Molecular Identification of Leishmania Species in Patient with Cutaneous Leishmaniasis in an Endemic Area of Fars Province, Southern Iran
Total Page：16
File Type：pdf, Size：1020Kb
American Journal of Animal and Veterinary Sciences Original Research Paper Molecular Identification of Leishmania Species in Patient with Cutaneous Leishmaniasis in an Endemic Area of Fars Province, Southern Iran 1Vahid Rahmanian, *1Nader Sharifi, 2Zahra Kargar Jahromi, 1Hayedeh Parvin, 1Narges Rahmanian and 3Hekmatollah Khoubfekr 1Zoonoses Research Center, Jahrom University of Medical Sciences, Jahrom, Iran 2Central Research Laboratory, Jahrom University of Medical Sciences, Jahrom, Iran 3Iranshahr Health Services, Iranshahr University of Medical Sciences, Iranshahr, Iran Article history Abstract: The Cutaneous Leishmaniasis (CL) contains a range of factors, Received: 30-01-2021 which provide different patterns of transmission that make it difficult to Revised: 08-03-2021 control. The aim of this study was to identify the different species of Accepted: 11-03-2021 Leishmania in the Jahrom district of Fars province, southern Iran. This descriptive study was done on CL suspected cases who were referential to Corresponding Author: Nader Sharifi the Reference of Jahrom Health Center laboratory in 2017 from all different Zoonoses Research center, zones mentioned. Demographic variables (age, sex, location, number and Jahrom University of Medical place of wounds) was recorded by a questionnaire. The blood smears were Sciences, Jahrom, Iran checked for the existence of amastigotes by light microscopy. After Email: [email protected] microscopic examination smears were extract DNA and used in the Polymerase Chain Reaction (PCR) method. Totally 165 slide samples checked were found to be positive for amastigotes via microscopy and positive for leishmanial DNA in the PCR. two (1.2%) of the slide samples gave the 750-bp indicative of Leishmania tropica and 163 samples (98.8%) gave the 560-bp indicative of Leishmania major. Although the actually that both species of CL are common in Iran, but our results showed that in Jahrom district the main specie was L. major. Thus, this fact displays the importance of reservoir rodents in programs of CL control in this County. Keywords: Species Identification, L. Major, L. Tropica, PCR, Iran Introduction is human and it is considered to be an excessive significance in many regions of Iran, including some big Leishmaniasis is a neglected of vector-borne diseases and middle sized cities such as Mashhad, Tehran, produced by many Leishmania species which can infect Sabzevar and Neishabur in the north-east, Fars in the both humans and other mammalian animals. Leishmaniasis south, Kerman and Bam in the southeast, Kashan, Yazd is can be seen in three main forms such as cutaneous, and parts of the city of Esfahan in the central region mucosal and visceral (Rahmanian et al., 2021). (Yaghoobi-Ershadi et al., 2013; 2015). Atypical mucosal It is estimated that 350 million population, are at risk of infections with leishmanial parasites have also been Cutaneous leishmaniasis (CL) and 1 million patient have detected in Iran, although infrequently. been described in the past five years (Laurent et al., 2017). Approximately 20,000 cases of CL are reported In Islamic republic of Iran, two forms of CL are yearly from provinces of Iran, but it is estimated that the occurs; Zoonotic Cutaneous Leishmaniasis (ZCL) number of actual cases has doubled (Karami et al., 2013; caused by Leishmania major (L. major) and the rodents Moein et al., 2018). CL is endemic in 15 provinces of IR including Rhombomys opimus, Meriones libycus and and in the recent years. In addition, in recent years, Meriones nesokia are considered as the main reservoir climatic and environmental variables have created (Shirzadi et al., 2015; Mohammadiha et al., 2018). The suitable conditions for the activity of reservoirs and Anthroponotic Cutaneous Leishmaniasis (ACL) caused vectors of CL in some new foci (Moein et al., 2018; by Leishmania tropica (L. tropica) whose main reservoir Shirzadi et al., 2015). © 2021 Vahid Rahmanian, Nader Sharifi, Zahra Kargar Jahromi, Hayedeh Parvin, Narges Rahmanian and Hekmatollah Khoubfekr. This open access article is distributed under a Creative Commons Attribution (CC-BY) 4.0 license. Vahid Rahmanian et al. / American Journal of Animal and Veterinary Sciences 2021, 16 (2): 105.111 DOI: 10.3844/ajavsp.2021.105.111 Epidemiological studies, taxonomic and population study an increasing trend in number of CL cases in genetics surveys, measuring a specific Jahrom county, 90 cases in 2010 to 309 cases in 2014 chemotherapeutic treatment, correct identification of and due to the lack of information about the kinds of the parasite species and the investigation of the species of CL in the county, this study was to identify genetic variation of the parasites are necessary for the different species of Leishmania in the Jahrom district leishmaniasis control program in endemic regions of Fars province, southern Iran. (Leite et al., 