RNA Helicase a Is a Downstream Mediator of Kif1bbtumor

Published OnlineFirst January 27, 2014; DOI: 10.1158/2159-8290.CD-13-0362

RESEARCH ARTICLE

RNA Helicase A Is a Downstream Mediator of KIF1Bb Tumor-Suppressor Function in Neuroblastoma

Zhi Xiong Chen 1 , Karin Wallis 1 , Stuart M. Fell 1 , 2, Veronica R. Sobrado 1 , Marie C. Hemmer 1 , Daniel Ramsköld1 , 2, Ulf Hellman 4 , Rickard Sandberg 1 , 2, Rajappa S. Kenchappa 6 , Tommy Martinson 5 , John I. Johnsen 3 , Per Kogner 3 , and Susanne Schlisio 1,2

ABSTRACT Inherited KIF1B loss-of-function mutations in neuroblastomas and pheochromocytomas implicate the kinesin KIF1B as a 1p36.2 tumor suppressor. However, the mechanism of tumor suppression is unknown. We found that KIF1B isoform β (KIF1Bβ) interacts with RNA helicase A (DHX9), causing nuclear accumulation of DHX9, followed by subsequent induction of the proapoptotic XIAP-associated factor 1 (XAF1) and, consequently, apoptosis. Pheochromocytoma and neuroblastoma arise from neural crest progenitors that compete for growth factors such as nerve growth factor (NGF) during development. KIF1Bβ is required for developmental apoptosis induced by competition for NGF. We show that DHX9 is induced by and required for apoptosis stimulated by NGF deprivation. More- over, neuroblastomas with chromosomal deletion of 1p36 exhibit loss of KIF1Bβ expression and impaired DHX9 nuclear localization, implicating the loss of DHX9 nuclear activity in neuroblastoma pathogenesis.

SIGNIFICANCE: KIF1Bβ has neuroblastoma tumor-suppressor properties and promotes and requires nuclear-localized DHX9 for its apoptotic function by activating XAF1 expression. Loss of KIF1Bβ alters subcellular localization of DHX9 and diminishes NGF dependence of sympathetic neurons, leading to reduced culling of neural progenitors, and, therefore, might predispose to tumor formation. Cancer Discov; 4(4); 434–51. ©2014 AACR.

See related commentary by Bernards, p. 392.

INTRODUCTION isoform β (KIF1Bβ) is necessary and suffi cient for apoptosis when NGF is limiting. KIF1B is a member of the kinesin During development of the peripheral nervous system, 3 family and encodes two alternatively spliced isoforms, neural progenitor cells depend on and compete for growth KIF1Bα and KIF1Bβ (7–9 ). Both share an N-terminal motor factors, such as nerve growth factor (NGF). Mutations affect- domain but contain different C-terminal cargo domains. ing NGF-dependent neuronal survival have been associated KIF1Bα and KIF1Bβ are motor proteins implicated in antero- with sympathetic nervous system tumors such as neuro- grade transport of mitochondria and synaptic vesicle precur- blastoma and later-developing malignancies of neural crest sors, respectively (10 ). However, the recently identifi ed role origin, such as paraganglioma and pheochromocytoma (1–5 ). of KIF1Bβ in NGF-mediated neuronal apoptosis implicates Germline mutations associated with paragangliomas and this kinesin as an important player during sympathetic neu- pheochromocytomas (VHL , RET , NF1 , and SDHB/C/D ) are ron development. Moreover, KIF1B maps to chromosome thought to defi ne a pathway that is activated when NGF is 1p36.2, a chromosomal region that is frequently deleted in limiting, leading to apoptosis mediated by the EGLN3 prolyl neural crest–derived tumors, including neuroblastomas (5 ). hydroxylase ( 4 ). Failure to properly cull the neuronal progeni- The identifi cation in neuroblastomas and pheochromocy- tor cells during development might predispose to neoplastic tomas of inherited KIF1B missense mutations that remove transformation (2 , 6 ). Recently, we identifi ed the KIF1B gene KIF1Bβ’s ability to induce neuronal apoptosis ( 5 , 11 ) suggests as a downstream mediator of the proapoptotic effects of the that KIF1Bβ is a pathogenic target of 1p36 deletion in these prolyl hydroxylase EGLN3 and demonstrated that KIF1B diseases. Therefore, we investigated the tumor-suppressive mechanism by which KIF1Bβ regulates apoptosis.

Authors’ Affi liations: 1 Ludwig Institute for Cancer Research Ltd.; 2 Depart- RESULTS ment of Cell and Molecular Biology, Karolinska Institutet; 3Department of DHX9 Is a Binding Partner of Women’s and Children’s Health, Karolinska University Hospital, Stockholm; 4Ludwig Institute for Cancer Research Ltd., Biomedical Center, Uppsala; the KIF1Bb Apoptotic Domain 5Department of Clinical Genetics, Institute of Biomedicine, University To investigate how EGLN3 regulates KIF1Bβ and how of Gothenburg, Sahlgrenska University Hospital, Göteborg, Sweden; and this promotes cell death, we mapped the domain of KIF1Bβ 6Moffi tt Cancer Center, Neuro-Oncology Program, Tampa, Florida that is necessary and suffi cient to induce apoptosis (Fig. 1A). Note: Supplementary data for this article are available at Cancer Discovery We tested a series of N- and C-terminal truncated KIF1Bβ Online (http://cancerdiscovery.aacrjournals.org/). variants for apoptotic function by electroporating them Current address for Z.X. Chen: Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore. into primary rat sympathetic neurons (Fig. 1B). Neurons were 4′,6-diamidino-2-phenylindole (DAPI) stained, and the Corresponding Author: Susanne Schlisio, Ludwig Institute for Cancer Research Ltd., Karolinska Institutet, Nobels väg 3, SE-17177, Stockholm, nuclei of FLAG-positive neurons were visualized for apoptotic Sweden. Phone: 46-8-52487117; Fax: 46-8-332812; E-mail: susanne.schlisio changes. In addition, we transfected NB1 neuroblastoma cells @licr.ki.se with the KIF1Bβ variants and stained cells with crystal violet doi: 10.1158/2159-8290.CD-13-0362 to determine cell viability ( Fig. 1C ). These results confi rm ©2014 American Association for Cancer Research. earlier observations that both full-length and motor-defi cient

APRIL 2014CANCER DISCOVERY | 435

RESEARCH ARTICLE Chen et al.

A Cell DHX9 DHX9 E

600 800 1000 1200 1400 1600 death: binding: localization: Flag- Flag- Flag- Flag- FL Motor Ye s Ye s Ye s 600–1400 1000–1400 600–1200 600–1400 600–1770 Ye s Ad-EgIN3 –+ – + –+ SCR shE3 Ye s 600–1600 Flag 600–1400 Ye s Ye s Ye s EGIN3 600–1200 No No No 600–1000 No Tubulin 800–1600 Ye s 1000–1600 Ye s Ye s Ye s F KIF1Bβ600–1400: + – 1200–1600 No Ye s No 1000–1400 Ye s Ye s Ye s DHX9 1a 600–1400 1b Δ1100–1300 No Ye s No Bait DHX9 binding DHX9 localization Apoptotic activity

B 40

ID In silica Protein ID Acc # Seq. # pep 10 pl MW cov. RNA helicase A (%) Apoptosis in PSN 0 1a 6.4 142 (DHX9) NP_001348 23 22/77 GFP –1400 Exportin-2 KIF-WT 1b 5.5 111 (XPO2) NP_001307 76/50

KIF-600–1000KIF-600–1200KIF-600KIF-600–1600KIF-600–1770KIF-800–1600 KIF-1000–1600KIF-1200–1600 CG 600–1600 600–1400 600–1200 600–1000 1% input IgG IP: KIF1B β IP: 1% input IgG IP: KIF1B β IP:

NB1 cells DHX9 KIF1Bβ

600–1770 800–1600 1000–1600 1200–1600 DH Empty WT 1000–1400 600–1400 600–1200 Δ1100–1300 IP: FLAG-KIF1Bβ 5% input

– 600– 600– – 600– 600– 1200 1400 1200 1400 endog. endog. DHX9 Empty WT 1000–1400 600–1400 DHX9

FLAG Tubulin NB1 CHP212

Figure 1. DHX9 is a binding partner of KIF1Bβ apoptotic domain. A, schematic representation of KIF1Bβ deletion mutants and their ability to induce cell death, DHX9 binding, and DHX9 nuclear localization. FL, full-length. B, percentage of apoptosis in FLAG-positive, rat primary sympathetic neurons after electroporation with plasmids encoding FLAG-KIF1Bβ mutants as indicated. DAPI-stained nuclei were evaluated for apoptotic changes such as nuclear condensation and fragmentation. C and D, crystal violet staining to measure cell viability in NB1 and CHP212 cells after transfection with FLAG- KIF1Bβ plasmids as indicated. Transfected cells were selected with G418 (500 μg/mL) for several weeks. Empty vector (empty) served as negative control. E, immunoblot analysis of NB1 cells that were coinfected with lentivirus encoding Flag-KIF1Bβ mutants together with adenovirus encoding EGLN3 or coinfected with lentivirus encoding short hairpin targeting EGLN3 (shE3) or nontargeting control (SCR) as indicated. F, large-scale immunoprecipitation in NB1 cells that were infected with lentivirus encoding Stag-FLAG-KIF1Bβ600–1400. Silver-stained gel indicates (arrow) identiﬁ ed coimmunoprecipitated proteins and table listing peptides identiﬁ ed by mass spectrometry. G, immunoblot showing coimmunoprecipitation of endogenous DHX9 and KIF1Bβ in SK-N-SH cells that were immunoprecipitated with KIF1Bβ antibody. H, anti-DHX9 immunoblot analysis of NB1 cells transfected to produce Flag-KIF1Bβ protein and immunoprecipitated with anti-Flag antibody as indicated (arrow).

