Identification of a Human ABCC10 Orthologue in Catharanthus Roseus

c Indian Academy of Sciences

RESEARCH ARTICLE

Identiﬁcation of a human ABCC10 orthologue in Catharanthus roseus reveals a U12-type intron determinant for the N-terminal domain feature

TAISSIR EL-GUIZANI1,2, CLOTILDE GUIBERT1, SAÏDA TRIKI2, BENOIT ST-PIERRE1 and ERIC DUCOS1∗

1EA2106, Biomolécules et Biotechnologies Végétales, Université François Rabelais de Tours, UFR Sciences et Techniques, Parc Grandmont 31, Avenue Monge, 37200 Tours, France 2Laboratoire de Biochimie, Département de Biologia, Faculté des Sciences de Tunis, Université Tunis El-Manar, 2092 Tunis, Tunisia

Abstract ABC (ATP-binding cassette) transporters are members of a large superfamily of proteins that utilize ATP hydrolysis to translocate a wide range of substrates across biological membranes. In general, members of C subfamily (ABCC) are structurally characterized by an additional (N-terminal) transmembrane domain (TMD0). Phylogenetic analysis of plant ABCCs separates their protein sequences into three distinct clusters: I and II are plant specific whereas cluster III contains both human and plant ABCCs. Screening of the Plant Medicinal Genomics Resource database allowed us to identify 16 ABCCs partial sequences in Catharanthus roseus; two of which belong to the unique CrABCC1 transcript that we identified in cluster III. Genomic organization of CrABCC1 TMD0 coding sequence displays an AT-AC U12-type intron that is conserved in higher plant orthologues. We showed that CrABCC1, like its human orthologue ABCC10, produces alternative transcripts that encode protein sequences with a truncated form of TMD0 without the first transmembrane span (TM1). Subcellular localization of CrABCC1 TMD0 variants using yellow fluorescent protein fusions reveals that the TM1 is required for a correct routing of the TMD0 to the tonoplast. Finally, the specific repartition of CrABCC1 orthologues in some species suggests that this gene was lost several times during evolution and that its physiological function may, rely on a common feature of multicellular eukaryotes.

[El-Guizani T., Guibert C., Triki S., St-Pierre B. and Ducos E. 2014 Identiﬁcation of a human ABCC10 orthologue in Catharanthus roseus reveals a U12-type intron determinant for the N-terminal domain feature. J. Genet. 93, 21–33]

Introduction two transmembrane domains (TMDs) and two NBDs (Higgins 1992). These domains may be expressed as a sin- Proteins are classified as ATP-binding cassette (ABC) trans- gle module (TMD1-NBD1-TMD2-NBD2) (so-called ‘full- porters based on the sequence and the organization of their size’), as two ‘half-size’ modules ([TMD-NBD] × 2) or nucleotide-binding domain(s) also known as nucleotide- as four separated polypeptides (Hyde et al. 1990; Tusnády binding folds (NBD/NBFs) which energize the transport et al. 2006). Based on the phylogenetic analyses, the cycle (Holland and Blight 1999; Higgins 2001). The NBDs human ABC family is divided into seven subfamilies named that bind ATP are made up of three conserved motifs com- from A to G, of which the C subfamily is also known mon to ABC proteins: Walker A and B boxes as well as as multidrug resistance-related proteins (MRPs) (Dean the ABC signature located in between (Walker et al. 1982; et al. 2001). Human ABCCs support a variety of substrates Higgins 1992). ABC transporters belong to a highly con- including anticancer drugs, xenobiotics and leucotrienes, served family found in prokaryotes and eukaryotes (Higgins and are membrane proteins that efflux these compounds 1992;Reaet al. 1998); they transport a wide variety of from cells (Leier et al. 1994; Leslie et al. 2001); conse- structurally unrelated substrates in an ATP-dependent man- quently they affect multidrug resistance (Leslie et al. 2005; ner, generally against a concentration gradient (Higgins Dean 2009). Full-size ABCC distribution is restricted to 1992;Reaet al. 1998; Rees et al. 2009). Functionally eukaryotic kingdoms (Higgins 1992; Tusnády et al. 2006); active ABC transporters consist of at least four domains: this subfamily is distinguished by an N-terminal hydrophobic extension (TMD0) which comprises five transmembrane ∗ For correspondence. E-mail: [email protected]. spans and a cytosolic linker region (L0) (Tusnády et al

Keywords. ABC transporter; orthologues; AT-AC U12-intron; MRP/ABCC topology; ABCC10; Catharanthus roseus.

Journal of Genetics, Vol. 93, No. 1, April 2014 21 Taissir El-Guizani et al.

1997). The additional TMD0-CL0 confers the typical secondary metabolism (review by Ziegler and Facchini ABCC topology: TMD0-CL0-TMD1-NBD1-TMD2-NBD2. 2008). The originality here is the presence of plant and Whether TMD0-CL0 contributes to substrate specificity or human ABC sequences in the same phylogenetic cluster. To not is not fully elucidated, but the implication of TMD0 por- date, no physiological function has been assigned to these tion in the proper subcellular localization of several human proteins, including the human orthologue ABCC10 which and yeast ABCCs proteins has been proposed (Fernandez has been mainly characterized for its involvement in can- et al. 2002; Mason and Michaelis 2002; Westlake et al. cer drug resistance (Chen et al. 2003; Hopper-Borge et al. 2003, 2005; Bandler et al. 2008). Apart from their puta- 2004; Hopper-Borge et al. 2009). Because human ABCC10 tive involvement in a multitude of functions, the typical N- is distinguished from other ABCCs by the existence of two terminal TMD0 gives an original and intriguing aspect to transcripts encoding TMD0 (Kao et al. 2003), we inves- ABCCs. tigated the TMD0-CL0 coding sequence of CrABCC1 to In plants, ABCCs are the second most represented subfam- clarify whether a similar feature exists in plant orthologues ily of full-size ABC transporters (Sánchez-Fernández et al. and highlighted an alternative splicing involving a U12- 2001) and they are involved in various physiological intron. This could be an interesting clue related to a possible processes related to plant development and adaptation common ancestral function. (Kolukisaoglu et al. 2002;Rea2007;Kanget al. 2011). However, despite many recent advances, most plant ABCCs are poorly functionally characterized to date. For instance in Material and methods Arabidopsis, AtABCC1 and AtABCC2 are cell detoxifiers Phylogenetic and topology analyses that hold folate, glutathione conjugates and phytochelatins in the vacuolar compartment (Lu et al. 1998; Raichaudhuri C. roseus sequences were recovered by querying the Medic- et al. 2009; Song et al. 2010). AtABCC5 modulates inos- inal Plant Genomics Resource (MPGR) BLAST server itol hexakisphosphate (i.e. phytic acid) homoeostasis in (http://medicinalplantgenomics.msu.edu/) with the 15 guard cells in relation to stomatal regulation and medi- Arabidopsis ABCC proteins. Sequence alignments were ates inositol hexakisphosphate loading into seeds (Nagy et produced using Clustal W 1.83 (Larkin et al. 2007) with al. 2009). Its orthologue in maize, ZmMRP4, was iden- the ABCC amino-acid sequences from Arabidopsis tified by map-based cloning of the lpa1 gene associ- (Kolukisaoglu et al. 2002), rice (Klein et al. 2006), ated with low-phytic-acid seeds (Shi et al. 2007; Badone Physcomitrella patens (Rensing et al. 2008), human (Dean et al. 2010). These results suggest that ABCC homo- et al. 2001), yeast (Decottignies and Goffeau 1997), logues may share similar functions in different plants. Other Chlamydomonas reinhardtii (Hanikenne et al. 2005), maize: research has shown that plant ABCCs are also involved ZmMRP1, ZmMRP2, ZmMRP3 and ZmLPA1 (GenBank in secondary metabolite transport (Yazaki 2006). In fact, accession nos: AAO72316, EF586878, AAO72317 and ZmMRP3 is a tonoplastic anthocyanin transporter that gen- AAT37905, respectively). For other species, CrABCC1 ho- erates a UV-light protection in the endothelium of maturing mologues were recovered in the NCBI genome database seeds; this constituted the first evidence that plant ABCCs (http://www.ncbi.nlm.nih.gov/) restricted to selected organ- are involved in secondary metabolite transport (Goodman isms using tBLASTn program (http://blast.ncbi.nlm. et al. 2004). ABC transporter transcripts are often sub- nih.gov/Blast.cgi?PROGRAM=tblastn&PAGE_TYPE=Blast jected to alternative splicings that lead to various pro- Search&LINK_LOC=blasthome), and CrABCC1 or ductions of mRNA. Up to now, no U12-intron has been ABCC10 amino-acid sequence as query. Fungal homologues described in ABC genes. U12-type introns are spliced by were assessed using ‘fungi’ as a selected organism. For the minor U12 spliceosome and, compared to conventional each organism, the first three sequences of the resulting U2-type introns, they occur with a very low frequency BLAST hits were associated, or not, to ABCC cluster III (0.35 and 0.17% for humans and Arabidopsis, respectively) by generating a phylogenetic tree including Arabidopsis (Zhu and Brendel 2003; Alioto 2007). Whereas U2-major and human ABCCs. The phylogenetic trees and bootstrap spliceosome localizes to the nucleus, U12-minor spliceo- values were generated using PhyML (www.phylogeny.fr). some resides in the cytosol where it is believed to manage Predicted transmembrane segments were identified using with genes involved in cell proliferation (Caceres and Misteli protein sequences and the Phobius prediction server (http:// 2007). phobius.sbc.su.se/) at Stockholm Bioinformatics Center. In the present study, in Catharanthus roseus we identified an ABC transporter belonging to the C subfamily: Nucleic acid preparation, reverse transcription and PCRs CrABCC1. The medicinal plant Madagascar periwinkle (i.e. C. roseus) produces monoterpene indole alkaloids (MIAs), Genomic DNA and RNA were isolated from two-week- secondary metabolites of high interest including the anti- old C. roseus (L. G. Don) seedlings using DNeasy Plant cancer agents, vinblastine and vincristine (Levêque et al. Mini Kit (Qiagen, Hilden, Germany) and TRI Reagent 1996). This plant is widely studied for its alkaloid pro- Kit (Ambion, Austin, USA), respectively. Total RNA duction and has become a model for the study of plant (5 μg) was treated with DNAse I (Invitrogen, Carlsbad,

