and the decision tree with the rpart R package. Statistical pattern. We report here the discov- ery of transitional stem significance between groups was assessed using a two-sided t test cell states, including embryonic genes identified in CML with Welch correction. Pseudotime analysis was performed in the cells at diagnosis, which could contribute to LSC resistance R software envi- ronment with monocle package version monocle 2.10.1 [17]. and persistence.
RNA extraction, reverse transcription and RT-qPCR Methods To validate the expression of genes identified by C1, we per- formed Peripheral blood from CML patients at diagnosis before any ther- RT-qPCR using peripheral blood from CML and control samples. apy were collected with informed consent from all patients For this purpose, CD34+ cells were studied in compari- son with according to the principles of the Declaration of Helsinki. Sin- gle- peripheral blood mononuclear cells (PBMCs). Isolation of RNA was cell analysis was performed in three patients, and molecular performed using the PureLink RNA Purification (Thermo Fisher validation in an independent cohort of 10 patients. Scientific, Waltham, MA). RNA was quantified with a NanoDrop spectrophotometer (Thermo Scientific). Reverse transcription was Isolation of CD34+ cells carried out using the Applied Biosys- tems High-Capacity cDNA Peripheral blood mononuclear cells (PBMCs) were separated Reverse Transcription Kit (Thermo Scientific). Quantitative real- from whole blood by density gradient centrifugation using the time PCR was performed using the Stratagene MxPro 3005P system Ficoll method, labeled with anti-CD34 antibodies (Ref. 130-090- (Agilent Technologies Santa Clara, CA) and SYBR Green PCR 954, Miltenyi, Bergisch Gladbach, Germany), and sorted using Master Mix (Applied Biosys- tems, Foster City, CA). magnetic columns from Miltenyi (Ref. 130-046- 703). The purity Quantification was performed using the DDCt method. was evaluated by flow cytometry (MACS- Quant, Miltenyi), Normalization was performed using b2-microglo- bulin mRNA as a using the anti-CD34+ human (Ref. 130- 090-954) antibody from housekeeper. The primers used for quantitative RT-qPCR were Miltenyi. obtained from Integrated DNA Technologies (IDT, Coralville, CA) and are listed in Table 2. Fluidigm assays To perform single-cell transcriptome analyses, we designed Evaluation of FGFR1 and ALOX5 co-regulation using 87 genes involved in the cell cycle, stem cell quiescence, FGFR1 inhibition proliferation, and pluripotency (Table 1). The designed panel was To determine these interactions, CD34+ cells (250 cells/mL) from validated for the possibility of amplification simulta- neously three CML patients were cultured in the presence of ponatinib for with Fluidigm. 3 days in Iscove’s modified Dulbecco’s medium (IMDM), 20% BIT 9500 Serum Substitute (STEMCELL
ARTICLE IN PRESS
S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 3
Table 1. Genes used to design C1 Fluidigm single-cell experiments
Gene symbol Gene NCBI ID Description ABI1 10006 abl interactor 1 ABL1 25 ABL proto-oncogene 1, non-receptor tyrosine kinase ACKR1 2532 Atypical chemokine receptor 1 AHI1 54806 Abelson helper integration site 1 AKT1 207 AKT serine/threonine kinase 1 ALOX5 240 Arachidonate 5-lipoxygenase ASH1L 55870 ASH1 like histone lysine methyltransferase
B2M 567 b2-microglobulin BAD 572 BCL2-associated agonist of cell death BCL2 596 BCL2 apoptosis regulator BMI1 648 BMI1 proto-oncogene, polycomb ring finger CASP3 836 Caspase 3 CD82 3732 CD82 molecule CD93 22918 CD93 molecule CDH1 999 Cadherin 1 CDK2 1017 Cyclin-dependent kinase 2 CDK6 1021 Cyclin-dependent kinase 6 CDKN1C 1028 Cyclin-dependent kinase inhibitor 1C CDKN2C 1031 Cyclin-dependent kinase inhibitor 2C CNNM1 26507 Cyclin and CBS domain divalent metal cation transport mediator 1 CTNNB1 1499 Catenin beta-1 CXCL2 2920 C−X−C motif chemokine ligand 2 CXCR2 3579 C−X−C motif chemokine receptor 2 CXCR3 2833 C−X−C motif chemokine receptor 3 CXCR4 7852 C−X−C motif chemokine receptor 4 CYLD 1540 CYLD lysine 63 deubiquitinase CYP1B1 1545 Cytochrome P450 family 1 subfamily B member 1 DACT1 51339 Dishevelled binding antagonist of catenin beta-1 DDX3X 1654 DEAD-box helicase 3 X-linked DLK1 8788 Delta-like noncanonical Notch ligand 1 DNMT3A 1788 DNA methyltransferase 3 alpha DNMT3B 1789 DNA methyltransferase 3 beta DPP4 1803 Dipeptidyl peptidase 4 DPPA3 359787 Developmental pluripotency associated 3 DPPA5 340168 Developmental pluripotency associated 5 EEF2K 29904 Eukaryotic elongation factor 2 kinase ERCC2 2068 ERCC excision repair 2, TFIIH core complex helicase subunit ETS1 2113 ETS proto-oncogene 1, transcription factor ETV6 2120 ETS variant transcription factor 6 EZH2 2146 Enhancer of zeste 2 polycomb repressive complex 2 subunit FBXW7 55294 F-box and WD repeat domain containing 7 FGF5 2250 Fibroblast growth factor 5 FGFR1 2260 Fibroblast growth factor receptor 1 FOS 2353 Fos proto-oncogene, AP-1 transcription factor subunit GAPDH 2597 Glyceraldehyde-3-phosphate dehydrogenase GLI1 2735 GLI family zinc finger 1 HSP90AA1 3320 Heat shock protein 90 alpha family class A member 1 IFNA1 3439 Interferon alpha-1 IGF2R 3482 Insulin like growth factor 2 receptor IL6ST 3572 Interleukin-6 signal transducer JAK1 3716 Janus kinase 1 JAK2 3717 Janus kinase 2 JUNB 3726 JunB proto-oncogene, AP-1 transcription factor subunit KIT 3815 KIT proto-oncogene, receptor tyrosine kinase KLF4 9314 Kruppel-like factor 4 KRAS 3845 KRAS proto-oncogene, GTPase LIFR 3977 LIF receptor subunit alpha LIMS1 3987 LIM zinc finger domain containing 1 LIN28A 79727 lin-28 homologue A MAPK1 5594 Mitogen-activated protein kinase 1 MAPK3 5595 Mitogen-activated protein kinase 3
(continued )
4 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10
Table 1 (Continued) Gene symbol Gene NCBI ID Description MCL1 4170 MCL1 apoptosis regulator, BCL2 family member MEG3 55384 Maternally expressed 3 MSI2 124540 Musashi RNA binding protein 2 MTOR 2475 Mechanistic target of rapamycin kinase MYC 4609 MYC proto-oncogene, bHLH transcription factor MYSM1 114803 Myb like, SWIRM and MPN domains 1 NANOG 79923 Nanog homeobox NOTCH1 4851 Notch receptor 1 PIK3CA 5290 Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha PML 5371 Promyelocytic leukemia POU5F1 5460 POU class 5 homeobox 1 PRKAA1 5562 Protein kinase AMP-activated catalytic subunit alpha-1 PROM1 8842 Prominin 1 PTCH1 5727 Patched 1 PTEN 5728 Phosphatase and tensin homologue PTK7 5754 Protein tyrosine kinase 7 PTPA 5524 Protein phosphatase 2 phosphatase activator SIRT1 23411 Sirtuin 1 SKP2 6502 S-Phase kinase-associated protein 2 SMO 6608 Smoothened, frizzled class receptor SOX2 6657 SRY-box transcription factor 2 SPP1 6696 Secreted phosphoprotein 1 STAT3 6774 Signal transducer and activator of transcription 3 STAT5A 6776 Signal transducer and activator of transcription 5A STMN1 3925 Stathmin 1 TFCP2L1 29842 Transcription factor CP2 like 1 TGFB1 7040 Transforming growth factor b1 TP53 7157 Tumor protein p53 ZBTB16 7704 Zinc finger and BTB domain containing 16 ZFP36 7538 ZFP36 ring finger protein ZFP36L1 677 ZFP36 ring finger protein-like 1
Technologies) containing interleukin (IL)-3, FMS-like tyro- sine The three patients at diagnosis (UPN1, UPN2, UPN3) kinase 3 ligand (FLT3-L) and stem cell factor (SCF) (100 were in the chronic phase of their disease. Blood cells ana- ng/mL each), and TPO (20 ng/mL). Cells were collected at day lyzed at diagnosis were 100% Ph1+ cells at cytogenetic and +3 and after extraction of RNA. RT-qPCR analysis was fluorescence in situ hybridization (FISH) analyses. These performed to evaluate the expression of FGFR1 and ALOX5a. cells were then used to perform Fluidigm experiments fol- lowed by bioinformatics analyses, as indicated in Figure 1. Results Identification of pluripotency genes in CML CD34+ Patient characteristics cells Characteristics of patients included in the initial study The first step of the analysis included the building of a are summarized in Table 3. matrix using 256 cells. We identified a population of 22 cells (8.59% of general population) that highly
Table 2. Genes analyzed by standard quantitative reverse transcription polymerase chain reaction validate C1 results
Gene RefSeq sequence Amplification Forward primer sequence Reverse primer sequence length (pb)
ALOX5 NM_001320861.2 86 AgCTgCAggACTTCgTgAA CTCTTgACCgACTTggggAA FGFR1 NM_023110.3 89 ACACTgCgCTggTTgAAAA ATgATgCTCCAggTggCATA JAK2 NM_004972.4 77 ACTTCTgCAgTACACATCTCA CCAgATCCCTgTggATATACC LIN28A NM_024674.6 84 CATgCAgAAgCgCAgATCAA ggTggCAgCTTgCATTCC MYC NM_002467.6 104 CCTggTgCTCCATgAggA CCTgCCTCTTTTCCACAgAAA PIK3CA NM_006218.4 82 CTgCAgTTCAACAgCCACAC ACAggTCAATggCTgCATCA SOX2 NM_003106.4 83 CATgAAggAgCACCCggATTA CgggCAgCgTgTACTTATCC TGFB1 NM_000660.7 85 CTACTACgCCAAggAggTCAC gCTgTgTgTACTCTgCTTgAAC FGF5 NM_001291812.1 107 gAgTggTATgTggCCCTgAA gACTgCTTgAATCTTggCAgAAA LIMS1 NM_001193483.3 76 ACTgCTTTgCCTgTTCTACC ACTggCTTCATgTCAAACTCC
ARTICLE IN PRESS
S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 5
Table 3. Characteristics of three patients included in the study
Patient Sex Age Sokal index WBC DG Disease phase at diagnosis Outcome Cells used for Fluidigm UPN1 M 57 Low 56 g/L - DMR +2 y Diagnosis CD34+ cells UPN2 F 62 Int 89 g/L CP DMR +2 y Diagnosis CD34+ cells UPN3 F 63 Int 286 g/L CP DMR +5 y Diagnosis CD34+ cells CP=Chronic phase; DMR=deep molecular response; F=female; M=male; WBC=white blood cell; DG=Diagnosis. expressed a specific group of 12 genes, among them process can be either linear or nonlinear, generating a pluripotency genes such as LIN28a NANOG, OCT4, and branching process such as during cell differentiation or in SOX2 (Figure 2). Interestingly, similar numbers of cells cells in a state of cycling or quiescence. expressed the pluripotency genes (eight cells in UPN1, Using these computational techniques, we estimated a seven cells in UPN2, seven cells in UPN3). As can be seen branched trajectory based on their gene expression. As in Figure 2, expression of the pluripotency genes was illustrated in Figure 4, the trajectory had three major restricted to this small population that we designated stem- hubs: hub 1 delimited the major cluster (contain- ing lower like cells. expression genes) from the clusters with more highly expressed genes. The last and most inter- esting hub 2 Estimation of gene trajectory using pseudotime analysis provided evidence of an important split between two Using t-distributed stochastic neighbor embedding (tSNE) different cell states. and unsupervised classification, we next analyzed the gene trajectory of the cells, allowing determination of four Cell fate decisions and trajectory validation principal clusters based on gene expression. For this To validate our trajectory, we estimated, using pseudo- analysis, we combined the results obtained in 256 time analysis, seven possible different cell fate deci- sions cells from three patients. As can be seen in Figure 3, the and crossed them with the four clusters we previously major cluster represented the cells with an overall reduced found (Supplementary Figure E1, online only, available gene expression compared with the other three clusters. As at www.exphem.org). opposed to this major cluster, the other three clusters had a Subsequently, we used the stem-like genes identified on distinct pattern of increased gene expres- sion. Cluster 1 (n the heatmap matrix (Supplementary Figure E2, online only, = 50 cells) included c-MYC and JAK2, two genes highly available at www.exphem.org) to perform the pseu- dotime involved in BCR-ABL−induced leuke- mogenesis and CML analysis with the cell fate decisions we have seen. As pathophysiology. Cluster 4 (n = 35 cells) included essentially illustrated in Figure 2, we found that the results highlighted ALOX5 and LIN28A involved, respectively, in self-renewal some of the stem-like genes that we had pre- viously and persistence of LSC (ALOX5) and CML progression identified, and it aggregates with ALOX5. Given the fact that (LIN28A). Cluster 3 (n = 41 cells) included MYC, the ALOX5 cluster belongs to hub 2 of our trajectory and LIMS1, and TGFB (Figure 3). considering that cells can decide to evolve toward ALOX5, Starting from such a data set, our aim was to use the the LIN28a cluster, or the cluster of MYC, LIMS1, and trajectory inference methods to order cells with respect to TGFB, we attempted to identify genes that can be involved an underlying dynamic process that explains the het- in its regulation. erogeneity of the sample. The structure of the dynamic We performed further bioinformatics analyses to determine the genes involved in this trajectory split. As
Figure 1. Schematic of the experimental strategy. The analysis at diagnosis included CD34+ cells purified at diagnosis, with a purity >98%. CML-CP=chronic myeloid leukemia-chronic phase.
6 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10
Figure 2. Identification of stem cells with pluripotency gene expression by single-cell analysis.
Figure 3. t-Distributed stochastic neighbor embedding (tSNE) and unsupervised classification allowed the identification of four principal clusters based on the genes of expression. The major cluster contains cells with a lower overall gene expression compared with the three other clusters.
Figure 4. Pseudotime branching analysis of the single-cell transcriptome in three patients.
ARTICLE IN PRESS
S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 7
Figure 5. Pseudotime relative expression of FGFR1 and PIK3CA as compared with ALOX5 stem cell marker and ABL1 used as control of expression. can be seen in Supplementary Figure E2, mathematical in vitro experiment consisting of the inhibition of FGFR analysis of gene expression revealed that from branch 2, expression, and to determine the potential impact of this cells could evolve in terms of gene expression either toward inhibition, we evaluated the expression of ALOX5, the ALOX5/LIN28A cluster or toward the FGFR1, FGF5, and PIK3CA in the pres- ence of MYC/LIMS/TGFP cluster. As can be seen in the figure, the appropriate control cells. As can be seen in Figure 6, CML gene most likely decisional in this event was STAT5A, a cells treated with the pan-FGFR inhib- itor ponatinib for druggable gene highly involved in the pathophysiology of 48 hours exhibited reduced expres- sion of ALOX5 and CML. FGFR1 gene, whereas expression of FGF5 and PIK3CA To identify genes that may be involved in ALOX5 was not modified (Figure 6). These experiments suggested regulation, we determined the wave of expression of the that the pattern isolated by pseudotime analysis could be genes belonging to the same group. As can be seen in demonstrated in pri- mary CML cells. Figure 5, PI3KCA and FGFR1 genes had a wave shape similar to that of ALOX5, suggesting that these genes may Validation of pluripotency gene expression in primary be co-regulated. CML cells We next asked whether the genomic pattern identified Functional evaluation of a common regulatory pathway for using Fluidigm analyses could be validated in a differ- ent ALOX5 and FGFR1 cohort of CML progenitors. For this purpose, we analyzed To determine and validate the possible functional role of CD34+ cells from 10 patients as compared ALOX5 and FGFR co-regulation, we designed an
Figure 6. Validation of gene signature trajectory with ponatinib functional experiments performed CML CD34+ cells.
8 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10
Figure 7. Validation of embryonic stem cell signature in CD34+ cells from CML patients: RT-qPCR relative expression were normalized with the b2-microglobulin housekeeping gene. Results of t-test: *p < 0.05, **p value between 0.05 and 0.005, ***p < 0.005, NS = nonsignificant.
with bulk PBMC mRNA expression. We analyzed the Discussion expression of genes including ALOX5, FGFR1, P1K3CA, One of the major reasons it is impossible to eradicate the TGFB1, LIMS1, SOX2, C-MYC, LIN28a, most primitive LSCs in CML is the heterogeneity of the and SOX2 (Figure 7). disease at diagnosis as well as during potentially successive This analysis revealed increased levels of expression for TKI therapies [1,9]. This phenomenon is certainly due to FGFR1, PIK3CA, LIMS1, TGFB1, SOX2, c-MYC, the genetic instability of BCR-ABL LIN28a, and JAK2 RNA in the CML CD34+ cell popu- −expressing leukemic cells [19], but it has also been found lation as compared with their PBMCs. Interestingly, that the primitive LSCs are not addict to the TK activity of despite the possibility of a common regulation in single BCR-ABL [20]. This led, during the last 10 years, to cells, ALOX5 and FGFR expression was found to be extensive research in the identification of novel targets discordant in bulk CD34+ cells, probably because the involved in the self-renewal of LSCs, allowing analysis in bulk cells does not capture the transitional identification of several important druggable targets such states and there is probably an inter-patient heterogene- ity as SMO [21,22], ALOX5a [23], PML [24], and STAT5 in the expression of both genes. It is also of interest to [25]. However, the identification of these pathways, which note that the overexpression of SOX2 in human stem have been validated in preclinical models [23] and, in some cells (HSCs) was reported in a previous work, whereas cases, have already been tested in clinical trials, do not OCT4 overexpression was not detected in the same take into account the heterogeneity of CML stem cells at population [18] (Supplementary Figure E3, online only, the single-cell level. available at www.exphem.org).
