Role of Brain Cytochrome P450 Enzymes in Bilirubin Oxidation -Speciﬁc Induction and Activity

Role of brain Cytochrome P450 enzymes in bilirubin oxidation -speciﬁc induction and activity-

Sabrina E. Gambaro

Diparmento Science della vita

Universita` degli Studi di Trieste

A thesis submitted for the degree of

Doctor of Philosophy in Molecular Biomedicine (PhD) - Ciclo XXVI -

Universita` degli Studi di Trieste Dottorato di ricerca in Biomedicina Molecolare Ciclo XXVI

Role of brain Cytochrome P450 enzymes in bilirubin oxidation -speciﬁc induction and activity- Settore Scientiﬁco - disciplinare: Biologia Molecolare (Bio/11)

PhD Student: Gambaro Sabrina Eliana

Doctoral Coordinator: Prof. Guidalberto Manﬁoletti Universit`a degli Studi di Trieste

Supervisior: Prof. Claudio Tiribelli Universit`a degli Studi di Trieste

Tutor: Dr. Silvia Gazzin Fondazione Italiana Fegato

iii Supervisior: Prof. Claudio Tiribelli Universit`a degli Studi di Trieste

Tutor: Dr. Silvia Gazzin Fondazione Italiana Fegato

External Supervisor: Dr. Martin Rumbo Universidad Nacional de La Plata, Argentina

Opponent: Dr. Jean-Francois Ghersi-Egea Lyon Neuroscience Research Center, Lyon, France

iv Abstract

Hyperbilirubinemia is the most common clinical diagnosis during neonatal life. The neonatal jaundice may be physiological without any clinical consequence, or can lead to an acute form of bilirubin encephalopathy with minimal neurological damage, or to more severe and dangerous condition called kernicterus (permanent neurological sequelae).

The Gunn rat is one of the models in which bilirubin encephalopathy was studied. It was shown that jaundiced newborn animals display an hepatic compensatory mechanism for the incapacity to eliminate bilirubin (Ugt1A1 mutant enzyme) by upregulation of cyotochrome P450 enzymes (Cyp) 1A1 and 1A2 compared with their not jaundiced littermates. In addition, their expression in brain was selectively induced (cortex higher and early vs. cerebellum lower and late induction) by sudden increase of bilirubin content.

Cyotochrome P450 enzymes are the main enzymes involved in the detoxiﬁcation of drug and endogenous compounds. In liver their role in bilirubin oxidation has been deeply demonstrated. In brain, there are many works that analyzed Cyps expression and induction, but their role in bilirubin oxidation has never been evaluated till now.

This thesis focused in; 1) analyze the inducibility of Cyps enzymes, by a known inducer, βNF in cortex and cerebellum astrocytes; 2) Select the optimal conditions to induce specifically each of them; 3) analyze their activity and 4) evaluate their capacity to oxidize bilirubin; 5) Last but not least, assess the protective effect of Cyps induction by challenging the cells with high concentrations of bilirubin. We demonstrated that astrocytes Cyps were inducible (both mRNA and activity) by βNF and this induction varies depending on the brain region and among the Cyps. To explain the differences we hypothesized the presence of: i) a different protein isoforms (discarded for Cyp1A1) ii) different maturation stage of astrocytes in the two brain regions (P2 rats: Cll is less developed than Cx), iii) differential regu- latory mechanisms. Our work showed that in Cx astrocytes Cyp1A1 induction (mRNA and activity) was an early event (6h), requiring low concentration of the drug, making this approach theoretically possible in vivo. On the other hand, to reach the higher levels of Cyp1A1 (mRNA and activity) in Cll we needed 24h. In both cases Cyp1A1 was able to oxidize bilirubin producing an increase in viability only after TCB addition. The Cyp1A2 was the major catalyst of bilirubin degradation (without the need of TCB), but its modulation was more difficult to be achieved. In addition, while Cyp1A2 modulation increased bilirubin oxidation in cortex (also reflected in an increment in viability), in cerebellum we noticed a slight reduction in bilirubin clearance (no improvements in viability). All this data could lead to the basis of the cerebellum susceptibility to UCB. The observation that the TCB addition in Cyp1A1 astrocytes increases bilirubin oxidation and viability suggest the possibility to induce Cll resistance toward bilirubin neurotoxicity by Cyps modulation and uncoupling. Riassunto

Una delle condizioni neonatali più comunie ` l’ittero. Esso rappresenta l’aumento fisiologico della bilirubina nel sangue e tessuti. Tuttavia esso può divenire una condizione patologica (encefalopatia da bilirubina), caratterizzata da un danno neurologico minimo, o condurre a una condizione severa e pericolosa per il neonato chiamata kernit- tero (danni permanenti), in caso di una esposizione prolungata ad alti livelli del pigmento. Attualmente, la patologia da iperbilirubinemia rappresenta la principale causa di riammissione in ospedale nel primo mese di vita.

Per il danno neurologico da bilirubina esiste un modello animale, il ratto Gunn, che presenta la stessa mutazione genica dei pazienti Crigler-Najjar I. Come nella condizione umana, esso manca della uridin di fosfo glucuronisil tranferasi 1a1 (Ugt1A1), enzima epatico deputato alla coniugazione della bilirubina. Tuttavia l’animale ri- esce a compensare la mancanza mantenendo bassi i livelli serici di bilirubina, grazie ad una incrementata attività delle citocromo P450 mono-ossigenasi epatiche (Cyps, Cyp1A1 and Cyp1A2). Tali enzimi riducono la concentrazione del pigmento attraverso la sua ossidazione. E` stato supposto che questo meccanismo possa essere alla base anche della capacità di specifiche aree del cervello (cortex e collicoli superiori, vs. i danneggiati cervelletto, ippocampo e collicoli inferiori) di ridurre la concentrazione del pigmento, limitando/impedendo il danno neurologico associato. Sebbene il loro ruolo, i meccanismi ed i prodotti della loro attività di clearance della bilirubina siano stati ampiamente dimostrati in fegato, in cervello non sono ancora disponibili evidenze funzionali della loro capacità di ossidare la bilirubina.

L’obiettivo di questa tesie ` stato di analizzare 1) la modulazione delle Cyps cerebrali (brain Cyp: bCyp) utilizzando un noto induttore, βNF; 2) selezionare le condizione ottimali per una induzione selettiva di cias- cuna bCyp; 3) allo scopo di valutare la loro attività (EROD/MROD); 4) e la capacità specifica di ossidare bilirubina; 5) conferendo pro- tezione (aumento vitalità) alle culture primarie di astrociti (da cortex e cervelletto) esposte a dosi tossiche di bilirubina. Questo studio ha dimostrato la inducibilità delle bCyps (mRNA e attività) tramite βNF. Abbiamo evidenziato una modulazione dipen- dente della regione cerebrale da cui sono state prodotte le cellule, in aggiunta ad un comportamento differenziale delle Cyps tra loro. Pos- sibili spiegazioni possono essere: i) la presenza di diverse isoforme tra le regioni (ipotesi scartata in seguito ad analisi tramite western blot); ii) diversa presenza delle vie di segnalazione alla base dei meccanismi di modulazione, o, iii) una diversa risposta dovuta al diverso stadio sviluppo degli astrociti preparati dalle due regioni (ratti P2: il Clle ` meno sviluppato del Cx). Inoltre, abbiamo documentato una precoce (6h) inducibilità della Cyp1A1 nei astrociti dal Cx, che inoltre necessità di minori concen- trazioni del principio. Tali caratteristiche suggeriscono che la Cyp1A1 sia più facilmente modulabile in vivo. Tuttavia, per ottenere una buona modulazione nel cervelletto (regione più sensibile al danno), bisogna mantenere la concentrazione dell’ induttore per un tempo lungo (24h). In entrambe le regioni, un incremento significativo della capacità di ossidare bilirubina, migliorando la vitalità delle cellule, e` stato ottenuto solo dopo il co-trattamento con TCB (disaccoppia- mento). La Cyp1A2 e` stata significativamente modulata solo negli astrociti da Cx (24h), in cui abbiamo evidenziato un chiara capacità dell’enzima di ossidare la bilirubina e migliorare la vitalità in assenza di TCB. I risultati ottenuti permettono di comprendere la suscettibilità differenziale (tra regioni del cervello) tipica di questa patologia. La capacità di indurre Cyp1A1 e renderli pronti a ossidare la bilirubina nei astrociti da Cll (regione più danneggiata) e Cyp1A1/Cyp1A2 in Cx e oltre migliorando la viabilità di questi suggeriscono la possibilità di conferire resistenza a la tossicità da bilirubina. This study was supported by a fellowship from the Italian Ministry of Foreign Affairs (MAE) in Rome, Italy. In particular, I would like to thank Dr. Paola Ranocchia.

i ii Contents

List of Figures vii

List of Tables ix

1 Introduction 1 1.1 Bilirubin ...... 1 1.1.1 Bilirubin metabolism ...... 1 1.1.2 Total, direct and indirect bilirubin in blood ...... 3 1.1.3 The free bilirubin theory ...... 4 1.1.4 Bilirubin in newborns ...... 5 1.1.5 Disorders of Bilirubin metabolism ...... 6 1.1.5.1 Disorders leading to unconjugated hyperbilirubinemia ...... 6 1.1.5.2 Disorders leading to conjugated hyperbilirubinemia8 1.1.6 Bilirubin Neurotoxicity ...... 9 1.1.7 Current treatments ...... 11 1.1.8 Animal models of bilirubin encephalopathy ...... 14 1.2 Brain ...... 16 1.2.1 Cerebellum and cerebral cortex ...... 16 1.2.2 Astrocytes cells ...... 17 1.3 Cyotochrome P450 enzymes ...... 19 1.3.1 Cytochrome P450 enzymes in liver ...... 20 1.3.2 Cyotochrome P450 enzymes in brain ...... 22

iii CONTENTS

2 Aims of the project 25 2.1 Aims ...... 25

3 Matherial & Methods 27 3.1 Chemicals and reagents ...... 27 3.2 Culture and treatment of Huh7 and HepG2 cells ...... 28 3.3 Animals ...... 29 3.4 Brain dissection, primary astrocytes culture ...... 29 3.5 UCB solutions and Bf measurements ...... 30 3.6 Astrocytes treatment conditions ...... 32 3.7 Viability tests ...... 32 3.8 Real-time RT-PCR ...... 33 3.9 Membrane fraction preparation ...... 35 3.10 Enzymatic assays ...... 35 3.11 Bilirubin disappearance activity ...... 36 3.11.1 TCB addition ...... 37 3.12 Western blot ...... 37 3.13 Statistical analysis ...... 38

4 Results 41 4.1 Hepatic cell culture ...... 41 4.1.1 Huh7 mRNA Cyps inducibility by βNF ...... 41 4.1.2 HepG2 mRNA Cyps induction by βNF ...... 45 4.1.3 EROD/MROD activity ...... 47 4.2 Astrocyte primary culture ...... 48 4.2.1 GFAP staining ...... 48 4.2.2 Cyps constitutive expression ...... 48 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF . . 50 4.3.1 Astrocytes βNF treatment ...... 50 4.3.2 Viability assays ...... 51 4.3.3 Cyps mRNA inducibility ...... 51 4.3.3.1 Cortex derived astrocytes ...... 51 4.3.3.2 Cerebellum derived astrocytes ...... 54

iv CONTENTS

4.3.4 Optimal condition for selective Cyps enzyme activity analysis 55 4.3.5 EROD and MROD activity ...... 55 4.3.5.1 Cortex derived astrocytes ...... 57 4.3.5.2 Cerebellum derived astrocytes ...... 58 4.3.6 Speciﬁcity of EROD/MROD activity ...... 61 4.4 Bilirubin Oxidation ...... 62 4.4.1 Bilirubin Oxidation in βNF induced astrocytes ...... 62 4.4.1.1 Cortex derived astrocytes membrane fraction . . 62 4.4.1.2 Cerebellum derived astrocytes membrane fraction 63 4.4.2 Bilirubin Oxidation by βNF induced astrocytes with TCB 63 4.5 Viability challenge ...... 64 4.5.1 Treatments with βNF (with or without TCB) and bilirubin 64 4.5.1.1 Cortex derived astrocytes ...... 64 4.5.1.2 Cerebellum derived astrocytes ...... 65 4.6 Cyps inducibility and activity by UCB ...... 66 4.6.1 Cyps mRNA expression ...... 66 4.6.2 Viability tests ...... 68 4.6.3 EROD and MROD activity ...... 68 4.6.4 Additional controls under excluded conditions ...... 68 4.7 Additional results ...... 72 4.7.1 Protein analysis ...... 72 4.7.2 Signaling ...... 72

5 Discussion 77

6 Conclusions 83

7 Publications 85

References 89

v CONTENTS

vi List of Figures

1.1 Heme degradation...... 2 1.2 Hepatic metabolism of bilirubin...... 4 1.3 Jaundice in newborn...... 6 1.4 Phototheraphy...... 13 1.5 Blood exchange transfusion...... 14 1.6 Sagital diagram of the rat brain ...... 17 1.7 The cytochrome P450 catalytic cycle...... 21

3.1 Morphology of Huh7 cells...... 28 3.2 Morphology of HepG2 cells...... 29 3.3 Morphology of Astrocytes derived from Cerebellum...... 31 3.4 Morphology of Astrocytes derived from Cortex...... 31

4.1 mRNA expression in Huh7 treated βNF...... 42 4.2 Viability percentage in Huh7...... 45 4.3 mRNA expression in HepG2 treated with βNF...... 46 4.4 EROD and MROD activity assays in treated HepG2...... 47 4.5 Representative immunostaining of rat Astrocytes...... 49 4.6 Constitutive mRNA expression of Cyps astrocytes from Cx and Cll. 50 4.7 Viability of Cx and Cll astrocytes treated with βNF...... 52 4.8 mRNA inducibility in Cx astrocytes treated with βNF...... 53 4.9 mRNA inducibility in Cll astrocytes treated with βNF...... 56 4.10 EROD and MROD activity in cells under the optimal condition for Cyp1A1...... 60

vii LIST OF FIGURES

4.11 EROD and MROD activity in cells under the optimal condition for Cyp1A2...... 61 4.12 Bilirubin viability challenge in cortex ...... 65 4.13 Bilirubin viability challenge in cerebellum ...... 66 4.14 mRNA relative expression of Cx and Cll astrocytes treated with UCB...... 67 4.15 EROD and MROD activity in Cx and Cll astrocytes treated with UCB...... 69 4.16 Western blot analysis of Cyp1A1 ...... 72 4.17 Ahr and Nrf2 mRNA constitutive expression in Cx and Cll astrocytes 73 4.18 Ahr mRNA relative expression in Cx and Cll astrocytes treated with βNF...... 74 4.19 Nrf2 mRNA relative expression in Cx and Cll astrocytes treated with βNF...... 75 4.20 Ahr and Nrf2 mRNA relative expression in astrocytes treated with UCB...... 76

viii List of Tables

3.1 mRNA designed primers ...... 39

4.1 Stadistic analysis of Huh7 mRNA treated with BNF ...... 43 4.2 Viability percentage of HepG2...... 46 4.3 Stadistic analysis of Cx astrocytes mRNA ...... 54 4.4 Stadistic analysis of Cll astrocytes mRNA ...... 57 4.5 Optimal conditions of Cx and Cll astrocytes ...... 59 4.6 Bilirubin oxidation initial rate by induced Cyps ...... 70 4.7 Viability percentage of astrocytes treated with UCB...... 71

ix Abbreviations

• ABC ATP-binding cassette

• BBB Blood brain barrier

• Bf Free unbound plasma bilirubin

• βNF β-naphtoﬂavone

• BR Bilirubin

• CB Conjugated bilirubin

• Cll Cerebellum

• CNS Central nervous system

• CNS -I -II CriglerNajjar syndrome Type I or II

• Cyps Cytochrome P450 enzymes

• Cx Cortex

• FVX Fluvoxamine maleate

• GFAP Glial ﬁbrillary acidic protein

• NADPH Nicotinamide-adenine dinucleotide phosphate

• ROS Reactive Oxygen species

• TBS Total serum bilirubin

• TCB 3,4, 3’,4’tetrachlorobiphenyl

• UCB unconjugated bilirubin

• UGT1A1 UDP-glucuronosyltransferases1A1 1

Introduction

1.1 Bilirubin

Bilirubin (BR) consists of an open chain of four pyrrole-like rings (tetrapyr- role) and is the end product of catabolism of the heme group present in hemoglobin, myoglobin and some cellular enzymes.

1.1.1 Bilirubin metabolism

80% of the bilirubin produced in human body derives from heme catabolism liberated from senescent red cells, 15-20% from turnover of myoglobin, cytochromes and other hemoproteins, and ﬁnally less than 3% from destruction of immature red blood cells. This breakdown generates between 250 and 400mg of the pigment daily in humans (85, 101). The heme group is broken by the heme oxygenase (HO-1) enzyme. The reaction to proceeds requires nicotinamide-adenine dinucleotide phosphate (NADPH) as reducing agent and three molecules of oxygen. This reaction require a complex series of oxidations and reductions, ultimately breaking the methane bridge in heme releasing carbon monoxide (CO) and ferrous iron (Fe+2) and biliverdin (128, 136). The next step is the conversion of biliverdin to bilirubin by the cytosolic biliverdin reductase enzyme (BVR), in the presence of NADPH (Fig. 1.1).

1 1. INTRODUCTION

The bilirubin formed in the various tissues eﬄux into blood serum (138). As it is water insoluble, unconjugated bilirubin (UCB) binds tightly to albumin (but reversible) and is transported to the liver where is removed from the plasma. The binding to albumin protects against toxic eﬀects of bilirubin.

Figure 1.1: Heme degradation. Microsomal heme oxygenase catalyzes the rate limiting step in heme metabolism. (Adapted from Ryter et.al (115))

The hepatic parenchyma absorbs the BR from the serum, the excact mechanism of UCB uptake is unknown; however, passive diﬀusion seems to be combined with intracellular carrier proteins such as ligandin (glutathione-S-transferase, OATP) facilitating the intracellular hepatic transport of BR (44, 130, 148). In the liver, UCB interacts mainly with several detoxifying enzymes such as glutathione- S-transferases (GSTs) and UDP-glucuronosyltransferases (UGTs). Unconjugated bilirubin is taken up by hepatocytes binds to cytosolic isoforms of GST (mainly

2 1.1 Bilirubin alpha, named ligandin), which maintains the gradient of free UCB, facilitates the UCB transfers to the endoplasmic reticulum, limiting the efflux from the cell, and protect hepatocites despite the high concentration that the pigment may reach in this organ (44, 149). The main pathway of bilirubin detoxication in the liver is the conjugation with glucuronic acid (one or two molecules). It is catalyzed by the uridine diphosphoglucuronate glucoronosyltransferase enzyme (UGT1A1) in the endoplasmic reticulum forming mono and diglucuronides, knowns as conjugated bilirubin (CB) (18, 57, 67). This pathway leads to the production of more water soluble metabolites which are transported into the bile by ATP-dependent transporter identified as the multidrug resistance-associated protein MRP2/cMOAT and, to a lesser extent, also by ATP-binding cassette (ABC) efflux transporter ABCG2 (69, 130) (Fig. 1.2). Recent studies have shown that under physiologic conditions, a fraction of the conjugated bilirubin in the liver is not excreted into bile but is transported back to the blood. OATP1A/1B activity in a downstream hepatocyte allows an efficient take back of this CB for final biliary excretion (62, 63, 138). The process is mediated by sinusoidal transporters MRP3 (ABCC3) and organic anion-transporting polypeptides OATP1B1 and OATP1B3. In addition, this OATP1B proteins mediate hepatic clearance of bilirubin conjugated in viceral organs and may be an important alternative pathway in enterohepatic circulation (138). In the colon, the glucuronide residues of CB are released by bacterial hydro- lases and the pigment is oxidize to urobilinoids, mostly excreted by feces. A small proportion of UCB is reabsorbed returning to the liver and secreted again to the bile (106).

1.1.2 Total, direct and indirect bilirubin in blood

In blood, the total bilirubin (TBS) is formed by three principals forms: albumin bound unconjugated bilirubin (A-UCB), conjugated bilirubin (direct bilirubin, CB) and unbound unconjugated bilirubin (free bilirubin; Bf). The Bf represents less than 0.1% of the pigment in normal condition (6, 144).

