Novel Β-Crystallin Gene Mutations in Chinese Families with Nuclear

OPHTHALMIC MOLECULAR GENETICS

SECTION EDITOR: JANEY L. WIGGS, MD, PhD Novel ␤-Crystallin Gene Mutations in Chinese Families With Nuclear Cataracts

Kai Jie Wang, MD; Bin Bin Wang, PhD; Fengju Zhang, MD; Yanyan Zhao, MD; Xu Ma, PhD; Si Quan Zhu, MD

Objective: To investigate the molecular genetic back- not observed in unaffected family members or the 150 ground in families with nuclear congenital cataract. healthy unrelated individuals.

Methods: Family history and clinical data were re- Conclusions: The CRYBB2 gene was shown to be an- corded. Ten candidate genes were screened for caus- other causative gene associated with congenital cataract ative mutations. Direct sequencing was performed to ana- and microcornea. Three novel mutations in ␤-crystallin lyze the cosegregation of the genotype with the disease genes (CRYB) were detected in Chinese families with phenotype. Effects of amino acid changes on the struc- nuclear autosomal dominant congenital cataracts, which ture and function of protein were predicted by bioinfor- underscores the genetic heterogeneity of this condition. matics analysis. Clinical Relevance: Studying the genetics of nuclear Results: Analyses of 20 Chinese families with heredi- cataracts is helpful for better understanding the patho- tary nuclear congenital cataract revealed 3 novel muta- physiologic mechanisms that underlie this phenotype and tions. Two of these mutations (V146M and I21N) af- for better disease management. This study helps expand fected ␤B2-crystallin (CRYBB2). One mutation (R233H) the genotype of nuclear cataract and microcornea. was detected in ␤B1-crystallin (CRYBB1). These mutations cosegregated with all affected individuals and were Arch Ophthalmol. 2011;129(3):337-343

ONGENITAL CATARACT IS A hereditary congenital cataract.4 Despite at- leading cause of visual dis- tempts to categorize hereditary cataracts ability in children. Glob- clinically, correlation of phenotypes with ally, its prevalence is 0.6 to genetic locus and specific mutation is lim- 6.0 in 10 000 live births, ited. The clinical and genetic heteroge- causing approximately 10% of childhood neity of congenital cataracts is well substan- C 1 blindness worldwide. Inherited isolated tiated. Conversely, congenital cataracts with (nonsyndromic) cataracts represent one- similar or identical clinical phenotypes can third of cases, and recently many causative result from mutations in completely differ- genetic mutations have been identified. To ent genes. Several genes have been associ- date, more than 30 loci and 18 genes on dif- ated with nuclear cataract to date (CRYAA, ferent chromosomes have been associated CRYBB1, CRYBB2, CRYBA3, CRYGC, with autosomal dominant congenital cata- CRYGD, GJA8, and GJA3).3 Therefore, it is Author Affiliations: Beijing 2 Tongren Eye Center, Beijing ract (ADCC). Of these mutations, approxi- appropriate to consider these genes as the Tongren Hospital, Capital mately half involve crystallins, one-quarter top list of functional candidates in heredi- Medical University, Beijing involve connexins, and the remaining one- tary congenital cataracts. In this study, we Ophthalmology & Visual quarter involve the other genes.3 screened 20 Chinese families with nuclear Sciences Key Lab (Drs K. J. Phenotypes are described mainly based ADCC for mutations in 8 crystallin and 2 Wang, Zhang, Zhao, and Zhu); on the physical appearance and site of oc- connexin genes. National Research Institute for currence of the opacity. Phenotypic vari- Family Planning, Peking Union abilities among and within families have METHODS Medical College (Drs B. B. been documented, including nuclear, an- Wang and Ma); and World Health Organization terior polar, posterior polar, coralliform, ce- FAMILY RECRUITMENT Collaborating Center for rulean (blue-dot), pulverulent, cortical, zo- 1 Research in Human nular, and sutural cataracts. Of the already This study adhered to the tenets of the Decla- Reproduction (Dr Ma), characterized phenotypes, nuclear congen- ration of Helsinki and was approved by the eth- Beijing, China. ital cataracts are the most common type of ics committee for medical research at Capital

