Introduction to RNA Interference (RNAi) Technology

Patipan Jaipeng (DVM)

1 Introduction to RNA Interference (RNAi) Technology

The Central dogma of molecular genetic - Replication - -

Replication

DNA RNA Protein Transcription Translation

2 Introduction to RNA Interference (RNAi) Technology

Study of gene function - Forward genetic ( phenotype  Mutant allele  Gene or Protein sequence) - Reverse genetic (Gene or Protein sequence  Mutant allele  Mutant phenotype) . Gene replacement or [1st recorded in 1989] . or RNA interference [1st recorded in 1998] . CRISPR/ and Targeted Editing [Function confirmed in 2007]

They were awarded the 2007 Nobel Prize They were awarded the 2006 Nobel Prize in Physiology or in Physiology or Medicine 3 Introduction to RNA Interference (RNAi) Technology

RNA interference (RNAi) - Phenotypic effect after injection of single-stranded or double-stranded -22 RNA into the gonad of C. elegans. - The unc-22 gene encodes a myofilament protein. - Decrease in unc-22 activity is known to produce severe twitching movements.

unc-22 RNA

- Injected double-stranded RNA, but not single-stranded RNA, induced the 4 twitching phenotype in the progeny. Introduction to RNA Interference (RNAi) Technology

What are and antisense strand ? Sense DNA strand Anti-sense DNA strand (Template)

Transcription

Sense DNA strand Anti-sense DNA strand Sense RNA strand

Sense DNA strand Anti-sense DNA strand

mRNA Sense RNA strand Anti-sense RNA strand 5 Introduction to RNA Interference (RNAi) Technology

RNA interference (RNAi) - Anti-sense RNA mechanism (concept)

Anti-sense RNA dsRNA Anti-sense RNA is complementary to mRNA Sense RNA

Anti-sense RNA DNA Protein mRNA

The anti-sense RNA hybridizes to the mRNA  mRNA degradation or blocking translation

6 Introduction to RNA Interference (RNAi) Technology

RNA interference (RNAi) - RNA interference is a posttranscriptional specific gene silencing (PTGS) pathway or specific mechanism in . - Double strand RNA (dsRNA) - Degradation or translation inhibition of the mRNA target

RNA interference (RNAi) application - Basic research (Gene function) - Medicine (Tumor suppression, Antiviral replication) - Agriculture technology

7 Introduction to RNA Interference (RNAi) Technology

Main Type of RNA interference (origin, structure) . MicroRNA (miRNA) . Small interfering RNA (siRNA) . -interacting RNA (piRNA); (functional most clearly in germline)

siRNA (Small interfering RNA)

miRNA (Micro RNA)

8 Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis . Nearly 97% of the human genome is composed of non-coding DNA. . Numerous non-coding DNA have been recently found to encode miRNAs (Lin et al., 2006)

miRNA (Micro RNA)

9 Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis in mammalian cells

(Lin et al., 2006)10 Introduction to RNA Interference (RNAi) Technology

MicroRNA biogenesis in mammalian cells

Monocistronic Dicistronic Polycistronic miRNA miRNA miRNA

Transcription (RNA pol II) *Imperfectly base-paired hairpins Monocistronic Dicistronic Polycistronic pri-miRNA pri-miRNA pri-miRNA

m7Gppp AAA m7Gppp AAA m7Gppp AAA

Cleavage Dorsha Nucleus Exportin-5 pre-miRNA (70-100 nt) 5’P OH 5’P OH 5’P OH 5’P OH 5’P OH 5’P OH

11 Sarnow et al. Reviews Microbiology 4, 651–659 (September 2006) | doi:10.1038/nrmicro1473 Introduction to RNA Interference (RNAi) Technology

MicroRNA mechanism in mammalian cells RISC AGO Dicer Mature- pre-miRNA TRBP PACT Cytoplasm TRPB miRNA (19-23 nt) Nucleus Exportin-5 RISC assembly Dorsha PACT TRBP pri-miRNA pre-miRNA (70-100 nt) AGO Dicer Anti-sense miRNA RNA pol II

Sense miRNA degrade (passenger strand)

miRNA gene TRPB: TAR RNA binding protein PACT TRBP RISC: RNA induced silencing complex PACT: Protein activator of PKR Target mRNA AGO Dicer AGO: protein; guide strand recognition Translation inhibition or mRNA cleavage 12 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment i. RNAi design . GenBank®; sequence database . DNA Sequencing

13 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment i. RNAi design . Non-vector base RNAi (synthetic siRNA/Long dsRNA); A, B . Vector base RNAi (synthetic shRNA; short-hairpin RNA) C, D

(A) Synthetic siRNA (B) Long dsRNA (C) -based (D) -based

shRNA vector shRNA vector sene sene

Dicer

RISC assembly siRNA (19-23 nt) Target mRNA

Mammalian cell 14 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment i. RNAi design T7 promoter T7 promoter . Long double-stranded RNA In-vitro transcription double- DNA template stranded RNA T7 promoter T7 promoter 1. Target gene 2. Primer design; contained T7 Transcribe with T7 RNA Polymerase promoter (GAATTAATACGACTCACTAT AGGGAGA) dsRNA 3. PCR amplification for ssRNA making DNA template 4. Synthetic dsRNA in a tube DNA template at 37˚C for overnight 5. Long-dsRNA purification 15 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment i. RNAi design . RNAi design; online tool

16 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment ii. Delivery system . Micro-injection; in worm and animal model . Feeding of artificial diet; in worm model . Soaking; in worm model . ; in model . Viral transduction; in cell culture and animal model . Electroporation; in cell culture model . Inhalation; in animal model

17 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment ii. Delivery system . Transfection; in cell culture and animal model • Chemically modified structure of . Enhanced stability (resistance to nuclease activity) . Higher target specificity • Ligand-based targeting . High affinity for cell specific targeting • Lipid-based delivery . Protection for nuclease degradation

18 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment Direct injection (Ex. Ocular, CNS system) ii. Delivery system Necked siRNA

Direct injection (Ex. Intra-tumor) Aptamer-conjugated siRNA

Systemic administration (Ex. Target: hepatocyte) Cholesterol-conjugated siRNA

19 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment ii. Delivery system Systemic administration Systemic administration (Specific cell expressed surface protein) Liposome formulated siRNA Antibody-protamine complex siRNA

PEG: polyethylene glycol 20 Introduction to RNA Interference (RNAi) Technology

Step of an RNAi experiment iii. Validation and measurement

#Phenotypic analysis

21 Thank you for your attention

22