436 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

KIF1Bβ induce apoptosis when ectopically expressed (5 , 12 ). tetracycline died upon KIF1Bβ induction; however, trans- The apoptosis-inducing region of KIF1Bβ was previously duction with shRNA against DHX9 resulted in resistance to mapped to amino acids 637 to 1576 (12 ). Moreover, we identi- KIF1Bβ-induced cell death (Fig. 2C). Conversely, coexpres- fi ed the domain that retains apoptotic activity residing within sion of DHX9 together with KIF1Bβ600–1400 in CHP-212 the 600–1400 amino acid region, whereas the 600–1200 and cells had a synergistic effect on cell death, as measured by the 1200–1600 domains failed to induce apoptosis ( Fig. 1B crystal violet staining for viability and cleavage of caspase-3 and C ). Therefore, we tested additional KIF1Bβ deletions (Fig. 2D). This synergy was specifi c to the apoptotic domain and identifi ed the domain-spanning amino acids 1000–1400 of KIF1Bβ (KIF1Bβ600–1400), as coexpression of DHX9 (KIF1Bβ1000–1400) as suffi cient to induce apoptosis similar with the nonapoptotic mutant KIF1Bβ600–1200 did not to full-length KIF1Bβ in NB1 and CHP-212 neuroblastoma have the same effect (Fig. 2E). In addition, we quantifi ed cells ( Fig. 1D ). In contrast, internal deletion of amino acids apoptosis by scoring the nuclei of cells expressing GFP– spanning 1100–1300 abrogated the ability of KIF1Bβ600– histone fusion protein (Fig. 2F and Supplementary Fig. 1400Δ1100–1300 to induce apoptosis. Comparable levels of S2B). The nuclei of NB1 cells transfected to produce GFP– KIF1Bβ protein production were confi rmed by immunoblot histone alone or together with WT-DHX9 were healthy analysis (Supplementary Fig. S1A). and uniform. In contrast, cells transfected with full-length Because KIF1Bβ was previously identifi ed downstream of RFP-KIF1Bβ (Fig. 2F) or RFP-KIF1Bβ600–1400 (Supple- the prolyl hydroxylase EGLN3 during apoptosis, we ques- mentary Fig. S2B) displayed signs of apoptosis (nuclear tioned whether the truncated KIF1Bβ variants are respon- condensation and fragmentation) in 22% and 30% of cells, sive to EGLN3. When ectopically expressed, the protein respectively. However, this proportion increased synergisti- level of KIF1Bβ600–1400 domain that retains apoptotic cally to 68% and 72% when RFP-KIF1Bβ was coexpressed activity was induced by EGLN3 (Fig. 1E, left). Conversely, together with DHX9 (Fig. 2F and Supplementary Fig. knockdown of EGLN3 expression by lentivirus encoding S2B). Previous studies demonstrated that DHX9 functions short hairpin RNA (shRNA) markedly decreased ectopic in the nucleus as a transcriptional activator (13–18 ). To KIF1Bβ600–1400 abundance ( Fig. 1E , right), similar to determine whether this function of DHX9 is required for what we observed with endogenous KIF1Bβ protein (Sup- KIF1Bβ-induced apoptosis, we used previously character- plementary Fig. S1B). However, the proapoptotic variant ized DHX9 mutants (19, 20) that are defective in either KIF1Bβ1000–1400 was not regulated by EGLN3, in contrast nuclear transport (ΔNTD-DHX9) or transcriptional activa- with the nonapoptotic variant KIF1Bβ600–1200 ( Fig. 1E ). tion (TD-DHX9; Supplementary Fig. S2C). When tested, Therefore, regulation by EglN3 and induction of apop- both DHX9 mutants, ΔNTD-DHX9 and TD-DHX9, failed tosis are mediated through distinct domains within the to synergize with KIF1Bβ in apoptosis induction, implying KIF1Bβ600–1400 region. DHX9 nuclear activity in the induction of apoptosis by Next, we searched for proteins that interact specifi cally with KIF1Bβ (Fig. 2F and Supplementary Fig. S2B). Expression the proapoptotic and EGLN3-responsive KIF1Bβ600–1400 and localization of RFP-KIF1Bβ and eCFP-DHX9 mutants domain. NB1 cells were transiently transduced with Stag- was confi rmed by confocal microscopy (Fig. 2G and Sup- FLAG-KIF1Bβ600–1400 lentivirus and bound proteins were plementary Fig. S2D). resolved by SDS-PAGE and analyzed by mass spectrometry (Fig. 1F). Among the peptides identifi ed, 22 peptides KIF1B b Promotes DHX9 Nuclear Localization from RNA helicase A (DHX9) were recovered ( Fig. 1F ). The Motivated by our fi ndings that nuclear localization of association between KIF1Bβ and DHX9 was confi rmed in DHX9 is needed to synergize with KIF1Bβ in apoptosis, we SK-N-SH neuroblastoma cells by coimmunoprecipitation of investigated DHX9 cellular localization upon KIF1Bβ expres- endogenous KIF1Bβ with endogenous DHX9 ( Fig. 1G ). Fur- sion. Endogenous DHX9 and exogenous eCFP-DHX9 were thermore, exogenously expressed FLAG-KIF1Bβ600–1400 in predominantly nuclear in 1p36-intact SK-N-SH neuroblas- NB1 cells also confi rmed the interaction with endogenous toma cells (KIF1Bβ +/+ ), in line with earlier reports describ- DHX9 (Fig. 1H). This interaction was specifi c, because DHX9 ing nuclear DHX9 localization ( Fig. 3A and B ; refs. 13, did not coprecipitate with nonapoptotic variant FLAG- 14, 16 ). However, in 1p36.2 homozygous-deleted NB1 cells KIF1Bβ600–1200 (Fig. 1H). (KIF1Bβ −/− ), DHX9 localized mainly in the cytoplasm ( Fig. 3A and B ). To understand whether cytoplasmic DHX9 in NB1 KIF1B b Requires DHX9 to Induce Apoptosis cells is a consequence of KIF1Bβ loss, we restored KIF1Bβ Next, we asked whether DHX9 is necessary for KIF1Bβ by ectopically expressing RFP-KIF1Bβ and visualized endog- apoptotic function. Knockdown of DHX9 in NB1 (Fig. 2A) enous DHX9 and exogenous eCFP-DHX9 (Supplementary and SK-N-SH cells (Fig. 2B) using lentiviral shRNA resulted Fig. S3A, S3C, and S3D). Nuclear localization of endog- in protection from apoptosis induced by ectopic expression enous DHX9 in NB1 cells was restored in 89% of cells upon of KIF1Bβ600–1400 as measured by crystal violet staining expression of RFP-KIF1Bβ or 80% of cells upon expression for viability. Cells transduced with nontargeting shRNA of RFP-KIF1Bβ600–1400 (Supplementary Fig. S3A). Simi- (shSCR) served as control. Protection from apoptosis was larly, ectopically expressed eCFP-DHX9 together with RFP- observed with multiple independent shRNAs targeting KIF1Bβ or RFP-KIF1Bβ600–1400 in NB1 cells resulted in DHX9, indicating that the knockdown was “on-target” nuclear localization of DHX9 in 92% and 80% of cells, respec- (Supplementary Fig. S2A). The same result was obtained tively ( Fig. 3C and D ). In contrast, the nonapoptotic KIF1Bβ using SK-N-SH cells that were engineered to induce KIF1Bβ mutant (KIF1Bβ600–1200) that does not interact with DHX9 upon tetracycline treatment (Fig. 2C). Cells treated with displayed signifi cantly less nuclear localization of DHX9

APRIL 2014CANCER DISCOVERY | 437

RESEARCH ARTICLE Chen et al.

A B C shSCR shDHX9 shSCR shDHX9 shSCR shDHX9

pcDNA3 pcDNA3 – Tet

β KIF1Bβ KIF1B + Tet

shSCR shDHX9 shSCR shDHX9 shSCR shDHX9 KIF1Bβ – + –+ KIF1Bβ –+–+ Tet –+ –+ DHX9 DHX9 DHX9 FLAG FLAG FLAG Tubulin Tubulin Tubulin

DE KIF1Bβ KIF1Bβ KIF1Bβ Empty 600–1400 600–1400 Empty 600–1400

– – DHX9 DHX9 + +

Empty + + + – + – – – + + – – Empty + + + – 600–1400 ––––+ + 600–1400 – – + + 600–1200 – + – + – + His-DHX9 – + – + His-DHX9 His His FLAG FLAG cl Casp-3 Tubulin Tubulin

F 80 ∗ G RFP-KIF1Bβ eCFP-DHX9 Hoechst Merge 70 Bars –10 μm 60 WT- 50 DHX9 40 30 Apoptosis (%) 20 ΔNTD- 10 DHX9 0 RFP-KIF1Bβ – – + + + + WT-DHX9 – + – + – – ΔNTD-DHX9 ––––+ – TD- TD-DHX9 – – – – – + DHX9 GFP-histone ++++++

Figure 2. DHX9 is required for KIF1Bβ-induced apoptosis. A, crystal violet staining of NB1 cells and (B) SK-N-SH cells after infection with lentivirus encoding shRNA targeting DHX9 (shDHX9 ) or control virus (shSCR) and transfected with Flag-KIF1Bβ600–1400. Cells were selected with G418 (500 μg/ mL) for several weeks. Bottom, corresponding immunoblot analysis. C, crystal violet staining of tetracycline-inducible SK-N-SH cells that were infected with lentivirus encoding shRNA targeting DHX9 (shDHX9 ) or control virus (shSCR) and treated with tetracycline (0.5 μg/mL) to induce Flag-KIF1Bβ. Bottom, corresponding immunoblot analysis. D, crystal violet staining of CHP-212 cells that were transfected with His-DHX9 plasmid as indicated and cotransfected with increasing amounts of Flag-KIF1Bβ600–1400 plasmid and selected with G418 (500 μg/mL) for several weeks. Bottom, corresponding immunoblot analysis. E, performed as D with addition of Flag-KIF1Bβ600–1200) plasmid as indicated (arrow). F, NB1 cells transfected with plasmid encoding GFP-histone along with plasmid encoding RFP-KIF1Bβ or WT-DHX9 (wild-type) alone, or RFP-KIF1Bβ in combination with WT-DHX9 or mutant DHX9 (ΔNTD-DHX9 or TD-DHX9) as indicated. Shown is the percentage of GFP-positive nuclei exhibiting apoptotic changes 48 hours after transfection (mean ± SD; n = 3; *, P < 0.05). G, corresponding immunoﬂ uorescence studies of F 24 hours after transfection with plasmids encoding RFP-KIF1Bβ (red) and eCFP-DHX9 (green).

438 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

A endg. DHX9 Hoechst Merge B eCFP-DHX9 DAPI Merge NB1 SK-N-SH

β SKNSH cells KIF1B SKNSH cells GAPDH NB1 cells NB1 cells Bars –20 μm

C F RFP-KIF1Bβ eCFP-DHX9 Hoechst Merge FLAG-KIF1Bβ endg. DHX9 Hoechst Merge Bars –20 μm Control Control

Bars –10 μm WT WT

Bars –10 μm E646V 600–1400

Bars –20 μm T827I 600–1200 P1217S

D Cytoplasmic E Cytoplasmic Nuclear Nuclear

100 *** ** 100 Nuclear/cytoplasmic S1481N ***

* 80 80

* E1628K *** Bars –10 μm ** 60 60 G ** * ** 100 *** Nuclear 40 40 80

60 eCFP-DHX9 localization (%) 20 eCFP-DHX9 localization (%) 20 40

20 0

0 DHX9 localization (%) 0 WT WT Control Control E646VT827I Control P1217SS1481NE1628K 600–1400 600–1200 600–1400 1000–1400 1000–1600 1200–1600 Δ 1100–1300

Figure 3. KIF1B β promotes DHX9 nuclear localization. A, left, anti-KIF1Bβ immunoblot analysis of NB1 and SK-N-SH cell lines. Right, immunofl uorescence images of NB1 and SK-N-SH cells stained for DHX9 (green) and counterstained with Hoechst to visualize nuclei (blue). B, fl uorescence studies of NB1 and SK-N-SH cells 24 hours after transfection with plasmid encoding eCFP-DHX9 (green) as indicated. C, fl uorescence studies in NB1 cells 24 hours after transfection with plasmid encoding eCFP-DHX9 together with either RFP-KIF1Bβ-WT or RFP-KIF1Bβ mutants as indicated (arrow). D, graphical representation showing percentage of transfected cells with nuclear or cytoplasmic eCFP-DHX9 localization (mean ± SD; n = 3; **, P < 0.01; ***, P < 0.001). E, graphical representation of immunofl uorescence images of NB1 cells (Supplementary Fig. S3D) transfected with Flag-KIF1Bβ mutants as indicated. Shown is the percentage of nuclear or cytoplasmic eCFP-DHX9 or both 24 hours after transfection (mean ± SD; n = 3; *, P < 0.05; **, P < 0.01; ***, P < 0.001). F, anti-DHX9 (green) immunofl uorescence staining of NB1 cells 24 hours after transfection with plasmids encoding Flag-KIF1Bβ wild-type (WT) or disease-causing variants as indicated (red). The percentage of transfected cells displaying nuclear DHX9 is shown in G (mean ± SD; n = 3; *, P < 0.05; **, P < 0.01; ***, P < 0.001).