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 337

(Gene Amplicon Forward Primers (5؅→3؅) Reverse Primers (5؅→3؅ CRYAA 1 TCCAGAGAAATCCCTTAATG GACGGAGCAAGACCAGAGT 2 GGCCCACCAGTAGCATTCA TCGGGAATGGTGACCTCTG 3 GCAGCTTCTCTGGCATG GGGAAGCAAAGGAAGACAG CRYAB 1 AACCCCTGACATCACCATT AAGGACTCTCCCGTCCTAG 2 CCATCCCATTCCCTTACCT GCCTCCAAAGCTGATAGCA 3 TCTCTCTGCCTCTTTCCTC CCTTGGAGCCCTCTAAATC CRYBA1 1 GGCAGAGGGAGAGCAGAGT CACTAGGCAGGAGAACTGG 2 AGTGAGCAGCAGAGCCAGA GGTCAGTCACTGCCTTATG 3 AAGCACAGAGTCAGACTGAAG CCCCTGTCTGAAGGGACCT 4 GTACAGCTCTACTGGGATT ACTGATGATAAATAGCATGAAC 5 GAATGATAGCCATAGCACTA CGCCCCACTTTGTATCTTCAT 6 GGCTCAGGTTTTGGGGTATTA GCAAGGTCTCATGCTTGAG CRYBB1 1 TGGAAGGTGAAGCTGCTGTG TGGCCCTGCTCTCTGACTC 2 CCGTTTCAGAAGGAGATAGAGAG AGGATAAGAGTCTGGGGAGGTGG 3 CCTGCACTGCTGGCTTTTATTTA TCTCCAGAGCCCAGAACCATG 4 CAGCCCCCTTTGGACTTTC CCTCCCTACCCACCATCATCTC 5 TAGACAGCAGTGGTCCCTGGAGA AGCACTGGGAGACTGTGGAAGG 6 CCTAGAAAAGGAAACCGAGGCC AGCGAGGAAGTCACATCCCAGTA CRYBB2 1 GTTTGGGGCCAGAGGGGAGTGG TGGGCTGGGGAGGGACTTTCAGT 2 CCTTCAGCATCCTTTGGGTTCTC GCAGTTCTAAAAGCTTCATCAGT 3 GTAGCCAGGATTCTGCCATAGGA GTGCCCTCTGGAGCATTTCATAG 4 GGCCCCCTCACCCATACTC CTTCCCTCCTGCCTCAACCTAAT 5 CTTACCCTTGGGAAGTGGCAATG TCAAAGACCCACAGCAGACAAGT CRYGC 1 GCAGCTACGAAACCACCACT GCAAACCTCCCTCCCTGTAA 2 TGGTTGGACAAATTCTGGAA CCCACCCCATTCACTTCTT CRYGD 1 CAACAAGCCCCGTGGTCTA GGGTCCTGACTTGAGGATG 2 GCTTTTCTTCTCTTTTTATTTCTG AAGAAAGACACAAGCAAATCAG CRYGS 1 GAAACCATCAATAGCGTCTAAATG TGAAAAGCGGGTAGGCTAAA 2 AATTAAGCCACCCAGCTCCT GGGAGTACACAGTCCCCAGA 3 GACCTGCTGGTGATTTCCAT CACTGTGGCGAGCACTGTAT GJA3 1 CGGTGTTCATGAGCATTTT CTCTTCAGCTGCTCCTCCT 2 GAGGAGGAGCAGCTGAAGA AGCGGTGTGCGCATAGTA 3 TCGGGTTCCCACCCTACTA TATCTGCTGGTGGGAAGTG GJA8 1 CCGCGTTAGCAAAAACAGA CCTCCATGCGGACGTAG 2 GCAGATCATCTTCGTCTCC GGCCACAGACAACATGAAC 3 CCACGGAGAAAACCATCTT GAGCGTAGGAAGGCAGTGT 4 TCGAGGAGAAGATCAGCAC GGCTGCTGGCTTTGCTTA

Abbreviation: PCR, polymerase chain reaction.

