Florida State University Libraries

2016 The Sine Oculis Homologue Six7 Maintains Photoreceptor Diversity and Patterning in the Diurnal Zebrafish Retina Mailin Sotolongo-Lopez

Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] FLORIDA STATE UNIVERSITY

COLLEGE OF ARTS AND SCIENCES

THE SINE OCULIS HOMOLOGUE SIX7 MAINTAINS PHOTORECEPTOR DIVERSITY

AND PATTERNING IN THE DIURNAL ZEBRAFISH RETINA

MAILIN SOTOLONGO-LOPEZ

A Dissertation submitted to the Department of Biological Science in partial fulfillment of the requirements for the degree of Doctor of Philosophy

2016 Mailin Sotolongo-Lopez defended this dissertation on March 14, 2016. The members of the supervisory committee were:

James M. Fadool Professor Directing Dissertation

Jamila I. Horabin University Representative

Brian P. Chadwick Committee Member

Hank W. Bass Committee Member

Wu-Min Deng Committee Member

The Graduate School has verified and approved the above-named committee members, and certifies that the dissertation has been approved in accordance with university requirements.

To my family

iii ACKNOWLEDGMENTS

I would like to sincerely acknowledge the following: The funding sources throughout graduate school: NIH Grant R01 EY017753 to major professor Dr. James M. Fadool, the Foundation Fighting Blindness, the Department of Biological Science for financial support, the Association for Research in Vision and Ophthalmology (ARVO) for the Grant Wood Balkema Memorial Travel Grant, and the Graduate School at FSU for the Leslie N. Wilson-Delores Auzenne Assistantship and the Dissertation Research Grant. The zebrafish and retina scientific communities for sharing reagents and fish lines. The FSU Biological Science Department; Duncan Sousa from the Biological Science Imaging Facility for great assistance; Cheryl Pye, Brian Washburn and Steve Miller from the Core Facility for assisting with cloning, qRT-PCR experiments and sequencing; Ms. Judy Bowers for invaluable help and guidance; Rita Sherrod and Dr. Ben Miller for advice with paperwork; Charles Badland for assistance with artwork and photography; Dr. James Fadool, Dr. Karen McGinnis, Dr George Bates and Dr. Hank W. Bass for their great teaching mentorship in Genetics; Dr. Debra Fadool, Dr. Hank Bass, Dr. Wu-Min Deng and Dr. Lisa Lyons and their lab members for being great third floor neighbors and supporters, especially Nicholas Thiebaud for his invaluable friendship; my officemates, all the CMB and Neuroscience graduate students for their friendship. I want to thank you Allison Jevitt for her contribution to the rod and cone artworks on my dissertation. To Dr. Daniel Vera from the Center for Genomics and Personalized Medicine at FSU for his collaboration and analysis of whole-genome sequencing data. My major professor and advisor Dr. James M. Fadool for his invaluable guidance and encouragement throughout my graduate studies. Thank you for being an excellent mentor. I would never find a better one. Thanks for always trusting me and contributing to my scientific development. I deeply thank him for fostering my capacity critically as an independent researcher. The members of my doctoral committee: Dr. Jamila Horabi, Dr. Brian Chadwick, Dr. Hank W. Bass and Dr. Wu-Min Deng for their valuable comments, suggestions and advising. All members of the J.M. Fadool laboratory for their friendship and support; the former members: Dr. Karen Alvarez-Delfin and Dr. Carole Saade for their wonderful friendship and support; Elizabeth Ball, Stephanie Schwendt, Gayatri Rajkumari, Dr. Ann C. Morris, Katie Loughlin, Tyler Scott; Chelsea Benoit, Joseph Lebowitz. I would like to express my appreciation to my lab-mates Chris Zelinka and Lorea Arambarri for their fun, support and great company. My friends, some of them have been far geographically, but always attentive to my career. My roommate and friend Sonia Haiduc for her guidance and motivation. My friend Lisa Harris and her kids for their company throughout these years and for being my family in Tallahassee. Specially I greatly thank my godmother Gonzalina Sotolongo and my family from Orlando for their care and company. My friend and companion Jarrett Liles for his support, patience, understanding, and the happiness he brings to my life. My parents Pedro Sotolongo and Dora Lopez for their unconditional love and inspiration, and for being the source of motivation throughout my life. Your confidence in me has enhanced my ability to get through it all and succeed in the end. My brother Pedro Sotolongo and his family for their irreplaceable love.

iv TABLE OF CONTENTS

List of Tables ...... vii List of Figures ...... viii List of Abbreviations ...... x Abstract ...... xii

CHAPTER 1-INTRODUCTION ...... 1

1.1 Retinal development ...... 1 1.2 Transcription regulatory network for photoreceptor development ...... 2 1.3 Photoreceptor patterning occurs during development ...... 3 1.4 Zebrafish: a genetic model for retinal development ...... 5 1.4.1 Genetic tools in zebrafish ...... 5 1.4.1.1 TALENs ...... 6 1.4.1.2 CRISPRs/Cas system ...... 7 1.5 SIX genes in vertebrate eye development ...... 7 1.6 ljr mutation and six7 the candidate gene...... 9

CHAPTER 2-GENETIC DISSECTION OF DUAL ROLES FOR THE TRANSCRIPTION FACTOR SIX7 IN PHOTORECEPTOR DEVELOPMENT AND PATTERNING IN ZEBRAFISH ...... 11

2.1 Introduction ...... 11 2.2 Materials and Methods ...... 14 2.2.1 Zebrafish lines and maintenance ...... 14 2.2.2 Mapping and sequencing...... 14 2.2.3 Morpholino injections ...... 14 2.2.4 Genome editing by TALENs ...... 15 2.2.5 Real-time quantitative PCR...... 15 2.2.6 Immunocytochemistry and fluorescent microscopy ...... 16 2.2.7 Quantitative analysis ...... 16 2.2.8 Whole-mount in situ hybridizations ...... 17 2.2.9 TUNEL assay ...... 18 2.2.10 Cell transplantation ...... 18 2.3 Results ...... 19 2.3.1 The lots-of-rods-junior locus regulates spatial patterning ...... 19 2.3.2 ljrp23ahub as a hypomorphic allele of six7 ...... 19 2.3.3 six7 morphants show extended proliferation in the ONL ...... 25 2.3.4 Genome editing of six7 locus recapitulates the increased rod number in ljrp23ahub mutant larvae ...... 29 2.3.5 RH2 opsin expression and green cone precursor survival are dependent upon six7 expression ...... 33 2.3.6 six7 functions cell autonomously to regulate rod number and green cone precursor survival ...... 37

v 2.4 Discussion ...... 38

CHAPTER 3-PHOTORECEPTOR DISTRIBUTION AND OPSIN DIVERSITY IN THE EVOLUTION OF THE VERTEBRATE EYE ...... 43

3.1 From day to night and the evolution of vertebrate vision ...... 43 3.2 Early vertebrates ...... 43 3.2.1 550-500 million years ago: the ancestral photoreceptors ...... 43 3.2.2 Evolution and diversity of color vision in early vertebrates ...... 46 3.3 From 300 Mya and the diversity in color vision and photoreceptor ratios ...... 47 3.3.1 Teleosts ...... 47 3.3.2 Birds ...... 48 3.3.3 Reptiles ...... 49 3.3.4 Mammals and adaptation of their vision to nocturnal environments ...... 51 3.3.5 Evolution of cone pigments ...... 52 3.3.5.1 Monotremes, marsupials and early eutherians ...... 52 3.3.5.2 Trichromacy in primates ...... 53 3.3.5.3 Monochromacy in mammals: owl monkey and aquatic mammals ...... 53 3.3.6 Rod diversity in mammalian retina ...... 54 3.3.7 From the reptile-like retina ancestors to the mammalian retina and the “twilight- bottleneck” ...... 54 3.4 Potential for alterations in gene regulatory network underlying changes in photoreceptor ratios ...... 55

APENDIX A-ACUC PROTOCOL APPROVAL ...... 60

References ...... 61

Biographical Sketch ...... 83

vi LIST OF TABLES

Table 2.1 Primer sequences...... 42 Table 3.1 Summary of the rod and cone phenotypes for different genetic backgrounds...... 58

vii LIST OF FIGURES

1.1 six7 gene and protein structure ...... 9

1.2 ljrp23ahub mutants display an increased number and uniform distribution of rod photoreceptors...... 10

2.1 No changes in green, UV and blue opsin expression in ljrp23ahub mutants...... 20

2.2 Genomic deletion upstream of six7 segregates with ljrp23ahub mutants...... 22

2.3 six7 knockdown increased rod photoreceptor number...... 24

2.4 six7 knockdown increases the number of cells in the outer nuclear layer...... 25

2.5 six7 is expressed in photoreceptor precursor cells...... 26

2.6 Photoreceptor progenitor proliferation is regulated by six7...... 27

2.7 Mitosis is increased in the ONL with knockdown of six7...... 28

2.8 Cells are biased to differentiate as rods in the absence of six7...... 29

2.9 six7 functions in photoreceptor progenitor cells...... 31

2.10 No change in dorsal-ventral patterning of the optic cup in six7 mutants...... 31

2.11 TALENs-mediated knockout of six7 locus recapitulates ljrp23ahub phenotype...... 32

2.12 Levels of mitosis are altered in six7fl4 at 56 hpf...... 33

2.13 Lacked green opsin expression in six7fl4 larvae...... 34

2.14 Red and green-sensitive cone mosaic is altered in six7fl4 but not in six7p23ahub...... 35

2.15 six7 controls green opsin expression...... 36

2.16 six7 regulates green-cone opsin precursors survival...... 37

2.17 six7 acts cell autonomously...... 38

3.1 Schematic structure of rod and cone photoreceptor cells structure...... 45

viii 3.2 A diagram illustrating main branches of vertebrate evolution showing opsin subtypes and example species...... 51

3.3 A model for variation of photoreceptor composition...... 59

ix LIST OF ABBREVIATIONS

ANOVA analysis of variance bp base pair bmp4 bone morphogenic protein 4 BrdU bromodeoxyuridine cDNA complementary deoxyribonucleic acid CMZ ciliary marginal zone Crx cone and rod homeobox transcription factor DAPI 4, 6-diamidino-2-phenylindole DNA deoxyribonucleic acid dpf days post fertilization efnb2b ephrin-B2b protein ENU ethyl-nitrosourea Indel insertion-deletion GCL ganglion cell layer gdf6 growth differentiation factor 6 GFP green flourescent protein hpf hours post fertilization INL inner nuclear layer LWS long-wavelength sensitive opsin Mya million years ago MO Morpholino Nrl neural retina leuzine zipper transcription factor NHEJ non-homologous end-joining HDR homology-directed repair ONL outer nuclear layer PCR polymerase chain reaction PH3 phospho-histone 3 RH1 rhodopsin RH2 middle-wavelength sensitive opsin

x RNA ribonucleic acid RPCs retinal progenitor cells RT-PCR reverse transcribed polymerase chain reaction RXR retinoic X receptor gamma Six7 sine oculis homeobox homolog 7 transcription factor SD standard deviation SNP single nucleotide polymorphisms SWS1 short-wavelength sensitive opsin 1 SWS2 short-wavelength sensitive opsin 1 TALENs Transcription activator like effector nucleases tbx2b T-box transcription factor 2b TRβ thyroid hormone receptor β TUNEL terminal deoxynucleotide transferase (TdT)-mediated dUTP nick-end labeling UTR untranslated region UV ultraviolet vax2/cVax ventral anterior homeobox 2 transcription factor WT wild-type

xi ABSTRACT

During the age of non-avian dinosaurs, ancestors of present-day mammals were likely small insectivores, relegated to nocturnal and subterranean niches. This nocturnal “bottle-neck” is postulated as a driving force of numerous physiological and sensory adaptations including those of the visual system. The consequences of structural mutations of opsins upon spectral sensitivity and environmental adaptation have been studied in great detail, but lacking is knowledge of how alterations in gene regulatory networks contribute to the extant diversity of cone subtypes and the variation in the ratio of rods and cones observed in diurnal and nocturnal species. Exploiting photoreceptor patterning in cone-dominated zebrafish, we uncovered two independent mechanisms by which the sine oculis homeobox homolog 7 (six7) regulates photoreceptor development. In a genetic screen, we isolated the lots-of-rods-junior (ljrp23ahub) mutation that resulted in an increased number and uniform distribution of rods in otherwise normal appearing larvae. Sequence analysis, genome editing using TALENs and knockdown strategies confirm ljrp23ahub as a hypomorphic allele of six7, a teleost orthologue of six3, with known roles in forebrain patterning and expression of opsins. Based on the lack of protein- coding changes and an identified deletion of a conserved sequence about 40 kb upstream of six7 loci, a cis-regulatory mutation is proposed as the basis of the reduced expression in ljrp23ahub. Comparison of the hypomorphic and knock-out alleles provides evidence of two independent roles in photoreceptor development. EdU and PH3 labeling show that the increase in rod number and uniform distribution is associated with extended mitosis of photoreceptor progenitors, and TUNEL suggests that the lack of green cones is the result of cell death of the cone precursor. These data add six7 to the small but growing list of genes essential for specification and patterning of photoreceptors in non-mammalian vertebrates, and form the basis of a model that underscores the potential of alterations in transcriptional regulation as a mechanism underpinning photoreceptor variation across species.

xii CHAPTER 1

INTRODUCTION

1.1 Retinal development

The retina is a light-sensitive tissue located in the back of the eye. The vertebrate retina contains six major neuronal cell types and one type of glial cell, arranged into three cellular layers each separated by two synaptic layers. The ganglion cell layer (GCL) is the inner most layer of the retina and transmits visual information to the brain. The inner nuclear layer (INL) contains the cell body of amacrine, bipolar, and horizontal cells which process and transmit information from the photoreceptors to the ganglion cells. The photoreceptors make up the outer most layer and are responsible for phototransduction. The major retinal cells contain numerous morphological and functional sub-types that together account for more than 60 different retinal neurons (reviewed by Masland, 2012). Photoreceptors are functionally distinguished as rods and cones. Rod photoreceptors mediate dim light vision. Rods contain the light-sensitive photopigment rhodopsin. Cone photoreceptors respond to bright light and facilitate color vision. Each cone contains one of the four cone opsin subtypes, each of which absorbs light of different wavelengths. My goal was to take advantage of photoreceptor subtypes to study the mechanisms that generate cell diversity during neurogenesis. In the last 25 years, there has been tremendous progress towards understanding the generation of this diversity in the retina. Lineage trace analysis in multiple organisms established that the major classes of retinal cell types are generated from a pool of multipotent retinal progenitor cells (RPCs) in a temporally conserved order (Holt et al., 1988; Turner and Cepko, 1987; Fekete et al., 1994; Reese et al., 1999). During retinogenesis, RPCs exit the cell cycle in a conserved yet overlapped order across vertebrate. Ganglion cells are generated first followed by cone, horizontal, amacrine, rod, and bipolar cells. Muller glia are the last retinal cell type to differentiate (Young, 1985; Hu and Easter, 1999; Schmitt and Dowling, 1996; Schmitt and Dowling, 1999; Rapaport et al., 2004). RPC transplantation studies showed that early RPCs always produce early retinal cell types (Kay et al., 2005; Belliveau and Cepko, 1999), and that late RPCs differentiate as late cell types independent of transplantation into an early or late environment (Belliveau et al., 2000). These findings suggest that intrinsic properties in RPCs determine the capacity of the progenitor cells to acquire cell fate (Cepko et al., 1996). In some

1 cases, cell-intrinsic mechanisms are necessary for lineage specification, such as Math5 (Atoh7) for ganglion cells (Wang et al., 2001), Nrl for rod photoreceptors (Mears et al., 2001), and tbx2b for UV cone photoreceptors (Alvarez-Delfin et al., 2009). However, extracellular signals are also involved in retinal cell fate determination. For example, 96% of the postmitotic cells differentiate as rods when Notch1 was ablated from newly postmitotic cells in mice during the postnatal stage, whereas in control retinas 30% of the cells became bipolar cells and Muller glia (Mizeracka et al., 2013). Recently, it has been proposed that stochastic mechanisms combined with factors that control cell cycle and cell fate determinants, could underlie the species-specific retinal sizes and cellular composition in all vertebrates (He et al., 2012; Bassett and Wallace, 2012; Boije et al., 2014). The inheritance of different amounts of intrinsic factors (determinants) can bias daughter cells toward certain fates to generate greater cellular diversity in clones. Mathematical models and retinal cell-lineage tracing studies in rat support a stochastic mechanism for cell fate determination (Slater et al., 2009; Gomes et al., 2011; He et al., 2012). Time lapse studies of cell lineage in zebrafish were consistent with both stochastic and programmed factors, governing the decisions of equipotent RPCs to either proliferate or differentiate (He et al., 2012).

1.2 Transcription regulatory network for photoreceptor development

The vertebrate retina has generally one kind of rod photoreceptor and up to four cone cell subtypes. Rods express rhodopsin (RH1). Cones can be classified into four spectral classes of cone pigments: long-wave class (LWS or L/M-cone) sensitive to the red-green spectral region, middle wave class (RH2) sensitive to the green, short-wave class (SWS2) sensitive to the blue, or short-wave class (SWS1/S-cone) sensitive to the violet or UV (reviewed by Bowmaker., 2008). Numerous transcription factors are involved in vertebrate photoreceptor specification. The orthodenticle homeobox 2, Otx2, is expressed in mitotic RPCs committed to the photoreceptor fate. Otx2 conditional knockout mice display complete loss of rods and cones with an increased number of amacrine cells which are also generated at this stage of development (Nishida et al., 2003). Photoreceptor progenitors express cone-rod homeobox transcription factor (Crx) as well as other transcription factors such as neurogenic differentiation factor 1 (Neurod1) (Liu et al., 2008). Loss of Crx gene expression in mice leads to the development of nonfunctional photoreceptors followed by slow retinal degeneration (Furukawa et al., 1997). Two additional transcription factors, neural retina leucine zipper (Nrl) and thyroid hormone receptor β2 (Trβ2),

2 control the final cell fate. Nrl is an instructive transcription factor that functions to determine rod cell fate. Nrl-/- mice lack rods and have an excess of S cones (Mears et al., 2001). The photoreceptor-specific nuclear receptor, Nr2e3, is a direct target of Nrl that consolidates the rod fate. Mice lacking expression of Nr2e3 have rods expressing cone markers (Chen et al., 2005). Conversely, Trβ2 determines the M-opsin or S-opsin cone fate. The cones in Trβ2-deficient mice only express S opsin (Lu et al., 2009; Swaroop et al., 2010). These findings support the transcriptional dominance model of photoreceptor cell fate determination in mammals. Photoreceptor precursor cells become S cones unless the expression of Nrl or Trβ2 direct the outcome to a rod or cone respectively (Swaroop et al., 2010). In zebrafish, the loss of function of T-box transcription factor (tbx2b) increases the rod number with a reduction of UV cones, homologue of S cones in mammals, due to cell fate (Alvarez-Delfin et al., 2009). The function of tbx2b is opposite to that of Nrl, raising questions about the “transcriptional dominance” model for photoreceptor cell development. Although much is known about mammalian photoreceptor genesis, little is known in other vertebrates.

1.3 Photoreceptor patterning occurs during development

The distribution of photoreceptors across the retina can significantly impact vision. The primate fovea constitutes a unique example of photoreceptor pattern with the highest density of cones within the retina. Outside the fovea cones constitute a 5% of the photoreceptors, while rods account for the remaining 95% (Morris, 1982; Curcio et al., 1990; Hendrickson, 1994). This spatial distribution of photoreceptors in the fovea allows the sharpest vision in humans. Photoreceptors are asymmetrically distributed across the vertebrate retina. In zebrafish larvae, rod density is highest in the ventral retina, lower in the central region, and sporadic, yet non-random across the dorsal retina (Fadool, 2003). In the chick retina, rods are more abundant dorsally than ventrally with a rod-free area centralis (Bruhn and Cepko, 1996). Despite the importance of photoreceptor distribution for visual perception, the molecular mechanisms that control spatial distribution of the photoreceptors remain relatively unknown. The expression of early transcription factors and signaling molecules in the optic vesicle predetermine the specification of neuronal patterning along the anterior-posterior and dorsal- ventral axes of the retina. Dorsal transcription factors, gdf6a, tbx2 and efnb2b, repress vax2 to ensure distinction between dorsal and ventral regions in the retina (Schulte et al., 1999; Sakuta et

3 al., 2001; Gosse and Baier, 2009; Koshiba-Takeuchi et al., 2000). The homeobox gene Vax2 is expressed ventrally in the eye and ensures the proper specification of the ventral optic vesicle (Barbieri et al., 1999; Peters and Cepko, 2002). In the chick retina, cVax/Vax2 is involved in rod patterning. Dorsal ablation of the chick eye causes cVax expression to extend to the dorsal cup as well as ventralization of the rod patterning. The rod free area and the rod sparse streak were missed (Schulte et al., 2005). Recently, transcriptome analysis and genetic manipulations in mice and medaka fish revealed that Vax2 controls the asymmetric production of retinoic acid (RA) and the expression of cone opsin genes in the retina (Alfano et al., 2011). Conversely, in vitro studies have shown that treatment with RA increases rod differentiation and guarantees the formation of the ventral region of the eye (Hyatt et al., 1996; Hyatt and Dowling, 1997; Sen et al., 2005; Khanna et al., 2006; Ng et al., 2001). Cone distribution in the mouse retina is not uniform. S-cones are abundant in the ventral retina and sparse in the dorsal retina, whereas M- cones are evenly distributed. S- and M-cone photopigments are expressed in midretinal regions (Szel et al., 1993). The nuclear hormone receptors TRβ- and RXR have been implicated in cone patterning in the mouse retina on the basis of the disruption of the S- and M-cone arrangement observed in the knockout mutants (Ng et al., 2001; Roberts et al., 2006; Roberts et al., 2005). Therefore, TH signaling via TRβ promotes dorsal-ventral pattern of cones in the mouse retina (Roberts et al., 2006). Photoreceptor distribution is “pre-patterned” at early stages of eye development in a range of species including mouse, Xenopus, chick, and zebrafish. However, photoreceptors show differences in patterning across species regardless the highly restricted expression of Vax in the ventral retinal domain (Barbieri et al., 1999; Ohsaki et al., 1999; Schulte et al., 1999; Take-uchi et al., 2003). This suggest that other mechanisms are regulating photoreceptor patterning. In mammals, where most of the studies have been conducted, rod genesis occurs after cone differentiation. Changes in timing of retina neurogenesis could explain differences in photoreceptor patterning between species. Studies of retinal cell proliferation in monkeys demonstrated that in the nocturnal monkey, Aoutus azarae, cell cycle exit is extended to later maturational stages, increasing the proportion of later differentiated neurons like rod and bipolar cells (Dyer et al., 2009).

