Alternative Splicing by Participation of the Group II Intron ORF in Extremely Halotolerant and Alkaliphilic Oceanobacillus Iheyensis

Microbes Environ. Vol. 26, No. 1, 54–60, 2011 http://wwwsoc.nii.ac.jp/jsme2/ doi:10.1264/jsme2.ME10154

Alternative Splicing by Participation of the Group II Intron ORF in Extremely Halotolerant and Alkaliphilic Oceanobacillus iheyensis

GAB-JOO CHEE1*†, and HIDETO TAKAMI1 1Microbial Genome Research Group, Japan Agency for Marine-Earth Science and Technology, 2–15 Natsushima Yokosuka 237–0061, Japan (Received August 3, 2010—Accepted October 26, 2010—Published online December 17, 2010)

Group II introns inserted into genes often undergo splicing at unexpected sites, and participate in the transcription of host genes. We identified five copies of a group II intron, designated Oi.Int, in the genome of an extremely halotolerant and alkaliphilic bacillus, Oceanobacillus iheyensis. The Oi.Int4 differs from the Oi.Int3 at four bases. The ligated exons of the Oi.Int4 could not be detected by RT-PCR assays in vivo or in vitro although group II introns can generally self-splice in vitro without the involvement of an intron-encoded open reading frame (ORF). In the Oi.Int4 mutants with base substitutions within the ORF, ligated exons were detected by in vitro self-splicing. It was clear that the ligation of exons during splicing is affected by the sequence of the intron-encoded ORF since the splice sites corresponded to the joining sites of the intron. In addition, the mutant introns showed unexpected multiple products with alternative 5' splice sites. These findings imply that alternative 5' splicing which causes a functional change of ligated exons presumably has influenced past adaptations of O. iheyensis to various environmental changes. Key words: group II intron, self-splicing, ribozyme, ligated exons, Oceanobacillus iheyensis

Group II introns, genetic retroelements capable of self- fied in the O. iheyensis genome showed only 62.5–63.2% splicing and mobility (20), are widely believed to be the identity and its phylogenetic placement was clearly separate evolutionary progenitors of eukaryotic spliceosome introns from the 11 other species. It is thought that the mobile group due to their splicing mechanism (13). Group II introns II introns may have evolved from a preexisting autocatalytic occur in mitochondrial and chloroplast genomes of fungi intron that acquired an open reading frame, perhaps from and plants and in cyanobacteria, proteobacteria, and Gram- another retroelement, or from a preexisting retroposon that positive bacteria (2, 8). Organella group II introns substan- acquired ribozyme activity, enabling it to function as a tially interrupt essential genes, whereas prokaryotic group II self-splicing intron (7, 29). Also, the diversity of these introns are found either in housekeeping genes or in inter- introns in bacteria supports the idea that the group II introns genic regions (1, 4, 35). Although the best-characterized evolved in bacteria and subsequently spread to the archaeal bacterial group II intron is L1.LtrB of Lactococcus lactis and eukaryotic genomes (12, 33). Group II introns are similar ML13, there are fewer known examples of group II introns in organization and mobility to spliceosomal introns and in Gram-positive bacteria, especially in bacilli, than Gram- non-long terminal repeat (LTR) retrotransposons (7, 16). negative bacteria (3, 8). Previously, we identified a group II Accordingly, it is thought that the RT of Oi.Int entered intron designated Bh.Int in the genome of an alkaliphilic in the O. iheyensis genome via a different route (27). Is Bacillus halodurans C-125, and confirmed that Bh.Int-like there any major difference in the manner of splicing and group II introns have been widely disseminated among behavior of the group II intron between O. iheyensis and bacilli possessing different phenotypic properties and habi- other bacillar species? This is a fundamental question when tats (27). Oceanobacillus iheyensis HTE831, isolated from a considering the effect of group II introns on genomic evolu- sediment sample collected at a depth of 1050 m (15), has tion and adaptation