Medical University. Twenty families affected by nuclear ADCC Bank NM_020989), CRYGD (GenBank NM_006891), CRYGS were recruited at the Beijing Tongren Eye Center, Beijing Ton- (GenBank NM_017541), GJA3 (GenBank NM_021954), and gren Hospital (Capital Medical University). Affected and un- GJA8 (GenBank NM_005267). Polymerase chain reaction was affected individuals underwent detailed ophthalmic examina- performed on genomic DNA samples using the primer pairs tions, including visual acuity and corrected visual acuity in listed in the Table. Polymerase chain reaction products were addition to slitlamp and fundus examinations, corneal diam- sequenced using an automated sequencer (model ABI 3730, Au- eter measurement, ultrasonography, and intraocular pressure tomated Sequencer; PE Biosystems, Foster City, California). Di- measurement using applanation tonometry. There was no evi- rect sequencing was also performed to analyze the cosegrega- dence of systemic abnormalities associated with congenital cata- tion of the genotype with the disease phenotype. ract in the probands. Control subjects who matched the ethnic background of the probands were also recruited. They were BIOINFORMATICS ANALYSIS given the same complete ophthalmologic examinations as the study individuals of the families with ADCC cataract and did Computational methods were used to determine whether a spe- not have eye diseases except mild myopia and age-related cata- cific amino acid substitution in a protein sequence might lead racts. Blood samples were obtained from the probands and their to altered protein function and possibly contribute to the dis- available family members after providing informed consent. ease. The possible functional impact of an amino acid change was predicted by using the PolyPhen (Polymorphism Pheno- MUTATION ANALYSIS typing) program (http://genetics.bwh.harvard.edu/pph/). The prediction is based on the position-specific independent counts Polymerase chain reaction was used to amplify all the exons score derived from multiple sequence alignments of observa- and intron/exon boundaries of the candidate genes: CRYAA tions. PolyPhen scores greater than 2.0 indicate that the poly- (GenBank NM_000394), CRYAB (GenBank NM_001885), morphism is probably damaging to protein function, scores of CRYBA1 (GenBank NM_005208), CRYBB1 (GenBank 1.5 to 2.0 are possibly damaging, and scores less than 1.5 are NM_001887), CRYBB2 (GenBank NM_000496), CRYGC (Gen- likely benign. The secondary structure of mutant and wild-

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 338

©2011 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 type amino acid sequences were analyzed using Antheprot 2000 version 6.0 software (IBCP, Lyon, France). A Male Female Affected RESULTS Unaffected II-2 II-1 Proband Twenty families with nuclear ADCC were identified. Cata- ract phenotypes showed some variability among families, but all involved the embryonal or fetal nucleus to a III-2 III-1

variable extent. Nystagmus was present in some fami- B lies and absent in others, depending primarily on the de- T G T G T G G G T G C G G A G gree of visual impairment during the first months of life. Three mutations were observed in 3 families (15%): 2 resided in CRYBB2 and1inCRYBB1.

FAMILY A

Four members (2 affected and 2 unaffected) partici- Affected (F)

pated in the study (Figure 1A). The proband was a T G T G T G G G T G C G G A G 3-year-old boy who had had cataract extraction performed at age 6 months. He was recorded as having nuclear lens opacification and microcornea. The corneal diameter was 9 mm in both eyes, and the axial length was 23.82 mm in the right eye and 23.74 mm in the left eye. The 2 affected individuals had similar

poor visual acuity measured using the decimal system Unaffected (F) of 0.02 to 0.05, and they also had nystagmus and amblyopia. There was no evidence of other ocular or C systemic abnormalities. Canis lupus familiaris F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R Ͼ Macaca mulatta F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R Mutation analysis revealed a c.436G A transversion Homo sapiens F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R in exon 5 of CRYBB2 that led to the replacement of va- Oryctolagus cuniculus F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R line at position 146 by methionine (V146M) (Figure 1B). Rattus norvegicus F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R Mus musculus F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R The mutation cosegregated with the disease in the fam- Gallus gallus F H A H G Y Q E K V S S V R V Q S G T W V G Y Q Y P G Y R ily (II-1 and III-1) and was not observed in unaffected Xenopus laevis F H A H G Y Q E K V S S A R V Q S G T W V G Y Q Y P G Y R family members or in control individuals of Chinese de- Danio rerio F H A H G Y H E K V S S V R V Q S G T W V G Y Q Y P G Y R scent. Consensus FHAHGYQEKVSSVRVQSGTWVGYQYRP G Y The Val at position 146 of human ␤B2-crystallin was 100% located in a phylogenetically conserved region by mul- Conservation tiple sequence alignment (Figure 1C). The PolyPhen score 0% from PolyPhen analysis was 2.046, which meant that this D