ARTICLE IN PRESS
S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 9
Single-cell transcriptome and, more recently, single- cell if the expression of these cells in the CD34+ cell popu- RNAseq analyses allow us to gain currently unprecedented lation correlates with functional stem cell detection tests insights into the pathophysiology of can- cer cells [26−30]. and outcome and resistance to TKI therapies. Studies analyzing the heterogeneity of single CML stem We also reported here that there is a sequential cells are limited [28,31], and there is currently no study expression of key genes involved in the pathogenesis of evaluating sequential gene expression using pseudotime CML, and according to the levels of expression of some analysis. In this work, our first objective was to determine, genes such as STAT5A, cells are engaged in dif- ferent at the single-cell level, the profile of gene expression in transcriptional pathways. STAT5 plays a major role in the single leukemic CD34+ cells using a panel of genes involved pathogenesis of CML [33,34], and it has been reported in the pathophysiology of CML. We chose, for this purpose, that STAT5A, in particular, can play a major role in the TKI genes involved in LSC quiescence self- renewal, drug resistance of CML cells [35]. STAT5 can represent a resistance, and apoptosis (Table 1). potential therapeutic target as it has been shown that The potential involvement of pluripotency genes in Pimozide, a STAT5 phosphoryla- tion inhibitor exhibits CML progression has previously been reported [32]. In our high synergistic activity with Imatinib against CML analysis, we included genes such as OCT4, SOX2, KLF4, progenitors [25,36−38]. and NANOG. Single-cell Fluidigm technology was used We also reported that the findings obtained using to analyze the simultaneous expression of these genes. For pseudotime wave analysis can be validated in primary CML the first time to our knowledge, we analyzed these cells samples, as this was seen in the experiments using FGFR using the bioinformatics tool pseu- dotime, allowing inhibition by ponatinib. Indeed, we found that FGFR classification of the genes in a trajec- tory, according to the inhibition by ponatinib can lead to reduction of the levels of expression in the population analyzed [17]. expression of ALOX5 and FGFR1, suggesting co- Pseudotime technology is a unique bioinformatics tool regulation, which needs to be confirmed in further studies. allowing analysis of gene expression patterns in single Similarly, further studies on the use of a more specific cells in which a transcrip- tome has been performed. One FGFR1 inhibitor are needed, because ponatinib also of the major advantages of this methodology is use of the inhibits other receptors and pathways such as PDGFR, Monocle algorithm, which provides unprecedented SRC, RET, KIT, and FLT1. insights into the tran- scriptome dynamics of data collected One of the major findings of our study is that CML stem at different sequential time points [17]. The question of the cells do not have a static transcriptional status but express hetero- geneity of CML LSCs has recently been studied different genes with a dynamic pattern and according to [28,31], allowing identification, in a combined muta- tional some key decisional points (Supplemen- tary Figure E4, and transcriptome analysis, the presence of mul- tiple online only, available at www.exphem. org). As can be seen subclones evolving during therapy. To our knowledge, in this figure, depending on the STAT5A levels, cells can there is no study has evaluated the role of sequential gene be involved in two different transcriptional pathways, and expression in single cells using the panel we report here. predominance of the ALOX5/LIN28 pathway could lead to One of the major findings of this study was the identifi- their resistance, persistence, and progression [9]. cation of a small population of single cells expressing genes Interestingly, zileuton, an inhibitor of ALOX5, is being involved in pluripotency, such as OCT4, SOX2, and tested in clinical trials in combination with imatinib [39]. NANOG. In the three patients studied, the numbers of such However, recent studies have provided evidence that this cells were low but consistent (8% of cells), suggest- ing their effect may not be transferable into human cells [40,41]. relevance to the pathophysiology of CML. Analy- sis of the The major consequence of the findings reported here expression of some these genes also revealed their high could be that CML CD34+ cells express a highly dynamic expression at diagnosis (Figure 7F). transcriptional pattern and should be targeted not by a The significance of these findings is not established at single pathway, but by several pathways involving several present, as analysis of these genes, detectable in CD34+ drugs. Indeed, recent work suggests that CML LSCs could cells (and not in the total blood RNA used for diagnosis), be best targeted by the combined use of JAK/STAT and is not performed routinely. One limitation of our analysis TKI inhibitors [42]. Further studies using the druggable that we could not analyze normal adult CD34+ cells with genes active in CML LSCs could possibly lead to a cure for this technology. All three patients analyzed had small CML. numbers of single cells expressing pluripotency genes and, at the time of analysis, had excellent responses to TKI therapies. It would be of major interest to determine in a References large cohort of patients 1. Houshmand M, Simonetti G, Circosta P, et al. Chronic myeloid leukemia stem cells. Leukemia. 2019;33:1543–1556. 2. Deininger MW, O’Brien Druker BJ. International randomized study of interferon vs STI571 (IRIS) 8-year follow up: sustained
10 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10
Zhao C, Chen A, Jamieson CH, et al. Hedgehog signalling is essential survival and low risk for progression or events in patients with newly for maintenance of cancer stem cells in myeloid leu- kaemia. Nature. diagnosed chronic myeloid leukemia in chronic phase (CML-CP) 2009;458:776–779. treated with imatinib. Blood. 2009;114:1126. 23. Nelson EA, Walker SR, Weisberg E, et al. The STAT5 inhibitor 3. Kantarjian H, Giles F, Wunderle L, et al. Nilotinib in imatinib- pimozide decreases survival of chronic myelogenous leukemia cells resistant CML and Philadelphia chromosome-positive ALL. N Engl resistant to kinase inhibitors. Blood. 2011;117:3421–3429. J Med. 2006;354:2542–2551. 24. Ito K, Bernardi R, Morotti A, et al. PML targeting eradicates quies- cent 4. Talpaz M, Shah NP, Kantarjian H, et al. Dasatinib in imatinib- leukaemia-initiating cells. Nature. 2008;453:1072–1078. resistant Philadelphia chromosome-positive leukemias. N Engl J 25. Chen Y, Hu Y, Zhang H, Peng C, Li S. Loss of the Alox5 gene impairs Med. 2006;354:2531–2541. leukemia stem cells and prevents chronic myeloid leuke- mia. Nat 5. Cortes JE, Kantarjian H, Shah NP, et al. Ponatinib in refractory Genet. 2009;41:783–792. Philadelphia chromosome-positive leukemias. N Engl J Med. ´ 2012;367:2075–2088. 26. Cobo I, Martinelli P, Flandez M, et al. Transcriptional regulation 6. Kantarjian HM, Shah NP, Cortes JE, et al. Dasatinib or imatinib in by NR5A2 links differentiation and inflammation in the pan- creas. newly diagnosed chronic-phase chronic myeloid leukemia: 2- year Nature. 2018;554:533–537. follow-up from a randomized phase 3 trial (DASISION). Blood. 27. Darmanis S, Sloan SA, Croote D, et al. Single-cell RNA-Seq analysis 2012;119:1123–1129. of infiltrating neoplastic cells at the migrating front of human glioblastoma. Cell Rep. 2017;21:1399–1410. 7. Bower H, Bjo€rkholm M, Dickman PW, Ho€glund M, Lambert PC, Andersson TML. Life expectancy of patients with chronic mye- loid 28. Giustacchini A, Thongjuea S, Barkas N, et al. Single-cell tran- scriptomics uncovers distinct molecular signatures of stem cells in leukemia approaches the life expectancy of the general pop- ulation. chronic myeloid leukemia. Nat Med. 2017;23:692–702. J Clin Oncol. 2016;34:2851–2857. 29. Hovestadt V, Smith KS, Bihannic L, et al. Resolving medullo- 8. Graham SM, Jørgensen HG, Allan E, et al. Primitive, quiescent, Philadel- blastoma cellular architecture by single-cell genomics. Nature. phia-positive stem cells from patients with chronic myeloid leukemia are 2019;572:74–79. insensitive to STI571 in vitro. Blood. 2002;99:319–325. 30. Ma X, Liu Y, Liu Y, et al. Pan-cancer genome and transcrip- tome 9. Chomel JC, Turhan AG. Chronic myeloid leukemia stem cells in the analyses of 1,699 paediatric leukaemias and solid tumours. Nature. era of targeted therapies: resistance, persistence and long- term 2018;555:371–376. dormancy. Oncotarget. 2011;2:713–727. 31. Warfvinge R, Geironson L, Sommarin MNE, et al. Single-cell molec- 10. Etienne G, Guilhot J, Rea D, et al. Long-term follow-up of the French ular analysis defines therapy response and immunophenotype of stem Stop Imatinib (STIM1) Study in patients with chronic myeloid cell subpopulations in CML. Blood. 2017;129:2384–2394. leukemia. J Clin Oncol. 2017;35:298–305. 32. Viswanathan SR, Powers JT, Einhorn W, et al. Lin28 promotes 11. Chomel JC, Sorel N, Guilhot J, Guilhot F, Turhan AG. BCR- ABL transformation and is associated with advanced human malig- expression in leukemic progenitors and primitive stem cells of nancies. Nat Genet. 2009;41:843–848. patients with chronic myeloid leukemia. Blood. 2012;119:2964– 33. Ahmed M, Dusanter-Fourt I, Dugray A, et al. BCR-ABL fails to inhibit 2965. author reply 2965−2966. apoptosis in U937 myelomonocytic cells expressing a carboxyl-termi- 12. Ross DM, Branford S, Seymour JF, et al. Safety and efficacy of nal truncated STAT5. Leuk Lymphoma. 2001;42:445–455. imatinib cessation for CML patients with stable undetectable 34. Walz C, Ahmed W, Lazarides K, et al. Essential role for Stat5a/ b minimal residual disease: results from the TWISTER study. Blood. in myeloproliferative neoplasms induced by BCR-ABL1 and 2013;122:515–522. JAK2(V617F) in mice. Blood. 2012;119:3550–3560. 13. Culhane AC, Thioulouse J, Perriere G, Higgins DG. MADE4: an R ´ package for multivariate analysis of gene expression data. 35. Casetti L, Martin-Lanneree S, Najjar I, et al. Differential contri- Bioinformatics. 2005;21:2789–2790. butions of STAT5A and STAT5B to stress protection and tyro- sine kinase inhibitor resistance of chronic myeloid leukemia 14. Le^ S, Josse J, Husson F. FactoMineR: an R package for multi- stem/progenitor cells. Cancer Res. 2013;73:2052–2058. variate analysis. J Stat Softw. 2008;25(1). 36. Turhan AG. STAT5 as a CML target: STATinib therapies? Blood. 15. Wickham H. ggplot2: Elegant Graphics for Data Analysis. New 2011;117:3252–3253. York: Springer; 2009. 37. Valent P. Targeting the JAK2-STAT5 pathway in CML. Blood. 16. Tibshirani R, Hastie T, Narasimhan B, Chu G. Diagnosis of multiple 2014;124:1386–1388. cancer types by shrunken centroids of gene expression. Proc Natl 38. Warsch W, Walz C, Sexl V. JAK of all trades: JAK2-STAT5 as novel Acad Sci USA. 2002;99:6567–6572. therapeutic targets in BCR-ABL1+ chronic myeloid leuke- mia. 17. Trapnell C, Cacchiarelli D, Grimsby J, et al. The dynamics and Blood. 2013;122:2167–2175. regulators of cell fate decisions are revealed by pseudotem- poral ordering of single cells. Nat Biotechnol. 2014;32:381–386. 39. O’Hare T, Zabriskie MS, Eiring AM, Deininger MW. Pushing the limits of targeted therapy in chronic myeloid leukaemia. Nat Rev 18. Cramer-Morales K, Nieborowska-Skorska M, Scheibner K, et al. Cancer. 2012;12:513–526. Personalized synthetic lethality induced by targeting RAD52 in 40. Dolinska M, Piccini A, Wong WM, et al. Leukotriene signaling via leukemias identified by gene mutation and expression profile. Blood. ALOX5 and cysteinyl leukotriene receptor 1 is dispensable for in 2013;122:1293–1304. vitro growth of CD34+CD38− stem and progenitor cells in chronic 19. Perrotti D, Jamieson C, Goldman J, Skorski T. Chronic myeloid myeloid leukemia. Biochem Biophys Res Commun. 2017;490:378– leukemia: mechanisms of blastic transformation. J Clin Invest. 384. 2010;120:2254–2264. 41. Lucas CM, Harris RJ, Giannoudis A, McDonald E, Clark RE. Low 20. Corbin AS, Agarwal A, Loriaux M, Cortes J, Deininger MW, Druker leukotriene B4 receptor 1 leads to ALOX5 downregulation at BJ. Human chronic myeloid leukemia stem cells are insensitive to diagnosis of chronic myeloid leukemia. Haematologica. imatinib despite inhibition of BCR-ABL activity. J Clin Invest. 2014;99:1710–1715. 2011;121:396–409. 42. Gallipoli P, Cook A, Rhodes S, et al. JAK2/STAT5 inhibition by 21. Katagiri S, Tauchi T, Okabe S, et al. Combination of ponatinib with nilotinib with ruxolitinib contributes to the elimination of CML hedgehog antagonist vismodegib for therapy-resistant BCR-ABL1- CD34+ cells in vitro and in vivo. Blood. 2014;124:1492–1501. positive leukemia. Clin Cancer Res. 2013;19:1422–1432. 22.
ARTICLE IN PRESS
S. Pagliaro et al. / Experimental Hematology 2020;000:1−10 10.e1
Supplemental Figures
Supplementary Figure. 1. Cluster stratification of the states identified during pseudotime analysis performed on single cell experiments of CML CD34+ cells. Seven states were highlighted with different colors on pseudotime trajectory for each four cluster
Supplementary Figure. 2. Pseudotime heatmap highlighting the fact that ALOX5 trajectory is shared with that of a gene cluster comprising pluripotentcy genes except MYC.
10.e2 S. Pagliaro et al. / Experimental Hematology 2020;000:1−10
Supplementary Figure. 3. Pseudotime analysis focus branching point which discriminated ALOX5 and MYC clusters from major clus ter: branching 2 allowed to separate MYC and ALOX5 clusters from major cluster: regulated genes on this branching are represented by pseudotime heatmap with best significance of STAT5A (negative log10 of p-value on barplot)
Supplementary Figure. 4. Bioinformatics analysis of expression of OCT4 (POU5F1) and Nanog in purified hematopietic cell populations show- ing absence of overexpression of OCT4 in the “bulk” HSC (4A) whereas an overexpression of Nanog is detected in the HSC (4B). (Data from Cramer- Morales K et al. Blood. 2013: 122:1293-304)
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
PAPER 2 – Summary
EUKARYOTIC ELONGATION FACTOR 2 KINASE (EEF2K) IS A TRANSCRIPTIONAL TARGET OF BCR-ABL AND IS IMPLICATED IN THE SURVIVAL OF LEUKEMIC CELLS
In previous studies, we demonstrated a major upregulation of ETS1 mRNA expression in UT7-cells expressing BCR-ABL as compared to UT7 control cells. As EEF2K was identified as a transcriptional target of ETS1 gene in BCR-ABL expressing cells, we checked the EEF2K gene expression in peripheral blood (total blood) of CML patients at diagnosis (n = 59) as compared to health donors (n = 32). Our results showed a major increase in EEF2K expression in CML patients compared to controls, with a p- value < 2.2e-16.
To determine the type of cells in which EEF2K is overexpressed, we tested its expression in purified CD34+, CD34- and PBMC from 3 CML patients. Our analyses revealed higher expression of EEF2K in more differentiated, light density cells and CD34- cells, as compared to CD34+ cells, suggesting that EEF2K expression appears to be increased in cells committed to differentiation. This result was further confirmed using single-cell analysis of CD34+ cells isolated from the peripheral blood of patients with CML showing that the expression of EEF2K was significantly lower (p = 0.006978) in stem cell-like cells.
Western blot analyses in UT7 cells expressing BCR-ABL detected higher levels of EEF2K and its target EF2 protein expression compared to parental UT7. Considering that EEF2K expression can be directly regulated by the presence or scarcity of nutrients in cancer cells, we analyzed the impact of a nutrient deprivation on EEF2K expression in the context of BCR-ABL, To perform nutrient deprivation experiments, cells were cultured for 4 days in three different conditions: normal conditions (NC), no FBS condition (NF) and no glucose condition (NG) .
The results suggest that, as shown in other cell culture systems, EEF2K expression in normal culture conditions oscillates according to nutrients levels in order to stop
Page | 103
elongation, allowing to protect cells from excess of unnecessary intracellular proteins. However, in BCR-ABL expressing cells, the expression of EEF2K do not appear to be regulated according to nutrient levels, suggesting that the EEF2K gene is regulated differently in BCR-ABL-positive and negative cells.
To evaluate further the potential effects of EEF2K expression in the context of BCR- ABL expression, we have designed knockdown experiments using shRNA strategy. For this purpose, two different shRNA targeting EEF2K in the presence of a scramble control were used.
Under normal conditions, the proliferation rates of UT7 shEEF2K were significantly decreased as compared to the scramble controls whereas in the same conditions UT7 -11-shEEF2K cells have proliferated. Under nutrient deprivation – glucose and/or FBS- free conditions - both UT7 and UT7 p210 decreased their proliferation rates. However, in UT7-11-shEEFK2 cells a recover of the proliferation as compared to scramble controls suggesting that EEF2K invalidation in BCR-ABL positive cells allows normal proliferation despite nutrient deprivation EEF2K appears to have protect UT7-11 cells from the effect of nutrient deprivation (FBS and glucose) while same did not occur in UT7 cells in which it was noticed an opposite effect, namely, an escalation of decreasing indexes of proliferation in cultures without FBS. EEF2K inhibition in UT7 cells had no impact at proliferation rates under glucose deprivation, compared to scramble. In addition, EEF2K inhibition had no effect on imatinib response in vitro neither under normal nor nutrient deprivation conditions, compared to scramble.
For this purpose, we have performed a metabolomics assay using the Energy Phenotype test kit from SeaHorse technology UT7 and ECAR levels in UT7 cells were impacted by shEEF2K in UT7 cells as compared to scramble controls, with cells not responding to stress conditions. On the other hand, UT7-11 cells had increased ECAR levels with or without EEF2K invalidation, suggesting the absence of control exerted by the EEF2K pathway in BCR-ABL-transformed cells.
The transcriptome in basal UT7 cell line comparing EEF2K shRNA and its scramble shRNA allowed to identify 402 differential expressed genes, revealing a positive induction of granulocyte migration and regulated secreted pathway. These results
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
showed that EEF2K play an important repressive role in invasive process regulated by myeloid cell at basal level.
In context of UT7-11 cell line, EEF2K shRNA induced a less differential expressed genes: only 136 genes were found regulated with 76 up regulated genes and 60 down regulated genes. This analysis also revealed an increase of positive regulation in intrinsic apoptosis A positive regulation of E2Fs targets genes was also found significant in p210 BCR-ABL UT7 cell lines under action of EEF2K shRNA. Repressed signatures by EEF2K shRNA in basal and p210 BCR-ABL conditions were found similar quantitatively with respectively 64 and 60 down regulated genes that allowed us to identify significant repression of cell cycle under action of EEF2K shRNA in basal condition. A significant repression of oxidative phosphorylation was found in basal condition under EEF2K shRNA. These results showed that in UT7 basal condition EEF2K play a role in the promotion of cell cycle and oxidative phosphorylation metabolism.
Page | 105
L’ARTICLE 2 – Résumé
LA KINASE DU FACTEUR D'ÉLONGATION EUCARYOTE 2 (EEF2K) EST UNE CIBLE TRANSCRIPTIONNELLE DE BCR-ABL ET EST IMPLIQUÉE DANS LA SURVIE DES CELLULES LEUCÉMIQUES
Dans des études précédentes, nous avons démontré une augmentation importante de l'expression de l'ARNm ETS1 dans les cellules UT7 exprimant la BCR-ABL par rapport aux cellules témoins UT7. Comme EEF2K a été identifié comme une cible transcriptionnelle du gène ETS1 dans les cellules exprimant BCR-ABL, nous avons vérifié l'expression du gène EEF2K dans le sang périphérique (sang total) des patients atteints de LMC au moment du diagnostic (n = 59) par rapport aux donneurs de santé (n = 32). Nos résultats ont montré une augmentation majeure de l'expression du gène EEF2K chez les patients atteints de LMC par rapport aux témoins, avec une valeur p < 2,2e-16.
Pour déterminer le type de cellules dans lesquelles EEF2K est surexprimé, nous avons testé son expression dans les cellules CD34+, CD34- et PBMC purifiées de 3 patients atteints de LMC. Nos analyses ont révélé une expression plus élevée d'EEF2K dans des cellules plus différenciées, de densité lumineuse et des cellules CD34-, par rapport aux cellules CD34+, ce qui suggère que l'expression d'EEF2K semble être accrue dans les cellules engagées dans la différenciation. Ce résultat a été confirmé par l'analyse d'une seule cellule de cellules CD34+ isolées du sang périphérique de patients atteints de LMC, montrant que l'expression de EEF2K était significativement plus faible (p = 0,006978) dans les cellules apparentées aux cellules souches.
Les analyses par Western blot dans les cellules UT7 exprimant le BCR-ABL ont permis de détecter des niveaux plus élevés d'EEF2K et de l'expression de la protéine EF2 qui lui sert de cible, par rapport à l'UT7 parentale. Considérant que l'expression d'EEF2K peut être directement régulée par la présence ou la rareté des nutriments dans les cellules cancéreuses, nous avons analysé l'impact d'une privation de nutriments sur l'expression d'EEF2K dans le contexte de BCR-ABL. Pour réaliser des expériences de
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
privation de nutriments, les cellules ont été cultivées pendant 4 jours dans trois conditions différentes : conditions normales (NC), pas de condition FBS (NF) et pas de condition glucose (NG) .
Les résultats suggèrent que, comme le montrent d'autres systèmes de culture cellulaire, l'expression de EEF2K dans des conditions de culture normales oscille en fonction des niveaux de nutriments afin de stopper l'élongation, ce qui permet de protéger les cellules contre l'excès de protéines intracellulaires inutiles. Cependant, dans les cellules exprimant le gène BCR-ABL, l'expression de EEF2K ne semble pas être régulée en fonction des niveaux de nutriments, ce qui suggère que le gène EEF2K est régulé différemment dans les cellules BCR-ABL positives et négatives.
Pour évaluer plus avant les effets potentiels de l'expression de EEF2K dans le contexte de l'expression de BCR-ABL, nous avons conçu des expériences de knockdown en utilisant la stratégie de l'ARNsh. À cette fin, deux ARNsh différents ciblant EEF2K en présence d'un contrôle de brouillage ont été utilisés.
Dans des conditions normales, les taux de prolifération des cellules UT7 shEEF2K ont été significativement réduits par rapport aux contrôles de brouillage alors que dans les mêmes conditions, les cellules UT7 -11-shEEF2K ont proliféré. Dans des conditions de privation de nutriments - sans glucose et/ou FBS - les taux de prolifération des cellules UT7 et UT7 p210 ont tous deux diminué. Cependant, dans les cellules UT7- 11-shEEFK2, une reprise de la prolifération par rapport aux témoins de brouillage suggère que l'invalidation EEF2K dans les cellules positives BCR-ABL permet une prolifération normale malgré la privation de nutriments. EEF2K semble avoir protégé les cellules UT7-11 de l'effet de la privation de nutriments (FBS et glucose) alors que cela ne s'est pas produit dans les cellules UT7 dans lesquelles on a remarqué un effet inverse, à savoir une augmentation des indices décroissants de prolifération dans les cultures sans FBS. L'inhibition de l'EEF2K dans les cellules UT7 n'a pas eu d'impact sur les taux de prolifération en cas de privation de glucose, par rapport au brouillage. En outre, l'inhibition d'EEF2K n'a eu aucun effet sur la réponse de l'imatinib in vitro, ni dans des conditions normales ni dans des conditions de privation de nutriments, par rapport à la culture brouillée.
Page | 107
À cette fin, nous avons effectué un test de métabolomique en utilisant le kit de test Energy Phenotype de la technologie SeaHorse UT7 et les niveaux ECAR dans les cellules UT7 ont été influencés par shEEF2K dans les cellules UT7 par rapport aux témoins scrables, les cellules ne répondant pas aux conditions de stress. D'autre part, les cellules UT7-11 ont augmenté les niveaux d'ECAR avec ou sans invalidation par EEF2K, ce qui suggère l'absence de contrôle exercé par la voie EEF2K dans les cellules transformées par BCR-ABL.
Le transcriptome de la lignée cellulaire UT7 basale comparant l'ARNsh EEF2K et son ARNsh brouillé a permis d'identifier 402 gènes différentiels exprimés, révélant une induction positive de la migration des granulocytes et une voie sécrétée régulée. Ces résultats ont montré que EEF2K joue un rôle répressif important dans le processus invasif régulé par la cellule myéloïde au niveau basal.
Dans le contexte de la lignée cellulaire UT7-11, l'ARNsh EEF2K a induit des gènes exprimés de manière moins différentielle : seuls 136 gènes ont été trouvés régulés, avec 76 gènes régulés vers le haut et 60 gènes régulés vers le bas. Cette analyse a également révélé une augmentation de la régulation positive dans l'apoptose intrinsèque. Une régulation positive des gènes cibles E2Fs a également été trouvée significative dans les lignées cellulaires UT7 p210 BCR-ABL sous l'action de l'ARNm EEF2K. Des signatures réprimées par l'ARNsh EEF2K dans des conditions basales et p210 BCR-ABL ont été trouvées de manière quantitativement similaire avec respectivement 64 et 60 gènes régulés à la baisse.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
IN PREPARATION
EUKARYOTIC ELONGATION FACTOR 2 KINASE (eEF2K) IS A TRANSCRIPTIONAL TARGET OF BCR-ABL AND IS IMPLICATED IN THE SURVIVAL OF LEUKEMIC CELLS
1,5,6 1,2,4 S. Pagliaro , L de Souza, C. Desterke, J.C. Chomel, P Hugues , F. Griscelli
1,2 1,2 A. Foudi, A. Bennaceur-Griscelli A.G. Turhan
1INSERM UMR-S 935, Université Paris Sud, 94800 Villejuif, France and ESTeam Paris Sud, Université Paris Sud, 94800 Villejuif, France.
2INGESTEM National iPSC Infrastructure, 94800 Villejuif, France
3ATIP-Avenir INSERM UMR-S 935, Université Paris Sud, 94800 Villejuif
4Université Paris Descartes, Faculté Sorbonne Paris Cité, Faculté des Sciences Pharmaceutiques et Biologiques, Paris, France
5 Université Paris-Sud, Faculté de Pharmacie, 92296 Châtenay-Malabry
6 Science without Borders, CAPES, Brasilia, Brazil
Page | 109
ABSTRACT
The oncoprotein BCR-ABL is the constitutively active tyrosine kinase produced by the chimeric BCR-ABL gene in chronic myeloid leukemia (CML). The transcriptional targets of BCR-ABL in leukemic cells have not been extensively studied. In transcriptome experiments using the hematopoietic UT7 cell line expressing BCR-ABL, we have identified ETS1 as a major upregulated gene. We report here that ETS1 controls the expression of eukaryotic elongation factor kinase 2 (eEF2K) which plays a major role in the survival of cells upon nutrient deprivation. eEEF2K expression was increased in the BCR-ABL expressing UT7-11 cells as compared to parental cells, with evidence of increased phosphorylation of the eEF2. Using q-RT-PCR assays we have evaluated the expression of eEF2 kinase in primary CML samples and this expression was found to be highly increased in CML samples (n = 59) as compared to controls (n=32). To determine the potential effects of eEF2K overexpression in the context of BCR-ABL expression, we inhibited eEF2K by shRNA strategy in UT7-11 cells as compared to parental cells and tested the growth and Imatinib sensitivity in the context of nutrient deprivation. In UT7-BCR-ABL cell with eEF2K inhibition, there was a significantly higher growth rate in glucose-deprivation and serum-deprivation conditions suggesting that, as opposed to data reported in solid tumors, eEF2K overexpression renders leukemic cells sensitive to nutrient-deprivation conditions. To determine the potential oncogenic role of eEF2K in BCR-ABL-expressing cells, a transcriptome analysis has been performed in UT7-11 cells expressing lower levels of eEF2K as compared to sh- scramble controls. These studies clearly indicate the positive correlation between inactivation of eEF2K and oxidative phosphorylation and genes involved in ROS as well as genes involved in peroxisome and IFN-gamma pathways. Overall, our data suggest that overexpression of eEF2K in CML is associated with an increased sensitivity to nutrient-deprivation.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Introduction
Protein synthesis is the cellular process that consumes the most of energy, demanding about 30-35% of ATPs or equivalents(Buttgereit and Brand, 1995). Since proteins play crucial roles and are essential for cellular homeostasis maintenance, the regulation of its synthesis is of fundamental importance for cell survival. One of the forms of regulation is through eukaryotic elongation factor 2 kinase (eEF2K), a kinase that, when active, phosphorylates and inhibits the action of elongation factor 2 (eEF2), blocking the elongation phase of translation(Ryazanov et al., 1988). EEF2 plays an essential role in the translocation of ribosomes carrying amino acids to the peptide- chain formation(Browne and Proud, 2002; Dever and Green, 2012; Kaul et al., 2011; Mauro and Matsuda, 2016). In normal cells, this mechanism is regulated, among other factors, by stress conditions, such as nutrient shortages (Browne et al., 2004; Browne and Proud, 2004; Pavur et al., 2000). Tumor cells are highly proliferative and grow rapidly and anarchically. Along with this rapid and abnormal cell growth, there is an increased energy/nutrient demand in tumor microenvironment. These factors led the scientific community to investigate the role of EEF2K in tumor cells. EEF2K is now known to be overexpressed in a wide range of tumors, such as breast (Bayraktar et al., 2018, p. 2; Guan et al., 2018, p. 2; Kabil et al., 2018, p. 2; Pan et al., 2018, p. 2), ovarian (Shi et al., 2018), colorectal (Ng et al., 2019). However, nothing is known about the impact of EEF2K on chronic myeloid leukemia.
