DOCSLIB.ORG

Mouse Il1rapl2 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Il1rapl2 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Il1rapl2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Il1rapl2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Il1rapl2 gene (NCBI Reference Sequence: NM_030688 ; Ensembl: ENSMUSG00000059203 ) is located on Mouse chromosome X. 11 exons are identified, with the ATG start codon in exon 2 and the TAG stop codon in exon 11 (Transcript: ENSMUST00000113063). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Il1rapl2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-210H6 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 100% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 80058 bp, and the size of intron 2 for 3'-loxP site insertion: 522727 bp. The size of effective cKO region: ~582 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 11 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Il1rapl2 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7082bp) | A(30.37% 2151) | C(17.16% 1215) | T(33.76% 2391) | G(18.71% 1325) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chrX + 137648471 137651470 3000 browser details YourSeq 235 438 698 3000 95.5% chr3 + 31787690 31787952 263 browser details YourSeq 220 438 694 3000 93.4% chr18 - 18180909 18181171 263 browser details YourSeq 218 438 677 3000 95.9% chr5 + 97919277 97919518 242 browser details YourSeq 216 438 680 3000 94.7% chrX + 161437700 161437943 244 browser details YourSeq 214 438 700 3000 92.8% chr10 - 35909044 35909296 253 browser details YourSeq 212 438 674 3000 95.3% chr9 + 105016271 105016516 246 browser details YourSeq 211 438 668 3000 96.2% chr14 - 70799329 70799567 239 browser details YourSeq 209 438 677 3000 94.1% chr8 - 40790843 40791082 240 browser details YourSeq 209 438 674 3000 94.5% chrX + 150518853 150519092 240 browser details YourSeq 207 340 658 3000 93.7% chrX - 137470169 137470763 595 browser details YourSeq 206 438 686 3000 92.6% chr17 - 85049301 85049552 252 browser details YourSeq 205 441 674 3000 95.2% chr2 + 5537546 5537781 236 browser details YourSeq 205 438 668 3000 94.8% chr13 + 64936333 64936567 235 browser details YourSeq 204 438 665 3000 94.8% chr19 - 54301918 54302145 228 browser details YourSeq 204 446 682 3000 93.6% chr3 + 78615499 78615737 239 browser details YourSeq 204 438 676 3000 92.9% chr14 + 62049161 62049400 240 browser details YourSeq 203 438 700 3000 89.1% chr15 - 60434012 60434256 245 browser details YourSeq 203 438 676 3000 93.2% chr18 + 51278236 51278475 240 browser details YourSeq 203 438 668 3000 94.4% chr15 + 29667947 29668180 234 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chrX + 137652053 137655052 3000 browser details YourSeq 32 2397 2450 3000 97.1% chr19 - 14848625 14848679 55 browser details YourSeq 30 2967 3000 3000 94.2% chr15 + 57979633 57979666 34 browser details YourSeq 28 1254 1301 3000 84.4% chr14 - 112987839 112987884 46 browser details YourSeq 25 2928 2955 3000 96.5% chr10 + 18809637 18809666 30 browser details YourSeq 25 96 126 3000 92.9% chr1 + 109625191 109625222 32 browser details YourSeq 23 2394 2419 3000 96.0% chr18 + 58280492 58280521 30 browser details YourSeq 22 2396 2419 3000 95.9% chr1 + 178882503 178882526 24 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Il1rapl2 interleukin 1 receptor accessory protein-like 2 [ Mus musculus (house mouse) ] Gene ID: 60367, updated on 12-Aug-2019 Gene summary Official Symbol Il1rapl2 provided by MGI Official Full Name interleukin 1 receptor accessory protein-like 2 provided by MGI Primary source MGI:MGI:1913106 See related Ensembl:ENSMUSG00000059203 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Expression Low expression observed in reference dataset See more Orthologs human all Genomic context Location: X; X F1 See Il1rapl2 in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) X NC_000086.7 (137570754..138849077) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) X NC_000086.6 (134106088..135381494) Chromosome X - NC_000086.7 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Il1rapl2 ENSMUSG00000059203 Description interleukin 1 receptor accessory