V146M CRYBB2 was predicted to be “probably damag- Wild type ing.” The secondary structure prediction showed that the mutation V146M led to the replacement of an original ␤-strand by an ␣-helix, a significant difference in cod- ing position 146 of the secondary structure of ␤B2- crystallin protein (Figure 1D). 100

FAMILY B Mutant type

Eight members (3 affected and 5 unaffected) partici- pated in the study (Figure 2A). The proband was a 2-year-old boy with dense white opacities distributed throughout the embryonic and fetal nuclei (Figure 2B). His mother (II-3) had had cataract extraction per- 100 formed at age 5 years and was recorded as having nuclear cataract. There was no evidence of other ocular or sys- Figure 1. Mutation analysis of CRYBB2 in family A. A, Pedigree of family A. B, DNA sequence chromatograms show that a single transition is observed temic abnormalities. at position 436 (GϾA) as a G/A double peak (arrow). F indicates forward The mutation in this family was identified as a c.62TϾA strand. C, A multiple sequence alignment of the amino acid sequence of transition in CRYBB2 that led to a missense mutation ␤B2-crystallin with different species. The R146 residue is indicated by an where a highly conserved isoleucine was replaced by as- arrow. D, The secondary structure prediction shows that the mutation leads to the replacement of an original ␤-strand by an ␣-helix. The target paragine (I21N) (Figure 2C). The mutation cosegre- sequences are indicated by red circles. Blue represents helix; yellow, strand; gated with the disease in the family and was not ob- and green, turn.

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 339

III:1 III:2

C 80 80 A T C A T C A T C T T T G A G A T C A T C A T C T T T G A G

Affected (F) Unaffected (F)

20 D E

Canis lupus familiaris M A S D H Q T Q A G K P − Q P L S P − − K I I I F E Q E N F Q G H S H E L Macaca mulatta M A S D H Q T Q A G K P − Q S L S P − − K I I I F E Q E N F Q G H S H E L Wild type Homo sapiens M A S D H Q T Q A G K P − Q S L S P − − K I I I F E Q E N F Q G H S H E L Oryctolagus cuniculus M A S D H Q T Q A G K P − Q P L S P − − K I I I F E Q E N F Q G H S H E L Rattus norvegicus M A S D H Q T Q A G K P − Q P L S P − − K I I I F E Q E N F Q G H S H E L Mus musculus M A S D H Q T Q A G K P − Q P L S P − − K I I I F E Q E N F Q G H S H E L Gallus gallus M A S E H Q M P A S K Q − Q P A S S − − K I A I F E Q E N F Q G R C H E L Xenopus laevis M A S D H Q T S G T K Q − Q Q − N A − − K L V I Y E Q E N F Q G R S H E L Danio rerio M A T D H Q N P A T K Q K Q P V A S A F K L V I Y E Q E N F Q G R C H E L Consensus MASDHQTQAGKP−QPLNP−−K I I IFNE Q E FQGHS H E L Mutant type 100%

Conservation 0%

Figure 2. Mutation analysis of CRYBB2 in family B. A, Pedigree of family B. B, Slitlamp photograph of individual III-2 shows the nuclear autosomal dominant congential cataract. C, DNA sequence chromatograms show a heterozygous TϾA transversion at position 62 that replaces Ile by Asn (arrow). F indicates forward strand. D, A multiple sequence alignment of the amino acid sequence of ␤B2-crystallin with different species. The I21 residue is indicated by an arrow. E, The secondary structure prediction shows that the mutation leads to the replacement of an original ␤-strand by an ␣-helix. The target sequences are indicated by red circles. Violet represents helix; orange, strand; and green, turn.

