Function of Inducible Nitric Oxide Synthase in the Regulation of Cervical Cancer Cell Proliferation and the Expression of Vascular Endothelial Growth Factor

MOLECULAR MEDICINE REPORTS 9: 583-589, 2014

Function of inducible nitric oxide synthase in the regulation of cervical cancer cell proliferation and the expression of vascular endothelial growth factor

JING DONG, MINGJUN CHENG and HONG SUN

Obstetrics and Gynecology Hospital, Shanghai Medical College, Fudan University, Shanghai 200011, P.R. China

Received August 9, 2012; Accepted November 1, 2013

DOI: 10.3892/mmr.2013.1838

Abstract. Inducible nitric oxide synthase (iNOS) is the key Inducible nitric oxide synthase (iNOS) is a key enzyme in enzyme in NO synthesis and exhibits a high expression in NO synthesis and has a high expression in numerous types numerous types of malignant tumors. Previous studies have of malignant tumors. Previous studies have demonstrated demonstrated that iNOS promotes the production of tumor that iNOS promotes the production of tumor blood vessels by blood vessels by catalyzing the synthesis of additional NO. catalyzing the synthesis of additional NO (9,12). Experimental Certain experimental evidence has suggested that iNOS evidence has suggested that iNOS may emerge as a VEGF may regulate the levels of vascular endothelial growth factor enhancer, due to the fact that the VEGF level is capable of (VEGF), as the level of VEGF may be induced by iNOS during being induced by iNOS in endothelial cell migration and endothelial cell migration and angiogenesis. In this study, angiogenesis (13). However, the correlation between iNOS and it was observed that SiHa and HeLa cells exhibit depressed VEGF in cervical cancer remains unclear (11,14). proliferation levels following the knockdown of iNOS with a lentivirus. In addition, NO levels demonstrated a correlation Materials and methods with VEGF levels in the cell culture supernatant. Cell culture. Two human cervical carcinoma cell lines, Hela and Introduction SiHa, which exhibit relatively low metastatic capability, were obtained from the China Center for Type Culture Collection Cervical cancer is one of the most common malignant cancers (Wuhan, China). Cells were all cultured in Dulbecco's modi- in gynecology (1-3). Recently, the incidence rate of the disease fied Eagle's medium supplemented with 10% fetal bovine has increased and has demonstrated an increasing trend in serum (FBS; Gibco, Grand Island, NY, USA) in an atmosphere younger females. However, the developmental process of the of 5% CO2 and 95% air. SiHa and HeLa cells were plated in tumor is complex and involves numerous factors at various 6-well plates. stages (4,5). Previous studies have demonstrated that angiogenesis was the foundation for tumor growth (6,7) and that Quantitative polymerase chain reaction (qPCR). Total NO is one of the most secondary messengers and is capable of RNA was extracted from 1x106 human SiHa and HeLa promoting the process (1). cells using TRIzol (Invitrogen Life Technologies, Carlsbad, Vascular endothelial growth factor (VEGF) is considered CA, USA). Aliquots (1 g) of RNA were reverse transcribed to be one of the most significant of the 30 cytokines whose to cDNA and aliquots (4 µl) of cDNA were used as a function it