to environments. alkaliphilic and extremely halotolerant properties, and its Five copies of Oi.Int, categorized as a standard group IIC whole genome sequence has been determined (28). intron, were identified in the O. iheyensis genome, and four The nucleotide sequence of the putative RT of Bh.Int (Oi.Int1, 3, 4, and 5) of them showed >99.2% identity at the was very homologous, with 98.4 to 99.9% identity, among nucleotide level (26). In comparison with the Oi.Int3 intron 11 bacillar species, whereas there was no particular trend whose crystal structure has been analyzed recently (31, 32), in phylogenetic relationships based on the 16S rRNA gene the Oi.Int4 has only four different bases, of which three are sequence and each species was randomly dispersed in the found in the intron-encoded ORF containing the RT domains phylogenetic tree (27). On the other hand, the nucleotide and the fourth lies within the non-coding domain VI. Most sequence of the RT of the Bh.Int-like intron (Oi.Int) identi- group II introns have been studied for in vitro self-splicing using only the regions of the intron lacking the intron- * Corresponding author. E-mail: [email protected]; encoded ORF (5, 9, 10, 25, 30) because the self-splicing Tel: +81–46–867–9643, Fax: +81–46–867–9722. activity of group II intron transcripts synthesized in vitro † Present address: Department of Biochemical Engineering, is usually unaffected, or only slightly stimulated, by the Dongyang Mirae University, 62–160 Gocheok Guro Seoul deletion of the intron-encoded ORF (17). 152–714, Korea In this study, the splicing of intact Oi.Int introns Alternative Splicing of the Oi.Int Intron 55 possessing the intron-encoded ORF was investigated in vivo buffer (0.1 M LiCl, 0.01 M EDTA, 0.01 M Tris-HCl, pH 7.4, and and in vitro. Only the Oi.Int4 could not make ligated 1% SDS), and then lysed by vortexing the cells in 4 mL phenol/ exons in vivo and in vitro. Thus, we investigated how base chloroform/isoamyl alcohol (25:24:1) and 1.8 mL of baked glass substitutions in the intron-encoded ORF affect self-splicing beads for 5 min. Following re-extraction of the aqueous phase with phenol/chloroform/isoamyl alcohol, 2.5 vol. ethanol and LiCl at a reactions, and first report that mutants of the intron-encoded final concentration of 0.2 M were added to the supernatant. The ORF yielded alternative 5' splice sites and multiple ligated slurry was centrifuged at 7,000 rpm for 15 min at 4°C. The pellet exons. Also, we characterize the ribozymic properties of the was washed with 70% ethanol, suspended in 350 µL of ultrafiltered Oi.Int introns, and discuss the evolution and diversity of H2O and 1.25 mL of 4 M sodium acetate (CH3COONa) (pH 6.0), group II introns. and then chilled at −20°C overnight. The mixture was centrifuged at 15,000 rpm for 20 min at 4°C, and washed with 70% ethanol. The RNA pellet was further purified with the RNeasy kit (Qiagen) Materials and Methods according to the manufacturer’s instructions. Bacterial strains, plasmids, and media In vitro transcription O. iheyensis HTE831 was grown in Marine broth medium For the synthesis of RNA in vitro, plasmid constructs were under aerobic conditions at 30°C (15). Escherichia coli TOP10 linearized with XbaI. The linearized templates were transcribed was cultured in LB medium at 37°C. E. coli TOP10 harboring ® ® ® ® using SP6 RNA polymerase in a final volume of 20 µL. Transcrip- plasmid pCR 2.1-TOPO , pCR -Blunt II-TOPO (Invitrogen, tion was performed with 1 µg of plasmid template and 2 µL of Carlsbad, CA, USA), or pSD64TF (4) was grown in a selective SP6 RNA polymerase (Ambion, Austin, TX, USA) for 2 h at 37°C medium containing ampicillin (100 µg mL−1) or kanamycin (25 µg −1 according to the manufacturer’s protocol. Samples were treated mL ). XL10-Gold competent cells (Stratagene, La Jolla, CA, USA) with 2U RNase-free DNase (Ambion) for 15 min at 37°C. After were used for the mutation experiments. extraction and purification, RNAs were resuspended in nuclease- − Cloning and site-directed mutagenesis free water and stored at 80°C. Chromosomal DNA of O. iheyensis was isolated using a In vitro self-splicing, RT-PCR, and inverse RT-PCR QIAGEN