22 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

Table 1. Repartition of CrABCC loci in the three plant clusters.

Locus Protein*

cra_locus_1763_iso_10_len_5663_ver_3 1621 Cluster I cra_locus_5265_iso_1_len_3763_ver_3 939 cra_locus_6500_iso_3_len_2549_ver_3 731 cra_locus_61200_iso_1_len_386_ver_3 129

cra_locus_6810_iso_3_len_5551_ver_3 1573 cra_locus_3045_iso_2_len_4637_ver_3 1453 cra_locus_1250_iso_8_len_5148_ver_3 1436 cra_locus_1810_iso_6_len_5044_ver_3 1163 Cluster II cra_locus_9997_iso_3_len_5150_ver_3 1508 cra_locus_33335_iso_1_len_3933_ver_3 1259 cra_locus_18785_iso_1_len_1523_ver_3 452 cra_locus_14948_iso_1_len_1687_ver_3 529 cra_locus_16174_iso_2_len_1988_ver_3 664 cra_locus_87321_iso_1_len_575_ver_3 193

Cluster III cra_locus_10644_iso_3_len_3174_ver_3 1014 cra_locus_15222_iso_1_len_911_ver_3 305

The protein sequences were retrieved from the website http://medicinalplantgenomics.msu.edu/integrated_searches.shtml. Bold numbers are references to C. roseus loci. Lengths of EST are indicated with ‘len_xxxx’. AAs, length of protein sequences encoded by the ESTs.

USA) before reverse transcription (reverse transcriptase C-3) for (35–267) TMD0-CL0, coupled to CL0R (5-GG M-MVL, Promega, France), following manufacturer instruc- ACTAGTATTTCTTTGTTGAGCTTCCCA-3).ThePCR tions. PCR were performed under standard conditions product was digested with SpeIandfusedtoYFPorf in the using the following primers: Exon1F (5-GCTCTTTGTAG plant expression vector ‘pSCA-cassette YFPi’ (Guirimand ACTGCTCCAATC-3), Int1F (5-TTTTTCTCCGGCCGGG et al. 2009). Constructions were checked by sequencing. C. G-3), Int2F (5-ATAAATTTCGCGAATTGTCCTTCC-3), roseus protoplast transfection was performed following Yoo Int3F (5-AAAGCTATTGCCTTTTAGTATGGG-3), Exon- et al. (2007) procedure with some modifications. Protoplasts 8R (5-CAGTCATTAATCACCTTTAAAAGACC-3). were obtained from C. roseus suspension cells (Merillon et al. 1984): 10 g of cells were incubated for 2 h at ◦ 26 C in 10 mL of 20 mM MES containing 12 mM CaCl2, Cloning of CrABCC1 cDNA 20 mM KCl, 0.4 M mannitol, 1% (w/v) cellulase R10 (Duchefa, Haarlem, Netherland) and 0.2% (w/v) pectolyase Two degenerate primers were used to amplify a genomic Y-23 (Duchefa). Protoplasts were filtered on a 100-μm nylon internal part of CrABCC1 gene (MRPdF 5-YTNCCNTT mesh and the flow-through was centrifuged for 5 min at YATHYTNAAYATH-3 and MRPdR 5-CANARNARYT 100 g. The pellet was suspended in 25 mL of 1.5 mM GNCKYTGNCC-3). The resulting PCR product was cloned MES (pH 5.7) containing 150 mM NaCl, 125 mM CaCl , into pGEM T-Easy vector (Promega, France) and sequenced. 2 5 mM KCl and 5 mM glucose (W5 solution), and cen- The ‘5 CrABCC1’ end portion was obtained by dCTP tailing trifuged again. Protoplasts were resuspended in W5 solu- using a terminal transferase (Roche, Meylan, France) fol- tion at 106 ml−1. For the transfection, 100 μL of protoplasts lowed by successive nested PCRs using oligo (18dG) and (105) were incubated for 15 min with 10 μL (20–30 μg) of specific CrABCC1 primers. CrABCC1 full-length cDNA plasmid DNA (Nucleospin Plasmid kit Macherey-Nagel, (4819 bp) was amplified using the primers CrABCC1F (5- Hoerdt, France) and 110 μL of a freshly prepared solution TGTGTCTTTCGTTTTTTCCCAG-3) and CrABCC1R (5- containing 0.1 M CaCl , 0.4 M mannitol and 40% (wt/vol) TCAATACTAATCTAATCTTCC-3), then sequenced. Sev- 2 PEG4000. Then, after adding 440 μL of W5 solution and eral attempts of TA-cloning have failed which means that centrifuged for 5 min at 100 g, the protoplasts were resus- CrABCC1 full sequence may be toxic for Escherichia coli. pended in 1 mL of W5 solution and incubated horizontally 24–48 h at 25◦C. The fluorescence of the YFP-fused proteins were visualized after transfections using the JP2 fil- Protoplast transfection and subcellular localization ter set (Chroma #31040; 500–520 nm excitation filter, 540– CrABCC1 ‘TMD0-CL0’ encoding sequences were ampli- 580 (Chroma Technology Corp., Bellows Falls, USA) nm fied using ATG1F primer (5-GGACTAGTAAAATGGAG band pass emission filter) and an Olympus BX51 (Tokyo, TTGCTTAAGCACATT-3) for (1–267) TMD0-CL0 or Japan) epifluorescence microscope equipped with an Olym- ATG2F (5 -GGACTAGTAAATATGGCGACTTTGATTGT pus DP50 digital camera.