is to promote vascular production (8). VEGF template for qPCR using an ABI7900HT PCR system increases cancer cell growth by promoting the cleavage and (Applied Biosystems, Carlsbad, CA, USA) according to the proliferation of tumor cells by binding to the tyrosinase manufacturer's instructions. The primers were as follows: receptor (9-11). Forward: 5'-TGGAGAGAAACTGAAGAAATCG-3' and reverse 5'-GTACCTGAATTTGTTGTTGAGC-3' for iNOS; forward: 5'-GCTGTGAAGCCAGACAGC-3' and reverse: 5'-GGCAAGTCACCCTGCTGA-3' for VEGF; and forward: 5'-CTCCATCCTGGCCTCGCTGT-3' and reverse: Correspondence to: Professor Hong Sun, Obstetrics and 5'-GCTGTCACCTTCACCGTTCC-3' for β‑actin (ACTB). All Gynecology Hospital, Shanghai Medical College, Fudan University, 419 Fangxie Road, Shanghai 200011, P.R. China experiments were performed in triplicate, with each reading E-mail: [email protected] taken three times. Average and standard deviations were subsequently calculated. Key words: inducible nitric oxide synthase, cervical cancer cell, proliferation, vascular endothelial growth factor Western blotting. A nuclear extraction kit (Chemicon International, Temecula, CA, USA) was used to isolate cyto- plasmic proteins. Proteins, 50 µg, from various groups were boiled for 5 min in sample buffer and were subsequently 584 DONG et al: iNOS IN CERVICAL CANCER CELL PROLIFERATION AND VEGF EXPRESSON separated in sodium dodecyl sulphate‑polyacrylamide gel Short hairpin RNA (shRNA) interference, lentivirus electrophoresis (SDS-PAGE) (10-15%) and transferred onto production and infection. iNOS-SH shRNA was gener- a polyvinylidene fluoride (PVDF) membrane (Bio-Rad ated from two different annealed oligonucleotides Laboratories, Hercules, CA, USA). Nonspecific reactivity was (target 1: 5'-CCGGCCAGAAGCAGAATGTGACATCTC blocked using 5% bovine serum albumin in a Tris‑buffered GAGTGGTCACATTCTGCTTCTGGTTTTTG-3' and saline (TBS) with Tween‑20 buffer (100 ml 10% TBS, 10 ml 5'-AATTCAAAAACCAGAAGCAGAATGTGACATCTCGA 10% Tween‑20 final 0.1% v/v, dissolved with 890 ml double GATGGTCACATTCTGCTTCTGG-3'; target 2: distilled-H2O) and subsequently incubated with primary 5'-CCGGGAAGCGGTAACAAAGGAGATACTCGAGTATC antibody mouse anti-VEGF (sc-1836, 1:200), rabbit anti-iNOS TCCTTTGTTACCGCTTCTTTTTG-3' and (sc-650, 1:200) or rabbit anti-actin (sc-130656 , 1:500) anti- 5'-AATTCAAAAAGAAGCGGTAACAAAGGAGATACTCGAG bodies (all from Santa Cruz Biotechnology, Santa Cruz, CA, TATCTCCTTTGTTACCGCTTC-3'; and target 3: USA) overnight at 4˚C and incubated with horseradish peroxi- 5'-CCGGCGAGGACTATTTCTTTCAGCTCTCGAGAGCT dase (HRP)-conjugated secondary antibodies (Santa Cruz GAAAGAAATAGTCCTCGTTTTTG-3' and 5'-AA Biotechnology). Bands were detected using the Supersignal TTCAAAAACGAGGACTATTTCTTTCAGCTCTCGAGAGCT West Dura Extended Duration Substrate (Pierce, Rockford, GAAAGAAATAGTCCTCG-3') that were inserted into the IL, USA), and quantified using the Chemi-doc gel quantifica- AgeI and EcoRI sites of SCR vector purchased from Addgene; tion system (Bio-Rad). All data were normalized to β-actin. the human iNOS target sequence is underlined. The control Western blotting experiments were repeated at least twice in shRNA was purchased from Addgene. All target sequences order to confirm the results. were designed and verified as specific for iNOS by