Genomic DNA Purification Kit (Qiagen, Valencia, CA, To obtain full-length intron segments, PCRs were performed USA) in accordance with the manufacturer’s instructions. DNA with 2 U of PyroBest DNA polymerase (Takara, Otsu, Japan) with fragments amplified by PCR using each primer set (Table 1) were ® 0.2 µM of each primer set (Table 1) and 100 ng of DNA template in recovered from the agarose gel and ligated into pCR -Blunt II- ® a final volume of 100 µL. All PCR products were purified with the TOPO . The recombinant plasmids were double-digested using GFX PCR-purification kit (GE Healthcare). PCR conditions were NotI and KpnI. These fragments were subcloned into the plasmid as follows: 1 cycle at 98°C for 30 s; 25 cycles at 98°C for 10 s, pSD64TF with a SP6 promoter digested by the same restriction −1 at 55°C for 30 s, and at 72°C for 1 min kb and 1 cycle at 72°C for enzymes. All the plasmids generated include both a group II intron 7 min. with an intron-encoded ORF and 5' and 3' exon figments. Self-splicing reactions were performed using 1 µg of total To generate point mutations in the Oi.Int4 intron, site-directed RNA or RNA synthesized in vitro, 5 mM MgCl2, and PCR buffer mutagenesis was performed using the Quikchange Multi system (Takara) at 50°C for 30 min. For reverse transcription reactions, (Stratagene) according to the manufacturer’s protocol. 5 U AMV reverse transcriptase XL (Takara) and primers specific All RT-PCR and inverse RT-PCR products were cloned with the ® to upstream and downstream regions of each intron (Table 1) TA vector pCR 2.1-TOPO (Invitrogen). The DNA sequence was were added, following the manufacturer’s protocol. RT-PCR was determined using MegaBACE 1000 (GE Healthcare, Buckingham- performed as follows: 1 cycle at 94°C for 2 min, 40 cycles at shire, UK). −1 94°C for 30 s, at 55°C for 30 s and at 72°C for 1 min kb , and 1 RNA purification cycle at 72°C for 7 min. To investigate the multisplicing of introns RNA from O. iheyensis was isolated from cells grown in Marine in vitro, inverse RT-PCR was performed using primers ACTS9 and broth to an optical density of 1.0 at 600 nm, as described previously ACTS10 (Table 1) under the same conditions. (11) with some modification. All aqueous solutions except growth TM media were treated with the Pyrogard D ultrafiltration cartridge Results and Discussion (Millipore, Billerica, MA, USA). Cells were harvested from 50 mL cultures by centrifugation and resuspended in 50 mL of ice-cold 10 mM Tris buffer (pH 7.4). The Splicing of the Oi.Int introns in vitro and in vivo cell suspension was centrifuged and resuspended in 4 mL of LETS To investigate whether the splicing events of each of the Oi.Int introns occur in vitro, RNAs synthesized in vitro Table 1. List of primers used in this study were reverse transcribed and amplified by PCR with primers specific to exons upstream and downstream of each Oi.Int Name Sequence Location (Table 1). For the Oi.Int1 intron, the 861-bp product obtained B0079 GCGAAGACCTTGTTAGAGGT 5' exon of Oi.Int1 was approximately 1.9 kb smaller than the product amplified B0081 TCCGTAGCTGCCACAGCATT 3' exon of Oi.Int1 by PCR from the chromosome of O. iheyensis HTE831 (Fig. B1430 TATGCCTGGGACTGTTTTAG 5' exon of Oi.Int2 1A, lanes 1 and 2). The Oi.Int3 and Oi.Int5 introns also B1435 CTCATCGTCTAGCAGCTGGT 3' exon of Oi.Int2 yielded 658-bp and 476-bp products, respectively, corre- B1803 TTGGAAAGCGATAGATTGCG 3' exon of Oi.Int3 sponding to the sizes of the ligated exons after the splicing B1805 GCTGGTGAAGAGGTATTAAC 5' exon of Oi.Int3 B2243 GGTTAAGTTCACAAGCAGCT 3' exon of Oi.Int4 of group II introns (Fig. 1A, lanes 5, 6, 9, and 10). The B2246 TGAGGCTCTTCAAGGTAGTG 5' exon of Oi.Int4 splicing events occurred correctly at normal sites of both B2714 TAGGTCTTGCAGGGTTATTG 3' exon of Oi.Int5 intron 5' and 3' ends (Fig. 1B). In vivo splicing was also B2717 CATCAGACGGGATACGGGTA 5' exon of Oi.Int5 carried out with total RNA from O. iheyensis using the same ACTS9 GCGCATGTGTATGTGGAAAC intron (3' end) primer sets. The RT-PCR products from in vivo splicing ACTS10 CTCTGTACCAACTTTGGCAG intron (5' end) were found to be the same as those from splicing in vitro 56 CHEE et al.