protein-like 2 [Source:MGI Symbol;Acc:MGI:1913106] Location Chromosome X: 137,570,608-138,846,946 forward strand. GRCm38:CM001013.2 About this gene This gene has 3 transcripts (splice variants), 199 orthologues, 10 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Il1rapl2- ENSMUST00000113063.7 3437 686aa ENSMUSP00000108686.1 Protein coding CCDS30429 Q0VBP3 TSL:1 202 Q9ERS6 GENCODE basic APPRIS P1 Il1rapl2- ENSMUST00000075471.3 2061 686aa ENSMUSP00000074917.3 Protein coding CCDS30429 Q0VBP3 TSL:5 201 Q9ERS6 GENCODE basic APPRIS P1 Il1rapl2- ENSMUST00000130879.1 2670 No - Retained - - TSL:5 203 protein intron 1.30 Mb Forward strand 137.6Mb 137.8Mb 138.0Mb 138.2Mb 138.4Mb 138.6Mb 138.8Mb Genes (Comprehensive set... Il1rapl2-202 >protein coding Il1rapl2-203 >retained intron Il1rapl2-201 >protein coding Contigs AL691422.15 > BX890639.3 > AL672286.9 > AL672205.7 > BX572626.6 > AL672067.5 > Genes < Gm14988-201processed pseudogene < Gm14989-201processed pseudogene < Gm23958-201snRNA < Gm15001-201processed pseudogene (Comprehensive set... < Gm25393-201misc RNA < Gm24675-201misc R<N GAm22057-201snRNA < Gm15000-201processed pseudogene < Tex13a-201protein coding Regulatory Build 137.6Mb 137.8Mb 138.0Mb 138.2Mb 138.4Mb 138.6Mb 138.8Mb Reverse strand 1.30 Mb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene pseudogene processed transcript Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000113063 1.28 Mb Forward strand Il1rapl2-202 >protein coding ENSMUSP00000108... Transmembrane heli... Low complexity (Seg) Cleavage site (Sign... Superfamily Immunoglobulin-like domain superfamily Toll/interleukin-1 receptor homology (TIR) domain superfamily SMART Immunoglobulin subtype Toll/interleukin-1 receptor homology (TIR) domain Immunoglobulin subtype 2 Prints Interleukin-1 receptor type II PR01537 Pfam IL-18Ra-like, immunoglobulin domain Toll/interleukin-1 receptor homology (TIR) domain Immunoglobulin-like domain Immunoglobulin I-set PROSITE profiles Immunoglobulin-like domain Toll/interleukin-1 receptor homology (TIR) domain PANTHER PTHR11890:SF10 Interleukin-1 receptor family Gene3D Immunoglobulin-like fold Toll/interleukin-1 receptor homology (TIR) domain superfamily CDD cd05896 cd05757 cd00096 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 540 600 686 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • HERV-K(HML7) Integrations in the Human Genome: Comprehensive Characterization and Comparative Analysis in Non-Human Primates
    biology Article HERV-K(HML7) Integrations in the Human Genome: Comprehensive Characterization and Comparative Analysis in Non-Human Primates Nicole Grandi 1,* , Maria Paola Pisano 1 , Eleonora Pessiu 1, Sante Scognamiglio 1 and Enzo Tramontano 1,2 1 Laboratory of Molecular Virology, Department of Life and Environmental Sciences, University of Cagliari, 09042 Monserrato, Cagliari, Italy; [email protected] (M.P.P.); [email protected] (E.P.); [email protected] (S.S.); [email protected] (E.T.) 2 Istituto di Ricerca Genetica e Biomedica, Consiglio Nazionale delle Ricerche (CNR), 09042 Monserrato, Cagliari, Italy * Correspondence: [email protected] Simple Summary: The human genome is not human at all, but it includes a multitude of sequences inherited from ancient viral infections that affected primates’ germ line. These elements can be seen as the fossils of now-extinct retroviruses, and are called Human Endogenous Retroviruses (HERVs). View as “junk DNA” for a long time, HERVs constitute 4 times the amount of DNA needed to produce all cellular proteins, and growing evidence indicates their crucial role in primate brain evolution, placenta development, and innate immunity shaping. HERVs are also intensively studied for a pathological role, even if the incomplete knowledge about their exact number and genomic position has thus far prevented any causal association. Among possible relevant HERVs, the HERV-K Citation: Grandi, N.; Pisano, M.P.; supergroup is of particular interest, including some of the oldest (HML5) as well as youngest (HML2) Pessiu, E.; Scognamiglio, S.; integrations. Among HERV-Ks, the HML7 group still lack a detailed description, and the present Tramontano, E.