Blast searching against the human genome. The resulting plasmids, Enzyme-linked immunosorbent assay (ELISA) and NO detect iNOS-SH1, iNOS-SH2 and iNOS-SH3, were sequence- assay (Griess method). The quantity of VEGF released was verified. measured by a sandwich ELISA. ELISA plates (Cat. No: To obtain a recombinant lentivirus, HEK-293T cells were 655001; Greiner, Bio-One, Frickenhausen, Germany) were cotransfected with the package, envelope and iNOS-SH coated with 100 µl of 2 µg/ml anti-VEGF165 (R&D Systems, constructs. The virus-containing supernatant was harvested Minneapolis, MN, USA) antibody in phosphate-buffered following 60 h cotransfection and concentrated by ultracentri- saline (PBS) for 12 h at 4˚C. The plates were washed with fugation at 100,000 x g for 2 h with an Avanti J-30I (Beckman PBS containing 0.1% Tween 20 (TPBS) and incubated for 1 h Coulter, Miami, FL, USA). For infection, the viral stock was at 25˚C with 200 µl/well of 1% bovine serum albumin (Sigma- supplemented with 8 µg/ml polybrene. Aldrich, St. Louis, MO, USA) in PBS. The conditioned medium, or various concentrations of recombinant human VEGF, were Tumorigenicity assays in nude mice. All studies involving incubated for 2 h at 25˚C and washed four times with TPBS. animals were approved by the Ethics Committee of Obstetrics Following incubation for 2 h at 25˚C with 100 µl of 0.2 µg/ml and Gynecology Hospital of Fudan University (Shanghai, biotinylated anti-VEGF antibody, the plates were washed and China). Five- to six-week-old female athymic BALB/c nude incubated for a further 45 min with 100 µl HRP-conjugated mice were purchased from Sino-British Sippr/BK Lab Animal streptavidin (Vector Laboratories, Burlingame, CA, USA). After Ltd, Co. (Shanghai, China). iNOS-SH and SCR‑infected HeLa washing, the plates were developed by adding 50 µl tetrameth- cells (1x106) were suspended in 100 µl PBS and were subcuta- ylbenzidine (Sigma-Aldrich) and the reaction was stopped by neously injected into the posterior flank of 4-5 week-old female adding 50 µl 2NH2SO4. The absorbance at 450 nm was measured nude mice. Tumor size measurement was performed every with a Tecan 96-well plate reader (Tecan, Untersbergstrasse, three days over the course of 4 weeks and the tumor volume was Austria). The NO level was detected by supernatant absorbance estimated using the formula: Volume = length x width2 x 0.5. at 540 nm, according to the Griess method (11). The comparison of tumor volumes between the iNOS-SH and vehicle control groups was performed using paired t-tests. Cell proliferation and cell apoptosis assays. Cell proliferation assays were performed with cell counting kit-8 (CCK‑8; Immunohistochemisty (IHC). Tissues were fixed in Dojindo, Kumamoto, Japan). SiHa and HeLa cells treated 10% buffered formalin fixative at room temperature with nonsense sequence (SCR) or lentiviruses expressing overnight. Samples were subsequently deparaffinized in iNOS-targeted shRNA (iNOS-SH) were seeded into 96-well xylene, rehydrated through graded ethanol, quenched for plates at 5x103 per well in a 100 µl cell culture medium and endogenous peroxidase activity in 0.3% hydrogen peroxide maintained at 37˚C in a humidified incubator containing and processed for antigen retrieval by microwave heating in

