Functional Characterization of Peroxisomal Import Receptors PEX5 and PEX19 in Trypanosoma Brucei

Functional characterization of peroxisomal import receptors PEX5 and PEX19 in Trypanosoma brucei

DISSERTATION

To obtain the degree Doctor Rerum Naturalium (Dr. rer. nat.) at the Faculty of Biology and Biotechnology International Graduate School of Biosciences Ruhr-University Bochum

From Institute of Biochemistry and Pathobiochemistry Department of System Biochemistry Faculty of Medicine

Submitted by M.Sc. Imtiaz Ali (Sialkot, Pakistan)

Bochum, January 2015

Supervisor: Prof. Dr. Ralf Erdmann

Co-supervisor: PD. Dr. Mathias Lübben Funktionelle Charakterisierung der peroxisomalen Matrix-Protein-Rezeptoren PEX5 und PEX19 in Trypanosoma brucei

DISSERTATION

zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie an der Internationalen Graduiertenschule Biowissenschaften der Ruhr-Universität Bochum

angefertigt im Institut für Biochemie und Pathobiochemie Abteilung Systembiochemie der Fakultät für Medizin

vorgelegt von M.Sc.

Imtiaz Ali (Sialkot, Pakistan)

Bochum, Januar 2015 Table of contents

Summary …………………………………………………………………………………i

Zusammenfassung ………………………………………………………………………iii

1.0 Introduction ……………………………………………………………….………….1

1.1 Trypanosoma brucei and sleeping sickness ………………………………………..1

1.2 Life Cycle of Trypanosoma brucei ………………………………………………...3

1.3 Metabolism of Bloodstream and Procyclic Form of parasites ………………..……4

1.4 Glycolysis and Glycosomes ………………………………………………………..4

1.5 Drug treatment ……………………………………………………………………..6

1.6 Peroxisomes ………………………………………………………………………..7

1.7 Peroxisomal matrix protein import ………………………………………………...8

1.7.1 PEX5 dependent matrix proteins import ………………………………………9

1.7.1.1 PTS1 signals and cargo recognition …………...………………………..10

1.7.1.2 Docking of receptor-cargo complex …………………………………….11

1.7.1.3 Dissociation and cargo translocation……………………….……………12

1.7.1.4 Receptor recycling ………………………………………………………13

1.7.2 PEX7 dependent import ……………………………………………………….14

1.8 Peroxisomal membrane proteins import …………………………………………..14

1.9 Peroxisomal membrane biogenesis factors ………………………………………..16

1.10 Aims of the study ………………………………………………………………...17

2.0 Materials and Methods ………………………………………………………………19

2.1 Chemicals ………………………………………………………………………….19

2.2 Enzymes …………………………………………………………………………...20 2.3 Molecular weight markers …………………………………………………………21

2.4 Antisera ……………………………………………………………………………21

2.5 Devices …………………………………………………………………………….22

2.6 Kits and Consumables ………………….………………………………………….23

2.7 Micro-organisms ……………………………………………….………………….24

2.7.1 Escherichia coli …………………………………………………..…………...24

2.7.2 Saccharomyces cerevisiae …………………………………………………….24

2.7.3 Trypanosoma brucei …………………………………………………………..25

2.8 Media ……………………………………………………………………………...25

2.8.1 Media for cultivation of Escherichia coli ………………………………...... 25

2.8.2 Media for cultivation of Saccharomyces cerevisiae ………………...………...25

2.8.3 Media for cultivation of Trypanosoma brucei.………………... …...…………27

2.9 Oligonucleotides ……………………………………………………….………….27

2.10 Vectors and Plasmids ………………………………………………...………….30

2.11 Molecular Biology Methods ………………………………………………….….33

2.11.1 Amplification of DNA fragments via PCR ………………………………….33

2.11.2 Agarose Gel Electrophoresis ………………………………………………...33

2.11.3 Excision and Purification of DNA from Agarose Gels ………….……...…...34

2.11.4 Restriction of Plasmid / DNA ……………………………….………...... ….34

2.11.5 Dephosphorylation of linker ………………………………………………...34

2.11.6 Ligation ……………………………………………………………………...35

2.11.7 Transformation of E. coli cells…………... ………………………………….35

2.11.8 Isolation of plasmid ………………………………………………………….35 2.11.9 Measurement of DNA concentration ………………………………….……..35

2.11.10 Sequencing of plasmids ……………………………………………….……35

2.11.11 Glycerin culture and storage of plasmids…………………………………...35

2.12 Biochemical Methods…………………………………………………………….36

2.12.1 Quantification of Proteins…………….……..………………………………..36

2.12.2 SDS- Polyacrylamide Gel Electrophoresis …………………………………..36

2.12.3 Coomassie Staining …………………………………………………………..36

2.12.4 Colloidal Coomassie Staining ………………………………………………..36

2.12.5 Silver Staining ………………………………………………………………..37

2.12.6 Immunoblotting ………………………………………………………………37

2.13 Methods to analyze protein-protein interactions…………………..……………...37

2.13.1 Yeast Two Hybrid Assay ……………………………………………………..37

2.13.2 Pull down Assay ……………………………………………………………...38

2.13.3 Size Exclusion Chromatography ……………………………………………..38

2.13.4 Multi Angle light Scattering ……………………………………………….....38

2.14 Expression and Purification of GST-tagged Proteins …………………….…….....39

2.15 Expression and Purification of His-tagged Proteins ……………………….…...…39

2.16 Expression and Purification of MBP-tagged Proteins …………………….…...….40

2.17 Thrombin Cleavage and Generation of Antisera ….…………………….....……...40

2.18 Cultivation of Saccharomyces cerevisiae ………………………………...….…....40

2.19 TCA Precipitation ………………………………………………………...….……41

2.20 Fluorescence microscopy ………………………………………………...….…….41

2.21 Growth Test ……………………………………………………………...….……..41 2.22 Trypanosoma brucei growth conditions ………………………………...………...41

2.23 Transfection of Trypanosoma brucei …………………………………...………...42

2.24 Trypanosoma brucei cell lysates preparation ……………..……….…...…....……42

2.25 Co-Immunoprecipitation ……………………………………………………….…42

2.26 Complex isolation …………………………………………………………….…..43

2.27 Mass Spectrometry ………………………………………………………….…….43

3.0 Results ……………………………………………………………………………….44

3.1 Functional characterization of Trypanosoma brucei PEX5 ……………………….44

3.1.1 Trypanosoma brucei PEX5 is a monomeric protein …………………………..44

3.1.2 Native conformation of GAPDH; a PTS1 containing glycosomal enzyme …...48

3.1.3 PEX5 makes a stable complex with GAPDH in vitro …………………………51

3.1.4 Molecular weight analysis of PEX5-GAPDH complex ……………………….52

3.1.5 Binding stoichiometry of PEX5-PEX14 complex …………………………….55

3.1.6 Cargo-loaded PEX5 docks on PEX14N ……………………………………….59

3.1.7 Domain mapping of PEX14 for interaction with its docking partner PEX13 ....62

3.1.8 PEX5 allosterically dissociates the docking complex …………………………67

3.1.9 PEX5 interacts with PEX13.1 in a PTS1 dependent manner …………….……68

3.1.10 Pre-loaded PEX5 does not bind PEX13.1 …………………………………....69

3.2 Functional characterization of Trypanosoma bruci PEX19 ……………………...71

3.2.1 Functional complementation of PEX19 in Saccharomyces cerevisiae ………..71

3.2.2 Molecular characterization of PEX19 …………………………………………73

3.2.3 Generation of anti-PEX19 antibodies ……………………………..…………...75

3.2.4 Characterization of TbPEX19-TbPEX14 interaction ………………………….77 3.2.4.1 Yeast Two hybrid assay …………………………………………...…….77

3.2.4.2 In vitro binding assay ……………………………………………………79

3.2.5 Identification of binding partners of PEX19 …………………………………..81

3.2.5.1 Co-immunoprecipitation ………………………………………………...81

3.2.5.2 Complex Isolation ……………………………………………………….82

3.2.5.3 Pull down Assay ………………………………………………………...83

4.0 Discussion …………………………………………………………………………...89

4.1 Functional characterization of the peroxisomal import receptor PEX5.….…….....89

4.1.1 Molecular characterization of PEX5 ………………………………………….89

4.1.2 Modulation of Quaternary structure of GAPDH ……………………………...90

4.1.3 Role of PEX14N as a cargo dissociation factor ……………………………....91

4.1.4 The dynamics of docking complex in PEX5 mediated import ……………….93

4.1.5 Development of glycosomal proteins import model ……………………..…..96

4.1.6 Summary and Outlook …………………………..…………………………....98

4.2 Functional characterization of peroxisomal membrane receptor PEX19 .………..98

4.2.1 Molecular characterization of PEX19 ………………………………………...99

4.2.2 PEX19-PEX14 interaction …………………………………………………...100

4.2.3 Identification of putative binding partners of PEX19 ………………………..101

4.2.4 Summary and outlook ………………………..……….………………..….…106

5.0 References ……………………..…………………………………………………...107

6.0 Annexure …………………………………………………………………………...123

Abbreviations …………………………………………………………………………..130

List of figures …………………………………………………………………………..133 List of tables …………………………………………………………………………....135

Publications ………………………………………………………………………….....136

CV ……………………………………………………………………………………...137

Acknowledgement ………………….………………………………………………….138

Erklärung ……………………………………………………………………………….139

Summary

Trypanosoma brucei; the causative agents of African trypanosomiasis, house the glycolytic pathways in peroxisomes-like organelles termed as glycosomes. Glycosomes provide the energy necessary for survival of parasites in the mammalian blood, hence viewed as potential drug targets in combating trypanosomiasis. The goal of this work was to identify molecular differences of peroxisomal and glycosomal biogenesis that could serve as targets for designing drugs against trypanosomes.

Functional characterization of peroxisomal matrix protein receptor PEX5

A vast majority of glycolytic enzymes (except Hexokinase and Aldolase) possess peroxisomal targeting signal type 1 (PTS1) at their extreme C-terminus. PEX5 is a soluble receptor that recognizes PTS1 containing proteins in the cytosol and transfers them to the peroxisomal membrane where two membrane components, PEX14 and PEX13 act as docking proteins. Upon assembly of a transient pore, the cargo is translocated into the matrix of peroxisomes while PEX5 is recycled back.

Using affinity purified proteins and size exclusion chromatography in combination with multi-angle light scattering, I have deduced the quaternary structure of PEX5 as monomeric; GAPDH, a glycosomal isoenzyme of glyceraldehyde phosphate dehydrogenase (a PTS1 glycolytic enzyme) as a homo-dimer and a C-terminally truncated version of PEX14, comprising residues 1-147 (PEX14(1-147)), as a homo-dimer. Molecular and biophysical parameters of PEX5-GAPDH and PEX5-PEX14 (1-147) complexes were analyzed by multi angle light scattering. The data suggest that PEX5 modulates the conformational change of GAPDH from a dimer to a monomer. Using similar approach, the binding stoichiometry of PEX5-PEX14 (1-147) complex was calculated as 1:4. It was assumed that two homo-dimeric subunits of PEX14 (1-147) interact individually with two diaromatic motifs, situated in N- terminal part of PEX5. Finally, I was able to demonstrate that the N-terminal fragment of PEX14 (1-78 residues) interacts with PEX5-GAPDH complex, however significant release of the cargo was not observed.

Using affinity purified proteins and truncated versions of PEX14, the interaction regions of PEX13 and PEX14 were mapped. Pull down assays indicate that the SH3 (Src homology 3) domain of PEX13 forms a docking complex through putative prolin rich motif of PEX14. Binding was competed by PEX5 due to the high binding affinity of PEX5 and PEX14

i proteins. PEX13 binds PEX5 through a peculiar TKL motif; a PTS1 resembling sequence present at the end of the C-terminus of PEX13. An in vitro competition binding assay was performed to determine the role of TKL motif of PEX13. Interestingly, PEX13-TKL could not interact with the cargo-bound PEX5. Conversely, a complex between PEX5 and PEX13- TKL has the capacity to interact with a PTS1 cargo protein. In conclusion, the molecular interactions observed during this work were used to develop a model for glycosomal proteins import, mediated by PEX5 receptor.

Here, a new mode of interaction was observed between PEX13 and PEX5, involving an unusual PTS1 motif (TKL) of PEX13. The critical role of PEX13 in docking of cargo-loaded receptor and the absence of corresponding motif in human system suggests that specific interruption of glycolytic matrix import as opposed to the peroxisomal import could lie in this interaction.

Functional characterization of peroxisomal membrane protein receptor PEX19

PEX19 is a soluble protein that is supposed to act as a chaperone and import receptor for peroxisomal membrane proteins. Critical components involved in peroxisomal biogenesis are still missing in trypanosomes e.g. PEX16 and PEX3 etc.

Here, the oligomeric state of PEX19 was deduced as a monomer. Specific antibodies were raised against the recombinant PEX19 to immunologically detect the endogenous PEX19. In contrast to the human network of peroxins interactions, an interaction between PEX19 and PEX14 could not be detected despite using a variety of experimental approaches. Finally, mass spectrometry analysis of PEX19 associated complexes identified a number of binding partners. The important ones are; the transporters of long chain fatty acids, the orthologue of yeast Vps1 (a vacuole sorting protein1) which is involved in peroxisomal fission and Trypanosoma counterpart of PEX16, an integral membrane and anchor protein for PEX19.

Zusammenfassung

In Trypanosoma brucei, dem Krankheitserreger der afrikanischen Trypanosomiasis, findet Glykolyse, in Peroxisomen ähnlichen Organellen, den Glykosomen, statt. Glykosomen stellen die Energie zu Verfügung, welche für das Überleben der Parasiten im Blut von Säugetieren essentiell ist und stellen deshalb ein potentielles Ziel für die Medikamentenentwicklung gegen die Trypanosomiasis dar. Das Ziel dieser Arbeit war die Identifizierung molekularer Unterschiede von peroxisomaler und glykosomaler Biogenese, auf die die Entwicklung von Medikamenten gegen Trypanosomen ausgerichtet werden könnte.

Funktionelle Charakterisierung der peroxisomalen Matrix-Protein-Rezeptor PEX5

Die große Mehrheit glykolytischer Enzyme (mit Ausnahme von Hexokinase und Aldolase) besitzen eine peroxisomale Zielsequenz Typ 1 (peroxisomal targeting signal 1, PTS1) am extremen C-terminus der Proteine. PEX5 ist ein löslicher Rezeptor der Proteine mit PTS1 Signal, der diese im Zytosol erkennt, bindet und zur peroxisomalen Membran transportiert. Dort agieren zwei Membrankomponenten, PEX14 und PEX13, als docking-Proteine. Im Anschluss an die Assemblierung einer transienten Importpore, erfolgt die Translokation des Cargo-Proteinen in die peroxisomale Matrix, während PEX5 in das Zytosol zurücktransportiert wird.

Mittels Größenausschluss-Chromatographie und Multi Angle Light Scattering konnte die Quartärstruktur affinitätsgereinigter Proteine analysiert werden. PEX5 wurde dabei als Monomer, GAPDH, ein glykosomales PTS1-tragendes Isoenzym der Glycerinaldehyd- Phosphat-Dehydrogenase als Homodimer und eine C-terminal verkürzte Version von PEX14, welche die Aminosäuren 1-147 (PEX14 (1-147)) umfasst, als Homodimer identifiziert. Desweiteren wurden molekulare und biophysikalische Parameter von PEX5- GAPDH- und PEX5-PEX14 (1-147)-Komplexen mittels Multi Angle Light Scattering analysiert. Die Daten lassen vermuten, dass PEX5 Konformationsänderungen von GAPDH von einem dimeren zu einem monomeren Zustand induziert. Unter Verwendung eines ähnlichen Ansatzes konnte die Stöchiometrie der PEX5-PEX14 (1-147) Komplexe als 1:4 bestimmt werden. Vermutlich können zwei homodimere Untereinheiten von PEX14 (1-147) unabhängig voneinander mit zwei diaromatischen Motiven, welche sich im N-terminalen Bereich von PEX5 befinden, interagieren. Letztendlich konnte gezeigt werden, dass ein N-

iii terminales Fragment von PEX14 (Aminosäuren 1-78) mit dem PEX5-GAPDH-Komplex interagieren kann, eine signifikante Freisetzung des Cargos konnte jedoch nicht beobachtet werden.

Unter Verwendung affinitätsgereinigter Proteine und verkürzter Versionen von PEX14, konnte eine Kartierung der Interaktionsstellen von PEX13 und PEX14 erfolgen. Pull down Analysen wiesen darauf hin, dass die SH3 (Src homology 3) Domäne von PEX13 an der Formation des Docking-Komplexes durch das putative PXXP-Motif von PEX14 beteiligt ist. Die Bindung erfolgte in Konkurrenz zu PEX5, bedingt durch die hohe Bindeaffinität von PEX5 und PEX14. PEX13 bindet PEX5 über ein ungewöhnliches TKL-Motif, eine PTS1 ähnliche Sequenz, welche sich am C-terminus von PEX13 befindet. Um die Rolle dieses TKL-Motives näher zu untersuchen, wurde eine in vitro Bindestudie durchgeführt. Interessanterweise war PEX13-TKL nicht in der Lage mit PEX5 zu interagieren wenn dieses Kargoprotein gebundenhatte. Dagegen konnte ein Pex5-Pex13-TKL Komplex mit PTS1- Proteinen interagieren. Aus den Ergebnissen der molekularen Interaktionstudien konnte ein Modell für den glykosomalen Protein-Import entwickelt werden.

Ein signifikanter Unterschied zum menschlichen Importsystem konnte zwischen PEX13 und PEX5 beobachtet werden, welche über ein ungewöhnliches PTS1-Motif (TKL) von PEX13 stattfindet. Diese Interaktion ermöglicht die Entwicklung spezifischer Inhibitoren, welche den glykosomalen Protein-Import in Trypanosomen unterbrechen, ohne dabei den Wirtsorganismus zu beeinflussen.

Funktionelle Charakterisierung des peroxisomalen Membran-Rezeptors PEX19

PEX19 ist ein lösliches Protein, von dem angenommen wird dass sowohl als Chaperon als auch als Import-Rezeptor für peroxisomale Membran-Proteine fungiert. Einige Proteine, die für die peroxisomale Biogenese essentiell sind, insbesondere PEX16 und PEX3, sind in Tryponosomen bislang nicht gefunden worden.

In dieser Arbeit konnte gezeigt werden, dass PEX19 als Monomer vorliegt. Mit Hilfe von rekombinantem PEX19 wurden spezifische Antikörper hergestellt um die immunologische Detektion von endogenem PEX19 zu ermöglichen. Trotz zahlreicher experimenteller Ansätze war es nicht möglich die Interaktion zwischen PEX19 und PEX14 zu zeigen, welche für das humane System bereits bekannt ist. Letztendlich konnten mit Hilfe einer massenspektrometrischen Analyse PEX19 assoziierte Komplexe analysiert und potentielle

Bindungspartner identifiziert werden. Die wichtigsten Vertreter waren Transporter für langkettige Fettsäuren, das Orthologe des Hefeproteins Vps1 (vacuole sorting protein 1), welches an der Teilung von Peroxisomen beteiligt ist, sowie das trypanosomale PEX16, welches einen Membrananker für PEX19 darstellt.

Introduction

1 Introduction

1.1 Trypanosoma brucei and sleeping sickness

Trypanosoma brucei are uni-flagellated protozoans and the etiological agents of Human African Trypanosomiasis (HAT) or sleeping sickness in humans and Animal African Trypanosomiasis (AAT) or nagana in domestic animals. The transmission of these parasites occur through the bite of a “Tsetse fly”; a blood-sucking insect of Glossina spp. These diseases are prevalent in several countries of sub-Saharan Africa.