The oncoprotein BCR-ABL is the constitutively active tyrosine kinase produced by the BCR-ABL fusion-gene in chronic myeloid leukemia (CML). In a previous study, we transfected the BCR-ABL gene into UT7 cells (Issaad et al., 2000) - an acute megakaryoblastic leukemia cell line - and performed a complete transcriptome analysis comparing the parental and transfected cells. The results have shown that BCR-ABL activates ETS1, a major transcriptional regulator in hematopoietic cells (Desterke et al., 2018).One of the targets of ETS1 is the EEF2Kinase, a unique kinase controlling the protein elongation. We report here that eEF2K expression is deregulated in CML via ETS1 induction and eEF2K could play a role in the metabolism of leukemic cells, in particular in the pathway of oxidative stress. In this study we demonstrate that ETS1 is a promoter of another EEF2K, also overexpressed in BCR-ABL positive cells. In this
Page | 111
study, our findings demonstrate that eEF2K inhibition affects differently, almost oppositely, UT7 expressing BCR-ABL comparing to UT7 parental.
Materials and Methods
Cell Lines
UT7 is a GM-CSF-dependent cell line (generously provided by Dr Komatsu(Komatsu et al., 1991)) from which we have generated UT7 cells expressing BCR-ABL (UT7-11) as previously described (Issaad et al., 2000). Parental UT7 cells were grown in RPMI 1640 medium (Thermo Fisher) containing 10% FBS (Gibco) and 10 ng/ml of rhGM- CSF whereas UT7-11 cells were growth-factor-independent. Cells were split three times per week at the concentration of 105 cells/ml.
Nutrient Deprivation Assay
UT7 and UT7 p210 cells were cultured at initial concentration as 100,000 cells/ml in glucose-less (RPMI 1640 without glucose, 10% FBS, 1% PenStrep,Glutamax), FBS- less (RPMI 1640, 1% PenStrep, 1% Glutamax) or normal conditions. GM-CSF cytokine was added in UT7 cells medium at 10 ng/ml concentration. Cells were collected at day 0, 2 and 4 for counting, RNA extraction and RT-qPCR analysis.
Lentiviral vectors and infection
The shRNA constructs targeting human EEF2K-1 (shRNA TRCN0000234847) and EEF2K-2 (shRNA TRCN0000234845) were obtained from the Integrated DNA Technologies (IDT). The constructs were in the pLKO.GFP-puro lentiviral vector. As controls, the lentiviral vectors pLKO-GFP-puro scrambles (the empty vector with a 1.2 kb stuffer element) were used .The sequences of the shRNAs used in this study are… Human kidney 293T cells plated onto 15 cm dishes with 24μg of EEF2K backbone, 1.2μg of tat, 1,2μg of rev, 1.2μg gag/pol and 2.4 μg vsv-g plasmid and 90μl of TransIT®-293 (Mirus). Supernatants were collected at 36 to 48 h after transfection. Concentrated vector preparations were made by ultracentrifugation, filtered (0.45 μm),
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
divided into aliquots and stored. Virus titration was performed using NIH 3T3 cells. UT7 and UT7 p210 cells were mixed with viral supernatant (MOI = 2) in the presence of 8 μg/ml polybrene in a 24-well plate at a density of 300,000 cells per well. The cells were left in viral supernatant overnight. The medium was replaced the morning after infection. Selection of infected cells was started 24 hours after infection with 2 μg/ml puromycin. The transduction efficiency was assessed by measuring the percentage of GFP+ cells by flow cytometry 48 hours post infection. Typically, the transduction efficiency was >80%.
Western Blots.
Cells were harvested at indicated time points, washed twice in PBS, resuspended in RIPA lysis buffer (NuPAGE, Thermo Scientific) supplemented with 1x Complete Mini EDTA-Free (Roche), 50 mM NaF and 10mM Na3VO4, vortexed and incubated for 30 min on ice, vortexing samples each 10 min. After centrifugation at 14,000 rpm for 10 min at 4°C to remove cellular debris, the remaining supernatant was transferred to a new tube. Protein dosage was performed using Bradford (Sigma Aldrich) method. Equal amounts of proteins were supplemented with 1x NuPAGE LDS sample buffer, 1% NuPAGE Sample Reducing Agent (Thermo Fisher Scientific) and incubated for 5 min at 100°C. Proteins were separated by SDS gel electrophoresis using the XCell™ Module system, NOVEX™ WedgeWell™ 4-20% or 10 % Tris-Glycine gel and Tris- Glycine Running Buffer (Thermo Scientific). Subsequently, proteins were transferred onto a NOVEX® PVDF 0.45µM pore size membrane (Thermo Scientific) using NOVEX® Transfer Buffer (Thermo Scientific). Membranes were blocked with 5% Bovine Serum Albumin (Sigma Aldrich) TBS buffer (Thermo Scientific), 0.1% Tween® 20 (Sigma Aldrich) for 1h and probed with mouse monoclonal antibody anti-EEF2 (#131202, Abcam) at a 1:500 dilution, rabbit monoclonal antibody anti-EEF2K antibody (#45168, Abcam) at a 1:500 dilution, rabbit polyclonal antibody anti-EEF2 [phospho T56] antibody (#53114, Abcam) at a 1:500 dilution, mouse monoclonal anti-c-ABL antibody (#OP20, Millipore), rabbit polyclonal anti-p–ABL (#7-788, Millipore), mouse monoclonal anti-β-Actin−Peroxidase antibody (#3854, Sigma) at a 1:10000 dilution in 5% BSA- TBST for 1 h at room temperature or overnight at 4°C. Membranes were washed four times with TBST, incubated with anti-mouse IgG (#0168, Sigma) or anti-
Page | 113
rabbit IgG (#0545, Sigma) to 1:10000 dilution in 5% BSA-TBST for 1h at room temperature, washed three times with TBST, and revealed with SuperSignal® West Dura (Thermo Scientific).
RT-qPCR
Isolation of RNA was performed using the PureLink RNA Purification (Thermo Fisher Scientific). RNA was quantified by a NanoDrop spectrophotometer (Thermo Scientific). Reverse transcription was carried out using the Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific). Quantitative Real-time PCR was performed using Strategene MxPro 3005P system (Agilent Tecnhologies) and SYBR Green PCR Master Mix (Applied Biosystems). Quantification was performed using the ΔΔCt method. Normalization was performed using β-2-Microglobulin mRNA as a housekeeper. The primers used for quantitative RT-PCR were obtained by IDT. (EEF2K1: TCCCTTGGACCACCCATAAAT, EEF2K2: CATGGCCACTCATACAGTAAT)
Transcriptome analysis
Total RNA from UT7 cells with or without transfection of p210 BCR-ABL and in presence of shRNAs targeting EEF2K or scramble control was used to perform transcriptome experiment on ClariomS Human Chip (ThermoFisher Scientific). Microarray experiments were processed with WT plus chemistry (ThermoFisher Scientific) dedicated to cell line treatment starting with 50 to 500 ng range of total RNA. CEL raw files were normalized with robust microarray analysis (RMA) method (Irizarry et al., 2003) with Transcriptome Analysis Console (TAC) version 4.0 software (ThermoFisher Scientific). Supervised analyses between each specific shRNA and their respective scramble control were performed with Significance Analysis for Microarray (SAM) algorithm with fold change threshold over 2 and false discovery rate (FDR) threshold less than 0.05 (Tusher et al., 2001). Bioinformatics analysis were performed in R software environment version 3.4.3. Expression heatmap were drawn made4 R Bioconductor package (Culhane et al., 2005, p. 4) and functional enrichment analysis was performed with Gene set enrichment analysis standalone software (GSEA) (Subramanian et al., 2005) with MSigDb version 6.2 (Liberzon et al., 2015).
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Sea Horse Assays
Real-time oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of live cells were measured using a 8-well plate by SeaHorse® XF Technology. Sensor Cartridge (SeaHorse Bioscience) were previously hydrated with XF Calibrant reagent (SeaHorse Bioscience) overnight at 37°C, non-CO2 conditions. UT7 and UT7 p210 – scrambles and shEEF2Ks – were seeded at 2x105 cells/well in XF Base Medium (SeaHorse Bioscience) added with 10mM Glucose solution (Sigma), 1mM Pyruvate solution (Sigma) and 2mM Glutamine solution (Sigma), plates were centrifugated to allow cells to seed at the bottom and let incubated at 37°C, non-CO2 conditions for 30- 60 min to equilibrate the temperature before the final assay. A stressor mix solution - olygomycin (1µM) and FCCP (0.5µM) – was added to the plate and the assay was followed according to the fabricant protocol. Cells were counted from each well after running to normalize the data set. Results were analyzed using the SeaHorse XF Cell Energy Phenotype Test Generator software, provided by the fabricant. Data are expressed as mean±S.E.M.
RESULTS
High Levels of eEF2K expression in UT7 cells expressing BCR-ABL.
As eEF2K was identified as a transcriptional target of ETS1 gene in BCR-ABL expressing cells (Supplementary Figure 1), we analyzed its expression in these two cell contexts. As can be seen in Figure 1 there was a major increase of ETS1 RNA expression in UT7-cells expressing BCR-ABL as compared to control cells (Figure 1). We then projected to determine if eEF2K overexpression was a feature that we could identify in primary CML cells.
Page | 115
Figure 1: Overexpression of EEF2K in transcriptome of UT7 cell transfected with BCR- ABL: Boxplot of EEF2K expression found to be significantly overexpressed (fold change =1.92) in UT7-11 (BCR-ABL positive) as compared to the UT7 cell control non- transduced (2 sided ttest p-value=0.00113).
EEF2K is overexpressed in CML patients
To assess the true relevance of the eEF2K gene in CML, we evaluated its expression by Q-RT-PCR in peripheral blood (total blood) of CML patients at diagnosis (n = 59) as compared to healthy donors (n = 32). As can be seen in Figure 2, Our results showed a major increase in eEF2K expression in CML patients compared to controls, with a p- value < 2.2e-16(Figure 2).
To determine the type of cells in which eEF2K is overexpressed, we tested its expression in purified CD34+ cells as compared to light-density cells separated by Ficoll. Using samples from 3 patients, we analyzed the expression in the light density cells as well as the CD34+ and CD34- fractions. These analyses revealed higher expression of eEF2K in more differentiated, light density cells and CD34- cells, as compared to CD34+ cells, suggesting that eEF2K expression appears to be increased in cells committed to differentiation (Figure 3A). This result was further confirmed in another study (Pagliaro et al., 2020) using single-cell analysis of CD34+ cells isolated
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
from the peripheral blood of patients with CML (Figure 3b). In this previous study, we performed a single cell transcriptomic profile using CD34+ cells from 3 CML patients, where a subpopulation expressing multiple pluripotent genes (stem cell-like cells). And which the expression of eEF2K was significantly lower (p = 0.006978) Thus, these results suggested that the expression of eEF2K was increased in differentiated myeloid components.
Figure 2: Over expression of EEF2K in peripheral blood of CML patients as compared to healthy donors: boxplot of EEF2K mRNA quantified by QRT-PCR at diagnostic time in peripheral blood of CML patients as compared to healthy donors. Total RNA was extract from peripheral blood mononuclear cells.
Page | 117
Figure 3. EEF2K is increased in CD34- cells: PBMC, CD34+ and CD34- cells from 3 CP-CML patients were isolated from whole blood using Ficoll (PBMC) followed from magnetic column separation (CD34+ and CD34-). 3a: RT-qPCR analysis show that mRNA eEF2K expression were 2.3x higher in CD34- cells than in CD34+ cells. Calculations were performed using ΔΔCt formula normalized by B2M mRNA expression. 3b: Violin plot from single-cell (C1) analysis of 3 CP-CML CD34+ cells show that eEEF2K expression is predominant in the non-stem cell-like population.
Evaluation of the expression of eEF2K protein and its target eEF2.
To determine the possibility of a direct link between BCR-ABL expression and that of eEFK, at the protein level, we have performed Western blot analyses in UT7 cells expressing BCR-ABL. We have asked whether the target of eEF2K underwent a phosphorylation in this context.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
As can be seen in Figure 4, BCR-ABL expressing UT7 cells (UT7-p210) had higher levels of eEF2K as compared to parental controls and in these cells, the levels of phosphorylated eEF2 which is the only target of eEF2K, were found to be increased (Figure 4)
Figure 4. eEF2K and p-eEF2K proteins levels are overexpressed in UT7-p210 cells. Western Blot comparing UT7 and UT7-p210 (BCR-ABL positive) cells shows that
Page | 119
eEF2K and p-eEF2K protein levels are overexpressed in UT7 BCR-ABL positive cells compared to UT7.
Evaluation of eEF2K mRNA levels in response to nutrient deprivation conditions
The expression of eEF2K can be directly regulated by the presence or scarcity of nutrients in cancer cells and cell lines. To analyze the impact of a nutrient deprivation on eEF2K expression in the context of BCR-ABL, we have used UT7 and UT7-p210 cell lines. To perform nutrient deprivation experiments, cells were cultured in three conditions including in the regular medium (complete RPMI, 10% FBS, 10% PenStrep) or in RPMI medium without glucose or without serum for 4 days. Cells from each group were collected on days 0, 2 and 4 counted and analyzed for eEF2K expression by RT- qPCR.
As can be seen in Figure 6a, both UT7 and UT7-p210 had their cell proliferation rates reduced when cultured without glucose or without serum (n = 3 experiments). In UT7 cells, there was an increase of eEF2K expression throughout the culture time under normal conditions, while this oscillation was significantly lower when cultured in the absence of glucose and serum. Interestingly, in UT7 p210 cells, none of the conditions (normal or nutrient deprivation) had an impact on eEF2K levels. (Figure 6b).
These results suggest that, as shown in other studies (reviewed in Wang et al., 2017), eEF2K expression in normal culture conditions oscillates in response to nutrient deprivation in order to regulate elongation, saving cells from high energy consumption by blocking protein synthesis. However, in BCR-ABL positive cells, the expression of eEF2K does not appear to be regulated according to nutrient levels, suggesting that the gene may be regulated differently in BCR-ABL-positive compare to negative cells.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Figure 5. Nutrient Deprivation assay scheme. UT7 and UT7-210 cells were cultured under normal conditions and nutrient deprivation conditions. Normal conditions (control): complete RPMI 1640, 10% FBS, 10% PenStrep. Glucose deprivation: RPMI 1640 without glucose, 10% FBS, 10% PenStrep. Serum deprivation: complete RPMI 1640, 10% PenStrep, no serum (FBS) added. Cells were seeded at 105cells/ml and collected at day 0, 2 and 4 for cell counting, RNA extraction and RT-qPCR.
Page | 121
Figure 6. EEF2K expression appears to not be regulated by nutrient deprivation in cells expressing BCR-ABL. In 6a, cells analyzed from nutrient deprivation assay (see Fig 5) show a cell growth decrease in the nutrient deprivation group for both cell lines (UT7 and UT7-p210). Glucose deprivation starts to show a significant decrease at day 4, while serum deprivation is impacting cell growth from day 2, comparing to the control group cultured under normal conditions. In 6b, EEF2K expression (RT-qPCR) oscillated according to nutrient deprivation in UT7 cells, but not in UT7-210, where the expression remained constant.
Evaluation of the inhibition of eEF2K expression in UT7 and UT7-BCR-ABL cells.
To further evaluate the potential effects of eEF2K expression in the context of BCR- ABL expression, we designed two different shRNA targeting eEF2K in the presence of a scramble control. After subcloning into the pLKO-GFP vector, defective lentivirus supernatants were produced, tittered and used to infect UT7 and UT7-p210 cells. The
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
efficiency of transduction was evaluated by analyzing GFP expression in both cell lines (Supplementary Figure 3).
The efficiency of the inhibition of eEF2K expression was also evaluated using Western blot analyses. As can be seen in Figure 7A, in two different clones with different shRNA targets, eEF2K expression was reduced (Figure 7a) as compared to scramble controls. The inhibition was confirmed by RT-qPCR (Figure 7b)
We then tested the proliferation rates of these cells in conditions of nutrient deprivation as well as their response to TKI (Imatinib) in vitro.
Page | 123
Figure 7. EEF2K knock down validation. UT7 and UT7 p210 were transduced with shEEF2K and scramble. EEF2K gene expression decrease were confirmed by western blot (7a) and rt-qPCR (7b).
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Proliferation rates under normal conditions were altered in UT7 shEEF2K, but not in UT7 BCR-ABL shEEF2K cells
Under normal conditions (Figure 8a), the proliferation rates of UT7 shEEF2K were significantly decreased (p < 0.002) as compared to the scramble controls whereas in the same conditions UT7-p210-shEEF2K cells proliferated (Figure 8A).
Under nutrient deprivation – glucose (Figure 8B) and/or FBS-free conditions - both UT7 and UT7 p210 decreased their proliferation rates. However, in UT7-p210-sh-eEFK cells we have observed a significant proliferation as compared to the scramble controls suggesting that eEF2K invalidation in BCR-ABL expressing cells allows normal proliferation despite nutrient deprivation. It appeared that eEF2K had protect UT7-p210 cells from the effect of nutrient deprivation (FBS and glucose), as it was observed a recovery of cellular proliferation compared to scramble under the same conditions. An opposite effect was noticed in UT7 cells, which presented an escalation of decreasing indexes of proliferation in cultures without FBS and no effect under Glucose deprivation compared to scramble.
EEF2K inhibition had no effect on imatinib response in vitro neither under normal nor nutrient deprivation conditions, compared to scramble (Supplementary Figure 4).
We next wished to evaluate the metabolic behavior of the UT7 and UT7-p210 cells in cells in which eEF2K expression was reduced by shRNA strategy.
Page | 125
Figure 8. EEF2K knockdown seems to protect cells under nutrient deprivation in UT7- 210 cells but not in UT7. UT7 and UT-p210 transduced with scramble and shEEF2K (1 and 2) were submitted to the same experimental scheme from figure 5. Using the scramble as the internal control and Normal Conditions (8a) as an experimental control, the results show that EEF2K knockdown has protected UT7-p210 cells from nutrient deprivation compared to scramble. UT7-p210 shEEF2K cells managed to recover their growth under nutrient deprivation (glucose and serum; 8b), while UT7 shEEF2K haven’t change under glucose deprivation and increased their growth loss under serum deprivation.
Evaluation of glucose and oxygen consumption in UT7 and UT7-11 after eEF2K invalidation.
For this purpose, we have performed a metabolomics assay using the Energy Phenotype test kit from SeaHorse technology. UT7 and UT7 11cells, before and after invalidation of eeF2K expression, and in the presence of scramble controls were analyzed. The Extracellular Acidification Rate (ECAR) and the Oxygen Consumption Rate (OCR) were measured in basal and stressed conditions. Oligomycin and FCCP
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
(Carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone) were used as metabolic stressors. The first blocks oxidative phosphorylation, stimulating anaerobic metabolism, thus increasing glycolysis levels; the second triggers oxidative phosphorylation, boosting oxygen consumption.
As can be seen in Figure 9, ECAR levels in UT7 cells were impacted by shEEF2K in UT7 cells as compared to scramble controls, with cells not responding to stress conditions. On the other hand, UT7-p210 cells had increased ECAR levels with or without eEF2K invalidation, suggesting the absence of control exerted by the eEF2K pathway in BCR-ABL-transformed cells. On the other hand, oxygen consumption rates were not found to be influenced consistently in UT7 p210 cells despite the fact it was found to be reduced in one UT7 -p210-shEEF2K cells (Figure 9B).
Page | 127
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Figure 9. Energy Phenotype (SeaHorse). UT7 and UT7 p210 cells – scramble vs shEEF2ks – Extracellular Acidification Rate (ECAR) and Oxygen Consumption Rate (OCR) were analyzed in basal and stress conditions. Oligomycin and FCCP were used as stressors ECAR levels were impacted by shEEF2K in UT7 cells, compared to scramble, but was not modified in UT7 p210 cells. Oxygen consumption rate (OCR) was reduced in one clone of UT7 p210 shEEF2K and didn’t change in UT7 cells.
Identification of the gene expression profile of UT7-11 cells with low levels of eEF2K
The previous results showed that EEF2K knockdown had different impacts on UT7 cells compared to UT7-p210. In order to understand better, we performed a transcriptome, using the Clariom S technique (ThermoFisher) comparing the UT7 and UT7-p210 cells transduced with shEEF2K and their respective scrambles. Supervised analysis performed in basal UT7 cell line comparing EEF2K shRNA (double shRNA in duplicates) and its scramble shRNA allowed to identified 402 differential expressed genes with a majority of up regulated genes (338 up regulated genes and 64 down regulated genes, supplementaryfigures5A(all) and 6A(only down regulated)). Gene set enrichment analysis of UT7 shEEF2K performed with Gene Ontology biological process database revealed a positive induction of granulocyte migration (normalized enrichment score (NES) = +2.61, p-value <0.001) with induction of chemokines molecules such CCL3, CCL4L2, CCL2, CCL3L3 (supplementary figure 6B), also a positive induction of regulated secreted pathway (NES = +2.32, p-value <0.001, supplementary figure 6B), and induction of vasculature development (NES = +2.54, p- value<0.001, supplementary figure 6B) especially by secreted molecules such as angiopoietin 2, FGF2, HGF, PDGFD, IL1B, C3, THBS1 (thrombospondin 1) and UTS2 (urotensin). These results showed that EEF2K play an important repressive role in invasive process regulated by myeloid cell at basal level. In context of UT7-p210 cell line, EEF2K shRNA induced a less differential expressed genes: only 136 genes were found regulated with 76 up regulated genes and 60 down regulated genes (supplementary figures 5B (all) and 7A (down regulated)). This analysis also revealed
Page | 129
an increase of positive regulation in intrinsic apoptosis signaling (NES = +2.13, P- value<0.001, supplementary figure 7B) especially with up regulation of clusterin alias SP-40. An positive regulation of E2Fs targets genes was also found significant in p210 BCR-ABL UT7 cell lines under action of EEF2K shRNA (NES=+1.69, p-value<0.001, supplementary figure 7B), among these target genes some polymerases like POL2D, POLE, some transcription factors like E2F8, ETS1 and MYC, EZH2 epigenetic regulator but also BRCA2 repair gene were found concerned.