Multiple self-splicing products caused by base substitutions in the intron-encoded ORF No ligated exons were obtained from the splicing of the Oi.Int4 intron in vivo or in vitro. We compared with sequences of the Oi.Int3 intron to investigate why the Oi.Int4 intron differed from other Oi.Int introns in splicing reactions. The Oi.Int3 and Oi.Int4 introns have the same sequence except for four base substitutions at positions 686 (G or A), 856 (A or T), 896 (A or G), and 1875 (T or C) (Fig. 2). The nucleotide at position 1875 is present in domain VI, but the other base substitutions are located in subdomain RT of the intron-encoded ORF in domain IV. We investigated the effect of base substitutions on exon ligation in self-splicing at four different positions between Oi.Int3 and Oi.Int4 using site-specific mutagenesis. In vitro splicing of the Oi.Int4 mutant introns (Fig. 2) was confirmed by RT-PCR amplification using the primer sets, as shown in Table 1. Interestingly, the mutants produced various RT-PCR products (Fig. 3 and Table 2) in contrast to the wild-type Oi.Int4 which showed no ligated exons. The Oi.Int4M1 intron, in which A at position 686 was replaced with G, represented self-splicing events, but two unexpected bands (526 bp and 753 bp) were also observed (Fig. 3), unlike in the 807-bp element when splicing occurred at canonical splice sites. For the 526-bp and 753-bp ligated exons, the accurate 3' exons were spliced to cryptic 5' exon sites located 281 bp and 54 bp upstream of the intron, respectively. Positions −281 and −54 in the 5' Fig. 1. Self-splicing of Oi.Int introns in vitro. (A) Electrophoretic exon were found to be UUAU and UAU, corresponding to assays of PCR products before and after the splicing of Oi.Int. Oi.Int1, the cryptic IBS1 sequence, respectively (Figs. 3B and 3C). Oi.Int2, Oi.Int3, Oi.Int4, and Oi.Int5 are shown in lanes 1 to 10, respec- Consequently, the splicing events in the Oi.Int4M1 intron tively. Lanes 1, 3, 5, 7, and 9 show PCR products obtained from O. iheyensis chromosomal DNA with each primer and lanes 2, 4, 6, 8, and did not occur at the canonical splice sites, but the 5' splice 10 show RT-PCR products obtained from mRNA synthesized in vitro site of the group II intron had the cryptic IBS1 sequence and with the above primers. Lane M is a size marker. Samples were ana- a putative stem-loop motif in the 5' exon, like the wild type lyzed on a 1% agarose gel. (B) DNA sequence of 5' and 3' junction sites of the Oi.Int3 intron. The chromatogram shows the sequence of the (Fig. 3C). For the Oi.Int4M12 intron, three bands (526, 629, spliced RT-PCR product. The splicing in vivo was the same as that in and 753 bp) were detected, and their splicing events occurred vitro. at −281, −178, and −54 in the 5' exon. A new 5' splicing site is shown at position −178, which is different from the products of the Oi.Int4M1 intron (Fig. 3C). Also, the (data not shown), and their sequences were identical to those Oi.Int4M123 intron yielded 526-, 729-, and 807-bp bands, found in vitro. which were spliced at −281, −78, and the normal sites in The Oi.Int2 and Oi.Int4 introns have EBS1 and EBS3 the 5' exon, respectively (Fig. 3). The 807-bp element of (exon-binding sites) in intron domain I, which undergoes these products was found to be spliced at the canonical sites base pairing with the complementary IBS1 and IBS3 (intron- of the intron unlike the other products. binding sites) in the 5' and 3' exons, respectively. Stem-loop An alternate 5' splicing site was also found at position −78 motifs are also located in exons upstream of these introns, in the 5' exon. All cleavages of the Oi.Int4M12 and as in the case of other Oi.Int introns. For the Oi.Int2 and Oi.Int4M123, however, occurred at UUAU, UUA, or UAU Oi.Int4, although PCR products were obtained from the sequences corresponding to a cryptic IBS1 motif. As men- chromosome of O. iheyensis HTE831, these introns could tioned above, the Oi.Int4M mutant introns yielded unex- not obtain the ligated exons from in vivo or in vitro splicing pected ligated exons except for the 807-bp element. Unex- (Fig. 1A, lanes 3, 4, 7, and 8). The lack of splicing of the pected 5' splice sites were not adjacent to the canonical Oi.Int2 is presumably due to the deleted sequences, which GUGYG start site of the intron. Nevertheless, three Oi.Int4M are nucleotides 355–479 and 1359–1431 corresponding to introns showed the ability to utilize nonadjacent splice regions of domain III and the intron-encoded ORF in domain sites in vitro. Toor et al. (30) demonstrated that the Bacillus IV, respectively (26). Although its function is not yet clear, halodurans B.h.I1 intron spliced at positions 76, 72, and 51 domain III is absolutely required for splicing in vivo and in bp upstream possessed a potential IBS1 sequence. The B.c.I4 vitro (6, 21). On the other hand, whereas the Oi.Int4 intron intron of Bacillus cereus utilizes a 3' splicing site 56 bp has a group II intron of the same length as the Oi.Int3, it gave downstream of the predicted end of the intron, which allows no ligated exons in RT-PCR amplification by in vivo or in the downstream ORF to be translated in frame with the vitro splicing. upstream ORF (25). Alternative Splicing of the Oi.Int Intron 57

Fig. 2. Schematic illustration of the Oi.Int intron and comparison of nucleotide sequences between the Oi.Int3, Oi.Int4, and Oi.Int4M mutants. The intron-encoded ORF was inserted in domain IV. The ORF consists of subdo- mains 0–7 of a reverse transcriptase (RT) domain and an X domain, which shows mat- urase activity. The short vertical lines indicate the nucleotide sequences at 4 different positions between the Oi.Int3, Oi.Int4, and Oi.Int4M mutants.