Nagana disease is a major threat to the livestock in remote areas where keeping of cattle and other domestic animals is partially/completely prevented, thus adding extra economic burdens to these societies. There is no exact statistical data available regarding the spreading of sleeping sickness. In 2005, a survey conducted by the World Health Organization (WHO) estimated 50,000 to 70,000 people are infected by the sleeping sickness (http://www.who.int/mediacentre/factsheets/fs259/en/). Due to the combined control measures, the number of new cases dropped to 10,000 in 2009. Considering the under- reporting which is known to exist especially in connection with remote areas, it is supposed that ~30,000 people are suffering from the sleeping sickness (Simarro et al., 2011). There are no effective vaccines available and current drug treatments are largely complicated and even worsening. Most of the drugs are inefficient and spreading of the drug-resistant parasites are becoming a major problem (Barrett et al., 2003; Diseases, 2001). Therefore, there is a desperate need for the new, effective and safe drugs.

Sleeping sickness is characterized by two distinct clinical stages. The first stage is also known as early hemolymphatic stage and is accompanied by the symptoms; headache, pain, fever, adenopathies etc. During this stage, the parasite is present in the blood, lymph or peripheral organelles of the patients (Kennedy, 2004). In the second stage or late encephalitic stage, the parasite crosses the blood brain barrier and invades the central nervous system. The symptoms include a variety of neurological disorders and sleep disturbances, the reason why the disease was named as sleeping sickness. The symptoms described here might vary, depending on the subspecies of the parasite involved (Kennedy, 2004). The disease is proven fatal if left untreated. Two subspecies of T. brucei; T. brucei gambiense and T. brucei rhodesiense are responsible for sleeping sickness in humans. Both parasitic forms are highly different with respect to their

Introduction distribution, prevalence of the disease and mode of transmission (Fig. 1.1). A third subspecies, T. brucei brucei is a non-pathogenic to human and therefore used as a model organism in the laboratory.

Figure 1.1 The number of cases of sleeping sickness, reported annually between 1940 and 2010 and geographical distribution of the disease in 2010, in Africa. Adopted from Lejon et al., 2013.

T. brucei gambiense causes a chronic infection which might continue for months or years before clinical symptoms appear. T. brucei gambiense is endemic to West and Central Africa (Simarro et al., 2011) and is responsible for more than 95% of the total cases of HAT. T. brucei rhodesiense causes acute infection that usually leads to the death within six months (Odiit et al., 1997). It contributes to less than 5% of the total cases of HAT (Simarro et al., 2008). The transmission of the parasite involves Glossina morsitans which inhabit in East and South parts of Africa. Livestock animals could also be infected with this subspecies, thus also serve as a major reservoirs and contribute to the spread of the disease. While T. brucei gambiense and T. brucei rhodesiense are infectious to human population, T. brucei brucei is the causative agent of nagana disease in animals. In human blood, it is readily recognized and killed by the innate immune system (Lugli et al., 2004; Raper et al., 1999). Human infective subspecies express serum resistance associated proteins (SRA) which enables their survival in the human blood by evading the lytic factors which, otherwise, would kill T. brucei brucei.

Introduction

Apart from this, T. brucei brucei is morphologically indistinguishable to human infective strains.

Trypanosomes are extracellular flagellates and therefore live outside the cells, in the blood of the hosts. The entire surface of trypanosomes is covered by a set of proteins, called variant surface glycoproteins (VSGs). These parasites evade the innate immune response by a process of antigenic variations (Pays, 2005). The surface coat is periodically altered and therefore is no more detected by existing human antibodies.

1.2 Life Cycle of Trypanosoma brucei

Trypanosomes have a complex life cycle which is completed into two hosts; an insect (Tsetse fly) and a human (Vickerman, 1985; Vickerman et al., 1988). Parasites undergo major physiological and morphological changes to adapt the different environments of its hosts. There are two major life cycle stages of T. brucei; bloodstream-form (BSF) in humans and procyclic form (PF) in insects. Life cycle stages of T. brucei parasites are summarized in Fig. 1.2.

Figure 1.2 Life cycle of Trypanosoma brucei (adopted from Holmes 2013).

Life cycle starts when an infected fly bites a person and injects metacyclic trypomastigotes into the blood. Here, parasites transform into long slender form. In the bloodstream, the

Introduction parasites could be present in a slender form for proliferation or adapted to a non-replicating short stumpy form in order to facilitate the uptake by the fly (MacGregor and Matthews, 2010; Vickerman, 1985). During the blood meal, some of the short stumpy form trypomastigotes enter into the midgut of the fly. Some species of the tsetse fly are resistant to the infection and therefore the population of the parasites decline in the midgut (Dyer et al., 2013; Oberle et al., 2010). The stumpy trypomastigotes differentiate into the procyclic form and multiply by binary fission. From here, they reach the proventriculus where they transform into epimastigotes (Roditi and Lehane, 2008; Rotureau and Van Den Abbeele, 2013). After reaching the salivary glands, they can transform into infectious metacyclic forms (Dyer et al., 2013). In the fly, it takes three to five weeks to complete the life cycle.

1.3 Metabolism of Bloodstream and Procyclic Form of parasites

Trypanosomes encounter different environments; from the insect’s gut to the mammalian blood. Therefore, they adjust their metabolism along with morphologies.

Bloodstream-form of parasites transform into the procyclic form in the midgut of the fly. The insect’s gut is full of amino acids and the PF utilizes this source to provide energy through the mitochondrial metabolic pathways. The end products of glucose metabolism, if present, are succinate and acetate (Bringaud et al., 2006). In contrast, the BSF have the access to a high rate of glucose supply within the mammalian blood. The BSF parasites compartmentalize glycolytic metabolism within the peroxisomes-like organelles called glycosomes. BSF parasites are completely dependent on glycolysis for their ATP supply. This is accompanied by a reduced mitochondrion and the absence of tricarboxylic acid cycle as well as electron transport chain components, resulting in incomplete oxidation of the food. This helps the organism to achieve the high ATP flux within the smaller cellular volume (Tetley and Vickerman, 1991). In BSF, about 90% of the total glycosomal protein content is glycolytic enzymes (Aman et al., 1985). This is accomplished by the evolvement of discrete glycosomal targeting signals on these enzymes which, otherwise, are cytosolic in other organisms.

1.4 Glycolysis and Glycosomes

Glycosomes and glycolysis are well studied in T. brucei. The bloodstream-form of T. brucei prefers glucose as an energy source, though fructose, mannose and glycerol also act as substrates. More precisely, first seven reactions of glycolysis occur into the glycosomes,

Introduction resulting in the conversion of glucose into 3-phophoglycerate kinase (Opperdoes and Borst, 1977). There is no net ATP or NADH generated inside the organelle (Fig. 1.3).

Figure 1.3 Glycolysis in bloodstream-form of Trypanosoma brucei. Glycolytic pathways occur in three cellular compartments; Glycosomes, mitochondria and cytosol. First seven reactions take place in glycosomes while the last three or four enzymes are localized in the cytosol. Arrows indicate the flow of glycolytic reactions. Glucose is converted into pyruvate and glycerol. Number of the ATP molecules consumed and produced are equal in glycosomes and indicated by the red font. Net ATP is generated in the cytosol as indicated in bold red. Enzymes catalyzing the reactions are in blue font and abbreviated as: HK, Hexokinase; PGI, Glucose-6-phosphate isomerase; PFK, Phosphofructokinase; ALD, Aldolase; TPI, Triosephosphate isomerase; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; PGK, Phosphoglycerate kinase; GPDH, glycerol-3- phosphate dehydrogenase; GK, Glycerol kinase; PGM, Phosphoglycerate mutase; ENO, Enolase; PK, Pyruvate kinase; GPO, mitochondrial glycerol phosphate oxidase complex. This model is adopted form Parsons, 2004.

Two ATP molecules are consumed during the conversion of glucose into 1,6-fructose bisphosphate which are regained during the conversion of 1,3-bisphosphoglycerate into 3- phoshoglycerate. 3-phoshoglycerate is excreted outside into the cytosol where net ATP is produced during the formation of pyruvate, the end product of glycolysis. Likewise, the NAD+ invested in the glyceraldehyde-3-phosphate dehydrogenase reaction is returned by glycerol-3-phosphate dehydrogenase reaction (Fig. 1.3). It is considered that glycosomal membrane is impermeable to cofactors such as NAD+/NADH and nucleotide such as

Introduction

ATP/ADP (Bakker et al., 2000; van Roermund et al., 1995). Under aerobic conditions, the glycerol 3-phosphate (Gly3P) produced by the reduction of dihydroxyacetone phosphate (DHAP) is transported to mitochondria where it is oxidized by glycerol phosphate oxidase complex (GPO) of mitochondria. Later, DHAP enters into the glycosomes and finally converted into pyruvate, thus producing two net ATP molecules per one molecule of glucose (Fig. 1.3). In anaerobiosis, Gly3P is converted into glycerol and excreted, giving a net production of one ATP in the cytosol (Fig. 1.3).

1.5 Drug treatment

Sleeping sickness is a lethal disease if left untreated. Currently, the drugs available to treat HAT are toxic and rather complex to use (Oberle et al., 2010). Among these, there are four which are heavily relied; Pentamidine isethionate, Suramin, Eflornithine and Melarsoprol. All these drugs can be obtained free of charge at the Department of Control of Neglected Tropical Diseases of the World Health Organization (WHO/NTD). The use of these drugs with respect to the specific stage of disease (Early hemolymphatic stage or late encephalitic stage), sub-species of the parasite involved and mode of administration of the drug is summarized in Table 1.1. T. b. gambiense T. b. rhodesiense

Early stage Pentamidine (intramuscular) Suramin (intravenal)

Late Stage Eflornithine (intravenal) Melarsoprol (intravenal)

Table 1.1 Available drugs to treat the Human African Trypanosomiasis (Lejon et al., 2013)

Pentamidine does not penetrate the central nervous system (Bray et al., 2003) and is used for early-stage HAT, caused by T. brucei gambiense. Treatment shows high cure rate (93–98%) (Balasegaram et al., 2006). Pentamidine is administered through intramuscular route. Suramin is used via intravenous route for the treatment of early-stage HAT caused by T. brucei rhodesiense. It also has high cure rate (95%) (Fairlamb, 2003). Eflornithine was discovered as an anti-tumoral drug. It is used to treat the late-stage HAT, caused by T. brucei gambiense. The efficiency is lower than first two compounds (Chappuis et al., 2005). It must be applied slowly through intravenous system. Melarsoprol can cross the blood brain barrier and therefore is used to treat the late stage of the disease caused by T. brucei rhodesiense. However, it is also used against T. brucei gambiense (Chappuis, 2007). It is highly toxic and

Introduction administered through interavenous rout or in combination with other compounds. Finally, Nifurtimox initially registered for Chagas disease is also used for HAT with little efficiency and is orally administered (Legros et al., 2002). All these drugs exhibit a wide range of side effects in addition to the toxicity observed in some cases.

In animals, the drugs available for the treatment of AAT are also largely unsatisfactory due to increasing drug resistance in the parasites (Holmes et al., 2004).

1.6 Peroxisomes

Peroxisomes were discovered in 1954 as microbodies by J. Rhodin (Rhodin, 1954) and later on, named as peroxisomes by C. de Duve (de Duve, 1969). Subsequent studies identified three subclasses of these organelles; glyoxysomes in plants (Tolbert and Essner, 1981), glycosomes in Trypanosomatids (Opperdoes and Borst, 1977) and Woronin bodies in Fungi (Jedd and Chua, 2000). Peroxisomes are surrounded by a single membrane and are present in almost all eukaryotic cells (De Duve and Baudhuin, 1966). They did not have their own DNA and proteins are, therefore, imported post-transnationally. Peroxisomes perform a wide range of functions, depending on the species and environmental or developmental condition of the organism.

The characteristic feature of peroxisomes is the production and degradation of peroxides, the reason why they are named peroxisomes (de Duve, 1969). Advancements in the knowledge of peroxisomes revealed that these cellular compartments perform a wide range of metabolic functions; α- and β-oxidation of fatty acids, ether lipid biosynthesis and oxidation of cholesterol and bile acids (Hogenboom et al., 2002; Kovacs and Krisans, 2003; Kovacs et al., 2002; Wanders, 2004). In addition to these common functions, peroxisomes contribute in the photorespiration and glyoxylate cycle in plants, plugging of septal injuries in fungi and glycolysis in Trypanosomatids (Baker et al., 2006; Jedd and Chua, 2000; Opperdoes and Borst, 1977; Tolbert and Essner, 1981; Wanders and Waterham, 2006).

The significance of several metabolic pathways harbored by peroxisomes is evident since genetic defects in peroxisomal biogenesis lead to a set of diseases called “Peroxisomal biogenesis disorders (PBDs)” in human. There are two classes of PBD; one is caused by the malfunction of the enzymes e.g. X-linked adrenoleukodystrophy and second is due to the mutations in single or multiple PEX genes, resulting in the loss of peroxisomal functions e.g. Zellwegers syndrome, neonatal adrenoleukodystrophy and infantile Refsums disease (Weller

Introduction et al., 2003). In addition to these lethal diseases, peroxisomes are also related to the process of aging in humans (Terlecky et al., 2006).

Since peroxisomes are devoid of DNA, their proteins have to be imported. However, this import mechanism is largely different from that of chloroplasts or mitochondria. Physical import process of mitochondria and chloroplast needs the proteins to be unfolded. Conversely, peroxisomes have the capacity to import fully folded and even large hetero- oligomeric complexes (Titorenko et al., 2002). Several studies performed in yeast and human cells have reported a set of proteins called peroxins (PEX), necessary for building the functional peroxisomes. Approximately 33 proteins have been identified so far involved in matrix protein import. A handful of them are required for the formation of peroxisomal membrane.

1.7 Peroxisomal matrix protein import

The import in peroxisomes is carried through peroxisome specific targeting signals (PTSs). The first step in this process is the recognition of these signals by the soluble receptors PEX5 or PEX7. There are three types of topological signals identified on peroxisomal matrix proteins. The most understood of these is the C-terminally located tripeptide, Ser- Lys- Leu, named as peroxisomal targeting signal type 1 (PTS1) (Gould et al., 1989; Sommer et al., 1992). Majority of the glycosomal as well as peroxisomal proteins possess this signal, suggesting that peroxisomal and glycosomal protein import mechanism shares similarity at some level. The proteins with PTS1 signals are recognized by the import receptor PEX5. Another signal sequence named as PTS2 (peroxisomal targeting sequence type 2) is composed of nine amino acids and located near the N-terminus of peroxisomal proteins. This signal is recognized by the import receptor PEX7 (Blattner et al., 1995). Beside these well- defined targeting sequences, there are internal targeting signals (I-PTS) which are not well understood till now (Karpichev and Small, 2000; Peterson et al., 1997).

In the first step of matrix protein import, peroxisomal receptors (PEX5 and PEX7) recognize the proteins with respective targeting sequences PTS1 and PTS2, respectively. Mutants of these receptors show defects in the import of PTS1 or PTS2 proteins. Later, cargo-loaded receptors docks at the peroxisomal membrane and subsequently releases its cargo into the peroxisomes and recycled back into the cytosol for next round of import. Given the importance of glycolytic matrix enzymes and the essential role of glycolysis in BSF parasites,

Introduction interference in the import of matrix enzymes may be promising drug targets against Trypanosomiasis.

Peroxisomal matrix proteins import follows two pathways; most of the proteins are transported via PEX5 while the others are transported via PEX7.

1.7.1 PEX5 dependent matrix proteins import

The import of PTS1 proteins can be divided into four steps; (i) cargo proteins are recognized by PEX5 in the cytosol which directs them to the (ii) docking complex where the receptor- cargo complex is dissociated and the cargo is (iii) discharged into the lumen of the peroxisomes and (iv) PEX5 is recycled back. A protein import model summarizing these events is presented in Fig. 1.4 and all the four steps occurring during the import are described in detail.

Figure 1.4 Model of proteins import into the matrix of peroxisomes via PEX5 in yeast. (1) PEX5 binds newly synthesized peroxisomal matrix proteins, in the cytosol, through their C-terminally located PTS1 signals. (2) Receptor-cargo complex docks on the peroxisomal membrane. The docking complex is usually composed of PEX13, PEX14 and PEX17. (3) PEX5 and PEX14 form a channel into the membrane through which cargo is translocated into the lumen of the peroxisomes. (4) Ring finger proteins, PEX2, PEX10, PEX12 and ubiquitin conjugation complex PEX4, PEX22 participate in mono-ubiquitination of PEX5 (5) subsequently, AAA complex, PEX1 and PEX6 extract ubiquitinated PEX5 from the membrane which is now available for another round of import. Adopted form Nuttall et al., 2011.

Introduction

1.7.1.1 PTS1 signals and cargo recognition

The import cycle begins when import receptor PEX5 interacts those matrix proteins which harbor PTS1 signals. Initially, PTS1 motif was identified as a tripeptide, SKL situated at the end of the luciferase enzyme of firefly (Gould et al., 1987). Later studies have identified a number of PTS1 sequences which resulted in a rather degenerate motif with a consensus of [S/C/A]-[R/K/H]-[M/L] (Lametschwandtner et al., 1998), although variants with a consensus of two out of three positions have also been reported (Reumann et al., 2007). Other variables are also demonstrated. These include the mammalian catalase whose PTS1 signal comprises four amino acids, KANL at extreme C-terminus (Purdue and Lazarow, 1996) and alanine/glyoxylate amino transferase which is targeted by two signals (Huber et al., 2005); a C-terminal KKKL and an internal sequence composed of eight amino acids (Ikeda et al., 2008). Importantly, targeting of variable PTS1 is species specific and a signal functional in one organism might not be working in others (Lametschwandtner et al., 1998). In addition, residues upstream of the tripeptide also contribute in the efficiency and specificity of the PTS1 motif (Lametschwandtner et al., 1998; Ma and Reumann, 2008).

Glycolysis is a cytosolic process that occurs in glycosomes in T. brucei. Therefore, glycolytic enzymes have evolved peroxisomal targeting signals (PTSs) to facilitate their import into the glycosomes (Table 1.2). Most of these enzymes show dual localization; cytosolic isoforms are without PTS motifs and glycosomal isoenzymes are with peroxisomal specific targeting signals.

PEX5 is present in all eukaryotes and recognizes the proteins with PTS1 signals (Terlecky et al., 1995). In mammals, a second isoform is also identified. The long isoform of mammalian PEX5 harbors a 37 amino acid exon insertion that enables it to participate in PTS2 import pathway (Otera et al., 1998, 2000). Structural studies of the PEX5 bound PTS1 ligand showed that PTS1 is interacting with the helices of tetra-trico peptide repeat (TPR) domains present at the C-terminus of PEX5 (Gatto et al., 2000; Stanley et al., 2006). Indeed, PEX5 comprises two major domains; an N-terminal domain with a characteristic presence of diaromatic motifs (WxxxF/Y) and the C-terminal region which is composed of seven TPR domains. Each TPR domain consist of 34 amino acids long degenerate motif and shares a highly sequence similarity among species (Gatto et al., 2000; de Walque et al., 1999). The function of TPR domain is conserved and it has been shown that this domain of PEX5 is exchangeable among different organisms (Gurvitz et al., 2001).