3 1. INTRODUCTION

Figure 1.2: Hepatic metabolism of bilirubin. Brieﬂy, Bilirubin is transported to hepatocyes by facilitated diﬀusion and OATP1A/1B transporters. Within the hepatocytes bilirubin binds to GSTs. Bilirubin is converted to mono or di-glucuronide by UGT1A1. Finally, Conjugated bilirubin (CB) is actively transported into bile by MRP2 or ABCG2.

The measure of TBS is usually performed by the diazo method. Brieﬂy, bilirubin is coupled with diazotized sulphanilic acid in acidic medium to form the pink colored azobilirubin. The intensity of the color produced is directly proportional to total bilirubin (CB and the two form of UCB, A-UCB and Bf) concentration present in the sample (35, 36).

1.1.3 The free bilirubin theory

Clinically, laboratory measurements of unbound circulating bilirubin is not generally available and the B/A ratio is used to extrapolated it level. If the amount of bilirubin does not exceed the albumin binding capacity (B/A ratio less than 1) the maximal amount of UCB is bound to albumin (435µM; 25mg/dL; (19)). If UCB concentration is higher than the binding capacity (B/A ratio more than 1), the amount of Bf rises. In this conditions, the UCB (that is lipophilic) can passively diffuse across the membranes and accumulates into the tissues (34, 102, 148). The proportion of free UCB depends not only to the presence of albumin but also its binding affinity constants. In newborn, the albumin affinity

4 1.1 Bilirubin constant for bilirubin (α-fetoprotein) is lower compared to adults (HSA) (102). Moreover, some drugs or competitor substance, commonly used in neonates, can modiﬁed the binding aﬃnity(112). Considering the above statements, the Bf measure by B/A ratio is an aproximative method.

1.1.4 Bilirubin in newborns

In utero, the excretory function of UCB is limited to the active transport from the placenta to the maternal circulation (123). At birth, the newborn, now without the placental protection, has to deal with an increase in catabolism of red cell hemoglobin to UCB loading the liver. In addition, neonates lack of anaer- obic ileo-colonic ﬂora that convert UCB into urobilinogens, thus increasing the enterohepatic circulation of UCB (32). Moreover, delayed maturation of hepatic transport processes and glucuronidation ability results in signiﬁcant retention of UCB even in healthy babies (50, 102). All this lead to a plasma bilirubin peak approximately 1 week of after birth and then return to normal. The average full-term infant has a peak serum bilirubin concentration of 5 to 10 mg/dL (86 to 170 µM). After a month, the processes of uptake, storage, conjugation and biliary secretion of bilirubin should be matured to near adult levels (≤1-2mg/dL) (50). Neonatal physiological jaundice may be aggravated by a combination of: augmented bilirubin production (e.g. haemolysis), increased enterohepatic circulation of UCB, hereditary defects, prematurity or abnormal maturation of the hepatic conjugation mechanism (68, 72, 86, 129). In addition, nowadays, early discharge from hospital (before bilirubin peaks) could lead to brain damage (Fig. 1.3) (11, 93). If blood bilirubin concentrations is not properly supervised and family lack of knowledge about bilirubin potential damage may turn out in high bilirubin brain concentration and produce bilirubin induced neurologic dysfunction (BIND).

5 1. INTRODUCTION

Figure 1.3: Jaundice in newborn. (taken from A.D.A.M. encyclopedia)

1.1.5 Disorders of Bilirubin metabolism

1.1.5.1 Disorders leading to unconjugated hyperbilirubinemia

Bilirubin encephalopathy

Bilirubin encephalopathy (bilirubin induced neurologic dysfunction; BIND) occurs when the pigment rises and accumulates in the body and brain (UCB surpass the blood brain barrier (BBB)) (128). This condition is caused by mod- erated levels of hyperbilirubinemia (200-300µM; 11.7 mg/dL). In general, BIND is a reversible event, particularly at the early stages. The spectrum of mani- festations varies from acute bilirubin encephalopathy to chronic sequelae. Mild stages present hypotonia, lethargy, poor sucking and abnormal brainstem auditory evoked potentials (BAEPs). With more severe or prolonged jaundice hyper- tonia, opisthotonus, a high-pitched cry, impairment of up gaze, fever and wors- ening the BAEPs can be observed. Irreversible neurological signs may develop principally when no treatment was promptly applied. They account for sub- tle deﬁcits, including delay in motor development, impaired cognitive function and auditory dysfunction, to more severe motor auditory, and cognitive disorders (65, 79, 102, 125).

6 1.1 Bilirubin

Several studies reported that there are some points of decrease in de IQ score between high and low levels of bilirubin. Of course the cause-reltaion is debated due to the inﬂuence others factors, like family, social, stress, educational (65). Commonly, phototherapy is the preferred treatment, but when do not response clinicians opt for the exchange transfusion and albumin infusion (54).

Kernicterus

The kernicterus nowadays is referred to the selective damage to globuls pal- lidus, substantia nigra, subthalamic nucleus, brainstem auditory, vestibular and oculomotor nuclei, hippocampus and cerebellum. Some abnormalities can be seen in magnetic resonance imaging scans (MRI), presenting loss of neurons demyeli- nation and gliosis. This is characteristic in infants that suﬀer the irreversible sequelae of the acute bilirubin encephalopathy (ABE). The common sequelae include abnormal motor control, movements and muscle tone; auditory abnormalities (that include auditory neuropathy/dys-synchrony (AN/AD)) which may or not be accompanied by deafness; oculomotor impairments such upward gaze abnormalities; and dysplasia of the enamel of deciduous teeth (65, 125).

Crigler-Najjar syndrome

The CriglerNajjar syndrome (CNS) was ﬁrst described in 1952 by Crigler and Najjar (24). Is a rare genetic disorder (one in a million neonates) that cause by persistent unconjugated hyperbilirubinemia. The UGT1A genes alteration are responsible for the disruption of the metabolic pathway, inherited in an autosomal recessive manner.

Type I (CNS-I) is the most severe type, characterized by a complete loss of bilirubin glucuronidation. They present mutations within the exons 2, 3 and 4 of the UGT1A gene locus, aﬀecting all transcripts (hepatic and extra hepatic) (131). Serum bilirubin levels range from 15 to 50mg/dL and, if untreated with exchange transfusions and daily phototherapy, may result in permanent neurological dam-

7 1. INTRODUCTION age or even to death. Currently, as patients lack of response to phenobarbital treatments, liver transplantation is the only deﬁnitive cure (116, 139).

In Type II (CNS-II), individuals have a partial function of the UGT1A (30% of normal the activity)(17). Even though it is compatible with normal life span, the absence of prompt suspicion and proper management can prove fatal not only in the neonatal period but also in the adult life. The bilirubin levels are lower compared to CNS-I (between 10-20mg/dL), and patients respond to phenobarbital that induce the residual UGT1A1. In animal model also the alternative oxidative mechanism by the Cytochrome P450 enzymes (see section 1.3) is activated, reducing bilirubin levels. In some patients, phototherapy is also used in conjunction with phenobarbital (84).

Gilbert Syndrome

The syndrome is characterized by a mild ﬂuctuating hyperbilirubinemia occurring in the absence of hemolysis or liver disease. Mild icterus is the only abnormal physical ﬁnding in Gilberts syndrome (GS). Genetically, this syndrome is due to a TATA-box polymorphism in the UGT1A1 promoter (most common insertion of

TAn) (116). The frequency for homozygosity for the (TA)7 in normal population is 10-16%. Serum bilirubin concentrations in GS are usually ≤ 3mg/dL. This syndrome requires no treatment and does not lead to hepatic damage (131).

1.1.5.2 Disorders leading to conjugated hyperbilirubinemia

Dubin-johnson syndrome

The Dubin-Johnson syndrome is a hereditary deﬁciency in the excretion of conjugated bilirrubin by hepatocytes characterized by chronic hyperbilirubinemia, alteration in coproporphyrin metabolism, and intracellular deposition of a dark melanin-like pigment giving the liver a typical black cast (16). Genetically,

8 1.1 Bilirubin patients have altered ATP-dependent transporter ABCC2 (non sense mutation) expression, so the biliary excretion of organic anions is impaired (except for bile acids). Bilirubin glucuronides reﬂux into blood producing conjugated hyperbilirubinemia. Total bilirubin serum reaches between 2 and 5 mg/dL (very rarely up to 20 mg/dL). Patients present normal liver enzymes values, blood count, lipids and serum albumin and no risk of ﬁbrosis or cirrhosis development (131).

Rotor syndrome

Rotor syndrome is a rare, benign familial disorder characterized by chronic ﬂuctuating, nonhemolytic and predominantly conjugated hyperbilirubinemia with normal hepatic histology (66). In contrast to Dubin-Johnson syndrome, there is no liver pigmentation. It seems that patients have impaired hepatocellular storage of conjugated bilirubin, resulting in a reﬂux into the plasma (131).

1.1.6 Bilirubin Neurotoxicity

To clarify the physiological relevance of the molecular mechanism by which bilirubin induce neurotoxicity, it is important to understand the particulars of the bilirubin exposure itself and to relate that exposure to central nervous system (CNS) injury likely to occur. It is suggested that the risk for neurological damage is related to the degree and duration of hyperbilirubinemia (128).

In the previous sections the physiological metabolism of bilirubin was described, the diﬀerent ligands of the molecule and the disorders that could be observed. In this section the molecular mechanism of bilirubin neurotoxicity are being detailed. The initial injury observed is principally the perturbations of membrane permeability and function, followed by mitochondrial energy failure and increase intracellular calcium concentration. All this can proceed to the activation of proteolytic enzymes and ﬁnally resulting in apoptosis or necrosis depending on the degree of the injury (141).

9 1. INTRODUCTION

The strong affinity of UCB to membranes could result in a conformational change in the N-methyl-D-aspartate glutamate receptor (NMDA), altering the glutamate uptake (excessive release and impaired reuptake) over-stimulating the receptor (excitotoxicity) (51, 59). Once NMDA channels are opened, it leads to increased intracellular Na+ and Cl−, followed by a Ca+2 influx and Ca+2 release from intracellular stores producing the activation of Ca+2-dependent enzymes that activate apoptosis (by caspase 3) and/or necrosis cell death pathways (20, 111, 142). There are some controversy about which mechanism occur first. It hes been proposed that the mitochondrial energy failure with a resultant neuronal depolarization opens the NMDA glutamate channels (99). Others, instead, consider that UCB may act directly on the neuronal cell membrane and mitochondria to perturb lipid polarity, fluidity, and protein order conducing to collapse of membrane potential, release of Cytochrome-c and activation of intrinsic apoptosis mechanisms independent of excitotoxic pathways (76, 114, 141).

Bilirubin neurotoxicity is selective, certain areas of the brain and certain cell types within these regions are more affected than others. The most vulnerable regions are the basal ganglia, hippocampus, cerebellum and cochlear nuclei. The selective affinity of bilirubin for those brain sites is uncertain. The local blood flow is homogeneous in both human and rodent during the early postnatal development and is not correlated to the regional susceptibility to UCB (48). Some possible explanations could be the differences in lipid composition in these areas (21), accumulation and clearance of UCB (44) and/or immature state of the cells in these areas. It has been demonstrated that immature neural cells (astrocytes and neurons) are more susceptible to UCB damage compared to more differentiated ones. Moreover, among the cell types neurons are more prone to bilirubin induced cell death, displaying low inflammatory response, whereas astrocytes are more competent in releasing glutamate and pro-inflammatory (NF-κβ, TNF-α, Il-β and IL-6) mediators (38).

10 1.1 Bilirubin

1.1.7 Current treatments

Phototherapy is the therapy widely used for hyperbilirubinemia to transform UCB in the skin to water-soluble isomers, cleared without the need of liver conjugation (Fig. 1.4) (13). The efficacy of phototherapy units varies widely because of differences in light source and configuration. The characteristics of the devices to contribute to its effectiveness are: the emission of light in the blue-to-green range that overlaps the in vivo plasma bilirubin absorption spectrum (≈ 460 - 490 nm); the irradiance of at least 30µW.cm−2.nm−1 (confirmed with an appropriate irra- diancemeter calibrated over the appropriate wavelength range); the illumination of maximal body surface (changing the infants posture every 2 to 3 hours may maximize the area exposed to light.); and the demonstration of a decrease in total bilirubin concentrations during the first 4 to 6 hours of exposure (should decrease more than 2mg/dl in serum bilirubin concentration). The initiation and duration of phototherapy is defined by the specific range of total bilirubin values based on an infant’s postnatal age and the potential risk for bilirubin neurotoxicity.

The clinical response depends on the rates of bilirubin production, enterohepatic circulation, and bilirubin elimination and the degree of tissue bilirubin deposition (135). Moreover, the neonates clinical status during phototherapy should be followed to ensure adequate hydration, nutrition, and temperature control. Currently, the administration of albumin prior to phototherapy producing im- mediate reduction in serum UCB values was also assessed (25, 60). If the UCB concentrations becomes dangerously high or rise rapidly despite phototherapy, exchange transfusion (ET) is indicated.

Nowadays, ET has become a rare event in most developed countries. How- ever, it remains as a frequent emergency rescue procedure for severe neonatal hyperbilirubinemia in many underdeveloped regions of the world (Fig. 1.5) (98). Exchange transfusions should lower the blood bilirubin levels sufficiently, quickly and safely, but also have serious side effects and complications. The mortality rate in the 80-90’s from the procedure was approximately 0.3-2.0% and signifi-

11 1. INTRODUCTION cant morbidity was associated with 5-12% of ETs. Complications include cardiac arrest, thrombosis of the portal vein, graft vs. host disease, coagulopathies, hy- poglycemia, hypocalcaemia, necrotizing enterocolitis, transmission of infectious diseases, bleeding, catheter-related complications, apnea and bradycardia with cyanosis requiring resuscitation (64, 75, 104). Conventionally, exchange transfusion has been performed via a central umbilical venous catheter by pull-push cycle method. Recently peripheral artery/peripheral vein has emerged as an alternative, isovolumetric route (Fig. 1.5). The procedure involves incremental removal of the infants blood having high bilirubin levels and simultaneous replacement with fresh donor blood providing fresh albumin with binding sites for bilirubin. Ideally, the infants total circulating blood volume needs to be repaced to have an eﬃcient ET. Some procedures use 80-90 ml/kg (the estimated blood volume in a newborn) of donor blood, termed as single-volume blood exchange transfusion (SBVET), others use the doble volume (160-180 mL/kg), double-volume blood exchange transfusion (DBVET). On the basis of the time constant of the exchange an SVET is likely to exchange 63% of the infants blood whereas DVET exchanges 86%. However, because of tissue intravascular dynamics, more bilirubin is removed from the infant than the blood volume exchanged during ET (98). Furthermore, an alternative to classical ET is to add albumin before ET to increase the reserve of albumin providing more binding sites for UCB. However, this is not yet of routine clinical use as the risk of albumin administration has not been assessed (92, 124).

New therapies are being developed to treat or prevent newborn of kernicterus. Metalloporphyrins (Mps) have been assessed as possible compounds to reduce bilirubin levels in blood. They are structural analogs of heme and their potential use in the management of neonatal hyperbilirubinemia has been the subject of considerable research for more than three decades. They are competitive inhibitors of heme oxygenase (HO), limiting the enzyme activity in bilirubin production and effectively reduce bilirubin formation. Ongoing research continues in identifying the ideal metalloporphyrins, which are safe and effective, by defining the therapeutic windows and targeted interventions for the treatment of excessive neonatal hyperbilirubinemia. Although Mps have been studied extensively

12 1.1 Bilirubin in animal models and some human trials, their safety has not been unequivocally proven yet, mainly due to the photosensitizing potential of these compounds (120, 143).

Minocycline, a neuroprotective agent, is effective in neurological disorders associated to the oxidative stresss and inflammation. The drug is an anti-inflammatory and anti-apoptotic semisynthetic tetracycline that inhibits the microglia activation, reducing also for example the cerebellar hypoplasia in Gunn rats (46, 82, 109). However, minocycline has several side effects such gastrointestinal symp- toms, pediatric tooth discoloration, dizziness (127).

In addition, Brites group has widely studied the effect of glycoursodeoxycholic acid, showing its anti-apoptotic, antioxidant and anti-inflammatory effects in neural cells (126, 140). Moreover, taurine is another compound of potential interest as a possible anti-inflammatory, anti-apoptotic molecule to treat or prevent bilirubin neuronal damage (146).

Figure 1.4: Phototheraphy. Neonatal jaundice is usually a self-limiting, mild disorder. The most commonly used treatment is ﬂuorescent light exposure, in which the infant is placed under a lamp for a few hours each day. The blue light breaks down bilirubin into a form the infant liver can process and eliminate (taken from A.D.A.M. encyclopedia).

Even there are many diﬀerent therapies an important point could be mis- leading. The decrease of bilirubin in blood may not represent the decrease of

13 1. INTRODUCTION

Figure 1.5: Blood exchange transfusion. Briefly, the infant is laid on his or her back, usually under a radiant warmer. The umbilical vein is catheterized with a fluid-filled catheter. The catheter is connected to an exchange transfusion set, incorporating lines to and from a waste container and a pack of donor blood. The ET goes ahead in cycles, each of a few minutes duration. Slowly the infant’s blood is withdrawn, and the fresh, pre-warmed blood or plasma is injected (taken from A.D.A.M. encyclopedia). bilirubin in tissues, particularly in brain (the reservoirs). There is a dynamical balance between bilirubin concentration in blood and tissues due to reversible diffusion of bilirubin between them. High levels of bilirubin in blood leads to a high bilirubin concentration in tissues and viceversa - low level of bilirubin in blood results in bilirubin counterblow from tissues to blood. This continue until the balance between these two bilirubin is reached (within 5-6 hours) (13). Considering what mentioned above, bilirubin could continue damaging the brain during this gap of time. Because of that, therapies that focus on brain bilirubin clearance/protection should be studied.

1.1.8 Animal models of bilirubin encephalopathy

Two rodents models of hyperbilirubinemia and kernicterus exist. The ﬁrst one is the Gunn rat that emerged spontaneously in the late 1936 in a wistar rat colony

14 1.1 Bilirubin

(52). The Gunn rat is characterized by a Ugt1A single base deletion, causing a frameshift mutation, leading to a stop codon and has been used as animal model of Crigler- Najjar type I syndrome and neonatal jaundice (22, 121).

Morphologically, the brain is aﬀected almost selectively in jj rat. The hippocampus, all basal ganglia, and most brain stem nuclei are damaged in hiper- bilirubinemic, with a distribution similar of what seen in humans (121). In contrast to human kernicterus, cerebellar hypoplasia is a prominent feature of bilirubin damage in Gunn rat, detected in rarely in babies and quite exclusively in preterms (23, 117, 121).

It has been suggested a developmental dependence of cerebellar hypoplasia in

Gunn rat (principally Purkinge cell and granular lost) (23, 117). It is known that cerebellum develops after the birth (34), and that cerebellar hypoplasia in jj rat begins largely after 8 post-natal days (23), consistent with the critical period for bilirubin-induced cerebellar hypoplasia identiﬁed at P6-10 (110, 117, 134). The principal characteristic of this model could be correlated with hyperbilirubinemic pre-term newborns (4, 12).

The second one is the mouse model, created by introducing the stop codon in the Ugt1A1 gene (15). This mice also present a cerebellar architecture aﬀected by bilirubin toxicity, with reductions in Purkinje cell number and dendritic arboriza- tion. Even both models have similar gene defect, they behave very diﬀerently.

Mutant mice die within 10 days, whereas Gunn rat pups survive.

15 1. INTRODUCTION

1.2 Brain

1.2.1 Cerebellum and cerebral cortex

The central nervous system consists of the brain and spinal cord, while the peripheral system consists of all the neural (nerve) tracts that lie outside these central tissues and connect the rest of the body. The human brain weights between 1200 a 1400gr in adults, while 350-400gr in newborns. It consists of three major divisions: 1) the massive paired hemispheres of the cerebrum; 2) the brain-stem, consisting of the thalamus, hypothalamus, epithalamus, subthalamus, midbrain, pons, and medulla oblongata, and 3) the cerebellum (Fig. 1.6). Due to the complexity of the whole brain structure that deﬁne each region, we only focus our attention on the description of the areas considered as target for our study, the cortex and cerebellum.