Repressed signatures by EEF2K shRNA in basal and p210 BCR-ABL conditions were found similar quantitatively with respectively 64 and 60 down regulated genes. Venn diagram showed that these two repressed signatures are specific with poor overlap (supplementary figure 5C). Unsupervised classification allowed to confirm specific repression of genes in basal condition under EEF2K shRNA action (supplementary figure 6A). In this context, Gene set enrichment analysis allowed to identified a significant repression of cell cycle (NES < -2.17, p-value < 0.001, supplementary figure 6C) under action of EEF2K shRNA in basal condition especially with centromeric molecules CENPA and CENPF, with CDC25A cell division molecule, with CCND1 and CCNB2 cyclins and divers E2F transcription factors. A significant repression of oxidative phosphorylation was found in basal condition under EEF2K shRNA (figure 2B, NES < -2.17, p-value < 0.001, supplementary figure 6C) with divers mitochondrial metabolic actors associated to a significant down regulation of reactive oxygen species (ROS) pathway (NES < -2.87, p-value < 0.001, supplementary figure 6C) especially with peroxiredoxin molecule family comprising PRDX2 and PRDX1, catalase, SOD2 superoxide dismutase 2 and NQO1 NADPH dehydrogenase quinone 1. These results showed that in UT7 basal condition EEF2K play a role in the promotion of cell cycle and oxidative phosphorylation metabolism.
A down regulation of peroxisome was also found significant in p210 BCR-ABL context (NES = -1.39, p-value < 0.001, supplementary figure 7C); interferon gamma mediated pathway was also found repressed in this context (NES = -2.16, p-value < 0.001, supplementary figure 7C) with repression of HLA class I molecules such as HLA-E, HLA-A, HLA-C and interferon regulatory factors IRF1 and IRF2, SP100 nuclear antigen, JAK2 signaling molecule.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Discussion
Eukaryotic elongation factor 2 kinase (eEF2 kinase) is a major protein controlling the adaptation of tumor cells to nutrient deprivation conditions (NDC) (Browne and Proud, 2002). The activation of this kinase leads to the phosphorylation of its only target eEF2, which is the rate limiting enzyme of translation elongation (Johanns et al., 2017). In eukaryotic cells, this mechanism allows avoiding of the accumulation of excessive protein production which could lead to cell death (Browne and Proud, 2002).
Therefore, the activation of eEF2K in NDC is a mechanism of cytoprotection in normal cells. On the other hand, eEF2K pathway activation has been shown to be a mechanism of adaptation to hostile microenvironment conditions in cancer cells (Leprivier et al., 2013a). Indeed, cancer cells undergo apoptosis in acute nutrient deprivation conditions and the inactivation of eEF2K allows to restore resistance to cell death.
The role of eEF2K has also been studied in colon cancer cells and its inactivation has been shown to induce autophagy via activation of AMPK-ULK1 pathways (Xie et al., 2014).
We report here for the first time to our knowledge, the implication of eEF2K in the context of CML.
We first show that eEF2K expression is increased in UT7 cells expressing BCR-ABL as well as in the leukemic cells in a large cohort of patient with CML as compared to healthy controls. This expression leads to the phosphorylation of eEF2K which is the only target of eEF2K, allowing the limitation of mRNA translation. The reasons for the increased expression of eEF2K could be due to the increased activation of several signaling pathways by BCR-ABL, including c--MYC, which has been shown to increase levels of EEF2K in neuroblastoma cells allowing them to survive in starvation conditions (Delaidelli et al., 2017). Our experiments showed a significantly higher growth rate of UT7-11 sheEF2K cells as compared to scramble controls in the conditions of serum or glucose deprivation, suggesting strongly that eEF2K impairs the survival of leukemic cells. These findings are in contrast with the data reported in
Page | 131
neuroblastoma (Delaidelli et al., 2017) glioblastoma (Leprivier et al., 2013b) or lung cancer (Moore et al., 2016) cell lines.
Our data in UT7-p210 suggest that, as opposed to what has been reported in other cancer cell lines and tumors, regulation of EEF2K is altered in CML cells in which eEF2K overexpression allows a functional role like that found in normal cells. Contrary to what we expected, EEF2K knock-down by shRNA, allows leukemic cells to survive and proliferate in nutrient deprivation conditions.
The significance of the major overexpression of eEF2K in CML cells is unclear at the present time. It is known that eEF2K activates a large number of proteins involved in the adhesion and migration of cancer cells (Xie et al., 2018). Further studies will be required to determine the potential role of eEF2K in the adhesion and migration abnormalities known to occur in CML (Chomel and Turhan, 2011).
In this work, we have also studied the transcriptomic network which might be involved in BCR-ABL-expressing leukemic cells with and without eEF2K invalidation at the level of RNA and protein.
We showed that in specific context of p210 BCR-ABL, UT7 could repress E2F target genes such as transcription factor ETS1 that was found previously implicated in pathophysiology of chronic myelogenous leukemia (Desterke et al., 2018).
EEF2K plays an important repressive function in basal condition of UT7 by acting in repression of invasion processes like granulocyte migration and promotion of vascular development through liberation of extracellular angiogenic ligands such as angiopoietin 2.
In basal condition of UT7, EEF2K specifically induced cell cycle and mitochondrial response to the oxidative phosphorylation.
These studies clearly indicate the positive correlation between inactivation of eEF2K and oxidative phosphorylation and genes involved in ROS as well as genes involved in peroxisome and IFN-gamma pathways.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Overall, we report for the first time to our knowledge, that eEF2K, a target of ETS1 gene overexpressed in CML, is involved in the pathophysiology of CML. This unique control mechanism of translation elongation appears to not be regulated in CML cells in response to NDC and might be involved in the myeloproliferative phenotype of CML in an uncontrolled manner. The inactivation experiments clearly showed that in the context of CML, the reduced expression of eEF2K allows leukemic cells to grow in extreme NDC. Further studies are required to determine the role of eEF2K in self- renewal and quiescence of primary leukemic cells in patients with CML.
References
Bayraktar, R., Ivan, C., Bayraktar, E., Kanlikilicer, P., Kabil, N.N., Kahraman, N., Mokhlis, H.A., Karakas, D., Rodriguez-Aguayo, C., Arslan, A., Sheng, J., Wong, S., Lopez-Berestein, G., Calin, G.A., Ozpolat, B., 2018. Dual Suppressive Effect of miR- 34a on the FOXM1/eEF2-Kinase Axis Regulates Triple-Negative Breast Cancer Growth and Invasion. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 24, 4225– 4241. https://doi.org/10.1158/1078-0432.CCR-17-1959
Browne, G.J., Finn, S.G., Proud, C.G., 2004. Stimulation of the AMP-activated Protein Kinase Leads to Activation of Eukaryotic Elongation Factor 2 Kinase and to Its Phosphorylation at a Novel Site, Serine 398. J. Biol. Chem. 279, 12220–12231. https://doi.org/10.1074/jbc.M309773200
Browne, G.J., Proud, C.G., 2004. A Novel mTOR-Regulated Phosphorylation Site in Elongation Factor 2 Kinase Modulates the Activity of the Kinase and Its Binding to Calmodulin. Mol. Cell. Biol. 24, 2986–2997. https://doi.org/10.1128/MCB.24.7.2986- 2997.2004
Browne, G.J., Proud, C.G., 2002. Regulation of peptide-chain elongation in mammalian cells. Eur. J. Biochem. 269, 5360–5368. https://doi.org/10.1046/j.1432- 1033.2002.03290.x
Page | 133
Buttgereit, F., Brand, M.D., 1995. A hierarchy of ATP-consuming processes in mammalian cells. Biochem. J. 312 ( Pt 1), 163–167. https://doi.org/10.1042/bj3120163
Chomel, J.-C., Turhan, A.G., 2011. Chronic myeloid leukemia stem cells in the era of targeted therapies: resistance, persistence and long-term dormancy. Oncotarget 2, 713–727. https://doi.org/10.18632/oncotarget.333
Culhane, A.C., Thioulouse, J., Perrière, G., Higgins, D.G., 2005. MADE4: an R package for multivariate analysis of gene expression data. Bioinforma. Oxf. Engl. 21, 2789–2790. https://doi.org/10.1093/bioinformatics/bti394
Delaidelli, A., Leprivier, G., Sorensen, P.H., 2017. eEF2K protects MYCN-amplified cells from starvation. Cell Cycle Georget. Tex 16, 1633–1634. https://doi.org/10.1080/15384101.2017.1355180
Desterke, C., Voldoire, M., Bonnet, M.-L., Sorel, N., Pagliaro, S., Rahban, H., Bennaceur-Griscelli, A., Cayssials, E., Chomel, J.-C., Turhan, A.G., 2018. Experimental and integrative analyses identify an ETS1 network downstream of BCR- ABL in chronic myeloid leukemia (CML). Exp. Hematol. 64, 71-83.e8. https://doi.org/10.1016/j.exphem.2018.04.007
Dever, T.E., Green, R., 2012. The elongation, termination, and recycling phases of translation in eukaryotes. Cold Spring Harb. Perspect. Biol. 4, a013706. https://doi.org/10.1101/cshperspect.a013706
Guan, Y., Jiang, S.-L., Yu, P., Wen, M., Zhang, Y., Xiao, S.-S., Xu, X.-J., Cheng, Y., 2018. Suppression of eEF-2K-mediated autophagy enhances the cytotoxicity of raddeanin A against human breast cancer cells in vitro. Acta Pharmacol. Sin. 39, 642– 648. https://doi.org/10.1038/aps.2017.139
Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., Speed, T.P., 2003. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 31, e15.
Issaad, C., Ahmed, M., Novault, S., Bonnet, M.L., Bennardo, T., Varet, B., Vainchenker, W., Turhan, A.G., 2000. Biological effects induced by variable levels of
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
BCR-ABL protein in the pluripotent hematopoietic cell line UT-7. Leukemia 14, 662. https://doi.org/10.1038/sj.leu.2401730
Johanns, M., Pyr Dit Ruys, S., Houddane, A., Vertommen, D., Herinckx, G., Hue, L., Proud, C.G., Rider, M.H., 2017. Direct and indirect activation of eukaryotic elongation factor 2 kinase by AMP-activated protein kinase. Cell. Signal. 36, 212–221. https://doi.org/10.1016/j.cellsig.2017.05.010
Kabil, N., Bayraktar, R., Kahraman, N., Mokhlis, H.A., Calin, G.A., Lopez-Berestein, G., Ozpolat, B., 2018. Thymoquinone inhibits cell proliferation, migration, and invasion by regulating the elongation factor 2 kinase (eEF-2K) signaling axis in triple-negative breast cancer. Breast Cancer Res. Treat. 171, 593–605. https://doi.org/10.1007/s10549-018-4847-2
Kaul, G., Pattan, G., Rafeequi, T., 2011. Eukaryotic elongation factor-2 (eEF2): its regulation and peptide chain elongation. Cell Biochem. Funct. 29, 227–234. https://doi.org/10.1002/cbf.1740
Komatsu, N., Nakauchi, H., Miwa, A., Ishihara, T., Eguchi, M., Moroi, M., Okada, M., Sato, Y., Wada, H., Yawata, Y., 1991. Establishment and characterization of a human leukemic cell line with megakaryocytic features: dependency on granulocyte- macrophage colony-stimulating factor, interleukin 3, or erythropoietin for growth and survival. Cancer Res. 51, 341–348.
Leprivier, G., Remke, M., Rotblat, B., Dubuc, A., Mateo, A.-R.F., Kool, M., Agnihotri, S., El-Naggar, A., Yu, B., Prakash Somasekharan, S., Faubert, B., Bridon, G., Tognon, C.E., Mathers, J., Thomas, R., Li, A., Barokas, A., Kwok, B., Bowden, M., Smith, S., Wu, X., Korshunov, A., Hielscher, T., Northcott, P.A., Galpin, J.D., Ahern, C.A., Wang, Y., McCabe, M.G., Collins, V.P., Jones, R.G., Pollak, M., Delattre, O., Gleave, M.E., Jan, E., Pfister, S.M., Proud, C.G., Derry, W.B., Taylor, M.D., Sorensen, P.H., 2013a. The eEF2 Kinase Confers Resistance to Nutrient Deprivation by Blocking Translation Elongation. Cell 153, 1064–1079. https://doi.org/10.1016/j.cell.2013.04.055
Page | 135
Leprivier, G., Remke, M., Rotblat, B., Dubuc, A., Mateo, A.-R.F., Kool, M., Agnihotri, S., El-Naggar, A., Yu, B., Somasekharan, S.P., Faubert, B., Bridon, G., Tognon, C.E., Mathers, J., Thomas, R., Li, A., Barokas, A., Kwok, B., Bowden, M., Smith, S., Wu, X., Korshunov, A., Hielscher, T., Northcott, P.A., Galpin, J.D., Ahern, C.A., Wang, Y., McCabe, M.G., Collins, V.P., Jones, R.G., Pollak, M., Delattre, O., Gleave, M.E., Jan, E., Pfister, S.M., Proud, C.G., Derry, W.B., Taylor, M.D., Sorensen, P.H., 2013b. The eEF2 kinase confers resistance to nutrient deprivation by blocking translation elongation. Cell 153, 1064–1079. https://doi.org/10.1016/j.cell.2013.04.055
Liberzon, A., Birger, C., Thorvaldsdóttir, H., Ghandi, M., Mesirov, J.P., Tamayo, P., 2015. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 1, 417–425. https://doi.org/10.1016/j.cels.2015.12.004
Mauro, V.P., Matsuda, D., 2016. Translation regulation by ribosomes: Increased complexity and expanded scope. RNA Biol. 13, 748–755. https://doi.org/10.1080/15476286.2015.1107701
Moore, C.E.J., Wang, X., Xie, J., Pickford, J., Barron, J., Regufe da Mota, S., Versele, M., Proud, C.G., 2016. Elongation factor 2 kinase promotes cell survival by inhibiting protein synthesis without inducing autophagy. Cell. Signal. 28, 284–293. https://doi.org/10.1016/j.cellsig.2016.01.005
Ng, T.H., Sham, K.W.Y., Xie, C.M., Ng, S.S.M., To, K.F., Tong, J.H.M., Liu, W.Y.Z., Zhang, L., Chan, M.T.V., Wu, W.K.K., Cheng, C.H.K., 2019. Eukaryotic elongation factor-2 kinase expression is an independent prognostic factor in colorectal cancer. BMC Cancer 19, 649. https://doi.org/10.1186/s12885-019-5873-0
Pagliaro, S., Desterke, C., Acloque, H., Chomel, J.C., de Souza, L., Hugues, P., Griscelli, F., Foudi, A., Bennaceur-Griscelli, A., Turhan, A.G., 2020. Single-Cell Transcriptome in Chronic Myeloid Leukemia: Pseudotime Analysis Reveals Evidence of Embryonic and Transitional Stem Cell States. Exp. Hematol. https://doi.org/10.1016/j.exphem.2020.04.005
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Pan, Z., Chen, Y., Liu, J., Jiang, Q., Yang, S., Guo, L., He, G., 2018. Design, synthesis, and biological evaluation of polo-like kinase 1/eukaryotic elongation factor 2 kinase (PLK1/EEF2K) dual inhibitors for regulating breast cancer cells apoptosis and autophagy. Eur. J. Med. Chem. 144, 517–528. https://doi.org/10.1016/j.ejmech.2017.12.046
Pavur, K.S., Petrov, A.N., Ryazanov, A.G., 2000. Mapping the Functional Domains of Elongation Factor-2 Kinase. Biochemistry 39, 12216–12224. https://doi.org/10.1021/bi0007270
Ryazanov, A.G., Davydova, E.K., 1989. Mechanism of elongation factor 2 (EF-2) inactivation upon phosphorylation. Phosphorylated EF-2 is unable to catalyze translocation. FEBS Lett. 251, 187–190. https://doi.org/10.1016/0014-5793(89)81452- 8
Ryazanov, A.G., Natapov, P.G., Shestakova, E.A., Severin, F.F., Spirin, A.S., 1988a. Phosphorylation of the elongation factor 2: the fifth Ca2+/calmodulin-dependent system of protein phosphorylation. Biochimie 70, 619–626.
Ryazanov, A.G., Shestakova, E.A., Natapov, P.G., 1988b. Phosphorylation of elongation factor 2 by EF-2 kinase affects rate of translation. Nature 334, 170–173. https://doi.org/10.1038/334170a0
Shi, N., Chen, X., Liu, R., Wang, D., Su, M., Wang, Q., He, A., Gu, H., 2018. Eukaryotic elongation factors 2 promotes tumor cell proliferation and correlates with poor prognosis in ovarian cancer. Tissue Cell 53, 53–60. https://doi.org/10.1016/j.tice.2018.05.014
Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., Mesirov, J.P., 2005. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545–15550. https://doi.org/10.1073/pnas.0506580102
Page | 137
Tusher, V.G., Tibshirani, R., Chu, G., 2001. Significance analysis of microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. U. S. A. 98, 5116– 5121. https://doi.org/10.1073/pnas.091062498
Wang, X., Xie, J., Proud, C., 2017. Eukaryotic Elongation Factor 2 Kinase (eEF2K) in Cancer. Cancers 9, 162. https://doi.org/10.3390/cancers9120162
Xie, C.-M., Liu, X.-Y., Sham, K.W.Y., Lai, J.M.Y., Cheng, C.H.K., 2014. Silencing of EEF2K (eukaryotic elongation factor-2 kinase) reveals AMPK-ULK1-dependent autophagy in colon cancer cells. Autophagy 10, 1495–1508. https://doi.org/10.4161/auto.29164
Xie, J., Shen, K., Lenchine, R.V., Gethings, L.A., Trim, P.J., Snel, M.F., Zhou, Y., Kenney, J.W., Kamei, M., Kochetkova, M., Wang, X., Proud, C.G., 2018. Eukaryotic elongation factor 2 kinase upregulates the expression of proteins implicated in cell migration and cancer cell metastasis. Int. J. Cancer 142, 1865–1877. https://doi.org/10.1002/ijc.31210
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Supplementary figure 1: Proximal Promoter binding events for EEF2K gene with ETS1 fixation in K562 by CHIP-sequencing: proximal events found in promoter (-3000 pb upstream Transcription starting site) of EE2K gene locus after analysis of ETS1 K562 CHIP-sequencing. Peaks were visualized with Integrative Genome Viewer on HG19 human genome.
Supplementary Figure 2. Lentiviral vector pLKO-GFP-puro shEEF2K. shEEF2K-1 (shRNA TRCN0000234847) and shEEF2K-2 (shRNA TRCN0000234845) were
Page | 139
obtained from the Integrated DNA Technologies (IDT). Scramble (empty vector with a 1.2 kb stuffer element) were used as control. Virus were produced in human kidney 293T. Concentrated vector preparations were made by ultracentrifugation, filtered (0.45 μm), divided into aliquots and stored. Virus titration was performed using NIH 3T3 cells. UT7 and UT7 p210 cells were transduced with viral supernatant (MOI = 2).
Supplementary Figure 3. EEF2K transduction efficiency. Selection of infected cells was started 24 hours after infection with 2 μg/ml puromycin. The infection efficiency infected cells were assessed by measuring the frequency of GFP+ cells by flow cytometry 48 hours post infection. Typically, the frequency of GFP+ cells for primary were >80%.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Supplementary Figure 4. Sensitivity to Imatinib. EEF2K knock down didn’t affect the sensitive to imatinib. Cells were cultured (105 cells/ml) under normal conditions (RPMI 1640, 10%FBS, 10% PenStrep) with or without imatinib (1 and 2µM) and counted at day 2. No significant changes were observed.
Page | 141
Supplementary Figure 5: Effect of EEF2K shRNA on cross expression profiles between UT7 basal and UT7-11 BCR-ABL: A/ expression heatmap of differential expressed genes induced by EEK2K shRNA in UT7 basal (Pearson distances); B/ expression heatmap of differential expressed genes induced by EEK2K shRNA in UT7 11 (BCR-ABL+) (Pearson distances); C/Venn diagram quantifying effect of EEF2K shRNA on cross expression profile between UT7 basal and UT7-11 BCR-ABL cell lines.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
Supplementary Figure 6: UT7 basal expression profile regulated by EEF2K shRNA: A/ Expression heatmap of genes found down regulated by EEF2K shRNA in UT7 basal cell line (Pearson distances), abbreviations for B and C: NES: normalized enrichment score); B/ Gene set enrichment scores found significantly increased by EEF2K shRNA in UT7 basal cell line; C/ Gene set enrichment scores found significantly repressed by EEF2K shRNA in UT7 basal cell line
Page | 143
GENERAL DISCUSSION
CML is one of the major models of oncogenesis and the first major success story for the use of targeted therapies. Indeed, the use of TKI therapies has now transformed the natural history of the disease for which the median survival was 3-5 years until 20 years ago. The bone marrow transplantation has first been shown to be the first curative therapy in early 70’s but is was applicable to a minority of patients. With the use of TKI’s introduced since 1999-2000, the survival of patients responding to
373 treatment is now equivalent to that of patients with the same age and the same sex .
The disease can now be followed by using molecular monitoring and deep molecular responses can be obtained in 30-40% of the patients, allowing to design treatment- free remission (TFR) strategies with discontinuation of TKI. However, TKI discontinuation lead to rapid molecular recurrences in 50-60% of the patients, suggesting the persistence of LSC in the bone marrow as this has been shown previously by our team159. As discussed in the introduction section, the characteristics of these cells remain elusive as there are very few differences between CML-LSC and normal HSC in terms of cell surface markers. Besides, these cells seem to escape TKI action either by their reduced BCR-ABL expression 159 or by their interaction with the bone marrow leukemic niche which can trigger in the LSC self-renewal or quiescence signaling pathways. Conversely, it has been shown that the bone marrow niche itself could be abnormal in CML, as it has been shown that MSC from CML patients express high levels of transforming genes such as podoplanin and the pluripotency gene Nanog. These finds were noticed even in patients in deep molecular responses, suggesting “memory” persistence in the components of LSC niche 374.
From this regard, one of the major insights into the CML LSC persistence has been the demonstration of the fact that they are not addicted to the activity of BCR-ABL oncogene.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
This finding suggested that it was possible to target CML stem cells by using other druggable pathways, combined with TKI, in order to obtain a status of deep molecular response, allowing to safely stop TKI. This concept is illustrated in the Figure 26.
Figure 26 – TKI Treatment alone Vs Combined treated
During the last 10 years, several signaling pathways which could be a druggable target has been identified in CML (Figure 27)
Page | 145
Figure 27 - Potential pathways to target CML stem cells Figure from Houshmand et al Leukemia 2019
The exploitation of these pathways led to the identification of drugs, some of which (such as Zileuton) have been introduced into the clinical trials. However, this approach needs to be carefully evaluated as the goal is to avoid toxicity in patients which remain for several years on TKI therapy with a satisfactory tolerance.
Persistence and resistance of LSC in patients on TKI therapy clearly indicates that these cells could be selected out during TKI administration or they are present at diagnosis with variable frequency. This would then suggest a heterogeneity at diagnosis, and we wished to analyze this phenomenon at the single cell level using transcriptome analysis.
One important result of my work is the identification of the expression of embryonic pluripotency genes in 9% of the CD34+ cells at diagnosis. This analysis was performed in a small number of patients, but these findings were consistent and clearly
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
different from controls. The second important result was the identification of several “stem cell states” using Pseudo time technology, suggesting that a CML stem cell could undergo during self-renewal divisions, several transcriptional modifications with successive expression of signaling pathways (Figure 27). These findings need to be confirmed in larger series of patients, but they suggest that targeting a single pathway will not be enough to eliminate LSC in some patients. Interestingly we have confirmed the expression of several pluripotency genes in a group of CML patients and currently we are analyzing the expression of this panel of genes in CML cells resistant to TKI.