served in unaffected family members or in controls of vidual II-1 displayed a nuclear cataract phenotype Chinese descent. (Figure 3B). He had nystagmus and a poor visual acuity The Ile at position 21 of human ␤B2-crystallin was lo- measured using the decimal system of 0.1. There were cated in a phylogenetically conserved region by mul- no other ocular or systemic abnormalities. tiple sequence alignment (Figure 2D). The PolyPhen score This family was identified as having a single base al- from PolyPhen analysis was 1.155, which meant that this teration c.698GϾAinexon6ofCRYBB1, which resulted I21N CRYBB2 was predicted to be “probably damag- in a substitution of Arg to His at codon 233 (R233H) ing.” The secondary structure prediction showed that the (Figure 3C). The mutation cosegregated with the disease mutation led to the replacement of an original ␤-strand in the family (II-1 and III-1) and was not observed in un- by an ␣-helix (Figure 2E). affected family members or in controls of Chinese descent. The Arg at position 233 of human ␤B1-crystallin was FAMILY C located in a phylogenetically conserved region by multiple sequence alignment (Figure 3D). The R233H mu- Eight members (2 affected and 6 unaffected) partici- tation caused no evident secondary structural change to pated in the study (Figure 3A). The proband was 2 years the protein by Antheprot 2000 prediction (data not old and had had cataract surgery performed at age 3 shown). However, The PolyPhen score from PolyPhen months. Hospital records confirmed that the cataract was analysis was 2.002, which meant that this R233H CRYBB1 present at birth. On clinical examination, affected indi- was predicted to be “probably damaging.”

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 340

©2011 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 17 ADDITIONAL FAMILIES A Male In 17 additional families (85%), no mutations in the 8 I-1 I-2 Female Affected crystallin and 2 connexin genes were observed. The phe- Unaffected notypes in all affected members were nuclear opacities Proband to a variable extent. Twelve families also revealed other II-1 II-2 II-3 II-4 associated ocular disorders, such as nystagmus, strabis- mus, and microcornea. Because no mutation was cosegregated with these 10 genes, these families need to be fur- III-1 III-2 ther investigated for the causative mutations. B