Fig. 3. Alternative exon ligation events during in vitro self-splicing with mutation of the Oi.Int4 intron. (A) RT-PCR analysis of the Oi.Int4M mutant introns. The Oi.Int4M1, Oi.Int4M12, Oi.Int4M123, Oi.Int4MA, and Oi.Int4M234 are shown in lane 1 (526- and 753-bp products), in lane 2 (526-, 629-, and 753-bp products), in lane 3 (526-, 729-, and 807-bp products), in lane 4 (no product,) and in lane 5 (no product), respectively. (B) Sequenc- ing of RT-PCR products. Sequences are shown for exon-exon junctions of 526-, 629-, 729-, 753-, and 807-bp bands in Panel A. Sites of cleavage upstream of the introns are shown in parentheses. (C) Structures and sequences of stem-loop motifs with cryptic IBS1s upstream of the Oi.Int4M introns. Cleavage sites are at − 281, −178, −78, −54, and WT (cognate splicing) at the intron 5' end. The Oi.Int4M introns have similar stem-loop motifs upstream of the splice sites compared with the WT. EBS1 and EBS3 interactions are illustrated above the exon sequences. Stem-loop motifs were predicted with Zuker’s Mfold (36).

No products could be obtained by RT-PCR amplification The results suggest that the 686th nucleotide within the of the Oi.Int4MA and Oi.Int4M234 introns (Fig. 3A). The intron-encoded ORF plays a significant role in the exon Oi.Int4MA had the same sequence as the Oi.Int3 except for ligation of self-splicing reactions in vitro. the flanking sequence, but the introns could not be obtained. To reconfirm multisplicing of the Oi.Int4M introns, we In vitro, the exon ligation might be affected by the sequences carried out inverse RT-PCR amplification using an outward- of both the intron-encoded ORF and the intron boundaries. directed primer set, ACTS9 and ACTS10 (Table 1), because 58 CHEE et al.

Table 2. The pattern of in vitro splicing in the Oi.Int4 and Oi.Int4 mutant introns Ligated exon (RT-PCR) Spliced intron (inverse RT-PCR) Wild type OI4M1 OI4M12 OI4M123 OI4MA OI4M234 Wild type OI4M1 OI4M12 OI4M123 OI4MA OI4M234 forma 526 nt 526 nt 526 nt 801 nt 801 nt 801 nt 801 nt 801 nt 801 nt (−281, 0) (−281, 0) (−281, 0) (−281, 0) (−281, 0) (−281, 0) (−281, 0) (−281, 0) (−281, 0) circle 629 nt linear? (−178, 0) 729 nt linear? (−78, 0) 753 nt 753 nt 574 nt 574 nt circle (−54, 0) (−54, 0) (−54, 0) (−54, 0) 807 nt 520nt (0, 0) (0, 0) circle? 527 nt 527 nt 527 nt 527 nt (0, +7) (0, +7) (0, +7) (0, +7) linear? a Joining sites of inverse RT-PCR products corresponded to splicing sites of RT-PCR elements. Parentheses represent cleavage positions in up- and down stream of the intron (up, down). OI means the Oi.Int intron. group II introns are generally lariat or circular in self-splicing (14, 18, 19, 25, 34). Surprisingly, the wild type Oi.Int4 intron produced no ligated exons on RT-PCR, but two different bands were observed on inverse RT-PCR (Fig. 4A and Table 2). An inverse RT-PCR product of similar size to a 514-bp lariat form was detected. After cloning and sequencing, however, the product was found to be linked to the first to last intron nucleotides, and potentially indicates that a full- length intron circle is six nucleotides larger than the lariat form (Fig. 4B (3) and Table 2). This suggests that the joining sites of the product correspond to the splice sites of the 807- bp RT-PCR product of the Oi.Int4M123 intron. The other product was an 801-bp segment in which nucleotide −281 of the 5' site intron was linked to the intron’s last nucleotide (Fig. 4B (1) and Table 2). The 801-bp inverse RT-PCR segment was detected not only in the Oi.Int4 but also in a series of Oi.Int4M introns (Fig. 4A and Table 2). This segment was found to correspond to the splice sites of the 526-bp RT-PCR product of the Oi.Int4M1, Oi.Int4M12, and Oi.Int4M123 introns (Fig. 3), but not the Oi.Int4MA and Oi.Int4M234. All Oi.Int4M introns, except for the Oi.Int4M234, also yielded the 527-bp inverse RT-PCR product, although it was a faint band on the agarose gel in the case of Oi.Int4M12 (Fig. 4A). The joining sites of the 527-bp product showed unexpected sequences, in which the intron’s first nucleotide was linked to position +7 at the intron 3' end (Fig. 4B (4) and Table 2). Unfortunately, the splice sites corresponding to the joining sites of the product Fig. 4. Inverse RT-PCR analyses of the Oi.Int4M introns. (A) Elec- could not be detected on RT-PCR amplification in this trophoresis of inverse RT-PCR products