4 1.4 Zebrafish: a genetic model for retinal development

Zebrafish (Danio rerio) is a genetic model system for investigating development and patterning of photoreceptors in the vertebrate retina. The conserved retinal anatomy, rapid retinal development, and tetrachromatic vision are among the key advantages to use zebrafish for photoreceptor genesis research. In addition, the accessibility of retinal molecular markers and the ability to manipulate the zebrafish genome have allowed for gene editing approaches to uncover functions during photoreceptor development (Dowling and Boycott, 1966; Larison and Bremiller, 1990; Trevarrow, 2011; Sander et al., 2011; Raymond et al., 1995; Hwang et al., 2013). In zebrafish, retinal development occurs rapidly compared with mammals. Ganglion cells are the first to differentiate around 28 hours-post-fertilization (hpf), followed by amacrine, horizontal, and bipolar cells beginning at 38 hpf. Around 48 hpf, the cells that exited the cell cycle are fated to become the photoreceptor cells. The zebrafish retina possesses rod photoreceptors and four distinct types of cone photoreceptors: red-, green-, blue-, and ultraviolet (UV)-sensitive cones (Raymond et al., 1995; Vihtelic et al., 1999). By 50 hpf, rhodopsin and red- sensitive opsin can be detected in the ventral patch, a region of precocious neurogenesis in the ventral retina, followed by blue-sensitive cones, UV-sensitive cones, and lastly the green- sensitive cones which are detected around 60 hpf (Schmitt and Dowling, 1999). By 5 days-post- fertilization (dpf), the zebrafish larvae are able to respond to a visual stimulus (Brockerhoff et al., 1995; Neuhauss et al., 1999; Gross et al., 2005). Photoreceptors are patterned in the zebrafish retina and cones are arranged in a precise mosaic in the zebrafish adult. (Takesue et al., 1998; Cameron and Carney, 2000; Mochizuki, 2002; Raymond and Barthel, 2004). The cone mosaic comprises rows of red and green-sensitive double cones that alternate with rows of blue- and UV-sensitive single cones (Robinson et al., 1993; Allison et al., 2010; Takesue et al., 1998). The cone photoreceptor mosaic constitutes an experimentally tractable system for the study of spatial arrangement of heterotypic cell types in the vertebrate central nervous system.

1.4.1 Genetic tools in zebrafish

The development of forward and reverse genetic tools have further strengthened the power of zebrafish as a model organism. Forward genetic approaches, like N-ethyl-N-nitrosurea mutagenesis (ENU), insertional retroviruses, and transposon-based techniques, have identified

5 genes essential to retinal development (reviewed by Morris., 2011). Large-scale screens for mutants with morphological, histochemical, and behavioral visual defects have enabled the identification of genes involved in photoreceptor structure, function, and survival (Malicki et al., 1996; Brockerhoff et al., 1995; Fadool et al., 1997; Brockerhoff et al., 1998; Alvarez-Delfin et al., 2009; Morris, 2011). Recently, two new technologies, Transcription activator like-effector nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs/Cas) have emerged as promising genetic tools that overcome the undesirable side- effects, cost and time consuming of previous genetic tools used in this vertebrate model (Christian et al., 2010; Cong et al., 2013).

1.4.1.1 TALENs

TALENs technology is based on the fusion of a DNA recognition motif with the FokI nuclease that cleaves double stranded DNA in a site-specific manner (Sander et al., 2011; Cade et al., 2012). FokI functions as a dimer, therefore the TAL effectors nucleases are designed in pairs to bind adjacent DNA sequences allowing FokI dimerization. FokI dimerization is followed by double strand break (DSB) between both binding sites. The DSB will be repaired by either the non-homology end-joining (NHEJ) pathway or homology-directed repair (HDR). The NHEJ system repair can generate insertions or deletions at the break site that often leads to gene disruption (Christian et al., 2010; Cristea et al., 2013; Maresca et al., 2013). In zebrafish, TALENs encoding mRNA can be injected into one-cell stage embryos where it is translated into functional proteins. Production of insertion or deletion mutations (indels) can be detected in the genome as early as at the 256 cells stage (Sander et al., 2011). The lesion can be identified by changes in restriction enzyme sites in the targeted region (Huang et al., 2011). TALENs can also generate highly precise sequence modification by HDR when a single strand oligo or even a larger sequence is co-injected. The HDR repair system can introduce the desired DNA with specific mutations or additional sequences, but the efficiency is about 1.5% (Zu et al., 2013). The knock-in or knock-out gene technology mediated by TALENs has been used as a tool to study the physiology, pharmacology treatments, or the whole exome variation observed in the human retina (Deml et al., 2015).

6 1.4.1.2 CRISPRs/Cas system

More recently an alternative nuclease genome-editing approach has been described. The CRISPRs/Cas9 system, initially found in bacteria and archae, has been used efficiently to introduce targeted custom changes at the genomic level (Horvath and Barrangou, 2010). This system mediates defense in bacteria against virus invasion by inducing cleavage in foreign DNA using homologous RNA as a guide to recruit the Cas9 nuclease (Jinek et al., 2012; Gasiunas et al., 2012; Garneau et al., 2010). Similar to TALENs, CRISPR/Cas system includes two components: the short CRISPR RNAs (crRNAs) or guide RNA (gRNA) domain responsible for target specification and the endonuclease Cas9 for inducing double stranded DNA cleavage in the target sequence. The gRNA contains around 20 variable nucleotides that can be designed to specifically recognize a desirable genome sequence. An additional requirement for CRISPR/Cas recognition is the protospacer adjacent motif in the γ’end of the target sequence. Co-delivery of expression vectors that contain the Cas9 endonuclease and the crRNAs have been used to interrupt precisely gene function in human cells and zebrafish (Mali et al., 2013; Hwang et al., 2013; Chang et al., 2013; Cho et al., 2014). Resulting genome alterations are stable and therefore heritable. In addition, precise genomic sequence change was observed by HDR when single- stranded oligo was supplied (Hwang et al., 2013). The availability of two independent tools provides alternative approaches to target loci when one or the other fails.

1.5 SIX genes in vertebrate eye development

SIX gene function, regulation, and interaction with signal transduction pathways in development are widely conserved from Drosophila to humans (Kawakami et al., 2000). The SIX proteins function as transcriptional activators by interactions with eyes absent, EYA, or transcriptional repressors by interactions with Groucho/TLE family through the engrailed domain (eh1) (Kumar, 2009). The molecular characterization of the sine oculis- medusa (so mda) mutant in Drosophila melanogaster resulted in the isolation of the first member of sine oculis (SIX) homeobox family, so (Serikaku and O'Tousa, 1994). Other gene family members have been identified in many species: murine, human, chicken, frog, fish, and nematode (Seo et al., 1999; Oliver et al., 1995; Kawakami et al., 2000). SIX genes encode a conserved N-terminal SIX-type homeodomain (SD) and a C-terminal homeodomain (HD). The HD is responsible for binding DNA-targets, whereas the SD mediates protein-protein interactions.

7 Phylogenetic analysis classifies SIX genes into three subfamilies: so/Six1/2, optix/Six3/6/7 and DSix4/Six4/5 (Kawakami et al., 2000). six7 is a member of the optix/Six3/6/7 subfamily protein. optix, the Drosophila member, is expressed in the eye and induces ectopic eye formation when misexpressed in non-retinal tissues (Seimiya and Gehring, 2000; Kenyon et al., 2005; Anderson et al., 2012). In addition, studies in Xenopus show that Six3 acts antagonistically to Geminin to regulate cell proliferation and differentiation at early stages of eye development and forebrain patterning (Del Bene et al., 2004). In the central nervous system, misexpression of Six3 in telencephalon progenitor cells leads to clonal expansion and failure of cell differentiation (Appolloni et al., 2008). In addition to the well-known function in eye and forebrain patterning, within the retina, retroviral infections of Six3 in newborn rat resulted in an increase of rod photoreceptors (Zhu et al., 2002). The six3/6/7 subfamily in zebrafish includes five homologues: six3a, six3b, six6a, six6b and six7. six3a and six3b expression is first detected in the still to develop forebrain, optic primordial, and optic vesicles (Seo et al., 1998a). In the retina, six3a and six3b express differently. At 24 hpf, six3a expression is located in the ventral part of the retina, while at 48 hpf it is mostly in the choroid fissure edges. However, six3b expression at 48 hpf is located in the ganglion cell layer and the inner nuclear layer (Seo et al., 1998). The loss of function of six3b and reduced six3a expression cause malformed eyes with optic nerve hypoplasia and mis- pathfinding of RGC axons (Samuel et al., 2016). Six3b protein functions as a transcriptional repressor during early development by interaction with the corepressor Groucho. six3b overexpression in zebrafish embryos causes eye and forebrain hypoplasia (Kobayashi et al., 2001). Similar to other members of the SIX-gene family, the six7 gene encodes the SD and a HD (Figure 1.1; Seo et al., 1998). The six7 gene has around 68% sequence identity with six3a/b. The sequences identity increases to 77% in the SD and 95% in the HD (Seo et al., 1998). The six7 gene has an early pattern of expression similar to that of Six3a/Six3b. Overexpression of six7, like six3 and six6, causes enlargement of brain and eye tissue (Inbal et al., 2007), but no difference in the photoreceptor rod number phenotype (Alvarez-Delfin, 2011). In addition, deficiency of six3b/six7 expression leads to mostly intact forebrain and lack of eyes in zebrafish, suggesting that both genes are necessary in early eye development (Inbal et al., 2007).

Figure 1.1. six7 gene and protein structure. (A) The genomic structure of the zebrafish six7 gene showing untranslated regions as white boxes and coding exons in colors. Green and yellow colors represent the nucleotide sequences that code for the SIX domain and homeodomain respectively. Beige color represents other regions of the protein. (B) cDNA structure for six7 transcript. 5’UTR and γ’UTR are white boxes. (C) Motifs of the Six7 protein

1.6 ljr mutation and six7 the candidate gene

In a previously published genetic screen to isolate loci that regulate rod development and spatial patterning in zebrafish (Morris and Fadool, 2005; Alvarez-Delfin et al., 2009), our laboratory identified lots-of-rods-junior (ljrp23ahub) mutant. The ljrp23ahub mutation results in an increased number of rods across the retina in otherwise normal appearing larvae (Figure 1.2A and 1.2B) (Alvarez-Delfin et al., 2009; Alvarez-Delfin, 2011). No changes in other retinal cell types were observed in ljrp23ahub mutant (Alvarez-Delfin, 2011). Genetic linkage analysis positioned the ljrp23ahub locus to a 0.3 Mb interval on chromosome 7 encompassing seven annotated genes. six7 was selected as the main candidate gene mutated in ljrp23ahub on the basis of the known function of the SIX family gene members in eye development (Kumar, 2009). Knockdown of six7 expression phenocopied the ljrp23ahub mutants. The increased rod number in a dose dependent manner (Figure 1.2C and 1.2D; Alvarez- Delfin, 2011) and no changes in other retinal cell types are consistent with six7 as the candidate locus in ljrp23ahub. The purpose of my dissertation project is to determine the role of six7 in photoreceptor cell development.

Figure 1.2. ljrp23ahub mutants display an increased number and uniform distribution of rod photoreceptors. (A) Confocal immunofluorescent images labeled for rods (red) and UV cones (green) from WT, ljrp23ahub retinas at 4 days-post-fertilization (dpf). WT larvae show asymmetric rod distribution in central and dorsal retina and a uniform distribution of UV cones across the entire retina. (B) Graph showing the average number of rods per unit area dorsal to the optic nerve (WT, n=5; ljrp23ahub, n=5). Significantly-different means p<0.0001. (C) Retinal cryosection from 4 dpf un-injected control WT and six7-MO1 injected embryos immunolabeled for rods (4C12, green). six7-morphants display an increase in the number of rods as detected in ljrp23ahub. Note the lack of gaps in rod distribution in the central retina of six7-knockdown larvae. (D) Graph showing dosage dependent increase in the average number of rods per unit area dorsal to the optic nerve of WT and six7-MO1 injected embryos (WT un-injected, n=4; six7-MO1, n=6, each dose), One-way ANOVA with Tukey’s post-hoc test. a vs b, p<0.05, b vs c, p<0.001, a vs c, p<0.0001. Error bars represent standard deviation (SD). MO1, morpholino 1. (Alvarez-Delfin, 2011).

10 CHAPTER 2

GENETIC DISSECTION OF DUAL ROLES FOR THE TRANSCRIPTION FACTOR SIX7 IN PHOTORECEPTOR DEVELOPMENT AND PATTERNING IN ZEBRAFISH

2.1 Introduction

Sensory systems provide a critical link for an animal to its ever changing and complex environment. Retinal photoreceptors are the highly specialized neurons that transduce light into the chemical and electrical signals of the nervous system. Representatives from nearly all classes of extant vertebrates possess two distinct types of photoreceptors: rods, which are highly sensitive to light mediate scotopic or dim light vision, and cones which function under daylight or bright light conditions and are responsible for color vision. The spectral sensitivity of cones is dependent upon the expression of one of four different visual pigments or opsins with peak sensitivity to ultraviolet or violet (SWS1), blue (SWS2), green (RH2), or red (LWS) wavelengths of light. Rods express rhodopsin (RH1) which is most sensitive to green light. Detailed phylogenetic and functional analyses of structural mutations affecting spectral sensitivity provide much insight about the evolution of the visual system and adaptation to different lighting environments (Yokoyama et al., 2008; Hofmann and Carleton, 2009; Bickelmann et al., 2015; Lagman et al., 2013; Yokoyama, 2002). Nevertheless, the molecular mechanisms leading to the major evolutionary changes in photoreceptor composition among vertebrate species remain unclear. Electrophysiological data provide compelling evidence that the first jawless vertebrates already possessed a duplex retina containing four cone subtypes as well as cells adapted to dim light conditions (Asteriti et al., 2015; Morshedian and Fain, 2015; Collin et al., 2009; Collin et al., 2003; Govavardovskii V.I. , Lychakov D.V., 1984). A cone rich architecture is still present in many extant species of teleosts, amphibians, reptiles, and birds (Cortesi et al., 2015; Bowmaker, 2008; Hart and Hunt, 2007; Vihtelic et al., 1999); in stark contrast, retinas of nocturnal animals are typically rod-dominated and possess only one or two cone subtypes (Ahnelt and Kolb, 2000). The high number of rods, relatively few cones, and eye shape reflect the prevailing view that mesozoic ancestors of extant mammals were adapted to a nocturnal environment (Walls, 1942; Wikler and Rakic, 1990; Heesy and Hall, 2010; Hall et al., 2012). Today, the remaining cones in

11 marsupials and eutherian mammals express LWS and SWS1 opsins, and in monotremes express functional LWS and SWS2 opsins. The absence of an RH2 gene in extant mammals suggests that trichromacy was a feature shared by the last common ancestor of all mammals, followed by the independent loss of one or the other short wavelength-sensitive opsin in the prototherian and metatherian lineages (Davies et al., 2007; Davies et al., 2012; Jacobs, 2013). The absence of RH2 and SWS2 but preservation of RH1, LWS, and SWS1 opsins in the basal lineage of modern snakes is an example of convergent evolution but suggests strong selection to maintain short and long wavelength sensitivity in nocturnal or burrowing species; continued adaptation is observed in more recent gene losses, adaptation of additional sensory modalities or regain of trichromacy (Jacobs, 2013; Nathans et al., 1986; Jacobs et al., 1996; Zhao et al., 2009). Walls proposed the transmutation of one photoreceptor cell type into another to explain changes in photoreceptor variation across species (Walls, 1942). Studies in garter snakes have shown the presence of RH1 opsin and rod transducin in “cone” photoreceptors (Schott et al., 2016a). However, phylogenetic analysis and experimental data support the notion that shifts in the timing of mitosis (heterochrony) are also associated with alterations in the proportion of neuronal subtypes produced during retinogenesis (Kay et al., 2001). For example, the greatly increased numbers of rod and bipolar cells in the nocturnal owl monkey (Aotus azarae) are associated with shifts in mitosis to later stages of development compared to a closely related diurnal capuchin monkey (Cebus apella) (Dyer et al., 2009). Analysis of mouse mutations and human diseases show that alterations in the photoreceptor gene-regulatory network leads to dramatic changes in the types and numbers of rods and cones generated during development. The specification of photoreceptor precursors and subsequent expression of rod and cone specific genes requires the expression of the homeobox transcription factor CRX (Furukawa et al., 1997; Swain et al., 1997; Freund et al., 1997; Chen et al., 1997). Subsequently, TRβ2 regulates the specification of the LWS cone (Ng et al., 2001; Roberts et al., 2006), and the transcription factor NRL acts synergistically with CRX to specify the rod fate and drive rod gene expression (Rehemtulla et al., 1996; Mitton et al., 2000). Mutations of the transcription factor Nrl result in an all cone retina, whereas mutations of its downstream target Nr2e3 result in an increased number of SWS1 cones, and rod-cone hybrids (Kobayashi et al., 1999; Bessant et al., 1999; Chen et al., 2005; Haider et al., 2000; Mears et al., 2001). The roles of these transcription factors are highly conserved yet studies have failed to find evidence that alteration of this gene regulatory

12 network drives adaptation of the visual system in different classes of vertebrates. In fact, little is known about the factors that generate the greater diversity of cone subtypes in non-mammalian vertebrates or the mechanisms underlying the wide range of rod to cone ratios in diurnal and nocturnal species (Adler and Raymond, 2008; Brzezinski and Reh, 2015). The spatial patterning of zebrafish photoreceptors combined with classical genetics and emerging gene-targeting technologies offer unprecedented opportunities to investigate photoreceptor biology in a diurnal species (Zou et al., 2012; Raymond et al., 2014; Allison et al., 2010; Alvarez-Delfin et al., 2009; Mitchell et al., 2015). Larval zebrafish retina contains four cone subtypes, which outnumber the many fewer, sparsely distributed rods. Previously, in a genetic screen, our laboratory identified a novel role for the transcription factor tbx2b, a co- orthologue of TBX2, in photoreceptor development. Mutations of tbx2b results in a cell fate switch of the SWS1 cone precursors into rods (Alvarez-Delfin et al., 2009). These data supported the conservation of the ontological relationship between the SWS1-cones and rods in mammals and zebrafish, but challenged the notion of a default photoreceptor fate among species. Here, I characterize in great detail the mutation called lots-of-rods junior (ljrp23ahub) that results in an increased number and uniform distribution of rods in larvae but with little affect upon cones. Data provide strong evidence that ljrp23ahub is a mutation in a cis-regulatory element of six7, a teleost member of the sine oculis family of homeobox transcription factors (Seo et al., 1998b). Our previous data show that knockdown of six7 led to the increased number of rods, and Ogawa et al., (2015) reported increased rod gene expression and altered cone opsin expression in a six7 knockout line (Saade et al., 2013; Ogawa et al., 2015). My genetic analysis of the hypomorphic allele and novel loss-of-function alleles reveal that six7 regulates mitosis of photoreceptor progenitors in a dosage dependent manner and independently is essential for the survival of green cone precursors. In addition to expanding the understanding of genes essential for maintenance of photoreceptor diversity in a diurnal species, the developmental variation in rod and cone numbers provide insight into putative steps along an evolutionary trajectory from a cone-rich towards a rod-dominated retina.

13 2.2 Materials and Methods

2.2.1 Zebrafish lines and maintenance

Zebrafish (Danio rerio) were reared, bred and staged according to standard methods (Westerfield, 1995). ljrp23ahub mutant was previously isolated (Alvarez-Delfin, 2011). The lorp25bbtl mutant was previously characterized. (Alvarez-Delfin, 2011) animal procedures were approved by the Florida State University (FSU) Institutional Animal Care and Use Committee.

2.2.2 Mapping and sequencing

ljrp23ahub mutant embryos were identified by immunolabeling as previously described (Alvarez-Delfin et al., 2009). Linkage mapping was performed at the Zebrafish Mapping Facility at the University of Louisville from DNA isolated from 100 ljrp23ahub mutant- and 100 WT sibling embryos using simple sequence-length polymorphism markers. Fine resolution mapping was performed with 463 ljrp23ahub mutant embryos (Gregg et al., 2003). Genomic DNA from 118 ljrp23ahub mutant embryos was isolated (DNeasy Blood 7 Tissue Kit; Quiagen, Valencia, CA, USA) and used for Illumina sequencing at the University of Texas Genomic Sequencing and Analysis Facility as previously described (Lee et al., 2014). Reads were aligned to the zv9 Zebrafish genome assembly (ensembl) with BWA (Li et al., 2009) using default parameters. Reads with alignment quality of at least 30 were used to identify SNPs against the zv9 genome assembly using samtools mpileup and bcftools 0.1.19 (Li, 2011). SNP densities were calculated using bedtools2 (Quinlan and Hall, 2010). Data was visualized using the UCSC genome Browser (Kent et al., 2002; Rosenbloom et al., 2015). Genomic DNA was isolated from tail-clip of adult zebrafish and the candidate deleted region was confirmed by PCR in: ljrp23ahub mutants (n=9) and WT embryos from: AB genetic background (n=6), TL genetic background (n=6) using the primers listed in Table 2.1. PCR of six7 fragment was used as positive control using primers listed in Table 2.1.

2.2.3 Morpholino injections

One of three different morpholinos (MO) were injected into one-cell stage WT embryos: mispaired-control MO, 5’-CGAACGCCATTCCGAGTCTGACTAAC-γ’; antisense nucleotide targeting six7 5’-UTR (MO1),5’-CCAACGGCATTCCAGTGTGAGTAAC-γ’ (Inbal et al.,

14 2007); and six7 splice-blocking MO (MOγ), 5’-GTACTTTTTGGTCTCACCTTAAAGC-γ’ (Gene Tools, LLC, Philomath, OR). Unless otherwise stated, embryos were injected with 0.87 ng of the indicated MO. To confirm the efficiency of MO3, RNA was isolated from un-injected and MO3-injected embryos and the region spanning from exon 1 to exon 2 of the six7-transcript was amplified by PCR using primers listed in Table 2.1. The truncated six7-transcript was sequenced using Applied Biosystems 3730 Genetic Analyzer with Capillary Electrophoresis (Foster City, CA).

2.2.4 Genome editing by TALENs

TALEN expression vectors were constructed in the Mutation Generation and Detection Core, University of Utah to target the exon 1 of six7 transcript. DNA plasmids were linearized by NotI (Invitrogen, Carlsbad, CA) and used as templates for TALEN mRNA synthesis with SP6 mMESSAGE mMACHINE Kit (Ambion, Austin, TX). To target the six7 genomic sequence, 50- 200 pg of the pair of TALEN mRNAs were injected in one-cell stage zebrafish embryos. Injected embryos were raised to adulthood and crossed to WT animals to generate the F1. DNA was extracted from either F1 embryos (groups of three to six embryos) from the outcross of founders or tail clips from adult F1 fish. To screen for insertions and deletions (indels), DNA was extracted and used as the PCR template to amplify the six7-TALENs targeted region using primers listed in Table 2.1. The DNA fragment was subjected to restriction fragment length polymorphism (RFLP) assay. Indels were tracked by loss of HaeIII (Invitrogen) restriction enzyme site in the targeted region. PCR products were sequenced to characterize the indels. The F1 embryos of positive founders were intercrossed to generate the F2 generation. F1 and F2 embryos were fixed in 4% paraformaldehyde in 80% phosphate-buffered saline (PFA/PBS) and processed for whole-mount rod immunolabeling as described (see Immunohisto-and immunocytochemistry).

2.2.5 Real-time quantitative PCR

RNA extraction was performed in TRIzol (Invitrogen) from pool of whole embryos (n=30) at 10 hpf, 18 hpf, 24 hpf and 52 hpf. Transcription into cDNA was performed using SuperScript™ II Reverse Transcriptase (Invitrogen). Real time quantitative PCR (RT-qPCR) was carried out using a 7500 Real-Time PCR Systems (Applied Biosystems) with SRBY-Green PCR

15 Master Mix (Applied Biosystems) and the primers listed in Table 2.1. Three biological replicates were performed for each developmental time and were duplicated for each cDNA sample for six7 qRT-PCR. The fold expression change was normalized to β-actin using the 2-∆∆CT (Livak) method (Livak and Schmittgen, 2001). Student’s t test was applied for comparison between groups at each developmental time.