In the second part of my work I have analyzed the role of EEF2K gene which we have
318 reported for the first time as a transcriptional target of ETS1 gene
One important finding of this work was the fact that EEF2K expression is highly increased in the whole blood of patients with CML at diagnosis. In cell separation experiments, this overexpression was found to be essentially in the more differentiated CD34- fraction. Our data in UT7-p210 suggest that, as opposed to what has been reported in other cancer cell lines and tumors, regulation of EEF2K is altered in CML cells in which eEF2K overexpression allows a functional role like that found in normal cells. Contrary to what we expected, EEF2K knock-down by shRNA, allows leukemic cells to survive and proliferate in nutrient deprivation conditions.
Thus, this unique control mechanism of translation elongation appears to be not regulated in CML cells in response to nutrient depletion conditions and might be involved in the myeloproliferative phenotype of CML in an uncontrolled manner. Further studies are required to determine the role of eEF2K in self-renewal and quiescence of primary leukemic cells in patients with CML. These studies will include, the lentivirus- mediated transfer of sh-eEF2K gene in normal and CML stem cells followed by functional stem cell assays using LTC-IC and NGS-mouse repopulating assays. These works are currently pursued in the Inserm Unit U935.
Overall, the work presented on this Thesis allowed to underline the important heterogeneity of CML stem cells at the level of single cell transcriptome analysis and at the level of the potential transcriptional targets of ETS1 genes such as EEF2K.
Page | 147
REFERENCES
1. Mughal TI, Goldman JM. Chronic myeloid leukemia: why does it evolve from chronic phase to blast transformation? Front Biosci J Virtual Libr. 2006;11:198-208. doi:10.2741/1791
2. Bennett JH, University of Glasgow. Library. Case of Hypertrophy of the Spleen and Liver, Which Death Took Place from Suppuration of the Blood [Electronic Resource]. [Edinburgh] : [Printed by Stark and Company]; 1845. http://archive.org/details/b21470388. Accessed October 11, 2019.
3. Silver GA. Virchow, the heroic model in medicine: health policy by accolade. Am J Public Health. 1987;77(1):82-88. doi:10.2105/ajph.77.1.82
4. Donne A. De l’origine des globules du sang, de leur mode de formation, de leur fin. CR Acad Sci.
5. Geary CG. The story of chronic myeloid leukaemia. Br J Haematol. 2000;110(1):2-11.
6. Nowell PC. The minute chromosome in human chronic granulocytic leukemia. Science. 1962;8:65-66. doi:10.1007/bf01630378
7. Rowley JD. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukaemia identified by quinacrine fluorescence and Giemsa staining. Nature. 1973;243(5405):290-293.
8. De Klein A, Hagemeijer A, Bartram CR, et al. bcr rearrangement and translocation of the c-abl oncogene in Philadelphia positive acute lymphoblastic leukemia. Blood. 1986;68(6):1369-1375.
9. Goldman JM, Grosveld G, Baltimore D, Gale RP. Chronic myelogenous leukemia--the unfolding saga. Leukemia. 1990;4(3):163-167.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
10. Groffen J, Stephenson JR, Heisterkamp N, de Klein A, Bartram CR, Grosveld G. Philadelphia chromosomal breakpoints are clustered within a limited region, bcr, on chromosome 22. Cell. 1984;36(1):93-99.
11. Canaani E, Gale RP, Steiner-Saltz D, Berrebi A, Aghai E, Januszewicz E. Altered transcription of an oncogene in chronic myeloid leukaemia. Lancet Lond Engl. 1984;1(8377):593-595.
12. Shtivelman E, Lifshitz B, Gale RP, Canaani E. Fused transcript of abl and bcr genes in chronic myelogenous leukaemia. Nature. 1985;315(6020):550-554.
13. Nowell PC, Hungerford DA. Chromosome studies in human leukemia. II. Chronic granulocytic leukemia. J Natl Cancer Inst. 1961;27:1013-1035.
14. Rowley JD. Ph1-positive leukaemia, including chronic myelogenous leukaemia. Clin Haematol. 1980;9(1):55-86.
15. Rozman C, Urbano-Ispizua A, Cervantes F, et al. Analysis of the clinical relevance of the breakpoint location within M-BCR and the type of chimeric mRNA in chronic myelogenous leukemia. Leukemia. 1995;9(6):1104-1107.
16. Harrison CJ. Philadelphia Chromosome. In: Brenner S, Miller JH, eds. Encyclopedia of Genetics. New York: Academic Press; 2001:1449-1450. doi:10.1006/rwgn.2001.0991
17. Verhest A, Monsieur R. Philadelphia chromosome-positive thrombocythemia with leukemic transformation. N Engl J Med. 1983;308(26):1603. doi:10.1056/NEJM198306303082620
18. Melo JV. The diversity of BCR-ABL fusion proteins and their relationship to leukemia phenotype. Blood. 1996;88(7):2375-2384.
19. Zhao X, Ghaffari S, Lodish H, Malashkevich VN, Kim PS. Structure of the Bcr- Abl oncoprotein oligomerization domain. Nat Struct Biol. 2002;9(2):117-120. doi:10.1038/nsb747
Page | 149
20. Mughal TI, Goldman JM. Chronic myeloid leukemia: why does it evolve from chronic phase to blast transformation? Front Biosci J Virtual Libr. 2006;11:198-208.
21. Li S, Ilaria RL, Million RP, Daley GQ, Van Etten RA. The P190, P210, and P230 Forms of the BCR/ABL Oncogene Induce a Similar Chronic Myeloid Leukemia–like Syndrome in Mice but Have Different Lymphoid Leukemogenic Activity. J Exp Med. 1999;189(9):1399-1412. doi:10.1084/jem.189.9.1399
22. Van Etten RA. The molecular pathogenesis of the Philadelphia-positive leukemias: implications for diagnosis and therapy. Cancer Treat Res. 1993;64:295- 325.
23. Chan LC, Karhi KK, Rayter SI, et al. A novel abl protein expressed in Philadelphia chromosome positive acute lymphoblastic leukaemia. Nature. 1987;325(6105):635- 637. doi:10.1038/325635a0
24. Kurzrock R, Shtalrid M, Talpaz M, Kloetzer WS, Gutterman JU. Expression of c- abl in Philadelphia-positive acute myelogenous leukemia. Blood. 1987;70(5):1584- 1588.
25. Pane F, Frigeri F, Sindona M, et al. Neutrophilic-chronic myeloid leukemia: a distinct disease with a specific molecular marker (BCR/ABL with C3/A2 junction). Blood. 1996;88(7):2410-2414.
26. Chen SJ, Flandrin G, Daniel MT, et al. Philadelphia-positive acute leukemia: lineage promiscuity and inconsistently rearranged breakpoint cluster region. Leukemia. 1988;2(5):261-273.
27. Hirsch-Ginsberg C, Childs C, Chang KS, et al. Phenotypic and molecular heterogeneity in Philadelphia chromosome-positive acute leukemia. Blood. 1988;71(1):186-195.
28. Schaefer-Rego K, Arlin Z, Shapiro LG, Mears JG, Leibowitz D. Molecular heterogeneity of adult Philadelphia chromosome-positive acute lymphoblastic leukemia. Cancer Res. 1988;48(4):866-869.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
29. Hantschel O. Structure, Regulation, Signaling, and Targeting of Abl Kinases in Cancer. Genes Cancer. 2012;3(5-6):436-446. doi:10.1177/1947601912458584
30. Daley GQ, Van Etten RA, Baltimore D. Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome. Science. 1990;247(4944):824-830. doi:10.1126/science.2406902
31. Kelliher MA, McLaughlin J, Witte ON, Rosenberg N. Induction of a chronic myelogenous leukemia-like syndrome in mice with v-abl and BCR/ABL. Proc Natl Acad Sci U S A. 1990;87(17):6649-6653. doi:10.1073/pnas.87.17.6649
32. Bedi A, Zehnbauer BA, Barber JP, Sharkis SJ, Jones RJ. Inhibition of apoptosis by BCR-ABL in chronic myeloid leukemia. Blood. 1994;83(8):2038-2044.
33. Hariharan IK, Adams JM, Cory S. bcr-abl oncogene renders myeloid cell line factor independent: potential autocrine mechanism in chronic myeloid leukemia. Oncogene Res. 1988;3(4):387-399.
34. Wetzler M, Talpaz M, Etten RAV, Hirsh-Ginsberg C, Beran M, Kurzrock R. Subcellular localization of Bcr, Abl, and Bcr-Abl proteins in normal and leukemic cells and correlation of expression with myeloid differentiation. J Clin Invest. 1993;92(4):1925-1939. doi:10.1172/JCI116786
35. Taagepera S, McDonald D, Loeb JE, et al. Nuclear-cytoplasmic shuttling of C- ABL tyrosine kinase. Proc Natl Acad Sci U S A. 1998;95(13):7457-7462. doi:10.1073/pnas.95.13.7457
36. Chai SK, Nichols GL, Rothman P. Constitutive activation of JAKs and STATs in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients. J Immunol Baltim Md 1950. 1997;159(10):4720-4728.
37. Samanta A, Perazzona B, Chakraborty S, et al. Janus kinase 2 regulates Bcr- Abl signaling in chronic myeloid leukemia. Leukemia. 2011;25(3):463-472. doi:10.1038/leu.2010.287
Page | 151
38. Spiekermann K, Pau M, Schwab R, Schmieja K, Franzrahe S, Hiddemann W. Constitutive activation of STAT3 and STAT5 is induced by leukemic fusion proteins with protein tyrosine kinase activity and is sufficient for transformation of hematopoietic precursor cells. Exp Hematol. 2002;30(3):262-271. doi:10.1016/s0301- 472x(01)00787-1
39. de Groot RP, Raaijmakers JA, Lammers JW, Koenderman L. STAT5-Dependent CyclinD1 and Bcl-xL expression in Bcr-Abl-transformed cells. Mol Cell Biol Res Commun MCBRC. 2000;3(5):299-305. doi:10.1006/mcbr.2000.0231
40. Hoelbl A, Schuster C, Kovacic B, et al. Stat5 is indispensable for the maintenance of bcr/abl-positive leukaemia. EMBO Mol Med. 2010;2(3):98-110. doi:10.1002/emmm.201000062
41. Walz C, Ahmed W, Lazarides K, et al. Essential role for Stat5a/b in myeloproliferative neoplasms induced by BCR-ABL1 and JAK2(V617F) in mice. Blood. 2012;119(15):3550-3560. doi:10.1182/blood-2011-12-397554
42. Hantschel O, Warsch W, Eckelhart E, et al. BCR-ABL uncouples canonical JAK2- STAT5 signaling in chronic myeloid leukemia. Nat Chem Biol. 2012;8(3):285- 293. doi:10.1038/nchembio.775
43. Zhao JJ, Cheng H, Jia S, et al. The p110alpha isoform of PI3K is essential for proper growth factor signaling and oncogenic transformation. Proc Natl Acad Sci U S A. 2006;103(44):16296-16300. doi:10.1073/pnas.0607899103
44. Sheng Z, Ma L, Sun JE, Zhu LJ, Green MR. BCR-ABL suppresses autophagy through ATF5-mediated regulation of mTOR transcription. Blood. 2011;118(10):2840- 2848. doi:10.1182/blood-2010-12-322537
45. ten Hoeve J, Arlinghaus RB, Guo JQ, Heisterkamp N, Groffen J. Tyrosine phosphorylation of CRKL in Philadelphia+ leukemia. Blood. 1994;84(6):1731-1736.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
46. Birge RB, Kalodimos C, Inagaki F, Tanaka S. Crk and CrkL adaptor proteins: networks for physiological and pathological signaling. Cell Commun Signal CCS. 2009;7:13. doi:10.1186/1478-811X-7-13
47. Seo J-H, Wood LJ, Agarwal A, et al. A specific need for CRKL in p210BCR-ABL- induced transformation of mouse hematopoietic progenitors. Cancer Res. 2010;70(18):7325-7335. doi:10.1158/0008-5472.CAN-10-0607
48. Steelman LS, Franklin RA, Abrams SL, et al. Roles of the Ras/Raf/MEK/ERK pathway in leukemia therapy. Leukemia. 2011;25(7):1080-1094. doi:10.1038/leu.2011.66
49. Puil L, Liu J, Gish G, et al. Bcr-Abl oncoproteins bind directly to activators of the Ras signalling pathway. EMBO J. 1994;13(4):764-773.
50. Baum KJ, Ren R. Effect of Ras inhibition in hematopoiesis and BCR/ABL leukemogenesis. J Hematol OncolJ Hematol Oncol. 2008;1:5. doi:10.1186/1756-8722- 1-5
51. Kim LC, Song L, Haura EB. Src kinases as therapeutic targets for cancer. Nat Rev Clin Oncol. 2009;6(10):587-595. doi:10.1038/nrclinonc.2009.129
52. Danhauser-Riedl S, Warmuth M, Druker BJ, Emmerich B, Hallek M. Activation of Src kinases p53/56lyn and p59hck by p210bcr/abl in myeloid cells. Cancer Res. 1996;56(15):3589-3596.
53. Wilson MB, Schreiner SJ, Choi H-J, Kamens J, Smithgall TE. Selective pyrrolo- pyrimidine inhibitors reveal a necessary role for Src family kinases in Bcr-Abl signal transduction and oncogenesis. Oncogene. 2002;21(53):8075-8088. doi:10.1038/sj.onc.1206008
54. Klejman A, Schreiner SJ, Nieborowska-Skorska M, et al. The Src family kinase Hck couples BCR/ABL to STAT5 activation in myeloid leukemia cells. EMBO J. 2002;21(21):5766-5774. doi:10.1093/emboj/cdf562
Page | 153
55. Warmuth M, Simon N, Mitina O, et al. Dual-specific Src and Abl kinase inhibitors, PP1 and CGP76030, inhibit growth and survival of cells expressing imatinib mesylate- resistant Bcr-Abl kinases. Blood. 2003;101(2):664-672. doi:10.1182/blood-2002-01- 0288
56. Hu Y, Liu Y, Pelletier S, et al. Requirement of Src kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronic myeloid leukemia. Nat Genet. 2004;36(5):453-461. doi:10.1038/ng1343
57. Neshat MS, Raitano AB, Wang HG, Reed JC, Sawyers CL. The survival function of the Bcr-Abl oncogene is mediated by Bad-dependent and -independent pathways: roles for phosphatidylinositol 3-kinase and Raf. Mol Cell Biol. 2000;20(4):1179-1186. doi:10.1128/mcb.20.4.1179-1186.2000
58. Mughal TI, Radich JP, Deininger MW, et al. Chronic myeloid leukemia: reminiscences and dreams. Haematologica. 2016;101(5):541-558. doi:10.3324/haematol.2015.139337
59. Orkin SH, Zon LI. Hematopoiesis: an evolving paradigm for stem cell biology. Cell. 2008;132(4):631-644. doi:10.1016/j.cell.2008.01.025
60. Eaves CJ. Hematopoietic stem cells: concepts, definitions, and the new reality. Blood. 2015;125(17):2605-2613. doi:10.1182/blood-2014-12-570200
61. Copelan EA. Hematopoietic stem-cell transplantation. N Engl J Med. 2006;354(17):1813-1826. doi:10.1056/NEJMra052638
62. Akashi K, Traver D, Miyamoto T, Weissman IL. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000;404(6774):193-197. doi:10.1038/35004599
63. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature. 2001;414(6859):105-111. doi:10.1038/35102167
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
64. Upadhaya S, Sawai CM, Papalexi E, et al. Kinetics of adult hematopoietic stem cell differentiation in vivo. J Exp Med. 2018;215(11):2815-2832. doi:10.1084/jem.20180136
65. Sun J, Ramos A, Chapman B, et al. Clonal dynamics of native haematopoiesis. Nature. 2014;514(7522):322-327. doi:10.1038/nature13824
66. Busch K, Klapproth K, Barile M, et al. Fundamental properties of unperturbed haematopoiesis from stem cells in vivo. Nature. 2015;518(7540):542-546. doi:10.1038/nature14242
67. Bhatia R, Holtz M, Niu N, et al. Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment. Blood. 2003;101(12):4701-4707. doi:10.1182/blood-2002-09-2780
68. Chapple RH, Tseng Y-J, Hu T, et al. Lineage tracing of murine adult hematopoietic stem cells reveals active contribution to steady-state hematopoiesis. Blood Adv. 2018;2(11):1220-1228. doi:10.1182/bloodadvances.2018016295
69. Biasco L, Pellin D, Scala S, et al. In Vivo Tracking of Human Hematopoiesis Reveals Patterns of Clonal Dynamics during Early and Steady-State Reconstitution Phases. Cell Stem Cell. 2016;19(1):107-119. doi:10.1016/j.stem.2016.04.016
70. Notta F, Zandi S, Takayama N, et al. Distinct routes of lineage development reshape the human blood hierarchy across ontogeny. Science. 2016;351(6269):aab2116. doi:10.1126/science.aab2116
71. Perié L, Duffy KR, Kok L, de Boer RJ, Schumacher TN. The Branching Point in Erythro-Myeloid Differentiation. Cell. 2015;163(7):1655-1662. doi:10.1016/j.cell.2015.11.059
72. Rodriguez-Fraticelli AE, Wolock SL, Weinreb CS, et al. Clonal analysis of lineage fate in native haematopoiesis. Nature. 2018;553(7687):212-216. doi:10.1038/nature25168
Page | 155
73. Carrelha J, Meng Y, Kettyle LM, et al. Hierarchically related lineage-restricted fates of multipotent haematopoietic stem cells. Nature. 2018;554(7690):106-111. doi:10.1038/nature25455
74. Lee Y, Decker M, Lee H, Ding L. Extrinsic regulation of hematopoietic stem cells in development, homeostasis and diseases. Wiley Interdiscip Rev Dev Biol. 2017;6(5). doi:10.1002/wdev.279
75. Naik SH, Perié L, Swart E, et al. Diverse and heritable lineage imprinting of early haematopoietic progenitors. Nature. 2013;496(7444):229-232. doi:10.1038/nature12013
76. Till JE, McCulloch EA. A Direct Measurement of the Radiation Sensitivity of Normal Mouse Bone Marrow Cells. :1.
77. Magli MC, Iscove NN, Odartchenko N. Transient nature of early haematopoietic spleen colonies. Nature. 1982;295(5849):527-529. doi:10.1038/295527a0
78. Siminovitch L, Till JE, McCulloch EA. Decline in colony-forming ability of marrow cells subjected to serial transplantation into irradiated mice. J Cell Comp Physiol. 1964;64(1):23-31. doi:10.1002/jcp.1030640104
79. Dick J, Magli M, Huszar D, Phillips R, Bernstein A. Introduction of a selectable gene into primitive stem cells capable of long-term reconstitution of the hemopoietic system of W/Wv mice. Cell. 1985;42(1):71-79. doi:10.1016/S0092-8674(85)80102-1
80. van de Rijn M, Heimfeld S, Spangrude GJ, Weissman IL. Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family. Proc Natl Acad Sci. 1989;86(12):4634-4638. doi:10.1073/pnas.86.12.4634
81. Yilmaz ÖH, Kiel MJ, Morrison SJ. SLAM family markers are conserved among hematopoietic stem cells from old and reconstituted mice and markedly increase their purity. Blood. 2006;107(3):924-930. doi:10.1182/blood-2005-05-2140
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
82. Sidney LE, Branch MJ, Dunphy SE, Dua HS, Hopkinson A. Concise Review: Evidence for CD34 as a Common Marker for Diverse Progenitors: CD34 as a Common Marker for Diverse Progenitors. STEM CELLS. 2014;32(6):1380-1389. doi:10.1002/stem.1661
83. Civin CI, Trischmann T, Kadan NS, et al. Highly purified CD34-positive cells reconstitute hematopoiesis. J Clin Oncol. 1996;14(8):2224-2233.
84. Larochelle A, Vormoor J, Hanenberg H, et al. Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: Implications for gene therapy. Nat Med. 1996;2(12):1329-1337. doi:10.1038/nm1296- 1329
85. Vogel W, Scheding S, Kanz L, Brugger W. Clinical applications of CD34(+) peripheral blood progenitor cells (PBPC). Stem Cells Dayt Ohio. 2000;18(2):87-92. doi:10.1634/stemcells.18-2-87
86. Civin CI, Strauss LC, Brovall C, Fackler MJ, Schwartz JF, Shaper JH. Antigenic analysis of hematopoiesis. III. A hematopoietic progenitor cell surface antigen defined by a monoclonal antibody raised against KG-1a cells. J Immunol. 1984;133(1):157- 165.
87. Ciraci E, Bella SD, Salvucci O, et al. Adult human circulating CD34−Lin−CD45−CD133− cells can differentiate into hematopoietic and endothelial cells. Blood. 2011;118(8):2105-2115. doi:10.1182/blood-2010-10-316596
88. Cheung AMS, Leung D, Rostamirad S, et al. Distinct but phenotypically heterogeneous human cell populations produce rapid recovery of platelets and neutrophils after transplantation. Blood. 2012;119(15):3431-3439. doi:10.1182/blood- 2011-12-398024
89. Glimm H, Eisterer W, Lee K, et al. Previously undetected human hematopoietic cell populations with short-term repopulating activity selectively engraft NOD/SCID-
Page | 157
beta2 microglobulin-null mice. J Clin Invest. 2001;107(2):199-206. doi:10.1172/JCI11519
90. Craig W, Kay R, Cutler RL, Lansdorp PM. Expression of Thy-1 on human hematopoietic progenitor cells. J Exp Med. 1993;177(5):1331-1342. doi:10.1084/jem.177.5.1331
91. Terstappen LW, Huang S, Safford M, Lansdorp PM, Loken MR. Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34+CD38- progenitor cells. Blood. 1991;77(6):1218-1227.
92. Dexter TM, Allen TD, Lajtha LG. Conditions controlling the proliferation of haemopoietic stem cells in vitro. J Cell Physiol. 1977;91(3):335-344. doi:10.1002/jcp.1040910303
93. Hao QL, Shah AJ, Thiemann FT, Smogorzewska EM, Crooks GM. A functional comparison of CD34 + CD38- cells in cord blood and bone marrow. Blood. 1995;86(10):3745-3753.
94. Sutherland HJ, Eaves CJ, Eaves AC, Dragowska W, Lansdorp PM. Characterization and partial purification of human marrow cells capable of initiating long-term hematopoiesis in vitro. Blood. 1989;74(5):1563-1570.
95. Ploemacher RE, van der Sluijs JP, Voerman JS, Brons NH. An in vitro limiting- dilution assay of long-term repopulating hematopoietic stem cells in the mouse. Blood. 1989;74(8):2755-2763.
96. Shultz LD, Schweitzer PA, Christianson SW, et al. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-scid mice. J Immunol Baltim Md 1950. 1995;154(1):180-191.