APRIL 2014CANCER DISCOVERY | 439

RESEARCH ARTICLE Chen et al. as compared with RFP-KIF1Bβ and RFP-KIF1Bβ600–1400 with wild-type FLAG-KIF1Bβ. However, the variants E646V ( Fig. 3C and D ). and S1481N stimulated DHX9 nuclear localization similar In addition to NB1 cells, KIF1Bβ-inducible SK-N-SH to wild-type KIF1Bβ despite their impairment in apoptosis cells (Tet-SK-N-SH) showed an enhanced nuclear accumu- ( Fig. 3F and G ), indicating that DHX9 nuclear localization is lation of endogenous DHX9 24 hours after FLAG-KIF1Bβ necessary but not suffi cient for KIF1Bβ to induce apoptosis, induction by tetracycline (Supplementary Fig. S3B). Nuclear and additional mechanisms might be required for KIF1Bβ DHX9 in tetracycline-treated cells was concentrated in spe- apoptotic function. cifi c nuclear regions and colocalized with the nucleoli, visualized by anti-Fibrillarin counterstaining (Supplementary Exportin-2 Is Necessary for DHX9 Nuclear Fig. S3B). Localization and KIF1Bb Apoptotic Function Because DHX9 nuclear localization depends upon KIF1Bβ To understand how KIF1Bβ regulates DHX9 nuclear expression, we reasoned that silencing of KIF1Bβ in SK-N-SH localization, we investigated other KIF1Bβ-associated pro- cells (KIF1Bβ +/+) should result in the reverse. Knockdown of teins that were identifi ed by large-scale immunoprecipita- KIF1Bβ in SK-N-SH cells using lentiviral shRNA resulted tion (Fig. 1F). In addition to DHX9, we identifi ed Exportin-2 in predominantly cytoplasmic DHX9 (Supplementary Fig. (XPO2) as a specifi c binding partner of the KIF1Bβ600–1400 S3C). This was also achieved using shRNA targeting EGLN3, apoptotic domain ( Fig. 1F ). XPO2 regulates nuclear import resulting in downregulation of KIF1Bβ protein and subse- and export of cellular proteins via its ability to reexport quent cytoplasmic localization of DHX9 (Supplementary Importin from the nucleus to the cytoplasm after imported Fig. S3C). substrates have been released into the nucleoplasm (21 ). We next examined the ability of additional KIF1Bβ vari- Knockdown of XPO2 in SK-N-SH cells using two independ- ants to infl uence eCFP-DHX9 localization. The proapoptotic ent lentiviral shRNAs caused robust reduction of nuclear domain 1000–1400, as well as the proapoptotic domain DHX9 (5%) compared with shSCR control (71%; Fig. 4A ). 1000–1600, signifi cantly stimulated DHX9 nuclear localiza- XPO2 knockdown effi ciency in these cells was verifi ed by tion in 40% and 52% of the cells, respectively, with 27% of Western blot analysis (Fig. 4B and Supplementary Fig. S4). the cells displaying partial DHX9 nuclear localization ( Fig. Because nuclear localization-defi cient DHX9 (ΔNTD-DHX9; 3E and Supplementary Fig. S3D). In contrast, the apoptotic- Fig. 2F and Supplementary Fig. S2B) failed to cooperate defective mutants 1200–1600 and 600–1400Δ1100–1300 with KIF1Bβ in apoptosis, we tested whether silencing of were impaired in stimulating eCFP-DHX9 nuclear localiza- XPO2 protects from KIF1Bβ-induced apoptosis. Coexpres- tion (Fig. 3E and Supplementary Fig. S3D), similar to what sion of GFP-KIF1Bβ, together with plasmids encoding shR- we observed for the apoptotic-defective mutant 600–1200 NAs targeting XPO2, demonstrated signifi cant protection ( Fig. 3D ). However, although mutant 600–1200 is defi cient from KIF1Bβ-mediated apoptosis in NB1 cells (Fig. 4C). in DHX9 binding, DHX9 nuclear localization, and apoptosis, Together, these results demonstrate that XPO2 is required the mutants 1200–1600 and 600–1400Δ1100–1300 retained for nuclear localization of DHX9 and that activity is essential the ability to bind to DHX9 despite being defective in apopto- for KIF1Bβ-induced apoptosis. sis and DHX9 nuclear localization ( Fig. 1A and Supplemen- tary Fig. S3E). On the basis of the DHX9-binding data, we conclude that the region required for DHX9 binding resides DHX9 Nuclear Localization Induced by KIF1Bb on amino acids 1300–1400, as 600–1400Δ1100–1300 retained Stimulates Proapoptotic XAF1 the ability to bind DHX9, whereas 600–1200 did not ( Fig. 1A Because transcription-dead mutant DHX9 (TD-DHX9) and H and Supplementary Fig. S3E). In contrast, the bind- failed to cooperate with KIF1Bβ in apoptosis, we asked ing site does not overlap with the DHX9 nuclear localization whether KIF1Bβ-mediated DHX9 nuclear localization site. We conclude that the DHX9 nuclear localization site results in activation of specific target genes. We performed resides on amino acids 1100–1200, as 1000–1400 localizes RNA-seq to analyze gene expression in NB1 cells that were DHX9 to the nucleus, whereas 1200–1600 and Δ1100–1300 transduced with either shRNA targeting DHX9 (sh DHX9 ) do not ( Figs. 1A and 3E ). This indicates that DHX9 binding or control virus (shSCR) and subsequently transfected and DHX9 localization are dictated by two distinct adja- with plasmid encoding KIF1Bβ600–1400. Principal com- cent sites. It further implies that both sites are required for ponent analysis (PCA) of overall gene expression profiles KIF1Bβ-induced apoptosis, because mutants that either lack revealed transcriptional changes in shSCR cells express- the DHX9 binding site (600–1200) or lack the DHX9 localiza- ing KIF1Bβ600–1400 compared with pcDNA3 control tion site (1200–1600 and Δ1100–1300) failed to induce apop- (Fig. 5A). Although DHX9 knockdown in cells alone tosis (Fig. 1A, C, and D). Collectively, these results suggest generally resulted in differences in gene expression com- that additional KIF1Bβ-interacting partners/modifi ers at the pared with the shSCR control, there was minimal differ- amino acid region 1100–1200 might be required to mediate ence in gene expression upon expressing pcDNA3 and DHX9 nuclear localization. KIF1Bβ600–1400 in the context of DHX9 knockdown Next, we tested putative disease-causing KIF1Bβ variants (Fig. 5A). Differential expression analysis using DESeq that were identifi ed in neuroblastomas and pheochromocy- revealed 58 genes significantly upregulated (false dis- tomas and were defective in apoptosis (5 ). The variants T827I covery rate, FDR, < 0.05) by KIF1Bβ600–1400, and their and P1217S failed to relocate DHX9 to the nucleus (Fig. 3F expression is depicted as a heatmap (Fig. 5B). Twenty- and G). Moreover, ectopic expression of the variant E1628K three genes were upregulated at least 2-fold and, among displayed a signifi cant reduction of nuclear DHX9 compared those, 18 genes were dependent on DHX9 expression

440 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

A DHX9 DAPI Merge Nuclear Bars –20 μm 100 Cytoplasmic

80 Nuclear and

shSCR cytoplasmic

40 sh XPO2 (90) Cell number (%) Cell number

(90) (92) sh XPO2 (92) shSCR

shXpo2 shXpo2

BC 100 **** **** (90) (92)

80 shSCR shXPO2 shXPO2 pcDNA3 MOI 2 20 220 2 KIF1Bβ XPO2 60 Tubulin

40 Apoptosis (%)

XPO(90)

pLKO-shSCR pLKO-sh pLKO-shXPO(92)

Figure 4. Exportin-2 is necessary for nuclear localization of DHX9 and KIF1Bβ to induce apoptosis. A, anti-DHX9 (green) immunofl uorescence staining of SK-N-SH cells stably expressing short hairpins targeting Exportin-2 (sh XPO2 ) or nontargeting control (shSCR) as indicated. Right, percentage of corresponding cells with nuclear or cytoplasmic DHX9 or both: nuclear, percentage of cells with higher nuclear fl uorescence intensity (green) compared with the cytoplasm; cytoplasmic, percentage of cells displaying higher cytoplasmic fl uorescence intensity (green) compared with the nuclear region. Nuclear and cytoplasmic, percentage of cells displaying similar fl uorescence intensity in the nucleus and cytoplasm. B, corresponding anti-XPO2 immunoblot analysis of stably infected cells with shRNA lentivirus targeting XPO2 that were displayed in A. C, NB1 cells were cotransfected with either empty pcDNA3 plasmid or GFP-KIF1Bβ600–1400 together with plasmids encoding short hairpin targeting XPO2 (pLKO-sh XPO2 ) or nontargeting control (pLKO- shSCR) as indicated. Shown is the percentage of apoptotic cells at 96 hours after transfection determined by fl uorescence-activated cell sorting (FACS) analysis using TMRE staining (mean ± SD; n = 3; ****, P < 0.0001). MOI, multiplicity of infection.

APRIL 2014CANCER DISCOVERY | 441

RESEARCH ARTICLE Chen et al.

A B 2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 –0.2 –0.4 –0.6 –0.8 –1.0 –1.2 –1.4 –1.6 –1.8 –2.0 log2 RPKM IFITM1 SAMD9 SP110 IFI44L TRIM22 IFI6 CXCL10 SAMD9L DDX60 IFI27 IFIT1B STAT2 EIF2AK2 BST2 UBA7 IFITM3 STAT1 OAS2 OASL PRIC285 DTX3L IFIT5 RNF213 OAS3 VCAM1 HERC6 DDX58 PLSCR1 MX2 IFIT1 C19orf66 DHX58 UBE2L6 PARP14 SAMHD1 PLEKHA4 IFIT2 OAS1 BATF2 ISG15 USP18 IL32 DDX60L CMPK2 PARP9 SP100 IFIT3 XAF1 PNPT1 ICAM1 RSAD2 NMI IFI44 IFI35 PARP10 SELE APOL6 shSCR + pcDNA3 shDHX9 + pcDNA3 shSCR + KIF1Bβ shDHX9 + KIF1Bβ

shSCR + pcDNA3 shSCR + KIF1Bβ shDHX9 + pcDNA3 shDHX9 + KIF1Bβ

CD 7.0 * Fold * Gene FDR change 6.0 * CXCL10 4.56 × 10–3 4.92 * SELE 1.32 × 10–2 4.02 5.0 XAF1 OAS2 2.96 × 10–19 2.88 XAF1.1 4.0 IFI44L 2.96 × 10–19 2.84 OASL 5.75 × 10–10 2.80 3.0 IFIT1B 5.80 × 10–3 2.79 2.0 MX 2 2.96 × 10–19 2.35 expression Relative XAF1 6.87 × 10–3 2.35 1.0 SAMD9 1.01 × 10–11 2.34 0.0 IFIT3 2.96 × 10–19 2.27 pcDNA3 KIF1Bβ pcDNA3 KIF1Bβ SAMD9L 1.53 × 10–4 2.16 shSCR shSCR shDHX9 shDHX9 OAS1 6.29 × 10–17 2.15 DDX60L 9.34 × 10–11 2.14 TRIM22 5.80 × 10–3 2.13 OAS3 4.37 × 10–18 2.12 IFITM1 6.47 × 10–15 2.11