Journal of Genetics, Vol. 93, No. 1, April 2014 23 Taissir El-Guizani et al.

Results and discussion et al. 2002); at least one ABCC sequence was identified in C. roseus for each cluster (table 1; figure 1). Except for the Retrieving C. roseus ABCC EST and phylogenetic analysis divergent P. patens PpABCC10, we show that this distribu- A phylogenetic tree was generated to compare the orga- tion is conserved in this moss too. The five MRP/ABCCs nization of the ABCC/MRP subfamilies among several of the unicellular C. reinhardtii (Hanikenne et al. 2005)do kingdoms. Since ABCCs are absent in prokaryotes, only not belong to those clusters. The ABCC subfamilies were complete genomes of some eukaryotic organisms selected probably defined during the evolution of green algae and among animal, plant and fungi kingdoms were inte- bryophytes, since the analysis of the genome of P. patens grated into the analysis. Concerning ABCC sequences in revealed the implementation of the three clusters of ABCC C. roseus, we investigated the publicly available ESTs (Rensing et al. 2008) (figure 1). Cluster I defines the largest (http://medicinalplantgenomics.msu.edu). We identified 16 group of ABCCs (10 out of 15 ABCCs in Arabidopsis, 15/17 CrABCC sequences (table 1). In higher plants, ABCCs in rice and 10/15 in moss) and is characterized by numerous are distributed in three phylogenetic clusters (Kolukisaoglu duplication events (e.g. AtABCC3/6/7 or PpABC8/9/14/15).

III 100

100 54 100

Figure 1. Phylogenetic analysis of ABCC proteins. Hs, Homo sapiens (black); At, A. thaliana (green); Os, O. sativa (red); Pp, P. patens (violet); Sc, S. cerevisiae (blue); Chl, C. reinhardtii (light green); Zm, Zea mays (beige); Cr, C. roseus (pink). Roman numbers and dotted lines display plant clusters. Except for cluster III, only the bootstrap values below 100 are indicated.

24 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

Except for AtABCC11 and AtABCC12, a peculiar carboxy- unique sequence. Specific sets of primers coupled to several terminal extension is seen in ABCCs of cluster II (Geisler runs of 5-rapid amplification of cDNA ends (RACE)s and 3- et al. 2004). Moreover, because PpABCC2, PpABCC3 and RACEs were used to identify the full-length cDNA sequence PpABCC11 possess this motif (figure 1 in electronic sup- of C. roseus CrABCC1 (GenBank accession no. AM849475). plementary material at http://www.ias.ac.in/jgenet/), we can CrABCC1 orf is 4374 bp length and includes two nonover- suspect that in cluster II, AtABCC11 and AtABCC12 lost this lapping C. roseus loci that we assigned to cluster III (table 1). extension during later evolution in land plants. In contrast Moreover, the last run of 5-RACE displayed two PCR to clusters I and II that exclusively contain plant ABCCs, products (figure 2B) revealing two transcription start sites cluster III includes plant and human proteins (figure 1). Two for the CrABCC1 gene. The orf encodes a predicted pro- C. roseus loci belong to cluster III while the other organ- tein of 162.764 Da. According to transmembrane prediction isms display a single sequence: human ABCC10, Arabidop- with Phobius (http://phobius.cbr.su.se), CrABCC1 displays sis AtABCC13, rice OsABCC12 and P. patens PpABCC1. a standard ABCC topology (figure 2C) and shares 61.1% Interestingly, publication of the moss genome (Rensing et al. (76.1%) and 36.4% (51.6%) sequence identity (similarity) 2008) emphasized that the sessile habit and metabolic diver- with Arabidopsis AtABCC13 and human ABCC10, respec- sity of land plants seems to require a diversification of ABC tively (table 2). CrABCC1 possesses a positively charged proteins. In the current study, this hypothesis is confirmed amino-acid motif (figure 2C) that is commonly described in for cluster I and II, but cluster III seems to have evolved in the first cytosolic loop of ABCC proteins (Westlake et al. another way, without duplication events. 2005) and might lead to a posttranslational cleavage. NBDs are usually highly conserved compared with transmembrane domains which are much diversified. Indeed, ABC signature CrABCC1 full-length sequence and ABCC10 orthology and Walker A/B display closely similar sequences between Because we identified two loci belonging to cluster III in cluster I (AtABCC5), cluster II (AtABCC1) and cluster III C. roseus, we investigated the possibility of finding other proteins (figure 2C). homologues. According to protein sequence alignments of ABCC10 may be an orthologue of CrABCC1 and plant cluster III, degenerate primers were designed (see Material cluster III ABCCs. In our phylogenetic analysis, a puta- and methods) to amplify by PCR an internal fragment of tive orthology link is strengthened by a bootstrap value ABCC10 orthologue in C. roseus. First, PCR was carried out of 100 (figure 1). Moreover, phylogenic analysis was con- on genomic DNA and displays a unique band at ∼2200 bp ducted using maximum likelihood (ML) method which is (figure 2A). Cloning and sequencing of the inserts revealed a less sensitive to long-branch-attraction effects (LBAe) than

A B C MW MW N TMD0 CL0 TMD1 NBD1 TMD2 NBD2

2200 500 300 C

RRSGRRSRR ++ ++ ++ ACB A C B

NBD1 NBD2 Walker A Sign. ABC Walker B Walker A Sign. ABC Walker B 644 759 1254 1381 CrABCC1 GEVGSGKSA-81aa-LSGGQRARLALARAIYCGSEIYMLDD GRTGAGKSS-93aa-FSVGQRQLLCLARALLKSSKVLCLDE AtABCC13 GEVGSGKTS-81aa-LSGGQRARFALARAVYHGSDMYLLDD GRTGAGKSS-93aa-FSVGQRQLLCLARALLKSSKILCLDE OsABCC12 GEVGCGKSS-81aa-LSGGQRARLALARALYHDSDVYLFDD GRTGAGKSS-93aa-FSVGQRQLLCLARAILKSSKILCLDE PpABCC1 GKVGAGKSS-81aa-LSGGQKARLALARALYQDREIYILDD GRTGAGKSS-93aa-FSQGQRQLLCLARSLLGTARILCLDE HsABCC10 GKVGCGKSS-84aa-LSGGQRARIALARAVYQEKELYLLDD GRTGSGKSS-93aa-LSLGQRQLLCLARALLTDAKILCIDE

AtABCC1 GSTGEGKTS-81aa-ISGGQKQRVSMARAVYSNSDVCILDD GRTGAGKSS-93aa-FSVGQRQLLSLGRSLLRRSKILVLDE AtABCC5 GTVGSGKSS-81aa-LSGGQKQRVQLARALYQDADIYLLDD GRTGSGKSS-93aa-WSVGQRQLVSLGRALLKQAKILVIDE

Figure 2. cDNA cloning and characteristics of CrABCC1. (A) PCR amplification of an internal genomic fragment of CrABCC1 using cluster-III degenerated primers. (B) RACE experiment for 5 amplification of CrABCC1 cDNA. (C) Predicted topology of CrABCC1; TMDs, NBDs and CL0 subdomains are indicated. RRSGRRSRR design a positively charged peptide in the first cytosolic loop. Location and sequence comparison of Walker A (A), B (B), and ABC signature (C) are displayed; (++), a positively charged amino-acid motif described in the first cytosolic loop.