Introduction

Enzymes Glycosomal (PTSs)

Hexokinase PTS2

Glucose-6-phosphate isomerase PTS1 (SHL)

Phosphofructokinase PTS1 (AKL)

Aldolase PTS2

Triose phosphate isomerase I-PTS

NAD-dependent glycerol-3-phosphate dehydrogenase PTS1 (SKM)

Glycerol kinase PTS1 (AKL)

Glyceraldehyde phosphate dehydrogenase PTS1 (AKL)

Glycerol-3-phosphate dehydrogenase PTS1 (SKM)

Phosphoglycerate kinase PTS1 (SSL)

Table 1.2 Glycolytic enzymes with specific peroxisomal targeting signals. The informations regarding the PTS signals of glycolytic enzymes are partly taken from Colasante et al., 2006. Abbreviations; PTS1, peroxisome targeting signal type 1; PTS2, peroxisome targeting signal type 2; I-PTS, internal peroxisomal targeting signal. Peroxisomal proteins containing I-PTS can interact either with PTS1 or PTS2 proteins and transported to the peroxisomes in a “piggyback” fashion (Klein et al., 2002).

1.7.1.2 Docking of receptor-cargo complex

While highly conserved TPR domains of PEX5 are involved in recognizing PTS1 proteins, the N-terminal domain is implicated in many interactions involving a variety of peroxins; PEX13, PEX14 and PEX7. Structural data regarding the N-terminal domain is generally lacking. However, using combined biophysical methods and biochemical approaches, it has been reported that unfolded N-terminal region has an extended conformation which is implicated in conveying interactions at peroxisomal membranes (Carvalho et al., 2006).

Once PEX5 is bound to the cargo protein, it has to dock at the peroxisomal membrane. Docking of the receptor-cargo complex is mediated by the N-terminal region of PEX5. Docking complex comprises peroxisomal membrane proteins; PEX14, PEX13 and (PEX17 in yeast) (Agne et al., 2003). The interaction between the docking partners, PEX14 and PEX13 is mediated by the SH3 (Src homology 3) domain of PEX13 and PXXP motif of PEX14

Introduction

(Girzalsky et al., 1999). Mutations in docking proteins exhibit compromised matrix proteins import (Girzalsky et al., 1999). The interaction between docking partners is largely influenced by the cytosolic receptor PEX5. The N-terminal region of PEX5 mediates the binding with SH3 domain of PEX13 in yeast (Bottger et al., 2000). Conversely, in mammals, the N-terminal portion of PEX13 provides the binding site (Otera et al., 2000). The other binding partner of docking apparatus, PEX14 interacts with WxxxF/Y motifs of PEX5 through conserved N-terminal portion (Schliebs et al., 1999).

The docking of PEX5-cargo complex modulates the interaction between PEX14 and PEX13. Presence of cargo seems to influence the binding affinity of PEX5 and the docking machinery. In yeast, cargo-loaded PEX5 binds more efficiently and with enhanced affinity with PEX14. Conversely, the affinity of PEX5 for SH3 domain of PEX13 is lowered in the presence of PTS1 peptide (Urquhart et al., 2000). In mammals, the level of interaction between PEX13 and PEX5 is reduced in the presence of PTS1 ligand (Costa-Rodrigues et al., 2005). In contrast, cargo-free PEX5 shows high affinity binding with PEX13.

Interestingly, in T. brucei genome, there are two isoforms of PEX13 identified; PEX13.1 and PEX13.2 (Brennand et al., 2012). The second isoform lacks an SH3 domain while PEX13.1 presents a remarkable feature; a PTS1 resembling sequence at the C-terminus which is highly conserved in Trypanosomatids but completely absent in PEX13s of other species identified so far (Verplaetse et al., 2009).

1.7.1.3. Dissociation and cargo translocation

Once the receptor-cargo complex docks at the peroxisomal membrane, subsequent events lead to the dissociation of the cargo which is translocated inside the membrane. However, the mechanism of translocation of the cargo is poorly understood. Repeortedly, PEX5 alters its topology and associate with the membrane, behaving like an intrinsic membrane component (Gouveia et al., 2000). Afterwards, cargo proteins enter into the peroxisomes. Several models have been presented to address this event. According to “Peroxisomes pinocytosis” model, peroxisomal proteins are imported by membrane invagination process which leads to the internalization of cargo proteins (McNew and Goodman, 1996). Another model postulates the formation of dynamic peroxisomal pore by the membrane integration of PEX5 and the docking component PEX14 (Erdmann and Schliebs, 2005). The cargo proteins are translocated through this flexible pore. It seems that PEX5-PTS1 complex reaches the matrix face of peroxisomes (Dammai and Subramani, 2001) but it is not yet clear if part of PEX5

Introduction enters into the peroxisomes, resulting in “shuttle model” of import or entire PEX5 enters the peroxisomal lumen so “extended shuttle mechanism”. In either case, the cargo protein is released inside the peroxisomes and PEX5 is recycled back.

The mechanism of cargo liberation is not yet known. Different components have been proposed as the releasing factors in different species. In Pichia pastoris, oligomeric PEX5 shows highest affinity to bind PTS1 proteins. However, the reducing environment of peroxisomal lumen contributes to the decreased oligomeric state of PEX5, resulting in partial dissociation of PTS1 proteins which is further enhanced by PEX8; an intra peroxisomal protein (Ma et al., 2013). In mammalian system, PEX5 preferably binds to the monomeric form of catalase. The PEX5-catalse complex is disrupted upon binding of PEX5 with the N- terminal region of PEX14 (Freitas et al., 2011). Further in this line, Leishmania PEX5 displays a reduced binding affinity towards PEX14 in the presence of PTS1 cargo (Madrid et al., 2004). These observations suggest a common unloading component or mechanism, the detail of which is not yet clear.

1.7.1.4 Receptor recycling

After cargo is discharged into the peroxisomes, PEX5 is pulled back into the cytosol. PEX5 is mono-ubiquitinated through conserved cysteine residues, present on the N-terminal portion (Williams et al., 2007). Mono-ubiquitination is mediated by PEX12; a ring finger domain protein and PEX4 which is ubiquitin conjugating enzyme (Platta et al., 2009). The recycling of PEX5 involves two important factors; PEX1 and PEX6 which are members of the AAA family (ATPase Associated with diverse cellular activities) and associated with the membrane through PEX15 in yeast or PEX26 in mammals (Kiel et al., 2005; Kragt et al., 2005a). There are two types of ubiquitinations observed with respect to the site of ubiquitin and number of ubiquitin molecules added (Kragt et al., 2005b; Platta et al., 2004). Mono- ubiquitination of the receptor resulted in the release of PEX5 back to the cytosol (Williams et al., 2007) while poly-ubiquitination leads to the degradation of PEX5 in 26S proteasome (Kiel et al., 2005; Platta et al., 2004). The later process is usually operated once PEX5 is accumulated at the peroxisomal membrane.

Introduction

1.7.2 PEX7 dependent import

Relatively little number of proteins are translocated via PTS2 signals. PTS2 sequence comprises a degenerate motif of nine amino acids with a general consensus of [K/R]- [V/L/I]-X5-[H/Q]-[A/L] (X is any amino acid), present at the N-terminus (Rachubinski and Subramani, 1995). The number of proteins imported through PTS2 sequence varies in different organisms; ranging from one protein (Thiolase) in Saccharomyces cerevisiae (Grunau et al., 2009) to plants where almost one third of the matrix proteins are imported (Reumann et al., 2009). Surprisingly, no proteins with a characteristic sequence of PTS2 are imported in Caenorhabditis elegans (Motley et al., 2000) and Cyanidioschyzon merolae (Shinozaki et al., 2009). It is proposed that PTS2 proteins of these organisms have adapted the PTS1 pathway for their import (Gonzalez et al., 2011), resulting in the loss of PTS2 pathway in these organisms. It was demonstrated that PTS2 sequence is cleaved after the protein is imported into the peroxisomes (Osumi et al., 1991; Swinkels et al., 1991). Such a mechanism is not observed in PTS1 dependent import (Tanaka et al., 2008). The PTS2 proteins are recognized by PEX7 which is a member of family WD40, characterized by a consensus sequence of 40 residues with a central tryptophan-aspartate motif (Marzioch et al., 1994; Rehling et al., 1996). Unlike PEX5, PEX7 requires auxiliary proteins or co-receptors to perform its function. These include; PEX20 in Hansenula polymorpha (Otzen et al., 2005) PEX18 and PEX21 in S. cerevisiae (Purdue et al., 1998) and PEX5 in plants and mammals (Hayashi et al., 2005; Woodward and Bartel, 2005).

1.8 Peroxisomal membrane proteins import

There is a little known about the mechanisms involving the peroxisomal membrane proteins import. The import of peroxisomal membrane proteins (PMPs) is completely independent to the matrix proteins. The mutants which are defective in PTS1/PTS2 import are still efficiently importing the membrane proteins (Erdmann and Blobel, 1996; Gould et al., 1996), resulting in peroxisomal ghosts (Santos et al., 1988; Schrader and Fahimi, 2008). Majority of PMPs synthesized in the cytosol are transported through PEX19. Based on the dependency of membrane proteins targeting, two classes of PMPs have been postulated; class I PMPs which are dependent on PEX19 for their import and class II PMPs which are imported independent of PEX19. Class I comprises majority of PMPs while PEX3, PEX16 and PEX22 are the members of class II PMPs (Eckert and Erdmann, 2003; Fang et al., 2004; Jones et al., 2004).

Introduction

PEX19 recognizes newly synthesized class I PMPs; specifically through membrane protein targeting signals (mPTS) and directs them to the peroxisomal membrane (Heiland and Erdmann, 2005). A schematic illustration of various steps of PEX19 dependent import is summarized in Fig. 1.5. Unlike matrix proteins targeting signals, there is a general lack of consensus in the sequence of mPTS. It has been shown that the mPTS comprises two important parts; PEX19 binding sites for recognition of the cargo and a transmembrane domain for correct insertion of PMPs into the membrane (Rottensteiner et al., 2004). PEX19 binding sites usually consist of 11 amino acid stretch of basic/hydrophobic residues of α- helical conformation which interact with the C-terminal region of PEX19 (Halbach et al., 2005). On the basis of these observations, a mathematical algorithm has been developed to predict the binding sites of PEX19 in membrane proteins (Rottensteiner et al., 2004). This prediction matrix was found useful to correctly identify the binding sites of PEX19 in yeast and human (Halbach et al., 2005) as well as in trypanosomes (Saveria et al., 2007).

Class II PMPs are generally believed to not to travel directly to the peroxisomes. Instead, they are inserted in the peroxisomal membrane via Endoplasmic reticulum (ER) pathway (Hoepfner et al., 2005; Karnik and Trelease, 2007; Kragt et al., 2005a).

Figure 1.5 Peroxisomal membrane proteins import model. PEX19 recognizes membrane proteins (class I) in the cytosol and binds their mPTS. Later, PEX19-cargo complex docks at the membrane where PEX3 act as a receptor for this complex. PEX16 anchor the PEX3-PEX19 complex in the peroxisomal membrane. The model is adopted from Girzalsky et al., 2010.

Introduction

1.9 Peroxisomal membrane biogenesis factors

Genetic studies led to the identification of three components; PEX19, PEX3 and (PEX16 present in some organisms) which are essential for peroxisomes biogenesis (Götte et al., 1998; Hettema et al., 2000; Honsho et al., 2002; Matsuzono et al., 1999). Δpex3, Δpex19 and Δpex16 mutants lack detectable peroxisomal structures which reappear upon introduction of wild type genes (Ghaedi et al., 2000; Matsuzono et al., 1999; Muntau et al., 2000).

PEX19 has been assigned with diverse functions. It acts as a chaperone to keep the cargo proteins in proper conformation (Shibata et al., 2004), enhances their solubility and ferries them to the peroxisomal membrane (Jones et al., 2004). PEX19 is mainly a cytosolic protein, although a small amount is associated with the membrane (Matsuzono et al., 1999; Sacksteder et al., 2000a). These features make it an excellent candidate for a general import receptor of PMPs. The long C-terminal domain of PEX19 contains a CAAX motif (C is cysteine, A is aliphatic amino acid, X is any residue) which is a farnesylation sequence (Fransen et al., 2005; Shibata et al., 2004). Interestingly, Trypanosomatids PEX19 lack this motif. Farnesylation of PEX19 is implicated in efficient targeting of PMPs (Banerjee et al., 2005). Cargo-bound PEX19 docks at the peroxisomal membrane where another integral membrane protein PEX3 functions as a docking partner. PEX19–PMP cargo has an enhanced affinity towards PEX3 as compared to the cargo-free PEX19 (Pinto et al., 2006).

PEX3 is an integral membrane protein but it does not contain usual mPTS for PEX19 binding (Halbach et al., 2009). Instead, its trafficking to the peroxisomal membrane is believed to occur via endoplasmic reticulum (ER) pathway (Hoepfner et al., 2005; Kragt et al., 2005b). The N-terminal region of yeast and mammalian PEX3 is a membrane anchoring part while C- terminal domain is located outside, in the cytosol. The C-terminal region of PEX3 acts as a receptor for cargo-loaded PEX19 and thus plays an essential role in the insertion of class I PMPs (Fang et al., 2004). In Pichia pastoris, PEX3 participate in peroxisomal matrix protein import (Hazra et al., 2002). In addition to these functions, PEX3 is implicated in peroxisomal inheritance (Chang et al., 2009). In trypanosomes, an orthologue of PEX3 has not yet been identified.

PEX16 is another member of class II PMPs, although its obvious orthologue is missing in most of the species (Kiel et al., 2006). The topology and function of PEX16 significantly differs among species. In mammals, PEX16 possess two transmembrane regions with

Introduction exposed N- and C- terminal domains towards the cytosol (Honsho et al., 2002). In contrast, Yarrowia lipolytica PEX16 is peripherally associated with the membrane and facing the luminal side of the peroxisomes (Eitzen et al., 1997). Yarrowia PEX16 functions as a negative regulator of peroxisomal division (Eitzen et al., 1997). While, HsPEX16 acts as a receptor at ER and peroxisomes for membrane proteins (Kim et al., 2006). Perhaps, the precise role for PEX16 is humans is that it acts as a docking site for PEX3 and facilitate the insertion of PEX3 in complex with cargo-loaded PEX19 (Kim et al., 2006; Matsuzaki and Fujiki, 2008). In Trypanosomatids, an orthologue of PEX16 is not yet known.

1.10 Aims of the study

Since their discovery, glycosomes have caught an increasing attention due to the unique property of compartmentalizing glycolytic pathways. Glycosomes are essential, especially for bloodstream-form of parasites. Therefore, glycosomal biogenesis is considered a potential drug target against sleeping sickness. Using RNA interference studies, several peroxins were demonstrated to be indispensable for proper growth of the parasites (Moyersoen et al., 2003; Verplaetse et al., 2009). Since Trypanosomatids present a diverged branch of evolution, subtle differences might exist among the peroxisomal import machinery of human and parasites which would be a help in fighting the disease. The general goal of this work was to identify the differences among peroxisomal and glycosomal biogenesis processes which might lead to the development of inhibitors, specifically targeting glycosomal biogenesis.

Glycolysis is normally a cytosolic process, which takes place in glycosomes in trypanosomes. The correct localization of the glycolytic enzymes is critical for survival of the parasites (Bakker et al., 2000; Moyersoen et al., 2003). Most of these enzymes belong to a class of PTS1 proteins. I have investigated the matrix proteins import process in detail in T. brucei.

PEX13 of T. brucei presents a remarkable feature; a PTS1 resembling sequence at the end of the C-terminus. The putative PTS1 motif is highly conserved among Trypanosomatids but completely absent in PEX13 orthologues of other organisms (Verplaetse et al., 2009). The probable role of PTS1 motif of PEX13 in PEX5 dependent import has been addressed in this work.

One aspect of peroxisomal biogenesis is the membrane biogenesis. A key player in this process is PEX19. Relatively little is known about the role of PEX19 in glycosomal

Introduction biogenesis. This study investigated the molecular characterization of PEX19 and performed a detail analysis of its interaction with PEX14, a peroxisomal membrane protein.

Critical components involved in peroxisomal biogenesis have not yet been identified in T. brucei. Among these are the PEX3 and PEX16, both of which are interacting partners of PEX19. Homology searches remain unsuccessful to find the potential candidates of PEX3 and PEX16, suggesting that sequences of these components have been diverged considerably, implying the potential role of these proteins in making drugs. Using pull down assays, I have purified PEX19 associated complexes. Mass spectrometry analysis was performed to identify the binding partners of PEX19 including the novel binding components in T. brucei.

Materials and Methods

2.0 Materials and Methods

2.1 Chemicals

Substance Manufacturer

Acrylamide, Bisacrylamide sol. (30%) Roth, Karlsruhe

Agar Difco BD Biosciences, Heidelberg

Agar select Invitrogen, Groningen (NL)

Agarose Eurogentec, Seraing (B)

Agarose (low melting) Biozym, Hameln

Ammonium per sulfate Merck, Darmstadt

Ampicillin Applichem, Darmstadt

Amylose resin New England Biolabs, Frankfurt

Benzamidine MP Biomedicals, Eschwege

Bromophenol blue Sigma, München

Coomasie brilliant blue R250 Serva, Heidelberg

Digitonin Merck, Darmstadt

Dry milk Netle, Frankfurt

DTT Applichem, Darmstadt

Ethidium bromide Sigma, München

Glutathion reduced Amersham Biosciences, Freiburg

Glutathion sepharose GE, Healthcare

Glycerin Riedel-de Haën, Seelze

Immidazol J. T. Baker, Deventer (NL)

Materials and Methods kanamycin AppliChem, Darmstadt

Maltose Riedel-de Haën, Seelze

Ni2+ -NTA- Agarose Qiagen, Hilden (BRD)

Oleic acid Merck, Darmstadt

Peptone select Invitrogen, Groningen (NL)

PMSF Roche Diagnostics, Mannheim

Sodium dodecylsulfate (SDS) Biomol, Hamburg

Sodium fluoride Sigma, München

TEMED Sigma, München

Trichloracetic acid (TCA) J. T. Baker, Deventer (NL)

Tris base Sigma, München

Triton X-100 Sigma, München

Tween 20 Sigma, München

Yeast extract difco BD Biosciences, Heidelberg

β – mercaptethanol Sigma, München

2.2 Enzymes

Antipain MP Biomedicals, Eschwege

Aprotinin MP Biomedicals, Eschwege

Bestatin MP Biomedicals, Eschwege

Chymostatin MP Biomedicals, Eschwege

Leupeptine MP Biomedicals, Eschwege

Materials and Methods

Lysozyme Sigma, München

Pepstatin A MP Biomedicals, Eschwege

Restriction endonucleases NEB, Frankfurt a. M.