Cerebellum (“little brain”), is located at the base of the brain that lies above the brain-stem. It regulates a range of functions including motor control, attention and cognition. The gross anatomy of the cerebellum is characterized by transverse fissures of different depths, which subdivide the cerebellum into lobes, lobules and folia (leaflets). The cerebellum is covered with a cortex; its central white matter contains the cerebellar nuclei. The structure of the cerebellar cortex appears to be uniform throughout the cerebellum. The cortex has a very complex structure, being made up of many different kinds of neurons, but it appears to be composed of only three layers. The main neurons of the cerebellar cortex are the Purkinje cells and the granule cells. With regard to Purkinje cells, they form structures subdivided into multiple paired, narrow longitudinal zones, and are orientated perpendicularly to the parallel fibres. The other types, the granular cells, are small, extremely abundant and located in the granular layer, underneath the Purkinje cells. Astrocytes are estimated to comprise only the 20% of cells in the cerebellum, while neurons represent the 80% (58, 108).

16 1.2 Brain

The cerebral cortex is the outermost layered structure of neural tissue of the brain, is divided into two cortices, covering the left and right cerebral hemispheres. The cerebral cortex plays a key role in memory, attention, perceptual awareness, thought, language, and consciousness. It consists of up to six horizontal layers, each with a diﬀerent composition in terms of neurons and glial cells. It is important to note that the cortical layers are not simply stacked one over the other. A characteristic connections between diﬀerent layers and neuronal types exists, which span all the thickness of the cortex. The two principal types of neurons that are present in cortex are the excitatory pyramidal neurons (≈80% of neocortical neurons) and inhibitory interneurons (≈20%). The neurons are also arranged in vertical structures called neocortical columns, each column typically responds to a sensory stimulus representing a certain body part or region (97, 108).

Figure 1.6: Sagital diagram of the rat brain (Taken from http://www.livescience.com/29365-human-brain.html)

1.2.2 Astrocytes cells

Astrocytes are a type of glial cells; they are star shaped, multifunctional and indispensable for neuronal survival and function. They provide the migratory scaﬀold for neurons; represent the major source of extracellular matrix proteins, adhesion molecules and glycogen. Also, they contribute to the formation and

17 1. INTRODUCTION preservation of a secure blood-brain barrier (BBB). Astrocytes control ionic and osmotic homeostasis, remove neurotransmitters from the synaptic cleft, and produced a variety of tropic factors. They have important roles in development and plasticity of the central nervous system by modifying the growth of axons and dendrites, and regulating synapse formation (94). In most instances, protoplasmic astrocytes predominate in gray matter and fibrous astrocytes are most common in white matter. The first ones processes contact blood vessels and form multiple contacts with neurones. The fibrous ones have long, thin, less branched processes. Another group are the radial glial cells, which are bipolar cells each with an ovoid cell body and elongated processes. Radial glia are a common feature of the developing brain, which assist in neuronal migration. After maturation, disappear from many brain regions and transform into stellated astrocytes. The cerebellum contains specialized semi-radial glia called Bergmann glia. They have relatively small cell bodies and 3-6 processes that extend from the Purkinje cell layer to the pial surface. The processes of Bergmann glial cells are extremely elaborated, and they form close contacts with synapses formed by parallel fibres on Purkinje neuron dendrites; each Bergmann glial cell provides coverage for up to 8000 of such synapses. Furthermore, the velate astrocytes are found in the cerebellum, where they form a sheath surrounding granule neurones; each velate astrocyte enwraps a single granule neurone. In cortex a particular type of astrocytes are present, the interlaminar astrocytes (observed in higher primates) that are small glial cells, similar to protoplasmic astrocytes. Their characteristic peculiarity is a very long single process, reside in the upper cortical layers, and extend long GFAP positive processes through cortical layers 2-4 (77). The amount of glial cells in cortex is higher compared to cerebellum that contain more neurons (9).

These cells may have either a neuroprotective or a neurotoxic role, leading the destiny of the neurons. Injuries in astrocytes function have been recognized as highly contributing to neuronal dysfunction (7). Astrocytes are known to be a heterogeneous cell population based on their morphology and the expression of diﬀerent sets of receptors, transporters, ions channels and other proteins (43, 87). Similarly to neurons, astrocytes exhibited an age-dependent sensitivity to UCB toxic eﬀects (38).

18 1.3 Cyotochrome P450 enzymes

As these cells could modulate the vulnerability of neurons to injury (39, 143). Astrocytes should be considered one of the targets when searching for novel ther- apeutics for preventing neurological sequelae by UCB.

1.3 Cyotochrome P450 enzymes

Cytochrome P450 enzymes (Cyps) are heme-containing superfamily that catalyze the detoxiﬁcation and bioactivation of a wide range of xenobiotics and endogenous compounds such as antibiotics, steroid, fatty acids, vitamins, among others. Heme proteins contain the heme prostatic group consisting of a Fe+2 (ferrous) ion in the centre of a porphyrin, a large heterocyclic organic ring made up of four pyrrolic groups joined together by methene bridges. The heme iron serves as a source or sink of electrons during electron transfer or redox chem- istry. These enzymes are potent oxidants that are able to catalyze several reactions such hydroxylation of saturated carbon-hydrogen bonds, the epoxidation of double bonds, the oxidation of heteroatoms, dealkylation reactions, oxidations of aromatics, and so on (26, 88). The principal mechanisms induced by xenobiotics are monoxygenation and uncoupled activity. The ﬁrst mechanism the

NADPH/O2 stoichiometry is 1 instead the second the ratio is 2. Moreover, the latter mechanism the molecular oxygen is fully reduced presumably to water (Fig. 1.7).

These enzymes are present in all organism including viruses. Genes encoding Cyp enzymes, and the enzymes themselves, are designated with the abbreviation Cyp, followed by a number indicating the gene family, a capital letter indicating the subfamily, and another numeral for the individual gene. The conven- tion is to italicize the name when referring to the gene. For example, CYP1A1 is the gene that encodes the enzyme CYP1A1 (all capital letters for human, in rodents the ﬁrst letter in uppercase and the remaining letters in lowercase).

19 1. INTRODUCTION

The current nomenclature guidelines suggest that members of new Cyp fami- lies share ≥40% amino acid identity, while members of subfamilies must share ≥55% amino acid identity (http://drnelson.uthsc.edu/CytochromeP450.html and http://www.cypalleles.ki.se/).

Cytochromes P450 play a central role in the Phase I metabolism of drugs and other xenobiotics induced by Aryl hydrocarbon receptor (AhR) (53, 78). The AhR bind to many compound such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), 3-Mehtylcholathrene (3-MC), β-naphtoﬂavone (βNF, natural occurring dietary chemical) to produce the dimerization of AhR with the AhR nuclear translocator (Arnt). The heterodimer binds to the xenobiotic response elements (XRE) in the distal and proximal promoter regions of the Cyp1A gene (137). In addition, Cyp1A activation may occur in a ligand-independent AhR manner, suggesting a cross-talk between AhR and other signaling pathways (74).

It is estimated that Cyps can metabolize up to two-thirds of drugs present in humans liver. Even it is believed that the liver is the main site of expression, these enzymes are also present in others tissues such as lungs, spleen, brain, kidney (49, 91, 122).

1.3.1 Cytochrome P450 enzymes in liver

The liver is one of the vital organs in vertebrates, is characterized principally by the detoxification of drugs, protein synthesis and the production of biochem- icals for the digestion. There are many Cyps involved in the metabolism of xenobiotics like CYP1A, CYP2C and CYP2E among others in humans. The constitutional factors such as age and gender, exposure to environmental agents like contaminants, cigarette and ethanol and moreover liver diseases may modulate their expression (47). Cyps induction in in vivo and in vitro models has been widely studied, using different inducers (β-naphtoflavone, 3-MC, TCDD, omepra- zole, phenobarbital) in rats and in hepatoma cell lines (28, 71, 80, 81, 107).

20 1.3 Cyotochrome P450 enzymes

Figure 1.7: The cytochrome P450 catalytic cycle. The diﬀerent steps involved in monooxygenation, “uncoupled” activity and “oxidase” activity of Cytochrome P450. The compound A-B mean any compound able to bind the active site of the enzyme. Taken from De Matteis et. al (26).

Moreover, cytochrome P450 enzymes have been linked to bilirubin oxidation. Firstly observed in 1978 by Kapitulnik (71) in treated Gunn rats (animals that lack the expression of UGT1A1 enzyme) by TCDD. Treated rats had lower levels of bilirubin in blood. What is more interesting, in 1993 the same group analyzed the Gunn rats without any treatment and revealed that jaundiced newborns rats have higher liver expression of Cyp1A1 and Cyp1A2 compared to the non jaundiced littermates, proposing them as a compensatory mechanims in UCB clearance.

De Matteis group, corroborated this hypothesis analyzing the capacity of Cyp1A1 and Cyp1A2 to oxidize bilirubin in rat liver treated with 3-MC and TCB or TCDD or in chicken embryos treated with βNF (27, 29, 145). In addition, Abu bakar, showed bilirubin oxidation by Cyp2A5 (homologous CYP2A6 in human; Cyp2A3 in rat) in liver mice and CYP2A6 in HepG2 hepatoma cell line (1, 2, 3).

21 1. INTRODUCTION

Additonal studies demonstrated that liver Cyps are more prone to oxidize bilirubin when exposed to planar or non-planar polyhalogenated biphenyl such as 3,4,3,4 tetrachlorobyphenyl (TCB). Depending on the Cyp and the polyhalogenated biphenyl interaction in the active site of the enzyme, could lead to the inhibition of its monooxygenase activity and increased production of reactive Oxygen species (ROS) by an uncoupling mechanism (28, 119). This ROS may be the responsible of bilirubin oxidation.

1.3.2 Cyotochrome P450 enzymes in brain

The neural tissue contains its own unique set of cytochrome P450 genes that are regulated in a manner that is distinct from their molecular regulation in peripheral tissue. These particular characteristics allow this family of proteins and their metabolites to perform vital functions in the brain such as neurotrophic support, neuroprotection, control of cerebral blood ﬂow, temperature control, neuropeptide control, regulation of neurotransmitter levels and other functions important in brain physiology, development and disease(122). On the other side, imposed to assess the ability in bilirubin oxidation.

Although Cyps in brain occur at low levels in comparison of liver, it has been reported that the amount of Cyps in specific cells can be as high as or even higher than the level in hepatocytes (90, 132). The brain complexity and cellular heterogeneity is reflected in the regional and cellular differences observed in Cyps distribution. This distribution may play a critical role in the activation of degradation of drugs and chemicals in specific areas and cell type. The constitutive expression of Cyps in neuron are higher than glial cells but the inducibility is higher in the latter ones indicating again a potential role in toxication-detoxication mechanism (33, 56, 73). Studies on the regional and cellular localization of Cyps in the brain have many discrepancies, principally by the diverse techniques used and the high degree of homology between Cyps. Some studies stated that the higher amount

22 1.3 Cyotochrome P450 enzymes of Cyps is in mitochondrial membranes and others microsomes fractions. More- over some studies showed that even the mitochondria Cyps content is higher the major activity is in microsomes (10, 49, 61).

Cytochrome P450 expression in newborn is still not known, but it is believed lower in comparison with an adult. CYP1A1 has been shown to be present in human adult brain localized in cortical region, midbrain, basal ganglia, hippocampus and cerebellum. CYP1A2 has been found in most brain regions (10, 37, 40). In rat models has been observed that young rats and the corresponding cells are more sensible to bilirubin than older ones (38). This could be in concordance with the maturation of Cyps expression observed in Gunn rats brain in our laboratory (unpublished results) and in liver by kapitulinik (70) as alternative explaination to ABCs mediated protection.

In addition, in our laboratory the tissue bilirubin dinamics in brain were analyzed in Gunn rats treated with sulphadimethoxine, a bilirubin displacing agent. Showing that in cortex and superior colliculus, not damaged regions, Cyp1A1, Cyp1a2 and Cyp2A3 mRNA induction was an early event in concordance with the bilirubin clearance. While in cerebellum and inferior colliculus, damaged regions, the Cyps induction had a delay of 24h and lower in extent, again in concordance with the bilirubin content and clearance (44).

23 1. INTRODUCTION

24 2

Aims of the project

2.1 Aims

Bilirubin encephalopathy may occur when bilirubin blood concentration rises and accumulates in the body. If the concentration reaches to high levels brain damage could be produced. Bilirubin neurotoxicity is selective; certain areas of the brain and certain cell types within these regions are more aﬀected than others. The most vulnerable regions are the cerebellum, basal ganglia, hippocampus and cochlear nuclei.

Between the cell types, neurons are more prone to bilirubin induced cell death, whereas astrocytes are more competent in releasing glutamate and pro- inﬂammatory cytokine (41, 42). Moreover, the greater magnitude of induction of Cyp1A in glial cells in comparison to neuron (73), suggest that these cells may have a potential role in detoxication mechanism. Astrocytes are known to be a heterogeneous cell population based on their morphology and the expression of diﬀerent sets of receptors, transporters, ions channels and other proteins (87).

25 2. AIMS OF THE PROJECT

Being different the “astrocytes types” between the regions. Based on these con- siderations glial cells could overcome or modulate the UCB toxicity in specific brain regions protecting the neurons located. For this study an in vitro model of primary culture of astrocytes from two different regions (Cortex; not damaged and Cerebellum; damaged) was used in order to assess their role in bilirubin oxidation.

The aims of my PhD thesis are:

• Analyze the inducibility of brain Cyps enzymes, by a known inducer, βNF in cortex and cerebellum astrocytes.

• Select the optimal conditions.

• Assess the capacity of induced Cyps to oxidize bilirubin.

• Evaluate the protective eﬀect of Cyps induction by challenging with high concentrations of bilirubin (140nM; 24h).

• Evaluate bilirubin (140nM; 2h) capacity to induce Cytochrome P450 enzyme (mRNA and activity) in cortex and cerebellum derived astrocytes.

26 3

Matherial & Methods

3.1 Chemicals and reagents

Dulbecco’s Modified Eagle Medium low glucose (DMEM LG) and gentamycin 50mg/mL solution were obtained from Invitrogen, Life technologies Corporation (Grand Island, NY). Dulbeccos Modified Eagle Medium (DMEM) from Euroclone (Milano, Italy). Fetal bovine serum (FBS), trypsin from bovine pancreas, Dul- becco’s phosphate buffered saline (PBS), unconjugated bilirubin (UCB), 3(4,5- dimethiltiazolil-2)-2,5 diphenil tetrazolium (for MTT assay), dimethyl sulfoxide (DMSO), trypan blue solution (0.4% w/v in PBS), β-naphtoflavone (βNF), resorufin sodium salt, 7-ethoxyresorufin (EROD assay), 7-methoxyresorufin (MROD assay), β-Nicotinamide adenine dinucleotide 2’-phosphate reduced tetrasodium salt hydrate (NADPH), 3,4, 3,4-tetrachlorobiphenyl (TCB), and fluorescamine and fluvoxamine maleate (FVX) were purchased from Sigma Aldrich (St. Louis, MO, USA). All chemicals and solvents were of analytical grade and were obtained from common commercial sources.

27 3. MATHERIAL & METHODS

3.2 Culture and treatment of Huh7 and HepG2 cells

The Huh7 is a well differentiated hepatocytes derived cellular carcinoma cell line that was originally taken from a liver tumor in a 57-year-old Japanese male in 1982. They are epithelial-like cells growing as 2D monolayers (fig 3.1). HepG2 cell line was derived from the liver tissue of 15-year-old male with differentiated hepatocellular carcinoma. HepG2 are adherent, epithelial-like cells growing as monolayers and in small aggregates (fig 3.2).

Huh7 and HepG2 hepatocellular carcinoma cells were cultured in DMEM containing 10% FBS, 2mM L-Glutamine and 1% of penicillin/streptomycin. The ◦ cells were kept in an atmosphere of 5% of CO2 at 37 C in a humidiﬁed incubator.

Seeded Huh7 cells (20000cell/cm2) were treated with a cytochrome P450 enzymes known inducer, βNF, at diﬀerent concentrations and times of exposure (2.5, 5, 10, 20 µM of βNF dissolved in DMSO, stock solution 20mM and for 1, 4, 6, 24h). HepG2 cells (35000cell/cm2) were treated with 20µM of βNF for 24h as described by Krusekopf et al. 2003 (81). Control cells were treated with DMSO only (ﬁnal DMSO concentration less than 0.5%).

Figure 3.1: Morphology of Huh7 cells. Phase contrast picture of Huh7 cells in culture.

28 3.3 Animals

Figure 3.2: Morphology of HepG2 cells. Phase contrast picture of HepG2 cells in culture.

3.3 Animals

Wistar HanTM Rats (2 day old: P2) of both sexes were obtained from the animal facility of the Department of Life sciences of Trieste University (Italy), after regular communication to the Competent Authorities (20-9-2011). Animal care and procedures were conducted according to the guidelines approved by the Italian law (decree 116-92) and by the European Communities Council Directive 86-609-ECC. As animals were used as “organ donor” no additional permission was required. All eﬀort to minimize the suﬀerance and the number of animals used were adopted, in respect to the “3R” rules.

3.4 Brain dissection, primary astrocytes culture

Six P2 wistar rats were used for primary culture of astrocytes as described previously by Booher (1972) (14) with some modification. Briefly, animals were sacrificed by decapitation; their brains were rapidly excised and placed in DMEM LG culture medium. Under the stereomicroscope the cortex (Cx) and cerebellum (Cll) were immediately dissected, cleaned from meninges and choroid plexus.

29 3. MATHERIAL & METHODS

The different parts were collected in DMEM LG supplemented with 1% of penicillin/streptomycin and cut in small pieces. Cells were mechanically dissociated by forcing the tissue through a 70µm nylon cell strainer (352350, BD Biosciences, Milan, Italy) with 5 or 3 mL of DMEM supplemented by 10% of heat-inactivated FBS, 50µg/mL gentamycin. The cell suspension was continuously dissociated by 1 a 5mL pipette to avoid cells aggregates. The latter suspension was diluted 4 and cells were seeded at 1.2 105 cells/mL in 6 well plates or flask 75 cm2. Astrocytes were incubated in culture medium in an incubator at 37◦C in an atmosphere of 95% air 5% CO2, with 90% of humidity (Fig 3.3 and 3.4). The purity of the astrocytes cultures were determined by immunocytochemical staining using the astrocytes marker glial fibrillary acidic protein (GFAP; polyclonal rabbit anti- GFAP Dako Cytomation Z0334, Denmark) vs. Hoechst staining of nuclei. Briefly, Astrocytes were grown on a glass coverslip, fixed with paraformaldehyde (PFA) 4% in phosphate buffer, blocked with normal goat serum 5% in 5%BSA, 0.3% Triton X100 in PBS. Anti-GFAP was diluted 1:1000 ON at 4◦C and secondary antibody Anti-Rabbit Alexa fluor 1:1000 (Alexa fluor 488, Life technologies, Milan, Italy) for 2h at room temperature. Cells were then washed and incubated with Hoescht (0.1µg/mL in PBS) for 30 min. Finally mounted on a glass microscope slide.

Experiments were performed within 15 days in vitro (div), when 90% of con- ﬂuence was reached.

3.5 UCB solutions and Bf measurements

The free bilirubin concentration (Bf) in DMEM medium was evaluated using the modiﬁed horseradish peroxidase assay as described by Roca (5, 113).

Unconjugated Bilirubin (UCB) was puriﬁed as described by Ostrow and Muk- erjee (100), divided into aliquot, and stored at -20◦C till use. Before each treat-

30 3.5 UCB solutions and Bf measurements

Figure 3.3: Morphology of Astrocytes derived from Cerebellum. Phase contrast picture of Cerebellar cells in culture.

Figure 3.4: Morphology of Astrocytes derived from Cortex. Phase contrast picture of Cortex cells in culture ment, an aliquot was dissolved in DMSO (0.3µL of DMSO per µg of UCB), and diluted with culture medium containing 10%FBS (Sigma-Aldrich; St. Louis, MO, USA; containing 25.6µM BSA). Experiments were performed with a ﬁnal UCB concentrations of 25µM, yielding to a free unbound UCB concentrations (Bf) of 140nM representing a toxic dose.

In order to standardize DMSO related eﬀect, control cells were incubated with medium containing DMSO 0.5% (the amount of DMSO needed to dissolve UCB 25µM). To minimize photodegradation, all the experiments were performed under light protection (dim lighting and vials wrapped in aluminum foil).