COMMENT

In this study, we identified the causative mutations in 3 families with nuclear ADCC. Among them, 1 family showed a nuclear cataract and microcornea phenotype. These mutations are observed only in affected individuals and not in unaffected family members or the 150 controls. We, therefore, assume that these variations are the disease-causing mutations rather than polymorphisms. To understand how the single amino acid exchange might affect the protein structure and function, several com- C putational methods are undertaken. C G C C T G C A T G A C A A G ␤-Crystallins make up approximately 35% of total crystallin protein and are recognized as a member of the ␤/␥- crystallin superfamily, which contains 4 Greek key mo- tifs encoded by separate exons. The ␤-crystallin family contains 5 protein chains (3 CRYBB and 4 CRYBA). CRYBB1, BB2, BB3, and BA4 all map to chromosome ␤ 22q11.2-13.1 with a similar gene structure. Different - Affected (F) crystallin proteins are found in prenatal and postnatal de- C G C C T G C G T G A C A A G veloping lens, and their interactions with each other and with other lens proteins are postulated to be critical for lens transparency.5 The CRYBB2 gene consists of 6 exons: the first exon is not translated, the second exon encodes the NH2- terminal extension, and the subsequent 4 exons are responsible for 1 Greek key motif each.6 Two CRYBB2 mu- Unaffected (F) tations were identified in the present study. The mutation D V146M in family A is located in the highly conserved va- ␤ Rattus norvegicus A F Q P Q M Q A V R R L R D R Q W H Q E G C F line residues in a major functional domain of the B2- Mus musculus A F Q P Q M Q A V R R L R D R Q W H Q E G C F crystallin, the third Greek key motif of the protein and a Bos taurus A F Q P Q M Q A V R R L R D R Q W H R E G C F region crucial to the correct formation of the tertiary struc- Homo sapiens A F Q P Q M Q S L R R L R D K Q W H L E G S F Xenopus (Silurana) tropicalis A Y Q P Q I Q S I R R I R D K Q W H Q K G C F ture. The secondary structure prediction shows that the Gallus gallus A F Q P Q I Q S I R R I R D M Q W D Q K G T F mutation leads to the replacement of an original ␤- Danio rerio A F Q P Q I Q S V R R V R D M Q F H Q R G C F ␣ strand by an -helix, which may affect the Greek key mo- Consensus AFQPQMQSVRRLRDRQWHQEGCF tifs and change the folding properties of ␤B2-crystallin. 100% Loss of valine would lead to a change in intrapeptide or Conservation interpeptide bonding and folding. The phenotype of cata- 0% ract is presumed to be caused by the formation of a heavy 6 molecular weight fraction or a decrease in the stability Figure 3. Mutation analysis of CRYBB1 in family C. A, Pedigree of family C. of ␤B2-crystallin. The associated microcornea might be B, Slitlamp photograph of individual II-1 shows the nuclear cataract. C, DNA sequence chromatograms show a single transition is observed at position due to the inductive effects from the abnormally formed 698 (GϾA) as a G/A double peak (arrow). F indicates forward strand. D, A lens on the cornea during embryogenesis or the change multiple sequence alignment of the amino acid sequence of ␤B1-crystallin in its steric coordinations with other proteins in lens. with different species. The R233 residue is indicated by an arrow. The observed p.I21N substitution is located in the first Greek key motif of the ␤B2-crystallin protein and re- analysis, which highlights the functional importance of places the highly conserved nonpolar isoleucine with po- this region of the protein. The secondary structure of the lar asparagine at position 21, in association with the mutant protein is predicted, and the ␤-strand is re- nuclear cataract in the present study. The I21N muta- placed by an ␣-helix, which may be the reason for the tion is predicted to be possibly damaging by PolyPhen dysfunction of the mutant protein. We, thus, hypoth-