    [Show full text]
  • A Novel Foxp3-Related Immune Prognostic Signature for Glioblastoma Multiforme Based on Immunogenomic Profiling
    www.aging-us.com AGING 2021, Vol. 13, No. 3 Research Paper A novel foxp3-related immune prognostic signature for glioblastoma multiforme based on immunogenomic profiling Xiao-Yu Guo1,*, Guan-Hua Zhang1,2,*, Zhen-Ning Wang1, Hao Duan1, Tian Xie1, Lun Liang1, Rui Cui1, Hong-Rong Hu1, Yi Wu3, Jia-jun Dong3, Zhen-Qiang He1, Yong-Gao Mou1 1Department of Neurosurgery AND Neuro-Oncology, Sun Yat-sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou 510000, China 2Department of Cerebrovascular Surgery, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou 510000, China 3Department of Neurosurgery, Jiangmen Central Hospital, Jiangmen 529030, China *Equal contribution Correspondence to: Yong-Gao Mou, Zhen-Qiang He; email: [email protected], [email protected] Keywords: glioblastoma multiforme, Foxp3, regulatory T cells, immune prognostic signature, nomogram Received: June 8, 2020 Accepted: October 31, 2020 Published: January 10, 2021 Copyright: © 2021 Guo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Foxp3+ regulatory T cells (Treg) play an important part in the glioma immunosuppressive microenvironment. This study analyzed the effect of Foxsp3 on the immune microenvironment and constructed a Foxp3-related immune prognostic signature (IPS)for predicting prognosis in glioblastoma multiforme (GBM). Immunohistochemistry (IHC) staining for Foxp3 was performed in 72 high-grade glioma specimens. RNA-seq data from 152 GBM samples were obtained from The Cancer Genome Atlas database (TCGA) and divided into two groups, Foxp3 High (Foxp3_H) and Foxp3 Low (Foxp3_L), based on Foxp3 expression.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Concurrent Mutations Associated with Trastuzumab-Resistance Revealed by Single Cell Sequencing
    Concurrent Mutations Associated With Trastuzumab-resistance Revealed by Single Cell Sequencing Yan Gao Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital Ning Wu Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital Shuai Wang Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital Xue Yang Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital Xin Wang Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital Bo Xu ( [email protected] ) Tianjin Medical University Cancer Institute and Hospital: Tianjin Tumor Hospital https://orcid.org/0000-0001-8693-3060 Research Article Keywords: HER2-positive breast cancer, trastuzumab-resistance, single cell sequencing, concurrent mutations Posted Date: February 25th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-253665/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/17 Abstract Purpose: HER2-positive breast cancer patients benet from HER2 targeted therapies, among which the most commonly used is trastuzumab. However, acquired resistance typically happens within one year. The cellular heterogeneity of it is less clear. Methods: Here we generated trastuzumab-resistant cells in two HER2-positive breast cancer cell lines, SK- BR-3 and BT-474. Cells at different time points during the resistance induction were examined by exome sequencing to study changes of genomic alterations over time. Single cell targeted sequencing was also used to identify resistance associated concurrent mutations. Results: We found a rapid increase of copy number variation (CNV) regions and gradual accumulation of single nucleotide variations (SNVs). On the pathway level, nonsynonymous SNVs for SK-BR-3 cells were enriched in the MAPK signaling pathway, while for BT-474 cells were enriched in mTOR and PI3K-Akt signaling pathways.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • A Systems-Genetics Analyses of Complex Phenotypes
    A systems-genetics analyses of complex phenotypes A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Life Sciences 2015 David Ashbrook Table of contents Table of contents Table of contents ............................................................................................... 1 Tables and figures ........................................................................................... 10 General abstract ............................................................................................... 14 Declaration ....................................................................................................... 15 Copyright statement ........................................................................................ 15 Acknowledgements.......................................................................................... 16 Chapter 1: General introduction ...................................................................... 17 1.1 Overview................................................................................................... 18 1.2 Linkage, association and gene annotations .............................................. 20 1.3 ‘Big data’ and ‘omics’ ................................................................................ 22 1.4 Systems-genetics ..................................................................................... 24 1.5 Recombinant inbred (RI) lines and the BXD .............................................. 25 Figure 1.1:
    [Show full text]
  • Expanding the Clinical Spectrum of COL1A1 Mutations in Different Forms of Glaucoma
    Mauri et al. Orphanet Journal of Rare Diseases (2016) 11:108 DOI 10.1186/s13023-016-0495-y RESEARCH Open Access Expanding the clinical spectrum of COL1A1 mutations in different forms of glaucoma Lucia Mauri1, Steffen Uebe2, Heinrich Sticht3, Urs Vossmerbaeumer4,NicoleWeisschuh5, Emanuela Manfredini1, Edoardo Maselli6, Mariacristina Patrosso1,RobertN.Weinreb7, Silvana Penco1,AndréReis2 and Francesca Pasutto2* Abstract Background: Primary congenital glaucoma (PCG) and early onset glaucomas are one of the major causes of children and young adult blindness worldwide. Both autosomal recessive and dominant inheritance have been described with involvement of several genes including CYP1B1, FOXC1, PITX2, MYOC and PAX6. However, mutations in these genes explain only a small fraction of cases suggesting the presence of further candidate genes. Methods: To elucidate further genetic causes of these conditions whole exome sequencing (WES) was performed in an Italian patient, diagnosed with PCG and retinal detachment, and his unaffected parents. Sanger sequencing of the complete coding region of COL1A1 was performed in a total of 26 further patients diagnosed with PCG or early onset glaucoma. Exclusion of pathogenic variations in known glaucoma genes as CYP1B1, MYOC, FOXC1, PITX2 and PAX6 was additionally done per Sanger sequencing and Multiple Ligation-dependent Probe Amplification (MLPA) analysis. Results: In the patient diagnosed with PCG and retinal detachment, analysis of WES data identified compound heterozygous variants in COL1A1 (p.Met264Leu; p.Ala1083Thr). Targeted COL1A1 screening of 26 additional patients detected three further heterozygous variants (p.Arg253*, p.Gly767Ser and p.Gly154Val) in three distinct subjects: two of them diagnosed with early onset glaucoma and mild form of osteogenesis imperfecta (OI), one patient with a diagnosis of PCG at age 4 years.
    [Show full text]
  • A Hot L1 Retrotransposon Evades Somatic Repression and Initiates Human Colorectal Cancer
    Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Research A hot L1 retrotransposon evades somatic repression and initiates human colorectal cancer Emma C. Scott,1,2,8 Eugene J. Gardner,1,2,8 Ashiq Masood,2,3,4,9 Nelson T. Chuang,1,2,5 Paula M. Vertino,6,7 and Scott E. Devine1,2,3,4 1Graduate Program in Molecular Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 2Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 3Greenebaum Cancer Center, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 4Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 5Division of Gastroenterology, Department of Medicine, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 6Department of Radiation Oncology, Emory University School of Medicine, Atlanta, Georgia 30322, USA; 7Winship Cancer Institute, Emory University, Atlanta, Georgia 30322, USA Although human LINE-1 (L1) elements are actively mobilized in many cancers, a role for somatic L1 retrotransposition in tumor initiation has not been conclusively demonstrated. Here, we identify a novel somatic L1 insertion in the APC tumor suppressor gene that provided us with a unique opportunity to determine whether such insertions can actually initiate co- lorectal cancer (CRC), and if so, how this might occur. Our data support a model whereby a hot L1 source element on Chromosome 17 of the patient’s genome evaded somatic repression in normal colon tissues and thereby initiated CRC by mutating the APC gene. This insertion worked together with a point mutation in the second APC allele to initiate tumor- igenesis through the classic two-hit CRC pathway.
    [Show full text]
  • IL1RAPL1 Antibody
    Efficient Professional Protein and Antibody Platforms IL1RAPL1 Antibody Basic information: Catalog No.: UMA21124 Source: Mouse Size: 50ul/100ul Clonality: Monoclonal 2H3C12 Concentration: 1mg/ml Isotype: Mouse IgG1 Purification: The antibody was purified by immunogen affinity chromatography. Useful Information: WB:1:500 - 1:2000 Applications: ELISA:1:10000 Reactivity: Human Specificity: This antibody recognizes IL1RAPL1 protein. Purified recombinant fragment of human IL1RAPL1 (AA: 541-694) expressed Immunogen: in E. Coli. The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associ- Description: ated with X-linked non-syndromic mental retardation. Deletions and muta- tions in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. Uniprot: Q9NZN1 BiowMW: 80kDa Buffer: Purified antibody in PBS with 0.05% sodium azide Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure. Data: Figure 1:Black line: Control Antigen (100 ng);Purple line: Antigen (10ng); Blue line: Antigen (50 ng); Red line:Antigen (100 ng) Gene Universal Technology Co. Ltd www.universalbiol.com Tel: 0550-3121009 E-mail: [email protected] Efficient Professional Protein and Antibody Platforms Figure 2:Western blot analysis using IL1RAPL1 mAb against human IL1RAPL1 (AA: 541-694) re- combinant protein.