31 3. MATHERIAL & METHODS

3.6 Astrocytes treatment conditions

Astrocytes primary cultures were grown for 12-15 div in the corresponding medium, and daily monitored. Cells were washed once with PBS and diﬀerent treatments were assessed.

First, to analyze the inducibility of bCyps it was used a known inducer, βNF, at diﬀerent concentrations (2.5; 5; 10; 20 µM of βNF, dissolved in DMSO; stock solution 20mM) and timings (1; 6; 24h).

Second, bilirubin oxidation capacity was assessed in membrane fraction of treated astrocytes for the optimal conditons.

Third, to evaluate if Cyps could protect astrocytes from UCB damage a two part treatment was performed. Initially, Cx and Cll astrocytes were treated with βNF optimal condition for Cyp1A1 or Cyp1A2 and with or without TCB (3.42µM). Then, once Cyps were induced, cells were loaded with bilirubin 25µM (Bf: 140nM) for 24h, as it is known that at this condition cells viability is reduced between 60-70% (data obtained in our lab). For this treatments control cells were exposed only with DMSO (ﬁnal concentration equal or less than 0.5%) and cells with only bilirubin.

Finally, in order to evaluate the capacity of bilirubin to induce bCyps, astrocytes were loaded with bilirubin 25µM (Bf: 140nM) for 2h.

3.7 Viability tests

MTT and Trypan blue assays were used to analyze the vitality of the cells after treatment. MTT allow to evaluate the mitochondrial activity by the reduction of 3(4,5-dimethyltiazolyl-2)-2,5 diphenyl tetrazolium (MTT), a monotetrazohum

32 3.8 Real-time RT-PCR salt, to a blue formazan product (31, 96). Trypan blue (TB) test assess the membrane integrity. This method is based on the principle that viable cells do not take up the dye, whereas non-viable cells do.

For MTT test, cells were washed once with PBS, then added the MTT solution (Stock solution 5mg/mL in PBS pH7.40) diluted to 0.5mg/mL in the corresponding treatment medium immediately before the treatment. The cells were incubated for 1h at 37◦C. After the incubation, formazan crystals were dissolved by adding 0.5mL of DMSO with gentle shaking. The absorbance was measured at 570nm in a LD 400C luminescence Detector (Beckman coulter, Milan, Italy).

TB assay was performed by harvesting cells, thus diluting the cells suspension 1:1 with trypan blue dye (Stock solution: 0.4% in PBS). The hemocytometer was loaded and examined immediately under a microscope. Both blue staining cells (dead) and unstained cells (living) were counted. Each square of the hemocytometer represents a total volume of 0.1 mm3 or 10−4 cm3. Since 1 cm3 is equivalent to approximately 1 mL, the subsequent cell concentration per mL is determined by the following calculation: the average count per square × dilution factor × 104. For the cell viability (%) = total viable cells (unstained) / total cells (stained and unstained) × 100. Each viability was expressed as percentage of control cells (with vehicle, DMSO).

3.8 Real-time RT-PCR

The mRNA expression of Cyp1A1/CYP1A1, Cyp1A2/CYP1A2, Cyp2A3/ CYP2A6 and Ugt1A1/UGT1A1, Nrf2 and Ahr genes (lowercase for rats, uppercase for human genes) was analyzed by quantitative RT-PCR. Total RNA of astrocytes primary culture and Huh7/HepG2 cells were extracted using Eurogold RNA Pure reagent (Euroclone, Milan, Italy).

33 3. MATHERIAL & METHODS

Retrotranscription of total RNA (1µg) was performed with High Capacity cDNA Reverse Transcription Kit (Applied biosystems, Monza, Italy) according to the manufacturers instructions. The reaction was run in a thermal cycler (Gene Amp PCR System 2400, Perkin-Elmer, Boston, MA, USA) at 25◦C for 5 min, 37◦C for 120 min, and 85◦C for 5 min. The ﬁnal cDNA was conserved at 20◦C until used.

For the quantitative PCR, primers were designed using the Beacon designer 8.1 software (Premier Biosoft International, Palo Alto, CA, USA) on rats or human sequences available in GenBank (see table 3.1). The reaction was performed on 25ng of cDNA, with the corresponding gene-speciﬁc sense and anti- sense primers 250nM (with the exception of Ahr concentration of 300nM), with 1x iQ SYBER Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) in a ﬁnal volume of 15µL(Ahr 20µL). Reactions were run on an iCycler iQ thermocy- cler (Bio-Rad Laboratories, Hercules, CA, USA). The thermal cycler conditions consisted of 3 min at 95◦C and 40 cycles each at 95◦C for 20s, 60◦C for 20s, and 72◦C for 30s.

The PCR was performed in 96-well plates; each sample was analysed in dupli- cate. Standard curves using a calibrator cDNA (chosen among the cDNA samples from astrocytes and hepatoma cell line without treatment) were prepared for each target and house-keeping gene. Melting curve analysis was performed to assess product specificity. The relative quantification was made using the iCycler iQ Software, version 3.1 (Bio-Rad Laboratories, Hercules, CA, USA) by the Pfaffl modification of the ∆∆CT equation (CT: cycle number at which the fluorescence passes the threshold level of detection) (105), taking into account the efficiencies of the individuals genes. The results were normalized to the chosen housekeeping genes and the initial amount of the template of each sample was determined as relative expression vs. one of the sample chosen as reference which is considered the 1x sample.

34 3.9 Membrane fraction preparation

3.9 Membrane fraction preparation

Treated astrocytes were harvested, washed and pelleted, then were homoge- nized by a gentle manual method using a glass on glass Dunce homogenizer (Ar- tiGlass, Pordenone, Italy) in a homogenization buﬀer (Tris HCl 10mM; EDTA 1mM; DTT 0.5mM; Protein Inhibitor 0.1mM pH:7.4). The homogenate was centrifuged at 900g using a Beckman Allegra 25R (Beckman, Milan, Italy) to eliminate the debris. The supernatant was directly applied to ultracentrifugation at 110000g for 60min using a Beckman LE-80K Optima; rotor 70.1 Ti (Beck- man, Milan, Italy). All procedures were performed at 4◦C. The resulting pellet was designated as a membrane fraction, under this condition microsomes are not separated from nuclear membranes and mitochondria (89). Membrane fractions were stored at -80◦C with 20% of glycerol till use.

3.10 Enzymatic assays

EROD and MROD assays were performed to assess the Cyp1A1 and Cyp1A2 activity by the O-dealkylations of ethoxyresorufin and methoxyresorufin, respectively, accordingly to the method described by Meyer et al. (89) with some modifications. Briefly, the membrane fraction of treated astrocytes primary culture were preincubated with 5µM of the substrate (ethoxyresorufin or methoxyresorufin) in ◦ a 50mM phosphate buffer with 2mM of MgCl2 for 5 min at 37 C. NADPH (1µM final concentration) was added and the reaction was allowed to proceed at 37◦C in darkness measuring every 5min fluorescence of the product (resorufin) with the Perkin Elmer Envision multilabel plate reader (excitation/emission wavelength 535/590nm) (PerkinElmer, Milan Italy). It must be notice that the amount of membrane fraction needed to perform these experiments was high, at least 40µg each well (100µL) to have a proper signal. For the HepG2 cell line, the same protocol was applied in intact cells as described by Zhang (147). Samples were assessed in duplicates and the amount of resorufin produced in the samples

35 3. MATHERIAL & METHODS was calculated based on a standard curve developed from a range of product (0-250nM) concentrations in the presence of the substrate and NADPH.

Results were normalized to protein content. Protein content was measured in every single well by the addition of fluorescamine in DMSO (4mg/mL). Fluo- rescamine reacts with primary amines in proteins forming a fluorescent product (excitation/emission wavelength 390nm/460nm). The results were calculated by regression curve analysis as respect the fluorescence generated by the standard curve of BSA (0-100µg) in the phosphate buffer with the substrate.

To analyze the speciﬁcity of the enzymatic tests, MROD assay was inhibited by the addition of ﬂuvoxamine 0.25µM to the samples. It is known that at low concentrations (0.25µM) inhibits only Cyp1A2 activity, while at higher concentrations (100µM) both Cyps are inhibited (Ki Cyp1A1 33000nM and Ki Cyp1A2 40nM) (103, 133).

3.11 Bilirubin disappearance activity

The rate of HepG2/astrocytes bilirubin degradation was determined as described previously by De Matteis and Abu-bakar (3, 26) with some modifications. Briefly, the enzymatic incubation mixture contained the following components: Tris-HCl 100mM pH=8.2, KCl 26mM, EDTA 2mM and membrane fraction of induced and non-induced astrocytes (40µg total protein/100µL). The final concentration of bilirubin employed was 15µM. After 5 min pre-incubation with bilirubin, NADPH (final concentration 137µM) was added to the sample to start the reaction. The loss of absorbance of bilirubin and NADPH was followed with the PerkinElmer Envision multilabel plate reader every 3min at 440 and 340nm. For the bilirubin calculations was used mM values of 64.34 for HepG2 and 21.6 and for astrocytes.

36 3.12 Western blot

3.11.1 TCB addition

It is been studied that for Cyp1A1 to be oxidative active, needs the addition of coplanar halogenated biphenyl substrate like 3,4, 3,4-tetrachlorobiphenyl (TCB; 3.42µM). To corroborate this in brain, the same protocol described above was performed also with the addition of TCB to the microsomal incubation together with NADPH (30, 145).

3.12 Western blot

After protein quantification of the membrane fraction from Cx and Cll astrocytes by fluorescamine protocol (described above), 40µg of each sample (rat liver control 20 µg) were denatured with 10% β-mercaptoethanol in Laemmli loading buffer (62.5 mM Tris-HCl, pH 6.80; 25 % glycerol, 2 % SDS, 0.01 % bromophe- nol blue) by 10 min boiling in water bath. Thus samples were separated by SDS-PAGE 12% polyacrylamide gels. Molecular weight standards (10-250 kDa, SM1811 Fermentas, M-medicals, Milan, Italy) were used to assess the proteins molecular weights. Proteins were electro-transferred with a wet blotting system (BioRad Laboratories, Hercules, CA, USA) at 100 V for 1h onto PVDF membrane (0.2µm; Whatman Schleicher and Schuell, Dassel, Germany) in transfer buffer (25mM Tris-Base; 192M glycine, 0.1% SDS; 20% methanol). Efficienty of the transfer was assessed by lack of Coomassie blue coloration of the gel after blotting and Ponceau staining of PVDF membrane.

Membranes were saturated for 1h in blocking solution 4% BSA in T-TBS (20mM Tris-Base; 500mM NaCl, pH 7.40, 0.2% Tween 20) at room temperature (RT) and incubated overnight at 4◦C with the primary antibody anti-Cyp1A1 e anti-Cyp1A2 ([H-70] sc-20772 and [3B8C1] sc-53614, respectively. Concentration 200g/mL, dilution 1/100, Santa Cruz Biotechnology, Santa Cruz, CA, USA; ) in the same solution. After three washing, membranes were incubated for 1h at RT

37 3. MATHERIAL & METHODS with peroxidase-conjugated anti-rabbit secondary antibody (P0448, 0.04 µg/mL, Dako, Glostrup, Denmark).

Protein bands were detected by peroxidase reaction according to the manufacturers protocol using a chemiluminescence procedure (Millipore, Billeria, MA, USA) and visualized on X-ray ﬁlms (BioMax Light, Kodak Rochester, NY, USA).

3.13 Statistical analysis

The statistical significance of difference between control and treated cells was evaluated by paired two tailed test using InStat 3.06 (GraphPad software, San Diego, CA, USA). Differences were considered statistically significant at a p value ≤0.05. All results were expressed as mean ± S.D.

38 3.13 Statistical analysis (bp) mRNA designed primers Table 3.1: 000194.2002046.3000499.3 ACATCTGGAGTCCTATTGACATCG000761.3 CCGCCCAAAGGGAACTGATAG TCAGCCGCATCTTCTTTTG000762.5 TATTGGTCTCCCTTCTCTA012583.2 TGAGTGACAGAGCAAGAC031144.2 193 GCAACAATATCCACTTTACCAG GCAGTTTAAGAAGAGTGA017008. GCTCAGGTAGTTGTTCTT AGACTGAAGAGCTACTGTAATGAC012540.2 GGCTGTACTGCTTGACCAAG GGTGTGATGGTGGGTATG GGTGACAGACTGAGATTCT 146 012541.3 GGTGAAGAAGAGAAAGAG CTCTCTGCTCCTCCCTGTTC007812 CAGGCGAGAAGGTGGATATGAC007812 163 188 CAATGCCGTGTTCAATGG GTGGTGGAATCGGTGGCTAATGTC GGTCTGTGTTTCTGACTGAAGTTG007812 GGGCTGGGTTGGGCAGGTAG 165 CACCGACCTTCACCATCTTG ACACAGGCACCCCAGGACATC 181 136 AGCACAGCCAACACATTCTTC CCAGGCTCAACGGGACAAGAAAC GGCGTTCCTAAGCAAGTT 175 103 87 TTGATGACCAGGACTCACAGG 99 GTGAGCAGCAGTCTGAAG 133 94 NM NM NM NM NM NM NM NM NM NM NM NM NM Gene Accession Number Forward Reverse Amplicon GAPDH CYP1A1 CYP1A2 CYP2A6 Hprt Actin Gapdh Cyp1A1 Cyp1A2 Cyp2A3 Nrf2 Ahr HPRT

39 3. MATHERIAL & METHODS

40 4

Results

4.1 Hepatic cell culture

4.1.1 Huh7 mRNA Cyps inducibility by βNF

The hepatic cell line Huh7 was grown in completed DMEM medium till 80- 90% of conﬂuence, and then treated with βNF at diﬀerent concentrations (2.5, 5, 10, 20µM) and timing 1, 4, 6 and 24h. After the treatment, mRNA was extracted and qRT-PCR was performed. CYP1A1, CYP1A2 and CYP2A6 (in humans, corresponding to Cyp2A3 in rat) mRNA was analyzed. As the Huh7 is an hepatic line (our liver model), it should express the bilirubin conjugating gene UGT1A1. mRNA expression was analyzed to assess their possible induction by the drug (Fig. 4.1).

41 4. RESULTS

Figure 4.1: mRNA expression in Huh7 treated βNF. CYP1A1, CYP1A2 and UGT1A1 mRNA expression of Huh7 cells treated with βNF at diﬀerent concentrations and timing (2.5, 5, 10, 20µM and 1, 4, 6, 24h, respectively). Control cells were exposed to the vehicle (DMSO). Data are mean SD of 4-5 independent experiments. Statistical analysis is detailed in Table 4.1. 42 4.1 Hepatic cell culture

Huh7

CYP1a1 µM βNF Hours 2.5µM 5µM 10µM 20µM 1h ns ns ns ns 4h ns ns ns ns 6h ns p≤0.05 p≤0.05 p≤0.05 24h p≤0.05 p≤0.01 p≤0.05 p≤0.001

CYP1A2 µM βNF Hours 2.5µM 5µM 10µM 20µM 1h ns ns ns ns 4h ns ns ns ns 6h p≤0.05 p≤0.05 p≤0.05 p≤0.05 24h ns p≤0.01 p≤0.01 ns

UGT1a1 µM βNF Hours 2.5µM 5µM 10µM 20µM 1h ns ns ns ns 4h ns ns ns p≤0.05 6h ns ns ns p≤0.05 24h p≤0.001 p≤0.001 p≤0.01 p≤0.05

Table 4.1: Stadistic analysis of Huh7 mRNA treated with BNF CYP1A1, CYP1A2 and UGT1A1 mRNA expression statistical analysis of treated Huh7 cells with diﬀerent concentrations and timing of βNF (2.5, 5, 10, 20µM and 1, 4, 6, 24h, respectively).

43 4. RESULTS

The CYP1A1 mRNA induction by βNF was not signiﬁcantly upregulated at 1 and 4h. The expression was signiﬁcantly induced as increase the concentration of the drug after 6 and 24h, with the higher induction at 20µM;24h (10fold p≤0.001).

CYP1A2 mRNA was not induced after 1 and 4h, while after 6h the induction was signiﬁcant at all the βNF concentrations, reaching a maximum of 28fold at 20µM. After 24h of treatment the mRNA expression return to similar values of 1 and 4h.

The UGT1A1 mRNA was also analyzed. The conjugating enzyme mRNA level was signiﬁcantly upregulated (2 folds) after 24h, when exposed to 2.5 - 10µM of βNF.

Finally, the CYP2A6 was not expressed in this cell line. To conﬁrm the absence of this Cyp were used three diﬀerent primer pairs, comprising the one detailed by Abu Bakar (2).

Moreover, after each treatment the viability was analyzed by two diﬀerent methods, Tripan blue and MTT. TB showed that the treatment was not harmful for the cells (with the exception at the higher concentration after 24h) (Fig.4.2), while by MTT a decrease in viability as we increase the drug concentration and time of exposure was observed, having a signiﬁcant drop at the higher concentration (4, 6 and 24h).

The optimal condition were selected taking in account the mRNA and the viability. For this reason, the 20µM;24h treatment was excluded (where viability drop). For Cyp1A1 the optimal condition selected was 10µM of βNF for 24h; the mRNA was upregulated only 3folds. For Cyp1A2 the optimal condition was 20µM of βNF for 6h (28fold).

44 4.1 Hepatic cell culture

Figure 4.2: Viability percentage in Huh7. Cells treated with diﬀerent concentrations of βNF (2.5, 5, 10, 20µM) analyzed at diﬀerent timing (1, 4, 6, 24h). Control cells were treated with the vehicle (DMSO). Data are mean SD of 4-5 independent experiments.

4.1.2 HepG2 mRNA Cyps induction by βNF

HepG2 was the other hepatic cell line analyzed, cells were grown in completed DMEM medium till 80-90% conﬂuence, and then treated with 20µM of βNF for 24h as described by Krusekopf (81). The viability of the cells was not compromised, showing 91% and 86% (Table 4.2, no statistical signiﬁcance) by trypan blue and MTT, respect to control. The mRNA levels of the CYP1A1, CYP1A2, CYP2A6 and UGT1A1 were measured by qRT-PCR in HepG2 cells treated compared to control (Fig. 4.3).

A signiﬁcant upregulation of 45.5fold (p≤0.01) of CYP1A1 was observed.

45 4. RESULTS

viability assays

Treatment Trypan blue MTT 20µM βNF 24h 91% 86%

Table 4.2: Viability percentage of HepG2. Cells were treated with 20µM of βNF viability was analyzed by trypan blue and MTT. Data are mean of 4-5 independent experiments.

Figure 4.3: mRNA expression in HepG2 treated with βNF. CYP1A1, CYP1A2 and UGT1A1 expression analyzed by qRT-PCR. The obtained values were normalized versus the expression of the endogenous house keeping genes GAPDH and HPRT. Control cells were treated only with the vehicle (DMSO). Data are mean S.D. of 4 experiments. Signiﬁcantly diﬀerent when compared to control (*p≤0.05,** p≤0.01). CYP2A6 was not expressed in this cell line.

Moreover, a 2.8fold upregulation of the CYP1A2 mRNA expression was detected.

The UGT1A1 mRNA expression was increased by 4.7fold (p≤0.05) compared to control. Again, CYP2A6 was not expressed in our HepG2 cells (three diﬀerent primer pairs were used, one detailed by Abu Bakar (2).

46 4.1 Hepatic cell culture

4.1.3 EROD/MROD activity

The CYP1A1 and CYP1A2 activity (refered as protein) was analyzed by the two specific test assessing the dealkylation activity, EROD and MROD assay, respectively. To set up the conditions for the assays, different concentration of the substrates 7-ethoxyresorufin and 7-methoxyresorufin (EROD and MROD, respectively, 1µM - 10µM) were tested over the time (90min). The optimal concentration chosen was 5µM for both compounds.

Huh7 revealed low EROD activity, the Cyp1a1 maximal possibility due to the low induction (only 3fold of mRNA) allowed by viability restriction (20µM; 24h).

For HepG2 cells a signiﬁcant increase in either assays was observed. EROD activity (CYP1A1) resulted in 12fold higher respect to control (p≤0.01) and MROD assay (CYP1A2), 4fold increased compared to control (p≤0.01) (Fig. 4.4). Due to its absence, CYP2A6 activity was not recorded.