2.2.6 Immunocytochemistry and fluorescent microscopy

Immunolabeling of larvae whole mount or cryosections (10 µm) was performed as previously described (Morris and Fadool, 2005). Sections and enucleated eyes from whole- mounted immunolabeled larvae were imaged using either a Zeiss Axiovert S100 fluorescent microscope (Carl Zeiss Inc., Thornwood, NY) or a LSM 510 or LSM 710 (Carl Zeiss) Laser Confocal equipped with a 40x C-Apochromar water immersion objective (N.A. 1.2). The following primary antibodies were used: monoclonal antibody 4C12 that labels rods (1:200), a monoclonal antibody zpr1 that labels double cone cells (arr3a) (1:20), a monoclonal antibody 1D1 against rhodopsin [120] a polyclonal antibody against zebrafish blue-, red-, green- or UV- cone opsin (1:200; (Vihtelic et al., 1999), and polyclonal PH3 antibody that labels mitosis marker phospho-Histone 3 (1:500; Cat. No. 06-570, Millipore, Billerica, MA). Host-specific, alexa fluor-conjugated secondary antibodies (Invitrogen) were used at a dilution of 1:200. Sections were counterstained with 4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI, 1:15000; Sigma-Aldrich). Proliferation was assessed by incubation of 48 hpf and 52 hpf embryos in fish water with 1.5 mM EdU (5-ethynil-β’-dexyuridine) during 30 minutes and subsequently fixed in 4% paraformaldehyde (PFA/PBS). The EdU labeling was processed by the Click-iT EdU Alexa Fluor 546 Imaging kit (Invitrogen) following the manufacturer’s instructions. For lineage tracing cell experiments, the EdU was washed with fish water and the embryos were incubated until 4 dpf and subjected to immunohistochemistry.

2.2.7 Quantitative analysis

Confocal images from whole eyes immunolabeled for UV cones and rods were analyzed with the Scion Image Software (Scion Corp, Frederick, MA). Areas of 3500 µm2 located dorsal to the optic nerve (Alvarez-Delfin et al., 2009) were counted for rods in WT (n=8); six7 fl4/fl4 (n=

16 7), six7 fl4/p23ahub (n=4). The number of Zpr1 (Arr3a) positive cells was quantified in WT (n=3); six7 p23ahub (n=6); six7 fl4 (n=3). When possible two of 3500 µm2 retinal areas were counted. The average number of Zpr1 (Arr3a) positive cells per unit area and the standard deviation (SD) were reported. One-way ANOVA with Tukey’s post-hoc test was used to compare means of rods between different genotypes. Student t test was applied to compare two sample data. The number of PH3 positive cells in the ONL and INL was quantified using 10-µm-thick- retina sections per section that excluded the CMZ. The following strains and number (n) of 48- hpf retinas were analyzed: WT (n=5), six7-MO1 injected embryos (n=4). A Student’s t-test was conducted to compare the number of PH3 positive cells in ONL and INL between WT and six7- knockdown retinas. Same procedure was used to count PH3 positive cells in the ONL and INL of six7 fl4/f+ (n=5) and six7 fl4/fl4 (n=11). Un-paired Student t test with Welch’s correction was used for statistical analysis. Quantitative analysis of photoreceptor pattern was performed as described (Fadool, 2003). Nearest Neighbor Dispersion Analysis (NNDA) was determined using Biotas and the conformity ratio was calculated and analyzed for randomness using the Ready-Reckoner Chart of Cook (Cook, 1996). Fluorescent structures were assigned (x, y) coordinate using ImageJ software (National Institutes of Health Windows version, (http://rsbweb.nih.gov/ij/index.html). For each point in the field Nearest Neighbor Distance (NND) was calculated using Biotas (Version 1.02; Ecological software Solutions).as previously described (Fadool, 2003).

2.2.8 Whole-mount in situ hybridizations

Whole-mount in situ hybridizations were performed as previously described (DeCarvalho et al., 2004) using pools of 25 embryos at 28 hpf and between 46-52 hpf. The antisense riboprobes were: six7 (this study), vax2 (this study), cyp26c1 (this study) and tbx2b (Alvarez- Delfin et al., 2009). The plasmids containing the probes for neurod (Ochocinska and Hitchcock, 2009), crx (Shen and Raymond, 2004), pax6a (Puschel et al., 1992), rx1 (Mathers et al., 1997) were kindly provided by A.C. Morris (University of Kentucky, Lexington, KY). To prepare a probe for six7, a 444 bp fragment of six7 gene was amplified from a cDNA fragment obtained from 10 hpf embryos, using primers listed in Table 2.1 and cloned into the vector PCR2.1-TOPO (Invitrogen). Antisense RNA probe was synthesized with a digoxigenin RNA-labeling kit (Roche, Indianapolis, IN) by in vitro transcription with T7 RNA polymerase, according to the

17 manufacturer's instructions. A 620 bp of vax2-cDNA fragment and a 692 bp of cyp26c1 were amplified using primers listed in Table 2.1. The antisense probes were prepared as described above. The hybridized probe was detected with alkaline phosphatase coupled with anti- digoxigenin antibodies and NBT/X-phosphate substrate (Roche). Labeled embryos were cleared in a graded series of glycerol and viewed on a Zeiss Axiovert S100 microscope. Images were captured by Carl Zeiss Axiocam Color Microscope camera and processed with Axiovision SE64 Rel 4.9.1 and Photoshop 5.5 (Adobe, Mountain View, CA) software.

2.2.9 TUNEL assay

Terminal deoxynucleotide transferase (TdT)-mediated dUTP nick labeling (TUNEL) was performed on 3 dpf retinal cryosections using the ApopTag Red In Situ Apoptosis Detection Kit (Millipore, Temecula, CA) according the manufacturer’s instructions and co-labeled for rods (4C12) to identify mutants. TUNEL assay was performed in six7fl4 mutants and WT embryos at 56 hpf and 4 dpf. Tail-clip genotyping was used to identify mutants at 56 hpf. The following strains and number (n) of 56 hpf were analysed: WT (n=5), six7fl4 (n=7) and at 4 dpf : WT (n=3), six7fl4 (n=6).

2.2.10 Cell transplantation

Genetic chimeras were generated as previously described (Link et al., 2000). Donor embryos were injected at the 1- and 2-cell stage with the lysine-fixable, dextran- Alexa Fluor 594 (Invitrogen). Donor blastulae cells were transferred to unlabeled host cells. At 4 dpf the chimeras were fixed with 4% PFA/PBS and immunolabeled for rods and green-opsin as described above. Imaging of the whole-dissected eyes was performed by confocal microscopy (WT into WT, n=3; six7fl4 into WT n=3; WT into WT, n=5; six7-MO1 into WT, n=6). The number of rhodamine- dextran labeled cells, 4C12/dextran (rod from donor cells)-labeled and green-opsin/dextran labeled cells were quantified. The percentage number of donor cells differentiated as rod photoreceptor or green cones was compared for six7fl4 mutant vs WT transplants into WT background. Numbers of donor cells were counted across the retinal layers from retinal sections of six7-MO into WT. Statistical analysis was performed by chi-square test.

18 2.3 Results

2.3.1 The lots-of-rods-junior locus regulates spatial patterning

The lots-of-rods-junior (ljrp23ahub) mutant was isolated from a previous genetic screen to isolate genes regulating rod development and spatial patterning in zebrafish retina (Morris and Fadool, 2005; Alvarez-Delfin et al., 2009; Alvarez-Delfin, 2011). In zebrafish larvae retina, rod photoreceptors are unevenly distributed across the retina. Rods show high density ventrally and accumulate more sporadically towards the dorsal retina (Raymond et al., 1995; Fadool, 2003). ljrp23ahub mutants displayed an increased number of rods across the entire retina in contrast with the sparse number of rods in the central retina of wild type (WT) larvae (Alvarez-Delfin, 2011). In homozygous ljrp23ahub larvae, immunolabeling for rods results in a uniform distribution typical of the cone pattern. To assess the regularity of spacing between rod photoreceptor, I calculated the conformity ratios (CR). For all mutant samples analyzed, conformity ratios (CR) were significantly different from random based on Cook’s criteria (p<0.05), and Nearest Neighbor Dispersion Analysis (NNDA) indicates the rods are arranged in a uniform pattern (p<0.05) (Cook, 1996). No significant changes were detected in whole mount immunolabeling of red and green cones in ljrp23ahub mutant when compared with WT (Figure 2.1A). Immunolabeling of serial sections of WT and ljrp23ahub mutant larvae with polyclonal antisera to green-, blue-, and UV-sensitive cones revealed no difference in their expression levels either (Figure 2.1B).

2.3.2 ljrp23ahub as a hypomorphic allele of six7

Genetic linkage analysis positioned the ljrp23ahub locus to a 0.3 Mb interval on chromosome 7 encompassing seven genes (Figure 2.2A): Ras and Rab interactor 1 (Rin1), actin related protein (Arp2), six7, beta-1,4 glucoronyltransferase 1, prefoldin subunit 2, nitrilase, and chloride channel 3. Genes lacking eye specific expression (Zfin) or with housekeeping functions were excluded from further consideration leaving six7 as the most plausible candidate. In order to more comprehensively examine for molecular lesions associated with the ljrp23ahub we performed whole-genome sequencing of DNA pooled from 118 homozygous ljrp23ahub larvae.

Figure 2.1. No changes in green, UV and blue opsin expression in ljrp23ahub mutants. (A) Flat mount views of confocal immunofluorescent images labeled for red (brighter green) and green (dimmer green) cones from WT and ljrp23ahub retinas at 4 dpf. ljrp23ahub mutants maintain the alternating arrangement of red and green cones. (B) Retinal cryosections from WT and ljrp23ahub embryos at 4 dpf immunolabeled for rods (4C12, red) and the green, UV and blue cone opsins (green). Nuclei were counterstained with DAPI (blue); dorsal is up. No differences in the number or expression levels are detected for any of the opsin subtypes, except for the increased number of rods in ljrp23ahub mutants.

Genome-wide SNP frequencies of reads were calculated against the Tuebingen (zv9) reference genome to identify regions depleted of SNPs that were associated with the mutant genetic background. Large, contiguous depletions in SNPs were present on chromosomes 3, 7, 9, and 20. A 5-megabase depletion of SNPs present on chr7 was centered directly over the mapping interval based on genetic linkage analysis (Figure 2.2B). Further examination of this interval

20 revealed two regions, 14 kb and 40 kb upstream of six7, devoid of uniquely-aligning reads that were not associated with assembly gaps. The region 40 kb upstream of six7, but not the region 14 kb upstream, was also associated with sequence conservation among six7 genes from 4 other fish species, but not with Six3 from frog, mouse, or human. This region also displayed ChIP-seq signal for H3K4me1 in 24 hours-post-fertilization (hpf) embryos (Aday et al., 2011). This mark is associated with distal enhancers in mammals (Heintzman et al., 2007). To verify that the deletion was associated with the ljrp23ahub mutation, DNA samples from fin clips of homozygous ljrp23ahub adults and wildtype AB and TL strains of zebrafish were subjected to PCR using primer pairs targeting a DNA sequence unique to the distal deletion or the first exon of six7 as a control. PCR confirmed the co-segregation of the genomic deletion upstream of six7 gene with ljrp23ahub (Figure 2.2B); the upstream region was only amplified in the TL and AB DNA. six7 is a teleost specific member of the sine oculis homeobox family of transcription factors, which have important roles in eye and forebrain patterning (Anderson et al., 2012; Kumar, 2009; Seo et al., 1998a; Oliver et al., 1996). In zebrafish, six7 expression co-localized with six3a/b transcript in the anterior region of the forebrain and optic vesicles (Seo et al., 1998b; Inbal et al., 2007) with no detectable expression by RT-PCR at 24 hpf (Seo et al., 1998b). However, I and others observed by in situ hybridization that by 48 hpf, six7 expression is detectable in the retina, specifically in neuroblasts and the differentiating outer nuclear layer (ONL) coincident with photoreceptor cell genesis (Ogawa et al., 2015) (Figure 2.3A). More precisely, between 48 hpf and 52 hpf more general labeling of the retinal neuroblasts gives way to robust six7 expression that follows the temporal and spatial wave of photoreceptor genesis spreading from the ventral to the nasal and temporal retina (Raymond et al., 1995; Schmitt and Dowling, 1999). qRT-PCR for six7 transcripts at developmental stages from 10 hpf to 52 hpf mirrored the in situ hybridization; in ljrp23ahub mutant embryos, greater expression was observed at 10 hpf compared with WT, and expression was absent in ljrp23ahub mutant embryos at 18 hpf and from both groups at 24 hpf. Lower levels in ljrp23ahub mutant embryos at 52 hpf were observed (Figure 2.3B). Thus, the spatial and temporal pattern of six7 expression and the changes observed in ljrp23ahub embryos are consistent with previously described roles in photoreceptor development (Saade et al., 2013; Ogawa et al., 2015).

Figure 2.2. Genomic deletion upstream of six7 segregates with ljrp23ahub mutants. (A) Linkage analysis places the ljrp23ahub locus on chromosome 7, 6 larvae out 463 showed recombination at marker ZC168D1-SSR6 and 1 larva of 252 showed recombination at marker ZC42C5-SSR2. (B) Frequency of SNPs across chromosome 7 relative to the TL reference genome (danRer7) calculated from whole-genome sequencing of a pool of DNA extracted from 118 ljrp23ahub mutants where TL is the reference background. Below, 75 kb view of the SNP-depleted region on chromosome 7. A 2.4 kb region depleted of uniquely-aligning reads is highlighted in teal. Shown are tracks for H3k4me3 (Aday et al., 2011), read alignments from whole-genome sequencing of ljrp23ahub mutants, and multiz-based sequence conservation UCSC genome browser tracks of six7 across four fish species and Six3 in frog, human, and mouse (Rosenbloom et al., 2015). PCR fragments amplified from genomic DNA were analyzed by 1% agarose gel electrophoresis. Genomic deletion upstream of six7 co-segregates with ljrp23ahub.

To test the candidacy of six7 as the mutated gene in ljrp23ahub, two antisense morpholinos targeting either the 5’UTR region (MO1) (Inbal et al., 2007) or the donor splice site in the first

22 intron (MO3) of six7 were injected into one-cell-stage WT embryos (Figure 2.3C). Injection of either morpholino phenocopied ljrp23ahub mutants (Figure 2.3D; (Alvarez-Delfin, 2011) and did not demonstrate any obvious morphological defects. To confirm the efficiency of the splice blocking morpholino, RNA was isolated from un-injected and MO3-injected embryos, and the region spanning exon1 and exon2 amplified by PCR from resulting cDNA (Figure 2.3C). Sequence data revealed that the MO3-injections resulted in alternative splicing upstream of the initiation codon deleting the majority of the exon1 of six7 mRNA including the SIX domain. Previous studies reported highly conserved roles for six3/six6 family members in patterning of the forebrain and eye field, and in zebrafish six3b and six7 appear to be functionally redundant (Inbal et al., 2007; Ogawa et al., 2015; Carlin et al., 2012). To study the hypothesis that six3a/b could be a target of six7, the levels of expression of six3a/six3b were determined by qRT-PCR. No significant difference in expression levels for six3a/six3b transcripts were detected between WT and ljrp23ahub mutants (Figure 2.3E), suggesting that six7 is not regulating the expression of six3a/six3b. Consistent with the expression of six7 in ljrp23ahub during forebrain patterning, analysis of 128 embryos from inbreeding of double heterozygous adults for ljrp23ahub and six3bvu87 did not result in any embryos displaying a greatly reduced or absent eye phenotype as previously observed for six7-morpholino knockdown on the six3b mutant background or in the recently reported double mutant harboring deletions of six7 and six3b (Inbal et al., 2007; Ogawa et al., 2015; Alvarez-Delfin, 2011). Based upon the genetic analysis, whole genome sequencing and gene expression changes, we propose that ljrp23ahub is a hypomorphic allele of six7 that affects a regulatory element controlling expression during photoreceptor genesis. To further characterize the increased labeling for rods, cell counts from methylene blue stained plastic sections of 4-days-post-fertilization (dpf) six7-MO1 embryos revealed a modest yet significant increased number of cells in the ONL compared with WT retinas, consistent with the observed increased rod number (Figure 2.4). However, no changes were detected in the number of nuclei in the inner nuclear layer (INL) or the ganglion cell layer (GCL), arguing against a general increase in neurogenesis across the retina (2, p < 0.05). These results suggest that knockdown of six7 led to an increased number of retinal cells specifically in the ONL with gene expression and morphological characteristics consistent with rods.

Figure 2.3. six7 knockdown increased rod photoreceptor number. (A) Whole mount in situ hybridization shows six7 expression confined to retinal neuroblast and differentiating ONL spatially and temporally with photoreceptor genesis. Dorsal is up. (B) qRT-PCR performed on mRNA from control (WT) and ljrp23ahub embryos from 10- 52 hpf reveal down regulation of six7 expression in ljrp23ahub at 52 hpf. Relative transcript abundance was normalized to actin levels and is presented as the mean fold change in expression relative to 10 hpf controls (n=30 embryos per group). Significant differences observed at 18 hpf and 52 hpf, Student’s t test, *p<0.05. (C) Diagram of predicted morpholino recognition sites (bars) in six7 loci. MO1 targets a translational site and MO3 blocks an acceptor splice site in intron 1 of six7. Incorrect splicing can be seen in morpholino-injected animals using primers in exon1 and 2 (arrows). RT-PCR fragments, using primers highlighted above, were analyzed by 1% agarose gel electrophoresis. Arrow highlights the six7 alternative spliced product obtained at 12 hpf (* indicates the new cryptic splice site).

24 Error bars represent SD. nb, neuroblast; vp, ventral patch; onl, outer nuclear layer; MO3, morpholino 3. (D) Retinal cryosection from 4 dpf un-injected WT and six7-MO3 injected embryos immunolabeled for rods (4C12, red). six7-morphants display an increase in the number of rods as detected in ljrp23ahub. (E) six3a/six3b expression is unchanged in six7 morphants. No changes in the expression of the homologues six3a (left graph) or six3b (right graph) were detected between WT and ljrp23ahub mutants (n=30 embryos per group). All the real-time PCR experiments were carried out in triplicates and normalized to -actin.

Figure 2.4. six7 knockdown increases the number of cells in the outer nuclear layer. Plastic sections of 4 dpf retinas from WT and six7-MO1 injected larvae. The three layers are regularly arranged in WT and morphant retinas. Close examination of the retina revealed a densely packed ONL in morphants. Graph showing the average number of nuclei per unit area (WT, n=3, 2 sections each; six7-MO1, n=3, 2 sections each). Cells are increased in the ONL of six7 morphants. Student t test, arcsin transformation, *p<0.05.

2.3.3 six7 morphants show extended proliferation in the ONL

The increased cell number in the ONL and lack of changes in cone numbers open the possibility that six7 regulates mitosis during photoreceptor development. Proliferation was assayed by EdU incorporation or phospho-histone 3 (PH3) immunolabeling. In zebrafish, neurogenesis occurs in three distinct waves; postmitotic cells appear first in the GCL, followed by the INL, and finally the ONL. At 48 hpf, a time coincident with photoreceptor cell genesis (Hu and Easter, 1999), co-labeling for EdU incorporation and in situ hybridization for six7 showed complex patterns of labeling. In histological sections, EdU labeling was most abundant in wedged-shaped clusters of highly proliferative cells near to the dorsal and ventral ciliary marginal zone (CMZ), and to a lesser degree in the developing ONL. In contrast, six7 expression near the CMZ was opposite of the EdU labeling; highest proximal to the CMZ where the neuroblasts had taken on a more salt and pepper EdU-labeling pattern (arrows), and nearly

25 absent from the highly proliferative CMZ. In the central retina, more robust labeling for six7 coincided with reduced EdU incorporation (Figure 2.5). These data show that six7 is expressed in photoreceptor precursors at or near the time of terminal mitosis.

Figure 2.5. six7 is expressed in photoreceptor precursor cells. EdU (red) and six7-in situ labeling (blue) in a retinal cryosection from 48-hpf WT embryos. Note the expression of six7 is coincident with proliferating cells in the ONL. ONL, outer nuclear layer; INL, inner nuclear layer; GCL, ganglion cell layer; CMZ, central marginal zone.

In a second set of experiments, un-injected, six7 MO1-, and control morpholino-injected embryos were incubated with EdU at 48 or 52 hpf and immediately processed for labeling. At 48 hpf, all treatment groups showed EdU labeling in the ONL. However, at 52 hpf, six7 MO1- injected embryos showed nuclear EdU labeling in the ONL but none was observed in the un- injected and 5 base mismatch control morpholino-injected embryos (Figure 2.6A). To determine if the EdU-labeled cells in the six7-morphant retinas differentiate specifically as rods, embryos were labeled with EdU at 48 hpf and maintained until 72 hpf, then fixed and processed for immunolabeling with a rod specific marker. EdU positive cells in the central retina co-labeled preferentially with a rod marker in six7-morphant retinas. However, some EdU positive cells differentiated as cones, consistent with the coincident timing of rod and cone differentiation in un-injected embryos (Figure 2.6B). We next immunolabeled retinas with anti PH3 to verify that the increased number of cells labeled with EdU was reflected by changes in the level of mitosis (Figure 2.7A). At 48 hpf retinas from six7-morphant embryos showed significant increases in the PH3 immunolabeling of the ONL compared to un-injected embryos (Figure 2.7B; Student t-test; p<0.001). No significant

26 changes were observed in labeling of the INL. To test if the six7-depleted cells are biased to differentiate as rods, genetic chimeras were generated by transplanting cells from six7 MO1- injected or WT donor embryos into WT hosts. In histological sections, six7-MO1 donor cells immunolabeled for a rod specific marker at a rate three times higher than WT transplanted cells (p<0.05; Figure 2.8A and B).

Figure 2.6. Photoreceptor progenitor proliferation is regulated by six7. (A) EdU labeling in retinal cryosections of WT, six7-MO control and six7 morphants at 52 hpf. Note that EdU labeled cells persist in the central retina in six7 morphants. (B) Retinal cryosections of WT and six7 morphants labeled with EdU at 48 hpf and immunolabeled for rods (4C12, green) at 4 dpf. Proliferative cells are restricted to the ONL and differentiate as photoreceptors in WT and six7- knockdown retinas. Proliferative cells colabeled for rod markers in the central retina, (arrowheads, inset).

Figure 2.7. Mitosis is increased in the ONL with knockdown of six7. (A) Retinal cryosections of WT and six7-morphants immunolabeled for phospho-histone 3 (PH3) at 48 hpf and (B) graph showing the number of PH3-positive cells in the INL and ONL per sections (WT, n=5; and six7- MO1, n=4; 3-4 sections/retina). Mitosis levels increased significantly in the ONL in six7- morphants. No significant changes were observed in the INL. (***p=0.0007, Student’s t test). Error bars represented SD.

The spatial and temporal appearance of the additional mitoses and bias to form rods led us to test the identity of the proliferative cells. WT and six7-knockdown retinas were labeled by in situ hybridizations with molecular markers for retinal progenitors, rx1 and pax6a (Shen and Raymond, 2004; Lakowski et al., 2007) or the photoreceptor specific transcription factors crx and neurod (Nelson et al., 2008); (Ochocinska and Hitchcock, 2007); (Ochocinska and Hitchcock, 2009). By 48 hpf in the WT and morphant larvae, the expression of the retinal progenitor marker rx1 was restricted to the CMZ and the pax6a gene was expressed by neuroblasts of the CMZ and in neurons located in the GCL and the proximal portion of the INL (Godinho et al., 2005). None was observed in the ONL (Figure 2.9). Probes for crx and neurod strongly label the forming ONL and to lesser extent cells of the INL, with no differences observed between WT and mutant larvae (Figure 2.9). Combined the data suggest that six7 regulates mitosis of late stage photoreceptor progenitors. In lower vertebrates, such as zebrafish, cell death in the retina can trigger proliferation of Muller glia cells and photoreceptor regeneration (Morris et al., 2008; Meyers et al., 2012). However, previous studies excluded apoptosis-induced proliferation as the mechanism leading to the increase in rod number, sections from control, ljrp23ahub, and six7-morphant retinas by transferase-mediated dUTP nick end labeling (TUNEL) assay. Few TUNEL positive cells were observed in WT and control-morpholino retinas, but none was observed in the ONL ruling out

28 cell death-induced regeneration as the mechanism triggering the increase in mitosis and rod number (Alvarez-Delfin, 2011).