5% CO2 for 24 h. One hundred microlitres of 2% FBS medium 10 mM citrate buffer (pH 6.0) using antibodies against iNOS, was used as a control. After 96 cultures, 10 µl CCK-8 solu- VEGF, and myeloperoxidase (MPO) (Dako, Carpinteria, tion was added to the triplicate wells and incubated for 3 h. CA, USA). Immunostaining was performed according to Subsequently, the absorbance at 450 nm was measured in the manufacturer's instructions using the ChemMate Dako order to calculate the number of vital cells in each well. Cell EnVision Detection kit, Peroxidase/DAB, Rabbit/Mouse proliferation is represented as the mean percentage ± stan- (DakoCytomation, Glostrup, Denmark), which resulted in a dard deviation of absorbance. Cell apoptosis assays were brown precipitate at the antigen site. performed by flow cytometry with propidium iodide (PI) and Annexin V-fluorescein isothiocyanate (FITC) once the cells Statistical analysis. All results are expressed as the had been digested with trypsin, washed and harvested. mean ± standard error of the mean. Differences were analyzed MOLECULAR MEDICINE REPORTS 9: 583-589, 2014 585

B C

D E

Figure 1. Characterisation of antisense iNOS cell lines in vitro. (A) HeLa cells that were stably transfected with control or iNOS short hairpin RNA and were analyzed by western blotting with antibodies against iNOS and actin. (B) iNOS expression in SiHa cell lines treated with blank, scramble (SCR) and iNOS-SH, determined by quantitative polymerase chain reaction. Results are provided as the mean ± standard error of the mean (SEM) of triplicates of three separate experiments, *P<0.05, Student's t-test. (C) iNOS expression in HeLa cell lines treated with blank, SCR and iNOS‑SH, determined by qPCR. Results are provided as the means ± SEM of triplicate of three separate experiments, *P<0.05, Student's t-test. (D) iNOS expression in SiHa cell lines treated with blank, SCR and iNOS-SH, determined by western blotting. (E) iNOS expression in HeLa cell lines treated with blank, SCR and iNOS-SH, determined by western blotting. Decreased iNOS expression occurred in the iNOS-SH-SiHa and iNOS-SH-HeLa cell lines. *P<0.05, compared with SCR. iNOS, inducible nitric oxide synthase; SCR, scramble; iNOS‑SH, iNOS-targeted shRNA; SEM, standard error of the mean.

by Student's t-test with SPSS 15.0 software, (SPSS, Chicago, Effect of inhibiting iNOS expression on tumor growth in vitro IL, USA). P<0.05 was considered to indicate a statistically and in vivo. To test the function of iNOS in cervical cancer significant difference. growth, cell proliferation was investigated following iNOS knockdown. As expected, the number of SiHa and HeLa Results cells decreased markedly under iNOS-SH downregulation, compared with the blank and scramble groups (Fig. 2A and Inhibition of iNOS expression in SiHa and HeLa cells. In B). However, data from flow cytometry revealed a statistically order to determine the function of iNOS in the development significant increase in the levels of SiHa and HeLa apoptosis of cervical cancer, a number of SiHa and HeLa cells were not (Fig. 2C and D). The experimental evidence reveals the critical infected or infected with lentiviruses expressing a 20 base frag- role of iNOS in SiHa and HeLa growth in vitro. In contrast to ment of human shRNA and control scramble, respectively. The their growth in vitro, when SiHa and HeLa cells were inocu- efficacy of this fragment in inhibiting the expression of iNOS lated into the flanks of nude mice, the iNOS-SH HeLa cells in these cell lines was determined by western blotting, and SH3 growth rate in vivo was significantly slower compared with was selected as the iNOS shRNA of the three shRNAs for its that of the control cells (Fig. 3A and B). Tumors derived from high knockdown efficiency (Fig. 1A). According to the results iNOS-SH SiHa cells exhibited a growth rate similar to that of of western blotting and qPCR, the iNOS protein product from iNOS-SH HeLa tumors. HeLa tumors became palpable and the SiHa and HeLa cells was significantly different between measurable 10 days after cell inoculation compared with SiHa the experimental and control groups following iNOS stable tumors, which could be measured 13 days following inocu- knockdown (P<0.05). In cells expressing iNOS-shRNA, there lation. Following 20 days of growth, the mean tumor size of was significant inhibition of iNOS expression (60% mRNA HeLa tumors was half that of the control tumors. Inhibition knockdown in SiHa cells, and 75% mRNA knockdown in of iNOS expression in HeLa tumors was confirmed by IHC HeLa cells; >70% protein knockdown efficacy in the two cell analysis iNOS (Fig. 3C and D) and VEGF (Fig. 3E and F) of lines) (Fig. 1). tumors with or without iNOS knockdown. 586 DONG et al: iNOS IN CERVICAL CANCER CELL PROLIFERATION AND VEGF EXPRESSON

A B

E F

Figure 2. Effect of iNOS RNAi on tumor growth in vitro and in vivo. (A and B) Normalized growth rates of SiHa or HeLa cell lines with or without iNOS knockdown, data points are presented as the mean ± SEM. The growth rate of iNOS-SH treated cell lines are significantly slower. (C and D) Normalized apoptosis rates of cells derived from SiHa or HeLa cell lines. Data points are the mean ± SEM. The apoptosis rate of iNOS-SH treated cell lines was considered to be significant. (E and F) Statistics of SiHa and HeLa cell apoptosis, showing significantly increased level of Annxin -V positive cells in iNOS-SH cells. Data points are the mean ± SEM. *P<0.05, compared with SCR. iNOS, inducible nitrix oxide synthase; SEM, standard error of the mean; SCR, scramble; iNOS-SH, iNOS-targeted shRNA.