obtained from the self-splicing study, although the 3' splice site of group II introns within of the Oi.Int4M introns in vitro. Lane 1, Oi.Int4; lane 2, Oi.Int4M1; lane the 3' exon was also observed in the B. cereus B.c.I4 intron 3, Oi.Int4M12; lane 4, Oi.Int4M123; lane 5, Oi.Int4MA; lane 6, Oi.Int4M234; and lane M, marker. Samples were analyzed on a 3% (25). Furthermore, the Oi.Int4M1 and M12 introns yielded a NuSieve GTG agarose gel (Cambrex). (B) Sequencing chromatograms 574-bp inverse RT-PCR product, the joining sites of which of inverse RT-PCR products. (1) White and (2) grey arrows indicate corresponded to the splice sites of the 753-bp RT-PCR full-length circles, which are at positions −281 and −54 at the intron 5' element (Fig. 4B (2) and Table 2). However, no inverse RT- end. No grey arrow is presented in Panel A because the 574-bp band of the −54 cleavage is too faint to be detected on the agarose gel. (3) Black PCR elements corresponding to the 629-, 729- and 807-bp arrow indicates the canonical splice sites of the Oi.Int4. (4) Black arrow RT-PCR elements were obtained. The results suggest the shows that the splice site in the Oi.Int4M1, Oi.Int4M12, Oi.Int4M123, RT-PCR elements to be produced from a linear intron in and Oi.Int4MA is 7 bp downstream of the intron 3' end. vitro. Actually, group IIC introns are linear in some bacteria, Group B Streptococci (10) and B. halodurans (30). The wild type Oi.Int4 yielded two inverse RT-PCR elements. the nucleotide sequence of the intron-encoded ORF was Nevertheless, the intron produced no ligated exons on RT- closely associated with exon ligation in splicing. PCR unlike the Oi.Int4M mutants. The results suggest that Alternative Splicing of the Oi.Int Intron 59

tertiary interactions. The Oi.Int4M introns yielded multiple Selection of 5' splice sites of the Oi.Int4 products at alternative 5' splice sites in vitro. This may be The recognition of 5' exons involves interaction by 3–4 because group II introns have many cryptic IBS1s and stem- nucleotides between IBS1 and EBS1 in group IIC introns loop motifs upstream. compared with 12 nt of both IBS1-EBS1 and IBS2-EBS2 for No ligated exons were obtained in the splicing reactions group IIA and IIB introns (23, 30). The behavior of group of the Oi.Int4 intron possessing only 4 base substitutions in IIC introns might suggest that the ribozyme is more flexible the intron-encoded ORF and domain VI compared with for 5' exon recognition than in the case of IIA and IIB the Oi.Int3 intron, which usually does not affect the self- introns. The Oi.Int4M introns were found to splice at splicing reactions in other group II introns. We found that multiple positions in the 5' exon in vitro. The cryptic IBS1 the Oi.Int4M mutants showed alternative 5' splice sites. sequence for the cleavage was UUAU for positions −281 and From the experimental results, we concluded that the alter- −178, UUA for position −78, and UAU for position −54 in native 5' splicing caused by the mutation of intron encoded- the 5' exon. Stem-loop motifs upstream of the IBS1 sequence ORFs increases the chance of functional change to the were found in all cases (Fig. 3B and 3C). ligated exons when Oi.Int4-like introns are inserted in the The stem-loop motifs play an important role in O. iheyensis genome and may influence to the adaptation of determining the splicing mobility of group IIC introns (24). O. iheyensis to environmental changes. The recA gene is Zuker’s RNA folding computer program, Mfold (36), was interrupted by the group II intron Gk.Int1 in Geobacillus used to predict the most thermodynamically stable stem-loop kaustophilus (4), and the groEL gene encoding a heat-shock motifs upstream of the cleavage sites and their free energies protein (Hsp60) is affected by the insertion of the group II of folding (ΔG) for each nucleotide sequence analyzed. intron AV in Azotobacter vinelandii (1). The alternative Generally, the GC content of stems, which are located in splicing event of the group II intron B.a.I2 in Bacillus the stem-loop motifs upstream of group IIC introns, is 70%, anthracis alters the predicted protein products of the indicating that superior stem stability enhances the mobility host gene (22). An extra segment of the Oi.Int4 intron like of the intron in splicing reactions (24). However, alternative B.c.I4 (25) is likely spliced as part of the intron