Figure 4.4: EROD and MROD activity assays in treated HepG2. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent from corresponding control (**p≤0.01).

47 4. RESULTS

4.2 Astrocyte primary culture

4.2.1 GFAP staining

To control the purity of the astrocytes cultures GFAP staining was performed.

After 12-15 days of cultures, cells were stained by GFAP antibody and Hoechst for nuclei. The purity of astrocytes, identiﬁed by counting multiple ﬁelds, was

90-95% (Fig. 4.5).

4.2.2 Cyps constitutive expression

In order to evaluate the diﬀerences in constitutive levels of Cyps in Cx and Cll astrocytes primary culture, the mRNA expression of Cyp1A1, Cyp1A2, Cyp2A3 and Ugt1A1 was assessed by qRT-PCR.

Fig 4.6 showed that only Cyp1A1 was 3fold higher (p≤0.05) in Cx astrocytes compared to Cll astrocytes. For the other genes there was a slight higher expression but not statistically relevant in Cx astrocytes.

48 4.2 Astrocyte primary culture

(a) Representative immunostained of Cx rat astrocytes

(b) Representative immunostained of Cll rat astrocytes

Figure 4.5: Representative immunostaining of rat Astrocytes. Green for astroglial GFAP (glial ﬁbrillary acidic protein), and blue for nuclei. In this picture, primary Cx (a) and Cll (b) astrocytes cultured for 10 - 12 days in vitro respectively (10 - 12 DIV) were grown on a glass coverslip, ﬁxed, and mounted on a glass microscope slide.

49 4. RESULTS

Figure 4.6: Constitutive mRNA expression of Cyps astrocytes from Cx and Cll. Cyp1A1, Cyp1A2, Cyp2A3 and Ugt1A1 mRNA expression. Values were normalized versus the expression of the endogenous house keeping genes Hprt, Gapdh, Actin. Relative expression levels were calculated with respect the normalized expression of the cerebellum at which it was assigned a value of 1. Data are mean S.D. of 4-5 experiments. Signiﬁcantly diﬀerent when compared to control (*p≤0.05).

4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF

4.3.1 Astrocytes βNF treatment

Several in vivo studies have used βNF as general inducer of Cyps (61, 95) but their speciﬁc role in bilirubin oxidation in glial cells was not assessed.

Cx and Cll astorcytes cells were treated at different concentrations (2.5, 5, 10 and 20µM of βNF) and for different timing (1, 6 and 24h) in order to analyze the inducibility of Cyps and select the optimal condition to assess the specific activity (EROD/MROD) and most importantly, their capacity to oxidize bilirubin.

50 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF

4.3.2 Viability assays

Viability was assessed after the treatments using Tripan blue and MTT test. The same trend was observed in both primary cultures. The ﬁrst method displayed that all the treatments were not harmful for the cells (viability between 90-100% compared to control cells). MTT revealed that after 1h of treatment the viability was similar to Trypan Blue (90-100%) whereas after 6 and 24h, as we increased the drug concentration, the viability decreased in a dependent manner, reaching a critical condition at the higher concentration (20µM of βNF) after 24h. This condition was excluded for the activity test (viability less than 50%, p≤0.001) (Fig 4.7).

4.3.3 Cyps mRNA inducibility

Cyps inducibility was assessed at the βNF concentrations and timing described above. Cyp1A1, Cyp1A2, Cyp2A3 and Ugt1A1 mRNA induction was analyzed by qRT-PCR (Fig. 4.8 and 4.9).

4.3.3.1 Cortex derived astrocytes

In Cx astrocytes, Cyp1A1 mRNA expression was slightly modified after 1h hour of treatment. After 6h of βNF treatement, regardless of the principle concentration, it was significantly higher (7.5fold, p≤0.05). After 24h, the level still continued to be significantly higher till the maximal concentration, 20µM of βNF, in which the expression decreased markedly to initial values (3.5fold). Maybe, due to the decrease in viability (critical value).

The Cyp1A2 mRNA expression, after 1 and 6h was quite similar to control cells and was signiﬁcantly induced only after 24h (p≤0.05), increasing in a de-

51 4. RESULTS

Figure 4.7: Viability of Cx and Cll astrocytes treated with βNF. Viability is expressed as percentage in astrocytes treated with different concentrations of βNF (2.5, 5, 10, 20µM) analyzed at different timing (1, 6, 24h). Significantly different when compared to control (*p≤0.05,**p≤0.01, ***p≤0.001).

pendent manner with the concentration of the drug. The maximal induction was observed at the condition that we were forced to exclude due to the toxicity of the treatment (20µM βNF; 24h, MTT: 30% viability; p≤0.001). On the other hand, Cyp2A3 was signiﬁcantly upregulated only after 24h at the higher concentration (12fold; p≤0.001) where the viability was compromised (MTT: 30% viability; p≤0.001).

52 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF

Figure 4.8: mRNA inducibility in Cx astrocytes treated with βNF. Cyp1A1, Cyp1A2 and Cyp2A3 mRNA expression of treated Cx astrocytes with βNF at diﬀerent concentrations and timing (2.5, 5, 10, 20µM and 1, 6, 24h, respectively). Control cells were treated with the vehicle (DMSO). Data are mean SD of 4-5 independent experiments. Statistical analysis is detailed in Table 4.3

53 4. RESULTS

Cortex

Cyp1A1 µM βNF Hours 2.5 5 10 20 1 p≤0.05 ns ns ns 6 p≤0.001 p≤0.05 p≤0.05 p≤0.05 24 p≤0.05 p≤0.05 p≤0.05 p≤0.01

Cyp1A2 µM βNF Hours 2.5 5 10 20 1 p≤0.05 ns ns ns 6 ns p≤0.05 ns p≤0.05 24 p≤0.05 p≤0,01 p≤0.05 p≤0.05

Cyp2A3 µM βNF Hours 2.5 5 10 20 1 ns ns ns ns 6 ns ns p≤0.05 ns 24 ns ns ns p≤0.001

Table 4.3: Stadistic analysis of Cx astrocytes mRNA

4.3.3.2 Cerebellum derived astrocytes

In Cll astrocytes, the Cyp1A1 mRNA induction was moderately increased after 1 and 6h of βNF exposure, reaching the maximal upregulation of 5fold (p≤0.05). After 24h of βNF treatment the expression increased even more, achieving the highest value with 10µM (13fold; p≤0.05) and then, as in Cx astrocytes, decreased to initial ones (3fold). Of notice, again this condition corre- sponded with the most toxic one for astrocytes (MTT 40% viability; p≤0.001) and

54 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF for this reason was not used in the following experiments. Cyp1A2 and Cyp2A3 in cerebellum astrocytes were not clearly induced at any βNF concentration and timing.

Ugt1A1 mRNA expression was also analyzed in both primary culture but in neither was induced at any condition.

4.3.4 Optimal condition for selective Cyps enzyme activity analysis

The optimal conditions of Cyps induction were considered those (βNF concentration and timing) that allow the maximal upregulation of each speciﬁc Cyps, together with the minimal/null modulation of the others Cyps (maximal selective induction). It was taken into account both the mRNA expression and the viability (Table 4.5).

4.3.5 EROD and MROD activity

Once selected the optimal conditions, we performed the activity tests. In each optimal condition, the EROD (Cyp1A1; refered as protein) and MROD (Cyp1A2; refered as protein) tests were assessed in order to corroborate the mRNA modulation with the functional induction.

55 4. RESULTS

Figure 4.9: mRNA inducibility in Cll astrocytes treated with βNF. Cyp1A1, Cyp1A2 and Cyp2A3 mRNA expression of treated Cll atrocytes with NF diﬀerent concentrations and timing (2.5, 5, 10, 20µM and 1, 6, 24h, respectively). Control cells were treated with the vehicle (DMSO). Data are mean SD of 4-5 independent experiments. Statistical analysis is detailed in Table 4.4.

56 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF

Cerebellum

Cyp1A1 µM βNF Hours 2.5 5 10 20 1 ns ns ns ns 6 p≤0.05 p≤0.05 ns p≤0.01 24 p≤0.05 p≤0.05 p≤0.01 p≤0.05

Cyp1A2 µM βNF Hours 2.5 5 10 20 1 ns ns ns ns 6 ns p≤0.05 ns p≤¡0.05 24 p≤0.05 ns ns ns

Cyp2A3 µM βNF Hours 2.5 5 10 20 1 p≤0.05 ns ns ns 6 ns p≤0,01 ns ns 24 ns ns ns ns

Table 4.4: Stadistic analysis of Cll astrocytes mRNA

4.3.5.1 Cortex derived astrocytes

The assays showed that in Cx astrocytes, when Cyp1A1 was selectively induced the EROD test was 4fold increased (p≤0.01). In the same condition, the MROD test was slightly but signiﬁcantly increased (1.4fold, p≤0.05) (Fig. 4.10). Under the Cyp1A2 optimal condition the activity tests revealed that both assays were signiﬁcantly augmented, showing 4fold (p≤0.01) for EROD and 5fold (p≤0.05) for MROD test (Fig. 4.11).

57 4. RESULTS

4.3.5.2 Cerebellum derived astrocytes

In Cll astrocyte culture, under Cyp1A1 optimal condition, EROD assay was principally induced having 2.5fold of increment (p≤0.01), with a concomitant MROD activity increase of about 1.5fold (p≤0.05) (Fig. 4.10). Under the optimal condition for Cyp1a2 (2fold mRNA, table 4.5) there was no upregulation in neither of the activities test (Fig. 4.11).

58 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF 0.001. ≤ : 2 : 4.47 : 1.18 : 0.99 0.01; ***p ≤ Cyp2A3 Cyp1A1 Cyp1A2 Cyp2A3 0.05; **p ≤ NF 13.65 ** NF 1,72 β β M M µ µ 6h; 20 24h; 10 : 2.3 : 7.85 : 1.52 : 1.44 Cyp2A3 Cyp1A1 Cyp2A3 Cyp1A2 Optimal conditions of Cx and Cll astrocytes NF 6.7 * NF 7.5 *** β β Table 4.5: Cortex Cerebellum M M µ µ Condition mRNA fold change Condition mRNA fold change 6h; 10 24h; 10 Cyp1A2 Cyp1A1 NF condition. Results are expresed as mean of 4-5 independent biological respetitions. Statistical relevance *p β Large number showed the condition forthe the same maximal selective induction of each Cyp. Small numbers detailed the mRNA upregulation of the other two Cyps at

59 4. RESULTS

Figure 4.10: EROD and MROD activity in cells under the optimal condition for Cyp1A1. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent when compared to control (*p≤0.05,**p≤0.01).

60 4.3 Inducibility of Cyps enzymes in Cx and Cll astrocytes by βNF

Figure 4.11: EROD and MROD activity in cells under the optimal condition for Cyp1A2. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent when compared to control (*p≤0.05,**p≤0.01).

4.3.6 Speciﬁcity of EROD/MROD activity

Moreover, to analyze the contribution of each Cyp to the activity tests, a Cyps inhibitor (ﬂuvoxamine) was used. Fluvoxamine inhibits only Cyp1A2 at lower concentrations (0.25µM) while at higher both Cyps are inhibited (100µM). The same functional assays were performed as detailed above with the addition of ﬂuvoxamine at low concentration (0.25µM) to inhibit selectively Cyp1A2. What we expected to observe was normal EROD activity (Cyp1A1) and inhibited MROD (Cyp1a2) test.

61 4. RESULTS

For this reason we decide to analyzed Cx astrocytes treated for Cyp1A2 condition, where both mRNA and activity test were upregulated. The assay consisted in perform the activity tests with or without the presence of the inhibitor. The inhibition with ﬂuvoxamine showed that only the MROD test was inhibited (no signal) whereas EROD test was similar to the samples without inhibitor corroborating the speciﬁcity of the tests (not shown).

4.4 Bilirubin Oxidation

4.4.1 Bilirubin Oxidation in βNF induced astrocytes

After selective induction of Cyps in Cx and Cll astrocytes we proceed to extract the membrane fraction and evaluate the capacity of these Cyps to oxidize bilirubin. 40µg of protein were incubated in presence of 15µM of bilirubin. The test was initiated by the addition of NADPH (137µM) (Table 4.6). Again, the liver model (HepG2 cell line) was used as control due to its expected maximal activity.

The results showed, as expected, a higher constitutive capacity to oxidize bilirubin in liver cells than astrocytes treated with βNF. After the treatment a double of activity in HepG2 cells was observed. By HPLC analysis, some glucuronidation products were detected due to Ugt1A1 activity (mRNA 4fold upregualted). For astrocytes no glucuronidation products were observed.

4.4.1.1 Cortex derived astrocytes membrane fraction

In Cx astrocytes under Cyp1A1 treatment was observed a slight, but not statistically signiﬁcant increase in bilirubin oxidation. However, under the Cyp1A2

62 4.4 Bilirubin Oxidation optimal condition we reported a signiﬁcant increment in the bilirubin oxidation compared to control (132%; p≤0.05).

4.4.1.2 Cerebellum derived astrocytes membrane fraction

In Cll derived astrocytes there were no mayor diﬀerences in bilirubin oxidation under Cyp1A1 optimal condition. When it was assessed bilirubin clearance at the condition for Cyp1A2 speciﬁc induction, even a slight decrease was observed compared to control.

4.4.2 Bilirubin Oxidation by βNF induced astrocytes with TCB

In liver, it has been studied that when Cyp1A1 was incubated with planar polyhalogenated biphenyl substrates (such TCB), the capacity to oxidize bilirubin was increased (28, 145). In order to evaluate if Cyp1A1 in brain astrocytes behaves in the same manner, membrane fraction were challenged with BR and TCB (3.42µM) (30). The reaction started with the addition of NADPH (same protocol as described above) (Table 4.6).

We observed that the addition of TCB produced a high increment in bilirubin oxidation initial rate. For Cx astrocytes under optimal condition for Cyp1A1, a marked increase was observed (137% samples with TCB compared to control with TCB; p≤0.05), demonstrating that TCB activates its capacity to oxidize bilirubin. Moreover, in astrocytes under optimal condition for Cyp1A2 (both Cyp1A1 and Cyp1A2 mRNA and activity were induced) the same increment was observed as Cyp1A1 condition (140% samples with TCB compared to control with TCB; p≤0.05).

63 4. RESULTS

For Cll samples under the optimal condition for Cyp1A1, when TCB was added a marked increase was observed (212% samples with TCB compared to control with TCB; p≤0.05). Under the optimal condition for Cyp1A2, TCB addition produced an increment in the rate of bilirubin oxidation (228% samples with TCB compared to control with TCB; p≤0.05). In this latter condition Cyp1A1 was also increased 4 folds in mRNA expression. (Controls means cells induced with βNF but without TCB).

4.5 Viability challenge

4.5.1 Treatments with βNF (with or without TCB) and bilirubin

The last step was to evaluate if the Cyps modulation (mRNA and activity) that we detailed until now, was translated in an increased protection of astrocytes towards bilribuin toxicity. In order to asses Cyps protection, MTT test was performed in cells ﬁrstly induced by βNF and then exposed to bilirubin. Based on the laboratory background, cells have been challenged with 140nM of bilirubin for 24h leads to a viability compromising of about 40-50%.

4.5.1.1 Cortex derived astrocytes

The selective treatment for Cyp1A1 induction (βNF) in Cx, leaded to a 10% decrease in viability (39%; p≤0.001), reversed by TCB addition (58%; p≤0.001).

On the other hand, when Cyp1A2 was induced in Cx astrocytes the viability was signiﬁcantly increased vs. uninduced cells (44%; p≤0.05). Unfortunately, the

64 4.5 Viability challenge complete protection was not reached. The addition of TCB, further improved the viability (56%, p≤0.05) (Fig.4.12).

Figure 4.12: Bilirubin viability challenge in cortex Treated astrocytes with βNF (with or without TCB) were loaded with 140nM of bilirubin. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent when compared to control with bilirubin (*p≤0.05,**p≤0.001).

4.5.1.2 Cerebellum derived astrocytes

For cerebellum astrocytes, under the optimal condition for Cyp1A1, the viability without TCB was even lower than cells with no βNF treatment (50%; not signiﬁcant). When TCB was present the viability increased (62%, p≤0.05) corroborating what observed in bilirubin oxidation experiment.

Under the optimal condition for Cyp1A2 induction, in which bilirubin oxidation was slightly inhibited, the viability was reduced about 5% compared to cells treated only with bilirubin (49%; p≤0.05). The same assay with TCB showed a slight increment (not signiﬁcant 58%) in viability compared to astrocytes with bilirubin (Fig.4.13).

65 4. RESULTS

Figure 4.13: Bilirubin viability challenge in cerebellum Treated astrocytes with BNF (with or without TCB) were loaded with 140nM of bilirubin. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent when compared to control with bilirubin (*p≤0.05).

4.6 Cyps inducibility and activity by UCB

To analyze if bilirubin itself was able to induce Cyps mRNA expression (44) and activity and if the modulation was similar to βNF exposure, primary astrocytes cultures were treated with 25µM (Bf:140nM) of bilirubin for 2h.

4.6.1 Cyps mRNA expression

The mRNA analysis revealed that in both primary culture Cyp1A1 was significantly upregulated (5fold; p≤0.001 for Cx and 3.3fold; p≤0.01 for Cll). Cyp1A2 was also increase in both Cx and Cll derived astrocytes but only statistically relevant in Cx (3.7fold; p≤0.05 vs. 2.5fold; no statistically signiﬁcant, respectively). Cyp2A3 expression was moderately increased in both primary culture but neither signiﬁcantly (Cx; 2fold; Cll: 1.5fold)(Fig. 4.14). Ugt1A1 mRNA was not induced in neither cultures.

66 4.6 Cyps inducibility and activity by UCB

Figure 4.14: mRNA relative expression of Cx and Cll astrocytes treated with UCB. mRNA relative expression of Cyp1A1, Cyp1A2, Cyp2A3 in astrocytes from cortex (A) and cerebellum (B). Values were normalized versus the expression of the house keeping genes Gapdh, Hprt, Actin. Relative expression levels were calculated with respect the normalized expression of control samples (DMSO). Data are mean S.D. of 4-5 independent experiments. Statistically relevant when compared to control (*p≤0.05, **p≤0.01).

67 4. RESULTS

4.6.2 Viability tests

Cell viability of treated astrocytes was unchanged after treatment by trypan blue, while MTT showed a moderately decrease of 20-30% (Table 4.7).

4.6.3 EROD and MROD activity

Bilirubin treated astrocytes were harvested and membrane fraction was extracted as detailed in section 3.9. For the activity assays the membrane fractions were resuspended in EROD/MROD buffer and incubated with the substrate (ethoxyresorufin or methoxyresorufin, respectively) at 37◦C for 5 min. The reaction was started by addition of NADPH (1µM final concentration). Fluorescence was recorded over the time (90min).

The EROD and MROD activity in treated Cx astrocytes (Fig. 4.15A) showed a significant increase (1.3fold and 2.8fold, respectively, both p≤0.05). The same trend was observed by Cll astrocytes (fig.4.15B) in which both test were upregulated but only EROD test was significant (1.16fold p≤0.05 and 1.54fold, respectively).

4.6.4 Additional controls under excluded conditions

Viability challenge assays were performed in the excluded condition as an additional controls. As the maximal modulation of Cyp1A2 (mRNA) was reached at the toxic concentration of βNF (20µM; 24h), we wondered to evaluate a possible beneﬁt in term of viability vs. bilirubin challenge. It was performed the same assays above described but with 20µM of βNF. The viability was less highly than the control cells with bilirubin, conﬁrming that at this condition the cells are stressed as shown by MTT test and Cyps were unable to protect the cells despite

68 4.6 Cyps inducibility and activity by UCB

Figure 4.15: EROD and MROD activity in Cx and Cll astrocytes treated with UCB. EROD/MROD activity in Cx (A) and Cll (B) astrocytes loaded with 25µM for 2h. Data are mean SD of 4-5 independent experiments. Signiﬁcantly diﬀerent when compared to control (*p≤0.05). the huge mRNA upregulation. This comforted us about the decision to exclude the critical viability condition.

Moreover, in order to evaluate if bilirubin could predispose Cyps upregulation to have an an additional increment in viability when incubated with βNF. We performed a pretreatment with bilirubin of 140nM for 2h and then treated with βNF. Unlikely, the results for bilirubin viability challenge were the same as obtained without this preincubation (n=1).