97. Ploemacher RE, van der Sluijs JP, van Beurden CA, Baert MR, Chan PL. Use of limiting-dilution type long-term marrow cultures in frequency analysis of marrow- repopulating and spleen colony-forming hematopoietic stem cells in the mouse. Blood. 1991;78(10):2527-2533.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
98. Rieger MA, Schroeder T. Hematopoiesis. Cold Spring Harb Perspect Biol. 2012;4(12). doi:10.1101/cshperspect.a008250
99. Bradley TR, Metcalf D. The growth of mouse bone marrow cells in vitro. Aust J Exp Biol Med Sci. 1966;44(3):287-299. doi:10.1038/icb.1966.28
100. Yang H, Acker JP, Cabuhat M, Letcher B, Larratt L, McGann LE. Association of post-thaw viable CD34+ cells and CFU-GM with time to hematopoietic engraftment. Bone Marrow Transplant. 2005;35(9):881-887. doi:10.1038/sj.bmt.1704926
101. Schofield R. The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells. 1978;4(1-2):7-25.
102. Jones DL, Wagers AJ. No place like home: anatomy and function of the stem cell niche. Nat Rev Mol Cell Biol. 2008;9(1):11-21. doi:10.1038/nrm2319
103. Kopp H-G, Avecilla ST, Hooper AT, Rafii S. The bone marrow vascular niche: home of HSC differentiation and mobilization. Physiol Bethesda Md. 2005;20:349-356. doi:10.1152/physiol.00025.2005
104. Calvi LM, Adams GB, Weibrecht KW, et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature. 2003;425(6960):841-846. doi:10.1038/nature02040
105. Calvi LM, Link DC. The hematopoietic stem cell niche in homeostasis and disease. Blood. 2015;126(22):2443-2451. doi:10.1182/blood-2015-07-533588
106. Visnjic D, Kalajzic Z, Rowe DW, Katavic V, Lorenzo J, Aguila HL. Hematopoiesis is severely altered in mice with an induced osteoblast deficiency. Blood. 2004;103(9):3258-3264. doi:10.1182/blood-2003-11-4011
107. Huber TL, Kouskoff V, Fehling HJ, Palis J, Keller G. Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature. 2004;432(7017):625-630. doi:10.1038/nature03122
Page | 159
108. Rafii S, Shapiro F, Pettengell R, et al. Human bone marrow microvascular endothelial cells support long-term proliferation and differentiation of myeloid and megakaryocytic progenitors. Blood. 1995;86(9):3353-3363.
109. Hess DA, Meyerrose TE, Wirthlin L, et al. Functional characterization of highly purified human hematopoietic repopulating cells isolated according to aldehyde dehydrogenase activity. Blood. 2004;104(6):1648-1655. doi:10.1182/blood-2004-02- 0448
110. Avecilla ST, Hattori K, Heissig B, et al. Chemokine-mediated interaction of hematopoietic progenitors with the bone marrow vascular niche is required for thrombopoiesis. Nat Med. 2004;10(1):64-71. doi:10.1038/nm973
111. Rafii S, Mohle R, Shapiro F, Frey BM, Moore MA. Regulation of hematopoiesis by microvascular endothelium. Leuk Lymphoma. 1997;27(5-6):375-386. doi:10.3109/10428199709058305
112. Heissig B, Hattori K, Dias S, et al. Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell. 2002;109(5):625-637. doi:10.1016/s0092-8674(02)00754-7
113. Kiel MJ, Morrison SJ. Uncertainty in the niches that maintain haematopoietic stem cells. Nat Rev Immunol. 2008;8(4):290-301. doi:10.1038/nri2279
114. Kiel MJ, Yilmaz ÖH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM Family Receptors Distinguish Hematopoietic Stem and Progenitor Cells and Reveal Endothelial Niches for Stem Cells. Cell. 2005;121(7):1109-1121. doi:10.1016/j.cell.2005.05.026
115. Sugiyama T, Kohara H, Noda M, Nagasawa T. Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches. Immunity. 2006;25(6):977-988. doi:10.1016/j.immuni.2006.10.016
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
116. Arai F, Hirao A, Ohmura M, et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell. 2004;118(2):149- 161. doi:10.1016/j.cell.2004.07.004
117. Hosokawa K, Arai F, Yoshihara H, et al. Knockdown of N-cadherin suppresses the long-term engraftment of hematopoietic stem cells. Blood. 2010;116(4):554-563. doi:10.1182/blood-2009-05-224857
118. Nilsson SK, Johnston HM, Whitty GA, et al. Osteopontin, a key component of the hematopoietic stem cell niche and regulator of primitive hematopoietic progenitor cells. Blood. 2005;106(4):1232-1239. doi:10.1182/blood-2004-11-4422
119. Lapidot T. Mechanism of human stem cell migration and repopulation of NOD/SCID and B2mnull NOD/SCID mice. The role of SDF-1/CXCR4 interactions. Ann N Y Acad Sci. 2001;938:83-95. doi:10.1111/j.1749-6632.2001.tb03577.x
120. Yin T, Li L. The stem cell niches in bone. J Clin Invest. 2006;116(5):1195-1201. doi:10.1172/JCI28568
121. Kaushansky K. Lineage-specific hematopoietic growth factors. N Engl J Med. 2006;354(19):2034-2045. doi:10.1056/NEJMra052706
122. Schäfer R, DeBaun MR, Fleck E, et al. Quantitation of progenitor cell populations and growth factors after bone marrow aspirate concentration. J Transl Med. 2019;17(1):115. doi:10.1186/s12967-019-1866-7
123. Kaushansky K. Lineage-specific hematopoietic growth factors. N Engl J Med. 2006;354(19):2034-2045. doi:10.1056/NEJMra052706
124. Buza-Vidas N, Antonchuk J, Qian H, et al. Cytokines regulate postnatal hematopoietic stem cell expansion: opposing roles of thrombopoietin and LNK. Genes Dev. 2006;20(15):2018-2023. doi:10.1101/gad.385606
Page | 161
125. Mackarehtschian K, Hardin JD, Moore KA, Boast S, Goff SP, Lemischka IR. Targeted disruption of the flk2/flt3 gene leads to deficiencies in primitive hematopoietic progenitors. Immunity. 1995;3(1):147-161. doi:10.1016/1074-7613(95)90167-1
126. Maurer A-M, Zhou B, Han ZC. Roles of platelet factor 4 in hematopoiesis and angiogenesis. Growth Factors Chur Switz. 2006;24(4):242-252. doi:10.1080/08977190600988225
127. Taichman RS, Reilly MJ, Matthews LS. Human osteoblast-like cells and osteosarcoma cell lines synthesize macrophage inhibitory protein 1alpha in response to interleukin 1beta and tumour necrosis factor alpha stimulation in vitro. Br J Haematol. 2000;108(2):275-283. doi:10.1046/j.1365-2141.2000.01873.x
128. Sauvageau G, Thorsteinsdottir U, Eaves CJ, et al. Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev. 1995;9(14):1753-1765. doi:10.1101/gad.9.14.1753
129. Buske C, Feuring-Buske M, Abramovich C, et al. Deregulated expression of HOXB4 enhances the primitive growth activity of human hematopoietic cells. Blood. 2002;100(3):862-868. doi:10.1182/blood-2002-01-0220
130. Boitano AE, Wang J, Romeo R, et al. Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells. Science. 2010;329(5997):1345-1348. doi:10.1126/science.1191536
131. Fang B, Zheng C, Liao L, et al. Identification of human chronic myelogenous leukemia progenitor cells with hemangioblastic characteristics. Blood. 2005;105(7):2733-2740. doi:10.1182/blood-2004-07-2514
132. Bhatia R, Holtz M, Niu N, et al. Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment. Blood. 2003;101(12):4701-4707. doi:10.1182/blood-2002-09-2780
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
133. Zhu J, Emerson SG. Hematopoietic cytokines, transcription factors and lineage commitment. Oncogene. 2002;21(21):3295-3313. doi:10.1038/sj.onc.1205318
134. Herrmann H, Cerny-Reiterer S, Gleixner KV, et al. CD34(+)/CD38(-) stem cells in chronic myeloid leukemia express Siglec-3 (CD33) and are responsive to the CD33- targeting drug gemtuzumab/ozogamicin. Haematologica. 2012;97(2):219-226. doi:10.3324/haematol.2010.035006
135. Landberg N, von Palffy S, Askmyr M, et al. CD36 defines primitive chronic myeloid leukemia cells less responsive to imatinib but vulnerable to antibody-based therapeutic targeting. Haematologica. 2018;103(3):447-455. doi:10.3324/haematol.2017.169946
136. Valent P, Sadovnik I, Ráčil Z, et al. DPPIV (CD26) as a novel stem cell marker in Ph+ chronic myeloid leukaemia. Eur J Clin Invest. 2014;44(12):1239-1245. doi:10.1111/eci.12368
137. Bocchia M, Sicuranza A, Abruzzese E, et al. Residual Peripheral Blood CD26+ Leukemic Stem Cells in Chronic Myeloid Leukemia Patients During TKI Therapy and During Treatment-Free Remission. Front Oncol. 2018;8:194. doi:10.3389/fonc.2018.00194
138. Landberg N, Hansen N, Askmyr M, et al. IL1RAP expression as a measure of leukemic stem cell burden at diagnosis of chronic myeloid leukemia predicts therapy outcome. Leukemia. 2016;30(1):253-257. doi:10.1038/leu.2015.135
139. Sadovnik I, Herrmann H, Eisenwort G, et al. Expression of CD25 on leukemic stem cells in BCR-ABL1+ CML: Potential diagnostic value and functional implications. Exp Hematol. 2017;51:17-24. doi:10.1016/j.exphem.2017.04.003
140. Herrmann H, Sadovnik I, Cerny-Reiterer S, et al. Dipeptidylpeptidase IV (CD26) defines leukemic stem cells (LSC) in chronic myeloid leukemia. Blood. 2014;123(25):3951-3962. doi:10.1182/blood-2013-10-536078
Page | 163
141. Matteucci E, Giampietro O. Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 2009;16(23):2943-2951. doi:10.2174/092986709788803114
142. Warfvinge R, Geironson L, Sommarin MNE, et al. Single-cell molecular analysis defines therapy response and immunophenotype of stem cell subpopulations in CML. Blood. 2017;129(17):2384-2394. doi:10.1182/blood-2016-07-728873
143. Houshmand M, Soleimani M, Atashi A, Saglio G, Abdollahi M, Nikougoftar Zarif M. Mimicking the Acute Myeloid Leukemia Niche for Molecular Study and Drug Screening. Tissue Eng Part C Methods. 2017;23(2):72-85. doi:10.1089/ten.TEC.2016.0404
144. Méndez-Ferrer S, Michurina TV, Ferraro F, et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature. 2010;466(7308):829-834. doi:10.1038/nature09262
145. Wilson A, Trumpp A. Bone-marrow haematopoietic-stem-cell niches. Nat Rev Immunol. 2006;6(2):93-106. doi:10.1038/nri1779
146. Sánchez-Aguilera A, Méndez-Ferrer S. The hematopoietic stem-cell niche in health and leukemia. Cell Mol Life Sci CMLS. 2017;74(4):579-590. doi:10.1007/s00018-016-2306-y
147. Banavali SD, Hulette BC, Preisler HD, Silvestri FF, Civin CI. Isolation and characterization of the cd34+ hematopoietic progenitor cells from the peripheral blood of patients with chronic myeloid leukemia. Int J Cell Cloning. 1991;9(5):474-490. doi:10.1002/stem.1991.5530090505
148. Elefanty AG, Hariharan IK, Cory S. bcr-abl, the hallmark of chronic myeloid leukaemia in man, induces multiple haemopoietic neoplasms in mice. EMBO J. 1990;9(4):1069-1078.
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
149. Koschmieder S, Göttgens B, Zhang P, et al. Inducible chronic phase of myeloid leukemia with expansion of hematopoietic stem cells in a transgenic model of BCR- ABL leukemogenesis. Blood. 2005;105(1):324-334. doi:10.1182/blood-2003-12-4369
150. Schemionek M, Elling C, Steidl U, et al. BCR-ABL enhances differentiation of long-term repopulating hematopoietic stem cells. Blood. 2010;115(16):3185-3195. doi:10.1182/blood-2009-04-215376
151. Schemionek M, Spieker T, Kerstiens L, et al. Leukemic spleen cells are more potent than bone marrow-derived cells in a transgenic mouse model of CML. Leukemia. 2012;26(5):1030-1037. doi:10.1038/leu.2011.366
152. Dazzi F, Capelli D, Hasserjian R, et al. The kinetics and extent of engraftment of chronic myelogenous leukemia cells in non-obese diabetic/severe combined immunodeficiency mice reflect the phase of the donor’s disease: an in vivo model of chronic myelogenous leukemia biology. Blood. 1998;92(4):1390-1396.
153. Wang JC, Lapidot T, Cashman JD, et al. High level engraftment of NOD/SCID mice by primitive normal and leukemic hematopoietic cells from patients with chronic myeloid leukemia in chronic phase. Blood. 1998;91(7):2406-2414.
154. Antonelli A, Noort WA, Jaques J, et al. Establishing human leukemia xenograft mouse models by implanting human bone marrow-like scaffold-based niches. Blood. 2016;128(25):2949-2959. doi:10.1182/blood-2016-05-719021
155. Eisterer W, Jiang X, Christ O, et al. Different subsets of primary chronic myeloid leukemia stem cells engraft immunodeficient mice and produce a model of the human disease. Leukemia. 2005;19(3):435-441. doi:10.1038/sj.leu.2403649
156. Hawkins ED, Duarte D, Akinduro O, et al. T-cell acute leukaemia exhibits dynamic interactions with bone marrow microenvironments. Nature. 2016;538(7626):518-522. doi:10.1038/nature19801
157. Lozzio CB, Lozzio BB. Human chronic myelogenous leukemia cell-line with positive Philadelphia chromosome. Blood. 1975;45(3):321-334.
Page | 165
158. Issaad C, Ahmed M, Novault S, et al. Biological effects induced by variable levels of BCR-ABL protein in the pluripotent hematopoietic cell line UT-7. Leukemia. 2000;14(4):662-670. doi:10.1038/sj.leu.2401730
159. Chomel J-C, Sorel N, Guilhot J, Guilhot F, Turhan AG. BCR-ABL expression in leukemic progenitors and primitive stem cells of patients with chronic myeloid leukemia. Blood. 2012;119(12):2964-2965; author reply 2965-2966. doi:10.1182/blood-2011-12- 396226
160. Gentil M, Hugues P, Desterke C, et al. Aryl hydrocarbon receptor (AHR) is a novel druggable pathway controlling malignant progenitor proliferation in chronic myeloid leukemia (CML). PloS One. 2018;13(8):e0200923. doi:10.1371/journal.pone.0200923
161. Takahashi, Yamanaka. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell. 2006. doi:10.1016/j.cell.2006.07.024
162. Yu J, Vodyanik MA, Smuga-Otto K, et al. Induced pluripotent stem cell lines derived from human somatic cells. Science. 2007;318(5858):1917-1920. doi:10.1126/science.1151526
163. Park I-H, Arora N, Huo H, et al. Disease-specific induced pluripotent stem cells. Cell. 2008;134(5):877-886. doi:10.1016/j.cell.2008.07.041
164. Carette JE, Pruszak J, Varadarajan M, et al. Generation of iPSCs from cultured human malignant cells. Blood. 2010;115(20):4039-4042. doi:10.1182/blood-2009-07- 231845
165. Turhan A, Foudi A, Hwang JW, Desterke C, Griscelli F, Bennaceur-Griscelli A. Modeling malignancies using induced pluripotent stem cells: from chronic myeloid leukemia to hereditary cancers. Exp Hematol. 2019;71:61-67. doi:10.1016/j.exphem.2019.01.003
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
166. Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2018 update on diagnosis, therapy and monitoring. Am J Hematol. 2018;93(3):442-459. doi:10.1002/ajh.25011
167. Hochhaus A, Saussele S, Rosti G, et al. Chronic myeloid leukaemia: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up†. Ann Oncol. 2017;28(suppl_4):iv41-iv51. doi:10.1093/annonc/mdx219
168. Pallera A, Altman J, Radich J. NCCN Guidelines Insights: Chronic Myeloid Leukemia, Version 1.2017 in: Journal of the National Comprehensive Cancer Network Volume 14 Issue 12 (2016). J Natl Compr Canc Netw. 2017. https://jnccn.org/view/journals/jnccn/14/12/article-p1505.xml?print&print. Accessed September 12, 2019.
169. Apperley JF. CML and tyrosine kinase inhibition: the hope becomes reality. Lancet Haematol. 2015;2(5):e176-177. doi:10.1016/S2352-3026(15)00072-1
170. Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood. 2016;127(20):2391-2405. doi:10.1182/blood-2016-03-643544
171. Hehlmann R, Hochhaus A, Baccarani M, European LeukemiaNet. Chronic myeloid leukaemia. Lancet Lond Engl. 2007;370(9584):342-350. doi:10.1016/S0140- 6736(07)61165-9
172. Clarke CJ, Holyoake TL. Preclinical approaches in chronic myeloid leukemia: from cells to systems. Exp Hematol. 2017;47:13-23. doi:10.1016/j.exphem.2016.11.005
173. Haddow A, Timmis G. Myleran in chronic myeloid leukaemia; chemical constitution and biological action. Lancet Lond Engl. 1953. doi:10.1016/s0140- 6736(53)90884-8
174. Hematologic remission and cytogenetic improvement induced by recombinant human interferon alpha A in chronic myelogenous leukemia. - PubMed - NCBI.
Page | 167
https://www-ncbi-nlm-nih-gov.gate2.inist.fr/pubmed/3457264. Accessed September 12, 2019.
175. Hehlmann R, Heimpel H, Heinzel B. ThRandomized comparison of interferon- alpha with busulfan and hydroxyurea in chronic myelogenous leukemia. Blood. 1994. doi:7994025
176. Kirken RA, Erwin RA, Taub D, et al. Tyrphostin AG-490 inhibits cytokine- mediated JAK3/STAT5a/b signal transduction and cellular proliferation of antigen- activated human T cells. J Leukoc Biol. 1999;65(6):891-899. doi:10.1002/jlb.65.6.891
177. Druker B. Imatinib (Gleevec®) as a Paradigm of Targeted Cancer Therapies. Keio J Med. 2010;59(1):1-3. doi:10.2302/kjm.59.1
178. Gambacorti-Passerini C. Part I: Milestones in personalised medicine—imatinib. Lancet Oncol. 2008;9(6):600. doi:10.1016/S1470-2045(08)70152-9
179. Edwin E, Osgood MD, Mathews MD. Aplastic anemia treated daily transfusions intravenous marrow case report. Ann Intern Med. 1939. doi:10.7326/0003-4819-13-2- 357
180. Koval, Shamrai. Effect of bone marrow transplantation on the activity of lethally irradiated animals. Vrach Delo. 1975. doi:766405
181. Barnes, Corp, Neal. Treatment of murine leukaemia with X rays and homologous bone marrow; preliminary communication. Br Med J. 1956. doi:10.1136/bmj.2.4993.626
182. Georges Mathé / Histoire de l’Inserm. https://histoire.inserm.fr/les-femmes-et- les-hommes/georges-mathe. Accessed March 5, 2020.
183. Thomas E, Lochte H, Ferrebee J. Intravenous infusion of bone marrow in patients receiving radiation and chemotherapy. N Engl J Med. 1957. doi:10.1056/NEJM195709122571102
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
184. Uchida N, Tsukamoto A, He D, Friera AM, Scollay R, Weissman IL. High doses of purified stem cells cause early hematopoietic recovery in syngeneic and allogeneic hosts. J Clin Invest. 1998;101(5):961-966. doi:10.1172/JCI1681
185. Thomas E, Buckner C, Weiden P. One hundred patients with acute leukemia treated by chemotherapy, total body irradiation, and allogeneic marrow transplantation. Blood. 1977. doi:14751
186. Loren Gragert, Martin Maiers, Mari Eapen. HLA Match Likelihoods for Hematopoietic Stem-Cell Grafts in the U.S. Registry | NEJM. N Engl J Med. 2014. doi:10.1056/NEJMsa1311707
187. Worldwide Network for Blood & Marrow Transplantation (WBMT) [General information, Bylaws, Presentations]. https://www.wbmt.org/general-information- bylaws-presentations. Accessed September 13, 2019.
188. Speck B, Bortin MM, Champlin R, et al. Allogeneic bone-marrow transplantation for chronic myelogenous leukaemia. Lancet Lond Engl. 1984;1(8378):665-668. doi:10.1016/s0140-6736(84)92179-2
189. Apperley JF, Jones L, Hale G, et al. Bone marrow transplantation for patients with chronic myeloid leukaemia: T-cell depletion with Campath-1 reduces the incidence of graft-versus-host disease but may increase the risk of leukaemic relapse. Bone Marrow Transplant. 1986;1(1):53-66.
190. Schattenberg A, Preijers F, Mensink E, et al. Survival in first or second remission after lymphocyte-depleted transplantation for Philadelphia chromosome-positive CML in first chronic phase. Bone Marrow Transplant. 1997;19(12):1205-1212. doi:10.1038/sj.bmt.1700824
191. Sehn LH, Alyea EP, Weller E, et al. Comparative outcomes of T-cell-depleted and non-T-cell-depleted allogeneic bone marrow transplantation for chronic myelogenous leukemia: impact of donor lymphocyte infusion. J Clin Oncol Off J Am Soc Clin Oncol. 1999;17(2):561-568. doi:10.1200/JCO.1999.17.2.561
Page | 169
192. Mahon F-X, Réa D, Guilhot J, et al. Discontinuation of imatinib in patients with chronic myeloid leukaemia who have maintained complete molecular remission for at least 2 years: the prospective, multicentre Stop Imatinib (STIM) trial. Lancet Oncol. 2010;11(11):1029-1035. doi:10.1016/S1470-2045(10)70233-3
193. Etienne MC, Lagrange JL, Dassonville O, et al. Population study of dihydropyrimidine dehydrogenase in cancer patients. J Clin Oncol Off J Am Soc Clin Oncol. 1994;12(11):2248-2253. doi:10.1200/JCO.1994.12.11.2248
194. Hehlmann R, Heimpel H, Hasford J, et al. Randomized comparison of busulfan and hydroxyurea in chronic myelogenous leukemia: prolongation of survival by hydroxyurea. The German CML Study Group. Blood. 1993;82(2):398-407.
195. Guilhot F, Chastang C, Michallet M, et al. Interferon alfa-2b combined with cytarabine versus interferon alone in chronic myelogenous leukemia. French Chronic Myeloid Leukemia Study Group. N Engl J Med. 1997;337(4):223-229. doi:10.1056/NEJM199707243370402
196. Talpaz M, Kantarjian HM, McCredie K, Trujillo JM, Keating MJ, Gutterman JU. Hematologic Remission and Cytogenetic Improvement Induced by Recombinant Human Interferon AlphaA in Chronic Myelogenous Leukemia. N Engl J Med. 1986;314(17):1065-1069. doi:10.1056/NEJM198604243141701
197. Larson RA. Is there a best TKI for chronic phase CML? Blood. 2015;126(21):2370-2375. doi:10.1182/blood-2015-06-641043
198. Deininger MW, O’Brien, Druker BJ. International Randomized Study of Interferon Vs STI571 (IRIS) 8-Year Follow up: Sustained Survival and Low Risk for Progression or Events in Patients with Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase (CML-CP) Treated with Imatinib. Blood. 2009. doi:10.1182/blood.V114.22.1126.1126
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
199. Monnereau A, Troussard X, Belot A, et al. Unbiased estimates of long-term net survival of hematological malignancy patients detailed by major subtypes in France. Int J Cancer. 2013;132(10):2378-2387. doi:10.1002/ijc.27889
200. Druker BJ, Tamura S, Buchdunger E, et al. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med. 1996;2(5):561- 566. doi:10.1038/nm0596-561
201. Nagar B, Bornmann WG, Pellicena P, et al. Crystal structures of the kinase domain of c-Abl in complex with the small molecule inhibitors PD173955 and imatinib (STI-571). Cancer Res. 2002;62(15):4236-4243.