–13 DDX60 4.82 × 10 2.03 F DHX9 Hoechst XAF1 Merge IFIT1 6.02 × 10–17 2.01

–Tet E CHP212 NB1

pcDNA3 KIF1Bβ pcDNA3 KIF1Bβ XAF1

FLAG +Tet

Tubulin Bars –20 μm

Figure 5. KIF1B β-driven nuclear DHX9 induces the expression of proapoptotic XAF1. A, PCA of overall gene expression profi les identifi ed by RNA-seq analysis. RNA was obtained from NB1 cells stably expressing short hairpins targeting DHX9 (shDHX9 ) or nontargeting control (shSCR) that were transfected with plasmids encoding FLAG-KIF1Bβ600–1400 or pcDNA3 as indicated. PCA plot displaying three independent experiments. B, heatmap depict- ing expression of genes in A that were signifi cantly upregulated (FDR < 0.05): green, lower expression; red, higher expression. C, list of genes identifi ed by differential expression analysis using DESeq that were upregulated greater than 2-fold (FDR < 0.05) by KIF1Bβ600–1400 and dependent on DHX9 expression as displayed in A. D, relative mRNA levels of XAF1 determined by qRT-PCR (XAF1 .1 corresponding to transcript variant 1; mean ± SD; n = 3; *, P < 0.05). E, anti-XAF1 immunoblot analysis of CHP-212 and NB1 cells transfected with plasmids encoding FLAG-KIF1Bβ600–1400 and FLAG-KIF1Bβ, respectively. F, anti-DHX9 (green) and anti-XAF1 (red) immunofl uorescence analysis in SK-N-SH cells with tetracycline-inducible KIF1Bβ (−Tet, nonin- duced; +Tet, induced).

442 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

(Supplementary Tables S1 and S2 and Fig. 5C ). Most DHX9 Nuclear Localization Is Impaired in of the KIF1Bβ-induced, DHX9-dependent targets were KIF1Bb-Defi cient Neuroblastoma Tumors IFN-induced or IFN-related, consistent with earlier To investigate whether nuclear localization of DHX9 reports implicating DHX9 in transcriptional regulation depends on KIF1Bβ in vivo , we studied the expression of α of IFN- –inducible genes (22 ). Some of these genes are DHX9 and KIF1Bβ in the mouse sympathetic nervous system κ known NF- B downstream targets (23–25 ), in line with when developmental apoptosis peaks, for example, around κ earlier observations demonstrating a DHX9–NF- B inter- birth (28 ). In situ hybridization revealed that KIF1Bβ was action resulting in the transactivation of specific promot- highly and exclusively expressed in the sympathetic ganglia ers (18 , 26 ). In addition, the proapoptotic XIAP-associated but not in non-neuronal tissue surrounding the ganglia, factor 1 ( XAF1) was identified (Fig. 5C). XAF1 functions highlighting its specifi c role in the sympathetic nervous as a negative regulator of members from the inhibitors system (Fig. 7A and B). The identity of the superior cervical of the apoptosis (IAP) family (27 ). Quantitative real-time ganglia (SCG) was confi rmed with immunohistochemistry PCR (qRT-PCR) confirmed that XAF1 mRNA is upregu- for tyrosine hydroxylase, a marker for noradrenergic and β lated by KIF1B in a DHX9-dependent manner (Fig. 5D). adrenergic neurons (Fig. 7C). To investigate whether nuclear β Moreover, exogenous expression of KIF1B 600–1400 or DHX9 localization coincides with KIF1Bβ expression in the β full-length KIF1B in CHP-212 and NB1 cells resulted in SCG, DHX9 immunofl uorescence studies were performed. XAF1 protein induction (Fig. 5E). In addition, inducible We observed DHX9 in the nuclei of cells within the SCG, but β KIF1B neuroblastoma cells (Tet-SK-N-SH) resulted in in the cytoplasm of cells in the surrounding, non-neuronal enhanced DHX9 nuclear localization and XAF1 induction tissue that lack KIF1Bβ expression ( Fig. 7D and Supplemen- (Fig. 5F). tary Fig. S6A). This is in accordance with our in vitro obser- vation that DHX9 nuclear localization is dependent upon Loss of DHX9 Promotes Neuronal Survival β in the NGF Signaling Pathway KIF1B expression. We next analyzed 13 primary neuroblastoma tumors for We used differentiated PC12 cells to study the regulation KIF1Bβ and DHX9 protein expression, determined DHX9 of DHX9 during neuronal survival by NGF. Consistent with cellular localization, and sequenced the KIF1B exome. Only previous reports (5 ), NGF withdrawal from PC12 cells caused two of 13 neuroblastomas, K14 and K33, were 1p36-intact β the induction of KIF1B protein, followed by the induction of (1p36+ /+), whereas the remaining 11 samples harbored apoptosis (Fig. 6A and Supplementary Fig. S5A). We observed hemizygous 1p36 deletions (Supplementary Table S3). We β that, like KIF1B , XAF1 protein was also induced with similar observed a complete lack of KIF1Bβ protein expression in kinetics in PC12 cells after NGF deprivation and associated most of the 1p36-deleted tumors, in contrast with tumor K14 with increased XAF1 mRNA (Fig. 6A and Supplementary (1p36+ /+) and the SK-N-SH cell line (1p36 +/+; Fig. 7E). Also, Fig. S5A and S5B). To determine whether induction of XAF1 tumor K33 (1p36+ /+ ) did not express KIF1Bβ, and tumors β depends on KIF1B -mediated DHX9 nuclear accumulation, K36 and K56 expressed faster migrating forms of KIF1Bβ we fi rst assayed endogenous DHX9 localization in PC12 cells protein, likely due to splicing alterations (Fig. 7E). Exome followed by NGF withdrawal. NGF-deprived PC12 cells dis- sequencing did not reveal any missense mutations in KIF1B b playing apoptotic characteristics showed enhanced nuclear alleles, although polymorphic variants were identifi ed in two DHX9 (67% of cells), in contrast with cells maintained in tumors, K14 (V1554M) and K10 (M807I; Supplementary NGF, which showed only 1% of cells with nuclear DHX9 Table S4). The lack of KIF1Bβ protein expression in KIF1Bβ- ( Fig. 6B ). However, PC12 cells transduced with shRNA target- hemizygous tumors might result from epigenetic silencing, β ing KIF1B prevented nuclear accumulation of DHX9 ( Fig. translation, or splicing alterations. Notably, DHX9 protein 6C ). Likewise, knockdown of EGLN3 reduced nuclear DHX9 expression varied across the different neuroblastoma tumors and caspase-3 cleavage compared with shSCR control (Fig. (Fig. 7E). 6D ). Moreover, PC12 cells transduced with shRNA target- Next, we investigated DHX9 localization in these tumors β ing KIF1B abolished the induction of XAF1 upon NGF in paraffi n-embedded sections ( Fig. 7F and Supplemen- withdrawal ( Fig. 6E ). Furthermore, we observed induction of tary Fig. S6B and S6C). Specifi city of the DHX9 staining DHX9 protein upon NGF withdrawal in shSCR PC12 cells in these paraffi n-embedded sections was confi rmed using and in primary mouse sympathetic neurons ( Fig. 6E, F, and the K11 tumor as negative control, because it lacks DHX9 G ). Next, we asked whether loss of DHX9 blocks apopto- protein expression (Supplementary Fig. S6C and Fig. 7E ). sis in NGF-deprived PC12 cells. PC12 cells transduced with In tumors that lacked KIF1Bβ protein expression (K10, shRNAs targeting DHX9 were protected from apoptosis K12, K33, K7, and K9), DHX9 was observed in both the upon NGF withdrawal compared with control cells, as deter- cytoplasm and nucleus, with the majority in the cytoplasm mined by cleaved caspase-3 quantifi cation ( Fig. 6H ). Fur- ( Fig. 7F and Supplementary Fig. S6B). However, the K14 thermore, silencing of DHX9 in NGF-deprived PC12 cells tumor expressing KIF1Bβ protein displayed predominantly showed ablated XAF1 induction similar to that observed fol- nuclear DHX9. These results accord with our observations β lowing KIF1B knockdown ( Fig. 6F ). Silencing of DHX9 also in the mouse sympathetic nervous system and in vitro stud- β abolished the induction of endogenous KIF1B protein in ies that nuclear localization of DHX9 depends on KIF1Bβ NGF-deprived PC12 cells and SK-N-SH neuroblastoma cells, protein. β possibly by regulating the translation of KIF1B mRNA (Fig. Collectively, our results demonstrate that DHX9 nuclear 6F and I and Supplementary Fig. S5C). localization is impaired in KIF1Bβ-defi cient neuroblastoma

APRIL 2014CANCER DISCOVERY | 443

RESEARCH ARTICLE Chen et al.

A B Nuclear DHX9 100 Cl. casp-3 endg. DHX9 cl. casp-3 Hoechst Merge 80 * NGF withdrawal

+ NGF 60 16 24 40 48 h * +NGF KIF1Bβ 40 XAF1 % of cells 20 Tubulin

–NGF 0 Bars –20 μm (+) 18 h 24 h NGF (–) NGF

C endg. DHX9 Hoechst Merge D endg. DHX9 cl. casp-3 Hoechst Merge μ Bars –20 m 100 + NGF Bars –20 μm – NGF (+) (+) NGF * NGF 80 shSCR (–) shSCR 60 (–) NGF NGF

(+) Nuclear DHX9 in % (+)

β NGF NGF 20 sh EgIN3 sh KIF1B (–) 0 (–) β NGF NGF

shSCR KIF1B sh β E shSCR shKIF1B – NGF – NGF GHNGF withdrawal 8162448h + NGF + NGF + NGF 8162448 + NGF 6121824h 50 – NGF β KIF1B DHX9 DHX9 KIF1Bβ 40 XAF1 Cl. casp-3 * GAPDH GAPDH 30 F shSCR shDHX9 I 20 – NGF – NGF shSCR shDHX9 Apoptosis (%)