69 4. RESULTS 3 aaaemean are Data srctsClCyp1A2 Cll Astrocytes srctsC Cyp1A2 Cx Astrocytes ape ihu C s ape ihTCB with samples vs. TCB without samples srctsClCyp1A1 Cll Astrocytes srctsC Cyp1A1 Cx Astrocytes ± Do - needn xeiet.Sgicnl ieetwe oprdto compared when diﬀerent Signiﬁcantly experiments. independent 4-5 of SD HepG2 432.5 320.8 248.1 al 4.6: Table 214 8 59133.7 95,9 180 Control ± ± ± ± nta aeo ososre po fbilirubin/min) of (pmol observed loss of rate Initial 02259 80.2 0. 837.5 200.6 4. 425 143.5 94231.25 89.4 iiui xdto nta aeb nue Cyps induced by rate initial oxidation Bilirubin β ± ± FCnrl+TCB + Control NF ± ± ± 8. 900 189.1 17900 91.7 5. p 259.4 97350 79.7 17431.67 81.7 1 ± ± ocnrlsample, control to ± ± 7, 1233.3 173,2 8, 1266.7 280,5 66800 86.6 3. 912.5 137.8 β 2 F+TCB + NF apewt C s oto ihTCB, with control vs. TCB with sample ± ± ± ± 3. ns 132.3 5. ns 256.3 2. ns 125.8 9. p 394.8 ≤ 0.05 1 1 P ; p ; 1 ;p 1 ≤ ≤ ≤ p ; 0.05 0.05 0.05 ≤ ≤ 0.05 0.05 2 2 2 p ; p ; p ; 1 2 ≤ ≤ ≤ p ; 0.001 0.001 0.01 ≤ 0.01 3 3 3 703 4.6 Cyps inducibility and activity by UCB

viability assays

Trypan Blue MTT Cortex astrocytes 99% 70.2% (p≤0.001) Cerebellum asotrocytes 99% 80% (p≤0.01)

Table 4.7: Viability percentage of astrocytes treated with UCB. Cells from Cx and Cll loaded with UCB 140nM for 2h and viability tests were performed.

71 4. RESULTS

4.7 Additional results

4.7.1 Protein analysis

To analyze the different behavior of Cyps among the regions Cyp1A1/Cyp1A2 were evaluated by SDS-PAGE Western blot analysis. As a positive control was used rat liver. As Cyps isoforms shared more than 55% of the aminoacidity chain, the selection of a specific antibody was difficult. For the Cyp1A2, the antibody did no work well. Only recognized human liver samples (despite the company stated that recognize rat) (not shown). Cyp1A1 protein was properly detected and showed the same molecular weight as rat liver sample in Cx and Cll samples 4.16.

Figure 4.16: Western blot analysis of Cyp1A1 Positive control Rat liver microsomes (line 1). Cerebellum (line 2,3) and Cortex (line 4,5) membrane fraction from astrocytes in line 2;3 and 4;5, respectively.

4.7.2 Signaling

To understand the diﬀerent possible mechanisms of Cyps activation by βNF vs. bilirubin, and between the two astrocytes preparations (cortex and cerebellum), we performed further analysis by RT-PCR. Cyps regulation was mainly reported due to Nrf2 and Ahr pathway (53, 78), so we analyzed them.

The analysis was performed in βNF treated cells after 6 and 24h and bilirubin treated astrocytes. Samples of 1h treated by βNF were not analyzed as we

72 4.7 Additional results did not observe any clear upregulation of the Cyps. Again firstly we analyzed the constitutive difference between Cx and Cll. Cx astrocytes revealed 2 fold higher Nrf2 mRNA expression than Cll (p≤0.05), for the Ahr no differences were observed (Fig.4.17).

Figure 4.17: Ahr and Nrf2 mRNA constitutive expression in Cx and Cll astrocytes Values were normalized versus the expression of the house keeping genes Gapdh, Hprt. Cerebellar samples were considered as 1. Data are mean S.D. of 4-5 independent experiments. Statistically relevant when compared to contro (*p≤0.05).

The Ahr mRNA in Cx astrocytes was upregulated only after 24h at 10 and 20µM. For Cll astrocytes it was induced at the higher concentration of βNF (20µM) at 6 and 24h, in a higher extent compared to Cx (Fig. 4.18). At 6h in both cultures the Nrf2 expression increased slightly with the concentration of the drug. After 24h of treatment the increment was more markedly, reaching the maximum value at the higher concentration (20µM; critical viability). Again in Cll cells the extent was higher compared to Cx cells (Fig.4.19).

For bilirubin treated astrocytes, from both regions the Ahr was downregulated (p≤0.01 in Cx). On the other hand, the Nrf2 behaved diﬀerently between Cx and Cll astrocytes. For Cx astrocytes a signiﬁcant decrease was observed (p≤0.01) while in Cll astrocytes was increased 1.5fold (p≤0.01) (Fig. 4.20).

73 4. RESULTS

Figure 4.18: Ahr mRNA relative expression in Cx and Cll astrocytes treated with βNF. Values were normalized versus the expression of the house keeping genesGapdh, Hprt. Relative expression levels were calculated with respect the normalized expression of control samples (DMSO). Data are mean S.D. of 4-5 independent experiments. Statistically relevant when compared to control.

74 4.7 Additional results

Figure 4.19: Nrf2 mRNA relative expression in Cx and Cll astrocytes treated with βNF. Values were normalized versus the expression of the house keeping genesGapdh, Hprt. Relative expression levels were calculated with respect the normalized expression of control samples (DMSO). Data are mean S.D. of 4-5 independent experiments. Statistically relevant when compared to control (*p≤0.05, **p≤0.01).

75 4. RESULTS

Figure 4.20: Ahr and Nrf2 mRNA relative expression in astrocytes treated with UCB. Values were normalized versus the expression of the house keeping genes Gapdh, Hprt. Relative expression levels were calculated with respect the normalized expression of each control samples (DMSO). Data are mean S.D. of 4-5 independent experiments. Statistically relevant when compared to control (**p≤0.01).

76 5

Discussion

Cyotochrome P450 enzymes are the main enzymes involved in the detoxiﬁca- tion of drug and endogenous compounds. In liver, their role in bilirubin oxidation has been deeply demonstrated (2, 3, 27, 145). From those studies, human and rat Cyp1A1 and Cyp1A2 seem the most important enzymes in bilirubin detoxiﬁca- tion when conjugations is inhibited or reduced. A similar role has been discovered for Cyp2A5 (corresponding to Cyp2A3 in rat, CYP2A6 in human) in mice. In addition, by the use of the Gunn rat, a model for Crigler-Najjar Type I syndrome, it was shown that jaundiced newborn animals displayed an upregulation of Cyp1A1 and Cyp1A2 in liver compared with their not jaundiced littermates (70). Further- more, their mRNA expression in brain was selectively induced (cortex, resistant to UCB toxicity, higher and early vs. cerebellum, macroscopically damaged, hypoplasia, lower and delayed induction) by sulphadimethoxine injection (bilirubin displacing agent) (44).

Despite that many works analyzed brain Cyps expression and induction, their role in bilirubin oxidation has never been evaluated till now. The only demonstration of a bilirubin oxidative activity in the CNS became from the ﬁndings of Hansen. His works supported the concept of bilirubin oxidation in brain by an

77 5. DISCUSSION

unidentiﬁed enzyme called “bilirubin oxidase”. Despite sometime supposed be- longing to Cyps family; the “bilirubin oxidase” had some characteristic that was not quite in concordance with the cytochrome P450 enzymes (55, 56). Waiting for identiﬁcation of “bilirubin oxidase”, we focused our work on Cyps.

Although it was shown the presence of Cyp1A1 and Cyp1A2 in rats brain, their distribution is contradictory (49, 61, 73, 83, 95). Between cell types it has been shown that neuronal cells have higher constitutive expression than glial cells. However, the inducibility is higher in the latter ones (73). For these reason we chose to work with astrocytes primary cultures.

By the experiments performed in this thesis, we demonstrated that in both Cx and Cll astrocytes treated by βNF, the principal Cyp to be induced was the Cyp1A1, the Cyp1A2 was up-regulated only in cortex preparation, and Cyp2A3 was not possible to modulate without affecting the cellular viability (assessed by MTT). Under optimal condition for the selective induction of each Cyp in cortex derived cultures, a significant and specific (demonstrated by fluvoxamine experiments) increase in the activity tests (EROD for Cyp1A1, MROD for Cyp1A2) was detected, confirming the good correlation between mRNA and activity al- ready suggested by Kapoor (73). This was not evident in cerebellum astrocytes, maybe due to the low mRNA up-regulation reached by the treatment (Cyp1A1/ Cyp1A2 : 4fold and 2fold in Cll, vs. 7fold and 8fold in Cx), possibly not sufficient to have a relevant protein modulation. These in vitro results are in agreement with data obtained in living animals exposed to βNF. Iba works (61) described a Cyp1A1 and Cyp1A2 constitutive expression (protein and activity) in both cerebellum and cortex with different induction pattern by βNF. Both regions resulted in a significant increase in Cyp1A1 activity, but with a higher extent in cortex. In concordance to our results, an incresed activity of the Cyp1A2 was observed only in cortex. It is important also to point out that our result of EROD and MROD increment were higher (Cx: 4 and 5fold; Cll: 2.5 and 1fold, respectively vs. Iba et al. Cx: 1.9 and 3.7fold; Cll: 1.5 and 0.4fold, respectively). These differences could be due to the treatment and samples used, in vivo vs. in vitro and tissue microsomes of treated rats vs. astrocytes treated membrane fraction. Liu

78 (83) used 3-MC as inducer and analyzed Cyp1A induction, showing a signiﬁcant increase in EROD test after 3 days of treatment and ROS generation. Unlikely, the whole brain homogenates were used in this study.

Of interest, despite both cellular preparations were quite pure astrocytes cultures, as characterized by GFAP staining (Fig. 4.5), we immediately observed differences in the Cyps behavior. The Cyp1A1, Cyp1A2 and Cyp2A3 constitutive level were slightly higher in Cx astrocytes compared to Cll cells, reaching 3 fold (p≤0.05) for Cyp1A1 (Fig.4.6). Furthermore, the induction of Cyps by βNF was different in timing and extent in the different regions. Cyp1A1 induction in Cx astrocytes was an early event (6h) while in Cll the higher induction was reached only after 24h. Moreover, Cyp1A2 was induced in Cortex after 24h while in Cll was not clearly induced. Cyp2A3 in Cx was upregulated only at the critical condition of viability, whereas in Cll was not upregulated (Fig. 4.8, 4.9). Of notice, the strong difference in the Cyp1a1, 1a2 and 2a3 modulation by βNF, among them and between the two “regions” may be explained in several ways. First, we hypothesized the presence of different isoforms of Cyps between Cx and Cll astrocytes, and between brain and liver. The Western blot results, seemed to indicate that this was not the answer as no differences in molecular weight (nor among brain areas, nor among brain and liver) were detected, at least for Cyp1A1. Second, despite the brain is commonly considered “an organ”; it is, in fact, a heterogeneous assembling of different regions, each of them possessing different cellular populations. Among them, astrocytes also comprise different types of cells (43, 87), making possible that the two preparations were representative of different “kind of astrocytes”. Third, the differential behavior that we described (Cx vs. Cll derived astrocytes) may be due to a different maturational stage of the two region (and contained cells) at the moment of the tissue dissection (P2 rats). It is well known that in rodents the cerebellum possess a delayed development respect to the cortex (8, 117).

When we evaluated the bilirubin oxidation in astrocytes under the optimal conditions to selectively induce each Cyp, a signiﬁcant increase in the rate of

79 5. DISCUSSION

bilirubin oxidation was recorded only after Cyp1A2 specific induction in Cx astrocytes, without any effect on bilirubin clearance under Cyp1A1 specific upregulation (Table 4.6). This leaded to consider that a delakylation reactions (EROD/MROD) by cyotochrome P450 enzymes did not reflect the capacity of Cyps to oxidize bilirubin. Thus, a proper analysis of the efficacy in protecting toward bilirubin toxicity cannot be assessed with EROD/MROD assays, must include a direct bilirubin clearance test. Moreover, we corroborated that Cyp1A2 seemed to be the principal brain Cyp involved in bilirubin oxidation in “physiological conditions”, in agreement with previous finding in hepatocyte models (107) and in mice (145).

In addition to the cited works (performed quite exclusively in liver models), the dual role (monooxygenation and uncoupled activity) of Cyps is explained by other studies (26). Usually Cyp1A2 is principally involved in bilirubin oxidation in “physiological conditions”, due to its partially uncoupled state. Under the same conditions, Cyp1A1 possess only limited enzymatic ability to degrade bilirubin. Polyhalogenated biphenyl compounds (such as TCB in an appropriate conﬁguration), interact with the enzyme active site of Cyp1A1, uncoupling the enzyme and producing the reactive oxygen species (ROS), which may oxidize the bilirubin. Similarly, in our cultures when TCB was added in astrocytes and Cyp1A1 induced, the enzyme became more able to oxidize bilirubin (both Cx and Cll culture, p≤0.05). An interesting point was that in optimal condition for Cyp1A2, in which both Cyps were induced (mRNA and activity), no synergic effect was observed. This is perfectly in agreement with the ﬁndings of Pons in liver Cyps supersome and in mice by Zaccaro showing that TCB only favor Cyp1A1 bilirubin oxidation and diminish at the same time Cyp1A2 activity (107, 145).

Because bilirubin degradation may play both across the direct Cyps enzymatic activity and the degradation by Cyps uncoupling (ROS species) and the latter alternative could be dangerous to the cell, we needed, the most important information: the viability after induction ± uncoupling. The MTT assay demonstrated that under the optimal condition for Cyp1A1 selective induction in Cx and Cll (whitout TCB), the viability was even slightly reduced when compared

80 to cells loaded with bilirubin alone. These results were in line with the absence of changes in bilirubin oxidation assay. On the contrary, when TCB was present, a significant increase in viability was assessed in both cultures (p≤0.05). After Cyp1A2 induction (without TCB) a slight but significant increase in MTT was shown in cortex, again in concordance with the capacity to oxidize bilirubin. The addition of TCB incremented even more the viability. So, an improvement of viability was finally reached in Cll, when Cyp1A1 was induced and uncoupled by TCB, in concordance with the bilirubin oxidation assay (Fig. 4.12, 4.13). This allowed us to confirm that, in the experimental condition that we tested, the uncoupling of Cyps improve the viability by reducing the bilirubin toxicity to the cell. Of notice, the HPLC analysis of products of bilirubin degradation by Cyps, revealed that brain Cyps clearance became by oxidation (no glucoronidation product detected), while in the liver model (HepG2) partial bilirubin disappearance may be due to glucoronidation (products detected in the media).

This study started from an in vivo background, suggesting a role for brain Cyps in CNS defense toward bilirubin, that we supposed due to their huge rise in tissue. To conclude this work, we assessed brain Cyp modulation by bilirubin itself. We obtained a similar trend of mRNA Cyps induction for all them (1A1, 1A2 and 2A3 ) in astrocytes of both regions (Cx and Cll), but in higher extent in cortex (p≤0.001, p≤0.01), in agreement with Gazzin (44).

Again we faced a different (in this case in extent) modulation between brain regions challenged with the same inducer. This may induce to consider the possibility that the modulation of a target gene in a specific brain region may depend from a heterogeneous presence of the signaling pathway (being different between βNF vs. bilirubin and between the regions). Looking for bibliography, it was difficult to find information about a regional pathways in different brain regions. But if we consider that each brain region has different cell population, each with their particular genes and protein expression, some differences are expected. Our brief signaling study revealed that the constitutive expression of Nrf2 was significantly higher in Cx compared to Cll, while no differences were detected for the Ahr gene (Fig. 4.17). Moreover, in Cll astrocytes treated with bilirubin the

81 5. DISCUSSION

Nrf2 was the only upregulated gene (p≤0.01) indicating some diﬀerent regulation between Cx and Cll (Fig. 4.20) supposing that UCB may skip Ahr receptor and act “directly” on Nrf2. After βNF treatment, the Ahr was only induced at the maximal concentration of βNF (20µM) after 6 and 24h in Cll and in Cx only at the condition excluded by MTT test (20µM; 24h). As it is known that the βNF works by Ahr receptor (118) and that transcription of downstream genes might play only through the protein nuclear translocation and not through the mRNA upregulation, protein analysis should be the ideal analysis. For the Nrf2 gene in both astrocytes cultures we observed a drug dependant increase, markedly at the critical condition (20µM; 24h) (Fig 4.18, 4.19). Of course this data should be con- ﬁrmed by Nrf2 nuclear translocation as Nrf2 is modulated principally by protein traslocation from cytoplasm to the nucleus and moreover ROS production.

In addition, our data might allow us speculate to a different subcellular localization between Cyp1A1 and Cyp1A2/2A3. In fact, when the maximal challenging with βNF, induce mitochondrial toxicity (showed by the MTT test) (Fig. 4.7), in this condition a markedly increase of Nrf2 mRNA expression, marker of oxidative stress, was observed (Fig. 4.19). Furthermore, an specific decrease of Cyp1A1 mRNA (on both Cx and Cll cultures) was observed. We could hy- pothesize, that this Cyp could be located on the mitochondria. On the contrary, under the same extreme challenging condition (and toxicity), Cyp1A2/2A3 were upregulated (in cx astrocytes) (Fig. 4.8, 4.9). This might suggest a different subcellular localization; less sensitive to mitochondrial alteration, such microsomes. This hypothesis should be evaluated by collecting the subcellular fractions (nuclear, mithocondrial and microsomal) and assessing the presence of Cyps in each fraction by Western blot analysis.

82 6

Conclusions

• The Cyps mRNA inducibility by βNF was diﬀerent in extent and timing between Cx and Cll astrocytes. The Cx have an early response by Cyp1A1 (6h) and then by Cyp1A2 (24h), while Cll only late response of Cyp1A1 (24h). Cyp2A3 was only induced at the critical condition in Cx and not induced in Cll.

• The diﬃculties in induction (mRNA and activity) cerebellar Cyps leave unprotected the Cll (most damaged region in rodents by bilirubin (15, 45)) under “physiological conditions”.

• Cyp1A1 was induced in both primary cultures (mRNA and activity) but produced no changes in bilirubin oxidation. The addition of TCB, uncoupled the Cyp1A1, increasing the bilirubin oxidation capacity and improving the viability, importantly in cerebellar astrocytes.

• Cyp1A2 was induced by βNF only in cortex (mRNA and activity) and bilirubin was oxidized by this enzyme without the need of TCB.

• Bilirubin was able to induce Cyps mRNA expression and activity, corroborating our hypothesis of a bilirubin role in vivo. In agreement, Cyp1A1 and

83 6. CONCLUSIONS

Cyp1A2 induction from cortex was higher compared to Cll. Cyp2A3 was not signiﬁcantly induced by BR in vitro, despite a trend of upregulation.

• This study revealed that Cyp1a1 and Cyp1a2 in astrocytes are inducible and able to oxidize bilirubin. Viability studies revealed that Cyps were active to protect cells form bilirubin damage, particularly in cerebellum (damaged region).

• Further studies should be performed to elucidate if the induction by βNF and uncoupling agents could overcome the bilirubin damage in vivo, as a possible treatment to bilirubin encephalopathy.

• βNF and bilirubin produced diﬀerent Cyps induction behavior, suggesting that might work by diﬀerent pathways. This study should be continue by evaluation of Nrf2 and Ahr nuclear translocation, to improve the possibility to modulate cerebral Cyps, specially from cerebellum.

• Finally, as the Cyps maximal protection, by bilirubin oxidation, play across uncoupling and ROS generation, ROS must be evaluated in the future experiments.

84 7

Publications

“Brain Cytochrome P450 enzymes in bilirubin oxidation: speciﬁc induction and activity-” Sabrina Eliana Gambaro, Maria Celeste Robert, Claudio Tiribelli and Silvia Gazzin. In preparation.

“Alterations in the cell cycle in the cerebellum of hyperbilirubinemic Gunn rat: A possible link with apoptosis?” Maria Celeste Robert; Giulia Furlan; Natalia Rosso; Sabrina Eliana Gambaro; Faina Apitsiona; Eleonora Vianello; Donald Ostrow; Claudio Tiribelli; Silvia Gazzin. PLOS ONE, 2013 Nov 1;8(11).