T4-DNA-ligase Fermentas (USA)

Taq-DNA-Polymerase Peqlab, Erlangen

Thrombin Serva, Heidelberg

2.3 Molecular weight markers

Product Sizes of the bands

Gene RulerTM DNA ladder Mix (Fermentas) 10000/5000/3000/1000/500

Page ruler TM plus Prestained Protein ladder 250 / 130 /100 / 70 / 55 / 35 / 25 / 15 / 10 (Fermentas)

2.4 Antisera

Primary antibodies Dilution Refermce

Anti-TbAldolase 1:150,000 Paul A.M. Michels

Anti-TbGAPDH 1:150,000 Paul A.M. Michels

Anti-GIM5 1:10,000 Maier et al., 2001

Anti-TbPEX5 1:10,000 de Walque et al., 1999

Anti-TbPex11 1:15,000 Lorenz et al., 1998

Anti TbPEX13 1:10,000 Verplaetse et al., 2009

Anti-TbPEX14 1:10,000 Moyersoen et al., 2003

Anti-TbPEX19 1:5,000 This study

Materials and Methods

Anti-DBD 1:1,000 Santa Cruz Biotechnology

Anti-GSTScPEX19 1:10,000 AG Erdmann

Anti-His 1:1000 Qiagen

Secondary antibodies

IRDye 800CW Goat anti-rabbit IgG 1:15,000 Li-COR biosciences, Bad Homburg

IRDye 680CW Goat anti-mouse IgG 1:15,000 Li-COR biosciences, Bad Homburg

2.5 Devices

Device Model Producer

Agarose Gel-system __ Ruhr-Universität Bochum

Cell incubator HERA Kendro, Langenselbold (BRD)

Centrifuges Centrifuge 5810R Eppendorf, Hamburg

Emulsiflex homogenizer Avestin Europe Mannheim

Fluorimeter Odyssey Infrared LI-COR Biosciences, Lincoln imaging system, LI- COR

Gel electrophoresis System Mini-Protean II, 3 Biorad München

Imaging system Odyssey Licor Boiscience Bad Homburg

Incubator C200 Labotech, Göttingen

Laminar flow IR 1500 Flow Meckenheim (BRD)

Microscope Axioplan 2 Zeiss, Oberkochen pH meter PHM220 Radiometer, Kopenhagen

Power supply Power Pac 250V Bio-rad München

Materials and Methods

Protein isolation system Äkta Purifier GE Healthcare

Äkta Prime Freiburg

Protein-Transfer-System Mini Trans-Blot Cell Bio-rad München

Rotors RC-5B Thermo

Sorvall Pro 80 Thermo

Optima®MAX Beckman Coulter, Krefeld

Spectrophotometer Ultrospec 3000pro GE Healthcare, Freiburg

Thermomixer Thermostat comfort Eppendorf, Hamburg

Thermocycler T3-Thermocycler Biometra, Göttingen

Ultrasound Digital Sonifier 250-D Branson

Water purifier Seralpur Pro 90 CN USF, Ransbach-Baumbach

Water bath Memmert Schwabach (BRD)

2.6 Kits and Consumables

Product Manafacturer

6-well plate Nunc, Roskilde (Dänemark)

Concentrator Amicon Utracell, Ireland

Cover slips (16 mm & 18 mm) Omnilab, Münster

Cryo Tube Nunc, Roskilde (Dänemark)

Gel extraction kit Macherey & Nagel, Düren

Glass slides Menzel GmbH & Co KG, Braunschweig

DNA purification kit Macherey & Nagel, Düren

Materials and Methods

Microcuvetes Sarstedt, Nümbrecht

Nitrocellulose membrane (0,45μm) Schleicher & Schuell, Dassel

NucleoSpinTM Plasmid Mini Kit Macherey & Nagel, Düren

Serologicals pipettes Sarstedt, Nümbrecht

Spin columns, 1 ml (Mobicols) Mo Bi Tec, Göttingen

Sterile flasks for cell culture Nunc, Wisebaden (BRD)

Whatman paper 3MM Whatman, Maidstone (GB)

Whatman paper Y2H Whatman, Maidstone (GB)

2.7 Micro-organisms 2.7.1 Escherichia coli

Strain Genotype Source

BL21 (DE3) F-ompT hsdSB (rB-mB-)gal dcm araB::T7RNAP-tetA Invitrogen

TOP10 F– mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Life ΔlacX74 recA1 araD139 Δ(ara leu) 7697 galU galK Technologies rpsL (StrR) endA1 nupG

2.7.2 Saccharomyces cerevisiae

Strain Genotype Source

UTL7A MAT , ura3-52, trp1, leu2-3/ 112 AG Duntze, Bochum

UTL7A∆pex19 -%- pex19::kanMX4 AG Erdmann

PCY2 MATα Δgal4 Δgal80 URA3�GAL1-lacZ lys2– AG Erdmann 801amber his3-Δ200 trp-1Δ631 leu2 ade2–101 ochre

Materials and Methods

2.7.3 Trypanosoma brucei

Strain Genotype Source

T. b. brucei 427 A genetically modified cell line derived from strain Biebinger et cell line 449 Lister 427 al., 1997

2.8 Media

2.8.1 Medium for cultivation of Escherichia coli

LB-medium

Tryptone 1% (w/v)

NaCl 0 1% (w/v)

Yeast extract 0.5 % (w/v) pH 7.5 (with KOH)

Ampicillin - 100µg / ml

Kanamycin 50µg / ml

LB-agar plates Agar 1.5% (w/v) in LB medium

2.8.2 Media for cultivation of Saccharomyces cerevisiae YPD-media Yeast extract 1% (w/v)

Peptone 2% (w/v)

Glucose 2% (w/v)

YPD-plates: Yeast extract 1% (w/v)

Materials and Methods

Peptone 2% (w/v)

Glucose 2% (w/v)

Agar 2.4% (w/v)

0.3% glucose-media Glucose 0.3% (w/v)

Ammonium sulfate 0.5% (w/v)

Yeast nitrogen base 0.17% (w/v)

Yeast extract 0.1% (w/v)

Rytka-media Glucose 0.1% (w/v)

Ammonium sulfate 5% (w/v)

Yeast Nitrogen Base 0.17% (w/v)

Yeast extract 0.1% (w/v)

20% Tween40 0.05% (w/v) oleic acid 0.1% (w/v)

Oleat plates Ammonium sulfate 5% (w/v)

Yeast Nitrogen Base 0.17% (w/v)

Yeast extract 0.1% (w/v)

20% Tween40 0.05% (w/v) oleic acid 0.1% (w/v)

Materials and Methods agar 2.4% (w/v)

2.8.3 Media for cultivation of Trypanosoma brucei HMI-9 media Heat inactivated fetal calf serum: 10% (w/v)

Phleomycin: 0.2 µg/ml

2.9 Oligonucleotides

Name Sequence 5ʹ - 3ʹ

RE2926 GATCGGATCCATGTCTCATCCCGACAATGAC

RE2927 GATCGAATTCCTACACTGATGGTTGCACATCG

RE2928 GATCGAATTCCATGTCTCATCCCGACAATGAC

RE2929 GATCGGATCCCTACACTGATGGTTGCACATCG

RE2967 GATCGAATTCCTATTGTTGTTTGCAACCGTCGGTTAATTCCTTATCA AGCACTGATGGTTGCACATCG

RE3028 GATCGGATCCCTATTGTTGTTTGCAACCGTCGGTTAATTCCTTATCA AGCACTGATGGTTGCACATCG

RE3308 GATCGTCGACCATGTCTTTGCTGCTGTCGG

RE3309 GATCGCGGCCGCCTAAGCTGCCTCGCCGCCAAC

RE3310 GATCGTCGACGATGTCTCATCCCGACAATGAC

RE3311 GATCGCGGCCGCCTACACTGATGGTTGCACATCG

RE3312 GATCATCGATATGGAACAAAAACTTATTTCTGAAGAAGATCTGAT GTCTCATCCCGACAATGAC

RE3313 GATCGGATCCATGGAACAAAAACTTATTTCTGAAGAAGATCTGAT GTCTCATCCCGACAATGAC

Materials and Methods

RE3782 ATAAGCTTCGATGGCGTCCTCGGAGCAGG

RE3783 ATAAGCTTCTAGTCCCGCTCACTCTCG

RE3784 ATTCCGGAATGGCGTCCTCGGAGCAGG

RE3785 ATAAGCTTCGATGTCTTTGCTGCTGTCGGG

RE3786 ATGGATCCTCAAGCTGCCTCGCCGCC

RE3787 ATGTCGACCATGTACGGTGGTTATGGTGC

RE3788 ATGCGGCCGCCTAGAGTTTTGTCTCCCTCTC

RE4104 GATCAAGCTTATGTCCCCTATACTAGGTTATTGG

RE4105 GATCAGATCTCTACACTGATGGTTGCACATCG

RE4106 GATCGGATCCCTAACGCGGAACCAGATCC

RE4249 GATCGAATTCGTCTACGTAGCCATGTTTGAT

RE4250 GATCCTCGAGCTAAAGACGCAAAAAATTTCCCG

RE4340 GATCGAATTCATGACTATTAAAGTTGGCATC

RE4341 GATC GGATCCCTATAGCTTTGCTGCACGGTC

RE4462 ATGTTTGATTATGTATCCCCCAAGAA AGAGGGGTTT ATTGGATTC

RE4463 GAATCCAATAAACCCCTCTTTCTTGGGGGATACATAATCAAACAT

RE4464 ATGTTTGATTATGTATCCCCCCAGAA AGAGGGGTTTATTGGATTC

RE4465 GAATCCAATAAACCCCTCTTTCTGGGGGGATACATAATCAAACAT

RE4466 GATTATGTATCCCCCGAGAA AAAGGGGTTTATTGGATTCA AGACC

RE4467 GGTCTTGAATCCAATAAACCCCTTTTTCTCGGGGGATACATAATC

RE4468 GATTATGTATCCCCCGAGAA ACAGGGGTTTATTGGATTCA AGACC

RE4469 GGTCTTGAATCCAATAAACCCCTGTTTCTCGGGGGATACATAATC

Materials and Methods

RE4470 TTTATTGTTGATGACTACACGAAAAATGGTTGGTGCCAGGCAACT

RE4471 AGTTGCCTGGCACCAACCATTTTTCGTGTAGTCATCAACAATAAA

RE4472 TTTATTGTTGATGACTACACGCAAAATGGTTGGTGCCAGGCAACT

RE4473 AGTTGCCTGGCACCAACCATTTTGCGTGTAGTCATCAACAATAAA

RE4474 GATGACTACACGGAAAATGGTGCGTGCCAGGCAACTACCGCAACT

RE4475 AGTTGCGGTAGTTGCCTGGCACGCACCATTTTCCGTGTAGTCATC

RE4476 GATGACTACACGGAAAATGGTTCGTGCCAGGCAACTACCGCAACT

RE4477 AGTTGCGGTAGTTGCCTGGCACGAACCATTTTCCGTGTAGTCATC

RE4486 GATCGGATCCATGACTATTAAAGTTGGCATC

RE4487 GATCGAATTCCTATAGCTTTGCTGCACGGTC

RE4493 ATTTTGAGCGAGCGGGCATATGTGGCAACAGGACCGAATAGC

RE4494 GCTATTCGGTCCTGTTGCCACATATGCCCGCTCGCTCAAAAT

RE4495 GAGCGGGCATATGTGGCAACAGGAGCGAATAGCCAGCACATGACT

RE4496 AGTCATGTGCTGGCTATTCGCTCCTGTTGCCACATATGCCCGCTC

RE4497 AGCGCCGATTCGGTTGCCACGGCTCATGCAAACCAATCCCGGCGT

RE4498 ACGCCGGGATTGGTTTGCATGAGCCGTGGCAACCGAATCGGCGCT

RE4499 AGTTTACTTTACGCGGCACAAGCTGCACCGCTCCCCGAAGCG

RE4500 CGCTTCGGGGAGCGGTGCAGCTTGTGCCGCGTAAAGTAAACT

RE4501 CTTTACGCGGCACAAGCTGCAGCGCTCGCCGAAGCGGCTGCT

RE4502 AGCAGCCGCTTCGGCGAGCGCTGCAGCTTGTGCCGCGTAAAG

Materials and Methods

2.10 Vectors and Plasmids

Constructs generated in this study

Name Insert Vector Primers Restriction sites pIA 01 TbPex19 pUG36 RE2926/ 2927 BamH1/ EcoR1 pIA 02 TbPex19caax pUG36 RE2926/ 2967 BamH1/ EcoR1 pIA 03 TbPex19 pUG36 (-GFP) RE2926/ 2927 BamH1/ EcoR1 pIA 04 TbPex19caax pUG36 (-GFP) RE2926/ 2967 BamH1/ EcoR1 pIA 05 Myc TbPex19 pUG36 (-GFP) RE3312/ 2927 BamH1/ EcoR1 pIA 06 Myc TbPex19caax pUG36 (-GFP) RE3312/ 2967 BamH1/ EcoR1 pIA 07 TbPex19 pEGFP C1 RE2928/ 2929 EcoR1/ BamH1 pIA 08 TbPex19caax pEGFP C1 RE2928/ 3028 EcoR1/ BamH1 pIA 09 TbPex19 pCDNA3.1 Zeo RE2926/ 2927 BamH1/ EcoR1 pIA 10 TbPex19caax pCDNA3.1 Zeo RE2926/ 2967 BamH1/ EcoR1 pIA 11 TbPex14 pPC86 RE3308/ 3309 Sal1/ Not1 pIA 12 TbPex14 pPC97 RE3308/ 3309 Sal1/ Not1 pIA 13 TbPex19 pPC86 RE3310/ 3311 Sal1/ Not1 pIA 14 TbPex19 pPC97 RE3310/ 3311 Sal1/ Not1 pIA 15 TbPex13 pPC86 RE3787/ 3788 Sal1/ Not1 pIA 16 TbPex13 pPC97 RE3787/ 3788 Sal1/ Not1 pIA 18 TbPex19 pET28a RE2926/ 2927 BamH1/ EcoR1 pIA 19 TbgGAPDH pMAL-C2 RE4340/ 4341 EcoR1/ BamH1 pIA 20 TbgGAPDH pET28a RE4486/ 4487 BamH1/ EcoR1

Materials and Methods pIA 21 TbgGAPDH pGEX4T1 RE4486/ 4487 BamH1/ EcoR1 pIA 22 TbPex13SH3 pGEX4T1 RE4249/ 4250 EcoR1/ Hind111 pIA 23 TbPex13SH3E336K pGEX4T1 RE4462/ 4463 Mutagenesis pIA 24 TbPex13SH3E336Q pGEX4T1 RE4464/ 4465 Mutagenesis pIA 25 TbPex13SH3E338K pGEX4T1 RE4466/ 4467 Mutagenesis pIA 26 TbPex13SH3E338Q pGEX4T1 RE4468/ 4469 Mutagenesis pIA 27 TbPex13SH3E356K pGEX4T1 RE4470/ 4471 Mutagenesis pIA 28 TbPex13SH3E356Q pGEX4T1 RE4472/ 4473 Mutagenesis pIA 29 TbPex13SH3W359A pGEX4T1 RE4474/ 4475 Mutagenesis pIA 30 TbPex13SH3W359S pGEX4T1 RE4476/ 4477 Mutagenesis pIA 31 TbPex13SH3-TKL pGEX4T1 RE4249/ 3175 EcoR1/ Hind111 pIA 32 GST pHD1336 RE4104/ 4106 Hind111/ BamH1 pIA 33 GSTTbPex19 pHD1336 RE4104/ 4105 Hind111/ Bgl11 pIA 34 TbPex14 pGC1 RE3785/ 3786 Hind111/ BamH1 pIA 35 TbPex14(1-147) pET9d RE4493/ 4494 Mutagenesis

P87A P90A pIA 36 TbPex14(1-147) pET9d RE4495/ 4496 Mutagenesis

P87A P90A P93A pIA 37 TbPex14(1-147) pET9d RE4497/ 4498 Mutagenesis

P111A P113AP115A pIA 38 TbPex14(1-147) pET9d RE4499/ 4500 Mutagenesis

P128A P131A

Materials and Methods pIA 39 TbPex14(1-147) pET9d RE4501/ 4502 Mutagenesis

P128A

P131A P132AP134A

Constructs from other sources

Name Insert Vector Source

TbPex14 (1-147) pET9d AG Erdmann

pHD1336 Paul Michael

pET28a Paul Michael

TbPex14 pET28a Moyerson et al., 2003

TbPex19 pGEX4T1 Parsons et al., 2007

PKG3-7-11 ScPex19 pRS316 Götte et al., 1998

DsRedSKL pUG34 AG Erdmann pPC97ScPex3 ScPex3 pPC97 (Franken, 1995) pKAT61 ScPex19 pPC86 AG Erdmann

TbPex14(1-147) pET9d AG Erdmann

TbPex14(1-84W) pET9d AG Erdmann

TbPex14(1-84) pET21d AG Erdmann

TbPex5 pET9d AG Erdmann

Materials and Methods

2.11 Molecular Biology Methods

2.11.1 Amplification of DNA fragments via PCR

To amplify the gene of interest, the method of PCR (polymerase chain reaction) was used. For isolation and polymerization of particular DNA fragment, following components have been added in a 50 µl reaction volume:

Component Volume (µl) Final concentration

Forward primer 0,5 0.2mM

Reverse primer 0,5 0.2mM

Template 1.0 20ng

Buffer (10X) 5.0 1x dNTPs (5X) 10.0 0.25mM

Polymerase (Taq, PWO) 0.5 1U

H2O 32,5

Depending on the experiment, the template used was either plasmid DNA or genomic DNA. Annealing temperature of the PCR cycle was adjusted according to the primers pair used. The time for the extension of DNA fragment depends upon the length of the gene to be amplified. All PCR reactions were carried out in T3-Thermocycler (Biometra, Göttingen) and either Taq or PWO polymerase was used.

2.11.2 Agarose Gel Electrophoresis

In order to verify the size of the PCR product, 1% agarose gel was prepared in TBE buffer. A drop of ethidium bromide was added in a gel mixture to visualize the gel bands under UV light. DNA samples were mixed with loading dye and electrophoresis was performed at 120V for a period of time depending on the size of DNA fragment to be analyzed.

1x TBE buffer: Tris 90mM, Boric Acid 90mM, EDTA 20mM, pH 8.2-8.4 Ethidium bromide 10 mg/ml.

Materials and Methods

DNA sample loading dye Glycerin 50% (w/v) Bromophenol blue 0.1% (w/v) 2.11.3 Excision and Purification of DNA from Agarose Gels

To remove the buffer and salt contaminants of the PCR product, desired DNA gel-bands have been cut out from the agarose gel and DNA was purified via a “Gel Extraction kit” (Macherey & Nagel, Düren).

2.11.4 Restriction of DNA

Restriction endonucleases were used to digest the gel-purified DNA and / or plasmid in order to produce the sticky ends of the nucleic acid. Restriction was carried out in 20 µl reaction volume.

Components Volume (µl)

Buffer (10X) 2.0

Substrate (PCR DNA / Plasmid) 1.5 (0.5-1.0µg)

Restriction enzyme 0.5

H2O (nucleases free) 16.0

The above mentioned components have been mixed gently, spinned briefly and incubated at 37oC for 2-3 hrs.

2.11.4 Dephosphorylation of linker

After digestion of the plasmid DNA with single restriction endonuclease, the enzyme calf intestinal phosphatase (CIP) was added in order to prevent the self-ligation of vector molecules. The enzyme was heat inactivated at 65oC. The plasmid DNA was purified and subsequently used for ligation purpose.

Materials and Methods

2.11.5 Ligation

The ligation reaction was carried out in 20µl reaction mixture containing 100-200 ng of plasmid DNA. Purified DNA fragments (vector and insert) digested with same set of restriction endonucleases have been mixed in 1:3 ratio. The ligation reaction was performed at 16oC for 14-16 h with 0.5 units of T4 DNA ligase.

2.11.6 Transformation of E. coli cells

E. coli cells have been prepared and transformed as described by Hanahan et al., 1983. About 10 µl of ligation reaction was mixed with 50 µl of Ca+ competent TOP10 E. cloi cells. The mixture was incubated on ice for 20-30 minutes followed by heat shock at 42oC for 1-2 minutes. The reaction was transferred back onto ice for 5 minutes. Afterwards, 500 µl of LB medium was added and the mixture was incubated for 1 h on 37oC in thermomixer (Eppendorf, Hamburg) while constantly shaking at 400-500 rpm.

Finally, 100 µl of transformation reaction was poured on plates containing LB agar supplemented with appropriate antibiotics (ampicillin or kanamycin). After 16 – 18 h of incubation at 37oC, the clones were picked and transferred in liquid LB media to isolate the plasmid DNA.