RNA mole- splice sites had a lower GC content ranging from 17% to cule in vivo. It is thought that the extra segment is more wide- 50% compared with the 55% content of the wild type intron spread in nature. The extra segment must act as a trigger to as shown in Fig. 3C. In addition, it has been shown that the improve the diversity and evolution of group II introns. Also, Oi.Int4M introns could be spliced at new 5' sites not adjacent they suggest that the derivatives of group II introns have to the normal 5' GUGYG start site of the intron. These results important roles in genomic rearrangement through suggest that the selection of 5' splice sites does not depend on retrohoming in the O. iheyensis genome. It will also be inte- the GC content of the stem. The free energy ΔG of the stem- resting to reveal whether the Oi.Int4M introns are capable loops of 5' splice sites was −15.3 to 0.1 kcal mol−1, as shown of mobility and role of the extra segment in retrohoming. in Fig. 3C. The splice sites at positions −78 and −54 in the 5' exon were UUA or UAU in the incomplete IBS1, whereas References the splicing events occurred at the sites of incomplete IBS1. These results suggest the selection of 5' splice sites to be 1. Adamidi, C., O. Fedorova, and A.M. Pyle. 2003. A group II intron related to the superior thermodynamic stability of stem-loop inserted into a bacterial heat-shock operon shows autocatalytic activity and unusual thermostability. Biochemistry 42:3409–3418. structures with a negative ΔG, dependent on free energy ΔG 2. Belfort, M., V. Derbyshire, M.M. Parker, B. Cousineau, and rather than GC content. A.M. Lambowitz. 2002. Mobile introns: Pathways and proteins, p The 807-bp element of the Oi.Int4M123 intron was the 761–783. In N.L. Craig, R. Crigie, M. Gellert, and A.M. Lambowitz product of splicing at the canonical splice sites, but the (ed.), Mobile DNA II. ASM Press, Washington, D.C. 3. Bonen, L., and J. Vogel. 2001. The ins and outs of group II introns. predominant product of the Oi.Int4M introns seems to be Trends Genet. 17:322–331. the 526-bp element. This is because the 526-bp element 4. Chee, G.-J., and H. Takami. 2005. Housekeeping recA gene was observed in the Oi.Int4M1–M123 introns, and the corre- interrupted by group II intron in the thermophilic Geobacillus sponding joining sites were detected in all Oi.Int4M introns. kaustophilus. Gene 363:211–220. 5. Chien, M.-F., S. Tosa, C.-C. Huang, and G. Endo. 2009. Splicing of In addition, the 526-bp element has a bulge nucleotide in the a bacterial group II intron from Bacillus megaterium is independent stem-loop motif as in the canonical splice sites, although the of intron-encoded protein. Microbes Environ. 24:28–32. ΔG value of the stem-loop is higher than that of the canonical 6. D’Souza, L.M., and J. Zhong. 2002. Mutations in the Lactococcus splice sites. The main splicing event should occur at position lactis Ll.LtrB group II intron that retain mobility in vivo. BMC Mol. − Biol. 3:17. 281 different from the canonical splice sites due to favor- 7. Dai, L., and S. Zimmerly. 2002. Compilation and analysis of group able conformational stability. Assuming that the splicing II intron insertions in bacterial genomes: Evidence for retroelement event occurs in the O. iheyensis genome, nucleotides 447 to behavior. Nucleic Acids Res. 30:1091–1102. 450 in ORF OB2243 (450 nt) of the host gene, in which the 8. Edgell, D.R., M. Belfort, and D.A. Shub. 2000. Barriers to intron promiscuity in bacteria. J. Bacteriol. 182:5281–5289. Oi.Int4 intron is inserted, should change from ATAA to 9. Ferat, J.L., M. Le Gouar, and F. Michel. 2003. A group II intron has TTAA. The original Oi.Int4 should have been spliced at the invaded the genus Azotobacter and is inserted within the termination canonical splice sites like other Oi.Int introns. However, codon of the essential groEL gene. Mol. Microbiol. 49:1407–1423. after being inserted at the present position in the O. iheyensis 10. Granlund, M., F. Michel, and M. Norgren. 2001. Mutually exclusive distribution of IS1548 and GBSi1, an active group II intron identified genome, the intron was presumably changed such that the in human isolates of group B streptococci. J. Bacteriol. 183:2560– intron-encoded ORF interferes with exon ligation in self- 2569. splicing, and its natural splicing functions may be lost due to 60 CHEE et al.