2010; Van der Auwera et al., 2013). In Iran, diagnosis commonly depends on detection of Methodology the species in the Giemsa-stained smear that is ready with the aspiration material of lesion. Furthermore, Study Site culture in Novy-MacNealNicolle (NNN) medium, ELISA, IFA and histopathological examination are The Fars province is situated in southern Iran and has used for investigation. On the other hand, diagnostic a distinct of 122, 400 km2. The climate is moderately ways based on Deoxyribonucleic Acid (DNA) have, dusty and dry. The study has been carried out in Jahrom nevertheless, now made the sensitive and quick of Fars province. This districtis located at ~53°33´E, recognition of many germs potential. In recent years, 28°30´N and 1050 m above the sea level. Due to the for instance, analyses based on PCR have showed to appropriate ecological situations for leishmaniasis be valid tools for the identification of Leishmania, (reservoir hosts, vectors variety and weather conditions), without the need to culture the organisms Jahrom has permanently been considered as one of the (Mohammadiha et al., 2013). Cutaneous and Visceral leishmaniasis (CL, VL) and Fars Province is an endemic cutaneous and visceral focus district (Davami et al., 2011), (Fig. 1). leishmaniasis, so that the cumulative incidence of cutaneous and visceral leishmaniasis was reported to be Study Design and Sampling Method between 59.9-98.8 and 0.58-0.73 cases per 100000 In this descriptive study, sampling lasted in a inhabitants, respectively (Shirzadi et al., 2015). The National Leishmaniasis Control Program in Iran due to laboratory for 12 months from January to December differences in reservoir, differences in the methods of 2017 in Jahrom leishmaniasis national surveillance control and prevention of Leishmania species highlights system. The inclusion criteria for entering the study were the essential of determining molecular identification of all patients referred by the physician (imported or species in endemic regions once every five years. On the autochthonous cases) to the reference laboratory in the other hand, (Rahmanian et al., 2018), showed in a one surveillance system for the diagnosis of leishmaniasis. Jahrom Fig. 1: The location of Jahrom County in Fars province, Iran 106 Vahid Rahmanian et al. / American Journal of Animal and Veterinary Sciences 2021, 16 (2): 105.111 DOI: 10.3844/ajavsp.2021.105.111 First, infection foci were determined according to temperature of 90°C for 5 min, followed by 30 cycles the cumulative incidence of the previous year. Then, including 90°C for 45 sec, 55°C for 1 min and 72°C for the samples were aseptically taken from all 1.5 min and then 72°C for 5 min (Davami et al., 2014). individuals with suspected CL lesions and referred to The produce of this step of the PCR was diluted with the laboratory by the physician after completing the pure water. Then, 1 μL of this diluted solution was used survey form. Two slides were prepared from each of in the second step of PCR. All steps are like the first step the 165 suspected patients and stained with Giemsa of PCR, except that the primers of LIR and 13Z stain. The samples were taken by scalpel from the (ACTGGGGGTTGGTGTAAAATAG) were used deep wound through harvesting the tissue containing instead of the primers of the first step and the final volume of the reaction solution increased to 100 μL macrophages, stained with Giemsa stain and explored (Davami et al., 2011; Azizi et al., 2013). with a magnification of 100 to observe the parasite. Next, 5 μL of the sample of the second PCR The surface of positive the samples was scraped from product was poured into the wells onto 1.5% agarose the slides and used for PCR. gel marked with ethidium bromide for the DNA Extraction implementation of electrophoresis and then explored by UV light (Davami et al., 2011). The DNA extraction was made via phenol- The size of each observed product was compared chloroform and proteinase K (Motazedian et al., 2002). with the ladder marker and the positive control Thus, the stained sample on the slide surface was poured sample. The positive controls were tested using DNA into 1.5 mM plus 200 μL of lysis buffer and 5 μL of extracted from reference promastigote cultures of proteinase K and incubated at 56°C for 2 h. Then, the parasite L. major (MHOM/IR/54/LV39) and L. contents of the microtube were mixed with 100 μL of the tropica (MHOM/IR/89/ARA2), created on any gel phenol/chloroform/isoamyl-alcohol mixture and (Pourmohammadi et al., 2010). centrifuged at 15,000 rpm for 5 min. At this stage, three layers were observed; the supernatant containing DNA, Results the middle layer containing lipids and proteins and the bottom layer containing phenol/chloroform/isoamyl- 165 slide samples checked were positive for amastigotes via microscopy and positive for leishmanial alcohol mixture. The supernatant (about 100-150 μL) was DNA in the PCR. 2(1.2%) of the slide samples presented carefully separated and poured into a new microtube and the 750-bp second-round amplicon indicative of L.