+ NGF 8 16 24+ NGF 8 16 24 h β KIF1B 10 KIF1Bβ DHX9 DHX9 0 XAF1 GAPDH

GAPDH DHX9 shSCRsh

Figure 6. Induction of KIF1Bβ increases nuclear DHX9 and XAF1 expression during NGF withdrawal. A, anti-KIF1Bβ and anti-XAF1 immunoblot analysis of differentiated PC12 cells subjected to NGF withdrawal. B–D, immunoﬂ uorescence images of differentiated PC12 cells that were subjected to NGF withdrawal (24 hours; −NGF). Antibodies against DHX9 (green) and cleaved caspase-3 (red) were used in addition to Hoechst staining to visualize nuclei (blue). B, right, percentage of PC12 cells exhibiting nuclear DHX9 and cleaved caspase-3 before (+) and after (−) NGF withdrawal at indicated times (mean ± SD; n = 3; *, P < 0.05). C, before NGF withdrawal, cells were infected with lentivirus encoding short hairpins targeting KIF1Bβ (sh KIF1Bβ) or nontargeting control virus (shSCR). Right, corresponding percentage of cells displaying DHX9 nuclear accumulation (mean ± SD; n = 3; *, P < 0.05). D, before NGF withdrawal, cells were infected with lentivirus encoding short hairpins targeting rat-EGLN3 (shEGLN3 ). E and F, immunoblot analysis of differentiated PC12 cells before (+) and after (−) NGF withdrawal as indicated. Before NGF withdrawal, differentiated cells were infected with lentivirus encoding short hairpins targeting KIF1Bβ (sh KIF1Bβ), DHX9 (sh DHX9 ), or nontargeting control virus (shSCR). G, immunoblot analysis of primary mouse sympathetic neurons subjected to NGF withdrawal at indicated times. H, percentage of apoptosis in differentiated PC12 cells before (+) and after (−) NGF withdrawal that were transduced with lentivirus encoding short hairpins targeting DHX9 (shDHX9 ) or nontargeting control virus (shSCR). Apoptosis was scored by cleaved caspase-3 quantiﬁ cation (mean ± SD; n = 5; *, P < 0.05). I, immunoblot analysis of SK-N-SH cells infected with lentivirus encoding short hairpins targeting DHX9 (shDHX9 ) or control virus (shSCR). GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

444 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

A B KIF1Bβ C Tyrosine KIF1Bβ KIF1Bβ sense KIF1Bβ hydroxylase

D DHX9 DHX9 DAPI Merge Bar –40 μm

E G NGF

NF1 Tr kA c-RET +/+ +/– +/+ +/–

1p36 1p36 1p36 1p36 VHL Jun-B c-JUN SKNSH K7 K10 K12 K14 K61K56K36K43K34K9K11K55K33 Short KIF1Bβ exp. SDH Succinate EGLN3 Long KIF1Bβ exp. KIF1Bβ DHX9 ?? GAPDH DHX9

XAF1

F Apoptosis KIF1Bβ positive KIF1Bβ negative ×20 ×20 ×20 ×20 ×20 K14 K10 K12 K33 K7

×100 ×100 ×100 ×100 ×100 DHX9

Figure 7. DHX9 is localized to the nuclei of developing mouse sympathetic neurons but not in human neuroblastoma tumors defi cient in KIF1Bβ. A, in situ hybridization using a probe for KIF1Bβ on sagittal sections of wild-type mouse at embryonic day E17.5 showing KIF1Bβ expression in the SCG adjacent to the cochlea as indicated. B, in situ hybridization for KIF1B b at P2 using both antisense and sense probes in adjacent sections. C, in situ hybridization for KIF1B b in mouse SCG at P2 and immunohistochemistry for tyrosine hydroxylase showing expression in the same area. D, anti-DHX9 (red) immunofl uorescence images in the SCG (1), non-neuronal surrounding tissue (2), and the cochlea (3) of mouse sagittal sections at postnatal day 1. E, immunoblot analysis of primary neuroblastoma tumors. 1p36 status has been characterized and is outlined in Supplementary Table S3 (1p36+ /+, wild- type; 1p36+ /−, 1p36 deletion). SK-N-SH cells (1p36-intact) served as positive control. F, immunohistochemistry for DHX9 on paraffi n-embedded tissue sections of human neuroblastoma tumors counterstained with hematoxylin. K10, K12, K33, and K7 do not express KIF1Bβ but are positive for DHX9 based on the immunoblot analysis in E. K14 is positive for KIF1Bβ and DHX9 based on immunoblot analysis in E. The image in A was acquired using a ×4 objective; images in F were acquired using a ×20 objective, whereas higher magnifi cation images of selected regions were acquired using a ×100 objective. G, signaling model linking familial genetic lesions associated with sympathetic nervous system cancer (pheochromocytoma or neuroblastoma) to apoptosis when NGF becomes limiting during sympathetic neuronal development.

APRIL 2014CANCER DISCOVERY | 445

RESEARCH ARTICLE Chen et al. tumors. This suggests that loss of KIF1Bβ during normal ates KIF1Bβ apoptotic function. However, variants E646V development of the sympathetic nervous system may impair and S1481N stimulated DHX9 localization to a compara- NGF-deprived apoptosis due to mislocalization of DHX9. ble degree as wild-type KIF1Bβ despite their impaired apop- Indeed, low expression of KIF1Bβ is correlated with poor totic abilities. This indicates that DHX9 nuclear localization prognosis and reduced survival of patients with neuro- is necessary but not suffi cient for KIF1Bβ to induce apop- blastoma, providing further evidence to suggest that tosis and that additional events are needed for KIF1Bβ to KIF1Bβ is a neuroblastoma tumor suppressor (Supplemen- induce apoptosis. tary Fig. S6D). In an attempt to mechanistically understand how KIF1Bβ regulates DHX9 nuclear localization, we examined other KIF1Bβ binding partners. In addition to DHX9, we found that XPO2 binds to the KIF1Bβ proapoptotic DISCUSSION 600–1400 domain. XPO2 has been reported to regulate KIF1B β was previously characterized as a potential 1p36 nuclear import and export of cellular proteins. Here, we tumor-suppressor gene that mediates neuronal apoptosis show that loss of XPO2 impairs DHX9 nuclear localiza- when NGF is limiting in the developing nervous system tion and, consequently, impedes KIF1Bβ-induced apop- ( 5 , 11 , 12 ). Here, we provide a mechanistic understanding tosis, further implicating DHX9 nuclear localization as of KIF1Bβ-mediated tumor suppression. We identifi ed the a requirement for KIF1Bβ apoptotic function. XPO2 was RNA helicase DHX9 as an interacting partner of KIF1Bβ previously implicated in regulating apoptosis induced by and found that DHX9 is necessary for KIF1Bβ to induce Pseudomonas exotoxin (34 ), and resistance to Pseudomonas apoptosis and is required for apoptosis when NGF is exotoxin is phenocopied in Egl-9 −/− worms (35 ), suggesting limiting. that XPO2 acts in the same apoptotic program mediated DHX9 is a member of the DEAH-box DNA/RNA helicase by EGLN3 and KIF1Bβ. Moreover, our results suggest that family that catalyzes the ATP-dependent unwinding of DHX9 binding and DHX9 nuclear localization are medi- double-stranded RNA and DNA–RNA complexes ( 14 ). ated by two distinct and adjacent sites, KIF1Bβ1300–1400 Recently, DHX9 has been characterized in multiple cellular and KIF1Bβ1100–1200, respectively. Because both sites functions, including translation, RNA splicing, and miRNA are required for KIF1Bβ apoptosis function, we concluded processing. In addition, DHX9 localizes to both the nucleus that additional KIF1Bβ binding partners on amino acid and the cytoplasm and functions as a transcriptional regu- region 1100–1200 might participate in DHX9 localiza- lator (13 , 15 – 17 ). Here, we report that KIF1Bβ induces tion. It was previously demonstrated that arginine meth- neuronal apoptosis by directing DHX9 nuclear accumula- ylation of DHX9 determines its subcellular localization tion, leading to induction of proapoptotic XAF1 . XAF1 has (36 ). Indeed, we identified arginine methyltransferase been reported as an antagonist of antiapoptotic XIAP and PRMT5 in the large-scale KIF1Bβ600–1400 immunopre- has been shown to convert XIAP into a proapoptotic pro- cipitation (data not shown). Therefore, PRMT5 might be tein to degrade survivin ( 27 , 29 ). Inhibition of XIAP is nec- such a modifier. essary and suffi cient for sympathetic neurons to acquire Finally, we demonstrate that the regulation of DHX9 by apoptotic competence during NGF withdrawal-induced KIF1Bβ is relevant in neuroblastoma. Our in vivo studies apoptosis (30 ). Similarly, expression of survivin is strongly in the mouse sympathetic nervous system demonstrate correlated with advanced stages of disease and unfavorable that DHX9 is specifically found in the nuclei of cells that neuroblastoma outcomes ( 31 ). express KIF1Bβ and that nuclear DHX9 is present in 1p36- Abnormal NGF signaling has been linked to nervous intact tumors that express wild-type KIF1Bβ. In contrast, system tumors such as neuroblastoma, medulloblastoma, analysis of 1p36-deleted neuroblastomas with complete and pheochromocytoma ( 1–5 , 32, 33 ). Our fi ndings imply loss of KIF1Bβ protein expression showed impaired DHX9 that alterations in NGF-mediated developmental apoptosis nuclear localization. In addition to our findings that may play a role in these types of cancers. We found that implicate impairment of nuclear DHX9 in neuroblastoma DHX9 is induced when NGF is limiting, localizes and accu- pathogenesis, other evidence points to dysfunction of RNA mulates in the nucleus, and that nuclear accumulation is helicases in pediatric nervous system cancers. Medullob- dependent upon KIF1Bβ expression. Furthermore, down- lastoma exome sequencing uncovered recurrent somatic regulation of DHX9 diminished the expression of proapop- missense mutations within RNA helicases and showed that totic XAF1 and caused escape from NGF withdrawal- 15% of medulloblastomas seemed to have some disruption dependent apoptosis. However, silencing of DHX9 also in RNA helicase activity ( 37 ). Given the apparent impor- abolished KIF1Bβ induction and, therefore, loss of DHX9 tance of RNA helicase function in medulloblastoma, we could also cause escape from apoptosis due to its effect on searched the Catalogue of Somatic Mutations in Cancer KIF1Bβ. Therefore, KIF1Bβ’s function in apoptosis might (COSMIC) database (38 ) for DHX9 mutations in cancer involve additional mechanisms that account for NGF- (Supplementary Table S5). We found numerous tumors dependent apoptosis. In this regard, we tested recently with DHX9 missense mutations within the CBP-binding identifi ed putative disease-causing KIF1Bβ mutants for domain, nuclear transport domain (NTD), minimal trans- their ability to regulate DHX9 localization. Indeed, variants activation domain (MTAD), and helicase ATP-binding T827I, P1217S, and E1628K—all of which are defective in domain, all of which were predicted to impair DHX9’s abil- apoptosis—failed to stimulate nuclear localization of ity to mediate transcription. Moreover, 44 of 144 unique DHX9, supporting our fi ndings that nuclear DHX9 medi- samples were found to contain mutations.