Journal of Genetics, Vol. 93, No. 1, April 2014 25 Taissir El-Guizani et al. the neighbour-joining method. However, LBAe was assessed Sequence comparison of cDNA (895 pb) and genomic frag- using the SAW method (Siddall and Whiting 1999) and our ment (2668 bp) revealed eight exons and seven introns that results contribute to strengthen the orthology link between differ from ABCC10 genomic organization but is identical to ABCC10 and CrABCC1 (figure 2 in electronic supplemen- Arabidopsis and rice ones (figure 3A). The encoded amino- tary material). terminal extensions confer a five transmembrane span topol- Subdomain sequence comparisons revealed that NBD2 is ogy to both AtABCC13 and OsABCC12 TMD0s (figure 3 the most conserved domain between human and C. roseus in electronic supplementary material). PpABCC1 amino- (49.2% (68.3%); table 2). However, among angiosperm se- terminal extension is encoded by eight exons but no intron quences, TMD1s display 72.8% (87.8%) to 78.0% (84.7%) locations correspond to CrABCC1 ones (figure 4 in elec- identity (similarity) while TMD2s show 54.0% (62.4%) to tronic supplementary material). Within the ABCC cluster 63.8% (73.2%), respectively for Oryza sativa and A. I or II, intron locations are highly conserved among plant thaliana. Besides the six hydrophobic α-helices that consti- ABCC genes (Kolukisaoglu et al. 2002). When we com- tute TMD1 and TMD2 of ABCCs (Tusnády et al. 2006), pare CrABCC1 with AtABCC1 (cluster I) or AtABCC5 (clus- the high amino-acid conservation in TMD1s may be asso- ter II), no intron location is conserved in the TMD0-CL0 ciated with the substrate binding pocket specificity in plants. genomic sequences (figure 3A). Taken together, these data Most transporters belonging to the ABCC family have an indicate that TMD0-CL0 eight exons structure is specific to additional N-terminal TMD0 which contains five transmem- the ABCCs of the cluster III in higher plants. brane α-helices (Tusnády et al. 2006). Human and C. roseus Detailed analysis of the 5 genomic extremity that encodes TMD0 sequences share 22.4% identity (table 2). When com- CrABCC1 TMD0-CL0 identified intron 2 as a putative U12- pared to other ABCC domains (i.e., NBDs and TMDs), type AT-AC intron, which is also conserved in rice and Ara- this low amino-acid sequence conservation suggests that bidopsis cluster III ABCCs (figure 3, A&B). Intron 2 possess TMD0 functions rely on critical structural features rather 5-ATATCCTT, 3-AC and a predicted TTCCTTA branch than amino-acid motifs. point sequences (figure 3B) that are highly conserved in U12-introns (Hall and Padgett 1994). Considering ABCC10 and MmMRP7 5-pre-mRNA modifications, we investigated Genomic organization of CrABCC1 TMD0-CL0 encoding putative U12-intron skipping in CrABCC1 TMD0 encoding sequence sequence. Two transcription start sites have been determined for the human ABCC10 gene (Kao et al. 2003). The first one Retention of U12-type AT-AC intron in CrABCC1 transcripts produces an mRNA encoding a complete ABCC10 protein and the second one, identified in intron 2, produces To assess whether U12-intron was correctly spliced in an mRNA encoding a truncated ABCC10A protein that CrABCC1 transcripts, PCR were performed using forward lacks the first transmembrane span of the TMD0. In mouse, primers designed in intron 1, 2, 3 or exon 1 (as a control) the ABCC10 orthologous gene (MmMRP7) produces two coupled to a forward primer specific to the eighth exon. main mRNAs that encode full-length or truncated proteins An expected one stair-shaped profile was obtained when as described for ABCC10. However, the mechanism that genomic DNA was used as template (figure 4A, gDNA). leads to the first transmembrane span skipping does not When cDNA is used as a template, no PCR product is imply alternative transcription start sites but an alterna- observed with intron 1 and 3 primers but only with intron tive splicing (Kao et al. 2002). To determine whether such 2 primer (836 bp) and as expected with exon 1 primer mechanisms are conserved in plant ABCCs, we investi- (figure 4A, cDNA). As shown by semiquantitative RT-PCR, gated the genomic organization of the TMD0-CL0 (GenBank mRNA with a correct intron 2 splicing is the most abundant accession no. HM581933) encoding fragment in CrABCC1. form in seedling. Sequencing of the 836-bp RT-PCR product

Table 2. Percentage of subdomain protein sequence identity between CrABCC1 and ABCCs of cluster I (AtABCC5), cluster II (AtABCC1) and cluster III (A. thaliana, O. sativa, P. patens and H. sapiens)usinghttp://www.ebi.ac.uk/Tools/psa/emboss_needle/.

TMD0 CL0 TMD1 NBD1 TMD2 NBD2 Entire seq.

A. thaliana 32.3 (52.7) 34.3 (54.3) 78.0 (87.8) 56.1 (75.2) 63.8 (73.2) 68.6 (78.8) 61.1 (76.1) O. sativa 32.6 (50.6) 32.7 (57.9) 72.8 (84.7) 55.1 (71.3) 54.0 (62.4) 68.2 (80.0) 57.7 (71.6) P. patens 5.3 (6.8) 25.9 (47.3) 43.0 (58.5) 45.5 (61.4) 34.4 (48.3) 53.5 (71.8) 38.7 (54.8) H. sapiens 22.4 (30.1) 16.2 (24.6) 41.7 (61.0) 39.8 (56.4) 33.1 (45.6) 49.2 (68.3) 36.4 (51.6)

AtABCC5 (cluster I) 18.2 (28.4) 28.0 (43.2) 27.6 (48.6) 37.6 (57.4) 32.7 (48.7) 44.0 (64.5) 31.4 (48.8) AtABCC1 (cluster II) 15.8 (31.7) 19.8 (32.8) 34.4 (53.6) 39.0 (56.8) 31.2 (49.5) 49.4 (68.3) 29.7 (46.0)

Percentage of similarities is indicated in brackets. Entire seq. corresponds to a comparison between the entire ABCC sequences.

26 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

HsABCC10A 1’ 500 bp

HsABCC10 1 2 3

CrABCC1 1 23* 4 5 6 7 8

* OsABCC12

AtABCC13 *

AtABCC1

AtABCC5 (exon1 = 2040 bp)

B 5’ splice sitebranch site 3’ splice site CrABCC1 ATatatcctt----87nu----ttccttaa----9nu----acGTGCT AtABCC13 ATatatcctt----74nu----ttccttaa----8nu----acAGTTT OsABCC12 TTatatcctt----107nu---ggccttaa----6nu----acGGTGT 3’exon2intron2 5’exon3

Figure 3. Genomic organization of TMD0-CL0 encoding fragments. (A) Exons are in grey boxes. Empty boxes display experimentally determined 5UTR. Bent arrows are transcription initiation sites, *AT-AC U12-type introns, dotted lines connect intron locations, and vertical half-lines replace missing introns. At, A. thaliana;Os,O. sativa; Hs, H. sapiens;Cr,C. roseus. (B) Sequence alignment of the speciﬁc AT-AC U12-intron motifs indicated with * in (A).