2.11.7 Isolation of Plasmid

Isolation and concentration of plasmid DNA was performed by “NucleospinTM” kit according to the instructions given in the Manuel.

2.11.8 Measurement of DNA concentration

The concentration of DNA was determined by measuring the absorbance at 260 nm while the purity of the samples was checked by 260/280 ratio.

2.11.9 Sequencing of Plasmids

Once the plasmids have been isolated, they were sent to GATC for sequencing.

2.11.10 Glycerin culture and storage of plasmid

E. coli cells transformed with sequenced plasmids have been stored at -80oC in 15 % glycerol culture. The isolated plasmids were stored at -20oC.

Materials and Methods

2.12 Biochemical Methods

2.12.1 Quantification of Proteins

Total protein conc. in solution was determined by the method of Bradford (Bradford 1976). The measurements were performed in triplicates. As a protein standard, various concentrations of BSA were used.

2.12.2 SDS- Polyacrylamide Gel Electrophoresis

SDS-PAGE was carried out by the method of Laemmli (Laemmli 1970). The protein samples were prepared by adding 2x or 5x SDS sample buffer and denatured for 5 -10 min on 95oC before applying them onto the gel. The electrophoresis was performed under denaturing conditions in gel system (Biorad, München) at 100V for stacking gel and 130V for resolving gel till the molecular weight marker corresponding to the size of protein of interest was well separated. Depending on the size of proteins to be separated, SDS gels containing 10%, 12.5% or 15% of polyacrylamide were used. The proteins were then directly stained or transferred on nitrocellulose membrane for Western blot analysis.

1x SDS Running Buffer: Tris 25 mM, Glycine 192 mM, SDS 0.1% (w/v), pH 8.3

Staining of Polyacrylamide Gels

Different staining methods were employed to stain the proteins.

2.12.3 Coomassie Staining

The staining of proteins was performed using Coomassie Brilliant Bue R- 250. The gels were first incubated for 1-2 h at room temperature in staining solution and then destained for several times until decolorization.

Staining solution: Glacial Acetic Acid 10%, Methanol 40%, Coomassie R250 0.1%

De-staining Solution: Methanol 20%, Glacial Acetic Acid 10%

2.12.4 Colloidal Coomassie Staining

The gel carrying the proteins was rinsed first with distilled water for 10-15 mins. The gel was incubated in 50 ml colloidal coomassie solution for at least 2 h (for higher sensitivity, 16-18 h

Materials and Methods incubation was achieved) before destaining several times with water to completely washout the background.

Colloidal Coomassie Solution: Ammonium sulfate 10%, Coomassie G-250 0.1%, Ortho- Phosphoric acid 3%, Methanol 20%

2.12.5 Silver Staining

For detection of low concentration of proteins, silver staining was performed as described by Celis et al., 2006.

2.12.6 Immunoblotting

The proteins from SDS-PAGE were transferred onto the nitrocellulose membrane in Mini- protean 3 cells (Biorad, München) at 300 mA current. The membranes were stained immediately with amido black to check the successful transfer of proteins. The free binding sites on nitrocellulose membrane for non-specific binding of primary antibodies were blocked by 5% non-fat dry milk. For immunodetection, the membranes were incubated with primary antibodies for 12-16 h at 4oC. After washing three times with blot wash buffer, the secondary antibodies (anti rabbit or anti mouse) were applied for 1 h. Finally, the blots were washed three times with blot wash buffer and proteins were visualized using odyssey imaging system (Licor Boiscience, Homburg).

Transfer Buffer: NaHCO3 10 mM, Na2CO3 3 mM, SDS: 0.01% (w/v), Methanol 20% (v/v)

Wash Buffer: PBS 1X, SDS 0.02%, Triron X-100: 0.1%

Blocking Buffer: Milk powder 5% dry milk in wash buffer.

2.13 Methods to analyze protein-protein interactions

2.13.1 Yeast Two Hybrid Assay

Yeast two hybrid assays were performed based on the method developed by Fields and Song 1989. Yeast strain PCY2 was used for all dihybrid assays performed during this work. Open reading frames of selected PEX genes were fused to trans-activation domain or DNA-binding domain of GAL4 and cloned in pPC86 or pPC97 plasmids respectively as described by Chevray and Nathans, 1992. All the constructs were first tested for auto-activation. Co- transformation of both fusion plasmids was performed according to standard Lithium acetate method developed by Gietz and Woods 1994. Transformants were selected on minimal media

Materials and Methods lacking tryptophan and leucin. β-galactosidase filter assay was performed as described by Rehling et al., 1996.

Z buffer + X-gal: Na2HPO4 60 mM, NaH2PO4.H2O 40 mM, KCl 10 mM, 1 mM, MgSO4.7H2O, β -mercaptethanol 39 mM, X-gal 1 mg/ml, pH 7.0

2.13.2 Pull down Assay

GST and His-tagged proteins were purified from soluble cell lysates of E. coli. GST fusion proteins and GST alone as control were immobilized on pre-equilibrated glutathione sepharose matrix for 1h. Purified His-tagged proteins were mixed and incubated for 3-4 h. Unbound proteins were removed by washing the matrix with 50-100 column volume of wash buffer. The bound fractions were eluted by 20mM of glutathione and size fractionated on SDS-PAGE.

For the identification of PEX19 binding partners, GST-tagged TbPEX19 was bound to the column and instead of purified proteins, soluble cell lysates of T. brucei were mixed. All pull down assays were performed at 4oC.

Wash Buffer: Tris 50mM, NaCl 150mM, pH 7.9

Elution Buffer: Tris 50mM, NaCl 150mM, Glutathione reduced 20mM, pH 7.9

2.13.3 Size Exclusion Chromatography

Size exclusion chromatography was performed using Superdex200 16/60 column (GE Healthcare) at an ÄKTA purifier (GE Healthcare). The column was washed twice before applying the sample. After injection of 500µl of sample, the run was started at a flow rate of 1ml/min in all chromatography experiments. Absorbance was recorded at 280nm and protein fractions were collected as 1ml aliquots. Buffer: Tris 50mM, NaCl 150mM, pH 7.9

2.13.4 Multi Angle light Scattering

Multi-angle light scattering was coupled downstream to the size exclusion chromatography system to measure an absolute molar mass and size of the desired proteins. The same instrumentation was also used to observe molecular interactions in real-time. Measurements were conducted on a Dyna Pro 99 device (Wyatt Tech. Corp., USA).

Materials and Methods

2.14 Expression and Purification of GST-tagged Proteins

E. coli cells BL21/DE3 were transformed with GST fusion constructs and allowed to grow at o 37 C in LB media supplemented with 100µg/ml ampicillin. When OD600 of the culture reached to 0.5, IPTG was added to a final concentration of 0.5 mM to induce the expression. The growth was continued for 5 h at 20oC. The cells were harvested, resuspended in cell lysis buffer and disrupted either by sonication (Digital Sonifier 250-D Branson) or by emulsiflex homogenizer (Avestin Europe, Mannheim). The cellular debris was removed by centrifugation at 14000 rpm for 1h (Sorvall RC5B, SS34). Soluble cell lysates were mixed with 1ml of Glutathione sepharose 4B (Amersham Biosciences) and incubated for 1h at 4oC on an overhead rotator. The column was emptied by gravity flow and beads were washed by 30 column volume of wash buffer. Subsequently, the bound proteins were eluted by 20mM glutathione reduced. The purity of eluted proteins was checked by SDS-PAGE. Lysis Buffer: Tris 50mM, NaCl 150mM, Protease inhibitors, DNAses, lysozymes, pH 7.4 Wash Buffer: Tris 50mM, NaCl 150mM, pH 7.9 Elution Buffer: Tris 50mM, NaCl 150mM, Glutathion reduced 20mM, pH 7.9

2.15 Expression and Purification of His-tagged Proteins Open reading frames of genes of interest and their truncations were cloned either in pET9d or pET28a plasmids. These constructs facilitates the expression of proteins with an N-terminal Histidine (His) tag. The E. coli BL21/DE3 cells harbouring the recombinant plasmids were cultured in LB media containing 30µg/ml kanamycin or 50µg/ml ampicillin at 37oC. IPTG was added to a final concentration of 1mM when OD600 reaches 0.5-0.6 and the culture was transferred to 20oC. After 8 h of continuous growth, the cells were harvested and stored at -80oC. For purification, cells were resuspended in lysis buffer and mechanically disrupted via sonication (Digital Sonifier 250-D Branson) or emulsiflex homogenizer (Avestin Europe, Mannheim). After centrifugation (14000rpm, 75 min), the clear supernatant was applied to the NiNTA agarose (Qiagen, Hilden). The purification procedure was performed with ÄKTA PrimeTM (GE Healthcare). Once the sample has a complete run over the column, the resin was washed extensively with wash buffer and bound fractions were eluted by increasing concentration of immidazol and collected in 30X 1ml Eppendorf at a flow rate of 1ml / min. Lysis Buffer: Tris 50mM, NaCl 150mM, Protease inhibitors, DNAses, lysozyme, pH 7.4 Wash Buffer: Tris 50mM, NaCl 150mM, pH 7.9 Elution Buffer: Tris 50mM, NaCl 150mM, immidazol 500mM, pH 7.9

Materials and Methods

2.16 Expression and Purification of MBP-tagged Proteins

The glycosomal isoform of T. brucei GAPDH (TbgGAPDH) was amplified from the genome and cloned in pMAL-C2 plamid. The resulting construct specifies the expression of protein including MBP-tag at the N-terminus. E. coli strain BL21/DE3 cells were transformed with empty as well as recombinant plasmids. The expression and lysis of cells was achieved essentially as described in sec. 2.14. To purify the recombinant gGAPDH, soluble cell lysates were incubated with 1 ml amylose resin (NEB) in a column buffer. After washing the matrix with 30 column volume of wash buffer, the bound proteins were eluted with 10mM maltose. Lysis Buffer: Tris 20mM, NaCl 200mM, Protease inhibitors, PMSF, DNAses, Lysozymes, EDTA 1mM, pH 8.0 Wash Buffer: Tris 20mM, NaCl 200mM, EDTA 1mM, pH 8.0 Elution Buffer: Tris 20mM, NaCl 200mM, EDTA 1mM, Maltose 10mM, pH 8.0

2.17 Thrombin Cleavage and Generation of Antisera

Heterologously expressed GST-tagged T. brucei PEX19 was purified by affinity column chromatography and Thrombin was added to the purified protein. After incubation of 12 - 16 h at 4oC, the cleaved GST was captured by glutathione sepharose 4B (Amersham Biosciences). PEX19 was further purified by size exclusion chromatography and used to raise the polyclonal antisera in rabbits (Eurogentec). Specificity of the antibodies was determined for the endogenous as well as plasmid-encoded Trypanosoma PEX19.

2.18 Cultivation of Saccharomyces cerevisiae

The cultivation of S. cerevisiae strains on solid agar plates and in liquid media was carried out at 30 ° C in complete medium (YPD) or in minimal medium (SD) (Erdmann et al., 1989). Under sterile conditions, YPD agar plates were incubated for 2 days. Cells were then shifted to glucose medium and incubated for 16-18 h. From the seed culture, cells were transferred to glucose medium or Rytka medium, depending on the experiment, and diluted to the OD600 of 0.1. After 16 – 18 h of incubation, the cells were sedimented (4000 rpm, 10 min, 4oC), washed twice with water and then processed for TCA precipitation or fluorescence microscopy.

Materials and Methods

2.19 TCA Precipitation

Yeast cells were disrupted according to Yaffe and Schatz 1984. The cells were grown for 16 h on minimal media and harvested. About 30 mg of cell pellet was resuspended in 1 ml of H2O. A mixture of 148 ul of 2 N NaOH and 12 ul β-mercaptoethanol was added to the cell suspension. After 10 min incubation on ice, the proteins were precipitated with 160 µl of 50% Trichloroacetic acid (TCA). After 10 min incubation on ice, cells were sedimented (2 min, 13000 rpm, 4 ° C). Finally, the cell sediments was resuspended with 500 ul of 1 M Tris Base and centrifuged again. The pellet was resuspended in 150 µl of SDS sample buffer and boiled for 10 min.

2.20 Fluorescence microscopy

The corresponding strains were initially grown for 18 h on selective medium containing glucose or oleaic acid as carbon sources. The cells were embedded on the slides with 0.5 % low-melting agarose. The fluorescence microscopy analysis were performed on an Axioplan 2 microscope (Zeiss).

2.21 Growth Test Yeast strain UTL7A was used for complementation assay. Respective yeast mutants and transformants were first cultured in selective medium containing 0.3% glucose and grown for 16h. For growth test, the cells were harvested and resuspended in sterile water. The cell suspension was diluted to an OD600 equal to 1. From here, a dilution series was prepared (1:1, 1:10, 1: 100, and 1: 1000) and 2 µl of each dilution was poured dropwise on oleat plates.

2.22 Trypanosoma brucei growth conditions

Bloodstream-form of T. brucei 427, cell line 449 (Biebinger et al., 1997) was used in this study. This strain has tetracycline repressor, chromosomally integrated into the genome which is constitutively expressed upon induction. Bloodstream-form T. brucei were grown on HMI-9 media supplemented with 10% (v/v) heat-inactivated fetal calf serum and 0.2µg / ml phleomycin (Krazy and Michels 2006) at 37oC under water-saturated air with 5% CO2 (Hirumi and Hirumi 1989). Cells were grown to a maximum density of 2x106 cells/ml (Alibu et al., 2005).

Materials and Methods

2.23 Transfection of Trypanosoma brucei

Transfection of bloodstream-form T. brucei was performed as described by (Krazy and Michels 2006; Yernaux et al., 2006; Leung et al., 2011) with the help of a kit “Nucleofactor amaxa II” according to the instructions given. Approximately 5x106 cells were harvested and resuspended in 100µl of “Nucelofector Solution” which was first mixed with “Supplement” according to the instructions given in Manuel. 10µg of plasmid DNA was digested with Not1 enzyme for 16 h. The linearized plasmid DNA was precipitated with ethanol and solubilized in 10µl of sterile water. DNA was added on cell suspension which was then transferred to the cuvette. Transfection was achieved by Amaxa Nucleofector program X-001. Transfectants were serially diluted in HMI-9 medium (1:1, 1:10, 1:100) and all dilutions were distributed among 24-well plates so that each well receives 1ml culture volume. After 6h of growth, selection was performed by adding blasticidine to a final concentration of 5µg/ml. After 5-6 days of transfection, positive clones were selected and tetracycline was added to a final concentration of 2mg/ml to induce the expression.

Expression was confirmed by immunoblotting and stable cell lines were stored at -80oC in HMI-9 medium containing 12% glycerol.

2.24 Trypanosoma brucei cell lysate preparation Bloodstream-form T. brucei cells were grown and maintained at a maximum cell density of 1×106 cells/ml. Approximately, 1× 1010 cells were harvested (1200Xg, 10 min, 4°C) and solubilized by modifying a protocol mentioned by Leung et al., 2011. Briefly, cell sediments were resuspended in lysis buffer and mechanically disrupted using a Potter-homogenizer. The amount of solubilized proteins was quantified by Bradford assay. A total of 50 mg Tb protein was incubated with a final conc. of 1% digitonin. After 2 h of incubation at 4°C, the cell lysates were centrifuged (16,000Xg, 15 min, 4°C) to remove the nuclei and insoluble contents. Lysis Buffer: Tris 50 mM, NaCl 150 mM, EDTA 5 mM, PMSF, Complete mini-protease inhibitor cocktail (Roche) 2.25 Co-Immunoprecipitation

The soluble fraction of T. brucei cell lysates were incubated with 5µl of polyclonal anti-PEX19 antisera at 4°C for 12-16 h. Immune-complexes were isolated by the addition of 60 µl of Protein A-Sepharose. Sepharose beads were then washed three times with PBS followed by centrifugation at 1,000xg for 1 min. Subsequently, the beads were resuspended in 1x SDS

Materials and Methods sample buffer at 95°C for 10 min to capture the bound complexes which were then analyzed by Western blotting.

2.26 Complex isolation

Nucleotide sequences of GST or GSTPEX19 proteins were amplified using pGEX4T1 or pGEX4T1-PEX19 constructs, respectively as templates and subcloned in T. brucei expression plasmid pHD1336. Bloodstream-form of T. brucei cells were transfected as described (Biebinger et al., 1996) and positive clones were selected on the basis of phleomycin resistance. 1mM tetracyclin was added to the culture to induce the expression. Cells were harvested and solubilized as described in sec. 2.24. To isolate the GST-tagged protein complexes, supernatant was applied to the glutathione sepharose 4B (Amersham biosciences) and incubated for 4 h at 4oC. Sepharose beads were washed with 10 column volume of wash buffer and bound complexes were eluted using 20mM glutathione reduced. The eluted components were then denatured with SDS sample buffer and subjected to the SDS-PAGE and Western blotting.

2.27 Mass Spectrometry

Mass spectrometric analysis was performed on a Finnigan LCQ Advantage Max-ion trap ESI-MS instrument. The protein was applied to a pre-injection concentration of 2mg/ml with 10 mM Tris-HCl, pH 7.4. Mass spectrometry analysis was carried out by Dr. Katja Kuhlmann (MPC, Ruhr-University Bochum).

Results

3.0 Results

3.1 Functional characterization of Trypanosoma brucei PEX5.

PEX5 recognizes newly synthesized PTS1 containing matrix proteins and facilitates their transportation across the membrane into the lumen of peroxisomes (Ma et al., 2013). Oligomerization of PEX5 is a matter of debate and there are conflicting reports about the quaternary structure of PEX5 (Costa-Rodrigues et al., 2005; Madrid et al., 2004). The functions related to the oligomeric states of PEX5 and their specificity to recognize cargo proteins is also not clear.

To the cargo’s end, peroxisomal import of matrix proteins show a wide spectrum of oligomerization states of the cargo proteins, ranging from monomers (Shiozawa et al., 2009), or dimers (Faber et al., 2002; Luo et al., 2008) to hetero-oligomers (Tanaka et al., 2008).

It is important to determine the molecular requirements for receptor-cargo interaction and the mechanisms of docking and cargo dissociation in peroxisomes.

3.1.1 Trypanosoma brucei PEX5 is a monomeric protein

Previous studies performed with PEX5 orthologues of Leishmania, mammals, Pichia and Hansenula spp. (Boteva et al., 2003; Costa-Rodrigues et al., 2005; Ma et al., 2013; Madrid and Jardim, 2005; Schliebs et al., 1999; Shiozawa et al., 2009) have presented conflicting reports about the quaternary structure of PEX5.

To determine the oligomeric state of T. brucei PEX5, a construct bearing a Histidine tag at the N-terminus of PEX5 termed as His-PEX5 (Fig. 3.1A) was expressed heterologously in E. coli by using T7 promoter-based expression system. After mechanical disruption of the cells, the supernatant was separated (Section: 2.15) from insoluble material and His-PEX5 was purified from soluble fraction on pre-equilibrated His-trap Ni-NTA agarose. After several washings, bound material was eluted with linear gradient (1-100%) of 300 mM immidazol. The amount and purity of His-PEX5 bound to the Ni-NTA column was assessed by SDS- PAGE followed either by coomassie staining or Western blotting, using anti His monoclonal antibody (Fig. 3.1B). PEX5 was virtually completely soluble and purified close to the homogeneity in one step chromatography. About 18 mg of recombinant protein was purified from 1 liter of bacterial culture. Prolonged storage of isolated protein, however, resulted in the formation of precipitates.