“Cytochrome P450 enzymes speciﬁc expression and modulation in brain as a tool to treat bilirubin encephalopathy” Sabrina Eliana Gambaro; Silvia Gazzin; Claudio Tiribelli. FEBS Journal Suppl 1 280: 420, 2013.

Oral Presentations:

“Brain Cyps in bilirubin oxidation: speciﬁc inducibility and activ-

85 7. PUBLICATIONS ity” Don Ostrow Trieste Yellow Retreat (TYR), Trieste, August 2013. Sabrina Eliana Gambaro, Silvia Gazzin, Claudio Tiribelli.

Poster Presentations:

“Diﬀerent regional Cytochrome P450 enzymes expression and activity may help understanding and treating bilirubin encephalopathy” First FVG PhD Simposium 7-9 of October 2013. Sabrina Eliana Gambaro; Silvia Gazzin; Claudio Tiribelli.

“Cytochrome P450 enzymes specic expression and modulation in brain as a tool to treat bilirubin encephalopathy” at the YSF Forum and the 38th FEBS Congress, St. Petersburg, Russia. 3-11 of July 2013. Sabrina Eliana Gambaro; Silvia Gazzin; Claudio Tiribelli.

“Constitutive and Inducible Levels of Cytochrome P450 enzymes related to Bilirubin-Induced Encephalopathy” at the 11th International Symposium on Cytochrome P450, Turin, Italy. 22-26 of June 2012. Title: Gam- baro, S.E.; Gazzin S.; Robert, M.C.; Tiribelli, C.

“Study on the role of Cytochrome P450 in bilirubin induced encephalopathy” at the International Symposium on biology and translational aspects if neurodegeneration, Venice, Italy. 12-14 of march 2012. Gambaro, S.E.; Gazzin S.; Robert, M.C.; Tiribelli, C.

86 Acknowledgments

87 7. PUBLICATIONS

88 References

[1] A. Abu-Bakar, D.M. Arthur, S. Aganovic, J.C. Ng, and M.A. Lang. Inducible bilirubin oxidase: a novel function for the mouse cytochrome p450 2a5. Toxicol.Appl.Pharmacol., 257(1):14–22, November 2011. 21

[2] A. Abu-Bakar, D.M. Arthur, A.S. Wikman, M. Rahnasto, R.O. Juvo- nen, J. Vepsalainen, H. Raunio, J.C. Ng, and M.A. Lang. Metabolism of bilirubin by human cytochrome p450 2a6. Toxicol.Appl.Pharmacol., 261(1):50– 58, May 2012. 21, 44, 46, 77

[3] A. Abu-Bakar, M.R. Moore, and M.A. Lang. Evidence for induced microsomal bilirubin degradation by cytochrome p450 2a5. Biochem.Pharmacol., 70(10):1527–1535, November 2005. 21, 36, 77

[4] M. Ahdab-Barmada and J. Moossy. The neuropathology of kernicterus in the premature neonate: diagnostic problems. J Neuropathol Exp Neurol, 43(1):45–56, Jan 1984. 15

[5] C.E. Ahlfors. Measurement of plasma unbound unconjugated bilirubin. Anal.Biochem., 279(2):130–135, March 2000. 30

[6] C.E. Ahlfors. Bilirubin-albumin binding and free bilirubin. J.Perinatol., 21 Suppl 1:S40–S42, December 2001. 3

89 REFERENCES

[7] I. Allaman, M. Belanger, and P.J. Magistretti. Astrocyte-neuron metabolic relationships: for better and for worse. Trends Neurosci., 34(2):76–87, February 2011. 18

[8] J. Altman and G. D. Das. Autoradiographic and histological studies of postnatal neurogenesis. i. a longitudinal investigation of the kinetics, migration and transformation of cells incorporating tritiated thymidine in neonate rats, with special reference to postnatal neurogenesis in some brain regions. J Comp Neu- rol, 126(3):337–389, Mar 1966. 79

[9] Frederico A C. Azevedo, Ludmila R B. Carvalho, Lea T. Grinberg, Jos Marcelo Farfel, Renata E L. Ferretti, Renata E P. Leite, Wil- son Jacob Filho, Roberto Lent, and Suzana Herculano-Houzel. Equal numbers of neuronal and nonneuronal cells make the human brain an isometri- cally scaled-up primate brain. J Comp Neurol, 513(5):532–541, Apr 2009. 18

[10] S.V. Bhagwat, M.R. Boyd, and V. Ravindranath. Multiple forms of cytochrome p450 and associated monooxygenase activities in human brain mitochondria. Biochem.Pharmacol., 59(5):573–582, March 2000. 23

[11] Vinod K. Bhutani. Kernicterus as a ’never-event’: a newborn safety standard? Indian J Pediatr, 72(1):53–56, Jan 2005. 5

[12] Vinod K. Bhutani and Ronald J. Wong. Bilirubin neurotoxicity in preterm infants: risk and prevention. J Clin Neonatol, 2(2):61–69, Apr 2013. 15

[13] V.K. Bhutani. Phototherapy to prevent severe neonatal hyperbilirubinemia in the newborn infant 35 or more weeks of gestation. Pediatrics, 128(4):e1046– e1052, October 2011. 11, 14

[14] J. Booher and M. Sensenbrenner. Growth and cultivation of dissociated neurons and glial cells from embryonic chick, rat and human brain in ﬂask cultures. Neurobiology, 2(3):97–105, 1972. 29

90 REFERENCES

[15] Giulia Bortolussi, Lorena Zentilin, Gabriele Baj, Pablo Giraudi, Cristina Bellarosa, Mauro Giacca, Claudio Tiribelli, and Andrs F. Muro. Rescue of bilirubin-induced neonatal lethality in a mouse model of crigler- najjar syndrome type i by aav9-mediated gene transfer. FASEB J, 26(3):1052– 1063, Mar 2012. 15, 83

[16] J.D. Bosia, M.V. D’Ascenzo, S. Borzi, S. Cozzi, J.R. Defelitto, and J.O. Curciarello. [the dubin-johnson syndrome: case report and review of literature]. Acta Gastroenterol.Latinoam., 38(3):194–198, September 2008. 8

[17] P.J. Bosma, B. Goldhoorn, R.P. Oude Elferink, M. Sinaasappel, B.A. Oostra, and P.L. Jansen. A mutation in bilirubin uridine 5’-diphosphate- glucuronosyltransferase isoform 1 causing crigler-najjar syndrome type ii. Gas- troenterology, 105(1):216–220, July 1993. 8

[18] P.J. Bosma, J. Seppen, B. Goldhoorn, C. Bakker, R.P. Oude Elferink, J.R. Chowdhury, N.R. Chowdhury, and P.L. Jansen. Bilirubin udp- glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J.Biol.Chem., 269(27):17960–17964, July 1994. 3

[19] M.A. Brito. The human rbc as a model of unconjugated bilirubin binding and toxicity, 2006. 4

[20] M.A. Brito, D. Brites, and D.A. Butterfield. A link between hyperbilirubinemia, oxidative stress and injury to neocortical synaptosomes. Brain Res., 1026(1):33–43, November 2004. 10

[21] W. J. Cashore. The neurotoxicity of bilirubin. Clin Perinatol, 17(2):437–447, Jun 1990. 10

[22] J.R. Chowdhury, R. Kondapalli, and N.R. Chowdhury. Gunn rat: a model for inherited deﬁciency of bilirubin glucuronidation. Adv.Vet.Sci.Comp Med., 37:149–173, 1993. 15

91 REFERENCES

[23] J.W. Conlee and S.M. Shapiro. Development of cerebellar hypoplasia in jaundiced gunn rats: a quantitative light microscopic analysis. Acta Neuropathol., 93(5):450–460, May 1997. 15

[24] Jr Crigler, J.F and V.A. NAJJAR. Congenital familial nonhemolytic jaundice with kernicterus. Pediatrics, 10(2):169–180, August 1952. 7

[25] F.J. Cuperus, A.B. Schreuder, D.E. van Imhoff, L. Vitek, J. Vanikova, R. Konickova, C.E. Ahlfors, C.V. Hulzebos, and H.J. Verkade. Beyond plasma bilirubin: the eﬀects of phototherapy and albumin on brain bilirubin levels in gunn rats. J Hepatol., 58(1):134–140, January 2013. 11

[26] F. De Matteis, D.P. Ballou, M.J. Coon, R.W. Estabrook, and D.C. Haines. Peroxidase-like activity of uncoupled cytochrome p450: studies with bilirubin and toxicological implications of uncoupling. Biochem.Pharmacol., 84(3):374–382, August 2012. 19, 21, 36, 80

[27] F. De Matteis, S.J. Dawson, A.R. Boobis, and A. Comoglio. Inducible bilirubin-degrading system of rat liver microsomes: role of cytochrome p450ia1. Mol.Pharmacol., 40(5):686–691, November 1991. 21, 77

[28] F. De Matteis, S.J. Dawson, N. Pons, and S. Pipino. Bilirubin and uroporphyrinogen oxidation by induced cytochrome p4501a and cytochrome p4502b. role of polyhalogenated biphenyls of diﬀerent conﬁguration. Biochem.Pharmacol., 63(4):615–624, February 2002. 20, 22, 63

[29] F. De Matteis, G.A. Lord, Lim C. Kee, and N. Pons. Bilirubin degradation by uncoupled cytochrome p450. comparison with a chemical oxidation system and characterization of the products by high-performance liquid chro- matography/electrospray ionization mass spectrometry. Rapid Commun.Mass Spectrom., 20(8):1209–1217, 2006. 21

92 REFERENCES

[30] F. De Matteis, T. Trenti, A.H. Gibbs, and J.B. Greig. Inducible bilirubin- degrading system in the microsomal fraction of rat liver. Mol.Pharmacol., 35(6):831–838, June 1989. 37, 63

[31] F. Denizot and R. Lang. Rapid colorimetric assay for cell growth and survival. modiﬁcations to the tetrazolium dye procedure giving improved sensitivity and reliability. J.Immunol.Methods, 89(2):271–277, May 1986. 33

[32] P.A. Dennery, D.S. Seidman, and D.K. Stevenson. Neonatal hyperbilirubinemia. N.Engl.J.Med., 344(8):581–590, February 2001. 5

[33] A. Dhawan, D. Parmar, M. Das, and P.K. Seth. Cytochrome p-450 dependent monooxygenases in neuronal and glial cells: inducibility and speciﬁcity. Biochem.Biophys.Res.Commun., 170(2):441–447, July 1990. 22

[34] I. Diamond and R. Schmid. Experimental bilirubin encephalopathy. the mode of entry of bilirubin-14c into the central nervous system. J.Clin.Invest, 45(5):678– 689, May 1966. 4, 15

[35] B.T. Doumas, P.P. Kwok-Cheung, B.W. Perry, B. Jendrzejczak, R.B. McComb, R. Schaffer, and L.L. Hause. Candidate reference method for de- termination of total bilirubin in serum: development and validation. Clin.Chem., 31(11):1779–1789, November 1985. 4

[36] B.T. Doumas, T.W. Wu, K.C. Poon, and B. Jendrzejczak. Chemical nature of a synthetic bilirubin conjugate and its reactivities in the total and direct reactions by the jendrassik-grof method. Clin.Chem., 31(10):1677–1682, October 1985. 4

[37] F. Dutheil, P. Beaune, and M.A. Loriot. Xenobiotic metabolizing enzymes in the central nervous system: Contribution of cytochrome p450 enzymes in normal and pathological human brain. Biochimie, 90(3):426–436, March 2008. 23

93 REFERENCES

[38] A.S. Falcao, A. Fernandes, M.A. Brito, R.F. Silva, and D. Brites. Bilirubin-induced immunostimulant eﬀects and toxicity vary with neural cell type and maturation state. Acta Neuropathol.(Berl), 112(1):95–105, July 2006. 10, 18, 23

[39] Ana Sofia Falco, Rui F M. Silva, Ana Rita Vaz, Sandra Leito Silva, Adelaide Fernandes, and Dora Brites. Cross-talk between neurons and astrocytes in response to bilirubin: early beneﬁcial eﬀects. Neurochem Res, 38(3):644–659, Mar 2013. 19

[40] F.M. Farin and C.J. Omiecinski. Regiospeciﬁc expression of cytochrome p-450s and microsomal epoxide hydrolase in human brain tissue. J Toxi- col.Environ.Health, 40(2-3):317–335, October 1993. 23

[41] A. Fernandes, A.S. Falcao, R.F. Silva, A.C. Gordo, M.J. Gama, M.A. Brito, and D. Brites. Inﬂammatory signalling pathways involved in astroglial activation by unconjugated bilirubin. J.Neurochem., 96(6):1667–1679, March 2006. 25

[42] A. Fernandes, R.F. Silva, A.S. Falcao, M.A. Brito, and D. Brites. Cytokine production, glutamate release and cell death in rat cultured astrocytes treated with unconjugated bilirubin and lps. J.Neuroimmunol., 153(1-2):64–75, August 2004. 25

[43] Sylvia Fitting, Shiping Zou, Wen Chen, Phu Vo, Kurt F. Hauser, and Pamela E. Knapp. Regional heterogeneity and diversity in cytokine and chemokine production by astroglia: diﬀerential responses to hiv-1 tat, gp120, and morphine revealed by multiplex analysis. J Proteome Res, 9(4):1795–1804, Apr 2010. 18, 79

[44] S. Gazzin, J. Zelenka, L. Zdrahalova, R. Konickova, C.C. Zabetta, P.J. Giraudi, A.L. Berengeno, A. Raseni, M.C. Robert, L. Vitek, and

94 REFERENCES

C. Tiribelli. Bilirubin accumulation and cyp mrna expression in selected brain regions of jaundiced gunn rat pups. Pediatr.Res., 71(6):653–660, June 2012. 2, 3, 10, 23, 66, 77, 81

[45] Silvia Gazzin, Andrea Lorena Berengeno, Nathalie Strazielle, Francesco Fazzari, Alan Raseni, J Donald Ostrow, Richard Wennberg, Jean-Franois Ghersi-Egea, and Claudio Tiribelli. Mod- ulation of mrp1 (abcc1) and pgp (abcb1) by bilirubin at the blood-csf and blood- brain barriers in the gunn rat. PLoS One, 6(1):e16165, 2011. 83

[46] A.S. Geiger, A.C. Rice, and S.M. Shapiro. Minocycline blocks acute bilirubin-induced neurological dysfunction in jaundiced gunn rats. Neonatology., 92(4):219–226, 2007. 13

[47] J. George, K. Byth, and G.C. Farrell. Inﬂuence of clinicopathological variables on cyp protein expression in human liver. J Gastroenterol.Hepatol., 11(1):33–39, January 1996. 20

[48] J.F. Ghersi-Egea, S. Gazzin, and N. Strazielle. Blood-brain interfaces and bilirubin-induced neurological diseases. Curr.Pharm.Des, 15(25):2893–2907, 2009. 10

[49] J.F. Ghersi-Egea, R. Perrin, B. Leininger-Muller, M.C. Grassiot, C. Jeandel, J. Floquet, G. Cuny, G. Siest, and A. Minn. Subcellular localization of cytochrome p450, and activities of several enzymes responsible for drug metabolism in the human brain. Biochem.Pharmacol., 45(3):647–658, February 1993. 20, 23, 78

[50] G.R. Gourley. Bilirubin metabolism and kernicterus. Adv.Pediatr., 44:173– 229, 1997. 5

95 REFERENCES

[51] S. Grojean, V. Koziel, P. Vert, and J.L. Daval. Bilirubin induces apoptosis via activation of nmda receptors in developing rat brain neurons. Exp.Neurol., 166(2):334–341, December 2000. 10

[52] C.H. Gunn. Hereditary acholuric jaundice in a new mutant strain of rats. J.Hered., 29:137–139, 1938. 15

[53] E. Guyot, A. Chevallier, R. Barouki, and X. Coumoul. The ahr twist: ligand-dependent ahr signaling and pharmaco-toxicological implications. Drug Discov.Today, 18(9-10):479–486, May 2013. 20, 72

[54] Thor Willy Ruud Hansen, Lutz Nietsch, Elisabeth Norman, Jes- per Vandborg Bjerre, Jean-Michel Hascoet, Khalaf Mreihil, and Finn Ebbesen. Reversibility of acute intermediate phase bilirubin encephalopathy. Acta Paediatr, 98(10):1689–1694, Oct 2009. 7

[55] T.W. Hansen. Bilirubin oxidation in brain. Mol.Genet.Metab, 71(1-2):411–417, September 2000. 78

[56] T.W. Hansen and J.W. Allen. Oxidation of bilirubin by brain mitochondrial membranes–dependence on cell type and postnatal age. Biochem.Mol.Med., 60(2):155–160, April 1997. 22, 78

[57] S.C. Hauser, J.C. Ziurys, and J.L. Gollan. Subcellular distribution and regulation of hepatic bilirubin udp-glucuronyltransferase. J.Biol.Chem., 259(7):4527–4533, April 1984. 3

[58] S. Herculano-Houzel and R. Lent. Isotropic fractionator: a simple, rapid method for the quantiﬁcation of total cell and neuron numbers in the brain. J.Neurosci., 25(10):2518–2521, March 2005. 16

[59] D.J. Hoffman, S.A. Zanelli, J. Kubin, O.P. Mishra, and M. Delivoria- Papadopoulos. The in vivo eﬀect of bilirubin on the n-methyl-d-aspartate

96 REFERENCES

receptor/ion channel complex in the brains of newborn piglets. Pediatr.Res., 40(6):804–808, December 1996. 10

[60] S. Hosono, T. Ohno, H. Kimoto, R. Nagoshi, M. Shimizu, and M. Nozawa. Eﬀects of albumin infusion therapy on total and unbound bilirubin values in term infants with intensive phototherapy. Pediatr.Int., 43(1):8–11, February 2001. 11

[61] Michael M. Iba, Amijoy Storch, Anima Ghosal, Susan Bennett, Ken- neth R. Reuhl, and Herbert E. Lowndes. Constitutive and inducible levels of cyp1a1 and cyp1a2 in rat cerebral cortex and cerebellum. Arch Toxicol, 77(10):547–554, Oct 2003. 23, 50, 78

[62] D. Iusuf, E. van de Steeg, and A. H. Schinkel. Hepatocyte hopping of oatp1b substrates contributes to eﬃcient hepatic detoxiﬁcation. Clin Pharmacol Ther, 92(5):559–562, Nov 2012. 3

[63] D. Iusuf, E. van de Steeg, and A.H. Schinkel. Functions of oatp1a and 1b transporters in vivo: insights from mouse models. Trends Pharmacol.Sci., 33(2):100–108, February 2012. 3

[64] J.C. Jackson. Adverse events associated with exchange transfusion in healthy and ill newborns. Pediatrics, 99(5):E7–, May 1997. 12

[65] Lois Johnson and Vinod K. Bhutani. The clinical syndrome of bilirubin- induced neurologic dysfunction. Semin Perinatol, 35(3):101–113, Jun 2011. 6, 7

[66] M.K. Jung, M.H. Bae, D.J. Kim, W.S. Lee, C.M. Cho, W.Y. Tak, and Y.O. Kweon. [a case with rotor syndrome in hyperbilirubinemic family]. Korean J Gastroenterol., 49(4):251–255, April 2007. 9

[67] A. Kadakol, S.S. Ghosh, B.S. Sappal, G. Sharma, J.R. Chowdhury, and N.R. Chowdhury. Genetic lesions of bilirubin uridine-diphosphoglucuronate

97 REFERENCES

glucuronosyltransferase (ugt1a1) causing crigler-najjar and gilbert syndromes: correlation of genotype to phenotype. Hum.Mutat., 16(4):297–306, October 2000. 3

[68] A. Kadakol, B.S. Sappal, S.S. Ghosh, M. Lowenheim, A. Chowd- hury, S. Chowdhury, A. Santra, I.M. Arias, J.R. Chowdhury, and N.R. Chowdhury. Interaction of coding region mutations and the gilbert-type promoter abnormality of the ugt1a1 gene causes moderate degrees of unconjugated hyperbilirubinaemia and may lead to neonatal kernicterus. J.Med.Genet., 38(4):244–249, April 2001. 5