    [Show full text]
  • Identifying a Major Locus That Regulates Spontaneous Arthritis in IL-1Ra-Deficient Mice and Analysis of Potential Candidates
    Genet. Res., Camb. (2011), 93, pp. 95–103. f Cambridge University Press 2011 95 doi:10.1017/S0016672310000704 Identifying a major locus that regulates spontaneous arthritis in IL-1ra-deficient mice and analysis of potential candidates YAN JIAO1, FENG JIAO1,JIANYAN2,QINGXIONG1, 3,DANIELSHRINER4, KAREN HASTY1, JOHN STUART2 AND WEIKUAN GU1* 1 Department of Orthopaedic Surgery – Campbell Clinic and Pathology, University of Tennessee Health Science Center (UTHSC), Memphis, TN 38163, USA 2 Department of Medicine, University of Tennessee Health Science Center, Memphis, TN 38163, USA 3 Institute for Genome Science and Policy, Duke University, Durham, NC 27708, USA 4 Department of Biostatistics, Section on Statistical Genetics, University of Alabama at Birmingham, Birmingham, AL 35294, USA (Received 17 August 2010; revised 8 December 2010; accepted 11 December 2010; first published online 18 March 2011) Summary To identify genetic loci that regulate spontaneous arthritis in interleukin-1 receptor antagonist (IL-1ra)-deficient mice, an F2 population was created from a cross between Balb/c IL-1ra-deficient mice and DBA/1 IL-1ra-deficient mice. Spontaneous arthritis in the F2 population was examined and recorded. Genotypes of those F2 mice were determined using microsatellite markers. Quantitative trail locus (QTL) analysis was conducted with R/qtlbim. Functions of genes within QTL chromosomal regions were evaluated using a bioinformatics tool, PGMapper, and microarray analysis. Potential candidate genes were further evaluated using GeneNetwork. A total of 137 microsatellite markers with an average of 12 cM spacing along the whole genome were used for determining the correlation of arthritis phenotypes with genotypes of 191 F2 progenies.
    [Show full text]
  • IL1RAPL2 (NM 017416) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC304458 IL1RAPL2 (NM_017416) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: IL1RAPL2 (NM_017416) Human Untagged Clone Tag: Tag Free Symbol: IL1RAPL2 Synonyms: IL-1R9; IL1R9; IL1RAPL-2; TIGIRR-1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 IL1RAPL2 (NM_017416) Human Untagged Clone – SC304458 Fully Sequenced ORF: >NCBI ORF sequence for NM_017416, the custom clone sequence may differ by one or more nucleotides ATGAAGCCACCATTTCTTTTGGCCCTTGTGGTCTGTTCTGTAGTCAGCACAAATCTGAAGATGGTGTCAA AGAGAAATTCTGTGGATGGCTGCATTGACTGGTCAGTGGATCTCAAGACATACATGGCTTTGGCAGGTGA ACCAGTCCGAGTGAAATGTGCCCTTTTCTACAGTTATATTCGTACCAACTATAGCACGGCCCAGAGCACT GGGCTCAGGCTTATGTGGTACAAAAACAAAGGTGATTTGGAAGAGCCCATCATCTTTTCAGAGGTCAGGA TGAGCAAAGAGGAAGATTCAATATGGTTTCACTCAGCTGAGGCACAAGACAGTGGATTCTACACTTGTGT TTTAAGAAACTCAACATATTGCATGAAGGTGTCAATGTCCTTGACTGTTGCAGAGAATGAATCAGGCCTG TGCTACAACAGCAGGATCCGCTATTTAGAAAAATCTGAAGTCACTAAAAGAAAGGAGATCTCCTGTCCAG ACATGGATGACTTTAAAAAGTCCGATCAGGAGCCTGATGTTGTGTGGTATAAGGAATGCAAGCCAAAAAT GTGGAGAAGCATAATAATACAGAAAGGAAATGCTCTTCTGATCCAAGAAGTTCAAGAAGAAGATGGAGGA AATTACACATGTGAACTTAAATATGAAGGAAAACTTGTAAGACGAACAACTGAATTGAAAGTTACAGCTT
    [Show full text]