Results

Figure 3.1 Expression and purification of recombinant TbPEX5 by metal affinity chromatography. (A) Schematic presentation of His-PEX5. Primary sequence of PEX5 contains three WxxxF/Y motifs on the N- terminal region which are potential binding sites for PEX14 and the SH3 domain of PEX13. Conserved C- terminal half contains seven TPR domains to bind PTS1 containing proteins. (B) His-PEX5 was expressed in E. coli and growth was continued for 5 hrs. After induction with IPTG, recombinant protein was isolated by Ni- NTA agarose and the elution fractions were analyzed by SDS-PAGE followed by coomassie staining or immunoblotting, using anti His antibody. Abbreviations used are: I0, before induction; I5, 5 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions ( 30X ) each having 1ml volume. Immidazol gradient is indicated as a bar. A strip of immunoblot, probed with anti His antisera indicated the recombinant PEX5 at the size of 90 kDa.

Immunoblotting revealed high degradation of PEX5 as detected by anti-His and anti Trypanosoma PEX5 antisera (data not shown). Addition of NaF to the lysis buffer efficiently inhibited extensive degradation. Coomassie stained SDS gel and Western blotting showed that recombinant PEX5 migrates at an apparent size of 90 kDa (Fig. 3.1B), whereas the calculated molar mass of PEX5 is 72 kDa. Similar aberrant migration behavior was also observed for the endogenous (de Walque et al., 1999) as well as N- and C-terminally His- tagged recombinant forms of full length T. brucei PEX5 (Gualdrón-López and Michels, 2013). Slow mobility on SDS-PAGE was attributed to the abundance of negatively charged residues as reflected by low isoelectric point (PI: 4.63) of TbPEX5.

Fractions enriched with PEX5 were subjected to the size exclusion chromatography (SEC). The samples were loaded on Superdex 200 column, pre-equilibrated with standard globular protein markers. The elution profile revealed that PEX5 displayed the hydrodynamic

Results properties of ~270 kDa globular protein, suggesting a tetrameric structure. Analysis with SDS-PAGE verified that components of the peak fractions migrate at the size of individual subunit of PEX5 (Fig. 3.2A). Similar results were also reported for Leishmania PEX5 (Jardim et al., 2002); a member of Trypanosomatidae family.

9.26x104

Figure 3.2 SEC-MALS analysis of His-PEX5. (A) His-PEX5 was subjected to the SEC and fractions were separated by SDS-PAGE followed by coomassie staining. Arrows specify molar masses of globular protein markers. Numbers indicate the retention volume of corresponding fractions. (B) MALS measurement of MM of corresponding elution volume of His-PEX5. The continuous line is a measure of UV absorbance at 280nM and the number above the UV trace indicates the MM of PEX5.

SEC considers the Stokes radius and shape of the molecule to estimate the molecular mass of protein which is calculated by calibration with elution volume of protein markers of known Stokes radii. These markers are globular proteins and can be a good reference to predict the

Results molar mass of smooth, spherical proteins. For elongated or asymmetrical shaped proteins, Stokes radius is increased and protein is eluted at higher molecular weight, disproportional to its actual mass.

Modern analytical approaches were applied recently and the solution structure of HsPEX5 was established as an elongated monomer (Shiozawa et al., 2009). Earlier it was concluded that an extended configuration of the N-terminal domain of HsPEX5 (Madrid et al., 2004) leads to the asymmetric shape of the protein (Costa-Rodrigues et al., 2005).

To address this issue, SEC coupled to the multi-angle light scattering (MALS) and differential refractive index (RI) detector was applied to measure an absolute molar mass (MM) and size of PEX5 in solution. This system was found useful and reliable to determine the molecular characteristics without any calibration standard (Bashari et al., 2013; Guo et al., 2010) and gives information about the size of molecule by measuring root mean square radius (RMS) or radius of gyration (Rg) of particles instead of hydrodynamic radius as measured by SEC. It also detects the homogeneity of the sample within the individual gel filtrated peak and calculates it as a polydispersity index (IPD). The shape of the molecule could be determined by the slope of logarithmic plot between MM and RMS.

The structural parameters measured by MALS are summarized in Table 3.1. SEC-MALS predicted the molar mass of peak fractions eluted with gel filtration column as 93 kDa, presenting PEX5 as a monomer in native conformation. The IPD index indicates that only one species of molecule was present in the peak fraction. The height of the peak corresponds to the UV absorbance and a clear signal indicates high concentration of the purified protein.

Parameters Retention Volume (ml) MMexp (g/mol) MMth (g/mol) IPD RMS (nm)

PEX5 11.7-12.8 9.26x104 7.20x104 1.010 19.9

Table 3.1 Relevant molecular parameters as produced by MALS analysis. Summarized are the calculated weight defined in terms of the average molecular weight (MMexp) estimated by MALS, theoretical molar mass

(MMth), polydispersity index (IPD) together with the average root mean square radius (RMS) of TbPEX5.

Analysis with blue native gel have shown that heterologously expressed PEX5 does not oligomerize (data not shown). Combining above mentioned observations with size exclusion chromatography and measurements with multi angle light scattering, it is concluded that TbPEX5 is a monomer that behaves as a non-globular protein.

Results

3.1.2 Native conformation of GAPDH; a PTS1 containing glycosomal enzyme

Recent experiments performed to explore PTS1 dependent import pathways demonstrated that PEX5 recognizes newly synthesized peroxisomal monomeric matrix proteins (Shiozawa et al., 2009), interacts with some oligomeric enzymes (Faber et al., 2002; Luo et al., 2008; Stewart et al., 2001) and transport artificial and naturally occurring heterodimers (Islinger et al., 2009; Tanaka et al., 2008). In certain cases, decreased oligomerization of matrix enzymes enhances their targeting to the peroxisomes (Luo et al., 2008; Tanaka et al., 2008) while under identical conditions other matrix proteins are imported in folded and even endogenous dimeric states (Faber et al., 2002).

In trypanosomes, the mechanism by which PEX5 interacts with cargos and displays preferences with respect to their oligomerization, if any, is not known. To gain insights into the structural basis of PEX5-PTS1 interaction, glyceraldehyde phosphate dehydrogenase (GAPDH); a T. brucei protein bearing PTS1 tripeptide, AKL, at the C-terminus was investigated. The GAPDH exists in two isoforms, named cytosolic and glycosomal. Only glycosomal isoenzyme (gGAPDH) contains PTS1 signal.

Recombinant proteins Solubility (approx.) Expression Yield Precipitation

His-TbgGAPDH 10% high High yes

GST-TbgGAPDH 5% high Undetectable N/A

MBP-TbgGAPDH 20% high high No

Table 3.2 Summary of different aspects of purification assays performed with varying tagged constructs of GAPDH. In each case, the E. coli transformants were grown for 8 h after induction with IPTG. The cells were harvested and mechanically disrupted by Emulsiflex. MBP-tag enhances the solubility of GAPDH whereas GST-GAPDH could not be purified on GSH agarose.

To purify recombinant proteins, several constructs bearing His, GST or MBP-tag fused to the amino terminus of TbgGAPDH were created and overexpressed in E. coli. A great fraction of the enzyme was associated with the inclusion bodies. Different fusions were tested, one after the other, to enhance the solubility and various approaches were employed to increase the yield of recombinant protein. Briefly, after inducing the culture with IPTG, purification was achieved by simple column affinity chromatography. Ni-NTA agarose, GSH sepharose or amylose resin were used to trap respective tagged version of GAPDH (Section: 2.14-2.16). Purification profile of MBP-GAPDH and GST-GAPDH is shown in supplementary figures

Results

S1 and S2, respectively. The results obtained with different purification techniques are summarized in Table 3.2.

Figure 3.3 Heterologous expression and purification of His-TbgGAPDH by metal affinity chromatography. (A) A schematic presentation of His-tagged construct of GAPDH depicts the presence of PTS1 stretch (AKL) on the C-terminus. (B) His-TbgGAPDH was overproduced in E. coli and induced with IPTG. His tagged proteins were purified on Ni-NTA agarose and the bound parts were eluted by linear gradient (1-100%) of 500 mM imidazol. Fractions from each step during the purification procedure were analyzed on 12.5 % SDS-PAGE followed by coomassie staining and Western blotting, using anti His antibody.

Abbreviations used are: I0, before induction; I8,. 8 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate the eluted fractions ( 60X concentrated ) each having 1ml volume. Immidazol gradient is indicated as a bar above the coomassie stained gel. A strip of blot, below the coomassie stained gel, indicates purified His-GAPDH at the size of 45 kDa.

His-GAPDH (the construct is described in Fig. 3.3A) was isolated from the soluble portion (Section: 2.15) of crude cell lysates. The efficiency of affinity chromatography was assessed by coomassie staining and immunoblotting, using anti His monoclonal antibody (Fig. 3.3B). An immune-reactive band of approximately 45 kDa was tightly bound to the column and eluted at 300-400 mM concentration of immidazol (Fig. 3.3B). The elution profile indicates highly pure protein without great loss of yield. A total of ~5mg of recombinant protein was isolated from 1 liter of heterologous (E. coli) culture. The purified protein was aggregating and therefore, used immediately.

Freshly purified protein was subjected to the size exclusion chromatography in order to elucidate the oligomeric state of GAPDH enzyme. The GAPDH peak appeared at an elution

Results volume of 14 – 15 ml whose molecular weight was estimated with calibration curve as 80 kDa (Fig. 3.4 A) which is approximately twice than the calculated mass of TbgGAPDH ORF.

9.32x104

Figure 3.4 SEC-MALS analysis of His-GAPDH. (A) SDS-PAGE analysis of elution fractions collected by size exclusion chromatography. Arrows indicate standard protein markers and numbers above the coomassie stained gel indicate corresponding retention volume. (B) MALS measurement of MM of GAPDH. Continuous peak corresponds to the UV absorption at 280nM and trace above the peak indicates MM of GAPDH. A low peak expresses smaller concentration of GAPDH was loaded onto the column.

In order to confirm the oligomeric state of GAPDH, the molecular weight of TbgGAPDH was analyzed by means of SEC-MALS-RI system. The weight average molar mass (Mw) of GAPDH elution peak was determined as 93 kDa (Table 3.3). This value is equivalent to the two fold molar mass of the gene sequence (including the tag and the linker), suggesting that GAPDH exists as a dimer in solution. SDS-PAGE analysis demonstrated that peak fractions migrate as monomeric subunits of GAPDH (Fig. 3.4A). The low value of IPD index

Results indicated that weight is narrowly dispersed in solution and dimer exist as a single population of molecules in peak fragments. In Table 3.3, relevant parameters are summarized.

Parameters Retention Volume (ml) MMexp (g/mol) MMth (g/mol) IPD RMS (nm)

His-GAPDH 14.3-15.2 9.32x104 4.50x104 1.010 34.8

Table 3.3 Biophysical parameters regarding the structure of His-GAPDH by MALS analysis. Shown are the theoretical MM (MMth) of GAPDH and the calculated weight (MMexp), polydispersity index (IPD) and average root mean square radius (RMS), as measured by MALS in corresponding peak retention volume.

SEC-MALS was carried out with MBP-GAPDH and the results obtained agreed with a dimeric structure of the glycolytic enzyme (Fig. S3A). Together these findings exhibit the native conformation of glycosomal isoform of GAPDH as a homo-dimer.

3.1.3 PEX5 makes a stable complex with GAPDH in vitro

The function of PEX5 to bind PTS1 proteins is conserved among species (Gurvitz et al., 2001). This interaction was investigated in T. brucei peroxisomal proteins. Recombinant proteins (His-TbPEX5 and MBP-TbgGAPDH) were expressed in E. coli and purified on Ni- NTA agarose or amylose resin, respectively (see Fig. 3.1 and S1). His-TbPEX5 was immobilized on Ni-NTA agarose and incubated with MBP-GAPDH or MBP alone, as a control. After extensive washing of beads, the bound parts were collected by immidazol and visualized by coomassie staining (Fig. 3.5). A highly pure complex of His-PEX5 and MBP- GAPDH was observed (lane 8) in fractions recovered with His-PEX5. PEX5 co-eluted with MBP-GAPDH (lane 8) but not with MBP (lane 4) indicates that the interaction was specifically initiated by GAPDH. The amount of PEX5 recovered in complex with MBP- GAPDH (lane 8) was approximately 8 fold less than the amount of corresponding elution fraction when PEX5 was incubated with MBP (lane 4). This leads to the assumption that His- PEX5 - MBP-GAPDH complex triggers the allosteric hindrance of His tag of PEX5 so that its accessibility to Ni-NTA agarose is greatly reduced. About 15% of the His-PEX5 was recovered in mixture with MBP-GAPDH while 70% of His-PEX5 was eluted when incubated with MBP protein.

Results

Figure 3.5 Pull down assay to determine the interaction between PEX5 and GAPDH. An equimolar amount (5µM each) of recombinant proteins were mixed to a final volume of 1200ul. The formation of complex was achieved by incubating the components at 4°C. His-PEX5 along with the associated components was purified on Ni-NTA agarose as 100 l fractions. The fractions recovered with PEX5 were loaded on 12.5% SDS-PAGE and stained with coomassie brilliant blue. Equivalent amount at each step of binding assay was loaded. Abbreviations: L, load; F, flow through; W, wash; E, eluate. Eluate fractions were 12X enriched.

3.1.4 Molecular weight analysis of PEX5-GAPDH complex

To further characterize the PEX5-GAPDH interaction, the molecular weight of GAPDH was analyzed in the presence and absence of PEX5 by SEC-MALS. Purified His-GAPDH alone as well as the same concentration of His-GAPDH in combination with PEX5 was subjected to size exclusion chromatography. A comparison of elution profile of His-GAPDH and mixture of PEX5 and His-GAPDH revealed a huge shift in the elution peak of His-GAPDH from a retention volume of 15.0 ml to 12.0 ml (Fig. 3.6B), indicating the formation of higher

Results molecular weight complex between PEX5 and GAPDH in solution. The corresponding molecular weights as determined from calibration curve were estimated as ~60 kDa and ~270 kDa, respectively. Interestingly, a second peak comprising aggregates of GAPDH was also observed, only when PEX5 was present (Fig. 3.6B, Fraction 9).

1.31x105 9.32x104

Figure 3.6 SEC-MALS analysis of formation of the complex between PEX5 and GAPDH. (A, B) the immunoblot analysis using anti-His antisera of elution fractions collected by size exclusion chromatography of (A) GAPDH and (B) PEX5-GAPDH mixture. Arrows indicate standard protein markers. Numbers correspond to the fractions collected on superdex 200. (C) A graphical presentation of MALS measurement of MM of GAPDH in comparison with mixture of PEX5 and GAPDH. Continuous peak corresponds to UV absorbance at 280nM and trace above the peak indicates MM of the corresponding components.

Results

To determine the relevance of these molar weights with respect to the stoichiometry of the complex, SEC-MALS-RI system was used. SEC was performed again with His-GAPDH alone and with a complex of PEX5 and His-GAPDH. The results obtained are described in Table 3.4. Briefly, the MM value detected by MALS corresponding to the elution peak of His-GAPDH was found to be 93 kDa, twice than the theoretical mass of His-GAPDH, suggesting GAPDH exists as a dimer. MALS predicted the MM of the elution peak corresponding to the complex of PEX5 and His-GAPDH as 131 kDa. It was assumed that PEX5 (MMexp: 92 kDa) and His-GAPDH (MMexp: 46 kDa) are forming a complex in a stoichiometric ratio of 1:1. This also implies that GAPDH which is a dimer in the absence of PEX5 modulated into a monomeric shape in the presence of PEX5. The low value of IPD index suggested a uniform population of molecules within the gel filtrated peak fraction of the complex.

To strengthen our opinion that PEX5 induces the modulation of quaternary structure of GAPDH, I have performed the SEC-MALS analysis with MBP-GAPDH, a different fusion construct, in the presence and absence of PEX5. The results obtained are described in supplementary Figure. S3. The structural parameters measured by MALS are summarized in Table S2. These results demonstrate that MBP-GAPDH is a dimer which is dissociated into a monomer after binding with PEX5 (See Fig. S3 and Table S2).

Taken together, these observations suggest that GAPDH is a homo-dimer which makes a binary complex with PEX5 in a binding stoichiometry of 1:1. It is also observed that GAPDH undergoes a dimer-monomer transition which is triggered after binding with PEX5.

Parameters Retention Volume (ml) MMexp (g/mol) MMth (g/mol) IPD RMS (nm)

GAPDH 14.1-15.0 9.32x104 4.50x104 1.002 34.8

PEX5-GAPDH 11.6-12.5 1.31x105 1.35x105 1.008 47.6

Table 3.4 A comparison of biophysical parameters of His-GAPDH in the absence and presence of PEX5 as calculated by MALS. The calculated molar weight of GAPDH was reduced to one half upon binding with

PEX5. Low value of IPD index suggests that complex exist as a homogenous mixture. Abbreviations: MMth, theoretical molar mass; MMexp, experimental molar mass; IPD, polydispersity index; RMS, root mean square radius.

Results

3.1.5 Binding stoichiometry of PEX5-PEX14 complex

In mammals, PEX14 is known to exist as a homo-oligomer (Su et al., 2010) and its interaction with PEX5 is mediated by conserved diaromatic pentapetide (WxxxF/Y) repeats of PEX5 (Neufeld et al., 2009; Schliebs et al., 1999).

In order to characterize the molecular interaction in T. brucei counterparts of PEX5 and PEX14, a GST fusion construct of T. brucei PEX14 (residues 1-78), named GST-PEX14N, was heterologously expressed in E. coli and purified by means of GSH sepharose. The elution fractions were analyzed by SDS-PAGE followed by coomassie staining as well as by Western blotting, using anti GST- GFP antibodies (Fig. 3.7). The recombinant protein was recovered almost completely from the soluble portion, close to the homogeneity in one step chromatography. Typically ~22 mg of pure protein could be achieved from 300 ml bacterial culture under the conditions used.

Figure 3.7 Heterologous expression and purification of GST-PEX14N on GSH sepharose. Recombinant protein was expressed in E. coli and supernatant portion (see methodology, Section: 2.14) was loaded on GSH sepharose. GST tagged proteins bound to column were eluted by glutathione and finally by laemmli sample buffer. Fractions from each step were analyzed by SDS-PAGE followed by coomassie staining. An immunoblot analysis was performed, using anti GST-GFP antibodies, to confirm the isolation of specific recombinant protein. Each well receives the similar amount of protein except the eluate fractions which are 15 fold concentrated. Abbreviation: I0, before induction; I6, 6 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions, each having 1ml volume; Esds, eluation with laemmli sample buffer.

Results

To determine the capacity of PEX14 to bind with PEX5, purified GST-TbPEX14N was mixed either with buffer or with the recombinant PEX5 and subjected to the size exclusion chromatography. Comparison of elution profiles depicts that mixture of components was gel filtrated as an early eluting species (Fig. 3.8B, fraction 12) while GST-TbPex14N, in the absence of PEX5, migrated as a late peak (Fig. 3.8A, fraction 18). Interestingly, a second peak was also observed (Fig. 3.8B, fraction 9) which is indicative of higher molecular weight complex between PEX5 and PEX14N. Our analysis demonstrated that N terminal domain of PEX14 is sufficient to convey an interaction with PEX5.

Figure 3.8 Size exclusion chromatography of GST-PE14N in the absence and presence of full length of recombinant PEX5. GST-PEX14N alone (A) or in mixture with His-PEX5 (B) were loaded on superdex 200, equilibrated with a buffer containing 50 mM Tris, 150 mM NaCl, pH 8.0 and allowed to run at a flow rate of 0.5 ml/min. The components of peak fractions were separated by 12.5 % SDS-PAGE and stained by coomassie brilliant blue. Arrows indicate the positions of globular proteins used as molecular mass standards.