Decreased NO and VEGF level in supernatant and cells compared with the control group, as determined by western in iNOS-knockdown SiHa and HeLa culture. NO has been blotting (Fig. 4C and D). demonstrated to stimulate and inhibit VEGF expression in a cell-dependent manner and is a potent modulator of vascular iNOS increases VEGF levels in SiHa and HeLa cell cultures. development and tumor progression. In in vitro studies, the To assess whether NO is a mediator for the reduction of VEGF iNOS-shRNA group demonstrated that the two cell lines in the supernatant and iNOS-SH treated cells, sodium nitro- produced lower levels of VEGF compared with the control prusside (SN), an exogenous NO donor, was applied to group. The inhibition of iNOS with lentivirus-based-RNAi for stimulate cells. The mRNA level of iNOS and VEGF in cells 24 h resulted in a significant 1.5-fold downregulation of NO in incubated in media with or without SN (DMSO, 0.25, 0.5 and the supernatant of SiHa and HeLa cell lines (Fig. 4A and B). 1 mM) were assessed (Fig. 5A and B). In all groups, the VEGF Furthermore, the concentration of VEGF in the same super- mRNA level (Fig. 5B) demonstrated a significant increase natant was markedly reduced in the iNOS-shRNA group, with treatment with a high concentration of SN (0.5 mM), MOLECULAR MEDICINE REPORTS 9: 583-589, 2014 587

A B

C D

E F

Figure 3. Effect of iNOS RNAi on HeLa and SiHa growth assessed by immunohistochemistry. (A) Representative image of iNOS effect in HeLa tumor growth. (B) Tumor weight statistics of (A). (C and D) Representative image of iNOS expression in HeLa tumor growth. (E and F) show represented image of VEGF expression in HeLa tumor growth. DAB was stained as a control. *P<0.05, compared with SCR. Original magnification, x200. iNOS, inducible nitric oxide synthase; VEGF, vascular endothelial growth factor; SCR, scramble; iNOS-SH, iNOS-targeted shRNA.

A B C D

Figure 4. The effect of iNOS on NO production and the secretion of VEGF. (A and B) Differences in supernatant NO levels among the experimental groups. NO analysis was performed on supernatants from the cell cultures collected 2 days after their infection with iNOS-SH. Control cells were transfected with or without scramble shRNA. Data are presented as the mean ± standard error of the mean *P<0.05. (C and D) Cell supernatant was harvested and used for VEGF concentration quantification with the human VEGF enzyme-linked immunosorbent assay kit. *P<0.05, compared with SCR. iNOS, inducible nitric oxide synthase; VEGF, vascular endothelial growth factor; SCR, scramble, iNOS-SH, iNOS-targeted shRNA.

without changing the iNOS level, which may mimic the effect 0.5 mM SN treatment, but exhibited a smaller increase with of iNOS. However, in SiHa and HeLa cells, SN increased the 1 mM SN (Fig. 5E and F). supernatant concentration of NO in a dose-dependent manner. In conclusion, the data indicated that the knockdown of The fact that SN increased the supernatant concentration of iNOS based on depressed lentivirus proliferation of SiHa NO in iNOS-SH SiHa and HeLa cells reveals that SN induced and HeLa, may be mimicked by applying an extrogenous NO NO production in an iNOS-independent way (Fig. 5C and D). donor. Furthermore, iNOS is capable of regulating the prolif- Furthermore, in SiHa and HeLa cells the stable knockdown eration of cervical cancer cells and the expression of VEGF by of iNOS-SH, the protein levels of VEGF and iNOS peaked at regulating the concentration of NO. 588 DONG et al: iNOS IN CERVICAL CANCER CELL PROLIFERATION AND VEGF EXPRESSON