Figure 2.8. Cells are biased to differentiate as rods in the absence of six7. (A) Histological sections of chimera retinas labeled for rods (4C12, green). six7-MO donor cells (red) preferentially generate rods compare to WT donor cells. Note the gap in rod labeling in WT/WT controls. (B) Graph represents the percentage of donor cells that differente as rods in the central retina of WT/WT (n=5) and six7-MO1/WTchimeras (n=6). *p<0.05, student t test

Lastly, previous studies in chick embryos have shown that ablation of the dorsal retina results in expansion of ventral domain and increased rod number in the central retina (Schulte et al., 2005). Given the high number of rods in the ventral patch of the zebrafish retina, we tested for expansion of ventral markers and loss of dorsal markers in ljrp23ahub mutants. However, in situ hybridization for the dorsal marker tbx2b, the midline marker cyp26c1, and the ventral marker vax2 showed no difference in labeling of WT and mutant embryos (Figure 2.10), decreasing the likelihood that the increased rod number resulted from alteration of dorsal-ventral patterning of the optic cup.

2.3.4 Genome editing of six7 locus recapitulates the increased rod number in ljrp23ahub mutant larvae

Based upon the sequencing data, morpholino phenotypes and gene expression, we designed TALENs (transcription activator-like effector nucleases) to target six7. The homeodomain and the SIX domain are two evolutionarily conserved domains in the SIX proteins

29 involved in DNA-protein or protein-protein interactions respectively (Pignoni et al., 1997), and mutations in the SIX domain in SIX3 are associated with congenital brain and eye defects (Wallis and Muenke, 1999). Therefore, a TALENs pair was designed to target 18-bp and 20- bp flanking a 14-bp spacer sequence of the first exon of six7, which corresponds to the SIX domain (Figure 2.11A). mRNAs encoding for the TALENs pair were co-injected into one-cell stage zebrafish embryos. Surviving embryos were grown to adulthood and mated to WT adults. Disruption of the six7 locus in the F1 larvae was detected by the loss of the HaeIII restriction site in the spacer region (Figure 2.11B). Fifty-two percent of the founders transmitted TALEN-induced mutations to the F1 (Figure 2.11C). F1 progeny were grown to adults and heterozygous carriers identified by fin clip analysis. F2 carriers of the following alleles were used in subsequent studies: c. 217_229del CAGGTGGCCCGAG, p. (Q11Cfs*39), from now on (six7fl4); p. (E10Ifs*50); p. (F7Lfs*44), (all predicted to result in frameshift mutations and premature termination of the Six7 protein). Approximately, one quarter of the F2 progeny from inter-crosses between carriers demonstrated an increased number (t-test, p<0.001) and uniform distribution of rods (Cook’s CR, p<0.05; NNDA, p<0.05) as observed in ljrp23ahub mutants (Figure 2.11D). Genotyping of the F2 larvae revealed that one quarter of the embryos with the lots-of-rods phenotype were heterozygous for the six7fl4 mutation, consistent with the semi-dominance previously observed in ljrp23ahub mutants. In mating between carriers or homozygous mutant adults, six7fl4 failed to complement ljrp23ahub (Figure 2.11A and 2.12A; One-way ANOVA, Tukey’s follow-up test, p<0.0001); no significant difference in rod number was observed between six7fl4/six7fl4, six7fl4//ljrp23ahub, and ljrp23ahub/ljrp23ahub larvae (One-way ANOVA, p>0.5) providing genetic evidence that ljr23ahub is indeed an allele of six7, and ljrp23ahub shall be referred to as six7p23ahub. Lastly, as previously observed in six7-knockdown embryos, immunolabeling for PH3 showed significant difference in sections from six7fl4 homozygous embryos and WT siblings (Figure 2.12B). But unlike the six7p23ahub allele, six7fl4 homozygous animals showed significantly reduced viability (χ2, p<0.05), but the few adults recovered were fertile.

Figure 2.9. six7 functions in photoreceptor progenitor cells. rx1- , pax6a-, crx- and neurod-in situ hybridization (blue) in a retinal cryosection from 48-hpf WT and six7-MO1 embryos. No labeling of retinal progenitor cell markers (rx1 and pax6a) were observed in the ONL of six7- morphant retinas.

Figure 2.10. No change in dorsal-ventral patterning of the optic cup in six7 mutants. Whole- mount in situ hybridization for the dorsal (tbx2b), midline (cyp26c1) and ventral (vax2) retinal marker. Labeling was indistinguishable different between WT and mutant embryos.

Figure 2.11. TALENs-mediated knockout of six7 locus recapitulates ljrp23ahub phenotype. (A) Schematic representation of the Six7 protein domains. six7-TALENs target site and the HaeIII restriction enzyme site are highlighted. The left and right monomer binding sites are underlined. (B) RFLP of six7 locus by HaeIII. A new 170 bp DNA-fragment is detected in six7fl4 carriers compared with controls. (C) Sequence analysis of the six7 target region shows recovery of multiple indel alleles of six7. The target region is highlighted in red. Dots represent deletions and lower case letters indicate insertions. The six7 sequence from WT is shown as a comparison. (D) Confocal immunofluorescent images labeled for rods (red) from WT and six7fl4 knockout mutants at 4 dpf. six7fl4 knockout mutants phenocopy ljrp23ahub phenotype. Sequencing chromatograms of WT and six7fl4 mutants illustrated the c.217_229del CAGGTGGCCCGAG (del13) six7 mutation in homozygous zebrafish. The bar graph shows the average number of rods counted in 1-3 different areas per retina (WT (n=8), six7fl4 (n=7), six7 fl4/p23ahub (n=4); One-way ANOVA with Tukey’s post-hoc test. a vs b, p<0.0001.

Figure 2.12. Levels of mitosis are altered in six7fl4 at 56 hpf. (A) Confocal immunofluorescent images labeled for rods (4C12, red) from WT, six7fl4 and six7fl4/p23ahub retinas at 4 dpf. (B) Retinal cryosections from carrier animals (six7fl4/+, n=5, 1-2 sections/retina) and six7 (n=11) embryos at 56 hpf co-labeled for TUNEL (red) and PH3 (green), nuclei counterstained with DAPI. No differences in TUNEL labeling were detected. Graphs showing the number of PH3+ cells by section (excluding CMZ). Number of PH3+ cells is significantly greater in ONL of six7fl4 mutants at 56 hpf. Un-paired Student t test with Welch’s correction, *p<0.05).

2.3.5 RH2 opsin expression and green cone precursor survival are dependent upon six7 expression

Ogawa et al. (2015) recently reported altered cone opsin expression in six7 knock-out animals with RH2 expression nearly absent and SWS2 significantly reduced (Ogawa et al., 2015). However, we observed few alterations with green cone opsin expression in six7p23ahub homozygous and six7 morphant larvae and no changes in SWS2 immunolabeling. Therefore, we tested for differences in cone photoreceptor cell phenotypes between the six7p23ahub and six7fl4 alleles, immunolabeling of histological sections confirmed the reduced green-cone opsins expression, but not changes in other cone subtypes (Figure 2.13). Immunolabeling and confocal analyses revealed a significant decline in the number of Zpr1/Arr3a positive photoreceptors in

33 homozygous six7fl4 larvae consistent with the lack of RH2 expression reported previously (Figure 2.14). Immunolabeled cells were evenly distributed across the retina, but clearly isolated from their neighbors as opposed to the mosaic of alternating red and green cones observed in the WT and six7p23ahub mutant larvae (Figure 2.14).

Figure 2.13. Lacked green opsin expression in six7fl4 larvae. Retinal cryosections from WT and six7fl4 embryos at 4 dpf immunolabeled for rods (4C12, red) and the green, UV, blue and red opsins (green). Nulcei were counterstained with DAPI (blue). Dorsal is up. Depleted green opsin expression is noticeable in six7fl4, other opsins appear unaltered.

Figure 2.14. Red and green-sensitive cone mosaic is altered in six7fl4 but not in six7p23ahub. Tangential views of confocal immunofluorescent images labeled for red (brighter green) and green (dimmer green) cones from WT, six7p23ahub, and six7fl4 retinas at 4 dpf. Graph showing the average number of red/green cones per unit area of WT (n=3), six7p23ahub (n=4), and six7fl4 (n=3); (ns p> 0.05; a vs b p  0.05; significant difference one-way ANOVA with Tukey’s post-hoc test).

In situ hybridization using an RH2 probe, or immunolabeling for green opsin demonstrated that six7fl4/fl4 larvae were mostly devoid of green opsin expression with only a few pairs of labeled cells in either eye (Figure 2.15A and inset); By comparison, homozygous six7p23ahub mutants show variable penetrance of the loss of green opsin expression phenotype; 83% of six7p23ahub homozygous larvae showed a WT labeling pattern and only 17% showed labeling similar to the six7fl4 mutants (Figure 2.15B). Co-labeling with a rhodopsin antibody showed that all six7p23ahub mutants retained the increased rod number regardless of the presence or absence of the green opsin labeling (Figure 2.16A), and green-opsin positive photoreceptors do not co-label with several different rod markers, suggesting that the extra rods in the six7p23ahub mutant retinas are not a rod-cone hybrid. The similarities and differences in phenotypes of the hypomorphic and knock-out alleles from our lab and previously reported (Ogawa et al., 2015) suggest that six7 regulates two distinct processes in photoreceptor cell genesis: terminal mitosis and differentiation or survival of green cones precursors. Consistent with our hypothesis, confocal images of DAPI-labeled retinas from homozygous six7fl4 larvae showed gaps in the photoreceptor mosaic and small intensely labeled structures consistent with nuclei of dead or dying cells (Figure 2.16B). TUNEL was performed on six7fl4 retinas at 56 hpf, a time when expression of the all opsin subtypes should be detected (Raymond et al., 1995; Takechi and Kawamura, 2005), and at 96 hpf, when all of the cones are mature. Few apoptotic nuclei were detected in WT or mutant retinas at 56 hpf. However, as development progressed to 96 hpf, considerable labeling of TUNEL positive cells was observed

35 in the ONL of six7fl4 retinas (Figure 2.16B). Labeling was also observed in the INL and in fibers extending across both plexiform layers to the inner limiting membrane. The morphology and labeling pattern are consistent with that of Muller glial cells which have been shown to become TUNEL positive from phagocytosis of cellular debris following photoreceptor degeneration (Morris and Fadool, 2005; Bailey et al., 2010), although we cannot rule out the possibility that a small population of cells in the inner retina is also dying. Together, the data show that six7 is essential for development of green cone precursors in the zebrafish retina and in its absence the precursors die.

Figure 2.15. six7 controls green opsin expression. (A) Whole mount in situ hybridization for p23ahub fl4 RH2 probe (green-cone opsin) in WT (n=30), six7 (n=30) and six7 embryos (n=30) at 4 dpf. WT and six7p23ahub embryos often showed the same pattern and number of green opsin cone labeling (Dorsal is up and nasal to the left), while six7fl4 knockout showed no labeling or few cells labeling for green-cone opsins (inset). (B) Graph showing the percentage of unlabeled and labeled embryos. Notice that 17% of the six7p23ahub embryos were un-labeled for green-cone opsin.

Figure 2.16. six7 regulates green-cone opsin precursors survival. (A) Retinal cryosections of in situ hybridization for green-cone opsin six7p23ahub (n=5) embryos immunolabeled with 1D1 (rods). Rods and green-cone opsin probes labeled different cells in the ONL of six7p23ahub embryos. (B) Evidence of cell death. Flat mount confocal image of nuclei counterstained with DAPI and retinal cryosections from WT and six7fl4 animals at 4dpf co-labeled for TUNEL (red) and rods (4C12, green). six7fl4 mutants (n=6, 1-2 sections/retina) showed an increase in apoptotic cells, especially in the ONL compared with WT (n=3, 1-2 sections/retina), (arrows pointing to apoptotic cells in the ONL).

2.3.6 six7 functions cell autonomously to regulate rod number and green cone precursor survival

Genetic chimeras were generated to further test the cell autonomy of six7 in photoreceptor biology. At blastula stage, cells were transplanted from rhodamine dextran- injected six7fl4 mutant donors into equivalent stage WT hosts. As control, WT cells were transplanted into WT embryos at the same developmental stage. The fate of WT vs six7fl4 donor cells showed statistically significant differences based upon co-immunolabeling host embryos for green opsin and a rod marker (χ2, p<0.0001). Of 96 six7fl4 rhodamine positive donor cells in the ONL of 3 hosts, 49 cells (51%) co-labeled with a rod specific marker consistent with the data from the MO-injected genetic mosaics, but only 2 cells (2%) immunolabeled for green opsin. However, the neighboring host cells frequently labeled for green opsin (Figure 2.17). In stark contrast, 16% of 106 rhodamine-labeled WT-donor cells co-labeled for the green opsin, but only

37 5.6% for the rod-specific marker. These data are consistent with a cell-autonomous role of six7 in regulating rod number and green cone precursor differentiation or survival.

Figure 2.17. six7 acts cell autonomously. (A) six7fl4-donor cells or (B) WT-donor cells were labeled by the tracer rhodamine-dextran, transplanted into WT genetic background and allowed to develop until 4 dpf. Expression of rods (4C12, green) and green opsin (pink) were detected by whole mount immunolabeling. Note that six7fl4-transplanted cells frequently differentiate as rod photoreceptors (orange, arrows) and rarely immunolabeled for green opsins while neighboring WT cells differentiate as green cones. Significant difference was observed in the percent of six7fl4-donor cells that differentiate into rods or cones compared to WT donor cells (χ2, p<0.0001).

2.4 Discussion

Taking advantage of photoreceptor patterning in the cone-rich, larval zebrafish retina, we characterize two independent roles for the transcription factor six7 in photoreceptor development: six7 regulates cell cycle exit affecting the number and distribution of rods; six7 is essential for RH2 and arr3a expression and survival green cone precursor. We show that the increased number and uniform distribution of rods are associated with increased mitosis, and independent of and do not account for the loss of green-wavelength-sensitive cones. Our research has identified genes essential for maintenance of a cone-dominated retinal, and based upon the

38 mutant phenotypes suggest a model for understanding how alteration of cis-regulatory elements could drive developmental changes transitioning a cone-dominated retina to a rod-dominated retina. The changes in rod number suggest that six7 has dosage-dependent affects upon mitosis. The heterozygous and homozygous mutant larvae displayed varying degrees of increased numbers of rods, and increased mitosis was observed in the ONL of mutant and six7 knockdown embryos. In WT embryos six7 is expressed in the ONL at 48 hpf, when few progenitors co- labeled for markers of proliferation are consistent with roles in the photoreceptor progenitors at or near the time of terminal mitosis. In zebrafish, gene expression studies, time lapse imaging and cell transplantation show that photoreceptor specification occurs prior to or coincident with cell cycle exit (Ogawa et al., 2015; Morris et al., 2008; Suzuki et al., 2013). In six7 mutants, the expression of crx, neurod, pax6 and rx1 were unchanged compared to WT animals suggesting that six7 functions in mitotic photoreceptor progenitors downstream of crx and neurod. The proliferation phenotype in six7 morphants and mutants was distinct from that observed in the lep/ptc2 mutant larva which is characterized by a proportional increase in the number of neurons in each retinal layer (Bibliowicz and Gross, 2009). Rather, the increase in rod number in six7 mutants is consistent with the hypothesis that selective alterations in the timing of cell-cycle exit can vary the proportion of the retinal cell types produced (Dyer et al., 2009; Finlay et al., 2005; Keeley et al., 2014). The effects on mitosis are surprisingly different from those observed for Six3 the closest homologue for which data are available. In murine cortical progenitors misexpression of Six3 caused clonal expansion, but the fate of cells could not be identified as the progenitors failed to differentiate (Appolloni et al., 2008). Similarly, in the rat retina, retroviral- mediated ectopic expression of Six3 led to an increased number of infected cells in the ONL relative to controls, though again the cells failed to mature properly. However, over-expression of a Six3 variant that alters the protein binding domain resulted in nearly exclusive generation of differentiated rods. These data are consistent with a role for Six3/6/7 family members in cell cycle regulation but antagonistic to differentiation (Zhu et al., 2002). The dissimilarities between six7 and Six3 may reflect inherent differences in the two protein, their binding partners, protein- protein interactions, or changes in the competency of the neural progenitors. Our observation that null alleles led to greatly reduced expression of RH2 opsin and failure of green cone differentiation corroborate the recent report of altered expression of

39 multiple cone opsins in independently generated six7 mutants (Ogawa et al., 2015). We initially reported that knockdown of six7 resulted in an increased number and uniform distribution of rods in the larval zebrafish retina, but no changes in cone number was observed (Saade et al., 2013). More recently, Ogawa et al. (2015) reported that TALENs-mediated knock-out of six7, in addition to increased expression of rod genes, resulted in loss of expression of RH2, lower expression of SWS2 in larvae, and altered expression of LWS1 and LWS2 in the adult, however no mechanism underlying these changes were identified (Ogawa et al., 2015). Taking advantage of hypomorphic and loss-of-function alleles we uncovered distinct functions of six7 underlying the two phenotypes. The lack of labeling for RH2 in homozygous six7fl4 larvae, gaps in the red- green cone mosaic, and the presence of numerous TUNEL positive cells in the ONL are consistent with failure of the RH2 expressing cones to differentiate and death of the green cone precursors. Interestingly, a few six7fl4 heterozygous larvae failed to label for RH2, and the phenotype was partially penetrant in larvae homozygous for the six7p23ahub allele. The lack of a graded response suggests that a small but reproducible number of animals is sensitized to modest changes in the level of six7. With the genome sequencing data, we may be able to tease out potential modifiers of the cone phenotype. In contrast, the observation of increased rod numbers in larvae homozygous for either allele or the weaker phenotype observed in six7p23ahub and six7fl4 heterozygous larvae suggests that the rod phenotype is quantitatively sensitive to changes in gene dosage. Together, these data suggest that six7 functions differently in the two populations of photoreceptor progenitors. six7 is the second gene we have identified which regulates rod and cone development in the zebrafish retina. We initially report a role for tbx2b in the specification of SWS1 cones. Although our results support the conservation of the ontological relationship between the SWS1- cones and rods observed in mammalian retinas, the identification of a novel role for tbx2b challenged the notion of a default photoreceptor phenotype. The subsequent identification of expression of TBX2 in SWS1 cones in chick suggests a conserved role in cone-dominated retinas (Enright et al., 2015). The isolation of alleles of tbx2b and six7 that show no change in coding sequence, but altered expression, provides insight into the potential for modulation of cis- regulatory elements as an underlying feature in varying the number and types of photoreceptors in some species (Wang et al., 2014). Cis-regulatory alleles are considered unique players in phenotypic evolution (Chan et al., 2010; Koshikawa et al., 2015; Arnold et al., 2014; Faial et al.,

40 2015). A basic tenant of the field of evolutionary developmental biology (evo-devo) is that small spatial or temporal changes in gene expression during development can have a dramatic effect upon morphology (Carroll, 2008). Cis-regulatory mutations are often co-dominant where natural selection operates more efficiently; heterozygous organisms express a new trait immediately rather than postponed until brought to homozygosity in the population (Wray, 2007; Kwasnieski et al., 2012). Frequently, mutations in cis-regulatory sequences are modular in their effect, leading to alleles with reduced pleiotropy, which would be favored over structural changes in individual proteins which would risk loss of essential functions in the intermediate phenotypes. Lastly, selection would necessitate that the output of the system is sensitive to variations in the level of expression of the factors. The alleles we recovered show many if not all of these features. We propose that changes in the photoreceptor gene-regulatory network are one potential driving force for adaptive changes in rod and cone numbers in evolution. This and our previous study of tbx2b identified distinct mechanisms for maintaining the cone-dominated retina in a diurnal species. The mutant phenotypes are consistent with the previously proposed evolutionary trajectories that may have been associated with the adaptation to a nocturnal environment although the precise mechanisms remain to be discovered. Based upon phylogenetic analysis and environmental considerations, Davies et al., (2012) proposed a series of structural mutations in opsins associated with adaptation to the present day, rod-dominated phenotype of extant mammals (Davies et al., 2012). Similarly, the loss of RH2 and SWS2 are observed in the basal lineage of snakes (Simoes et al., 2015). However, diurnal or nocturnal vision is not merely limited to the expression of a specific opsin, but rather by the coordinated expression of signal transduction genes, metabolic function and structural elements to maximize sensitivity or spatial and temporal resolution. As yet, our experiments have not identified the precise nature of the molecular lesions that control the expression of six7or tbx2b. Identifying the causative lesions are essential steps towards a more complete understanding of the mechanisms regulating the variations in photoreceptor numbers in zebrafish and how the potential conservation or loss of these mechanisms shape photoreceptor patterning in other species. Regardless of the exact mechanism, our study clearly indicates the potential of a small number of genotypic changes in a gene

41 regulatory network provide substantive developmental changes and could make available selective advantage for visual adaptation.

Table 2.1. Primer sequences.

Gene Forward primer (5’ 3’) Reverse primer (5’ 3’) Use

β-actin TGGTATTGTGATGGACTCTGG GCTGTAGCCACGCTCGGTC RT-qPCR

six7 GACCAGACTGGACCTCACG GCAAATCAGACTGTTGTTGG RT-qPCR

six3a CAAGCAATAGGGCAGAATGG TTGACGTGCCCGTGTCGAC RT-qPCR

six3b TACAGACAGTGACTCTGATTTC GTCAGTCCGTTGAAGCGCTG RT-qPCR

six7 exon 1- 2 GACCTACAGAGAATTCGTCC’ GAGCACAACCCACTCCTGC PCR for MO3

six7 spacer region TGCCGTCTGGAAGTTCTCC ACTTCTCTACCGGGCCGAG PCR TALENs

six7 TGCCGTCTGGAAGTTCTCC GCAAATCAGACTGTTGTTGG probe

vax2 TGACAGGAACGAACTTCGCTAG TTCGGAGGTGGATGATGAGC probe

cyp26c1 GTTCGGGCACGATTTCTGCC CTCTGATTCCCTTGCGCAGG probe

 ljr region GATGTGAGATGTAAATCGGTC CATATCGTTATCGCAGTACTC PCR deletion

six7 GACCTACAGAGAATTCGTCC ACTTCTCTACCGGGCCGAG PCR

42 CHAPTER 3

PHOTORECEPTOR DISTRIBUTION AND OPSIN DIVERSITY IN THE EVOLUTION OF THE VERTEBRATE EYE

3.1 From day to night and the evolution of vertebrate vision

Vertebrate species rely on rod photoreceptors for dim-light vision and cones for color discrimination and visual acuity during day-light conditions. The striking diversity of types and numbers of photoreceptors across vertebrates have been a source of study by naturalist and evolutionary biologists for more than a century. The addition of molecular and computational tools for comparative genomics between extant species, spectral analysis of regenerated opsins in vitro, as well as evo-devo approaches, have brought new insights into possible mechanisms of vertebrate color vision tuning. However, the molecular mechanisms underlying the changes from cone-dominated retinas typical of vertebrates like fish, reptiles, and birds to rod-dominated retinas typical of most extant mammals remains unknown. This chapter reviews the diversity of photoreceptors and opsins in the vertebrate retina in relation to adaptive diversification in ecological niches ranging from the deep-sea to shallow waters to terrestrial habitats, and from bright light to dim light environments. Lastly, a model is proposed to address the potential mechanisms underlying photoreceptor variation and an evolutionary shift towards a rod- dominated retina. This model highlights the roles of known transcription factors involved in photoreceptor development in the context of gradual evolutionary changes that could have lead from a cone dominated to a rod-dominated retina.