(figure 4A, lane 2) revealed that introns 3–7 are correctly et al. 2005). Other studies have shown that, MRP2/ABCC2 spliced but not intron 2. Retention of intron 2 introduces deleted for the TMD0 was associated with an intracellu- three stop-codons in frame with the first exon (figure 4B). lar compartment and that its plasma membrane localization We suspect that another in-frame ATG codon localized in the was rescued with the TMD0 coexpression (Fernandez et al. exon 3 may initiate protein translation as an alternative start 2002). In addition, ABCC8/SUR1 (Sulfonyl urea receptor 1) codon. Because exon 3 encodes the first predicted transmem- is a modulator of ATP-sensitive potassium channels (i.e., Kir brane span (figure 4B), TMD0-CL0 topology was assessed 6.2) and acts through protein–protein interactions that engage with the alternative ATG as the first codon. According to TMD0-CL0 (Chan et al. 2003). Phobius prediction, when in silico translation starts with the Conservation of truncated TMD0 alternative forms alternative ATG codon, CrABCC1 (so called CrABCC1A) between higher plants and mammals (i.e., CrABCC1/ and ABCC10A display a similar topology which is char- ABCC10) suggest a role for some important aspect of protein acterized by the loss of the first transmembrane span intracellular trafficking and/or protein–protein interactions. (figure 4C). CrABCC1 and PpABCC1 share an overall 54.8% sequence similarity. However, TMD0 identities dra- matically decrease to 6.8% (30.1% between human and TMD0-CL0: YFP tonoplastic localization requires the first transmembrane span C. roseus TMD0s) (table 2). Topology prediction revealed that amino-terminal extremity of PpABCC1 does not display The ABCC transporters are likely to have an additional transmembrane domains, as shown in figure 4C. The absence targeting sequence in TMD0 region that is essential for of a typical TMD0 in PpABCC1 suggests that the TMD1- their proper targeting (Fernandez et al. 2002;Chanet al. NBD1-TMD2-NBD2 core is sufficient to insure transport 2003; Westlake et al. 2005). Subcellular localization of the activity in moss. Up to now, TMD0 functions remain unclear; CrABCC1 TMD0-CL0 and the TM1 deleted form (pre- however molecular data partially uncouple this domain of dicted for CrABCC1A) was assessed by protoplast transfec- the transport process. For instance, deletion of TMD0 of the tion and epifluorescence microscopy. C. roseus protoplasts human MRP1/ABCC1 has no influence on transport function exhibit a large vacuole (neutral red staining) and a visible but impairs its trafficking to the plasma membrane (Westlake nucleus (figure 5A). YFP transiently expressed in C. roseus

Journal of Genetics, Vol. 93, No. 1, April 2014 27 Taissir El-Guizani et al.

ACTMD0 CL0 introns exon1 [1][2] [3] CrABCC1

gDNA CrABCC1A PCR cycles x27 ABCC10 x29 cDNA x31 Posterior label probability ABCC10A

x33 PpABCC1

0 50100 150 200 250 B Amino acid

gactcctgctgatttacccagtaccagcaaaagtttaatgtgtctttcgttttttcccag 60 aaagcatgctggagcaggaatacccccgaatcccagtcaggaacattattgaattgaacc 120 cacctcgtaattctataatattttgttatatatgggtatcgccagtggtctggtgttaaa 180 tgtgttgctcagtttagattccatgccaaaatcgccgaaacccttattagttactgtaga 240 M E L L 4 ctctgcgatcagttgagagttgctctttgtagactgctccaatc ATG GAG TTG CTT 296 K H I C P D S P Y 13 AAG CAC ATT TGC CCT GAT TCT CCT TAC gtaagccaattcttcttcttttt 346 tctcgaaaacgaaagctattatatatcgttcaaactcagccttttttttttcccctgcct 406 ttcttgttttctttaattttacgttttatgaactctttttacatccccttgttgaggaaa 466 caaacgatcctttcatgtcttcggagaaagccgcagctttttctgtttttctccggccgg 526 ggaacattaatacatatatttggatacatttctgtttccttgatgtctttgcagccattt 586 ttaagtatacaatgttattgtcctatttgctggtttttgtatttttgtccaattcttatt 646 V W N G N G V S 21 gaaatatcctgttattttttaaacag GTA TGG AAT GGA AAC GGA GTC TCA 696 R C F S N I 26 ******* AGA TGC TTT AGC AAT AT atatcctggaaattacagtctgttctgtcctgactta 750 ***** gttattcgattaaaaatgttattgcttttgttcacataaatttcgcgaattgtccttcct 810 V L G F G A N M A T L 38 ** ** tagtaataattacA GTG CTA GGT TTT GGC GCA AAT ATG GCG ACT TTG 857 ~~ ~~ ~~ I V I V L V G V T R R S G R R 53 ATT GTC ATT GTT TTG GTT GGA GTA ACC AGA AGA AGT GGC AGG AGA 902 S R R 56 AGT AGA AGG gtaagcagtcagtccacctttttctctgacacagtaaaagtaactac 958 attgtcaagttgacattacactttaacctgtgaataaacggtattgtataatattgtaaa 1018 caagacatatctgttcaaattattgctctgttatacatcctatgtattggaaaagctatt 1078 gccttttagtatggggcatctagttcatgttctggcatttatttgttaccatactgaaca 1138 I H L S A K I L L F T V P A L 71 gATA CAC CTT TCA GCA AAG ATT CTG CTG TTC ACT GTG CCT GCT CTT 1184

Figure 4. Description of U12-intron retention and impact on CrABCC1 TMD0 organization. (A) PCR (gDNA) and semiquantitative RT- PCR (cDNA) analyses; 27, 29, 31 and 33 indicate PCR cycles. White arrowhead indicates exon-1 RT-PCR product and black arrowhead intron-2 product of 836 bp. (B) TMD0-CL0 nucleotide and deduced amino-acid sequences of CrABCC1 exons 1–4. Translated codons are in uppercase with their corresponding amino acids. 5UTR and introns are in lowercase. Bent arrows indicate 5 ends of cDNA. Putative first ATG codons and in-frame stop codon are boxed and linked. A putative TATA box is boxed in dashed lines. ∼∼, three stop codons within intron 2 in frame with the first methionine. GT-5, AG-3 splice sites and putative polypyrimidine tracks of GT-AG U2 introns are underlined. *Consensus sequences of AT-AC U12-introns. Putative transmembranes 1 and 2 are displayed in grey. (C) Phobius topology predictions for TMD0-CL0 predicted variants of C. roseus, H. sapiens and P. patens. protoplasts displays a predicted nuclear-cytoplasmic local- the nucleus (figure 5, F&G). Unidentified vesicles may ization (figure 5, B&C). The full length (1–267) TMD0-CL0 correspond to ER/Golgi derived structures or multivesicu- fused to YFP is localized to the tonoplast (figure 5,D&E). lar bodies, which are sometimes referred to the prevacuo- When protoplasts are transfected with the truncated (35– lar compartment, resulting from a misrouting of the trun- 267) TMD0-CL0: YFP construction (i.e. missing TM1), the cated (35–267) TMD0-CL0: YFP. However, even if we can- fusion protein displays a vesicle-like pattern surrounding not exclude an artefactual localization due to hydrophobic

28 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

A B C

D E

F G

Figure 5. Subcellular localization of CrABCC1 TMD0-CL0 variants fused to YFP. Arrowheads indicate location of nucleolus. (A) Dif- ferential interference contrast (DIC) image of a C. roseus protoplast stained with neutral red. (B) DIC image of a C. roseus protoplast transfected with expression vector containing p35S::YFP construct. (C) YFP fluorescence of the cell shown in B. (D) DIC image of a protoplast transfected with p35S::(1-267)TMD0-CL0:YFP fusion. (E) YFP fluorescence of the cell shown in D. (F) DIC image of a protoplast transfected with p35S::(35-267)TMD0-CL0:YFP fusion. (G) YFP fluorescence of the cell shown in (F). nature of the (35–267) TMD0 overexpressed by the 35S proteome identified trypsin peptides corresponding to the promoter, most of the protoplasts transfected with the (1– AtABCC13 protein (Jaquinod et al. 2007). Taken together, 267) TMD0-CL0 constructs displayed the pattern shown in with localization of CrABCC1 (1–267) TMD0-CL0: YFP figure 5E. to the tonoplast, we can suggest that plant ABCC10 ABCC transporters are located to the plasma membrane orthologues may be tonoplastic ABC transporters. ABCC10 or to the tonoplast and contribute to the transport of vari- subcellular localization is not documented so far but most of ous compounds across these membranes. In yeast, Ycf1p is human MRP/ABCCs are localized to the plasma membrane a tonoplastic ABCC involved in cadmium sequestration (Li (Zhang et al. 2004). Plasmalemma and tonoplast addressing et al. 1996) and its TMD0 peptide, expressed alone, is also signals remain uncertain; for instance, heterologous expres- localized to the vacuolar membrane (Mason and Michaelis sion of the human MRP1/ABCC1 in tobacco resulted in a 2002). Up to now, most of plant ABCCs were localized tonoplastic localization where the functional protein confers to the tonoplast; vacuoles are indeed alternative pathways heavy metal tolerance to the transgenic cells (Yazaki et al. to extrusion for detoxification processes (Martinoia et al. 2006). Functional significances of the alternative transcripts 1993; Geisler et al. 2004; Goodman et al. 2004;Wojaset of CrABCC1 and ABCC10 and the consequences on pro- al. 2007;Nagyet al. 2009). Moreover, Arabidopsis vacuole tein subcellular trafficking remain unclear. Nonetheless, we