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 341

©2011 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 esize that the novel mutation I21N changes the protein ported herein excludes possible mutations in those genes, structure around the mutant site that could alter the lo- suggesting that other genes or loci could be involved with cal binding ability, which would disrupt dimerization of nuclear congenital cataract. the ␤B2-crystallin protein or impair binding with other lens-soluble proteins. The phenotype observed shows Submitted for Publication: March 17, 2010; final revi- marked nuclear cataract comparable with the mutation ␤ sion received June 29, 2010; accepted July 2, 2010. in the first Greek key motif of B2-crystallin, which is Correspondence: Si Quan Zhu, MD, Beijing Tongren Eye linked with coronary cataract. The result highlights the 7 Center, Beijing Tongren Hospital, Capital Medical Uni- phenotypic heterogeneity of congenital cataracts. versity, Beijing Ophthalmology & Visual Sciences Key There are other mutations in CRYBB2 reported to cause Lab, 1 Dong Jiao Min Xiang, Beijing 100730, China a cataract phenotype in families of different ethnic origins 8 9 10 11 12-17 ([email protected]). (W151C, D128V, V187M, S31W, and Q155X ). Author Contributions: Drs K. J. Wang and B. B. Wang However, all these families, including family B in the pre- contributed equally to the article; Drs Ma and Zhu consent study, are described as having no microcornea. The tributed equally to the project and may be considered co- mutation V146M reported herein is the first CRYBB2 mu- corresponding authors. Dr K. J. Wang had full access to tation identified in association with cataract and micro- all the data in the study and takes responsibility for the cornea, which highlights the functional importance of this integrity of the data and the accuracy of the data analysis. region of the protein. It is probable that some lens changes Financial Disclosure: None reported. affect cornea development and others do not. Further Funding/Support: This study was supported by grants physicochemical experiments are needed to demon- 2008BAH24B05 from the National Science & Technol- strate the function of CRYBB2. ␤ ogy Pillar Program of China (Dr Ma), 2009-3-37 from B1-crystallin is another major subunit of the the high-level technical personnel training project of ␤-crystallins and composes 9% of the total soluble 18 Beijing Municipal health system (Dr Zhu), and crystallins in the human lens. A novel mutation 2006DKA21300 from the National Infrastructure Pro- R233H of CRYBB1 was identified in the present study. gram of Chinese Genetic Resources (Dr Ma). The proband shows a nuclear cataract phenotype with Additional Contributions: We are grateful to the pa- no ocular or systemic abnormalities. The mutation is tients and their families for their enthusiastic participa- located in exon 6, which encodes the Greek key IV tion in this study. and the COOH-terminal domain, and the arginine at position 233 is highly conserved among ␤-crystallin. The PolyPhen analysis considers the mutation to be REFERENCES possibly damaging to the protein. All the findings indi- 1. Reddy MA, Francis PJ, Berry V, Bhattacharya SS, Moore AT. Molecular genetic cate that Arg233 is an important residue for the func- basis of inherited cataract and associated phenotypes. Surv Ophthalmol. 2004; tion of ␤B1-crystallin protein. Although major struc- 49(3):300-315. tural changes are not found by Antheprot 2000 2. Wang K, Wang B, Wang J, et al. A novel GJA8 mutation (p.I31T) causing auto- analysis, previous functional studies19,20 have shown somal dominant congenital cataract in a Chinese family. Mol Vis. 2009;15: that the same amino acid change in different genes 2813-2820. 3. Hejtmancik JF. Congenital cataracts and their molecular genetics. Semin Cell Dev causes reduced solubility of the protein, which may Biol. 2008;19(2):134-149. contribute to cataract formation. The strongly posi- 4. Stambolian D, Ai Y, Sidjanin D, et al. Cloning of the galactokinase cDNA and iden- tively charged guanidino group of arginine is replaced tification of mutations in two families with cataracts. Nat Genet. 1995;10(3): by the alkalescent positively charged imidazole func- 307-312. 5. Bax B, Lapatto R, Nalini V, et al. X-ray analysis of ␤ B2-crystallin and evolution tional group of a histidine, which may result in insta- of oligomeric lens proteins. Nature. 1990;347(6295):776-780. bility of the molecule. Therefore, a strong positively 6. Graw J, Löster J, Soewarto D, et al. Aey2, a new mutation in the ␤B2-crystallin– charged residue may be important for the structural encoding gene of the mouse. Invest Ophthalmol Vis Sci. 2001;42(7):1574- and functional integrity of ␤B1-crystallin, but its effect 1580. on the ␤B1-crystallin structure should be further 7. Hansen L, Yao W, Eiberg H, et al. Genetic heterogeneity in microcornea- cataract: five novel mutations in CRYAA, CRYGD, and GJA8. Invest Ophthalmol investigated. Vis Sci. 2007;48(9):3937-3944. To our knowledge, there are only 4 previous studies 8. Santhiya ST, Manisastry SM, Rawlley D, et al. Mutation analysis of congenital of CRYBB1 mutations in patients with ADCC.21-24 All the cataracts in Indian families: identification of SNPS and a new causative allele in sequence changes reported in these families are located CRYBB2 gene. Invest Ophthalmol Vis Sci. 2004;45(10):3599-3607. 9. Pauli S, Söker T, Klopp N, Illig T, Engel W, Graw J. Mutation analysis in a Ger- in exon 6, encoding the Greek key IV and the COOH- man family identified a new cataract-causing allele in the CRYBB2 gene. Mol Vis. terminal extension. All these changes suggest that dis- 2007;13:962-967. ruption of the fourth Greek key motif in ␤B1-crystallin 10. Mothobi ME, Guo S, Liu YY, et al. Mutation analysis of congenital cataract in a might result in an abnormal COOH-terminus and pro- Basotho family identified a new missense allele in CRYBB2. Mol Vis. 2009; duction of a mutant protein, which underscores the im- 15:1470-1475. 11. Lou D, Tong JP, Zhang LY, Chiang SW, Lam DS, Pang CP. A novel mutation in portance of the fourth Greek key motif. CRYBB2 responsible for inherited coronary cataract. Eye (Lond). 2009;23(5): In conclusion, we reported 3 novel mutations in CRYB 1213-1220. genes associated with nuclear ADCC in Chinese fami- 12. Litt M, Carrero-Valenzuela R, LaMorticella DM, et al. Autosomal dominant ceru- lies, which strongly underscores the importance of the lean cataract is associated with a chain termination mutation in the human ␤- ␤ crystallin gene CRYBB2. Hum Mol Genet. 1997;6(5):665-668. -crystallins for lens development and contributes to the 13. Gill D, Klose R, Munier FL, et al. Genetic heterogeneity of the Coppock-like cata- evaluation of the phenotype-genotype relationship. In ad- ract: a mutation in CRYBB2 on chromosome 22q11.2. Invest Ophthalmol Vis Sci. dition, the analysis of the remaining 17 families re- 2000;41(1):159-165.