202. Deininger MW, Goldman JM, Lydon N, Melo JV. The tyrosine kinase inhibitor CGP57148B selectively inhibits the growth of BCR-ABL-positive cells. Blood. 1997;90(9):3691-3698.
203. O’Brien SG, Guilhot F, Larson RA, et al. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med. 2003;348(11):994-1004. doi:10.1056/NEJMoa022457
204. Hughes T, Saglio G, Hochhaus A. Early molecular response predicts outcomes in patients with chronic myeloid leukemia in chronic phase treated with frontline nilotinib or imatinib. Blood. 2014. doi:10.1182/blood-2013-06-510396
205. Walz C, Sattler M. Novel targeted therapies to overcome imatinib mesylate resistance in chronic myeloid leukemia (CML). Crit Rev Oncol Hematol. 2006;57(2):145-164. doi:10.1016/j.critrevonc.2005.06.007
206. Lombardo LJ, Lee FY, Chen P, et al. Discovery of N-(2-chloro-6-methyl- phenyl)- 2-(6-(4-(2-hydroxyethyl)- piperazin-1-yl)-2-methylpyrimidin-4- ylamino)thiazole-5- carboxamide (BMS-354825), a dual Src/Abl kinase inhibitor with potent antitumor activity in preclinical assays. J Med Chem. 2004;47(27):6658-6661. doi:10.1021/jm049486a
Page | 171
207. Muller, Cortes J, Kin D. Dasatinib treatment of chronic-phase chronic myeloid leukemia: analysis of responses according to preexisting BCR-ABL mutations. Blood. 2009. doi:10.1182/blood-2009-04-214221
208. Kantarjian HM, Shah, Baccarani M. Dasatinib versus imatinib in newly diagnosed chronic-phas... - Google Scholar. N Engl J Med. 2010. doi:10.1056/NEJMoa1002315
209. Talpaz M, Shah NP, Kantarjian H, et al. Dasatinib in imatinib-resistant Philadelphia chromosome-positive leukemias. N Engl J Med. 2006;354(24):2531- 2541. doi:10.1056/NEJMoa055229
210. Milojkovic D, Apperley JF, Gerrard G, et al. Responses to second-line tyrosine kinase inhibitors are durable: an intention-to-treat analysis in chronic myeloid leukemia patients. Blood. 2012;119(8):1838-1843. doi:10.1182/blood-2011-10-383000
211. Miura M. Therapeutic Drug Monitoring of Imatinib, Nilotinib, and Dasatinib for Patients with Chronic Myeloid Leukemia. Biol Pharm Bull. 2015;38(5):645-654. doi:10.1248/bpb.b15-00103
212. Shah N, Guilhot F, Saglio G. Long-term outcome with dasatinib after imatinib failure in chronic-phase chronic myeloid leukemia: follow-up of a phase 3 study. Blood. 2014. doi:10.1182/blood-2013-10-532341
213. Jabbour E, Kantarjian HM, Hochhaus A. Early response with dasatinib or imatinib in chronic myeloid leukemia: 3-year follow-up from a randomized phase 3 trial (DASISION). Blood. 2014. doi:10.1182/blood-2013-06-511592
214. Kantarjian HM, Giles F, Gattermann N, et al. Nilotinib (formerly AMN107), a highly selective BCR-ABL tyrosine kinase inhibitor, is effective in patients with Philadelphia chromosome-positive chronic myelogenous leukemia in chronic phase following imatinib resistance and intolerance. Blood. 2007;110(10):3540-3546. doi:10.1182/blood-2007-03-080689
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
215. Kantarjian H, Giles F, Wunderle L, et al. Nilotinib in imatinib-resistant CML and Philadelphia chromosome-positive ALL. N Engl J Med. 2006;354(24):2542-2551. doi:10.1056/NEJMoa055104
216. Giles FJ, le Coutre PD, Pinilla-Ibarz J, et al. Nilotinib in imatinib-resistant or imatinib-intolerant patients with chronic myeloid leukemia in chronic phase: 48-month follow-up results of a phase II study. Leukemia. 2013;27(1):107-112. doi:10.1038/leu.2012.181
217. Hochhaus A, Saglio G, Hughes TP. Nilotinib is associated with a reduced incidence of BCR-ABL mutations vs imatinib in patients with newly diagnosed chronic myeloid leukemia in chronic phase. Blood. 2013. doi:10.1182/blood-2012-04-423418
218. Larson RA, Kim D-W, Hughes TP. Efficacy and Safety of Nilotinib (NIL) vs Imatinib (IM) in Patients (pts) With Newly Diagnosed Chronic Myeloid Leukemia in Chronic Phase (CML-CP): Long-Term Follow-Up (f/u) of ENESTnd. Blood. 2014. doi:10.1182/blood.V124.21.4541.4541
219. Larson RA, Kim D-W, Hughes TP. ENESTnd 5-year (y) update: Long-term outcomes of patients (pts) with chronic myeloid leukemia in chronic phase (CML-CP) treated with frontline nilotinib (NIL) versus imatinib (IM). J Clin Oncol. 2014. doi:014 32:15_suppl, 7073-7073
220. Khoury HJ, Cortes JE, Kantarjian HM, et al. Bosutinib is active in chronic phase chronic myeloid leukemia after imatinib and dasatinib and/or nilotinib therapy failure. Blood. 2012;119(15):3403-3412. doi:10.1182/blood-2011-11-390120
221. Redaelli S, Piazza R, Rostagno R, et al. Activity of bosutinib, dasatinib, and nilotinib against 18 imatinib-resistant BCR/ABL mutants. J Clin Oncol Off J Am Soc Clin Oncol. 2009;27(3):469-471. doi:10.1200/JCO.2008.19.8853
222. Gambacorti-Passerini C, Brümmendorf TH, Kim D-W, et al. Bosutinib efficacy and safety in chronic phase chronic myeloid leukemia after imatinib resistance or
Page | 173
intolerance: Minimum 24-month follow-up. Am J Hematol. 2014;89(7):732-742. doi:10.1002/ajh.23728
223. Miller GD, Bruno BJ, Lim CS. Resistant mutations in CML and Ph(+)ALL - role of ponatinib. Biol Targets Ther. 2014;8:243-254. doi:10.2147/BTT.S50734
224. Wehrle J, von Bubnoff N. Ponatinib: A Third-Generation Inhibitor for the Treatment of CML. Recent Results Cancer Res Fortschritte Krebsforsch Progres Dans Rech Sur Cancer. 2018;212:109-118. doi:10.1007/978-3-319-91439-8_5
225. Cortes J, Kim D-W, Kantarjian HM. A phase 2 trial of ponatinib in Philadelphia chromosome-positive leukemias. N Engl J Med. 2013. doi:10.1056/NEJMoa1306494
226. Cortes J, Kantarjian HM, Turner. Ponatinib in Refractory Philadelphia Chromosome–Positive Leukemias. N Engl J Med. 2012. doi:10.1056/NEJMoa1205127
227. Kuwazuru Y, Yoshimura A, Hanada S, et al. Expression of the multidrug transporter, P-glycoprotein, in chronic myelogenous leukaemia cells in blast crisis. Br J Haematol. 1990;74(1):24-29. doi:10.1111/j.1365-2141.1990.tb02533.x
228. Mahon F-X, Belloc F, Lagarde V, et al. MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models. Blood. 2003;101(6):2368- 2373. doi:10.1182/blood.V101.6.2368
229. Thomas J, Wang L, Clark RE, Pirmohamed M. Active transport of imatinib into and out of cells: implications for drug resistance. Blood. 2004;104(12):3739-3745. doi:10.1182/blood-2003-12-4276
230. Crossman LC, Druker BJ, Deininger MWN, Pirmohamed M, Wang L, Clark RE. hOCT 1 and resistance to imatinib. Blood. 2005;106(3):1133-1134; author reply 1134. doi:10.1182/blood-2005-02-0694
231. White DL, Saunders VA, Dang P, et al. Most CML patients who have a suboptimal response to imatinib have low OCT-1 activity: higher doses of imatinib may
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
overcome the negative impact of low OCT-1 activity. Blood. 2007;110(12):4064-4072. doi:10.1182/blood-2007-06-093617
232. Hiwase DK, Saunders V, Hewett D, et al. Dasatinib cellular uptake and efflux in chronic myeloid leukemia cells: therapeutic implications. Clin Cancer Res Off J Am Assoc Cancer Res. 2008;14(12):3881-3888. doi:10.1158/1078-0432.CCR-07-5095
233. White DL, Saunders VA, Dang P, et al. OCT-1-mediated influx is a key determinant of the intracellular uptake of imatinib but not nilotinib (AMN107): reduced OCT-1 activity is the cause of low in vitro sensitivity to imatinib. Blood. 2006;108(2):697-704. doi:10.1182/blood-2005-11-4687
234. Geahlen RL, Handley MD, Harrison ML. Molecular interdiction of Src-family kinase signaling in hematopoietic cells. Oncogene. 2004;23(48):8024-8032. doi:10.1038/sj.onc.1208078
235. Donato NJ, Wu JY, Stapley J, et al. BCR-ABL independence and LYN kinase overexpression in chronic myelogenous leukemia cells selected for resistance to STI571. Blood. 2003;101(2):690-698. doi:10.1182/blood.V101.2.690
236. Hu Y, Swerdlow S, Duffy TM, Weinmann R, Lee FY, Li S. Targeting multiple kinase pathways in leukemic progenitors and stem cells is essential for improved treatment of Ph+ leukemia in mice. Proc Natl Acad Sci U S A. 2006;103(45):16870- 16875. doi:10.1073/pnas.0606509103
237. Schindler T, Bornmann W, Pellicena P, Miller WT, Clarkson B, Kuriyan J. Structural mechanism for STI-571 inhibition of abelson tyrosine kinase. Science. 2000;289(5486):1938-1942. doi:10.1126/science.289.5486.1938
238. Mahon F-X, Hayette S, Lagarde V, et al. Evidence that resistance to nilotinib may be due to BCR-ABL, Pgp, or Src kinase overexpression. Cancer Res. 2008;68(23):9809-9816. doi:10.1158/0008-5472.CAN-08-1008
Page | 175
239. Jamieson CHM, Ailles LE, Dylla SJ, et al. Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med. 2004;351(7):657- 667. doi:10.1056/NEJMoa040258
240. Gorre ME, Mohammed M, Ellwood K, et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science. 2001;293(5531):876-880. doi:10.1126/science.1062538
241. Hochhaus A, Kreil S, Corbin AS, et al. Molecular and chromosomal mechanisms of resistance to imatinib (STI571) therapy. Leukemia. 2002;16(11):2190-2196. doi:10.1038/sj.leu.2402741
242. Barnes DJ, Palaiologou D, Panousopoulou E, et al. Bcr-Abl expression levels determine the rate of development of resistance to imatinib mesylate in chronic myeloid leukemia. Cancer Res. 2005;65(19):8912-8919. doi:10.1158/0008-5472.CAN-05- 0076
243. Quintás-Cardama A, Kantarjian HM, Cortes JE. Mechanisms of primary and secondary resistance to imatinib in chronic myeloid leukemia. Cancer Control J Moffitt Cancer Cent. 2009;16(2):122-131. doi:10.1177/107327480901600204
244. Nicolini FE, Corm S, Lê Q-H, et al. Mutation status and clinical outcome of 89 imatinib mesylate-resistant chronic myelogenous leukemia patients: a retrospective analysis from the French intergroup of CML (Fi(phi)-LMC GROUP). Leukemia. 2006;20(6):1061-1066. doi:10.1038/sj.leu.2404236
245. Jabbour E, Kantarjian H, Jones D, et al. Characteristics and outcomes of patients with chronic myeloid leukemia and T315I mutation following failure of imatinib mesylate therapy. Blood. 2008;112(1):53-55. doi:10.1182/blood-2007-11-123950
246. Nicolini FE, Hayette S, Corm S, et al. Clinical outcome of 27 imatinib mesylate- resistant chronic myelogenous leukemia patients harboring a T315I BCR-ABL mutation. Haematologica. 2007;92(9):1238-1241. doi:10.3324/haematol.11369
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
247. Soverini S, Colarossi S, Gnani A, et al. Contribution of ABL kinase domain mutations to imatinib resistance in different subsets of Philadelphia-positive patients: by the GIMEMA Working Party on Chronic Myeloid Leukemia. Clin Cancer Res Off J Am Assoc Cancer Res. 2006;12(24):7374-7379. doi:10.1158/1078-0432.CCR-06- 1516
248. Brandford S, Rudzki Z, Hughes T. Detection of BCR-ABL mutations in patients with CML treated with imatinib is virtually always accompanied by clinical resistance, and mutations in the ATP phosphate-binding loop (P-loop) are associated with a poor prognosis. Blood. 2003. doi:10.1182/blood-2002-09-2896
249. Griswold IJ, MacPartlin M, Bumm T, et al. Kinase domain mutants of Bcr-Abl exhibit altered transformation potency, kinase activity, and substrate utilization, irrespective of sensitivity to imatinib. Mol Cell Biol. 2006;26(16):6082-6093. doi:10.1128/MCB.02202-05
250. Soverini S, Martinelli G, Rosti G, et al. ABL mutations in late chronic phase chronic myeloid leukemia patients with up-front cytogenetic resistance to imatinib are associated with a greater likelihood of progression to blast crisis and shorter survival: a study by the GIMEMA Working Party on Chronic Myeloid Leukemia. J Clin Oncol Off J Am Soc Clin Oncol. 2005;23(18):4100-4109. doi:10.1200/JCO.2005.05.531
251. Khorashad JS, de Lavallade H, Apperley JF, et al. Finding of kinase domain mutations in patients with chronic phase chronic myeloid leukemia responding to imatinib may identify those at high risk of disease progression. J Clin Oncol Off J Am Soc Clin Oncol. 2008;26(29):4806-4813. doi:10.1200/JCO.2008.16.9953
252. Soverini S, Gnani A, Colarossi S, et al. Philadelphia-positive patients who already harbor imatinib-resistant Bcr-Abl kinase domain mutations have a higher likelihood of developing additional mutations associated with resistance to second- or third-line tyrosine kinase inhibitors. Blood. 2009;114(10):2168-2171. doi:10.1182/blood-2009- 01-197186
Page | 177
253. Mahon FX, Deininger MW, Schultheis B, et al. Selection and characterization of BCR-ABL positive cell lines with differential sensitivity to the tyrosine kinase inhibitor STI571: diverse mechanisms of resistance. Blood. 2000;96(3):1070-1079.
254. Graham SM, Jørgensen HG, Allan E, et al. Primitive, quiescent, Philadelphia- positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro. Blood. 2002;99(1):319-325. doi:10.1182/blood.v99.1.319
255. Copland M, Hamilton A, Elrick LJ, et al. Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction. Blood. 2006;107(11):4532-4539. doi:10.1182/blood-2005-07-2947
256. Jørgensen HG, Allan EK, Jordanides NE, Mountford JC, Holyoake TL. Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells. Blood. 2007;109(9):4016-4019. doi:10.1182/blood-2006-11-057521
257. Corbin AS, Agarwal A, Loriaux M, Cortes J, Deininger MW, Druker BJ. Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity. J Clin Invest. 2011;121(1):396-409. doi:10.1172/JCI35721
258. Kumari A, Brendel C, Hochhaus A, Neubauer A, Burchert A. Low BCR-ABL expression levels in hematopoietic precursor cells enable persistence of chronic myeloid leukemia under imatinib. Blood. 2012;119(2):530-539. doi:10.1182/blood- 2010-08-303495
259. Houshmand M, Simonetti G, Circosta P, et al. Chronic myeloid leukemia stem cells. Leukemia. 2019;33(7):1543-1556. doi:10.1038/s41375-019-0490-0
260. Zhao C, Blum J, Chen A, et al. Loss of beta-catenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell. 2007;12(6):528-541. doi:10.1016/j.ccr.2007.11.003
261. Fleming HE, Janzen V, Lo Celso C, et al. Wnt signaling in the niche enforces hematopoietic stem cell quiescence and is necessary to preserve self-renewal in vivo. Cell Stem Cell. 2008;2(3):274-283. doi:10.1016/j.stem.2008.01.003
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
262. Cobas M, Wilson A, Ernst B, et al. Beta-catenin is dispensable for hematopoiesis and lymphopoiesis. J Exp Med. 2004;199(2):221-229. doi:10.1084/jem.20031615
263. Nakahara F, Sakata-Yanagimoto M, Komeno Y, et al. Hes1 immortalizes committed progenitors and plays a role in blast crisis transition in chronic myelogenous leukemia. Blood. 2010;115(14):2872-2881. doi:10.1182/blood-2009-05-222836
264. Briscoe J, Thérond PP. The mechanisms of Hedgehog signalling and its roles in development and disease. Nat Rev Mol Cell Biol. 2013;14(7):416-429. doi:10.1038/nrm3598
265. Zhao C, Chen A, Jamieson CH, et al. Hedgehog signalling is essential for maintenance of cancer stem cells in myeloid leukaemia. Nature. 2009;458(7239):776- 779. doi:10.1038/nature07737
266. Ito K, Bernardi R, Morotti A, et al. PML targeting eradicates quiescent leukaemia- initiating cells. Nature. 2008;453(7198):1072-1078. doi:10.1038/nature07016
267. Hurtz C, Hatzi K, Cerchietti L, et al. BCL6-mediated repression of p53 is critical for leukemia stem cell survival in chronic myeloid leukemia. J Exp Med. 2011;208(11):2163-2174. doi:10.1084/jem.20110304
268. Naka K, Hoshii T, Muraguchi T, et al. TGF-beta-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia. Nature. 2010;463(7281):676- 680. doi:10.1038/nature08734
269. Rådmark O, Samuelsson B. Regulation of the activity of 5-lipoxygenase, a key enzyme in leukotriene biosynthesis. Biochem Biophys Res Commun. 2010;396(1):105- 110. doi:10.1016/j.bbrc.2010.02.173
270. Chen Y, Hu Y, Zhang H, Peng C, Li S. Loss of the Alox5 gene impairs leukemia stem cells and prevents chronic myeloid leukemia. Nat Genet. 2009;41(7):783-792. doi:10.1038/ng.389
Page | 179
271. Zhou LL, Zhao Y, Ringrose A, et al. AHI-1 interacts with BCR-ABL and modulates BCR-ABL transforming activity and imatinib response of CML stem/progenitor cells. J Exp Med. 2008;205(11):2657-2671. doi:10.1084/jem.20072316
272. Arrigoni E, Del Re M, Galimberti S, et al. Concise Review: Chronic Myeloid Leukemia: Stem Cell Niche and Response to Pharmacologic Treatment. Stem Cells Transl Med. 2018;7(3):305-314. doi:10.1002/sctm.17-0175
273. Jabbour E, Kantarjian H, Jones D, et al. Frequency and clinical significance of BCR-ABL mutations in patients with chronic myeloid leukemia treated with imatinib mesylate. Leukemia. 2006;20(10):1767-1773. doi:10.1038/sj.leu.2404318
274. Cortes J, O’Brien S, Kantarjian H. Discontinuation of imatinib therapy after achieving a molecular response. Blood. 2004;104(7):2204-2205. doi:10.1182/blood- 2004-04-1335
275. Mauro MJ, Druker BJ, Maziarz RT. Divergent clinical outcome in two CML patients who discontinued imatinib therapy after achieving a molecular remission. Leuk Res. 2004;28 Suppl 1:S71-73. doi:10.1016/j.leukres.2003.10.017
276. Merante S, Orlandi E, Bernasconi P, Calatroni S, Boni M, Lazzarino M. Outcome of four patients with chronic myeloid leukemia after imatinib mesylate discontinuation. Haematologica. 2005;90(7):979-981.
277. Rousselot P, Huguet F, Rea D, et al. Imatinib mesylate discontinuation in patients with chronic myelogenous leukemia in complete molecular remission for more than 2 years. Blood. 2007;109(1):58-60. doi:10.1182/blood-2006-03-011239
278. Verma D, Kantarjian H, Jain N, Cortes J. Sustained complete molecular response after imatinib discontinuation in a patient with chronic myeloid leukemia not previously exposed to interferon alpha. Leuk Lymphoma. 2008;49(7):1399-1402. doi:10.1080/10428190802043903
279. Mahon F-X, Réa D, Guilhot J, et al. Discontinuation of imatinib in patients with chronic myeloid leukaemia who have maintained complete molecular remission for at
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
least 2 years: the prospective, multicentre Stop Imatinib (STIM) trial. Lancet Oncol. 2010;11(11):1029-1035. doi:10.1016/S1470-2045(10)70233-3
280. Eaves AC, Barnett MJ, Ponchio L, Cashman JD, Petzer AL, Eaves CJ. Differences between normal and CML stem cells: potential targets for clinical exploitation. Stem Cells Dayt Ohio. 1998;16 Suppl 1:77-83; discussion 89. doi:10.1002/stem.5530160809
281. Jin L, Tabe Y, Konoplev S, et al. CXCR4 up-regulation by imatinib induces chronic myelogenous leukemia (CML) cell migration to bone marrow stroma and promotes survival of quiescent CML cells. Mol Cancer Ther. 2008;7(1):48-58. doi:10.1158/1535-7163.MCT-07-0042
282. Jiang X, Zhao Y, Smith C, et al. Chronic myeloid leukemia stem cells possess multiple unique features of resistance to BCR-ABL targeted therapies. Leukemia. 2007;21(5):926-935. doi:10.1038/sj.leu.2404609
283. Konig H, Copland M, Chu S, Jove R, Holyoake TL, Bhatia R. Effects of dasatinib on SRC kinase activity and downstream intracellular signaling in primitive chronic myelogenous leukemia hematopoietic cells. Cancer Res. 2008;68(23):9624-9633. doi:10.1158/0008-5472.CAN-08-1131
284. Holtz M, Forman SJ, Bhatia R. Growth factor stimulation reduces residual quiescent chronic myelogenous leukemia progenitors remaining after imatinib treatment. Cancer Res. 2007;67(3):1113-1120. doi:10.1158/0008-5472.CAN-06-2014
285. Copland M, Fraser AR, Harrison SJ, Holyoake TL. Targeting the silent minority: emerging immunotherapeutic strategies for eradication of malignant stem cells in chronic myeloid leukaemia. Cancer Immunol Immunother CII. 2005;54(4):297-306. doi:10.1007/s00262-004-0573-1
286. Singh KP, Wyman A, Casado FL, Garrett RW, Gasiewicz TA. Treatment of mice with the Ah receptor agonist and human carcinogen dioxin results in altered numbers
Page | 181
and function of hematopoietic stem cells. Carcinogenesis. 2009;30(1):11-19. doi:10.1093/carcin/bgn224
287. Sakai R, Kajiume T, Inoue H, et al. TCDD treatment eliminates the long-term reconstitution activity of hematopoietic stem cells. Toxicol Sci Off J Soc Toxicol. 2003;72(1):84-91. doi:10.1093/toxsci/kfg002
288. Singh KP, Bennett JA, Casado FL, Walrath JL, Welle SL, Gasiewicz TA. Loss of aryl hydrocarbon receptor promotes gene changes associated with premature hematopoietic stem cell exhaustion and development of a myeloproliferative disorder in aging mice. Stem Cells Dev. 2014;23(2):95-106. doi:10.1089/scd.2013.0346
289. Singh KP, Garrett RW, Casado FL, Gasiewicz TA. Aryl hydrocarbon receptor- null allele mice have hematopoietic stem/progenitor cells with abnormal characteristics and functions. Stem Cells Dev. 2011;20(5):769-784. doi:10.1089/scd.2010.0333
290. Pophali P, Patnaik M. The Role of New Tyrosine Kinase Inhibitors in Chronic Myeloid Leukemia. Cancer J. 2016. doi:10.1097/PPO.0000000000000165.