Journal of Genetics, Vol. 93, No. 1, April 2014 29 Taissir El-Guizani et al. cannot exclude the hypothesis that miss-localization of the downregulation of CrABCC1 by methyljasmonate is organ C. roseus truncated TMD0-CL0 may be related to a post- dependent. Moreover, the interference of TDC, the enzyme transcriptional regulation process that involves U12-intron. that catalyses the last step of the indole pathway (tryptamine Indeed, the canonical TMD0 exposes the N-terminus part biosynthesis), does not modify the CrABCC1 expression to the extra cytosolic side (i.e. apoplast or vacuolar lumen). level (Ziegler and Facchini 2008). Because tryptamine is We suggest that TM1 absence, due to intron retention may the indole core of MIAs, this suggests that the physiologi- produce a misfolded ABC protein not suitable for transport cal function of C. roseus CrABCC1 is not directly related to activities. the MIAs biosynthesis, but rather some function common to plants and mammals. Evaluation of CrABCC1 expression pattern ABCC cluster III distribution among eukaryotes The MPGR offers a wide range of transcriptome data. We investigated FPKM values for the two C. roseus loci cor- The presence of ABCC cluster III was investigated among responding to CrABCC1 (figure 6A). According to these various organisms selected according to their relevance data, CrABCC1 is widely expressed in plant organs, hairy with regard to eukaryote evolution. ABCC10 or CrABCC1 roots and at lower levels in suspension cultures (figure 6B). homologous sequences were recovered by genome BLAST Roots and stems display the highest FPKM values, respec- analysis (Altschul et al. 1990) (see Material and meth- tively 17 and 14, whereas other organs are between 3 ods.), then cluster III orthologues were identified by phylo- (flower) and 6 (seedling). Interestingly, CrABCC1 expres- genetic analyses (table 1; figure 5 in electronic supplemen- sion is negatively modulated by methyljasmonate in WT tary material). In the animal kingdom, vertebrates, insects and TDC-interfered (Tryptophan Decarboxylase) hairy root. and cnidarian (i.e. jelly fish) have a single sequence. No Elicitor (yeast extract) and methyljasmonate treatments do orthologues were identified in nematodes, stressing the dis- not modify the CrABCC1 expression in suspension culture or crepancy of ABCC-cluster III representation in the animal seedlings (only methyljasmonate tested). This suggests that kingdom (figure 7A; figure 5 in electronic supplementary

A 1 Kb

CrABCC1

Loci 10644

Loci 32480 B Plant organs Hairy roots Suspension cultures FPKM values

Figure 6. Expression data analysis of FPKM values for CrABCC1 loci. (A) Local- ization of CrABCC1 corresponding loci recovered in MPGR. (B) Representation of CrABCC1 FPKM values from MPGR database. MJ, methyljasmonate; YE, yeast extract; TDCi, tryptophan decarboxylase interfered; d, day.

30 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

A H. sapiens B 1022 1041 Vertebrate M. musculus Hs GRILNRFSSDVACADDSLPF G. galus Mm GRVLNRFSSDVACVDDSLPF D. rerio Gg GRILNRFSSDLYCVDDSLPF D. melanogaster Dr GRILNRFSSDIYSVDDSLPF Insect A. gambiae Dm GRILNRFSSDTNTVDDSLPF Am GRILNRFSSDIYTIDDSLPF A. mellifera Ag GRILNRFSSDVYAVDDTLPF C. elegans Animal Nematode Nv GRIINRFSSDVYSIDDSLPF N. vectensis Cnidarian Mb GRLVNRFSSDVYGVDDSLPF M. brevicollis Pp GRILNRFSSDQFSVDDSLPF Choanoflagellate Fungi Os GRILNRLSSDLYAIDDSLPF Red algae C. merolae At GRILNRFSSDLYTIDDSLPF Cr GRILNRFSSDLYTIDDSLPF Green algae O. lucimarinus Cons.GR##NRFSSD#XX#DDSLPF C. reinhardii Bryophyte ↑↑↑↑ Plant P. patens PKA cdc2 O sativa Angiosperm A. thaliana (Tree not to scale) C. roseus

Figure 7. ABCC cluster III specificities. (A) Phylogenetic distribution of ABCC cluster III. Black lines indicate the presence of one ABCC10 orthologue in the organism, grey lines when it is absent. Arrowheads are brief descriptions of the branches. (B) Sequence alignment of a shared 20 amino acid peptide among cluster-III ABCCs. First letters of each line correspond to the initials of organisms cited in table 1 in electronic supplementary material. Amino-acids are numbered according to human ABCC10 sequence. Cons., consensus sequence; #, aliphatic amino acids (I, V and L). Putative phosphoserines for protein kinase A (PKA) and cell division control protein 2 (cdc2) are arrowed. material). However, the Choanoflagellate Monosiga brevi- DDSLPF motif is exclusive to cluster III (data not shown). collis which is described as an animal common ancestor Whereas Walker A, Walker B and ABC signatures are (King et al. 2008) has an ABCC10 orthologue (figure 7A; conserved among all ABC proteins, the 20-residue peptide figure 5 in electronic supplementary material). The absence identified here defines an ABCC cluster-III specific signa- of cluster III in C. elegans (Sheps et al. 2004) implies ture. The presence of 20 amino acids peptide exclusively an independent loss of gene in this phylum and indi- present in cluster III ABCCs is consistent with the ortholo- cates that physiological function of ABCC10 ortho- gous link identified through phylogenetic analysis in figure 1. logues is not required for nematodes or may be some- how compensated through some other nematode-specific physiological processes. According to our analysis, no Conclusion ABCC10 orthologue was identified in the fungal king- Investigating MPGR allowed the identification of 16 ABCC dom (figure 7A; figure 5 in electronic supplemen- loci in C. roseus; two of them correspond to a unique tary material). Surprisingly, no orthologue was identi- ABCC10 orthologue. Mammal ABCC10s display alterna- fied in the green algae genomes (i.e. C. reinhardtii and tive transcripts that encode amino-terminal truncated pro- O. lucimarinus) (figure 7A; figure 5 in electronic supplemen- teins. This peculiar feature is also predicted for higher plants tary material). Since green algae are considered to be ances- and it may be dependent on the presence of U12-type intron tors of land plants, we may suspect that one more indepen- in the TMD0 encoding sequence. We have shown that this dent loss of ABCC10 orthologue gene occurred after separa- process alters the TMD0-CL0 tonoplast localization in C. tion of green algae and land plants. ABCC cluster III is also roseus protoplasts. Finally, the FPKM values exploitation of absent in the red alga C. merolae (Hanikenne et al. 2005). CrABCC1 indicate that methyljasmonate, a phytohormone However, ABCC10 orthologues are present in complex plant that steers the balance between growth and defense pro- and animal organisms. grammes, represses CrABCC1 expression. Further investi- An overview of cluster III amino-acid sequences align- gations would unravel whether ABCC10 orthologues share ments reveals a highly conserved peptide (figure 7B) local- similar physiological functions and substrates in plants and ized in the cytosolic loop between transmembrane spans animals. 13 and 14. Among those 20 amino-acids, two putative phosphorylated serines are predicted within the conserved motifs NRFSSD and DDSLPF that are described as protein Acknowledgements kinase A (PKA) and cell division control protein 2 homo- logue (cdc2), respectively (NetPhosK 1.0 server; Blom et al. We would like to thank Marc Rideau and Christelle Dutilleul for the critical reading of this paper. This work was partly supported by 2004). Sequence alignments generated for ABCC phyloge- grants from the Tunisian Ministry of Higher Education and Scien- netic analysis revealed that the NRFSSD motif is also found tific Research, from the French Institute of Cooperation and from in the yeast Bpt1p and human SUR1 sequences while the French Ministère de la Recherche et de l’Enseignement Supérieur.