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 342

©2011 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 09/26/2021 14. Bateman JB, von-Bischhoffshaunsen FR, Richter L, Flodman P, Burch D, Spence 19. Pande A, Pande J, Asherie N, et al. Crystal cataracts: human genetic cataract caused MA. Gene conversion mutation in crystallin, beta-B2 (CRYBB2) in a Chilean fam- by protein crystallization. Proc Natl Acad Sci U S A. 2001;98(11):6116-6120. ily with autosomal dominant cataract. Ophthalmology. 2007;114(3):425-432. 20. Gu F, Luo WX, Li X, et al. A novel mutation in ␣A-crystallin (CRYAA) caused au- 15. Yao K, Tang X, Shentu X, Wang K, Rao H, Xia K. Progressive polymorphic con- tosomal dominant congenital cataract in a large Chinese family. Hum Mutat. 2008; genital cataract caused by a CRYBB2 mutation in a Chinese family. Mol Vis. 2005; 29(5):769. 11:758-763. 21. Willoughby CE, Shafiq A, Ferrini W, et al. CRYBB1 mutation associated with con- 16. Li FF, Zhu SQ, Wang SZ, et al. Nonsense mutation in the CRYBB2 gene causing genital cataract and microcornea. Mol Vis. 2005;11:587-593. autosomal dominant progressive polymorphic congenital coronary cataracts. Mol 22. Mackay DS, Boskovska OB, Knopf HL, Lampi KJ, Shiels A. A nonsense mutation Vis. 2008;14:750-755. in CRYBB1 associated with autosomal dominant cataract linked to human chro- 17. Wang L, Lin H, Gu J, Su H, Huang S, Qi Y. Autosomal-dominant cerulean cata- mosome 22q. Am J Hum Genet. 2002;71(5):1216-1221. ract in a Chinese family associated with gene conversion mutation in 23. Wang J, Ma X, Gu F, et al. A missense mutation S228P in the CRYBB1 gene causes beta-B2-crystallin. Ophthalmic Res. 2009;41(3):148-153. autosomal dominant congenital cataract. Chin Med J (Engl). 2007;120(9):820- 18. Lampi KJ, Ma Z, Shih M, et al. Sequence analysis of ␤A3, ␤B3, and ␤A4 crys- 824. tallins completes the identification of the major proteins in young human lens. 24. Yang J, Zhu Y, Gu F, et al. A novel nonsense mutation in CRYBB1 associated J Biol Chem. 1997;272(4):2268-2275. with autosomal dominant congenital cataract. Mol Vis. 2008;14:727-731.

Ophthalmic Images

Black Operculum in Full-Thickness Macular Hole Jay Kumar Chhablani, MS, DNB, FMRF Bill Aylward, MD, FRCS, FRCOphth Thomas Wolfensberger, MD, PD, MER

A 72-year-old woman had visual loss in the left eye for 3 months. Visual acuity was 20/200 and a full-thickness macular hole with a black operculum was noted. Red-free and fluorescein angiography images showed the change in position of the dark lesion corresponding to movements of the pigmented operculum embedded in the posterior hyaloid. Optical coherence tomography showed a full-thickness macular hole. The patient declined surgical treatment.

(REPRINTED) ARCH OPHTHALMOL / VOL 129 (NO. 3), MAR 2011 WWW.ARCHOPHTHALMOL.COM 343