The native oligomeric state of PEX14 and binding stoichiometry of PEX5-PEX14 complex was determined. GST itself is a dimeric protein (McTigue et al., 1995) and could interfere in molecular weight analysis of PEX14-PEX5 complex.

To avoid this uncertainty, a fusion construct with a His-tag at the N-terminus of T. brucei PEX14 (residues 1 to 147), termed as His-PEX14 (1-147), was overproduced in E. coli.

Results

Recombinant His-PEX14 (1-147) was isolated by Ni-NTA affinity column (for purification profile, see Fig. 3.16) and subjected to the size exclusion chromatography alone or in the presence of equivalent amount of His-PEX5.

1.41x105

2.82x104

Figure 3.9 SEC elution profile and MALS measurements of His-PEX14 (1-147) and His-PEX14 (1-147) - PEX5 complex. Equivalent amount of His-PEX14 (1-147) separately or in complex with full length PEX5 were loaded on superdex 200. The components of gel filtrated fractions of His-PEX14 (1-147) (A) or a mixture of His-PEX14 (1-147) and PEX5 (B) were size fractionated on SDS-PAGE followed by coomassie staining. (C) The continuous line corresponds to the UV absorbance at 280nM while the numbers above the trace represents the molar weights of the corresponding samples as calculated by MALS.

Results

The results obtained are presented in Fig 3.9. SEC analysis indicated that PEX14 (1-147) and mixture of equimolar amounts of PEX5 and PEX14 (1-147) were eluted at a retention volume of 15.5 ml and 11.5 ml, respectively. A huge shift in the migration behavior of PEX14 (1- 147) was observed in the presence of PEX5, suggesting that PEX5 has recruited PEX14 (1- 147).

As MM of PEX5 could not be determined by size exclusion chromatography (discussed in Section: 3.1.1), SEC-MALS-RI system was used to determine the stoichiometry and molecular weight of this complex. The results obtained with relevant parameters are summarized in Table 3.5. The molecular weight of His-PEX14 (1-147) was estimated as 28 kDa, approximately double than its calculated MM (16 kDa), suggesting a dimeric structure. This observation is consistent with the reported homo-dimeric form of LdPEX14 (Cyr et al., 2008). The peak elution limit of His-PEX14 (1-147) also gave the same MM when estimated by standard globular protein markers, predicting a globular and spherical shape. As truncated version of PEX14 was purified, the sequence elements responsible for the oligomerization of PEX14 are limited in residues 1-147.

SEC-MALS determined the MM of PEX5-His-PEX14 (1-147) complex at a retention volume of 11 ml as 141 kDa (Fig. 3.9) while MM of PEX5 alone was 93 kDa (see Fig. 3.2). Comparison of RMS radii of PEX14 (1-147) and the mixture of PEX5-PEX14 (1-147) depicts minor change in size in spite of a huge change in the molecular weight. This is an indicative of compact structure of the complex. It is estimated that PEX5-PEX14 (1-147) complex (141 kDa) comprises one PEX5 (MMexp: 92 kDa) and four PEX14 (1-147) subunits (MMexp: 56 kDa), leading to the hetero-oligomeric structure. This situation could best be explained by the presence of three WxxxF/Y motifs in TbPEX5 sequence. Only 1st and 3rd WxxxF/Y motifs were shown to bind PEX14 in vitro (Choe et al., 2003). Such a molar ratio of 1:4 in PEX5:PEX14 complex was also observed in Leishmania (Cyr et al., 2008).

Parameters Peak ranges (ml) MMexp (g/mol) MMth (g/mol) IPD RMS (nm)

PEX14(1-147) 15.4-16.4 2.82x104 3.21x104 1.003 25.3

PEX14(1-147)-PEX5 10.9-11.7 1.41x105 1.08x105 1.007 27.0

Table 3.5 A summary of molecular parameters of His-PEX14 (1-147) and His-PEX14 (1-147)-PEX5 complex in terms of theoretical molar mass (MMth), experimental molar mass (MMexp), polydispersity index (IPD) and root mean square radius (RMS) as measured by MALS.

Results

3.1.6 Cargo-loaded PEX5 docks on PEX14N

PEX5 not only recognizes PTS1 in the cytosol but also facilitates its docking and translocation across the peroxisomal membrane. The peroxins comprising docking complex are PEX13 and PEX14 (Agne et al., 2003). In order to determine the role of PEX14; a likely candidate of docking or cargo dissociation factor in T. brucei and to investigate the sequence of events, based on protein-protein interactions in PEX5 dependent import pathway, the binding affinity of PEX14 with PEX5 was assessed in the presence and absence of PTS1 ligand.

Figure 3.10 Interactions of PEX14N with cargo-unloaded and cargo-loaded PEX5. In vitro binding assay was performed using fusion proteins GST-PEX14N (160 µg), GST (120 µg), PEX5 (210 µg) and His-GAPDH (120 µg). GST-tagged proteins, bound to the GSH sepharose were pulled down. The fusion proteins along with associated polypeptides were analyzed by SDS-PAGE followed by coomassie staining. The components added to the pull down reactions are mentioned above. Asterics indicate the degradation products of PEX5.

An in vitro binding assay was performed and each of GST-PEX14N or GST alone were immobilized on GSH sepharose and mixed either with His-PEX5 or His-GAPDH. Formation of the ternary complex was achieved in two ways; either PEX5 was incubated with GST- PEX14N and then GAPDH was loaded onto the column or a preformed complex of PEX5 and GAPDH was loaded upon immobilized GST-PEX14N. About 70% of the GST tagged proteins were recovered in eluate fractions. The GST fusion proteins along with associated factors were analyzed by SDS-PAGE followed by coomassie staining (Fig. 3.10). The control

Results incubations did not show any binding of PEX5 or GAPDH with GST (lane1, 2). His-PEX5 was found in fraction recovered by GST-PEX14N (lane 3). Whereas, no such interaction was observed with His-GAPDH except a tiny amount was associated which is visible probably due to an unspecific interaction (lane 4). A ternary complex was observed irrespective of the order of mixing of the components, revealing that PEX14 can bind with PEX5 in the presence of cargo-protein (lane 5, 6). A preformed PEX5-GAPDH complex loaded on PEX14N showed comparable affinity between PEX5 and GST-PEX14N (lane 5) as compared to the reaction mixture where GAPDH was incubated on PEX5 - GST-PEX14N complex (lane 6). Cargo unloading feature of PEX14N was not evident from the results obtained from pull down assay.

Figure 3.11 SEC analysis of PEX14N as a PTS1-dissociation factor. Recombinant proteins were affinity purified and assessed for their ability to make complexes, using SEC analysis. His-PEX5 (240ug) and His- GAPDH (80ug) were incubated on ice for 30 min to generate a complex (A), or a preformed complex between similar amounts of proteins was incubated with GST-PEX14N (120ug) (B), and finally, to test an unspecific binding of GAPDH and GST-PEX14N, both proteins were mixed as stated above (C). All mixtures were subjected to SEC on superdex 200 column, equilibrated with 50 mM Tris, 150 mM NaCl, pH 8.0 at a flow rate of 0.5 ml/min. Protein elution was monitored spectrophotometrically at 280 nm. Arrows indicate the positions of globular proteins used as molecular mass standards.

Results

SEC was employed to identify a potential role of PEX14N in releasing a cargo. Purified proteins, PEX5 and GAPDH were mixed and subjected to SEC analysis. Similar amounts of PEX5 and GAPDH were incubated on ice and allowed to assemble a complex. Afterwards, GST-PEX14N was added to the preformed complex and size exclusion chromatography was performed with this mixture. In the absence of PEX14N, PEX5-GAPDH complex was observed at a retention volume of 11.5-12 ml (Fig. 3.11A, fraction 13, 14). In the presence of PEX14N, maximum of PEX5 was present at a retention volume of 11 ml in complex with PEX14N (Fig. 3.11B, fractions 11, 12). In these fractions, a tiny amount of GAPDH was also associated. Under these conditions, a vast majority of GAPDH was associated with PEX5 (Fig. 3.11B, Fraction 14, 15). A ternary complex was achieved, at higher molecular weight fraction (Fig. 3.11B, Fraction 8-10).

MALS predicted 4 distinct peaks despite a mild overlap of components which is visible by coomassie staining (Fig. 3.11B). On the basis of MALS calculations (Table 3.6) and SDS- PAGE analysis (Fig. 3.11B) of individual components in peak ranges, a possible interpretation is that peak1 depicts a ternary complex of PEX5:PEX14N:GAPDH in a molar stoichiometry of 1:4:1. Similarly, peak2 and Peak3 are equivalent to the complexes of PEX5:PEX14N as 1:4 and PEX5: GAPDH as 1:1molar ratio, respectively. The components of peak4, presenting the MM of monomeric GAPDH, were undetectable on SDS-PAGE presumably due to a low sensitivity of coomassie staining.

Parameters Peak Elution (ml) MMexp(g/mol) MMth (g/mol)

PEX5-GAPDH - 11.6 - 12.5 1.31×105 1.37×105

1 10.0 – 10.5 3.21×10 5 2.77×10 5

PEX5-GAPDH 2 10.9 – 11.2 2.55×10 5 2.32×10 5

plus PEX14N 3 11.7 – 12.5 1.21×105 1.38×10 5

4 15.6 – 16.5 4.91×104 4.51×10 4

Table 3.6 Comparison of the MALS measurements of PEX5-GAPDH complex in the absence and presence of PEX14N. A mixture of PEX5 and GAPDH was co-eluted at the size of 131 kDa. In the presence of PEX14N, all three components appeared in four peaks as different molecular weight composition (second last column, MMexp) whose stoichiometry was compared with theoretical MM of corresponding complexes (last column, MMth). Abbreviations: MMth, theoretical molar mass; MMexp, experimental molar mass; IPD, polydispersity index and RMS, root mean square radius

Results

Together, this data did not yield significant results regarding binary and ternary complexes, largely due to the lack of sharp and well defined peaks. Pull down and SEC analysis exhibited that PEX14N make stable complexes with cargo-bound/unbound PEX5, suggesting that it acts as docking site for the cargo-loaded PEX5. However, a role of PEX14N as a cargo dissociation factor could not be demonstrated. The possible factors involved are discussed in Section: 4.1. Summary of the molecular events regarding the interaction of PEX5 with its cargo and docking partner is presented in Fig. 3.12.

Figure 3.12 Schematic presentation of interactions of PEX5 with PTS1-moiety and PEX14N. PEX5 binds with GAPDH (a PTS1 ligand) through TPR domains of the conserved C-terminal region. Later, cargo bound complex associates with the membrane by an interaction which is mediated by 1st and 3rd WxxxF/Y stretches of PEX5 (Choe at al., 2003) and N-terminal conserved core of PEX14

3.1.7 Domain mapping of PEX14 for interaction with docking partner PEX13

Peroxisomal membrane proteins PEX13 and PEX14 are components of the docking complex (Agne et al., 2003) which facilitates the insertion and cargo translocation processes of matrix proteins. Schematic presentation of specific molecular features of T. brucei PEX13.1 and PEX14 are shown in Fig. 3.13.

In yeast, PEX13 is reported to interact via its SH3 domain with PXXP ligand localized to the N-terminal region of PEX14 (Pires et al., 2003). In T. brucei, PEX13.1 depleted cell lines exhibited mislocalization of PEX14 to small granular particles (Verplaetse et al., 2012). However, a direct interaction between T. brucei orthologues of PEX13 and PEX14 has not

Results yet been demonstrated. Moreover, the role of a peculiar PTS1 tripeptide of PEX13.1 is also not yet known.

Figure 3.13 Structural features of TbPEX13.1 and TbPEX14 sequences. (A) T. brucei PEX14 is a peripheral membrane protein with conserved N-terminal domain, a putative proline rich ligand located upstream of the transmembrane segment followed by coiled coil region and an ill conserved C-terminus. (B) PEX13.1 is an integral membrane protein having YG repeats (tyrosin and glycin) located in the N-terminal domain of which the function is not known. Two putative transmembrane domains are located in the middle part while intra-trans membrane loop is predicted to possess a binding site for PEX19. C-terminus contains an SH3 domain followed by four residues LERE and a PTS1 resembling sequence, TKL.

Figure 3.14 Schematic figures of truncated constructs of Trypanosoma brucei PEX14 and PEX13.1 (A) An N-terminal His-Tagged versions of PEX14 encompassing residues 1-147 including conserved region and a PXXP ligand. (B) A shorter version of PEX14 without PXXP. (C) An N-terminal GST fusions of an SH3 domain of PEX13.1 and (D) SH3 domain along with terminal PTS1 sequence, TKL.

Results

Our preliminary studies performed with yeast two hybrid assay displayed an interaction between full lengths of T. brucei PEX13.1 and PEX14 fused to GAL4 activation domain (AD) and GAL4 binding domain (BD), respectively (see Fig. 3. 26B). In order to investigate the protein-protein interactions in more detail, an in vitro binding assay was applied. For this purpose, two GST fusion constructs of PEX13.1 were created; one comprising amino acid residues from 325 to 384, designated as GST-PEX13SH3 and second construct comprising the amino acid residues 325 to 391, named as GST-PEX13SH3TKL (Fig. 3.14 C, D). Also, Two His-tagged truncated versions of T. brucei PEX14 were generated; one comprising residues 1-84 termed as His-Pex14 (1-84) while the other composed of aa 1-147 designated as His-Pex14 (1-147) (Fig. 3.14 A, B).

Figure 3.15 Expression and purification of GST-tagged SH3 domain (A) and SH3TKL (B) from E. coli. The samples from each step were analyzed by coomassie staining and immunoblotting, using anti GST-GFP antisera. Recombinant proteins were expressed in bacterial cells. After 8 h of induction with IPTG, the cells were harvested. Homogenates (H) fraction was separated in soluble (S) and insoluble part (P). Cytosolic fraction was loaded on the column and unbound parts were collected as Flow through (F) while the bound fractions (E) were recovered by 20mM glutathione after extensive wash steps (W). Eluates were 10X concentrated.

I0, before induction; I8, 8 h after indution

To obtain a high yield of homogenous proteins, recombinant domains of PEX13 were heterologously expressed and a soluble fraction (see methodology, Sections: 2.14) was applied on GSH sepharose. The quantity as well as purity of GST fusion proteins, bound to the column, was checked by SDS-PAGE analysis followed by coomassie staining and Western blotting, using anti GST-GFP antibodies (Fig. 3.15). The solubility of SH3 domain was increased by three fold when LERE-TKL sequence was added (compare the pellet fraction of both constructs) (Fig. 3.15). Under experimental conditions used, a total of ~7mg of GST-PEX13SH3 and ~18 mg of GST-PEX13SH3TKL was obtained from 300 ml bacterial

Results culture. Interestingly, GST-PEX13SH3 was precipitated when stored for longer than one week.

His-PEX14 (1-84) and His-PEX14 (1-147) were purified on Ni-NTA agarose and analyzed by SDS-PAGE followed by coomassie staining. Both His-PEX14 (1-147) and His-PEX14 (1- 84) migrate at an apparent size of 17 kDa and 12 kDa, equivalent to their calculated molar weights, respectively (Fig 3.16). A total of 500 ml induced bacterial culture yielded ~10 mg of His-PEX14 (1-84) and ~4 mg of His-PEX14 (1-147) protein.

Figure 3.16 Heterologous expression and purification of His-tagged versions of PEX14 (1-147) (A) and PEX14 (1-84) (B). Expression of recombinant proteins was induced with IPTG and the soluble part of cell lysates were used to capture His-tagged proteins on Ni-NTA agarose followed by elution with linear gradient (1- 100%) of 300mM immidazol. An immunoblot analysis was applied to confirm the specificity of the purification, using anti His antisera. Abbreviations used are: I0, before induction; I5, 5 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions ( 30X ) each having 1ml volume. Immidazol gradient is indicated as a bar.

A pull down assay using purified proteins was performed to elucidate the protein-protein interactions between SH3 domain of T. brucei PEX13.1 and varying length regions of T. brucei PEX14. GST-PEX13SH3 or GST alone, as a control, were immobilized on GSH sepharose beads followed by incubation with affinity purified His-PEX14 (1-84) or His- PEX14 (1-147). Equivalent amounts of purified proteins were incubated to allow the quantitative assessment.

The beads were washed to remove unspecific bindings. The GST fusions along with associated partners were eluted and separated by SDS-PAGE followed by coomassie staining (Fig. 3.17). His-PEX14 (1-84) was absent in the fractions recovered with GST-PEX13SH3 (Fig. 3.17A) while His-PEX14 (1-147) was detected in the elution fraction of GST- PEX13SH3 (Fig. 3.17B). The binding of PEX14 (1-147) to SH3 domain was specific as GST alone has not recruited PEX14 (1-147) (Fig. 3.17B, lane 3, 4). This clearly indicates that the

Results binding properties of SH3 domain required region of PEX14 from AA 84 to 147. About 70% of the GST fusion proteins were recovered in the binding assay.

Figure 3.17 Domain mapping of PEX14 involved in interaction with PEX13SH3. GST fused with the SH3 domain of PEX13.1 was incubated with recombinant truncated versions of His-PEX14 (1-84) or His-PEX14 (1- 147). After a thorough washing, proteins bound to the sepharose beads were analyzed by SDS-PAGE followed by staining with coomassie brilliant blue. (A) His-PEX14 (1-84) does not interact with the SH3 domain (lane 8, 10) and detected as an unbound fraction (lane 4). (B) His-PEX14 (1-147) is present in the fractions recovered with GST-SH3 (lane 7, 8) while the same recombinant protein was found in flow through when mixed with GST (lane 2), as a control. Abbreviations used are: L, load (input mixture); F, flow through (unbound material); W, wash; and E, Eluate. Eluates are 20X enriched.

Results

3.1.8 PEX5 allosterically dissociates the docking complex

PEX13, being a part of docking complex, provides an interaction site for PEX5 as well as for PEX14. Such an interaction was shown by the N-terminal domain of PEX13 in Chinese hamster (Otera et al., 2000) while in yeasts (S. cerevisiae and P. pastoris) and homo sapiens, SH3 domain provides the binding site (Bottger et al., 2000; Costa-Rodrigues et al., 2005; Urquhart et al., 2000) for one of the WxxxF/Y motif of PEX5.

Figure 3.18 Disassembly of docking complex by competitive binding of PEX5. 5µM of GST-PEX13SH3 or GST alone, as a control, were added with equivalent amounts of His-PEX5 and His-PEX14 (1-147) in a reaction volume equal to 1ml. Similar amounts of both recombinant proteins were mixed and allowed to generate a complex. The preformed complex was incubated with 1.25 and 2.50 µM of PEX5. The components captured on GSH sepharose were eluted, as 80µl fractions, with 20mM glutathione and assessed on SDS-PAGE. Abbreviations: L, load; F, flow through; E, Eluates. Eluates are 12X enriched.