Journal of Genetics, Vol. 93, No. 1, April 2014 31 Taissir El-Guizani et al.

References of molecules in organisms from bacteria to humans. J. Mol. Biol. 293, 381–399. Alioto T. S. 2007 U12DB: A database of orthologous U12-type Hopper-Borge E., Chen Z. S., Shchaveleva I., Belinsky M. G. and spliceosomal introns. Nucleic Acids Res. 35, 110–115. Kruh G. D. 2004 Analysis of the drug resistance profile of mul- Altschul S. F., Gish W., Miller W., Myers E. W. and Lipman D. J. tidrug resistance protein 7 (ABCC10): resistance to docetaxel. 1990 Basic local alignment search tool. J. Mol. Biol. 215, 403– Cancer Res. 64, 4927–4930. 410. Hopper-Borge E., Xu X., Shen T., Shi Z., Chen Z. S. and Kruh G. D. Badone F. C., Cassani E., Landoni M., Doria E., Panzeri D., Lago C. 2009 Human multidrug resistance protein 7 (ABCC10) is a resis- et al. 2010 The low phytic acid1-241 (lpa1-241) maize muta- tance factor for nucleoside analogues and epothilone B. Cancer tion alters the accumulation of anthocyanin pigment in the kernel. Res. 69, 178–184. Planta 231, 1189–1199. Hyde S. C., Emsley P., Hartshorn M. J., Mimmack M. M., Gileadi Bandler P. E., Westlake C. J., Grant C. E., Cole S. P. and Deeley U., Pearce S. R. et al. 1990 Structural model of ATP-binding R. G. 2008 Identification of regions required for apical mem- proteins associated with cystic fibrosis, multidrug resistance and brane localization of human multidrug resistance protein 2. Mol. bacterial transport. Nature 346, 362–365. Pharmacol. 74, 9–19. Jaquinod M., Villiers F., Kieffer-Jaquinod S., Hugouvieux V., Blom N., Sicheritz-Pontén T., Gupta R., Gammeltoft S. and Brunak Bruley, C., Garin J. and Bourguignon J. 2007 A proteomics S. 2004 Prediction of post translational glycosylation and phos- dissection of Arabidopsis thaliana vacuoles isolated from cell phorylation of proteins from the amino acid sequence. Pro- culture. Mol. Cell. Proteomics 6, 394–412. teomics 4, 1633–1649. Kang J., Park J., Choi H., Burla B., Kretzschmar T., Lee Y. and Caceres J. F. and Misteli T. 2007 Division of Labor: Minor splicing Martinoia E. 2011 Plant ABC transporters. Arabidopsis Book 9, in the cytoplasm. Cell 131, 645–646. e0153. Chan K. W., Zhang H. and Logothetis D. E. 2003 N-terminal trans- Kao H. H., Huang J. D. and Chang M. S. 2002 cDNA cloning and membrane domain of the SUR controls trafficking and gating of genomic organization of the murine MRP7, a new ATP-binding Kir6 channel subunits. EMBO J. 22, 3833–3843. cassette transporter. Gene 286, 299–306. Chen Z. S., Hopper-Borge E., Belinsky M. G., Shchaveleva I., Kao H. H., Chang M. S., Cheng J. F. and Huang J. D. 2003 Genomic Kotova E. and Kruh G. D. 2003 Characterization of the trans- structure, gene expression, and promoter analysis of human mul- port properties of human multidrug resistance protein 7 (MRP7, tidrug resistance-associated protein 7. J. Biomed. Sci. 10, 98– ABCC10). Mol. Pharmacol. 63, 351–358. 110. Dean M. 2009 ABC transporters, drug resistance, and cancer stem King N., Westbrook M. J., Young S. L., Kuo A., Abedin M., cells. J. Mammary Gland Biol. Neoplasia 14, 3–9. Chapman J. et al. 2008 The genome of the choanoflagellate Dean M., Hamon Y. and Chimini G. 2001 The human ATP Binding Monosiga brevicollis and the origin of metazoans. Nature 451, cassette (ABC) transporters superfamily. J. Lipid Res. 42, 1007– 783–788. 1017. Klein M., Burla B. and Martinoia E. 2006 The multidrug resis- Decottignies A. and Goffeau A. 1997 Complete inventory of the tance associated protein (MRP/BCC) subfamily of ATP-binding yeast ABC proteins. Nat. Genet. 15, 137–145. cassette transporters in plants. FEBS Lett. 580, 1112–1122. Fernandez S. B., Hollo Z., Kern A., Bakos E., Fischer P. A., Borst P. Kolukisaoglu H. U., Bovet L., Klein M., Eggmann T., Geisler M., and Evers R. 2002 Role of the N-terminal transmembrane region Wanke D. et al. 2002 Family business: the multidrug-resistance of the multidrug resistance protein MRP2 in routing to the apical related protein (MRP) ABC transporter genes in Arabidopsis membrane in MDCKII cells. J. Biol. Chem. 277, 31048–31055. thaliana. Planta 216, 107–119. Geisler M., Girin M., Brandt S., Vincenzetti V., Plaza S., Paris N. Larkin M. A., Blackshields G., Brown N. P., Chenna R., et al. 2004 Arabidopsis immunophilin-like TWD1 functionally McGettigan P. A., McWilliam H. et al. 2007 Clustal W and interacts with vacuolar ABC transporters. Mol. Biol. Cell. 15, Clustal X version 2.0. Bioinformatics 23, 2947–2948. 3393–3405. Leier I., Jedlitschky G., Buchholz U., Cole S. P., Deeley R. G. Goodman C. D., Casati P. and Walbot V. 2004 A multidrug and Keppler D. 1994 The MRP gene encodes an ATP-dependent resistance-associated protein involved in anthocyanin transport in export pump for leukotriene C4 and structurally related conju- Zea mays. Plant Cell 16, 1812–1826. gates. J. Biol. Chem. 269, 27807–27810. Guirimand G., Burlat V., Oudin A., Lanoue A., St-Pierre B. and Leslie E. M., Deeley R. G. and Cole S. P. 2001 Toxicological rele- Courdavault V. 2009 Optimization of the transient transforma- vance of the multidrug resistance Protein 1, MRP1 (ABCC1) and tion of Catharanthus roseus cells by particle bombardment and related transporters. Toxicology 167, 3–23. its application to the subcellular localization of hydroxymethyl- Leslie E. M., Deeley R. G. and Cole S. P. 2005 Multidrug resis- butenyl 4-diphosphate synthase and geraniol 10-hydroxylase. tance proteins: role of P-glycoprotein, MRP1, MRP2, and BCRP Plant Cell Rep. 28, 1215–1234. (ABCG2) in tissue defense. Toxicol. Appl. Pharmacol. 204, 216– Hall S. L. and Padgett R. A. 1994 Conserved sequences in a class of 237. rare eukaryotic nuclear introns with non-consensus splice sites. Levêque D., Wihlm J. and Jehl F. 1996 Pharmacology of Catharan- J. Mol. Biol. 239, 357–365. thus alkaloids. Bull. Cancer 83, 176–186. Hanikenne M., Krämer U., Demoulin V. and Baurain D. 2005 A Li Z. S., Szczypka M., Lu Y. P., Thiele D. J. and Rea P. A. 1996 The comparative inventory of metal transporters in the green alga yeast cadmium factor protein (YCF1) is a vacuolar glutathione Chlamydomonas reinhardtii andtheredalgaCyanidioschizon S-conjugate pump. J. Biol. Chem. 271, 6509–6517. merolae. Plant Physiol. 137, 428–446. Lu Y. P., Li Z. S., Drozdowicz Y. M., Hörtensteiner S., Martinoia Higgins C. F. 1992 ABC transporters: from microorganisms to man. E. and Rea P. A. 1998 AtMRP2, an Arabidopsis ATP binding Annu. Rev. Cell. Biol. 8, 67–113. cassette transporter able to transport glutathione S-conjugates and Higgins C. F. 2001 ABC transporters: physiology, structure chlorophyll catabolites: functional comparisons with AtMRP1. and mechanism-an overview. Res. Microbiol. 152, 205– Plant Cell 10, 267–282. 210. Martinoia E., Grill E., Tommasini R., Kreuz K. and Amrhein N. Holland I. B. and Blight M. A. 1999 ABC-ATPases, adaptable 1993 ATP-dependent glutathione S-conjugate ‘export’ pump in energy generators fuelling transmembrane movement of a variety the vacuolar membrane of plants. Nature 364, 247–249.