11. Igo, M.M., and R. Losick. 1986. Regulation of a promoter that is 25. Stabell, F.B., N.J. Tourasse, S. Ravnum, et al. 2007. Group II utilized by minor forms of RNA polymerase holoenzyme in intron in Bacillus cereus has an unusual 3' extension and splices 56 Bacillus subtilis. J. Mol. Biol. 191:615–624. nucleotides downstream of the predicted site. Nucleic Acids Res. 12. Lambowitz, A.M., and S. Zimmerly. 2004. Mobile group II introns. 35:1612–1623. Annu. Rev. Genet. 38:1–35. 26. Takaki, Y., A. Matsuki, G.-J. Chee, et al. 2004. Identification and 13. Lehmann, K., and U. Schmidt. 2003. Group II introns: Structure and distribution of new insertion sequences in the genome of the catalytic versatility of large natural ribozymes. Crit. Rev. Biochem. extremely halotolerant and alkaliphilic Oceanobacillus iheyensis Mol. Biol. 38:249–303. HTE831. DNA Res. 11:233–245. 14. Li-Pook-Than, J., and L. Bonen. 2006. Multiple physical forms of 27. Takami, H., A. Matsuki, and Y. Takaki. 2004. Wide-range distribu- excised group II intron RNAs in wheat mitochondria. Nucleic Acids tion of insertion sequences identified in B. halodurans among bacilli Res. 34:2782–2790. and a new transposon disseminated in alkaliphilic and thermophilic 15. Lu, J., Y. Nogi, and H. Takami. 2001. Oceanobacillus iheyensis bacilli. DNA Res. 11:153–162. gen. nov., sp. nov., a deep-sea extremely halotolerant and alkaliphilic 28. Takami, H., Y. Takaki, and I. Uchiyama. 2002. Genome sequence species isolated from a depth of 1050 m on the Iheya Ridge. of Oceanobacillus iheyensis isolated from the Iheya Ridge and its FEMS Microbiol. Lett. 205:291–297. unexpected adaptive capabilities to extreme environments. Nucleic 16. Martinez-Abarca, F., and N. Toro. 2000. Group II introns in the Acids Res. 30:3927–3935. bacterial world. Mol. Microbiol. 38:917–926. 29. Toor, N., G. Hausner, and S. Zimmerly. 2001. Coevolution of 17. Michel, F., and J.L. Ferat. 1995. Structure and activities of group group II intron RNA structures with their intron-encoded reverse II introns. Annu. Rev. Biochem. 64:435–461. transcriptases. RNA 7:1142–1152. 18. Molina-Sanchez, M.D., F. Martinez-Abarca, and N. Toro. 2006. 30. Toor, N., A.R. Robart, J. Christianson, et al. 2006. Self-splicing of Excision of the Sinorhizobium meliloti group II intron RmInt1 as a group IIC intron: 5' exon recognition and alternative 5' splicing circles in vivo. J. Biol. Chem. 281:28737–28744. events implicate the stem-loop motif of a transcriptional terminator. 19. Murray, H.L., S. Mikheeva, V.W. Coljee, et al. 2001. Excision of Nucleic Acids Res. 34:6461–6471. group II introns as circles. Mol. Cell 8:201–211. 31. Toor, N., K.S. Keating, S.D. Taylor, et al. 2008. Crystal structure of a 20. Peebles, C.L., P.S. Perlman, K.L. Mecklenburg, et al. 1986. A self-spliced group II intron. Science 320:77–82. self-splicing RNA excises an intron lariat. Cell 44:213–223. 32. Toor, N., K. Rajashankar, K.S. Keating, et al. 2008. Structural basis 21. Qin, P.Z., and A.M. Pyle. 1998. The architectural organization for exon recognition by a group II intron. Nat. Struct. Mol. Biol. and mechanistic fuction of group II intron structural elements. Curr. 15:1221–1222. Opin. Struct. Biol. 8:301–308. 33. Toro, N. 2003. Bacteria and Archaea group II introns: Additional 22. Robart, A.R., N.K. Montgomery, K.L. Smith, et al. 2004. Principles mobile genetic elements in the environment. Environ. Microbiol. of 3' splice site selection and alternative splicing for an unusual group 5:143–151. II intron from Bacillus anthracis. RNA 10:854–862. 34. Vogel, J., and T. Börner. 2002. Lariat formation and a hydrolytic 23. Robart, A.R., and S. Zimmerly. 2005. Group II intron retroelements: pathway in plant chloroplast group II intron splicing. EMBO J. function and diversity. Cytogenet. Genome Res. 110:589–597. 21:3794–3803. 24. Robart, A.R., W. Seo, and S. Zimmerly. 2007. Insertion of group 35. Zimmerly, S., G. Hausner, and X. Wu. 2001. Phylogenetic relation- II intron retroelements after intrinsic transcriptional terminators. ships among group II intron ORFs. Nucleic Acids Res. 29:1238– Proc. Natl. Acad. Sci. U.S.A. 104:6620–6625. 1250. 36. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406–3415.