3.2 Early vertebrates

3.2.1 550-500 million years ago: the ancestral photoreceptors

A distinctive feature of vertebrate eye evolution is that ciliary, as opposed to rhabdomeric, photoreceptor cells became the main light-sensitive cell in the retina. The prototypical vertebrate photoreceptor cell which is estimated to have emerged between 550 and 530 Mya (Lamb et al., 2007) is composed of an elaborated dendrite, the outer segment, an inner segment, the cell body and a synaptic terminal as summarized in Figure 3.1. The outer segment contains the visual pigments and phototransduction proteins embedded within stacks of discs of invaginated plasma membrane. The outer segment connects with the inner segment by a narrow

43 bridge of cytoplasm containing a modified cilium. The inner segment contains mitochondria, ribosomes, as well as the Golgi complex that are responsible for synthesis and transport of proteins. The nucleus is contained in the cell body, and the presynaptic terminal contains one or more ribbon-like structures for rapid released of vesicles at the invaginating synapses (Figure 3.1). Vertebrate photoreceptors are broadly classified on the basis of the morphology of the rod- or cone-shaped outer segment. In jawed vertebrates, cone inner segments are smaller and broader than rods and their outer segments display a small tapered shape with continuous discs of plasma membrane, creating a stack of plate-like lamellae. The cone photoreceptor nuclei are large with euchromatin residing toward the nuclear interior. The cone terminals, or pedicles, have a pyramid shape with multiple invaginated synapses. In contrast, rod outer segments show a long cylindrical shape with a stack of membrane-bound discs enclosed in a plasma membrane that separates them from the extracellular matrix. Their nuclei are located more vitread than those of cones. In nocturnal animals, the nuclear architecture is inverted with heterochromatin localized to the nuclear center and euchromatin towards the nuclear border. The rod terminals possess fewer synaptic ribbons than cones (Figure 3.1). Outer segment morphology was initially used to classify and study photoreceptor evolution from primitive vertebrates to current species. Jawless fish of the agnathan lineage, the earliest vertebrates, are represented by hagfish (Myxiniformes), and lampreys, (Petromyzontiformes), which diverged from the ancestors of jawed animals about 505 Mya (Xian-guang et al., 2002; Shu et al., 2003) (Figure 3.2). Hagfish live in deep water. Their eyes have poorly developed vision and function mainly as a circadian organ (Lamb et al., 2007). Hagfish are the most primitive species to have evolved ciliary photoreceptors which may provide an advantage for light detection in dim light environments (Collin, 2010). Hagfish photoreceptors are cylindrical receptor cells with rod-like properties and an overall similar cellular organization to those observed in other vertebrates. However, their outer segments are poorly organized membranes radiating from a central cilium, similar to the pineal organ of non- mammalian vertebrates. The outer segments protrude into the extracellular spaces and make contact with unpigmented epithelial-cells. The synaptic terminal contains a synaptic density enclosed by a “synaptic body” that projects to postsynaptic cells of unknown nature (Holmberg, 1971; Lamb, 2013).

Figure 3.1. Schematic structure of rod and cone photoreceptor cells structure. Cone (red) and rod (dark grey) photoreceptor cells have distinct outer segment shape. Rods have neatly arrayed stack of discs surrounded by plasma membrane. The outer segment in cones is tapered to a point with in-folded discs of plasma membrane.

Unlike hagfish, light and electron microscopy studies have shown that adult lampreys possess protuberant eyes that resemble the design of gnathostomatous vertebrates (Holmberg, 1971; Pu and Dowling, 1981; Collin et al., 1999). Lampreys are found in salt and fresh water and their eyes can vary depending upon which hemisphere they inhabit. As early as 1916, Tretjakoff reported that northern hemisphere lampreys have two morphologically distinct types of photoreceptors based on the length of their inner segments, short or long. However, their classification has been the subject of studies for years (Lamb, 2013). In 1935, Walls confirmed the duplex morphological properties of the retina, and suggested that one of the receptors was a rod, on the basis of the presence of rhodopsin (Walls, 1935). Later, ultrastructural studies classified both receptors as rods while Dickson and Graves considered both as cones (Öhman, 1971; Dickson and Graves, 1979). Morphologically, these ancestral photoreceptor structures

45 showed intermediate features between rods and cones. The outer segments were tapered and appeared to be continuous with the plasma membrane, but occasionally in-folded, confounding their classification (Collin et al., 2009; Lamb, 2013). However, recent studies in northern lampreys (sea lamprey Petromyzon marinus and the river lamprey Lampetra fluviatilis) using patch clamp and suction electrode recording techniques in the short and long photoreceptors showed membrane potentials and hyperpolarization responses that are characteristic of the Cambrian photoreceptors (Asteriti et al., 2015). In addition, data recorded from the short photoreceptors showed high sensitivity to light and flow of the signal to the long photoreceptor, features of rods and cones in jawed vertebrates. These data support the hypothesis that scotopic vision was a feature present before the time of divergence of agnatha and gnathostomata (Asteriti et al., 2015; Morshedian and Fain, 2015). In contrast, in the adult southern lamprey Geotria australis (both upstream and downstream migrants), five types of photoreceptors have been identified (Collin et al., 2009; Collin et al., 2004). Based on the morphology of the outer segment discs and the presence of multiple synaptic ribbons, all are classified as cone-like (Collin and Trezise, 2004; Dickson and Graves, 1979). Uniquely, the retina of another southern lamprey species, Mordacia mordax, contains a single morphological type of photoreceptor with dual characteristics of rods and cones that shows adaptations for dim light and high photon capture properties (Collin et al., 2004). In summary, the diversity of photoreceptor types observed in lampreys illustrates visual adaptations to different environments.

3.2.2 Evolution and diversity of color vision in early vertebrates

Rod and cone photoreceptors contain visual pigments that are composed of opsin proteins linked with the chromophore retinal. Opsins were the first member identified from the G-protein- coupled receptor (GPCR) family. Their structures are characterized by 350 amino acids in seven α-helical transmembrane domains enclosing a chromophoric ligand-binding pocket (Bowmaker, 2008). Unlike other GPCRs, the chromophore 11-cis- retinal or 11-cis-3, 4-dehydroretinal binds covalently to a highly conserved lysine in the seven transmembrane helix (Wald, 1968). Opsin spectral sensitivity is determined primarily by the interaction of the chromophore with specific amino acids lining the ligand-binding pocket of the opsin that allows the detection of a wide range of light between 360 and 750 nm (Fasick et al., 2002). Rods express rhodopsin (RH1) with a range max 460- 530 nm; while cones express one of four distinct opsin subtypes: a long- to

46 middle-wave length class from 490-570 nm (LWS, sometimes called LWS/MWS), a middle- wave class from 480-535 nm (RH2 or green), a short-wave length class from 410-490 nm (SWS2) and a violet-ultraviolet class from 344-440 nm (Yokoyama, 2000; Bowmaker, 2008). While little is known about hagfish opsins, considerably more is known about lamprey opsins. In the Northern Hemisphere, the river lamprey Lampreta japonica and the marine lamprey Petromyzon marinus appear to contain two classes of photoreceptors, classified as rods with high similarity with rod opsins of higher vertebrates (maximum sensitivity around 510-525 nm) and a single class of cones with peak sensitivity around 550 nm (Harosi and Kleinschmidt, 1993; Ishikawa et al., 1987; Negishi et al., 1987). In contrast, the Southern hemisphere species Geotria australis has a broad spectral sensitivity for cones with a total of five different opsin- types (LWS, SWS2, SWS1, RhA and RhB) identified by analysis of opsin genes (Collin et al., 2003; Collin and Trezise, 2004). Their phylogenetic studies show that LWS, SWS2 and SWS1 opsin genes from Geotria australis are orthologues to the LWS, SWS2 and SWS1 in jawed vertebrates. The remaining two opsin types, RHA and RHB, appear to be equally distantly related to either of the two Rh1 and Rh2 opsin genes of the jawed vertebrates (Collin et al., 2003; Bowmaker, 2008). These findings are consistent with the presence of a single ancestral RH opsin gene was present in the genome of the recent common ancestor of jawless and jawed vertebrates (Collin and Trezise, 2004). Collin S. et al., 2003 suggested that after the separation of agnaths and gnathostomes, a gene duplication event gave rise to Rh1 and Rh2 in jawed vertebrates, and RhA and RhB in jawless vertebrates (Collin et al., 2003). Further phylogenetic analysis assigned orthology pairs, RhA and Rh1 and RhB and Rh2 (Collin et al., 2009). Although, phylogenetic questions remain open, these analyses suggest that the first vertebrates had at least trichromatic color vision as early as 540 Mya (Bowmaker, 2008).

3.3 From 300 Mya and the diversity in color vision and photoreceptor ratios

3.3.1 Teleosts

Teleosts show the greatest range of visual capacity from pure rod vision in many deep- sea fish species to tetrachromacy in species living in brightly lit environments (Figure 3.2). A whole genome duplication event underlies the evolution of many functional cone opsins in most teleost families creating a photopigment pool from where, through gene duplication or loss,

47 mutations or selective pressure, teleosts acquire their diverse vision (Trezise and Collin, 2005). Genomic analysis of the teleost model system, zebrafish (Danio rerio) shows that eight cone opsin subtypes are present: two LWS (LWS1.1 and LWS1.2) genes located in tandem on chromosome 11 with a peak sensitivity of 558 and 548 nm respectively. Four RH2 (RH2.1, RH2.2, RH2.3, RH2.4) genes are also in tandem on chromosome 8 allowing a range of color vision from 467 to 505 nm (Chinen et al., 2003). SWS1 (355 nm) and SWS2 (416 nm) genes are present in single copies (Vihtelic et al., 1999); (Takechi and Kawamura, 2005; Chinen et al., 2003). The tandem arrays of RH2 and LWS genes illustrate the individual gene duplication mechanisms (Chinen et al., 2003; Davies et al., 2012), also observed in the primate LWS gene opsin (Dulai et al., 1999). Multiple opsin gene duplications have been identified in the colorful cichlid populations of the African Great Lakes, where visual communication is crucial for mate choices and adaptation to different photopic environments (Carleton and Kocher, 2003); (Carleton et al., 2005); (Parry et al., 2005). In the European eel, A. anguila, the switch of two different types of RH1 genes from long-wavelength form (freshwater) to the short-wavelength form (deep-sea) exemplifies how ontogenetic differences in the expression of photopigments can extend the light spectrum range within a species with different lifestyles (Archer et al., 1995). This opsin switch allows sub-functionalization of opsin genes with retention of the desired feature (Spady et al., 2006). The diversity of the teleost visual system is not only restricted to the number of cone opsin subtypes. Skates, for example, only show rod photoreceptor types in their retinas, while sharks and rays possess cone and rod photoreceptors. Several species of ray possess trichromatic color vision, whereas shark retinas only express a single cone subtype (Davies et al., 2012). In deep sea teleost fishes, the deep water arrowtooth eel Histiobranchus bathybius has retinas devoid of cone photoreceptors (Hope et al., 1997) while the short fin pearl-eye Scoterlarchus analis has retained the RH2 gene (Pointer et al., 2007).

3.3.2 Birds

In general, birds display cone-dominated, duplex retinas with 20-30% rods in most the species. Retinas of diurnal species are characterized by the presence of double cones that account for 50% of the cone population, and four spectral classes of single cones. LWS opsin is expressed in the double and single cones while RH2, SWS1, and SWS2 opsins can be found in

48 single cones (Figure 3.2) (Bowmaker, 2008). Double cones in birds consist of a larger and smaller cell in close physical contact that function in achromatic motion perception (Bowmaker et al., 1997; Osorio et al., 1999; Osorio and Vorobyev, 2005). In contrast, in nocturnal bird species like the tawny owl, Strix aluco, rods represent 90% of the photoreceptors. The remaining 10% are cone photoreceptors expressing three opsin subtypes: LWS, RH2 and SWS2 (Bowmaker and Martin, 1978). However, only a mutated form of the RH2 cone opsin has been reported in addition to RH1 for the barn owl (Borges et al., 2015). This shift in photoreceptor ratios from diurnal to nocturnal species is also observed in wading birds that forage during low light levels. For example, oilbirds have a rod/cone ratio of 123/1 and pauraques have a rod/cone ratio of 5/1 (Rojas et al., 2004). Recent comparative genomic analyses of 48 avian genomes showed that no major early events of gene loss or gain of opsins have taken place throughout avian radiation (Zhang et al., 2014; Borges et al., 2015). RH1 and RH2 were present in all birds, while SWS1, SWS2 and LWS were detected in more than 50% of the 48 analyzed genomes (Borges et al., 2015). As observed for teleosts, diurnal species have a modified repertoire of cone opsins to fit their photic vision, while nocturnal birds dramatically shift the rod/cone ratio to maximize light detection. It is unknown whether this change in photoreceptor ratio is simply due to altered expression of opsin subtypes, or some other mechanism. Altered expression of opsins may seem too simplistic explanation, if we consider rods and cones to be distinct not only in the visual opsins they express, but also based on their morphology, physiological machinery, and response kinetics.

3.3.3 Reptiles

Nocturnal geckos are descendants of diurnal lizards but have evolved an all-rod retina during adaptation to scotopic conditions. The nocturnal retina of geckos (Gekko gekko) provides interesting oddities by having exclusive rod photoreceptor features in response to light: robust photo-response and slow recovery time (Kleinschmidt and Dowling, 1975; Rispoli et al., 1993; Zhang et al., 2006). However, the outer segments of gecko photoreceptors are morphologically rod-like because of the presence of “discs” mainly enclosed by plasma membrane (Yoshida, 1978; Roll, 2000) or cone-like because of their shorter connecting cilium, dispersed chromatin nuclei and synaptic terminal similar to cone pedicles (Roll, 2000). Adaptation to nocturnal life by the helmet gecko (Tarentola chazaliae) includes photoreceptors 400 times more sensitive than

49 these of the human eye (Roth et al., 2009). Despite being active at night, gecko photoreceptors contain cone visual pigments that are blue-shifted RH2 and MWS (max at 467 and 521 nm respectively), in addition to SWS1 with max at 364 nm (Roll, 2000; Kojima et al., 1992; Loew, 1994). Behavioral assays show that nocturnal geckos are able to discriminate blue from grey patterns in dim light (Roth and Kelber, 2004). In 1942, Walls proposed his “transmutation theory” (Walls, 194β) which hypothesized that during evolution, rod and cone photoreceptors could convert into the other type to fulfill adaptation to different scotopic environments. The intermediate morphological and physiological features of the nocturnal gecko photoreceptors between rods and cones supported the theory that these rod photoreceptors are transmuted cones. Snakes inhabit many different ecological niches and also became a key component group in Walls “transmutation theory” (Walls, 1942). Their photoreceptors are variable in morphology, ranging from all-cone to all-rod retina, or a mixture, exemplified by species like boas and pythons that display duplex retinas expressing RH1, LWS and SWS1 opsins (Walls, 1942; Jacobs and Deegan, 1992; Davies et al., 2009; Schott et al., 2016). Previous studies characterized the retina of the diurnal garter snake (Thamnophis sirtalis) as an all-cone retina with double and large single cones expressing LWS and two types of small single cones containing SWS1 and an un-characterized middle-wavelength pigment. No evidence for the existence of rod visual response was found (Sillman et al., 1999). Recently, Schott et al. identified a functional RH1 gene and cells expressing rod-transducin in the “all-cone retina” of the diurnal garter snake (Thamnophis proximus). These suggest that the previously unidentified photopigment may be a highly blue-shifted rhodopsin (Schott et al., 2016). Close examination of the ultrastructure of photoreceptors identified one of the small single cones with rod structural features: less-tapered outer segments discs enclosed by plasma membrane and inner segments less rounded than typical cones (Schott et al., 2016). This data supports the evolutionary transmutation of rods into “cone-like” photoreceptors in colubrid snakes. But an important question remains: why had colubrids and nocturnal geckos modified their rod and cone photoreceptors while other groups had not? Possible explanations may include Thamnophis snakes being a species caught in transition or their modified rods and cones provide an advantage to regain visual function that was lost in their ancestors. The absence of transcription factors that guarantee a complete photoreceptor fate might explain the cone-like rod photoreceptors and the absent of the “true” rod and cone morphology.

Figure 3.2. A diagram illustrating main branches of vertebrate evolution showing opsin subtypes and example species. Branch points of divergence are estimated millions of years ago (MYA). Schematic summary of vertebrate ancestor (lamprey) is showing five types of photoreceptors in the extant lineage diverged from G australis (modified from Collin S, 2009). (?) represents potential trichromacy in marsupials (Arrese CA. et al., 2005), (*) represents a nonfunctional SWS1 gene in monotremes (Jacobs GH. 2009). SWS1, UV cones; SWS2, blue cones; RH2, green cones; LWS, red cones; RH1, rods.

3.3.4 Mammals and adaptation of their vision to nocturnal environments

Mammals are primarily dichromatic with only two distinct types of single cones, LWS and SWS1 cones (Figure 3.2). In most mammalian species, LWS cones have spectral sensitivity ranging from 530 to 565 nm, whereas in rats, mouse, and rabbit, sensitivity is shifted approximately to 510 nm (Sun et al., 1997). SWS1 cones exhibit spectral absorbance to violet

51 wavelengths (max 440 nm) and in some rodents SWS1 cones absorb UV light (365 nm). In primates, SWS1 cones display peak of absorption around 420 to 440 nm (Bowmaker, 1998). However, the reduced variety of cone subtypes is not the only distinctive characteristic in the mammalian vision system. The majority of mammals display a predominant increase in rod number with comparatively few cones. Data collected from analysis of fossils suggest that ancestors of present day mammals, which evolved during the Early Jurassic around 200 Mya (Kemp, 2006), were small nocturnal animals possibly due to predation pressure with dinosaurs as the predominant threat. In 1942, Walls proposed the “nocturnal-bottle neck” hypothesis to explain the dramatic changes in photoreception and sensory systems in mammals (Walls, 1942). The “nocturnal-bottleneck” hypothesis suggests that mammals, which spent more than 160 million years as nocturnal species, accumulated traits characteristics of nocturnal lifestyle. For example, numerous characteristics of the extant mammalian visual system, like the limited dichromatic color vision, illustrate the nocturnal ancestry in mammals.

3.3.5 Evolution of cone pigments

3.3.5.1 Monotremes, marsupials and early eutherians

Monotremes, Prototheria, diverged from therians roughly 166 Mya. Marsupial (Metatheria) and placental (Eutheria) mammals, split about 148 Mya (Figure 3.2) (Jacobs, 2009).

Cones from marsupials and placental mammals express LWS (max at 539 and 533 nm respectively) and SWS1 (max at 420 and 363 nm respectively) opsins, whereas monotremes possess functional LWS (max at 550 nm) and SWS2 (max at 451 nm) opsins. But remnants of the SWS1 gene were identified in the platypus genome (Davies et al., 2007; Wakefield et al., 2008). The middle wavelength sensitive RH2 gene is absent from all extant mammals, suggesting that its loss was an early event in mammalian evolution. These suggest that ancestral mammals before the prototherian/therian split must have possessed trichromatic retinas expressing three cone opsins (LWS, SWS1 and SWS2) (Jacobs, 2009; Hunt et al., 2009). Next, the independent loss of a short wavelength-sensitive opsin in the prototherian and metatherian lineages led to dichromatic vision in early eutherian and contemporary mammals (Davies et al., 2007; Jacobs G. et al., 2009).

3.3.5.2 Trichromacy in primates

The first primates evolved around 80-90 Mya (Bininda-Emonds et al., 2007; Springer and Murphy, 2007) and their diurnal or nocturnal behavior has been controversial. Tan et al. 2005 concluded by phylogenic and mutation studies of the opsins in primates that these ancestral primates were diurnal or cathemeral (Tan et al., 2005; Ankel-Simons and Rasmussen, 2008). However, the majority of the data suggests early primates were nocturnal (Jacobs, 2009; Perry and Pickrell, 2010) with dichromatic retinas expressing two types of cones, LWS and SWS1 (Jacobs, 2009). Other more recent adaptations further shaped the visual capacity of the mammalian retina: spectral tuning by single nucleotide polymorphisms, gene loss, and/or gene duplication like the LWS duplication observed in primate lineages (Davies et al., 2012). The molecular mechanisms leading to trichromacy differ between the two major simian groups, the plathyrrines (New World monkeys) and the catarrhines (Old World monkeys, gibbons, and great apes). In catarrhines, the M (max 530 nm) and L (max 530 nm) photopigments are the result of duplication of the original LWS gene on the X chromosome and one or the other being expressed in the red or green cone subtype (Nathans et al., 1986). This duplication occurred around 30-40 Mya (Nathans et al., 1986; Jacobs, 2009). In plathyrrine and prosimians (lorises, lemurs and tarsiers), no duplication of opsin is observed, with trichromacy only existing in females. Trichromacy can be explained by the occurrence of three distinct polymorphisms of the X-linked LWS gene leading to change in spectral sensitivity. Random inactivation of the X-chromosome in polymorphic females would result in cones expressing one or the other LWS opsin allowing trichromatic color vision (Neitz et al., 1991; Jacobs et al., 2007).

3.3.5.3 Monochromacy in mammals: owl monkey and aquatic mammals

The owl monkey (Aotus) constitutes an exception to all present-day monkeys with a fully nocturnal retina and restricted color vision as a result of a non-functional S-opsin (Jacobs, 1993). Recent studies suggested that a shift in neurogenesis in the developing retina of Aoutus azarae accounts for the increasing proportion of later differentiated neurons, such as rod and rod-bipolar cells, at the expense of earlier cell types like cones (Dyer et al., 2009). Many aquatic mammals that populate the deep ocean with scotopic conditions also display monochromacy with retention of an intact LWS opsin (Figure 3.2). Gene sequence analysis in 16 species of cetaceans identified

53 mutations in SWS1 opsin gene leading to loss of function of SWS1 opsin (Levenson and Dizon, 2003; Levenson et al., 2006). The loss of the SWS1-sensitive cone subtype may have resulted from the lack of selective pressure to maintain color vision.

3.3.6 Rod diversity in mammalian retina

The mammalian retina responds dramatically to variation of photopic enviroments. Most mammals display rod dominated retinas but the range can vary from almost all-rod retinas, 99%, in the small eye of the rats to 70% rods in most diurnal mammals (Ahnelt and Kolb, 2000; Peichl et al., 2000). However, despite the high rod percentage, cones are frequently retained, for example, pigs have about 10-20% cones (Hendrickson and Hicks, 2002), guinea pig about 8-17% (Peichl and Gonzalez-Soriano, 1994) while degu have up to 30% (Jacobs et al., 2003). Few mammals show a cone-dominated retina. In ground squirrels, Spermophilus beecheyi, rods constitute only the 25% of the photoreceptor cells (Kryger et al., 1998). The tree shrew, Tupaia glis, is even more dramatic with only 5% of rods (Muller and Peichl, 1989). The tree shrew outer nuclear layer, in contrast with most of the mammalian retinas, forms a single row of photoreceptor nuclei. Rod density in the majority of mammals is about 200 to 400,000/mm2, but diurnal species like tree shrews show only 500 to 3,500 rods/mm2 (Muller and Peichl, 1989), likewise the ground squirrel has only 1,000 to 13,000 rods/ mm2 (Kryger et al., 1998). In contrast, the African pouched rat retina exhibits a drastic increased rod density of 390,000 to 730,000 rods/mm2 (Peichl and Moutairou, 1998). Cone and rod photoreceptors have been retained in mammals despite the increased rod number in some nocturnal mammals likely due to the circuitry of the retina. Otherwise, major cell rewiring would be required if cones are completely abolished from the mammalian retina.