291. Grigg A, Hughes T. Role of Allogeneic Stem Cell Transplantation for Adult Chronic Myeloid Leukemia in the Imatinib Era. Biol Blood Marrow Transplant. 2006;12(8):795-807. doi:10.1016/j.bbmt.2006.03.012
292. Talati C, Pinilla-Ibarz J. Resistance in chronic myeloid leukemia: definitions and novel therapeutic agents. Curr Opin Hematol. 2018;25(2):154-161. doi:10.1097/MOH.0000000000000403
293. Shlush, Hershkovitz. Clonal evolution models of tumor heterogeneity. Am Soc Clin Oncol Educ Book. 2015. doi:10.14694/EdBook_AM.2015.35.e662
294. Campbell LL, Polyak K. Breast Tumor Heterogeneity: Cancer Stem Cells or Clonal Evolution? Cell Cycle. 2007;6(19):2332-2338. doi:10.4161/cc.6.19.4914
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
295. Clarke MF, Dick JE, Dirks PB, et al. Cancer Stem Cells—Perspectives on Current Status and Future Directions: AACR Workshop on Cancer Stem Cells. Cancer Res. 2006;66(19):9339-9344. doi:10.1158/0008-5472.CAN-06-3126
296. The clonal evolution of tumor cell populations | Science. https://science.sciencemag.org/content/194/4260/23. Accessed September 16, 2019.
297. Swanten C. Intratumor heterogeneity: evolution through space and time. - PubMed - NCBI. Cancer Res. 2012. doi:10.1158/0008-5472.CAN-12-2217
298. Cancer as an evolutionary and ecological process | Nature Reviews Cancer. https://www.nature.com/articles/nrc2013. Accessed September 17, 2019.
299. Cassidy J, Caldas C, Bruna A. Maintaining Tumor Heterogeneity in Patient- Derived Tumor Xenografts. Cancer Res. 2015. doi:10.1158/0008-5472.CAN-15-0727
300. Auman, McLeod. Colorectal Cancer Cell Lines Lack the Molecular Heterogeneity of Clinical Colorectal Tumors. Clin Colorectal Cancer. 2010. doi:10.3816/CCC.2010.n.005
301. Intra-tumour heterogeneity: a looking glass for cancer? | Nature Reviews Cancer. https://www.nature.com/articles/nrc3261. Accessed September 18, 2019.
302. Dagogo-Jack I, Shaw AT. Tumour heterogeneity and resistance to cancer therapies. Nat Rev Clin Oncol. 2018;15(2):81-94. doi:10.1038/nrclinonc.2017.166
303. The causes and consequences of genetic heterogeneity in cancer evolution. https://www.nature.com/articles/nature12625. Accessed September 17, 2019.
304. Gordon MY, Marley SB, Goldman JM. Clinical heterogeneity in chronic myeloid leukaemia reflecting biological diversity in normal persons. Br J Haematol. 2003. doi:10.1046/j.1365-2141.2003.04451.x
305. Goldman JM, Gordon M, Bazeos A, Marin D. Biology of CML stem cells: the basis for clinical heterogeneity? Leuk Suppl. 2012;1(S2):S43-S45. doi:10.1038/leusup.2012.23
Page | 183
306. Condello C, Lemmin T, Stöhr J, et al. Structural heterogeneity and intersubject variability of Aβ in familial and sporadic Alzheimer’s disease. Proc Natl Acad Sci U S A. 2018;115(4):E782-E791. doi:10.1073/pnas.1714966115
307. Oehler V, Yeung K, Radich J. The derivation of diagnostic markers of chronic myeloid leukemia progression from microarray data. Blood. 2009. doi:10.1182/blood- 2009-03-212969
308. Single-cell transcriptomics uncovers distinct molecular signatures of stem cells in chronic myeloid leukemia. - PubMed - NCBI. https://www-ncbi-nlm-nih- gov.gate2.inist.fr/pubmed/28504724. Accessed September 30, 2019.
309. Chen J, Odenike O, Rowley JD. Leukaemogenesis: more than mutant genes. Nat Rev Cancer. 2010;10(1):23-36. doi:10.1038/nrc2765
310. Lenstra TL, Rodriguez J, Chen H, Larson DR. Transcription Dynamics in Living Cells. Annu Rev Biophys. 2016;45(1):25-47. doi:10.1146/annurev-biophys-062215- 010838
311. Gonda TJ, Ramsay RG. Directly targeting transcriptional dysregulation in cancer. Nat Rev Cancer. 2015;15(11):686-694. doi:10.1038/nrc4018
312. Core LJ, Waterfall JJ, Lis JT. Nascent RNA Sequencing Reveals Widespread Pausing and Divergent Initiation at Human Promoters. Science. 2008;322(5909):1845- 1848. doi:10.1126/science.1162228
313. Koschmieder S, Vetrie D. Epigenetic dysregulation in chronic myeloid leukaemia: A myriad of mechanisms and therapeutic options. Semin Cancer Biol. 2018;51:180- 197. doi:10.1016/j.semcancer.2017.07.006
314. Crans HN, Sakamoto KM. Transcription factors and translocations in lymphoid and myeloid leukemia. Leukemia. 2001;15(3):313-331. doi:10.1038/sj.leu.2402033
315. Cuartero S, Innes AJ, Merkenschlager M. Towards a Better Understanding of Cohesin Mutations in AML. Front Oncol. 2019;9:867. doi:10.3389/fonc.2019.00867
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
316. Takei H, Kobayashi SS. Targeting transcription factors in acute myeloid leukemia. Int J Hematol. 2019;109(1):28-34. doi:10.1007/s12185-018-2488-1
317. Sportoletti P, Celani L, Varasano E, et al. GATA1 epigenetic deregulation contributes to the development of AML with NPM1 and FLT3-ITD cooperating mutations. Leukemia. 2019;33(7):1827-1832. doi:10.1038/s41375-019-0399-7
318. Desterke C, Voldoire M, Bonnet M-L, et al. Experimental and integrative analyses identify an ETS1 network downstream of BCR-ABL in chronic myeloid leukemia (CML). Exp Hematol. 2018;64:71-83.e8. doi:10.1016/j.exphem.2018.04.007
319. Dugray A, Geay JF, Foudi A, et al. Rapid generation of a tetracycline-inducible BCR-ABL defective retrovirus using a single autoregulatory retroviral cassette. Leukemia. 2001;15(10):1658-1662.
320. Desterke C, Voldoire M, Bonnet M-L, et al. Experimental and integrative analyses identify an ETS1 network downstream of BCR-ABL in chronic myeloid leukemia (CML). Exp Hematol. 2018;64:71-83.e8. doi:10.1016/j.exphem.2018.04.007
321. Plas DR, Thompson CB. Cell metabolism in the regulation of programmed cell death. Trends Endocrinol Metab TEM. 2002;13(2):75-78. doi:10.1016/s1043- 2760(01)00528-8
322. Ng TH, Sham KWY, Xie CM, et al. Eukaryotic elongation factor-2 kinase expression is an independent prognostic factor in colorectal cancer. BMC Cancer. 2019;19(1):649. doi:10.1186/s12885-019-5873-0
323. Gu H, Chen J, Song Y, Shao H. Gastric Adenocarcinoma Predictive Long Intergenic Non-Coding RNA Promotes Tumor Occurrence and Progression in Non- Small Cell Lung Cancer via Regulation of the miR-661/eEF2K Signaling Pathway. Cell Physiol Biochem Int J Exp Cell Physiol Biochem Pharmacol. 2018;51(5):2136-2147. doi:10.1159/000495831
Page | 185
324. Zhao Y-Y, Tian Y, Liu L, et al. Inhibiting eEF-2 kinase-mediated autophagy enhanced the cytocidal effect of AKT inhibitor on human nasopharyngeal carcinoma. Drug Des Devel Ther. 2018;12:2655-2663. doi:10.2147/DDDT.S169952
325. Shi N, Chen X, Liu R, et al. Eukaryotic elongation factors 2 promotes tumor cell proliferation and correlates with poor prognosis in ovarian cancer. Tissue Cell. 2018;53:53-60. doi:10.1016/j.tice.2018.05.014
326. Qadir F, Aziz MA, Sari CP, et al. Transcriptome reprogramming by cancer exosomes: identification of novel molecular targets in matrix and immune modulation. Mol Cancer. 2018;17(1):97. doi:10.1186/s12943-018-0846-5
327. Kabil N, Bayraktar R, Kahraman N, et al. Thymoquinone inhibits cell proliferation, migration, and invasion by regulating the elongation factor 2 kinase (eEF-2K) signaling axis in triple-negative breast cancer. Breast Cancer Res Treat. 2018;171(3):593-605. doi:10.1007/s10549-018-4847-2
328. Pan Z, Chen Y, Liu J, et al. Design, synthesis, and biological evaluation of polo- like kinase 1/eukaryotic elongation factor 2 kinase (PLK1/EEF2K) dual inhibitors for regulating breast cancer cells apoptosis and autophagy. Eur J Med Chem. 2018;144:517-528. doi:10.1016/j.ejmech.2017.12.046
329. Ji C, Xu Q, Guo L, et al. eEF-2 Kinase-targeted miR-449b confers radiation sensitivity to cancer cells. Cancer Lett. 2018;418:64-74. doi:10.1016/j.canlet.2018.01.014
330. Guan Y, Jiang S-L, Yu P, et al. Suppression of eEF-2K-mediated autophagy enhances the cytotoxicity of raddeanin A against human breast cancer cells in vitro. Acta Pharmacol Sin. 2018;39(4):642-648. doi:10.1038/aps.2017.139
331. Wu H, Zhu H, Liu DX, et al. Silencing of elongation factor-2 kinase potentiates the effect of 2-deoxy-D-glucose against human glioma cells through blunting of autophagy. Cancer Res. 2009;69(6):2453-2460. doi:10.1158/0008-5472.CAN-08- 2872
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
332. Zhang Y, Cheng Y, Zhang L, et al. Inhibition of eEF-2 kinase sensitizes human glioma cells to TRAIL and down-regulates Bcl-xL expression. Biochem Biophys Res Commun. 2011;414(1):129-134. doi:10.1016/j.bbrc.2011.09.038
333. Cheng Y, Ren X, Zhang Y, et al. eEF-2 kinase dictates cross-talk between autophagy and apoptosis induced by Akt Inhibition, thereby modulating cytotoxicity of novel Akt inhibitor MK-2206. Cancer Res. 2011;71(7):2654-2663. doi:10.1158/0008- 5472.CAN-10-2889
334. Leprivier G, Remke M, Rotblat B, et al. The eEF2 Kinase Confers Resistance to Nutrient Deprivation by Blocking Translation Elongation. Cell. 2013;153(5):1064-1079. doi:10.1016/j.cell.2013.04.055
335. Tsoucas D, Yuan G-C. Recent progress in single-cell cancer genomics. Curr Opin Genet Dev. 2017;42:22-32. doi:10.1016/j.gde.2017.01.002
336. Baslan T, Kendall J, Rodgers L, et al. Genome-wide copy number analysis of single cells. Nat Protoc. 2012;7(6):1024-1041. doi:10.1038/nprot.2012.039
337. Janiszewska M, Liu L, Almendro V, et al. In situ single-cell analysis identifies heterogeneity for PIK3CA mutation and HER2 amplification in HER2-positive breast cancer. Nat Genet. 2015;47(10):1212-1219. doi:10.1038/ng.3391
338. Femino AM, Fay FS, Fogarty K, Singer RH. Visualization of single RNA transcripts in situ. Science. 1998;280(5363):585-590. doi:10.1126/science.280.5363.585
339. Dalerba P, Kalisky T, Sahoo D, et al. Single-cell dissection of transcriptional heterogeneity in human colon tumors. Nat Biotechnol. 2011;29(12):1120-1127. doi:10.1038/nbt.2038
340. Patel AP, Tirosh I, Trombetta JJ, et al. Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma. Science. 2014;344(6190):1396- 1401. doi:10.1126/science.1254257
Page | 187
341. Dalerba P, Kalisky T, Sahoo D, et al. Single-cell dissection of transcriptional heterogeneity in human colon tumors. Nat Biotechnol. 2011;29(12):1120-1127. doi:10.1038/nbt.2038
342. Hou Y, Guo H, Cao C, et al. Single-cell triple omics sequencing reveals genetic, epigenetic, and transcriptomic heterogeneity in hepatocellular carcinomas. Cell Res. 2016;26(3):304-319. doi:10.1038/cr.2016.23
343. Van Loo P, Voet T. Single cell analysis of cancer genomes. Curr Opin Genet Dev. 2014;24:82-91. doi:10.1016/j.gde.2013.12.004
344. Papalexi E, Satija R. Single-cell RNA sequencing to explore immune cell heterogeneity. Nat Rev Immunol. 2018;18(1):35-45. doi:10.1038/nri.2017.76
345. Hedlund E, Deng Q. Single-cell RNA sequencing: Technical advancements and biological applications. Mol Aspects Med. 2018;59:36-46. doi:10.1016/j.mam.2017.07.003
346. Brehm-Stecher BF, Johnson EA. Single-cell microbiology: tools, technologies, and applications. Microbiol Mol Biol Rev MMBR. 2004;68(3):538-559, table of contents. doi:10.1128/MMBR.68.3.538-559.2004
347. Guo F, Li L, Li J, et al. Single-cell multi-omics sequencing of mouse early embryos and embryonic stem cells. Cell Res. 2017;27(8):967-988. doi:10.1038/cr.2017.82
348. Whitesides GM. The origins and the future of microfluidics. Nature. 2006;442(7101):368-373. doi:10.1038/nature05058
349. Hwang B, Lee JH, Bang D. Single-cell RNA sequencing technologies and bioinformatics pipelines. Exp Mol Med. 2018;50(8):96. doi:10.1038/s12276-018-0071- 8
Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity
350. Utada AS, Lorenceau E, Link DR, Kaplan PD, Stone HA, Weitz DA. Monodisperse double emulsions generated from a microcapillary device. Science. 2005;308(5721):537-541. doi:10.1126/science.1109164
351. Thorsen T, Roberts RW, Arnold FH, Quake SR. Dynamic pattern formation in a vesicle-generating microfluidic device. Phys Rev Lett. 2001;86(18):4163-4166. doi:10.1103/PhysRevLett.86.4163
352. Buettner F, Natarajan KN, Casale FP, et al. Computational analysis of cell-to-cell heterogeneity in single-cell RNA-sequencing data reveals hidden subpopulations of cells. Nat Biotechnol. 2015;33(2):155-160. doi:10.1038/nbt.3102
353. Liang S, Fuhrman S, Somogyi R. Reveal, a general reverse engineering algorithm for inference of genetic network architectures. Pac Symp Biocomput Pac Symp Biocomput. 1998:18-29.
354. Basso K, Margolin AA, Stolovitzky G, Klein U, Dalla-Favera R, Califano A. Reverse engineering of regulatory networks in human B cells. Nat Genet. 2005;37(4):382-390. doi:10.1038/ng1532
355. Setty M, Tadmor MD, Reich-Zeliger S, et al. Wishbone identifies bifurcating developmental trajectories from single-cell data. Nat Biotechnol. 2016;34(6):637-645. doi:10.1038/nbt.3569
356. Bendall SC, Davis KL, Amir ED, et al. Single-Cell Trajectory Detection Uncovers Progression and Regulatory Coordination in Human B Cell Development. Cell. 2014;157(3):714-725. doi:10.1016/j.cell.2014.04.005
357. Haghverdi L, Büttner M, Wolf FA, Buettner F, Theis FJ. Diffusion Pseudotime Robustly Reconstructs Lineage Branching. Bioinformatics; 2016. doi:10.1101/041384
358. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018;36(5):411-420. doi:10.1038/nbt.4096
Page | 189
359. McCarthy DJ, Campbell KR, Lun ATL, Wills QF. Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinforma Oxf Engl. 2017;33(8):1179-1186. doi:10.1093/bioinformatics/btw777
360. Trapnell C, Cacchiarelli D, Grimsby J, et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat Biotechnol. 2014;32(4):381-386. doi:10.1038/nbt.2859
361. Wolf FA, Angerer P, Theis FJ. SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 2018;19(1):15. doi:10.1186/s13059-017-1382-0
362. Chen, Renia, Ginhoux. Constructing cell lineages from single-cell transcriptomes. Mol Asp Med. 2018. doi:10.1016/j.mam.2017.10.004
363. Análisis de componentes principales ⋆ Quantdare. Quantdare. March 2014. https://quantdare.com/analisis-de-componentes-principales/. Accessed September 26, 2019.
364. Stock classification with ISOMAP ⋆ Quantdare. Quantdare. January 2016. https://quantdare.com/stock-classification-with-isomap/. Accessed September 26, 2019.
365. Visualizing Fixed Income ETFs with T-SNE ⋆ Quantdare. Quantdare. July 2016. https://quantdare.com/tsne/. Accessed September 26, 2019.
366. Maaten L van der, Hinton G. Visualizing Data Using T-SNE.; 2008.
367. Reid JE, Wernisch L. Pseudotime estimation: deconfounding single cell time series. Bioinformatics. 2016;32(19):2973-2980. doi:10.1093/bioinformatics/btw372
368. Monocle. http://cole-trapnell-lab.github.io/monocle-release/docs/#constructing- single-cell-trajectories. Accessed September 19, 2019.
369. Suvà ML, Tirosh I. Single-Cell RNA Sequencing in Cancer: Lessons Learned and Emerging Challenges. Mol Cell. 2019;75(1):7-12. doi:10.1016/j.molcel.2019.05.003
370. Jerby-Arnon L, Shah P, Cuoco MS, et al. A Cancer Cell Program Promotes T Cell Exclusion and Resistance to Checkpoint Blockade. Cell. 2018;175(4):984- 997.e24. doi:10.1016/j.cell.2018.09.006
371. Puram SV, Tirosh I, Parikh AS, et al. Single-Cell Transcriptomic Analysis of Primary and Metastatic Tumor Ecosystems in Head and Neck Cancer. Cell. 2017;171(7):1611-1624.e24. doi:10.1016/j.cell.2017.10.044
372. Hunter KW, Amin R, Deasy S, Ha N-H, Wakefield L. Genetic insights into the morass of metastatic heterogeneity. Nat Rev Cancer. 2018;18(4):211-223. doi:10.1038/nrc.2017.126
373. Bower H, Björkholm M, Dickman PW, Höglund M, Lambert PC, Andersson TM- L. Life Expectancy of Patients With Chronic Myeloid Leukemia Approaches the Life Expectancy of the General Population. J Clin Oncol Off J Am Soc Clin Oncol. 2016;34(24):2851-2857. doi:10.1200/JCO.2015.66.2866
374. Aggoune D, Sorel N, Bonnet M-L, et al. Bone marrow mesenchymal stromal cell (MSC) gene profiling in chronic myeloid leukemia (CML) patients at diagnosis and in deep molecular response induced by tyrosine kinase inhibitors (TKIs). Leuk Res. 2017;60:94-102. doi:10.1016/j.leukres.2017.07.007
Titre : Contrôle transcriptionnel induit par Bcr-Abl et son rôle dans l'hétérogénéité des cellules souches leucémiques.
Mots clés : Chromosome Philadelphie, Analyse sur cellule unique, Cellules souches hématopoïétiques
La leucémie myéloïde chronique est une hématopoïèse La leucémie myéloïde chronique est une hématopoïèse maligne clonale, caractérisée par l'acquisition de la maligne clonale, caractérisée par l'acquisition de la translocation t (9;22) conduisant au chromosome Ph1 et à translocation t (9;22) conduisant au chromosome Ph1 et à son homologue l'oncogène BCR-ABL, dans une cellule son homologue l'oncogène BCR-ABL, dans une cellule souche hématopoïétique très primitive. La LMC est un souche hématopoïétique très primitive. La LMC est un modèle de thérapies ciblées, car il a été démontré que la modèle de thérapies ciblées, car il a été démontré que la preuve de la faisabilité du ciblage de l'activité tyrosine kinase preuve de la faisabilité du ciblage de l'activité tyrosine (TK) BCR-ABL à l'aide d'inhibiteurs de TK (TKI) entraîne des kinase (TK) BCR-ABL à l'aide d'inhibiteurs de TK (TKI) réponses et des rémissions majeures. Cependant, les entraîne des réponses et des rémissions majeures. problèmes actuels rencontrés dans ces thérapies sont la Cependant, les problèmes actuels rencontrés dans ces résistance des cellules souches leucémiques primitives et thérapies sont la résistance des cellules souches leur persistance qui serait liée à l'hétérogénéité des cellules leucémiques primitives et leur persistance qui serait liée à souches au moment du diagnostic, ce qui conduit à la l'hétérogénéité des cellules souches au moment du sélection clonale de cellules résistant aux thérapies TKI. J'ai diagnostic, ce qui conduit à la sélection clonale de cellules appliqué la technologie de l'analyse du transcriptome des résistant aux thérapies TKI. J'ai appliqué la technologie de cellule uniques aux cellules de la LMC en utilisant un panel l'analyse du transcriptome des cellule uniques aux cellules de gènes impliqués dans différentes voies, combinée à de la LMC en utilisant un panel de gènes impliqués dans l'analyse d'inférence de trajectoire au modèle d'expression différentes voies, combinée à l'analyse d'inférence de des gènes. trajectoire au modèle d'expression des gènes.
Title : Transcriptional control induced by Bcr-Abl and its role in leukemic stem cell heterogeneity.
Keywords : Philadelphia Chromosome, Single Cell Analysis, Hematopoietic Stem Cells
Chronic myeloid leukemia is a clonal hematopoietic Chronic myeloid leukemia is a clonal hematopoietic malignancy, characterized by the acquisition of the t (9;22) malignancy, characterized by the acquisition of the t (9;22) translocation leading to Ph1 chromosome and its translocation leading to Ph1 chromosome and its counterpart BCR-ABL oncogene, in a very primitive counterpart BCR-ABL oncogene, in a very primitive hematopoietic stem cell. CML is a model of targeted hematopoietic stem cell. CML is a model of targeted therapies as the proof of concept of the feasibility of therapies as the proof of concept of the feasibility of targeting the tyrosine kinase (TK) activity BCR-ABL using TK targeting the tyrosine kinase (TK) activity BCR-ABL using inhibitors (TKI) has been shown to lead to major responses TK inhibitors (TKI) has been shown to lead to major and remissions. However, the current problems encountered responses and remissions. However, the current problems in these therapies are primitive leukemic stem cells encountered in these therapies are primitive leukemic resistance and their persistence which is thought to be stem cells resistance and their persistence which is related to the heterogeneity of the stem cells at diagnosis thought to be related to the heterogeneity of the stem leading to clonal selection of cells resisting to TKI therapies. cells at diagnosis leading to clonal selection of cells I have applied the technology of single cell transcriptome resisting to TKI therapies. I have applied the technology of analysis to CML cells using a panel of genes involved in single cell transcriptome analysis to CML cells using a different pathways combined with trajectory inference panel of genes involved in different pathways combined analysis to the gene expression pattern. with trajectory inference analysis to the gene expression pattern.
Université Paris-Saclay Espace Technologique / Immeuble Discovery Route de l’Orme aux Merisiers RD 128 / 91190 Saint-Aubin, France