446 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

In summary, we propose that loss of nuclear DHX9 due reverse: 5′-ACTAGTCGCAGGATTCGCGTTGGATTGTGGAGGTG to impaired EGLN3 activity or loss of KIF1Bβ promotes ACGCAGGAACC-3′. neuronal survival during the NGF-dependent developmental culling of sympathetic neurons. On the basis of our shRNA and siRNA studies, we propose that failure to properly cull neuronal shRNA-expressing lentiviral plasmids targeting DHX9 were progenitors during development predisposes to sympathetic obtained from Mission shRNA (Sigma). shRNA sequence target- nervous system tumors such as neuroblastoma. Alterations ing human DHX9 was (#1): 5′-TCGAGGAATCAGTCATGTAAT-3′, ′ ′ ′ in developmental apoptosis due to dysfunction of EGLN3, (#2): 5 -CCAGAAGAATCAGTGCGGTTT-3 , (#3): 5 -GGGCTATATC ′ KIF1Bβ, and DHX9 might play a role in the pathogenesis CATCGAAATTT-3 . shRNA (#1) was also used to target DHX9 in rat PC12 cells. shRNA sequences targeting rat KIF1Bβ and of these tumors by allowing neuronal progenitors to escape rat EGLN3 in PC12 cells as well as human KIF1Bβ and human from developmental culling and thereby predisposing them EGLN3 have been previously described ( 5 ). siRNAs targeting rat to neoplastic transformation (Fig. 7G and Supplementary DHX9 were purchased from Euroﬁ ns MWG Operon; siDHX9(1) Fig. S7). 5′-GCAUGGACCUUAAGAAUGA-3′ and siDHX9(3) 5′-CCACG CAAGUUCCACAAUA-3′. siRNA targeting human XAF1 was purchased from Dharmacon under ON-TARGETplus SMARTpool METHODS siRNA. Cotransfections of siRNA with pcDNA3 plasmids were per- Cell Culture formed using DharmaFECT Duo Transfection Reagent according to the manufacturer’s recommendations. Human neuroblastoma cell lines (NB1, CHP-212, and SK-N- SH) and PC12 cells were maintained as previously described (5 ). CHP-212, SK-N-SH, and PC12 cell lines were obtained from the Viral Expression and Infection American Type Culture Collection, and NB1 cells were obtained Adenovirus encoding rat EGLN3 (SM-20) was a gift from Robert from the Japanese Collection of Research Bioresources. The cell Freeman (University of Rochester, Rochester, NY). Virus ampliﬁ ca- lines used were not further authenticated. Sympathetic neurons tion and infection has been previously described (5 ). Lentiviral infec- from P1 mice were isolated from the SCG and cultured as described tion for gene silencing using shRNA was performed according to the previously (39 ). manufacturer’s instructions (MISSION shRNA; Sigma).

Plasmids Immunoprecipitation and Mass Spectrometry FLAG-tagged KIF1Bβ plasmids and corresponding mutants A total of 160 × 10 6 NB1 cells were transduced with lentivirus were generated as described previously (5 ). RFP-KIF1Bβ, RFP- expressing S-tag-KIF1Bβ(600–1400). Two days later, cells were har- KIF1Bβ(600–1400), and RFP-KIF1Bβ(600–1200) were generated by vested with lysis buffer (150 mmol/L NaCl, 50 mmol/L Tris–HCl, cloning TagRFP into FLAG-KIF1Bβ plasmids. RFP was cloned into 5 mmol/L EDTA, 0.1% CHAPS, and pH 7.4) and incubated for the Kpn I-digested 5′ region of FLAG-KIF1Bβ pcDNA3.1 expression 2 hours at 4°C with rotation. The lysate was centrifuged at 20,000 vectors. Lentivirus expressing RFP-KIF1Bβ(600–1400) was gener- × g for 20 minutes. The resulting supernatant was precleared for ated as previously described using pLenti-Flag-KIF1Bβ(600–1400). 2 hours and, subsequently, S-protein agarose beads (Novagen) were Stag was cloned into FLAG-KIF1Bβ(600–1400) by annealing 5′ added to lysates and incubated for 3 hours at 4°C with rotation. phosphorylated oligonucleotides containing S-tag sequence and Samples were centrifuged and beads were washed fi ve times in wash Xba I restriction site, followed by ligation with the Xba I-digested 5′ buffer (500 mmol/L NaCl, 50 mmol/L Tris–HCl, 5 mmol/L EDTA, region of pLenti-FLAG-KIF1Bβ(600–1400). His-DHX9 and eCFP- pH 7.4). Bound protein complexes were eluted in Laemmli buffer DHX9 were purchased from Genocopoeia. eCFP-ΔNTD-DHX9, and containing 10 mmol/L Dithiothreitol and heated for 10 minutes eCFP-TD-DHX9 were generated from eCFP-DHX9 (Genocopoeia). at 95°C. Eluates were analyzed by SDS-PAGE, gels were subjected eCFP-ΔNTD-DHX9 was created by introducing a premature STOP to silver stain, and bands of interest were excised for mass spec- codon at residue position 1146 of DHX9 to result in a truncated trometry identifi cation. Mass spectrometry protocol was previously DHX9 lacking in NTD. eCFP-TD-DHX9 was created by introducing described (40 ). W332A, W339A, and W342A mutations at the MTAD domain of DHX9. eCFP-ΔNTD-DHX9, eCFP-TD-DHX9, and eCFP-R1166L- Coimmunoprecipitation of Endogenous Proteins DHX9 were all generated using the QuikChange Site-Directed One confl uent p150 plate of SK-N-SH neuroblastoma cells was Mutagenesis Kit (Stratagene). harvested with 1-mL immunoprecipitation (IP) buffer (20 mmol/L Tris, 150 mmol/L NaCl, 2 mmol/L EDTA, 10% glycerol, 0.1% Primers CHAPS, and protease inhibitors, pH 7.4), incubated for 2 hours, RFP- XbaI forward primer: 5′-TGCTCTAGAATGGTGTCTAAGGG and then centrifuged at 14,000 × g for 30 minutes. The resulting CGAAGA-3′; RFP-XbaI reverse primer: 5′-TGCTCTAGAATTAAG supernatant was precleared with 40-μL Protein A agarose slurry for TTTGTGCCCCAGTTTG-3′; S-tag-XbaI sense oligo: 5′-CTAGAA 1 hour and then centrifuged at 2,500 × g for 3 minutes. Either 5-μg TGAAGGAGACCGCCGCCGCCAAGTTCGAGAGACAGCACAT rabbit polyclonal KIF1Bβ antibody or rabbit immunoglobulin G GGACAGCT-3′; S-tag- XbaI antisense oligo: 5′-CTAGAGCTGTCCAT- (IgG) isotype control antibody (Cell Signaling Technology; DA1E, GTGCTGTCTCTCGAACTTGGCGGCGGCGGTCTCCTTCATT-3′. #3900) was added to 1-mg lysate overnight at 4°C. Subsequently, Site-directed mutagenesis primers: XbaI -pLenti-KIF1Bβ(600–1400) 40-μL Protein A agarose slurry was added and incubated on a rota- forward: 5′-CTCAGCTTATAATCGAGAGGGCCCGCGGT-3′; XbaI- tor for 3 hours and then centrifuged at 2,500 × g for 30 seconds, pLenti-KIF1Bβ(600–1400) reverse: 5′-ACCGCGGGCCCTCTCGATT and the resulting resin was washed with 1-mL IP buffer. The resin ATAAGCTGAG-3′; eCFP-ΔNTD-DHX9_STOP forward: 5′-CTCAG was washed three times in total, and reducing 2× sample buffer CTGCTGGTATCTAACCTTATGATTGGC-3′; eCFP-ΔNTD-DHX9_ was added to the resin and boiled for 5 minutes and analyzed by STOP reverse: 5′-GCCAATCATAAGGTTAGATACCAGCAGCTGAG-3′; immunoblotting. Coimmunoprecipitation of exogenous FLAG- eCFP-TD-DHX9_MTAD forward: 5′-GGTTCCTGCGTCACCTCCAC KIF1Bβ with Anti-FLAG M2 Affi nity Gel was prepared according to AATCCAACGCGAATCCTGCGACTAGT-3′; eCFP-TD-DHX9_MTAD the manufacturer’s instructions (Sigma).

APRIL 2014CANCER DISCOVERY | 447

RESEARCH ARTICLE Chen et al.

Apoptosis Assays treated with 10 mmol/L sodium citrate for 10 minutes at 98°C. Apoptosis was assessed using GFP-histone to quantify apoptotic Blocking was performed with 1% BSA followed by 2% NGS in 1% nuclei as previously described ( 5 ). Alternatively, immunofl uorescence BSA/PBS, after which the sections were incubated with mouse anti- ° staining for cleaved caspase-3 allowed for visualization and quantifi - DHX9 at 1:1,000 dilution in NGS/BSA overnight at 4 C (Novus Bio- cation of apoptotic cells via microscopy. Apoptosis in primary sym- logicals). The sections were subsequently washed and incubated in pathetic neurons was scored by DAPI staining, to visualize apoptotic biotinylated goat anti-mouse antibody at 1:250 dilution, followed by changes as previously described (5 , 41 ). KIF1Bβ-induced apoptosis the Vectastain ABC Kit and DAB visualization as above. The sections assays in XPO2-knockdown cells were performed by fl uorescence- were counterstained with Mayer’s hematoxylin, dehydrated, cleared activated cell sorting (FACS) analysis using tetramethylrhodamine in xylene, coverslipped (Histolab), and viewed with a Nikon Eclipse ethyl esters (TMRE; Invitrogen Corporation) 92 hours after trans- E1000 microscope. fection. Statistical analysis was performed by one-way ANOVA, followed by the Bonferroni posttest using the GraphPad Prism software Microscopy (GraphPad Software Inc., version 6.00). Immunofl uorescence and fl uorescent protein-tagged images were acquired and analyzed using Zeiss LSM 5 EXCITER or Zeiss LSM Tetracycline-Regulated Expression System 510 META laser-scanning confocal microscopes together with Zeiss Tetracycline-responsive inducible KIF1Bβ expression in SK-N- LSM 5 EXCITER or Zeiss LSM 510 software, respectively. Images SH cells was constructed using the T-REx System (Invitrogen). were acquired using 63X Plan-Apochromat/1.4 NA Oil with DIC Tetracycline-inducible cells were plated in a 6-well plate and trans- capability objective. The excitation wavelengths for TagRFP/Alexa duced with either shSCR or shDHX9 lentivirus. After 24 hours, Fluor 555, eCFP, GFP/Alexa Fluor 488, and DAPI/Hoechst were cells were grown in selection medium (1 μg/mL puromycin) for 543, 458, 488, and 405 nm, respectively. Images were captured at 3 days before being replenished with fresh medium containing frame size: 1024, scan speed: 7, and 12-bit acquisition and line aver- 0.5 to 1 μg/mL tetracycline. Fresh medium containing tetracy- aging mode: 8. Pinholes were adjusted so that each channel had the μ cline and puromycin was replenished every 2 days. After 4 days same optical slice of 1 to 1.2 m. Image scaling was performed using of induction or upon reaching confl uence, cells were transferred the Photoshop CS6 “Place Scale Marker” tool, whereby the number into p100 plates to undergo further selection and induction of pixels was divided by the fi eld size and multiplied by the desired until resistant colonies were identifi ed. Cells were maintained in distance to indicate the respective scales. Approximately 50 to 100 blasticidin and zeocin at all times at concentrations previously cells per sample were counted for quantifi cation analysis. Images mentioned. of neuroblastoma paraffi n-embedded tissue sections were acquired using ×20 and ×100 objectives mounted on a Nikon Eclipse E1000 microscope. Immunofl uorescence and Immunohistochemistry Cells were fi xed with 4% paraformaldehyde (PFA) and stained with Antibodies 1 μg/mL Hoechst for 10 minutes at room temperature. Immunofl uo- Rabbit polyclonal anti-Flag (F7425) and mouse monoclonal anti- rescence was performed by fi xation with 4% PFA for 15 minutes, fol- Flag (F3165 and F1804) were purchased from Sigma. Mouse mono- lowed by quenching with 10 mmol/L glycine for 20 minutes. Cells clonal anti-EGLN3 was generously provided by Dr. Peter Ratcliffe were then permeabilized with 0.1% Triton X-100, blocked with 5% (Oxford University, Oxford, UK). Mouse monoclonal anti-DHX9 was goat serum, and incubated with primary antibodies in PBS contain- purchased from Novus Biologicals (3G7; H00001660-M01). XPO2 ing 0.1% bovine serum albumin (BSA) overnight at 4°C. Secondary mouse monoclonal antibody (#610482; BD Transduction Labora- antibodies conjugated to fl uorophores were incubated in PBS with tories) was used at a dilution of 1:1,000 for immunoblot analysis. 0.1% BSA at 1:1,000 for 1 hour, followed by 1 μg/mL Hoechst for 10 Polyclonal KIF1Bβ-antibody was raised in rabbits against a syn- minutes (Invitrogen). All steps were interspersed with two to three thetic peptide (GHYQQHPLHLQGQELNSPPQPC) by Peptide Spe- washes with PBS or PBS with 0.1% BSA and performed at room tem- cialty Laboratories GmbH. Rabbit monoclonal anti-cleaved caspase-3 perature unless otherwise stated. (D175; 5A1E; #9664), rabbit monoclonal anti-Fibrillarin (C13C3; C57BL/6 mice were decapitated at postnatal day 1 (P1) and frozen #2639), and rabbit polyclonal anti-His (#2365) were purchased from on dry ice. Immunohistochemistry was performed on 12-μm cryostat Cell Signaling Technology. Rabbit polyclonal anti-XAF1 (ab17204) sagittal sections. The sections were fi xed with PFA and blocked with was purchased from Abcam. Rabbit anti-tyrosine hydroxylase was Mouse on Mouse blocking reagent, followed by incubation with 5% purchased from Pel-Freeze. normal goat serum (NGS) in 0.3% Triton X-100 in PBS for 1 hour (Vector Laboratories). After blocking, the sections were incubated NGF Withdrawal with mouse anti-DHX9 at 1:250 dilution (Novus Biologicals) and rabbit anti-tyrosine hydroxylase at 1:1000 dilution (Pel-Freeze) in NGF withdrawal in primary sympathetic neurons and PC12 cell 5% NGS and Triton X-100 overnight at 4°C. The sections were sub- has been recently described (39 ). sequently washed in 0.1% Triton X-100 in PBS and incubated with anti-rabbit Alexa Fluor 488 and anti-mouse Alexa Fluor 594 second- RNA-seq Analysis ary antibodies at 1:1,000 dilution (Invitrogen) for 1 hour at room NB1 cells stably transduced with either shSCR or shDHX9 were trans- temperature, washed, and coverslipped with Vectashield mounting fected with either empty pcDNA3.1 plasmid or KIF1Bβ(600–1400) medium containing DAPI (Vector Laboratories). Sections were ana- expression plasmid, in conjunction with pMACS Kk .II plasmid in a lyzed using an LSM 5 Exciter confocal laser-scanning microscope 1.5:1 ratio (Miltenyi Biotec). We made three biologic replicates for (Zeiss). Alternatively, sections were incubated with a biotinylated each condition. After 48 hours, cells expressing both the plasmid of goat anti-rabbit antibody at 1:500 dilution for 1 hour at room tem- interest and selection plasmid were isolated using the MACSelect perature, followed by the Vectastain ABC Kit and visualization with Transfected Cell Selection System and performed as recommended 3,3′-diaminobenzidine (DAB kit; Vector Laboratories). by the vendor (Miltenyi Biotec). RNA purifi cation of isolated cells was Human primary neuroblastoma paraffi n-embedded tissue sections carried out with the RNeasy Mini Kit according to the manufacturer’s were deparaffi nized in xylene and rehydrated. The sections were instructions (Qiagen). Purifi ed total RNA was sent for mRNA-seq