3.3.7 From the reptile-like retina ancestors to the mammalian retina and the “twilight- bottleneck”

The drastically reduced number and variation of cones together with the greatly increased rod density in mammals when compared with their ancestral vertebrates suggests that early mammalian retinas have undergone genetic changes to reduce visual acuity and increase light sensitivity. Absence of RH2 and SWS1 gene photopigments, lack of double cones, and changes in lens and eye shapes to ensure scotopic eye design were some of the alterations that took place

54 in the visual system to ensure adaptation to nocturnal environments (Bowmaker et al., 1997). Despite the increased rod number, cones are frequently retained, which highlight the importance of dichromacy for survival. Based upon opsin sequences and ecological adaptations, Davies et al., postulated an alternative “twilight-bottleneck” hypothesis (Davies et al., 2012). Mammalian ancestors gradually extended their behavior under twilight conditions to maximize feeding and survival. In phase one, the hypothesis suggests that under mesopic conditions, rods and cones contribute to color vision, RH1 and RH2 overlap in spectral sensitivity. As rods are more sensitive that cones, RH2 became redundant and was eventually lost from the genome. In phase two of the alternative “twilight-bottleneck” hypothesis, loss of SWS1 in monotremes and parallel loss of SWS2 in eutherian genomes suggests independent adaptation to nocturnal conditions but selective pressure to maintain long and short long wavelength-sensitive opsins (Davies et al., 2012). Therefore, a dichromatic retina has been shaped gradually throughout the adaptation of ancestors of present day mammals to nocturnal habitats.

3.4 Potential for alterations in gene regulatory network underlying changes in photoreceptor ratios

Photoreceptor subtypes and number are different across vertebrates. Diurnal species are tetrachromats, while nocturnal species have lost green- and blue-sensitive cones and are dichromats. However, opsin alterations are not the only striking changes that characterize the evolution of the vertebrate retina. A dramatic shift in the rod to cone ratio is also evident (Figure 3.3A). This raises an interesting question in an evolutionary context; could mutations in gene regulatory network involved in photoreceptor development explain the molecular changes in photoreceptor composition from cone-dominated retinas in vertebrate ancestors to rod-dominated retinas in mammals? Studies of mutations in mouse and humans provide evidence for a highly conserved transcription factor network regulating photoreceptor specification. For example, the basic leucine zipper transcription factor NRL determines the rod versus cone cell fate in mammals (Mears et al., 2001). NRL ChIP-seq data identified target genes involved in rod cell homeostasis such as histone demethylase Kdm5b which regulates rod-expressed genes (Hao et al., 2012). The thyroid hormone nuclear receptor TR2 is necessary for red-sensitive cone determination (Lu et al., 2009). Our lab identified the gene tbx2b as necessary for the differentiation of SWS1 cone. Mutations in tbx2b causes an increased rod number and fewer

55 SWS1 cones (Alvarez-Delfin et al., 2009). However, little is known about the factors that generate the greater diversity of cone subtypes in non-mammalian vertebrates. The genes involved in blue- or green-sensitive cones determination are unknown (Figure 3.3B). Over the past 15 years, the relationship between gene mutations, development, and implications in the evolution of forms has impacted how biologists study evolution. In addition, the roles of cis-regulatory alleles in phenotypic evolution have been recognized as a likely target for gene regulation and morphology (Carroll SB., 2008; Chan YF et al., 2010; Wittkopp PJ. et al., 2012; Arnold CD. et al., 2014; Koshikawa S., et al., 2015; Faial T., 2015). Small spatial or temporal changes in gene expression during development can cause dramatic variation in morphology (Carrol SB. Et al., 2008). Cis-regulatory mutations are often co-dominant where natural selection operates more efficiently. Heterozygous organisms express a new trait immediately rather than postpone it until brought to homozygosity in the population (Wray G., 2007; Kwasnieski JC et al., 2012). The characterization of six7 function during this dissertation thesis, the analysis of the phenotypes of the hypomorphic mutants lor (lots-of-rods) and ljr (lots- of-rods-junior) emphasize the possible role of regulatory mutations on transcription factors as potential driving forces leading to variation in photoreceptor composition across vertebrates (Table 3.1). We provide a model for understanding how alteration of cis-regulatory elements could drive developmental changes transitioning a cone-dominated retina to a rod-dominated retina, better suited for a nocturnal environment. The model shown in Figure 3.3C summarizes hypothetical changes in the evolution of a rod-dominated retina from a cone-dominated ancestor using the effects of known genetic alterations upon photoreceptor specification as examples. First, increased mitosis of late stage progenitors leads to the generation of additional rods without altering cone subtypes. This allows for adaptation to mesopic conditions without sacrificing color perception. Next, the increased expression of RH1 would render RH2 cones functionally redundant, leading to accumulation of deleterious mutations in factors that specify the green-sensitive cones and preceding the loss of the RH2 gene in the early mammalian ancestors (Davies et al., 2012). Third, mutations of cis- regulatory enhancers altering the expression of genes that control photoreceptor cell fate would result in transmutations or a cell-fate switch of most of the SWS1 cone precursors into rods, similar to our observations for tbx2bp25bbtl. The retention of low level expression would ensure preservation of modest SWS1 cone function (Alvarez-Delfin et al., 2009). Taken together and on

56 the basis of the highly conserved role of TRβ2 for specification of the LWS cone fate (Lu et al., 2009), we hypothesize that the mutation of a cis-element regulating retina specific expression of TRβ2 in a genetic background such as tbx2bp25bbtl could further increase rod number. The LWS cone precursors would fail to adopt the SWS1 cone fate and in this scenario move towards a rod fate instead. Notably, evidence suggests transmutation of a rod into a middle wavelength- sensitive cone subtype in the recent evolution of the all-cone retina of garter snake (Schott et al., 2016). Thus, a few genetic changes could result in a significant shift of photoreceptor composition to better adapt to a novel environment. It is interesting to speculate that remnants of the proposed evolutionary history for two distinct origins of rods may persist in present day mammals. In the rod-dominated mouse retina, rod genesis initially overlaps with that of cones but peaks during post-natal development (reviewed by Swaroop et al., 2010). BrdU labeling revealed that excess S cones in the rd7 mouse are generated from proliferation of early born photoreceptor precursors that aberrantly express cone-specific genes including SWS1 opsin (Cheng et al., 2011). Late born rods, on the other hand, did not co-label for S opsin. The different requirements for NR2E3 to suppress cone fate possibly reflect the convergence of two mechanisms associated with nocturnal adaptation, transmutation of populations of cones into rods and extended proliferation of precursors at later stages of development. Shifts in the photoreceptor cell repertoire are frequently accompanied by modifications in retinal circuitry. Examples in mouse and zebrafish show considerable plasticity in synapse formation in response to changes in photoreceptor specification (Raven et al., 2007; Saade et al., 2013; Montana et al., 2013; Oh et al., 2007; Yoshimatsu et al., 2014; Smallwood et al., 2003). These observations suggest that existing features of retinal circuitry could accommodate shifts in photoreceptor subtypes and that through the co-evolution of genes regulating synaptic connectivity, new synaptic connections would become fixed over time.

57 Table 3.1: Summary of the rod and cone phenotypes for different genetic backgrounds.

Genotype Rods Cones

wild type

SWS1 SWS2 RH2 LWS

six7p23ahub Increased number

SWS1 SWS2 RH2 LWS

six7fl4 Increased number

SWS1 SWS2 LWS

tbx2bp25bbtl Increased number Fewer UV-cones (SWS1)

SWS1 SWS2 RH2 LWS

tbx2bp25bbtl/six7p23ahub Even more rods Fewer UV-cones (SWS1)

SWS1 SWS2 RH2 LWS

Figure 3.3. Summary diagrams and a model for variation of photoreceptor composition. (A) Photoreceptor composition varies across vertebrates. Cone-rich, tetrachromat species shown on the left and rod-rich, dichromat species shown on the right. (B) Schematic representation of highly conserved transcription factor network during photoreceptor specification in vertebrates. RPCs that express Otx2 and Crx are committed to differentiate as photoreceptors. The expression of other transcription factors determines the photoreceptor subtypes. RPC, retinal progenitor cells; PhPC: photoreceptor precursor cell; OTX2, orthodenticle homeobox 2; CRX, cone-rod homeobox transcription factor. (C) Pie charts showing the changes in relative abundance of photoreceptor subtypes from a cone- (far left) to a rod-dominated retina (far right). The different colors represent the cone subtypes. Black was used for rods (RH1). The proposed genetic mechanisms underlying the progressive changes in photoreceptor composition are indicated by arrows. Step 1: a cis-regulatory mutation leads to an increase in mitosis. Step 2: RH2 gene becomes functionally redundant, followed by the loss of green-sensitive cones. Step 3: a cis- regulatory mutation causes a cell-fate switch of UV cones to rods. Step 4: a subsequent epistatic mutation gives rise to a cell fate change from red cones to rods. RH1, rods; RH2, green cones; LWS, red cones; SWS1, UV cones; SWS2, blue cones.

59 APPENDIX A

ACUC PROTOCOL APPROVAL

60 REFERENCES

Aday AW, Zhu LJ, Lakshmanan A, Wang J, Lawson ND (2011) Identification of cis regulatory features in the embryonic zebrafish genome through large-scale profiling of H3K4me1 and H3K4me3 binding sites. Dev Biol (United States) 357:450-462.

Adler R, Raymond PA (2008) Have we achieved a unified model of photoreceptor cell fate specification in vertebrates? Brain Res (Netherlands) 1192:134-150.

Ahnelt PK, Kolb H (2000) The mammalian photoreceptor mosaic-adaptive design. Prog Retin Eye Res (England) 19:711-777.

Alfano G, Conte I, Caramico T, Avellino R, Arno B, Pizzo MT, Tanimoto N, Beck SC, Huber G, Dolle P, Seeliger MW, Banfi S (2011) Vax2 regulates retinoic acid distribution and cone opsin expression in the vertebrate eye. Development (England) 138:261-271.

Allison WT, Barthel LK, Skebo KM, Takechi M, Kawamura S, Raymond PA (2010) Ontogeny of cone photoreceptor mosaics in zebrafish. J Comp Neurol (United States) 518:4182-4195.

Alvarez-Delfin K (2011) Transcriptional regulation of photoreceptor development in the zebrafish retina. (Florida State University) .

Alvarez-Delfin K, Morris AC, Snelson CD, Gamse JT, Gupta T, Marlow FL, Mullins MC, Burgess HA, Granato M, Fadool JM (2009) Tbx2b is required for ultraviolet photoreceptor cell specification during zebrafish retinal development. Proc Natl Acad Sci U S A (United States) 106:2023-2028.

Anderson AM, Weasner BM, Weasner BP, Kumar JP (2012) Dual transcriptional activities of SIX proteins define their roles in normal and ectopic eye development. Development (England) 139:991-1000.

Ankel-Simons F, Rasmussen DT (2008) Diurnality, nocturnality, and the evolution of primate visual systems. Am J Phys Anthropol (United States) Suppl 47:100-117.

Appolloni I, Calzolari F, Corte G, Perris R, Malatesta P (2008) Six3 controls the neural progenitor status in the murine CNS. Cereb Cortex (United States) 18:553-562.

Archer S, Hope A, Partridge JC (1995) The molecular basis for the green-blue sensitivity shift in the rod visual pigments of the european eel. Proc Biol Sci (England) 262:289-295.

Arnold CD, Gerlach D, Spies D, Matts JA, Sytnikova YA, Pagani M, Lau NC, Stark A (2014) Quantitative genome-wide enhancer activity maps for five drosophila species show functional enhancer conservation and turnover during cis-regulatory evolution. Nat Genet (United States) 46:685-692.

61 Asteriti S, Grillner S, Cangiano L (2015) A cambrian origin for vertebrate rods. Elife (England) 4:10.7554/eLife.07166.

Bailey TJ, Fossum SL, Fimbel SM, Montgomery JE, Hyde DR (2010) The inhibitor of phagocytosis, O-phospho-L-serine, suppresses muller glia proliferation and cone cell regeneration in the light-damaged zebrafish retina. Exp Eye Res (England) 91:601-612.

Barbieri AM, Lupo G, Bulfone A, Andreazzoli M, Mariani M, Fougerousse F, Consalez GG, Borsani G, Beckmann JS, Barsacchi G, Ballabio A, Banfi S (1999) A homeobox gene, vax2, controls the patterning of the eye dorsoventral axis. Proc Natl Acad Sci U S A (United States) 96:10729-10734.

Bassett EA, Wallace VA (2012) Cell fate determination in the vertebrate retina. Trends Neurosci (England) 35:565-573.

Belliveau MJ, Cepko CL (1999) Extrinsic and intrinsic factors control the genesis of amacrine and cone cells in the rat retina. Development (England) 126:555-566.

Belliveau MJ, Young TL, Cepko CL (2000) Late retinal progenitor cells show intrinsic limitations in the production of cell types and the kinetics of opsin synthesis. J Neurosci (United States) 20:2247-2254.

Bessant DA, Payne AM, Mitton KP, Wang QL, Swain PK, Plant C, Bird AC, Zack DJ, Swaroop A, Bhattacharya SS (1999) A mutation in NRL is associated with autosomal dominant retinitis pigmentosa. Nat Genet (United States) 21:355-356.

Bibliowicz J, Gross JM (2009) Expanded progenitor populations, vitreo-retinal abnormalities, and muller glial reactivity in the zebrafish leprechaun/patched2 retina. BMC Dev Biol (England) 9:52-213X-9-52.

Bickelmann C, Morrow JM, Du J, Schott RK, van Hazel I, Lim S, Muller J, Chang BS (2015) The molecular origin and evolution of dim-light vision in mammals. Evolution .

Bininda-Emonds OR, Cardillo M, Jones KE, MacPhee RD, Beck RM, Grenyer R, Price SA, Vos RA, Gittleman JL, Purvis A (2007) The delayed rise of present-day mammals. Nature (England) 446:507-512.

Boije H, MacDonald RB, Harris WA (2014) Reconciling competence and transcriptional hierarchies with stochasticity in retinal lineages. Curr Opin Neurobiol (England) 27:68-74.

Borges R, Khan I, Johnson WE, Gilbert MT, Zhang G, Jarvis ED, O'Brien SJ, Antunes A (2015) Gene loss, adaptive evolution and the co-evolution of plumage coloration genes with opsins in birds. BMC Genomics (England) 16:751-015-1924-3.

Bowmaker JK (2008) Evolution of vertebrate visual pigments. Vision Res (England) 48:2022- 2041.

62 Bowmaker JK (1998) Evolution of colour vision in vertebrates. Eye (Lond) (England) 12 ( Pt 3b):541-547.

Bowmaker JK, Martin GR (1978) Visual pigments and colour vision in a nocturnal bird, strix aluco (tawny owl). Vision Res (England) 18:1125-1130.

Bowmaker JK, Heath LA, Wilkie SE, Hunt DM (1997) Visual pigments and oil droplets from six classes of photoreceptor in the retinas of birds. Vision Res (England) 37:2183-2194.

Brockerhoff SE, Dowling JE, Hurley JB (1998) Zebrafish retinal mutants. Vision Res (England) 38:1335-1339.

Brockerhoff SE, Hurley JB, Janssen-Bienhold U, Neuhauss SC, Driever W, Dowling JE (1995) A behavioral screen for isolating zebrafish mutants with visual system defects. Proc Natl Acad Sci U S A (United States) 92:10545-10549.

Bruhn SL, Cepko CL (1996) Development of the pattern of photoreceptors in the chick retina. J Neurosci (United States) 16:1430-1439.

Brzezinski JA, Reh TA (2015) Photoreceptor cell fate specification in vertebrates. Development (England) 142:3263-3273.

Cade L, Reyon D, Hwang WY, Tsai SQ, Patel S, Khayter C, Joung JK, Sander JD, Peterson RT, Yeh JR (2012) Highly efficient generation of heritable zebrafish gene mutations using homo- and heterodimeric TALENs. Nucleic Acids Res (England) 40:8001-8010.

Cameron DA, Carney LH (2000) Cell mosaic patterns in the native and regenerated inner retina of zebrafish: Implications for retinal assembly. J Comp Neurol (United States) 416:356-367.

Carleton KL, Kocher TD (2003) Rose-colored goggles. Heredity (Edinb) (England) 90:116-117.

Carleton KL, Parry JW, Bowmaker JK, Hunt DM, Seehausen O (2005) Colour vision and speciation in lake victoria cichlids of the genus pundamilia. Mol Ecol (England) 14:4341- 4353.

Carlin D, Sepich D, Grover VK, Cooper MK, Solnica-Krezel L, Inbal A (2012) Six3 cooperates with hedgehog signaling to specify ventral telencephalon by promoting early expression of Foxg1a and repressing wnt signaling. Development (England) 139:2614-2624.

Carroll SB (2008) Evo-devo and an expanding evolutionary synthesis: A genetic theory of morphological evolution. Cell (United States) 134:25-36.

Cepko CL, Austin CP, Yang X, Alexiades M, Ezzeddine D (1996) Cell fate determination in the vertebrate retina. Proc Natl Acad Sci U S A (United States) 93:589-595.

63 Chan YF, Marks ME, Jones FC, Villarreal G,Jr, Shapiro MD, Brady SD, Southwick AM, Absher DM, Grimwood J, Schmutz J, Myers RM, Petrov D, Jonsson B, Schluter D, Bell MA, Kingsley DM (2010) Adaptive evolution of pelvic reduction in sticklebacks by recurrent deletion of a Pitx1 enhancer. Science (United States) 327:302-305.

Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong JW, Xi JJ (2013) Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res (England) 23:465-472.

Chen J, Rattner A, Nathans J (2005) The rod photoreceptor-specific nuclear receptor Nr2e3 represses transcription of multiple cone-specific genes. J Neurosci (United States) 25:118- 129.

Chen S, Wang QL, Nie Z, Sun H, Lennon G, Copeland NG, Gilbert DJ, Jenkins NA, Zack DJ (1997) Crx, a novel otx-like paired-homeodomain protein, binds to and transactivates photoreceptor cell-specific genes. Neuron (United States) 19:1017-1030.

Cheng H, Khan NW, Roger JE, Swaroop A (2011) Excess cones in the retinal degeneration rd7 mouse, caused by the loss of function of orphan nuclear receptor Nr2e3, originate from early-born photoreceptor precursors. Hum Mol Genet. (England) 21:4102-15.

Chinen A, Hamaoka T, Yamada Y, Kawamura S (2003) Gene duplication and spectral diversification of cone visual pigments of zebrafish. Genetics (United States) 163:663-675.

Cho SW, Kim S, Kim Y, Kweon J, Kim HS, Bae S, Kim JS (2014) Analysis of off-target effects of CRISPR/cas-derived RNA-guided endonucleases and nickases. Genome Res (United States) 24:132-141.

Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove AJ, Voytas DF (2010) Targeting DNA double-strand breaks with TAL effector nucleases. Genetics (United States) 186:757-761.

Collin SP (2010) Evolution and ecology of retinal photoreception in early vertebrates. Brain Behav Evol (Switzerland) 75:174-185.

Collin SP, Trezise AE (2004) The origins of colour vision in vertebrates. Clin Exp Optom (Australia) 87:217-223.

Collin SP, Potter IC, Braekevelt CR (1999) The ocular morphology of the southern hemisphere lamprey geotria australis gray, with special reference to optical specialisations and the characterisation and phylogeny of photoreceptor types. Brain Behav Evol (Switzerland) 54:96-118.

Collin SP, Davies WL, Hart NS, Hunt DM (2009) The evolution of early vertebrate photoreceptors. Philos Trans R Soc Lond B Biol Sci (England) 364:2925-2940.

64 Collin SP, Hart NS, Wallace KM, Shand J, Potter IC (2004) Vision in the southern hemisphere lamprey mordacia mordax: Spatial distribution, spectral absorption characteristics, and optical sensitivity of a single class of retinal photoreceptor. Vis Neurosci (England) 21:765- 773.

Collin SP, Knight MA, Davies WL, Potter IC, Hunt DM, Trezise AE (2003) Ancient colour vision: Multiple opsin genes in the ancestral vertebrates. Curr Biol (England) 13:R864-5.

Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/cas systems. Science (United States) 339:819-823.

Cook JE (1996) Spatial properties of retinal mosaics: An empirical evaluation of some existing measures. Vis Neurosci (England) 13:15-30.

Cortesi F, Musilova Z, Stieb SM, Hart NS, Siebeck UE, Malmstrom M, Torresen OK, Jentoft S, Cheney KL, Marshall NJ, Carleton KL, Salzburger W (2015) Ancestral duplications and highly dynamic opsin gene evolution in percomorph fishes. Proc Natl Acad Sci U S A (United States) 112:1493-1498.

Cristea S, Freyvert Y, Santiago Y, Holmes MC, Urnov FD, Gregory PD, Cost GJ (2013) In vivo cleavage of transgene donors promotes nuclease-mediated targeted integration. Biotechnol Bioeng (United States) 110:871-880.

Curcio CA, Sloan KR, Kalina RE, Hendrickson AE (1990) Human photoreceptor topography. J Comp Neurol (United States) 292:497-523.

Davies WI, Collin SP, Hunt DM (2012) Molecular ecology and adaptation of visual photopigments in craniates. Mol Ecol (England) 21:3121-3158.

Davies WL, Cowing JA, Bowmaker JK, Carvalho LS, Gower DJ, Hunt DM (2009) Shedding light on serpent sight: The visual pigments of henophidian snakes. J Neurosci (United States) 29:7519-7525.

Davies WL, Carvalho LS, Cowing JA, Beazley LD, Hunt DM, Arrese CA (2007) Visual pigments of the platypus: A novel route to mammalian colour vision. Curr Biol (England) 17:R161-3.

DeCarvalho AC, Cappendijk SL, Fadool JM (2004) Developmental expression of the POU domain transcription factor brn-3b (Pou4f2) in the lateral line and visual system of zebrafish. Dev Dyn (United States) 229:869-876.

Del Bene F, Tessmar-Raible K, Wittbrodt J (2004) Direct interaction of geminin and Six3 in eye development. Nature (England) 427:745-749.

65 Deml B, Kariminejad A, Borujerdi RH, Muheisen S, Reis LM, Semina EV (2015) Mutations in MAB21L2 result in ocular coloboma, microcornea and cataracts. PLoS Genet (United States) 11:e1005002.

Dickson DH, Graves DA (1979) Fine structure of the lamprey photoreceptors and retinal pigment epithelium (petromyzon marinus L.). Exp Eye Res (England) 29:45-60.

Dowling JE, Boycott BB (1966) Organization of the primate retina: Electron microscopy. Proc R Soc Lond B Biol Sci (England) 166:80-111.

Dulai KS, von Dornum M, Mollon JD, Hunt DM (1999) The evolution of trichromatic color vision by opsin gene duplication in new world and old world primates. Genome Res (United States) 9:629-638.

Dyer MA, Martins R, da Silva Filho M, Muniz JA, Silveira LC, Cepko CL, Finlay BL (2009) Developmental sources of conservation and variation in the evolution of the primate eye. Proc Natl Acad Sci U S A (United States) 106:8963-8968.

Enright JM, Lawrence KA, Hadzic T, Corbo JC (2015) Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. J Comp Neurol (United States) 523:649-668.

Fadool JM (2003) Development of a rod photoreceptor mosaic revealed in transgenic zebrafish. Dev Biol (United States) 258:277-290.

Fadool JM, Brockerhoff SE, Hyatt GA, Dowling JE (1997) Mutations affecting eye morphology in the developing zebrafish (danio rerio). Dev Genet (United States) 20:288-295.

Faial T, Bernardo AS, Mendjan S, Diamanti E, Ortmann D, Gentsch GE, Mascetti VL, Trotter MW, Smith JC, Pedersen RA (2015) Brachyury and SMAD signalling collaboratively orchestrate distinct mesoderm and endoderm gene regulatory networks in differentiating human embryonic stem cells. Development (England) 142:2121-2135.