[69] T. Kamisako, I. Leier, Y. Cui, J. Konig, U. Buchholz, J. Hummel- Eisenbeiss, and D. Keppler. Transport of monoglucuronosyl and bisglu- curonosyl bilirubin by recombinant human and rat multidrug resistance protein 2. Hepatology, 30(2):485–490, August 1999. 3

[70] J. Kapitulnik and F.J. Gonzalez. Marked endogenous activation of the cyp1a1 and cyp1a2 genes in the congenitally jaundiced gunn rat. Mol.Pharmacol., 43(5):722–725, May 1993. 23, 77

[71] J. Kapitulnik and J.D. Ostrow. Stimulation of bilirubin catabolism in jaundiced gunn rats by an induced of microsomal mixed-function monooxygenases. Proc.Natl.Acad.Sci.U.S.A, 75(2):682–685, February 1978. 20, 21

[72] M. Kaplan, P. Renbaum, E. Levy-Lahad, C. Hammerman, A. Lahad, and E. Beutler. Gilbert syndrome and glucose-6-phosphate dehydrogenase deﬁciency: a dose-dependent genetic interaction crucial to neonatal hyperbilirubinemia. Proc.Natl.Acad.Sci.U.S.A, 94(22):12128–12132, October 1997. 5

[73] N. Kapoor, A.B. Pant, A. Dhawan, U.N. Dwievedi, P.K. Seth, and D. Parmar. Cytochrome p450 1a isoenzymes in brain cells: Expression and inducibility in cultured rat brain neuronal and glial cells. Life Sci., 79(25):2387– 2394, November 2006. 22, 25, 78

98 REFERENCES

[74] Kaname Kawajiri and Yoshiaki Fujii-Kuriyama. Cytochrome p450 gene regulation and physiological functions mediated by the aryl hydrocarbon receptor. Arch Biochem Biophys, 464(2):207–212, Aug 2007. 20

[75] W.J. Keenan, K.K. Novak, J.M. Sutherland, D.A. Bryla, and K.L. Fetterly. Morbidity and mortality associated with exchange transfusion. Pe- diatrics, 75(2 Pt 2):417–421, February 1985. 12

[76] P. Keshavan, S.J. Schwemberger, D.L. Smith, G.F. Babcock, and S.D. Zucker. Unconjugated bilirubin induces apoptosis in colon cancer cells by trig- gering mitochondrial depolarization. Int.J.Cancer, 112(3):433–445, November 2004. 10

[77] H. Kettenmann and A. Verkhratsky. [neuroglia–living nerve glue]. Fortschr Neurol Psychiatr, 79(10):588–597, Oct 2011. 18

[78] C. Kohle and K.W. Bock. Coordinate regulation of phase i and ii xenobiotic metabolisms by the ah receptor and nrf2. Biochem.Pharmacol., 73(12):1853– 1862, June 2007. 20, 72

[79] Leonard F. Koziol, Deborah Ely Budding, and Dana Chidekel. Hyper- bilirubinemia: subcortical mechanisms of cognitive and behavioral dysfunction. Pediatr Neurol, 48(1):3–13, Jan 2013. 6

[80] S. Krusekopf, U. Kleeberg, A. G. Hildebrandt, and K. Ruckpaul. Ef- fects of benzimidazole derivatives on cytochrome p450 1a1 expression in a human hepatoma cell line. Xenobiotica, 27(1):1–9, Jan 1997. 20

[81] S. Krusekopf, I. Roots, A.G. Hildebrandt, and U. Kleeberg. Time- dependent transcriptional induction of cyp1a1, cyp1a2 and cyp1b1 mrnas by h+/k+ -atpase inhibitors and other xenobiotics. Xenobiotica, 33(2):107–118, February 2003. 20, 28, 45

99 REFERENCES

[82] S. Lin, X. Wei, K.R. Bales, A.B. Paul, Z. Ma, G. Yan, S.M. Paul, and Y. Du. Minocycline blocks bilirubin neurotoxicity and prevents hyperbilirubinemia-induced cerebellar hypoplasia in the gunn rat. Eur.J Neu- rosci., 22(1):21–27, July 2005. 13

[83] L. Liu, R.J. Bridges, and C.L. Eyer. Eﬀect of cytochrome p450 1a induction on oxidative damage in rat brain. Mol.Cell Biochem., 223(1-2):89–94, July 2001. 78, 79

[84] Torrecilla B. Lodoso, Atance E. Palomo, Grande C. Camarena, M.C. Diaz Fernandez, Llanillo L. Hierro, V De, la, Remacha E. Frauca, Bartolo G. Munoz, and Vega P. Jara. [crigler-najjar syndrome: diagnosis and treatment]. An.Pediatr.(Barc.), 65(1):73–78, July 2006. 8

[85] I.M. LONDON, R. WEST, D. SHEMIN, and D. RITTENBERG. On the origin of bile pigment in normal man. J.Biol.Chem., 184(1):351–358, May 1950. 1

[86] M.J. Maisels and T.B. Newman. Kernicterus in otherwise healthy, breast-fed term newborns. Pediatrics, 96(4 Pt 1):730–733, October 1995. 5

[87] V. Matyash and H. Kettenmann. Heterogeneity in astrocyte morphology and physiology. Brain Res.Rev., 63(1-2):2–10, May 2010. 18, 25, 79

[88] B. Meunier, S.P. de Visser, and S. Shaik. Mechanism of oxidation reactions catalyzed by cytochrome p450 enzymes. Chem.Rev., 104(9):3947–3980, September 2004. 19

[89] Ralf Peter Meyer, Michael Podvinec, and Urs A. Meyer. Cytochrome p450 cyp1a1 accumulates in the cytosol of kidney and brain and is activated by heme. Mol Pharmacol, 62(5):1061–1067, Nov 2002. 35

100 REFERENCES

[90] S. Miksys, E. Hoffmann, and R.F. Tyndale. Regional and cellular induction of nicotine-metabolizing cyp2b1 in rat brain by chronic nicotine treatment. Biochem.Pharmacol., 59(12):1501–1511, June 2000. 22

[91] A. Minn, J.F. Ghersi-Egea, R. Perrin, B. Leininger, and G. Siest. Drug metabolizing enzymes in the brain and cerebral microvessels. Brain Res.Brain Res.Rev., 16(1):65–82, January 1991. 20

[92] S. Mitra, M. Samanta, M. Sarkar, A.K. De, and S. Chatterjee. Pre-exchange 5intensive phototherapy failure–a randomized controlled trial. J Trop.Pediatr., 57(3):217–221, June 2011. 12

[93] T.J. Mollen, R. Scarfone, and M.C. Harris. Acute, severe bilirubin encephalopathy in a newborn. Pediatr.Emerg.Care, 20(9):599–601, September 2004. 5

[94] D. L. Montgomery. Astrocytes: form, functions, and roles in disease. Vet Pathol, 31(2):145–167, Mar 1994. 18

[95] D.C. Morse, A.P. Stein, P.E. Thomas, and H.E. Lowndes. Distri- bution and induction of cytochrome p450 1a1 and 1a2 in rat brain. Toxi- col.Appl.Pharmacol., 152(1):232–239, September 1998. 50, 78

[96] T. Mosmann. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J.Immunol.Methods, 65(1-2):55–63, December 1983. 33

[97] V.B. Mountcastle. The columnar organization of the neocortex. Brain, 120 ( Pt 4):701–722, April 1997. 17

[98] S. Murki and P. Kumar. Blood exchange transfusion for infants with severe neonatal hyperbilirubinemia. Semin.Perinatol., 35(3):175–184, June 2011. 11, 12

101 REFERENCES

[99] A. Novelli, J.A. Reilly, P.G. Lysko, and R.C. Henneberry. Glutamate becomes neurotoxic via the n-methyl-d-aspartate receptor when intracellular energy levels are reduced. Brain Res., 451(1-2):205–212, June 1988. 10

[100] J Donald Ostrow and Pasupati Mukerjee. Solvent partition of 14c- unconjugated bilirubin to remove labeled polar contaminants. Transl Res, 149(1):37–45, Jan 2007. 30

[101] J.D. Ostrow, J.H. JANDL, and R. Schmid. The formation of bilirubin from hemoglobin in vivo. J Clin.Invest, 41:1628–1637, August 1962. 1

[102] J.D. Ostrow, L. Pascolo, S.M. Shapiro, and C. Tiribelli. New concepts in bilirubin encephalopathy. Eur.J.Clin.Invest, 33(11):988–997, November 2003. 4, 5, 6

[103] A. Pastrakuljic, B. K. Tang, E. A. Roberts, and W. Kalow. Distinc- tion of cyp1a1 and cyp1a2 activity by selective inhibition using ﬂuvoxamine and isosafrole. Biochem Pharmacol, 53(4):531–538, Feb 1997. 36

[104] K. Patra, A. Storfer-Isser, B. Siner, J. Moore, and M. Hack. Adverse events associated with neonatal exchange transfusion in the 1990s. J Pediatr., 144(5):626–631, May 2004. 12

[105] M. W. Pfaffl. A new mathematical model for relative quantiﬁcation in real- time rt-pcr. Nucleic Acids Res, 29(9):e45, May 2001. 34

[106] R.L. Poland and G.B. Odell. Physiologic jaundice: the enterohepatic circulation of bilirubin. N.Engl.J Med., 284(1):1–6, January 1971. 3

[107] N. Pons, S. Pipino, and Matteis F. De. Interaction of polyhalogenated compounds of appropriate conﬁguration with mammalian or bacterial cyp enzymes. increased bilirubin and uroporphyrinogen oxidation in vitro. Biochem.Pharmacol., 66(3):405–414, August 2003. 20, 80

102 REFERENCES

[108] J. Voogd R. Nieuwenhuys and C. van Huijzen. The human central nervous system. Springer, 2008. 16, 17

[109] A.C. Rice, V.L. Chiou, S.B. Zuckoff, and S.M. Shapiro. Proﬁle of minocycline neuroprotection in bilirubin-induced auditory system dysfunction. Brain Res., 1368:290–298, January 2011. 13

[110] D. Rice and Barone S Jr. Critical periods of vulnerability for the developing nervous system: evidence from humans and animal models. Environ.Health Perspect., 108 Suppl 3:511–533, June 2000. 15

[111] M.C. Robert, G. Furlan, N. Rosso, S.E. Gambaro, F. Apitsionak, E. Vianello, C. Tiribelli, and S. Gazzin. Alterations in the cell cycle in the cerebellum of hyperbilirubinemic gunn rat: a possible link with apoptosis? PLoS One, 8(11):e79073–, 2013. 10

[112] A. Robertson, W. Karp, and R. Brodersen. Bilirubin displacing eﬀect of drugs used in neonatology. Acta Paediatr Scand, 80(12):1119–1127, Dec 1991. 5

[113] L. Roca, S. Calligaris, R.P. Wennberg, C.E. Ahlfors, S.G. Malik, J.D. Ostrow, and C. Tiribelli. Factors aﬀecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method. Pedi- atr.Res., 60(6):724–728, December 2006. 30

[114] C.M. Rodrigues, S. Sola, and D. Brites. Bilirubin induces apoptosis via the mitochondrial pathway in developing rat brain neurons. Hepatology, 35(5):1186– 1195, May 2002. 10

[115] S.W. Ryter and R.M. Tyrrell. The heme synthesis and degradation pathways: role in oxidant sensitivity. heme oxygenase has both pro- and antioxidant properties. Free Radic.Biol.Med., 28(2):289–309, January 2000. 2

[116] M. Sampietro and A. Iolascon. Molecular pathology of crigler-najjar type i and ii and gilbert’s syndromes. Haematologica, 84(2):150–157, February 1999. 8

103 REFERENCES

[117] Y. Sawasaki, N. Yamada, and H. Nakajima. Developmental features of cerebellar hypoplasia and brain bilirubin levels in a mutant (gunn) rat with hereditary hyperbilirubinaemia. J.Neurochem., 27(2):577–583, August 1976. 15, 79

[118] B. Schilter and C. J. Omiecinski. Regional distribution and expression modulation of cytochrome p-450 and epoxide hydrolase mrnas in the rat brain. Mol Pharmacol, 44(5):990–996, Nov 1993. 82

[119] J.J. Schlezinger, R.D. White, and J.J. Stegeman. Oxidative inactivation of cytochrome p-450 1a (cyp1a) stimulated by 3,3’,4,4’-tetrachlorobiphenyl: production of reactive oxygen by vertebrate cyp1as. Mol.Pharmacol., 56(3):588–597, September 1999. 22

[120] S. Schulz, R.J. Wong, H.J. Vreman, and D.K. Stevenson. Metallopor- phyrins - an update. Front Pharmacol., 3:68–, 2012. 13

[121] H.S. Schutta and L. Johnson. Bilirubin encephalopathy in the gunn rat: a ﬁne structure study of the cerebellar cortex. J.Neuropathol.Exp.Neurol., 26(3):377–396, July 1967. 15

[122] Matej Seliskar and Damjana Rozman. Mammalian cytochromes p450– importance of tissue speciﬁcity. Biochim Biophys Acta, 1770(3):458–466, Mar 2007. 20, 22

[123] M.A. Serrano, J.E. Bayon, L. Pascolo, C. Tiribelli, J.D. Ostrow, J. Gonzalez-Gallego, and J.J. Marin. Evidence for carrier-mediated transport of unconjugated bilirubin across plasma membrane vesicles from human placental trophoblast. Placenta, 23(7):527–535, August 2002. 5

[124] M. Shahian and M.A. Moslehi. Eﬀect of albumin administration prior to exchange transfusion in term neonates with hyperbilirubinemia–a randomized controlled trial. Indian Pediatr., 47(3):241–244, March 2010. 12

104 REFERENCES

[125] Steven M. Shapiro. Chronic bilirubin encephalopathy: diagnosis and outcome. Semin Fetal Neonatal Med, 15(3):157–163, Jun 2010. 6, 7

[126] R.F. Silva, C.M. Rodrigues, and D. Brites. Bilirubin-induced apoptosis in cultured rat neural cells is aggravated by chenodeoxycholic acid but prevented by ursodeoxycholic acid. J.Hepatol., 34(3):402–408, March 2001. 13

[127] K. Smith and J.J. Leyden. Safety of doxycycline and minocycline: a system- atic review. Clin.Ther., 27(9):1329–1342, September 2005. 13

[128] David K. Stevenson, Hendrik J. Vreman, and Ronald J. Wong. Bilirubin production and the risk of bilirubin neurotoxicity. Semin Perinatol, 35(3):121–126, Jun 2011. 1, 6, 9

[129] D.K. Stevenson, A.A. Fanaroff, M.J. Maisels, B.W. Young, R.J. Wong, H.J. Vreman, J.R. MacMahon, C.Y. Yeung, D.S. Seidman, R. Gale, W. Oh, V.K. Bhutani, L.H. Johnson, M. Kaplan, C. Ham- merman, and H. Nakamura. Prediction of hyperbilirubinemia in near-term and term infants. Pediatrics, 108(1):31–39, July 2001. 5

[130] E. Sticova and M. Jirsa. New insights in bilirubin metabolism and their clinical implications. World J Gastroenterol., 19(38):6398–6407, October 2013. 2, 3

[131] C.P. Strassburg. Hyperbilirubinemia syndromes (gilbert- meulengracht, crigler-najjar, dubin-johnson, and rotor syndrome). Best.Pract.Res.Clin.Gastroenterol., 24(5):555–571, October 2010. 7, 8, 9

[132] H.W. Strobel, C.M. Thompson, and L. Antonovic. Cytochromes p450 in brain: function and signiﬁcance. Curr.Drug Metab, 2(2):199–214, June 2001. 22

[133] S. K. Sy, B. K. Tang, A. Pastrakuljic, E. A. Roberts, and W. Kalow. Detailed characterization of experimentally derived human hepatic cyp1a1 activ-

105 REFERENCES

ity and expression using differential inhibition of ethoxyresorufin o-deethylation by fluvoxamine. Eur J Clin Pharmacol, 57(5):377–386, Aug 2001. 36

[134] Y. Takagishi and H. Yamamura. The critical period of purkinje cell degener- ation and cerebellar hypoplasia due to bilirubin. Acta Neuropathol, 75(1):41–45, 1987. 15

[135] K.L. Tan. The pattern of bilirubin response to phototherapy for neonatal hyperbilirubinaemia. Pediatr.Res., 16(8):670–674, August 1982. 11

[136] R. Tenhunen, H.S. Marver, and R. Schmid. The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase. Proc.Natl.Acad.Sci.U.S.A, 61(2):748–755, October 1968. 1

[137] Leslie M. Tompkins and Andrew D. Wallace. Mechanisms of cytochrome p450 induction. J Biochem Mol Toxicol, 21(4):176–181, 2007. 20

[138] E. van de Steeg, E. Wagenaar, C.M. van der Kruijssen, J.E. Burggraaff, D.R. de Waart, R.P. Elferink, K.E. Kenworthy, and A.H. Schinkel. Organic anion transporting polypeptide 1a/1b-knockout mice provide insights into hepatic handling of bilirubin, bile acids, and drugs. J Clin.Invest, 120(8):2942–2952, August 2010. 2, 3

[139] C.N. Van Der Veere, M. Sinaasappel, A.F. McDonagh, P. Rosenthal, P. Labrune, M. Odievre, J. Fevery, J.B. Otte, P. McClean, G. Burk, V. Masakowski, W. Sperl, A.P. Mowat, G.M. Vergani, K. Heller, J.P. Wilson, R. Shepherd, and P.L. Jansen. Current therapy for crigler-najjar syndrome type 1: report of a world registry. Hepatology, 24(2):311–315, August 1996. 8

[140] A.R. Vaz, M. Delgado-Esteban, M.A. Brito, J.P. Bolanos, D. Brites, and A. Almeida. Bilirubin selectively inhibits cytochrome c oxidase activity and induces apoptosis in immature cortical neurons: assessment of the protective

106 REFERENCES

eﬀects of glycoursodeoxycholic acid. J Neurochem., 112(1):56–65, January 2010. 13

[141] J.F. Watchko. Hyperbilirubinemia and bilirubin toxicity in the late preterm infant. Clin.Perinatol., 33(4):839–852, December 2006. 9, 10

[142] J.F. Watchko. Kernicterus and the molecular mechanisms of bilirubin-induced cns injury in newborns. Neuromolecular.Med., 8(4):513–529, 2006. 10

[143] J.F. Watchko and C. Tiribelli. Bilirubin-induced neurologic damage– mechanisms and management approaches. N.Engl.J Med., 369(21):2021–2030, November 2013. 13, 19

[144] R.A. Weisiger, J.D. Ostrow, R.K. Koehler, C.C. Webster, P. Muk- erjee, L. Pascolo, and C. Tiribelli. Affinity of human serum albumin for bilirubin varies with albumin concentration and buffer composition: results of a novel ultrafiltration method. J.Biol.Chem., 276(32):29953–29960, August 2001. 3

[145] C. Zaccaro, S. Sweitzer, S. Pipino, N. Gorman, P.R. Sinclair, J.F. Sinclair, D.W. Nebert, and Matteis F. De. Role of cytochrome p450 1a2 in bilirubin degradation studies in cyp1a2 (-/-) mutant mice. Biochem.Pharmacol., 61(7):843–849, April 2001. 21, 37, 63, 77, 80

[146] B. Zhang, X. Yang, and X. Gao. Taurine protects against bilirubin-induced neurotoxicity in vitro. Brain Res., 1320:159–167, March 2010. 13

[147] R. Zhang, J. Sun, L. Ma, X. Wu, G. Pan, H. Hao, F. Zhou, A J, C. Liu, H. Ai, L. Shang, H. Gao, Y. Peng, P. Wan, H. Wu, and G. Wang. Induction of cytochromes p450 1a1 and 1a2 by tanshinones in human hepg2 hepatoma cell line. Toxicol.Appl.Pharmacol., 252(1):18–27, April 2011. 35

107 REFERENCES

[148] S.D. Zucker, W. Goessling, and A.G. Hoppin. Unconjugated bilirubin exhibits spontaneous diﬀusion through model lipid bilayers and native hepatocyte membranes. J.Biol.Chem., 274(16):10852–10862, April 1999. 2, 4

[149] S.D. Zucker, W. Goessling, B.J. Ransil, and J.L. Gollan. Inﬂuence of glutathione s-transferase b (ligandin) on the intermembrane transfer of bilirubin. implications for the intracellular transport of nonsubstrate ligands in hepatocytes. J Clin.Invest, 96(4):1927–1935, October 1995. 3

108