A B

C D

E F

Figure 5. Effect of extrogenous NO on VEGF in SiHa and HeLa cells. (A and B) Quantitation of iNOS mRNA level obtained from SiHa and HeLa treated with SN among each experiment group. Cells harvested following stimulation for 24 h with 0.25, 0.5 or 1 mM SN, DMSO was applied as the control. (C and D) Quantitation of VEGF mRNA level obtained from SiHa and HeLa treated with SN among each experiment group. Cells harvested after stimulation for 24 h with 0.25, 0.5 or 1 mM SN, DMSO was applied as the control. (E and F) The supernatant concentration of NO treated with or without SN (DMSO, 0.25, 0.5 and 1 mM) (G and H) Protein levels of VEGF and iNOS in cells treated with SN. Results are provided as the means ± SEM. *P<0.05, Student's t-test. NO, nitric oxide; VEGF, vascular endothelial growth factor; iNOS, inducible nitric oxide synthase; SN, sodium nitroprusside; DMSO, dimethylsulfoxide ; SCR, scramble; iNOS-SH, iNOS-targeted shRNA.

Discussion Several factors have been implicated in tumor development. One of the most prominent cytokines is VEGF, which induces In recent years, the incidence rate of cervical cancer has increased sprouting angiogenesis, increases blood vessel permeability and markedly, with an increasing trend in young females. However, maintains tumor vessel integrity (15). VEGF expression has the mechanisms underlying the disease remain unknown. been shown to be a survival factor for blood vessels in SiHa (14). MOLECULAR MEDICINE REPORTS 9: 583-589, 2014 589