Fasick JI, Applebury ML, Oprian DD (2002) Spectral tuning in the mammalian short-wavelength sensitive cone pigments. Biochemistry (United States) 41:6860-6865.

Fekete DM, Perez-Miguelsanz J, Ryder EF, Cepko CL (1994) Clonal analysis in the chicken retina reveals tangential dispersion of clonally related cells. Dev Biol (United States) 166:666-682.

Finlay B, Silveira L, Reichenbach A (2005) Comparative aspects of visual system development. In: The primate visual system: A comparative approach (Kremers J, ed), pp37-72. Chichester, England, UK: John Wiley & Sons.

Freund CL, Gregory-Evans CY, Furukawa T, Papaioannou M, Looser J, Ploder L, Bellingham J, Ng D, Herbrick JA, Duncan A, Scherer SW, Tsui LC, Loutradis-Anagnostou A, Jacobson

66 SG, Cepko CL, Bhattacharya SS, McInnes RR (1997) Cone-rod dystrophy due to mutations in a novel photoreceptor-specific homeobox gene (CRX) essential for maintenance of the photoreceptor. Cell (United States) 91:543-553.

Furukawa T, Morrow EM, Cepko CL (1997) Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell (United States) 91:531-541.

Garneau JE, Dupuis ME, Villion M, Romero DA, Barrangou R, Boyaval P, Fremaux C, Horvath P, Magadan AH, Moineau S (2010) The CRISPR/cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature (England) 468:67-71.

Gasiunas G, Barrangou R, Horvath P, Siksnys V (2012) Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci U S A (United States) 109:E2579-86.

Godinho L, Mumm JS, Williams PR, Schroeter EH, Koerber A, Park SW, Leach SD, Wong RO (2005) Targeting of amacrine cell neurites to appropriate synaptic laminae in the developing zebrafish retina. Development (England) 132:5069-5079.

Gomes FL, Zhang G, Carbonell F, Correa JA, Harris WA, Simons BD, Cayouette M (2011) Reconstruction of rat retinal progenitor cell lineages in vitro reveals a surprising degree of stochasticity in cell fate decisions. Development (England) 138:227-235.

Gosse NJ, Baier H (2009) An essential role for radar (Gdf6a) in inducing dorsal fate in the zebrafish retina. Proc Natl Acad Sci U S A (United States) 106:2236-2241.

Govavardovskii V.I. , Lychakov D.V. (1984) Visual cells and visual pigments of the lamprey, lampetra fluviatilis. Journal of Comparative Physiology A 154:279-286.

Gregg RG, Willer GB, Fadool JM, Dowling JE, Link BA (2003) Positional cloning of the young mutation identifies an essential role for the brahma chromatin remodeling complex in mediating retinal cell differentiation. Proc Natl Acad Sci U S A (United States) 100:6535- 6540.

Gross JM, Perkins BD, Amsterdam A, Egana A, Darland T, Matsui JI, Sciascia S, Hopkins N, Dowling JE (2005) Identification of zebrafish insertional mutants with defects in visual system development and function. Genetics (United States) 170:245-261.

Haider NB, Jacobson SG, Cideciyan AV, Swiderski R, Streb LM, Searby C, Beck G, Hockey R, Hanna DB, Gorman S, Duhl D, Carmi R, Bennett J, Weleber RG, Fishman GA, Wright AF, Stone EM, Sheffield VC (2000) Mutation of a nuclear receptor gene, NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate. Nat Genet (United States) 24:127- 131.

67 Hall MI, Kamilar JM, Kirk EC (2012) Eye shape and the nocturnal bottleneck of mammals. Proc Biol Sci (England) 279:4962-4968.

Hao H, Kim DS, Klocke B, Johnson KR, Cui K, Gotoh N, Zang C, Gregorski J, Gieser L, Peng W, Fann Y, Seifert M, Zhao K, Swaroop A (2012) Transcriptional regulation of rod photoreceptor homeostasis revealed by in vivo NRL targetome analysis. PLoS Genet (United States) 8:e1002649.

Harosi FI, Kleinschmidt J (1993) Visual pigments in the sea lamprey, petromyzon marinus. Vis Neurosci (England) 10:711-715.

Hart NS, Hunt DM (2007) Avian visual pigments: Characteristics, spectral tuning, and evolution. Am Nat (United States) 169 Suppl 1:S7-26.

He J, Zhang G, Almeida AD, Cayouette M, Simons BD, Harris WA (2012) How variable clones build an invariant retina. Neuron (United States) 75:786-798.

Heesy CP, Hall MI (2010) The nocturnal bottleneck and the evolution of mammalian vision. Brain Behav Evol (Switzerland) 75:195-203.

Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO, Van Calcar S, Qu C, Ching KA, Wang W, Weng Z, Green RD, Crawford GE, Ren B (2007) Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet (United States) 39:311-318.

Hendrickson A, Hicks D (2002) Distribution and density of medium- and short-wavelength selective cones in the domestic pig retina. Exp Eye Res (England) 74:435-444.

Hendrickson AE (1994) Primate foveal development: A microcosm of current questions in neurobiology. Invest Ophthalmol Vis Sci (United States) 35:3129-3133.

Hofmann CM, Carleton KL (2009) Gene duplication and differential gene expression play an important role in the diversification of visual pigments in fish. Integr Comp Biol (England) 49:630-643.

Holmberg K (1971) The hagfish retina: Electron microscopic study comparing receptor and epithelial cells in the pacific hagfish, polistotrema stouti, with those in the atlantic hagfish, myxine glutinosa. Z Zellforsch Mikrosk Anat (GERMANY, WEST) 121:249-269.

Holt CE, Bertsch TW, Ellis HM, Harris WA (1988) Cellular determination in the xenopus retina is independent of lineage and birth date. Neuron (United States) 1:15-26.

Hope AJ, Partridge JC, Dulai KS, Hunt DM (1997) Mechanisms of wavelength tuning in the rod opsins of deep-sea fishes. Proc Biol Sci (England) 264:155-163.

68 Horvath P, Barrangou R (2010) CRISPR/cas, the immune system of bacteria and archaea. Science (United States) 327:167-170.

Hu M, Easter SS (1999) Retinal neurogenesis: The formation of the initial central patch of postmitotic cells. Dev Biol (United States) 207:309-321.

Huang P, Xiao A, Zhou M, Zhu Z, Lin S, Zhang B (2011) Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol (United States) 29:699-700.

Hunt DM, Chan J, Carvalho LS, Hokoc JN, Ferguson MC, Arrese CA, Beazley LD (2009) Cone visual pigments in two species of south american marsupials. Gene (Netherlands) 433:50- 55.

Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK (2013) Efficient genome editing in zebrafish using a CRISPR-cas system. Nat Biotechnol (United States) 31:227-229.

Hyatt GA, Dowling JE (1997) Retinoic acid. A key molecule for eye and photoreceptor development. Invest Ophthalmol Vis Sci (United States) 38:1471-1475.

Hyatt GA, Schmitt EA, Fadool JM, Dowling JE (1996) Retinoic acid alters photoreceptor development in vivo. Proc Natl Acad Sci U S A (United States) 93:13298-13303.

Inbal A, Kim SH, Shin J, Solnica-Krezel L (2007a) Six3 represses nodal activity to establish early brain asymmetry in zebrafish. Neuron (United States) 55:407-415.

Ishikawa M, Takao M, Washioka H, Tokunaga F, Watanabe H, Tonosaki A (1987) Demonstration of rod and cone photoreceptors in the lamprey retina by freeze-replication and immunofluorescence. Cell Tissue Res (GERMANY, WEST) 249:241-246.

Jacobs GH (2013) Losses of functional opsin genes, short-wavelength cone photopigments, and color vision--a significant trend in the evolution of mammalian vision. Vis Neurosci (England) 30:39-53.

Jacobs GH (2009) Evolution of colour vision in mammals. Philos Trans R Soc Lond B Biol Sci (England) 364:2957-2967.

Jacobs GH (1993) The distribution and nature of colour vision among the mammals. Biol Rev Camb Philos Soc (England) 68:413-471.

Jacobs GH, Deegan JF,2nd (1992) Cone photopigments in nocturnal and diurnal procyonids. J Comp Physiol A (GERMANY) 171:351-358.

Jacobs GH, Williams GA, Cahill H, Nathans J (2007) Emergence of novel color vision in mice engineered to express a human cone photopigment. Science (United States) 315:1723-1725.

69 Jacobs GH, Neitz M, Deegan JF, Neitz J (1996) Trichromatic colour vision in new world monkeys. Nature (England) 382:156-158.

Jacobs GH, Calderone JB, Fenwick JA, Krogh K, Williams GA (2003) Visual adaptations in a diurnal rodent, octodon degus. J Comp Physiol A Neuroethol Sens Neural Behav Physiol (United States) 189:347-361.

Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science (United States) 337:816-821.

Kawakami K, Sato S, Ozaki H, Ikeda K (2000) Six family genes--structure and function as transcription factors and their roles in development. Bioessays (England) 22:616-626.

Kay JN, Link BA, Baier H (2005) Staggered cell-intrinsic timing of ath5 expression underlies the wave of ganglion cell neurogenesis in the zebrafish retina. Development (England) 132:2573-2585.

Kay JN, Finger-Baier KC, Roeser T, Staub W, Baier H (2001) Retinal ganglion cell genesis requires lakritz, a zebrafish atonal homolog. Neuron (United States) 30:725-736.

Keeley PW, Whitney IE, Madsen NR, St John AJ, Borhanian S, Leong SA, Williams RW, Reese BE (2014) Independent genomic control of neuronal number across retinal cell types. Dev Cell (United States) 30:103-109.

Kemp TS (2006) The origin and early radiation of the therapsid mammal-like reptiles: A palaeobiological hypothesis. J Evol Biol (Switzerland) 19:1231-1247.

Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, Haussler D (2002) The human genome browser at UCSC. Genome Res (United States) 12:996-1006.

Kenyon KL, Yang-Zhou D, Cai CQ, Tran S, Clouser C, Decene G, Ranade S, Pignoni F (2005) Partner specificity is essential for proper function of the SIX-type homeodomain proteins sine oculis and optix during fly eye development. Dev Biol (United States) 286:158-168.

Khanna H, Akimoto M, Siffroi-Fernandez S, Friedman JS, Hicks D, Swaroop A (2006) Retinoic acid regulates the expression of photoreceptor transcription factor NRL. J Biol Chem (United States) 281:27327-27334.

Kleinschmidt J, Dowling JE (1975) Intracellular recordings from gecko photoreceptors during light and dark adaptation. J Gen Physiol (United States) 66:617-648.

Kobayashi M, Nishikawa K, Suzuki T, Yamamoto M (2001) The homeobox protein Six3 interacts with the groucho corepressor and acts as a transcriptional repressor in eye and forebrain formation. Dev Biol (United States) 232:315-326.

70 Kobayashi M, Takezawa S, Hara K, Yu RT, Umesono Y, Agata K, Taniwaki M, Yasuda K, Umesono K (1999) Identification of a photoreceptor cell-specific nuclear receptor. Proc Natl Acad Sci U S A (United States) 96:4814-4819.

Kojima D, Okano T, Fukada Y, Shichida Y, Yoshizawa T, Ebrey TG (1992) Cone visual pigments are present in gecko rod cells. Proc Natl Acad Sci U S A (United States) 89:6841- 6845.

Koshiba-Takeuchi K, Takeuchi JK, Matsumoto K, Momose T, Uno K, Hoepker V, Ogura K, Takahashi N, Nakamura H, Yasuda K, Ogura T (2000) Tbx5 and the retinotectum projection. Science (United States) 287:134-137.

Koshikawa S, Giorgianni MW, Vaccaro K, Kassner VA, Yoder JH, Werner T, Carroll SB (2015) Gain of cis-regulatory activities underlies novel domains of wingless gene expression in drosophila. Proc Natl Acad Sci U S A (United States) 112:7524-7529.

Kryger Z, Galli-Resta L, Jacobs GH, Reese BE (1998) The topography of rod and cone photoreceptors in the retina of the ground squirrel. Vis Neurosci (England) 15:685-691.

Kumar JP (2009) The sine oculis homeobox (SIX) family of transcription factors as regulators of development and disease. Cell Mol Life Sci (Switzerland) 66:565-583.

Kwasnieski JC, Mogno I, Myers CA, Corbo JC, Cohen BA (2012) Complex effects of nucleotide variants in a mammalian cis-regulatory element. Proc Natl Acad Sci U S A (United States) 109:19498-19503.

Lagman D, Ocampo Daza D, Widmark J, Abalo XM, Sundstrom G, Larhammar D (2013) The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications. BMC Evol Biol (England) 13:238-2148-13-238.

Lakowski J, Majumder A, Lauderdale JD (2007) Mechanisms controlling Pax6 isoform expression in the retina have been conserved between teleosts and mammals. Dev Biol (United States) 307:498-520.

Lamb TD (2013) Evolution of phototransduction, vertebrate photoreceptors and retina. Prog Retin Eye Res (England) 36:52-119.

Lamb TD, Collin SP, Pugh EN (2007) Evolution of the vertebrate eye: Opsins, photoreceptors, retina and eye cup. Nat Rev Neurosci 8:960-976.

Larison KD, Bremiller R (1990) Early onset of phenotype and cell patterning in the embryonic zebrafish retina. Development (England) 109:567-576.

71 Lee C, Wallingford JB, Gross JM (2014) Cluap1 is essential for ciliogenesis and photoreceptor maintenance in the vertebrate eye. Invest Ophthalmol Vis Sci (United States) 55:4585-4592.

Levenson DH, Dizon A (2003) Genetic evidence for the ancestral loss of short-wavelength- sensitive cone pigments in mysticete and odontocete cetaceans. Proc Biol Sci (England) 270:673-679.

Levenson DH, Ponganis PJ, Crognale MA, Deegan JF,2nd, Dizon A, Jacobs GH (2006) Visual pigments of marine carnivores: Pinnipeds, polar bear, and sea otter. J Comp Physiol A Neuroethol Sens Neural Behav Physiol (Germany) 192:833-843.

Li H (2011) A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics (England) 27:2987-2993.

Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup (2009) The sequence alignment/map format and SAMtools. Bioinformatics (England) 25:2078-2079.

Link BA, Fadool JM, Malicki J, Dowling JE (2000) The zebrafish young mutation acts non-cell- autonomously to uncouple differentiation from specification for all retinal cells. Development (England) 127:2177-2188.

Liu H, Etter P, Hayes S, Jones I, Nelson B, Hartman B, Forrest D, Reh TA (2008) NeuroD1 regulates expression of thyroid hormone receptor 2 and cone opsins in the developing mouse retina. J Neurosci (United States) 28:749-756.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods (United States) 25:402-408.

Loew ER (1994) A third, ultraviolet-sensitive, visual pigment in the tokay gecko (gekko gekko). Vision Res (England) 34:1427-1431.

Lu A, Ng L, Ma M, Kefas B, Davies TF, Hernandez A, Chan CC, Forrest D (2009) Retarded developmental expression and patterning of retinal cone opsins in hypothyroid mice. Endocrinology (United States) 150:1536-1544.

Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM (2013) RNA-guided human genome engineering via Cas9. Science (United States) 339:823-826.

Malicki J, Neuhauss SC, Schier AF, Solnica-Krezel L, Stemple DL, Stainier DY, Abdelilah S, Zwartkruis F, Rangini Z, Driever W (1996) Mutations affecting development of the zebrafish retina. Development (England) 123:263-273.

72 Maresca M, Lin VG, Guo N, Yang Y (2013) Obligate ligation-gated recombination (ObLiGaRe): Custom-designed nuclease-mediated targeted integration through nonhomologous end joining. Genome Res (United States) 23:539-546.

Masland RH (2012) The neuronal organization of the retina. Neuron (United States) 76:266-280.

Mathers PH, Grinberg A, Mahon KA, Jamrich M (1997) The rx homeobox gene is essential for vertebrate eye development. Nature (England) 387:603-607.

Mears AJ, Kondo M, Swain PK, Takada Y, Bush RA, Saunders TL, Sieving PA, Swaroop A (2001) Nrl is required for rod photoreceptor development. Nat Genet (United States) 29:447-452.

Meyers JR, Hu L, Moses A, Kaboli K, Papandrea A, Raymond PA (2012) Beta-catenin/wnt signaling controls progenitor fate in the developing and regenerating zebrafish retina. Neural Dev (England) 7:30-8104-7-30.

Mitchell DM, Stevens CB, Frey RA, Hunter SS, Ashino R, Kawamura S, Stenkamp DL (2015) Retinoic acid signaling regulates differential expression of the tandemly-duplicated long wavelength-sensitive cone opsin genes in zebrafish. PLoS Genet (United States) 11:e1005483.

Mitton KP, Swain PK, Chen S, Xu S, Zack DJ, Swaroop A (2000) The leucine zipper of NRL interacts with the CRX homeodomain. A possible mechanism of transcriptional synergy in rhodopsin regulation. J Biol Chem (United States) 275:29794-29799.

Mizeracka K, DeMaso CR, Cepko CL (2013) Notch1 is required in newly postmitotic cells to inhibit the rod photoreceptor fate. Development (England) 140:3188-3197.

Mochizuki A (2002) Pattern formation of the cone mosaic in the zebrafish retina: A cell rearrangement model. J Theor Biol (England) 215:345-361.

Montana CL, Kolesnikov AV, Shen SQ, Myers CA, Kefalov VJ, Corbo JC (2013) Reprogramming of adult rod photoreceptors prevents retinal degeneration. Proc Natl Acad Sci U S A (United States) 110:1732-1737.

Morris AC (2011) The genetics of ocular disorders: Insights from the zebrafish. Birth Defects Res C Embryo Today (United States) 93:215-228.

Morris AC, Fadool JM (2005) Studying rod photoreceptor development in zebrafish. Physiol Behav (United States) 86:306-313.

Morris AC, Scholz TL, Brockerhoff SE, Fadool JM (2008) Genetic dissection reveals two separate pathways for rod and cone regeneration in the teleost retina. Dev Neurobiol (United States) 68:605-619.

73 Morris VB (1982) An afoveate area centralis in the chick retina. J Comp Neurol (United States) 210:198-203.

Morshedian A, Fain GL (2015) Single-photon sensitivity of lamprey rods with cone-like outer segments. Curr Biol (England) 25:484-487.

Muller B, Peichl L (1989) Topography of cones and rods in the tree shrew retina. J Comp Neurol (United States) 282:581-594.

Nathans J, Thomas D, Hogness DS (1986) Molecular genetics of human color vision: The genes encoding blue, green, and red pigments. Science (United States) 232:193-202.

Negishi K, Teranishi T, Kuo CH, Miki N (1987) Two types of lamprey retina photoreceptors immunoreactive to rod- or cone-specific antibodies. Vision Res (England) 27:1237-1241.

Neitz M, Neitz J, Jacobs GH (1991) Spectral tuning of pigments underlying red-green color vision. Science (United States) 252:971-974.

Nelson SM, Frey RA, Wardwell SL, Stenkamp DL (2008) The developmental sequence of gene expression within the rod photoreceptor lineage in embryonic zebrafish. Dev Dyn (United States) 237:2903-2917.

Neuhauss SC, Biehlmaier O, Seeliger MW, Das T, Kohler K, Harris WA, Baier H (1999) Genetic disorders of vision revealed by a behavioral screen of 400 essential loci in zebrafish. J Neurosci (United States) 19:8603-8615.

Ng L, Hurley JB, Dierks B, Srinivas M, Salto C, Vennstrom B, Reh TA, Forrest D (2001) A thyroid hormone receptor that is required for the development of green cone photoreceptors. Nat Genet (United States) 27:94-98.

Nishida A, Furukawa A, Koike C, Tano Y, Aizawa S, Matsuo I, Furukawa T (2003) Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nat Neurosci (United States) 6:1255-1263.

Ochocinska MJ, Hitchcock PF (2009) NeuroD regulates proliferation of photoreceptor progenitors in the retina of the zebrafish. Mech Dev (Ireland) 126:128-141.

Ochocinska MJ, Hitchcock PF (2007) Dynamic expression of the basic helix-loop-helix transcription factor neuroD in the rod and cone photoreceptor lineages in the retina of the embryonic and larval zebrafish. J Comp Neurol (United States) 501:1-12.

Ogawa Y, Shiraki T, Kojima D, Fukada Y (2015) Homeobox transcription factor Six7 governs expression of green opsin genes in zebrafish. Proc Biol Sci (England) 282:10.1098/rspb.2015.0659.

74 Oh EC, Khan N, Novelli E, Khanna H, Strettoi E, Swaroop A (2007) Transformation of cone precursors to functional rod photoreceptors by bZIP transcription factor NRL. Proc Natl Acad Sci U S A (United States) 104:1679-1684.

Öhman P (1971) The photoreceptor outer segments of the river lamprey (lampetra fluviatilis). an electron-fluorescence and light microscopic study. (Acta. Zool.) 52:287–297.

Ohsaki K, Morimitsu T, Ishida Y, Kominami R, Takahashi N (1999) Expression of the vax family homeobox genes suggests multiple roles in eye development. Genes Cells (England) 4:267-276.

Oliver G, Loosli F, Koster R, Wittbrodt J, Gruss P (1996) Ectopic lens induction in fish in response to the murine homeobox gene Six3. Mech Dev (IRELAND) 60:233-239.

Oliver G, Wehr R, Jenkins NA, Copeland NG, Cheyette BN, Hartenstein V, Zipursky SL, Gruss P (1995) Homeobox genes and connective tissue patterning. Development (England) 121:693-705.

Osorio D, Vorobyev M (2005) Photoreceptor spectral sensitivities in terrestrial animals: Adaptations for luminance and colour vision. Proc Biol Sci (England) 272:1745-1752.

Osorio D, Vorobyev M, Jones CD (1999) Colour vision of domestic chicks. J Exp Biol (England) 202:2951-2959.

Parry JW, Carleton KL, Spady T, Carboo A, Hunt DM, Bowmaker JK (2005) Mix and match color vision: Tuning spectral sensitivity by differential opsin gene expression in lake malawi cichlids. Curr Biol (England) 15:1734-1739.

Peichl L, Moutairou K (1998) Absence of short-wavelength sensitive cones in the retinae of seals (carnivora) and african giant rats (rodentia). Eur J Neurosci (FRANCE) 10:2586-2594.

Peichl L, Gonzalez-Soriano J (1994) Morphological types of horizontal cell in rodent retinae: A comparison of rat, mouse, gerbil, and guinea pig. Vis Neurosci (England) 11:501-517.

Peichl L, Kunzle H, Vogel P (2000) Photoreceptor types and distributions in the retinae of insectivores. Vis Neurosci (England) 17:937-948.

Perry GH, Pickrell JK (2010) A rod cell marker of nocturnal ancestry. J Hum Evol (England) 58:207-210.

Peters MA, Cepko CL (2002) The dorsal-ventral axis of the neural retina is divided into multiple domains of restricted gene expression which exhibit features of lineage compartments. Dev Biol (United States) 251:59-73.

75 Pignoni F, Hu B, Zavitz KH, Xiao J, Garrity PA, Zipursky SL (1997) The eye-specification proteins so and eya form a complex and regulate multiple steps in drosophila eye development. Cell (United States) 91:881-891.

Pointer MA, Carvalho LS, Cowing JA, Bowmaker JK, Hunt DM (2007) The visual pigments of a deep-sea teleost, the pearl eye scopelarchus analis. J Exp Biol (England) 210:2829-2835.

Pu GA, Dowling JE (1981) Anatomical and physiological characteristics of pineal photoreceptor cell in the larval lamprey, petromyzon marinus. J Neurophysiol (United States) 46:1018- 1038.

Puschel AW, Gruss P, Westerfield M (1992) Sequence and expression pattern of pax-6 are highly conserved between zebrafish and mice. Development (England) 114:643-651.