448 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

analysis (Fasteris) using TruSeq library preparation (polyA+ , not KIF1B exome mutation reports of primary neuroblastomas were strand-specifi c) and sequencing on Illumina HiSeq 2000, with a 50-bp based on custom target sequencing of human chromosome 1 from single-end read length. Between 6,972,104 and 13,963,048 reads were 10,270,764 to 10,441,661 using HiSeq2000 PE100 with minimum generated per sample. Reads were aligned to genome assembly hg19 80× coverage. and exon–exon junctions using bowtie with setting best , and fi ltered for unique hits ( 42, 43 ). We generated gene expression values and Tumor Material read counts with the rpkmforgenes.py May 3, 2011, version with set- All available neuroblastoma tumors were from the Swedish NB tings fulltranscript – mRNAnorm ( 44 ). Genes were tested for differential Registry. Tumors were staged according to the International Neu- expression using DESeq 1.0.6 with default settings (45 ). DESeq uses roblastoma Staging System (INSS; ref. 46 ) and INRG criteria ( 47 ). the Benjamini–Hochberg method to calculate FDRs from its P values. Ethical permission was granted by the local ethics committee. Tumor PCA plot and heatmap of signifi cantly regulated genes were generated analysis has been previously described (48 ). using Qlucore Omics Explorer 2.2. Disclosure of Potential Confl icts of Interest qRT-PCR Analysis No potential confl icts of interest were disclosed. qRT-PCR was performed on cDNA libraries previously created for RNA-seq using KAPA SYBR FAST Universal 2× qPCR Mas- Authors’ Contributions ter Mix according to the manufacturer’s instructions (Kapa Bio- Conception and design: Z.X. Chen, K. Wallis, P. Kogner, S. Schlisio systems) in an Applied Biosystems VIIA7 machine in 384-well Development of methodology: Z.X. Chen, K. Wallis, V.R. Sobrado, μ format. Reactions (10 L) were prepared in technical triplicate S. Schlisio and total XAF1 and XAF1.1 (NM_017523) mRNAs were quanti- Acquisition of data (provided animals, acquired and managed fi ed relative to RPL13A mRNA by relative standard curve quan- patients, provided facilities, etc.): Z.X. Chen, K. Wallis, S.M. Fell, tifi cation using the Applied Biosystems VIIA7 software bundle. V.R. Sobrado, M.C. Hemmer, U. Hellman, T. Martinson, J.I. Johnsen, ′ qRT-PCR primers were as follows: RPL13A forward primer: 5 -TCC P. Kogner, S. Schlisio ′ ′ AAGCGGCTGCCGAAGATG-3 ; RPL13A reverse primer: 5 -ACCTT Analysis and interpretation of data (e.g., statistical analysis, ′ ′ CCGGCCCAGCAGTACC-3 ; XAF1 forward primer: 5 -AAGCCCAGG biostatistics, computational analysis): Z.X. Chen, K. Wallis, V.R. ′ ′ ACCAGCTCCCCTA-3 ; XAF1 reverse primer: 5 -AGACCACCACAGC Sobrado, D. Ramsköld, U. Hellman, T. Martinson, J.I. Johnsen, P. ′ ′ AAGTAGGCAGG-3 ; XAF1.1 forward primer: 5 -ACCAGCAGGTTG Kogner, S. Schlisio ′ ′ GGTGTACGATGT-3 ; XAF1.1 reverse primer: 5 -CGCTCCTGGCA Writing, review, and/or revision of the manuscript: Z.X. Chen, ′ CTCATTGGCCTT-3 . K. Wallis, S.M. Fell, V.R. Sobrado, T. Martinson, J.I. Johnsen, P. Kogner, S. Schlisio In Situ Hybridization Administrative, technical, or material support (i.e., reporting or C57BL/6 mice were decapitated at embryonic day 17.5 organizing data, constructing databases): Z.X. Chen, T. Martin- (E17.5) or P1 and were processed as for immunohistochemistry. son, J.I. Johnsen, P. Kogner, S. Schlisio Digoxigenin-labeled RNA probes were generated from a cDNA sub- Study supervision: S. Schlisio clone in the pGEM-T easy plasmid (Promega). In vitro transcription Supervision of RNA-seq analyses: R. Sandberg was carried out using the DIG RNA Labeling Kit (Roche), according Performed one experiment for this article: R.S. Kenchappa to the manufacturer’s instructions. Sense and antisense probes were generated from a cDNA fragment corresponding to nucleotides Acknowledgments 3709-4292 of the KIF1Bβ tail domain (accession no. NM_207682.2) The authors thank Robert Freeman, Peter Ratcliffe, and Shazib and designed not to cross-react with the KIF1Bα isoform. Probes Pervaizfor for valuable reagents, and Anita Bergstrom for technical were diluted in hybridization buffer [50% formamide, 5% saline- assistance. sodium citrate buffer, 5× Denhardt’s solution, 250 μg/mL tRNA, 500 μg/mL sonicated salmon sperm DNA, 20 mg/mL blocking rea- Grant Support gent for nucleic acid hybridization and detection (Roche)] to a fi nal Z.X. Chen is supported by the Swedish Children Cancer Founda- concentration of 10 ng/μL. Hybridization was performed at 70°C tion and the National University of Singapore. K. Wallis is supported overnight and detected using anti-digoxigenin (DIG) antibody, by the Swedish Brain Foundation and the Swedish Children Cancer followed by visualization with nitroblue tetrazolium (NBT) and Foundation. S. Schlisio is supported by grants from the Swedish 5-bromo-4-chloro-3-indolyl phosphate (BCIP; Roche). The SCG was Children Cancer Foundation, the Swedish Research Council, the identifi ed on the basis of its proximity to the cochlea and through Swedish Cancer Society, and the Åke Wiberg Foundation, and is immunohistochemical staining in adjacent sections, using an anti- an Assistant Member of Ludwig Institute for Cancer Research Ltd body against tyrosine hydroxylase, which is a marker for adrenergic (LICR). and noradrenergic sympathetic neurons. Received July 11, 2013; revised January 7, 2014; accepted January Mice 22, 2014; published OnlineFirst January 27, 2014. C57BL/6 mice were kept at 21°C on a 12-hour light and 12-hour dark cycle. Animal care procedures were in accordance with the guidelines set by the European Community Council Directives REFERENCES (86/609/EEC). Required animal permissions were obtained from the 1. Zhu Y , Parada LF . The molecular and genetic basis of neurological local ethical committee. tumours. Nat Rev 2002 ; 2 : 616 – 26 . 2. Schlisio S . Neuronal apoptosis by prolyl hydroxylation: implication in nervous system tumours and the Warburg conundrum. J Cell Mol KIF1B Exome Sequencing Med 2009 ; 13 : 4104 – 12 . Genomic DNA was isolated from primary neuroblastoma tumors 3. Nakagawara A . Trk receptor tyrosine kinases: a bridge between cancer and submitted for exome sequencing performed by Otogenetics. and neural development. Cancer Lett 2001 ; 169 : 107 – 14 .

APRIL 2014CANCER DISCOVERY | 449

RESEARCH ARTICLE Chen et al.