iNOS and VEGF are important in tumor growth. The 2. Bosch FX, Manos MM, Munoz N, et al: Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. level of iNOS is correlated with that of VEGF. One of the International biological study on cervical cancer (IBSCC) Study most important mechanisms is that angiogenesis is induced Group. J Natl Cancer Inst 87: 796-802, 1995. by iNOS, which is capable of synthesizing more NO, regu- 3. Dürst M, Gissmann L, Ikenberg H and zur Hausen H: A papillomavirus DNA from a cervical carcinoma and its prevalence in lating VEGF levels in tumors. NO is capable of inducing cancer biopsy samples from different geographic regions. Proc VEGF expression and mediating the angiogenic effects of Natl Acad Sci USA 80: 3812-3815, 1983. VEGF (16). Therefore it was hypothesized that the decline 4. Bosch FX, Lorincz A, Muñoz N, Meijer CJ and Shah KV: The causal relation between human papillomavirus and cervical in growth and vessel perfusion of SiHa and HeLa tumor cells cancer. J Clin Pathol 55: 244-265, 2002. may correlate with decreased VEGF expression. Notably, 5. Morris M, Eifel PJ, Lu J, et al: Pelvic radiation with concurrent analyses of VEGF expression and production in tumor cells chemotherapy compared with pelvic and para-aortic radiation for high-risk cervical cancer. N Engl J Med 340: 1137-1143, and explants following RNAi of iNOS revealed a correlation 1999. between VEGF and NO levels. This, coupled with previously 6. Isacson C, Kessis TD, Hedrick L and Cho KR: Both cell prolif- published data, suggests that NO produced from iNOS activity eration and apoptosis increase with lesion grade in cervical neoplasia but do not correlate with human papillomavirus type. is important for the maintenance of tumor blood vessel tone Cancer Res 56: 669-674, 1996. and function and further highlights the different roles of NOS 7. Tsang RW, Fyles AW, Li Y, et al: Tumor proliferation and isotypes and their tissue/cell type of origin in vivo (17). apoptosis in human uterine cervix carcinoma I: correlations between variables. Radiother Oncol 50: 85-92, 1999. NO production is induced by numerous angiogenic stimuli 8. Lo HW, Hsu SC, Ali-Seyed M, et al: Nuclear interaction of and is an important extracellular and intracellular signaling EGFR and STAT3 in the activation of the iNOS/NO pathway. molecule synthesized from arginine by NOS. Of the three NOS Cancer Cell 7: 575-589, 2005. 9. Kroll J and Waltenberger J: VEGF-A induces expression of isoforms, including iNOS, endothelial (eNOS) and neuronal eNOS and iNOS in endothelial cells via VEGF receptor-2 (KDR). NOS, iNOS specifically produces the greatest quantities of NO Biochem Biophys Res Commun 252: 743-746, 1998. and is associated with a number of pathologies (18). Although 10. Ichinoe M, Mikami T, Shiraishi H and Okayasu I: High micro- vascular density is correlated with high VEGF, iNOS and COX-2 their precise roles remain unclear, the activites of iNOS and expression in penetrating growth-type early gastric carcinomas. eNOS have been implicated in tumor progression and angio- Histopathology 45: 612-618, 2004. genesis, and their effectiveness appears to be dependent on 11. Zhang J and Peng B: NF-kappaB promotes iNOS and VEGF expression in salivary gland adenoid cystic carcinoma cells their activity and distribution, the concentration and duration and enhances endothelial cell motility in vitro. Cell Prolif 42: of exposure to NO and the intrinsic sensitivity of cells to 150-161, 2009. NO (19). The effect of altered NO levels on tumor growth and 12. Saura M, Zaragoza C, McMillan A, et al: An antiviral mechanism of nitric oxide: inhibition of a viral protease. Immunity 10: 21-28, angiogenesis has also been exploited through pharmacological 1999. manipulation with either NO donors or NOS inhibitors. 13. Kostourou V, Cartwright JE, Johnstone AP, et al: The role of In the present study, it was observed that iNOS knockdown tumour-derived iNOS in tumour progression and angiogenesis. Br J Cancer 104: 83-90, 2011. results in the decreased proliferation of SiHa and HeLa cells 14. Benjamin LE, Hemo I and Keshet E: A plasticity window for and the concentration of VEGF in the supernatant, which blood vessel remodelling is defined by pericyte coverage of the means that iNOS regulates the growth of cervical cancer preformed endothelial network and is regulated by PDGF-B and VEGF. Development 125: 1591-1598, 1998. cells in a VEGF-dependent process. Further studies are 15. Holash J, Davis S, Papadopoulos N, et al: VEGF-Trap: a VEGF required in order to confirm that SN is capable of rescuing the blocker with potent antitumor effects. Proc Natl Acad Sci iNOS-induced decrease. USA 99: 11393-11398, 2002. 16. Feng CW, Wang LD, Jiao LH, Liu B, Zheng S and Xie XJ: In conclusion, it was demonstrated i) Using a Expression of p53, inducible nitric oxide synthase and vascular lentivirus-delivered RNAi approach that iNOS is a key modu- endothelial growth factor in gastric precancerous and cancerous lator of tumor growth and angiogenesis; ii) that the level of lesions: correlation with clinical features. BMC Cancer 2: 8, 2002. VEGF correlates with the expression of iNOS in SiHa and 17. Chiarugi V, Magnelli L and Gallo O: Cox-2, iNOS and p53 as HeLa cells, which may be mediated by the level of NO; and play-makers of tumor angiogenesis (review). Int J Mol Med 2: iii) that the level of NO generated in the tumor is lower than 715-724, 1998. 18. Martí nez-Estrada OM, Rodrí guez-Millá n E , the concentration at which apoptosis occurs, which promotes González-De Vicente E, Reina M, Vilaró S and Fabre M: growth and angiogenesis. Erythropoietin protects the in vitro blood-brain barrier against VEGF-induced permeability. Eur J Neurosci 18: 2538-2544, 2003. Acknowledgements 19. Fukumura D and Jain RK: Tumor microvasculature and micro- environment: targets for anti-angiogenesis and normalization. This work was supported by The National Natural Science Microvasc Res 74: 72-84, 2007. Foundation of China (81272877) and Cancer Foundation of China.

References

1. Walboomers JM, Jacobs MV, Manos MM, et al: Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 189: 12-19, 1999.