Quinlan AR, Hall IM (2010) BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics (England) 26:841-842.

Rapaport DH, Wong LL, Wood ED, Yasumura D, LaVail MM (2004) Timing and topography of cell genesis in the rat retina. J Comp Neurol (United States) 474:304-324.

Raven MA, Oh EC, Swaroop A, Reese BE (2007) Afferent control of horizontal cell morphology revealed by genetic respecification of rods and cones. J Neurosci (United States) 27:3540- 3547.

Raymond PA, Barthel LK (2004) A moving wave patterns the cone photoreceptor mosaic array in the zebrafish retina. Int J Dev Biol (Spain) 48:935-945.

Raymond PA, Barthel LK, Curran GA (1995) Developmental patterning of rod and cone photoreceptors in embryonic zebrafish. J Comp Neurol (United States) 359:537-550.

Raymond PA, Colvin SM, Jabeen Z, Nagashima M, Barthel LK, Hadidjojo J, Popova L, Pejaver VR, Lubensky DK (2014) Patterning the cone mosaic array in zebrafish retina requires specification of ultraviolet-sensitive cones. PLoS One (United States) 9:e85325.

Reese BE, Necessary BD, Tam PP, Faulkner-Jones B, Tan SS (1999) Clonal expansion and cell dispersion in the developing mouse retina. Eur J Neurosci (FRANCE) 11:2965-2978.

Rehemtulla A, Warwar R, Kumar R, Ji X, Zack DJ, Swaroop A (1996) The basic motif-leucine zipper transcription factor nrl can positively regulate rhodopsin gene expression. Proc Natl Acad Sci U S A (United States) 93:191-195.

Rispoli G, Sather WA, Detwiler PB (1993) Visual transduction in dialysed detached rod outer segments from lizard retina. J Physiol (England) 465:513-537.

76 Roberts MR, Hendrickson A, McGuire CR, Reh TA (2005) Retinoid X receptor (gamma) is necessary to establish the S-opsin gradient in cone photoreceptors of the developing mouse retina. Invest Ophthalmol Vis Sci (United States) 46:2897-2904.

Roberts MR, Srinivas M, Forrest D, Morreale de Escobar G, Reh TA (2006) Making the gradient: Thyroid hormone regulates cone opsin expression in the developing mouse retina. Proc Natl Acad Sci U S A (United States) 103:6218-6223.

Robinson J, Schmitt EA, Harosi FI, Reece RJ, Dowling JE (1993) Zebrafish ultraviolet visual pigment: Absorption spectrum, sequence, and localization. Proc Natl Acad Sci U S A (United States) 90:6009-6012.

Rojas LM, Ramirez Y, McNeil R, Mitchell M, Marin G (2004) Retinal morphology and electrophysiology of two caprimulgiformes birds: The cave-living and nocturnal oilbird (steatornis caripensis), and the crepuscularly and nocturnally foraging common pauraque (nyctidromus albicollis). Brain Behav Evol (Switzerland) 64:19-33.

Roll B (2000) Gecko vision-visual cells, evolution, and ecological constraints. J Neurocytol (United States) 29:471-484.

Rosenbloom KR et al (2015) The UCSC genome browser database: 2015 update. Nucleic Acids Res (England) 43:D670-81.

Roth LS, Kelber A (2004) Nocturnal colour vision in geckos. Proc Biol Sci (England) 271 Suppl 6:S485-7.

Roth LS, Lundstrom L, Kelber A, Kroger RH, Unsbo P (2009) The pupils and optical systems of gecko eyes. J Vis (United States) 9:27.1-2711.

Saade CJ, Alvarez-Delfin K, Fadool JM (2013) Rod photoreceptors protect from cone degeneration-induced retinal remodeling and restore visual responses in zebrafish. J Neurosci (United States) 33:1804-1814.

Sakuta H, Suzuki R, Takahashi H, Kato A, Shintani T, Iemura S, Yamamoto TS, Ueno N, Noda M (2001) Ventroptin: A BMP-4 antagonist expressed in a double-gradient pattern in the retina. Science (United States) 293:111-115.

Samuel A, Rubinstein AM, Azar TT, Ben-Moshe Livne Z, Kim SH, Inbal A (2016) Six3 regulates optic nerve development via multiple mechanisms. Sci Rep (England) 6:20267.

Sander JD, Yeh JR, Peterson RT, Joung JK (2011) Engineering zinc finger nucleases for targeted mutagenesis of zebrafish. Methods Cell Biol (United States) 104:51-58.

Schmitt EA, Dowling JE (1999) Early retinal development in the zebrafish, danio rerio: Light and electron microscopic analyses. J Comp Neurol (United States) 404:515-536.

77 Schmitt EA, Dowling JE (1996) Comparison of topographical patterns of ganglion and photoreceptor cell differentiation in the retina of the zebrafish, danio rerio. J Comp Neurol (United States) 371:222-234.

Schott RK, Muller J, Yang CG, Bhattacharyya N, Chan N, Xu M, Morrow JM, Ghenu AH, Loew ER, Tropepe V, Chang BS (2016) Evolutionary transformation of rod photoreceptors in the all-cone retina of a diurnal garter snake. Proc Natl Acad Sci U S A (United States) 113:356- 361.

Schulte D, Peters MA, Sen J, Cepko CL (2005) The rod photoreceptor pattern is set at the optic vesicle stage and requires spatially restricted cVax expression. J Neurosci (United States) 25:2823-2831.

Schulte D, Furukawa T, Peters MA, Kozak CA, Cepko CL (1999) Misexpression of the emx- related homeobox genes cVax and mVax2 ventralizes the retina and perturbs the retinotectal map. Neuron (United States) 24:541-553.

Seimiya M, Gehring WJ (2000) The drosophila homeobox gene optix is capable of inducing ectopic eyes by an eyeless-independent mechanism. Development (England) 127:1879- 1886.

Sen J, Harpavat S, Peters MA, Cepko CL (2005) Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina. Development (England) 132:5147-5159.

Seo HC, Curtiss J, Mlodzik M, Fjose A (1999) Six class homeobox genes in drosophila belong to three distinct families and are involved in head development. Mech Dev (IRELAND) 83:127-139.

Seo HC, Drivenes, Ellingsen S, Fjose A (1998a) Expression of two zebrafish homologues of the murine Six3 gene demarcates the initial eye primordia. Mech Dev (IRELAND) 73:45-57.

Seo HC, Drivenes O, Ellingsen S, Fjose A (1998b) Transient expression of a novel Six3-related zebrafish gene during gastrulation and eye formation. Gene (NETHERLANDS) 216:39-46.

Serikaku MA, O'Tousa JE (1994) Sine oculis is a homeobox gene required for drosophila visual system development. Genetics (United States) 138:1137-1150.

Shen YC, Raymond PA (2004) Zebrafish cone-rod (crx) homeobox gene promotes retinogenesis. Dev Biol (United States) 269:237-251.

Shu DG, Morris SC, Han J, Zhang ZF, Yasui K, Janvier P, Chen L, Zhang XL, Liu JN, Li Y, Liu HQ (2003) Head and backbone of the early cambrian vertebrate haikouichthys. Nature (England) 421:526-529.

78 Sillman AJ, Carver JK, Loew ER (1999) The photoreceptors and visual pigments in the retina of a boid snake, the ball python (python regius). J Exp Biol 202 (Pt 14):1931-1938.

Simoes BF, Sampaio FL, Jared C, Antoniazzi MM, Loew ER, Bowmaker JK, Rodriguez A, Hart NS, Hunt DM, Partridge JC, Gower DJ (2015) Visual system evolution and the nature of the ancestral snake. J Evol Biol (Switzerland) 28:1309-1320.

Slater JL, Landman KA, Hughes BD, Shen Q, Temple S (2009) Cell lineage tree models of neurogenesis. J Theor Biol (England) 256:164-179.

Smallwood PM, Olveczky BP, Williams GL, Jacobs GH, Reese BE, Meister M, Nathans J (2003) Genetically engineered mice with an additional class of cone photoreceptors: Implications for the evolution of color vision. Proc Natl Acad Sci U S A (United States) 100:11706-11711.

Spady TC, Parry JW, Robinson PR, Hunt DM, Bowmaker JK, Carleton KL (2006) Evolution of the cichlid visual palette through ontogenetic subfunctionalization of the opsin gene arrays. Mol Biol Evol (United States) 23:1538-1547.

Springer MS, Murphy WJ (2007) Mammalian evolution and biomedicine: New views from phylogeny. Biol Rev Camb Philos Soc (England) 82:375-392.

Sun H, Macke JP, Nathans J (1997) Mechanisms of spectral tuning in the mouse green cone pigment. Proc Natl Acad Sci U S A (United States) 94:8860-8865.

Suzuki SC, Bleckert A, Williams PR, Takechi M, Kawamura S, Wong RO (2013) Cone photoreceptor types in zebrafish are generated by symmetric terminal divisions of dedicated precursors. Proc Natl Acad Sci U S A (United States) 110:15109-15114.

Swain PK, Chen S, Wang QL, Affatigato LM, Coats CL, Brady KD, Fishman GA, Jacobson SG, Swaroop A, Stone E, Sieving PA, Zack DJ (1997) Mutations in the cone-rod homeobox gene are associated with the cone-rod dystrophy photoreceptor degeneration. Neuron (United States) 19:1329-1336.

Swaroop A, Kim D, Forrest D (2010) Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina. Nat Rev Neurosci (England) 11:563-576.

Szel A, Rohlich P, Mieziewska K, Aguirre G, van Veen T (1993) Spatial and temporal differences between the expression of short- and middle-wave sensitive cone pigments in the mouse retina: A developmental study. J Comp Neurol (United States) 331:564-577.

Takechi M, Kawamura S (2005) Temporal and spatial changes in the expression pattern of multiple red and green subtype opsin genes during zebrafish development. J Exp Biol (England) 208:1337-1345.

79 Takesue A, Mochizuki A, Iwasa Y (1998) Cell-differentiation rules that generate regular mosaic patterns: Modelling motivated by cone mosaic formation in fish retina. J Theor Biol (England) 194:575-586.

Take-uchi M, Clarke JD, Wilson SW (2003) Hedgehog signalling maintains the optic stalk- retinal interface through the regulation of vax gene activity. Development (England) 130:955-968.

Tan Y, Yoder AD, Yamashita N, Li WH (2005) Evidence from opsin genes rejects nocturnality in ancestral primates. Proc Natl Acad Sci U S A (United States) 102:14712-14716.

Trevarrow B (2011) Techniques for optimizing the creation of mutations in zebrafish using N- ethyl-N-nitrosourea. Lab Anim (NY) (United States) 40:353-361.

Trezise AE, Collin SP (2005) Opsins: Evolution in waiting. Curr Biol (England) 15:R794-6.

Turner DL, Cepko CL (1987) A common progenitor for neurons and glia persists in rat retina late in development. Nature (England) 328:131-136.

Vihtelic TS, Doro CJ, Hyde DR (1999) Cloning and characterization of six zebrafish photoreceptor opsin cDNAs and immunolocalization of their corresponding proteins. Vis Neurosci (England) 16:571-585.

Wakefield MJ, Anderson M, Chang E, Wei KJ, Kaul R, Graves JA, Grutzner F, Deeb SS (2008) Cone visual pigments of monotremes: Filling the phylogenetic gap. Vis Neurosci (England) 25:257-264.

Wald G (1968) Molecular basis of visual excitation. Science (United States) 162:230-239.

Wallis DE, Muenke M (1999) Molecular mechanisms of holoprosencephaly. Mol Genet Metab (United States) 68:126-138.

Walls GL (1942) Duplicity and transmutation in: The vertebrate eye and its adaptative radiation. Canbrook Institute of Science, Bloomfield Hills, Michigan 163-168.

Walls GL (1935) The visual cells of lampreys. Br J Ophthalmol (England) 19:129-148.

Wang S, Sengel C, Emerson MM, Cepko CL (2014) A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell (United States) 30:513-527.

Wang SW, Kim BS, Ding K, Wang H, Sun D, Johnson RL, Klein WH, Gan L (2001) Requirement for math5 in the development of retinal ganglion cells. Genes Dev (United States) 15:24-29.

Westerfield M (1995) The zebrafish book.(University of Oregon, Eugene, OR).

80 Wikler KC, Rakic P (1990) Distribution of photoreceptor subtypes in the retina of diurnal and nocturnal primates. J Neurosci (United States) 10:3390-3401.

Wray GA (2007) The evolutionary significance of cis-regulatory mutations. Nat Rev Genet (England) 8:206-216.

Xian-guang H, Aldridge RJ, Siveter DJ, Siveter DJ, Xiang-hong F (2002) New evidence on the anatomy and phylogeny of the earliest vertebrates. Proc Biol Sci (England) 269:1865-1869.

Yokoyama S (2002) Molecular evolution of color vision in vertebrates. Gene (Netherlands) 300:69-78.

Yokoyama S (2000) Molecular evolution of vertebrate visual pigments. Prog Retin Eye Res (England) 19:385-419.

Yokoyama S, Yang H, Starmer WT (2008) Molecular basis of spectral tuning in the red- and green-sensitive (M/LWS) pigments in vertebrates. Genetics (United States) 179:2037-2043.

Yoshida M (1978) Some observations on the patency in the outer segments of photoreceptors of the nocturnal gecko. Vision Res (England) 18:137-143.

Yoshimatsu T, Williams PR, D'Orazi FD, Suzuki SC, Fadool JM, Allison WT, Raymond PA, Wong RO (2014) Transmission from the dominant input shapes the stereotypic ratio of photoreceptor inputs onto horizontal cells. Nat Commun (England) 5:3699.

Young RW (1985) Cell differentiation in the retina of the mouse. Anat Rec (United States) 212:199-205.

Zhang G, Jarvis ED, Gilbert MT (2014) Avian genomes. A flock of genomes. introduction. Science (United States) 346:1308-1309.

Zhang X, Wensel TG, Yuan C (2006) Tokay gecko photoreceptors achieve rod-like physiology with cone-like proteins. Photochem Photobiol (United States) 82:1452-1460.

Zhao H, Rossiter SJ, Teeling EC, Li C, Cotton JA, Zhang S (2009) The evolution of color vision in nocturnal mammals. Proc Natl Acad Sci U S A (United States) 106:8980-8985.

Zhu CC, Dyer MA, Uchikawa M, Kondoh H, Lagutin OV, Oliver G (2002) Six3-mediated auto repression and eye development requires its interaction with members of the groucho- related family of co-repressors. Development (England) 129:2835-2849.

Zou J, Wang X, Wei X (2012) Crb apical polarity proteins maintain zebrafish retinal cone mosaics via intercellular binding of their extracellular domains. Dev Cell (United States) 22:1261-1274.

81 Zu Y, Tong X, Wang Z, Liu D, Pan R, Li Z, Hu Y, Luo Z, Huang P, Wu Q, Zhu Z, Zhang B, Lin S (2013) TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nat Methods (United States) 10:329-331.

82 BIOGRAPHICAL SKETCH

Mailin Sotolongo-Lopez

EDUCATION

2010-present PhD. candidate, Cellular and Molecular Biology Program Department of Biological Science The Florida State University, Tallahassee, Florida. Advisor: Dr. James Fadool 1998-1999 Internship in Plant Molecular Biology Institute for Molecular and Cellular Plant Biology. Polytechnic University of Valencia, Valencia,Spain. Advisor: Dr. Pablo Vera 1994-1996 Internship in Molecular Biology Center for Genetic Engineering and Biotechnology, Havana, Cuba. 1991-1996 Bachelor of Science: Biochemistry University of Havana, Cuba.

SKILLS

Molecular Biology: RNA and DNA extraction. Southern and Northern blot. Polymerase Chain Reaction. Nested Polymerase Chain Reaction. Reverse Transcription Polymerase Chain reaction (RT-PCR). Quantitative PCR using SYBR- Green. DNA sequencing analysis. Construction of genomic and cDNA libraries. Mapping and cloning of prokaryotic and eukaryotic genes. In situ hybridization. DNA sequencing analysis Genome editing and engineering: Genome editing by Transcription Activator like Nucleases (TALENs). Site-directed mutagenesis. PCR- based tail biopsy genotyping. Transposon mediated transgenesis in zebrafish and

83 Agrobacterium-mediated plant transformation. Expression of genes in bacteria, plants and zebrafish. Molecular characterization of transgenic plants and zebrafish. Cell Biology and Biochemistry: Protein engineering. Purification, biochemistry and immunological characterization of natural and recombinant proteins. In vivo and in vitro evaluation of fungi resistance in plants. Immuno- cytochemistry. Perform Immune and Enzymatic Tests. cytotoxicity and proliferation assays. Other skills: Bioinformatics. Basic experience with computers, MS Office. Adobe Photoshop. Fluent in both Spanish and English. Experience in experimental designs, data analysis and graphing of results. Good documentation practices for recording of experiments and data. Ability to present scientific data and results Critical thinking and excellent writing and verbal communication skills. Organized and detail oriented scientist. Teaching: Biological Science Laboratory I, General Genetics, Animal Development.

POST-GRADUATED COURSEWORK

2011 Bioregulation, FSU. 2011 Cell and Molecular Mechanisms of Diseases, FSU. 2010 Advanced Cell Biology, FSU. 2010 Advanced Molecular Biology, FSU. 2010 Cell and Molecular Neuroscience, FSU. 2010 Animal Development, FSU. 2010 Responsible Conduct of Research, FSU. 2004 Plant Physiology. University of Havana, Cuba. 2003 Biochemistry and Molecular Biology of Plants I, Research Institute of Tropical Fruit, Havana, Cuba. 2001 Bioinformatics, Genetic Engineering and Biotechnology Center, Havana Cuba. 2001 Plant Biotechnology, University of Havana, Cuba. 1996 Biostatistics, University of Havana, Cuba.

HONORS AND AWARDS

2013-2014 Dissertation Research Grant Award, FSU, USA 2013-2014 Leslie N. Wilson-Delores Auzenne Assistantship, FSU, USA 2013 Grant Wood Balkema Memorial Travel Grant. (ARVO), USA 2001 Cuban Academic of Science National Award: Molecular cloning and expression in Escherichia coli and Pichia pastoris of an exolevanase gene from Gluconoacteobacter diazotrophicus. Cuba.

1998-1999 Spain’s Ministry of Foreign Affairs and Cooperation and Spanish Agency for International Development Cooperation, MAECD-AECID Scholarship. Spain. 1997 Cuban Academic of Science National Award: Transgenic tobacco plants (Nicotiana Tabacum) with enhanced resistant toward Blue mold (Peronospora tabacica) in field conditions. Cuba

EMPLOYMENT HISTORY

Department of Biological Science, FSU Tallahassee, Florida

2010-Present (PhD. student) Genetic and biochemical mechanisms regulating development and degenerative diseases of the visual system.

2009-2010 (Laboratory Assistant) Animal husbandry, genotype. Basic and advanced Molecular Biology.

Center for Genetic Engineering and Biotechnology Havana, Cuba

1996-2004 (Research Associate) Sucrose metabolism in endophytic bacterium Gluconacetobacter diazotrophicus.

1996-2004 (Research Associate) Fungal disease resistances in transgenic plants.

SCIENTIFIC PUBLICATIONS

1. Genetic Dissection of Dual Roles for the Transcription Factor six7 in photoreceptor development and Patterning in Zebrafish. (2016) M. Sotolongo-Lopez, K. Alvarez, C. Saade, D. Vera, J. Fadool. (accepted PLos Genetics)

2. SodERF3, a Novel Sugarcane Ethylene Responsive Factor (ERF), Enhances Salt and Drought Tolerance when Overexpressed in Tobacco Plants. (2008) L. E. Trujillo, M. Sotolongo, C. Menendez, M. E. Ochogavia, Y. Coll, I. Hernandez, O. Borras-Hidalgo, B. P. H. J. Thomma, P. Vera, and L. Hernandez. (Plant Cell Physiol., 49(4): 512 – 525)

3. Identification of a type II protein secretory pathway required for levansucrase secretion by Gluconacetobacter diazotrophicus (2004) J.G. Arrieta, M. Sotolongo, C. Menéndez, D. Alfonso, L.E. Trujillo, M. Soto, R. Ramírez and L. Hernández (J. Bacteriology, 186:5031- 5039)

4. Constitutive expression of enzymatically active Gluconacetobacter diazotrophicus levansucrase in the methylothrophic yeast Pichia pastoris (2002) L.E. Trujillo, A. Banguela, J. País, Y. Támbara, J.G. Arrieta, M. Sotolongo and L. Hernández. (Afinidad,59:365-370)

5. Molecular cloning and expression in Escherichia coli of an exo-levanase gene from the endophytic bacterium Gluconacetobacter diazotrophicus SRT4 (2002) C. Menéndez, L. Hernández, G. Selman M.F. Mendoza, P. Hevia, M. Sotolongo and J. Arrieta (Current Microbiology, 45:5-12)

6. Structural levansucrase gene (lsdA) constitutes a functional locus conserved in the species Gluconacetobacter diazotrophicus (2000) L. Hernández, M. Sotolongo, Y. Rosabal, C. Menéndez, R. Ramírez, J. Caballero-Mellado and J. Arrieta (Archives of Microbiology, 174: 120-124)

PRESENTATIONS

2015, Association for Research in Vision and Ophthalmology, Annual Meeting, Denver, Colorado. TALEN-mediated mutagenesis establishes a role for six7 in photoreceptor patterning in zebrafish. Sotolongo-Lopez M., Alvarez-Delfin K. and and Fadool JM (Paper talk)

2014, Association for Research in Vision and Ophthalmology, Annual Meeting, Orlando. FL. Regulation of Spatial Pattering of Rods and Cones in the Larval Zebrafish Retina. James M. Fadool, Karen Alvarez-Delfin, Orleiquis Guerra, Mailin Sotolongo-Lopez (Poster) 2013, Association for Research in Vision and Ophthalmology, Annual Meeting, Seattle. The transcription factor six7 regulates rod number during zebrafish retinal development. Sotolongo- Lopez M., Alvarez-Delfin K. and and Fadool JM (Poster)

2010, Association for Research in Vision and Ophthalmology, Annual Meeting, Fort Lauderdale. “Lots-Of-Rods-Junior (lrj) is a Second Locus Regulating Rod Photoreceptor Number in Zebrafish”. Alvarez-Delfin K., Willer JR, Sotolongo-Lopez M and Fadool JM. (Poster)

2004, 5th International Scientific Seminar of Plant Health, Havana, Cuba. Isolation and Molecular Characterization of an Ethylene-responsive Element Binding Factor Gene in Sugarcane. (Poster).

2004, 5th Latin American and Caribbean Meeting on Agricultural Biotechnology, (REDBIO 2004), Boca Chica, Dominican Republic. Isolation of sugarcane genes induced for ethylene treatment by differential screening. (Poster).

2000, 4th Internacional Fructan Symposium (Fructan 2000), Arolla, Suiza. A type II protein secretory pathway required for levansucrase secretion by Gluconacetobacter diazotrophicus. (Poster).

1999, Center for International Meetings on Biology: Dynamics of the plant extracellular matrix Madrid, Spain. Functional cloning of proteic substrate of P69A, a subtilisin-like protease from tomato plants. (Poster).

1999, International Congress Biotecnologia Habana’ 99. Constitutive co-expression of antifungal proteins in transgenic tobacco plants to improve Blue Mold (Peronospora tabacina Adam) resistance in field conditions. (Poster).

1998, 16th North American Conference on Symbiotic Nitrogen Fixation. Cancún, México. Levansucrase is the responsible enzyme in sucrose metabolism in nitrogen fixation bacteria Acetobacter diazotrophicus. (Poster).

1998, (REDBIO'98), Habana, Cuba. Field resistance to Blue Mould (Peronospora tabacina) by constituent co expression of two antifungal proteins in transgenic tobacco plants. (Poster)