32 Journal of Genetics, Vol. 93, No. 1, April 2014 Identiﬁcation of a human ABCC10 orthologue in C. roseus

Mason D. L. and Michaelis S. 2002 Requirement of the N-terminal in Arabidopsis is mediated by two ABCC type phytochelatin extension for vacuole trafficking and transport activity of yeast transporters. Proc. Natl. Acad. Sci. USA 107, 21187–21192. Ycf1p, an ATP-binding cassette transporter. Mol. Biol. Cell. 13, Tusnády G. E., Bakos E., Váradi A. and Sarkadi B. 1997 Membrane 4443–4455. topology distinguishes a subfamily of the ATP-binding cassette Merillon J. M., Rideau M. and Chenieux J. C. 1984 Influence of (ABC) transporters. FEBS Lett. 402, 1–3. sucrose on levels of ajmalicine, serpentine, and tryptamine in Tusnády G. E., Sarkadi B., Simon I. and Váradi A. 2006 Mem- Catharanthus roseus cells in vitro. Planta Med. 50, 497–501. brane topology of human ABC proteins. FEBS Lett. 580, 1017– Nagy R., Grob H., Weder B., Green P., Klein M., Frelet-Barrand 1022. A. et al. 2009 The Arabidopsis ATP-binding cassette protein Walker J. E., Saraste M., Runswick M. J. and Gay N. J. 1982 Dis- AtMRP5/AtABCC5 is a high affinity inositol hexakisphosphate tantly related sequences in the alpha- and beta-subunits of ATP transporter involved in guard cell signaling and phytate storage. synthase, myosin, kinases and other ATP-requiring enzymes and J. Biol. Chem. 284, 33614–33622. a common nucleotide binding fold. EMBO J. 1, 945–951. Raichaudhuri A., Peng M., Naponelli V., Chen S., Sánchez- WestlakeC.J.,QianY.M.,GaoM.,VasaM.,ColeS.P.andDeeley Fernández R., Gu H. et al. 2009 Plant vacuolar ATP-binding Cas- R. G. 2003 Identification of the structural and functional bound- sette transporters that translocate folates and antifolates in vitro aries of the multidrug resistance protein 1 cytoplasmic loop 3. and contribute to antifolate tolerance in Vivo. J. Biol. Chem. 284, Biochemistry 42, 14099–14113. 8449–8460. Westlake C. J., Cole S. P. and Deeley R. G. 2005 Role of the NH2- Rea P. A. 2007 Plant ATP-binding cassette transporters. Annu. Rev. terminal membrane spanning domain of multidrug resistance pro- Plant. Biol. 58, 347–375. tein 1/ABCC1 in protein processing and trafficking. Mol. Biol. Rea P. A., Li Z. S., Lu Y. P., Drozdowicz Y. M. and Martinoia E. Cell. 16, 2483–2492. 1998 From vacuolar GS-X pumps to multispecific ABC transpor- Wojas S., Hennig J., Plaza S., Geisler M., Siemianowski O., ters. Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 49, 727–760. Skłodowska A. et al. 2007 Ectopic expression of Arabidopsis Rees D. C., Johnson E. and Lewinson O. 2009 ABC transporters: ABC transporter MRP7 modifies cadmium root-to-shoot trans- the power to change. Nat. Rev. Mol. Cell. Biol. 10, 218–227. port and accumulation. Environ. Pollut. 157, 2781–2789. RensingS.A.,LangD.,ZimmerA.D.,TerryA.,SalamovA., Yazaki K. 2006 ABC transporters involved in the transport of plant Shapiro H. et al. 2008 The Physcomitrella genome reveals evolu- secondary metabolites. FEBS Lett. 580, 1183–1191. tionary insights into the conquest of land by plants. Science 319, Yazaki K., Yamanaka N., Masuno T., Konagai S., Shitan N., 64–69. Kaneko S. et al. 2006 Heterologous expression of a mammalian Sánchez-Fernández R., Davies T. G., Coleman J. O. and Rea P. ABC transporter in plant and its application to Phytoremediation. A. 2001 The Arabidopsis thaliana ABC protein superfamily, a Plant Mol. Biol. 61, 491–503. complete inventory. J. Biol. Chem. 1276, 3023–3044. Yoo S. D., Cho Y. H. and Sheen J. 2007 Arabidopsis mesophyll Sheps J. A., Ralph S., Zhao Z., Baillie D. L. and Ling V. 2004 protoplasts: a versatile cell system for transient gene expression The ABC transporter gene family of Caenorhabditis elegans analysis. Nat. Protoc. 2, 1565–1572. has implications for the evolutionary dynamics of multidrug Zhang Y., Schuetz J. D., Elmquist W. F. and Miller D. W. 2004 resistance in eukaryotes. Genome Biol. 5, R15. Plasma membrane localization of multidrug resistance-associated Shi J., Wang H., Schellin K., Li B., Faller M., Stoop J. M. et al. protein homologs in brain capillary endothelial cells. J. Pharma- 2007 Embryo-specific silencing of a transporter reduces phytic col. Exp. Ther. 311, 449–455. acid content of maize and soybean seeds. Nat. Biotechnol. 25, Zhu W. and Brendel V. 2003 Identification, characterization and 930–937. molecular phylogeny of U12 dependent introns in the Arabidop- Siddall M. E. and Whiting M. F. 1999 Long-branch abstractions. sis thaliana genome. Nucleic Acids Res. 31, 4561–4572. Cladistics 15, 9–24. Ziegler J. and Facchini P. J. 2008 Alkaloid Biosynthesis: Song W. Y., Park J., Mendoza-Cózatl D. G., Suter-Grotemeyer Metabolism and Trafficking. Annu. Rev. Plant. Biol. 59, 735– M., Shim D., Hörtensteiner S. et al. 2010 Arsenic tolerance 769.

Received 19 April 2013, in revised form 30 July 2013; accepted 10 September 2013 Published on the Web: 16 April 2014

Journal of Genetics, Vol. 93, No. 1, April 2014 33