4. Lee S , Nakamura E , Yang H , Wei W , Linggi MS , Sajan MP , et al. 24. Schindler U , Baichwal VR . Three NF-kappa B binding sites in the Neuronal apoptosis linked to EglN3 prolyl hydroxylase and familial human E-selectin gene required for maximal tumor necrosis factor pheochromocytoma genes: developmental culling and cancer . Cancer alpha-induced expression. Mol Cell Biol 1994 ; 14 : 5820 – 31 . Cell 2005 ; 8 : 155 – 67 . 25. Hamoudi RA , Appert A , Ye H , Ruskone-Fourmestraux A , Streubel 5. Schlisio S , Kenchappa RS , Vredeveld LC , George RE , Stewart R , Greu- B , Chott A , et al. Differential expression of NF-kappaB target lich H , et al. The kinesin KIF1Bbeta acts downstream from EglN3 to genes in MALT lymphoma with and without chromosome trans- induce apoptosis and is a potential 1p36 tumor suppressor. Genes location: insights into molecular mechanism . Leukemia 2010 ; 24 : Dev 2008 ; 22 : 884 – 93 . 1487 – 97 . 6. Maher ER , Eng C . The pressure rises: update on the genetics of phaeo- 26. Anderson SF , Schlegel BP , Nakajima T , Wolpin ES , Parvin JD . BRCA1 chromocytoma. Hum Mol Genet 2002 ; 11 : 2347 – 54 . protein is linked to the RNA polymerase II holoenzyme complex via 7. Nagai M , Ichimiya S , Ozaki T , Seki N , Mihara M , Furuta S , et al. RNA helicase A. Nat Genet 1998 ; 19 : 254 – 6 . Identifi cation of the full-length KIAA0591 gene encoding a novel 27. Liston P , Fong WG , Kelly NL , Toji S , Miyazaki T , Conte D , et al. Iden- kinesin-related protein which is mapped to the neuroblastoma sup- tifi cation of XAF1 as an antagonist of XIAP anti-caspase activity . Nat pressor gene locus at 1p36.2. Int J Oncol 2000 ; 16 : 907 – 16 . Cell Biol 2001 ; 3 : 128 – 33 . 8. Yang HW , Chen YZ , Takita J , Soeda E , Piao HY , Hayashi Y . Genomic 28. Glebova NO , Ginty DD . Growth and survival signals controlling structure and mutational analysis of the human KIF1B gene which sympathetic nervous system development. Annu Rev Neurosci 2005 ; is homozygously deleted in neuroblastoma at chromosome 1p36.2 . 28 : 191 – 222 . Oncogene 2001 ; 20 : 5075 – 83 . 29. Arora V , Cheung HH , Plenchette S , Micali OC , Liston P , Korneluk 9. Zhao C , Takita J , Tanaka Y , Setou M , Nakagawa T , Takeda S , et al. RG . Degradation of survivin by the X-linked inhibitor of apoptosis Charcot-Marie-Tooth disease type 2A caused by mutation in a micro- (XIAP)–XAF1 complex. J Biol Chem 2007 ; 282 : 26202 – 9 . tubule motor KIF1Bbeta. Cell 2001 ; 105 : 587 – 97 . 30. Potts PR , Singh S , Knezek M , Thompson CB , Deshmukh M . 10. Nangaku M , Sato-Yoshitake R , Okada Y , Noda Y , Takemura R , Critical function of endogenous XIAP in regulating caspase activa- Yamazaki H , et al. KIF1B, a novel microtubule plus end-directed tion during sympathetic neuronal apoptosis. J Cell Biol 2003 ; 163 : monomeric motor protein for transport of mitochondria . Cell 789– 99 . 1994 ; 79 : 1209 – 20 . 31. Adida C , Berrebi D , Peuchmaur M , Reyes-Mugica M , Altieri DC . An ti- 11. Yeh IT , Lenci RE , Qin Y , Buddavarapu K , Ligon AH , Leteurtre E , apoptosis gene, survivin, and prognosis of neuroblastoma. Lancet et al. A germline mutation of the KIF1B beta gene on 1p36 in a 1998 ; 351 : 882 – 3 . family with neural and nonneural tumors. Hum Genet 2008 ; 124 : 32. Johnsen JI , Kogner P , Albihn A , Henriksson MA . Embryonal neural 279 – 85 . tumours and cell death. Apoptosis 2009 ; 14 : 424 – 38 . 12. Munirajan AK , Ando K , Mukai A , Takahashi M , Suenaga Y , Ohira 33. Katsetos CD , Del Valle L , Legido A , de Chadarevian JP , Perentes E , M , et al. KIF1Bbeta functions as a haploinsuffi cient tumor suppres- Mork SJ . On the neuronal/neuroblastic nature of medulloblastomas: sor gene mapped to chromosome 1p36.2 by inducing apoptotic cell a tribute to Pio del Rio Hortega and Moises Polak . Acta Neuropathol death. J Biol Chem 2008 ; 283 : 24426 – 34 . 2003 ; 105 : 1 – 13 . 13. Lee CG , Hurwitz J . Human RNA helicase A is homologous to the 34. Brinkmann U , Brinkmann E , Gallo M , Pastan I . Cloning and char- maleless protein of Drosophila. J Biol Chem 1993 ; 268 : 16822 – 30 . acterization of a cellular apoptosis susceptibility gene, the human 14. Zhang S , Grosse F . Domain structure of human nuclear DNA helicase homologue to the yeast chromosome segregation gene CSE1 . Proc II (RNA helicase A). J Biol Chem 1997 ; 272 : 11487 – 94 . Natl Acad Sci U S A 1995 ; 92 : 10427 – 31 . 15. Lee CG , Chang KA , Kuroda MI , Hurwitz J . The NTPase/helicase 35. Darby C , Cosma CL , Thomas JH , Manoil C . Lethal paralysis of activities of Drosophila maleless, an essential factor in dosage compen- Caenorhabditis elegans by Pseudomonas aeruginosa . Proc Natl Acad Sci U S A sation. EMBO J 1997 ; 16 : 2671 – 81 . 1999 ; 96 : 15202 – 7 . 16. Nakajima T , Uchida C , Anderson SF , Lee CG , Hurwitz J , Parvin J D, 36. Smith WA , Schurter BT , Wong-Staal F , David M . Arginine methyla- et al. RNA helicase A mediates association of CBP with RNA polymer- tion of RNA helicase a determines its subcellular localization . J Biol ase II. Cell 1997 ; 90 : 1107 – 12 . Chem 2004 ; 279 : 22795 – 8 . 17. Aratani S , Fujii R , Fujita H , Fukamizu A , Nakajima T . Aromatic resi- 37. Pugh TJ , Weeraratne SD , Archer TC , Pomeranz Krummel DA , Auclair dues are required for RNA helicase A mediated transactivation . Int J D , Bochicchio J , et al. Medulloblastoma exome sequencing uncovers Mol Med 2003 ; 12 : 175 – 80 . subtype-specifi c somatic mutations. Nature 2012 ; 488 : 106 – 10 . 18. Tetsuka T , Uranishi H , Sanda T , Asamitsu K , Yang JP , Wong-Sta a l F , 38. Bamford S , Dawson E , Forbes S , Clements J , Pettett R , Dogan A , et al. et al. RNA helicase A interacts with nuclear factor kappaB p65 and The COSMIC (Catalogue of Somatic Mutations in Cancer) database functions as a transcriptional coactivator. Eur J Biochem 2004 ; 271 : and website. Br J Cancer 2004 ; 91 : 355 – 8 . 3741– 51 . 39. Palmada M , Kanwal S , Rutkoski NJ , Gustafson-Brown C , Johnson 19. Aratani S , Fujii R , Oishi T , Fujita H , Amano T , Ohshima T , et al. Dual RS , Wisdom R , et al. c-jun is essential for sympathetic neuronal death roles of RNA helicase A in CREB-dependent transcription. Mol Cell induced by NGF withdrawal but not by p75 activation . J Cell Biol Biol 2001 ; 21 : 4460 – 9 . 2002 ; 158 : 453 – 61 . 20. Tang H , McDonald D , Middlesworth T , Hope TJ , Wong-Staal F . The 40. Malewicz M , Kadkhodaei B , Kee N , Volakakis N , Hellman U , Viktors- carboxyl terminus of RNA helicase A contains a bidirectional nuclear son K , et al. Essential role for DNA-PK-mediated phosphorylation of transport domain. Mol Cell Biol 1999 ; 19 : 3540 – 50 . NR4A nuclear orphan receptors in DNA double-strand break repair. 21. Kutay U , Bischoff FR , Kostka S , Kraft R , Gorlich D . Export of impor- Genes Dev 2011 ; 25 : 2031 – 40 . tin alpha from the nucleus is mediated by a specifi c nuclear transport 41. Kenchappa RS , Zampieri N , Chao MV , Barker PA , Teng HK , Hemp- factor. Cell 1997 ; 90 : 1061 – 71 . stead BL , et al. Ligand-dependent cleavage of the P75 neurotrophin 22. Fuchsova B , Novak P , Kafkova J , Hozak P . Nuclear DNA helicase II is receptor is necessary for NRIF nuclear translocation and apoptosis in recruited to IFN-alpha-activated transcription sites at PML nuclear sympathetic neurons. Neuron 2006 ; 50 : 219 – 32 . bodies. J Cell Biol 2002 ; 158 : 463 – 73 . 42. Wang ET , Sandberg R , Luo S , Khrebtukova I , Zhang L , Mayr C, 23. Clarke DL , Clifford RL , Jindarat S , Proud D , Pang L , Belvisi MG , et al. et al. Alternative isoform regulation in human tissue transcriptomes . T N F α and IFNγ synergistically enhance transcriptional activation of Nature 2008 ; 456 : 470 – 6 . CXCL10 in human airway smooth muscle cells via STAT-1, NF-κB 43. Langmead B , Trapnell C , Pop M , Salzberg SL . Ultrafast and memory- and the transcriptional coactivator CREB-binding protein. J Biol effi cient alignment of short DNA sequences to the human genome . Chem 2010 ; 285 : 29101 – 10 . Genome Biol 2009 ; 10 : R25 .

450 | CANCER DISCOVERYAPRIL 2014 www.aacrjournals.org

RNA Helicase A Is Vital for KIF1Bβ Tumor Suppression RESEARCH ARTICLE

44. Ramskold D , Wang ET , Burge CB , Sandberg R. An abundance of ubiq- 47. Monclair T , Brodeur GM , Ambros PF , Brisse HJ , Cecchetto G , Ho l- uitously expressed genes revealed by tissue transcriptome sequence mes K , et al. The International Neuroblastoma Risk Group (INRG) data. PLoS Comput Biol 2009 ; 5 : e1000598 . staging system: an INRG Task Force report . J Clin Oncol 2009 ; 27 : 45. Anders S , Huber W . Differential expression analysis for sequence 298– 303 . count data. Genome Biol 2010 ; 11 : R106 . 48. Caren H , Kryh H , Nethander M , Sjoberg RM , Trager C , Nilsson S , 46. Brodeur GM , Pritchard J , Berthold F , Carlsen NL , Castel V , Castelberry et al. High-risk neuroblastoma tumors with 11q-deletion display a RP , et al. Revisions of the international criteria for neuroblastoma diag- poor prognostic, chromosome instability phenotype with later onset. nosis, staging, and response to treatment. J Clin Oncol 1993 ; 11 : 1466 – 77 . Proc Natl Acad Sci U S A 2010 ; 107 : 4323 – 8 .

APRIL 2014CANCER DISCOVERY | 451

RNA Helicase A Is a Downstream Mediator of KIF1Bβ Tumor-Suppressor Function in Neuroblastoma

Zhi Xiong Chen, Karin Wallis, Stuart M. Fell, et al.

Cancer Discovery 2014;4:434-451. Published OnlineFirst January 27, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/2159-8290.CD-13-0362

Supplementary Access the most recent supplemental material at: Material http://cancerdiscovery.aacrjournals.org/content/suppl/2014/01/27/2159-8290.CD-13-0362.DC1 http://cancerdiscovery.aacrjournals.org/content/suppl/2021/03/04/2159-8290.CD-13-0362.DC2

Cited articles This article cites 48 articles, 20 of which you can access for free at: http://cancerdiscovery.aacrjournals.org/content/4/4/434.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://cancerdiscovery.aacrjournals.org/content/4/4/434.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerdiscovery.aacrjournals.org/content/4/4/434. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.