Earlier in this studies, it was shown that PEX14 binds with PEX5 via N-terminal domain (see Fig. 3.8) as well as with PEX13 via an uncharacterized putative PXXP stretch situated in the region spanning from residues 84 to147 (Fig. 3.17). An in vitro competition assay was applied to determine the potential ability of PEX5 to disassemble the docking complex. For this purpose, a preformed complex of GST-PEX13SH3 and His-PEX14 (1-147) was incubated with increasing amounts of His-PEX5 such that the molar concentration of PEX5 was 4 or 2 fold fewer than SH3 and PEX14 (1-147), respectively. Those proteins which were associated with GST or GST-PEX13SH3 have been collected, resolved on SDS-PAGE and visualized by coomassie staining (Fig. 3.18). Almost 70% of GST fusions were recovered. His-PEX14 (1-147) was detected in GST-PEX13SH3 fraction (lane 15, 16) while PEX5 did not bind to the SH3 domain under similar conditions (lane 11, 12). The addition of PEX5 inhibited the binding of PEX14 and SH3 domain at 1.25µM conc. (lane 19, 20), though a small amount of PEX14 (1-147) was still associated. An increased amount of PEX5 (2.5µM)

Results abolished the binding completely (lane 23, 24). Despite the different binding surfaces of PEX5 and SH3 domain on PEX14, lower binding affinity between PEX13 and PEX14 resulted in dissociation of SH3-PXXP ligand upon incubation with PEX5.

3.1.9 PEX5 interacts with PEX13 in a PTS1 dependent manner

PEX13-PEX5 interaction is well conserved among different organisms and proven crucial for matrix proteins import. Such an interaction was not observed between PEX5 and the SH3 domain of PEX13.1 in T. brucei. The presence of a PTS1 resembling sequence, TKL, in the primary structure of TbPEX13.1 and an evolutionary conservation of this motif among Trypanosomatids suggests a specific function which is very likely in docking or translocation of PTS1 containing glycosomal polypeptides. To understand the function of TKL motif of PEX13.1, both the SH3 and SH3TKL domains of PEX13.1 were purified (constructs are described in detail in Fig. 3.14 C, D) by affinity chromatography (Fig. 3.15 A, B).

Figure 3.19 PTS1-dependent interactions of PEX5 and PEX13.1. GST-tagged domains of PEX13.1 comprising either SH3 or SH3TKL sequence were immobilized on GSH sepharose and incubated with recombinant PEX5. The proteins bound to the column were eluted and analyzed by SDS-PAGE followed by coomassie staining. PEX5 was recovered in association with GST-PEX13SH3TKL constructs (lane 6) but absent in fraction eluted with SH3 (lane 5). Abbreviation: L, load; F, flow through; E, eluate. Eluates were 20X enriched than input

Results

The capacity of TKL to bind PEX5 was determined by pull down experiment. GST- PEX13SH3 or GST-PEX13SH3TKL were immobilized on GSH sepharose and incubated individually with His-PEX5. SH3 domain does not bind with PEX5 (Fig. 3.19, lane 5) and therefore was used as a control. GST fusions bound to the column were analyzed by SDS- PAGE. It was estimated that 70% of GST-PEX13SH3 and 60% of GST-PEX13SH3TKL was recovered in eluate fractions. His-PEX5 was detected in fraction recovered by GST- PEX13SH3TKL (Fig. 3.19, lane 6) but not in GST-PEX13SH3 (lane 5). This depicts that occurrence of TKL on PEX13.1 is responsible for binding with PEX5.

3.1.10 Pre-loaded PEX5 does not bind PEX13.1

An interaction between docking partners is largely influenced by cargo- bound / unbound PEX5, in yeasts and mammals (Bottger et al., 2000; Costa-Rodrigues et al., 2005). This studies revealed certain aspects of PEX13.1-PEX5 interaction which are specific to T. brucei e.g. a candidate PTS1, TKL, on PEX13.1 is responsible for conveying an interaction with PEX5. One possible role that could be assigned to this motif is the competitive binding to PEX5 in order to detach the cargo-proteins.

To investigate the role of PEX13.1TKL in mediating cargo import process, downstream to the PEX5-cargo interaction, a competitive binding assay was performed using purified recombinant proteins; GST-PEX13SH3TKL, His-PEX5 and His-GAPDH (PTS1 ligand).

To compare the binding affinity of PEX13.1 to interact with bound and unbound PEX5, GST fusions and associated proteins were size fractionated on SDS-PAGE and identified by Western blotting analysis, using either His or GST specific antisera (Fig. 3.20). Equivalent amounts from input and unbound fractions was also resolved on SDS-PAGE and probed by Western blotting (Fig. 3.20B). The proteins recovered with GST alone could not be detected by anti-His antibody (Fig. 3.20A, lane 1, 2). GST-PEX13SH3TKL captured His-PEX5 (Fig. 3.20A, lane 3), though a significant amount of GAPDH was also associated with PEX13SH3TKL as observed in lane 4. Interestingly, PEX13.1 does not recruit PTS1 bound PEX5 (Fig. 3.20A, lane 5). On the other hand, PEX5-PEX13SH3TKL complex still have the capacity to bind GAPDH (Fig. 3.20A, lane 6).

Results

Figure 3.20 PEX13.1 does not interact with cargo-loaded PEX5 in vitro. Each recombinant protein was mixed to a final conc. of 2uM. GST alone, as negative control, or GST-PEX13SH3TKL were incubated either with His-PEX5 or His-GAPDH. The formation of the ternary complex was achieved in two ways; either a preformed PEX5-GAPDH complex was loaded on immobilized GST-PEX13SH3TKL (lane 5) or PEX5 was allowed to bind first with GST-PEX13SH3TKL and then His-GAPDH (lane 6) was loaded on it. The bound parts were immuno-detected, using anti-His antisera (upper panel of each step of the binding assay) followed by stripping of the blot and Western blotting with anti-GST antisera (lower panel in each step of binding assay). (A) Shown are the Eluates fractions (E1) and (E11) and (B) load and Flow through (FT) as probed with anti-His and anti-GST antibodies.

Results

3.2 Functional characterization of Trypanosoma bruci PEX19

PEX19 is largely a cytosolic protein (Jones et al., 2004) but a small amount is transiently associated with peroxisomal membranes (Matsuzono et al., 1999; Sacksteder et al., 2000a). PEX19 binds newly synthesized peroxisomal membrane proteins (PMPs) through their membrane peroxisomal targeting signals (mPTS) in the cytosol and carries them to the peroxisomes for subsequent insertion into the membrane. The mechanism of PMPs targeting is still poorly defined.

Recently, genome database searches led to the identification of T. brucei orthologue of PEX19 (Banerjee et al., 2005; Yernaux et al., 2006) which shares a low sequence identity (15-16%) to its human counterpart. The PEX19 knockdown resulted in slower growth of the parasites (Banerjee et al., 2005), implying the essentiality of this protein in glycosomal biogenesis. The presence of a CAAX box at the C-terminal end of PEX19 in yeast and human is essential for efficient targeting of PMPs to the peroxisomes (Götte et al., 1998; Matsuzono and Fujiki, 2006). Noteworthy, Trypanosomatids PEX19s lack any farnesylation sequence which is defined by the carboxy terminal sequence, CAAX. Moreover, cross species targeting of PMPs does not seem to be conserved between humans and T. brucei (Saveria et al., 2007). This further suggests that some aspects of PMP targeting might be different between human and trypanosomes which could serve as a potential drug targets against Trypanosomiasis.

3.2.1 Functional complementation of PEX19 in Saccharomyces cerevisiea

∆pex19 cells do not contain detectable peroxisomes and PMPs are miss-targeted to the cytosol where they are rapidly degraded (Götte et al., 1998; Hettema et al., 2000). The question arose whether or not the T. brucei orthologue of PEX19 is able to rescue the peroxisomal biogenesis defect in yeast deletion strain. The similarity of functions of TbPEX19 was tested by cross-species complementation assay. Expression of Trypanosoma PEX19 (Fig. 3.22B) did not rescue the growth defect of ∆pex19 mutants (Fig. 3.22A).

Results

Figure 3.21 Expression of TbPEX19/PEX19CAAX does not restore peroxisomal import defect in yeast deletion strains. Immunofluorescence analysis of ∆pex19 cells co-transformed with DsRed-SKL (a peroxisomal matrix protein marker) and yeast as well as T. brucei PEX19. A characteristic punctate pattern indicating peroxisomes in cells harboring the plasmids encoding ScPex19 while a diffuse cytosolic staining is observed in TbPEX19 transformants indicating failure in the import of peroxisomal proteins.

Immunofluorescence analysis have deduced the cytosolic staining of peroxisomal matrix protein marker (Fig. 3.21), suggesting that TbPEX19 did not complement the function of yeast PEX19.

Results

Figure 3.22 Growth and expression test of wild-type cells, pex19 mutants, and mutant cells expressing T. brucei PEX19 or PEX19CAAX (A) Mutants transformed either with TbPEX19 or TbPEX19CAAX did not grow equal to the wild type strain on oleic acid medium. Bar shows 10 fold decrease in the cell density in each dilution. (B) An expression of both versions of TbPEX19 proteins was verified by immunoblot analysis, using antisera raised against recombinant TbPEX19. The presence of additional upper bands in yeast mutants transformed with PEX19 and PEX19CAAX, respectively, confirms the expression of TbPEX19. A cross reacting band below the PEX19 protein depicts that equivalent amounts of samples were loaded.

Trypanosoma PEX19 does not contain a CAAX motif at the C-terminus which has been found essential for efﬁcient targeting of PMPs in humans and yeasts. The question arose whether farnesylation sequence missing in our construct is responsible for the proper functioning of the trypanosomal orthologue in yeast strain. Therefore, a new construct encoding TbPEX19 fused at C-terminal CAAX box was co-transformed along with peroxisomal marker in yeast mutants. Fluorescence microscopy analysis of mutants expressing PEX19CAAX did not reveal any peroxisomal structure (Fig. 3.21), although the mutants expressing wild type ScPEX19 demonstrated normal-looking peroxisomes (Fig. 3.21). Moreover, PEX19CAAX transformants displayed the growth defect on oleic acid medium (Fig. 3.22A).

3.2.2 Molecular characterization of PEX19

T. brucei PEX19 has been identified recently (Banerjee et al., 2005; Yernaux et al., 2006) and there is a general lack of in vitro and in vivo data regarding the characteristic features of this protein. In order to examine the molecular properties of T. brucei orthologue of PEX19,

Results

GST-PEX19 was overexpressed in E. coli and purified via GSH sepharose and size exclusion chromatography. SDS-PAGE analysis of the purification steps are summarized in Fig. 3.30. GST-PEX19 was cleaved with thrombin in order to remove the GST-tag. An SDS-PAGE analysis indicate the released PEX19 migrate at the size of ~25 kDa (Fig. 3.23 A).

2.42x104

Figure. 3.23 Molecular and biophysical characterization of thrombin cleaved PEX19. (A) Affinity purified GST-PEX19 was (T) was incubated with thrombin (H) to release the recombinant polypeptide. GST was removed by adding GSH sepharose followed by centrifugation, resulting in sediment (P) and PEX19 containing supernatant (S). A significant amount of PEX19 was visible in the sediments (P) (B) SDS-PAGE analysis of the total amount of protein loaded (load) on superdex 200 and the peak fractions eluted thereafter. Numbers correspond to the retention volume. Molecular weight markers are presented above by the arrows. (C) The estimation of MM by MALS corresponding to the elution volume of PEX19. The height of peak depicts the UV absorbance at 280nM and a clear signal indicates highly purified protein.

Results

To determine the molecular weight of recombinant PEX19 in native state, cleaved PEX19 was enriched and loaded, in the absence of reducing agents, on Superdex 200. PEX19 was eluted as a sharp, single peak at an elution volume of 14.5 ml (Fig. 3.23B). This location corresponds to the molar mass of ~60 kDa, suggesting PEX19 exists as a dimer. These findings are in line with the reported dimeric form of Arabidopsis PEX19 (Hadden et al., 2006).

To confirm the oligomerization of PEX19, SEC-MALS-RI system was used to characterize the molecular mass of PEX19. A chromatogram using MALS is presented in Fig. 3.23C. The predicted average molar weight value of peak fractions, lying within the elution range of 13.9 - 14.8 ml, by MALS was estimated as 26 kDa. It was proposed that much smaller size of PEX19 (26kDa), estimated by MALS as compared to its theoretical size (30.9 kDa) is due to the extensive degradation at the C-terminus. It was concluded that PEX19 is a monomer (MALS data) that migrates faster on sizing column than its actual size, possibly due to the non-globular shape.

To test this hypothesis, His-PEX19 was purified (Fig. S5A) and SEC-MALS analysis estimated the MM of this recombinant polypeptide as 34kDa (Table S3), thus corroborating our hypothesis that PEX19 exist as a monomer in native conformation.

Parameters Elution Volume (ml) MMexp (g/mol) MMth (g/mol) IPD RMS (nm)

PEX19 13.9-14.8 2.62x104 3.09x104 1.000 4.0

Table 3.7 Molecular parameters of PEX19 as produced by MALS detection. Summarized are the calculated average molecular mass (MMexp), estimated by MALS and theoretical molar mass (MMth), polydispersity index (IPD) together with the average root mean square radius (RMS) of TbPEX19.

3.2.3 Generation of anti-PEX19 antibodies

Next, the electrophoretic mobility of the endogenous PEX19 was investigated. For this purpose, purified full length PEX19 (as shown in Fig. 3.23B) was used to immunogenize the rabbits (Eurogentec) and polyclonal antibodies were raised. The specificity of this antibody was tested. Total cell lysates from BSF of T. brucei were loaded on SDS-PAGE and transferred to nitrocellulose membrane. Preimmune serum (PI) and final bleed (FB) were applied for immunological probing of TbPEX19. A protein band with an apparent size of 35 kDa was detected with FB (Fig. 3.24A, right panel). This band was absent when

Results nitrocellulose membrane was probed with PI (Fig. 3.24A, left panel). The sensitivity of antisera was tested and it was found that antibodies readily detected 5 and even 0.25-1 ng of the recombinant protein.

Figure 3.24 Optimization of immunological conditions for the detection of endogenous PEX19. (A) Cell lysates of BSF of T. brucei and recombinant PEX19 were separated by SDS-PAGE, transferred to nitrocellulose membrane and immunologically detected, using PI or FB, respectively. Asterisks indicate cross-reacting proteins. (B) Varying blocking conditions were tested. Either BSA (3% w/v) or milk powder (5% w/v), as a blocking reagent, were incubated for (1h at 20°C or 16h at 4°C) and nitrocellulose membrane was immuno- decorated by PEX19 antisera (final bleed). Dilution of the antiserum used is given below the respective blots.

To optimize the conditions for immunodetection, crude cell lysates transferred on nitrocellulose membrane were blocked either by BSA solution (3% w/v) or milk powder solution (5% w/v) and incubated with antisera for varying durations. Blocking of nitrocellulose membrane with BSA (3% w/v) and longer incubation with antibodies lead to a stronger signal of the protein (Fig. 3.24B). It was also noted that higher concentration of antibodies had a major impact to amplify immunological signals.

In order to prove that a 35kDa band is indeed a native form of PEX19, plasmid-encoded TbPEX19, without any tag, has been probed with PEX19 antisera. An immunoreactive species at an apparent molecular weight of 35kDa was observed with FB (Fig. 3.22B). It is concluded that a protein run on SDS-PAGE, at the size of 35 kDa is a strong candidate for endogenous T. brucei PEX19. Whether the aberrant migration behavior of PEX19 on SDS- PAGE is accredited to the high density of negatively charged residues or possible post translational modifications has yet to be deduced.

Results

3.2.4 Characterization of TbPEX19-TbPEX14 interaction

The C-terminal domain of PEX19 is known to bind with multiple class1 PMPs and various transporters (Fransen et al., 2005). The only exception is PEX14 which interacts with the N- terminal portion of PEX19 (Fransen et al., 2005; Mayerhofer et al., 2002; Neufeld et al., 2009). Previously, it was demonstrated that glycosomal ABC transporters (Yernaux et al., 2006), TbPEX10 and TbPEX12 (Saveria et al., 2007) are targeted to peroxisomes in human cells. In contrast, GFP-TbPEX14 exhibited a cytosolic localization in human cells although expression of the same fusion protein depicts glycosomal targeting in T. brucei (Saveria et al., 2007). These results indicate that PEX14 trafficking to glycosomes represents an exception to the conserved PEX19-dependent import. The goal of our study was to disrupt glycosomal biogenesis by exploiting the PEX19 and PMP interaction, while leaving their counterparts unharmed in host cells. These observations prompted us to analyze the PEX19- PEX14 interaction, which has not yet been reported in T. brucei.

3.2.4.1 Yeast Two hybrid assay

To determine a possible interaction between TbPEX14 and TbPEX19 in vivo, constructs expressing these proteins fused to GAL4 activation domain (AD) as well as GAL4 binding domain (BD) were designed and the yeast strain PCY2 was transformed. Double transformants were selected on double dropout plates (-Tryp -Leu). PEX19 fused to GAL4 binding domain exhibited auto-activation (Fig. 3.25B) and thereby, could not be tested further. However, the same protein fused with GAL4 activation domain did not interact with PEX14 (Fig. 3.25A). To check the expression of the respective proteins, an immunoblot analysis was performed, as shown in Fig. 3.25C. Interestingly, immunoblot probed with anti- BD antisera revealed the expression of BD-PEX14 only in co-transformants, expressing PEX19 (Fig. 3.25C, right panel). The possible reason might either be a lower expression or degradation of PEX14 in the absence of PEX19.

The main drawback of yeast two hybrid assays is the possibility of false negatives. If the candidate protein is not properly folded or lacking necessary post translational modifications in heterologous system, it might not be able to exhibit the binding properties.

Results

Figure 3.25 Recognition of PEX19 binding sites in PEX14 by two-hybrid assays. (A) PEX19 fused to the GAL4 AD did not show any interaction with BD-TbPEX14. (B) The fusion protein fused to GAL4 binding domain was auto-activating (C) Immunoblotting was performed, using anti PEX19 antisera to determine the expression of AD-PEX19 (left panel) and anti-BD antisera to confirm the expression BD-PEX14 (right panel). The interaction between ScPEX19 and ScPEX3 is used as a positive control in yeast two hybrid assays.

T. brucei PEX13.1 protein was fused to GAL4 activation or GAL4 binding domain and used as a positive control to determine if the fusion constructs of PEX19 and PEX14 were functional. Full length fusion construct of PEX13.1 (BD-PEX13.1) was expressed in yeast strain PCY2 and screened against PEX14 and PEX19 fused with AD, for binding activity. Co-transformants were assayed for β-galactosidase activity on filter and it was revealed that BD-PEX13.1 interacts with AD-PEX19 (Fig. 3.26C). BD-PEX19 could not be tested due to the auto-activation. Furthermore, AD-PEX13.1 interacts with BD-PEX14 (Fig. 3.26B). Conversely, BD-PEX13.1 did not bind AD-PEX14 (Fig. 3.26A).

Results

Figure.3.26 Yeast two hybrid assays to determine the interaction of PEX13.1 with PEX14 and PEX19 (A) PEX13.1 fused to GAL4 BD does not show any interaction with AD-PEX14 (B) While AD-PEX13.1 co- expressed with BD-PEX14 exhibited the activation of the reporter gene. (C) Similarly, PEX19 fused with Gal4 AD displayed the interaction with PEX13.1.

The results obtained by two-hybrid analysis are intriguing given the fact that PEX14 is a PMP and its targeting to peroxisomal membrane should be PEX19 dependent. To obviate the disadvantages associated with two hybrid system, pull down assay was applied using the purified proteins.

3.2.4.2 In vitro binding assays

To detect the PEX19-PEX14 interaction in vitro, an ORF encoding the full length sequence of T. brucei PEX19 was cloned downstream to the GST (GST-PEX19). Expression and purification of this recombinant protein is described in Fig. 3.30.

N-terminal His-tagged versions of full length PEX14 (His-PEX14), a truncated version containing 1-147 residues (His-PEX14 (1-147)) and a shorter fragment encompassing residues 1-84 (His-PEX14 (1-84)), were generated. His-PEX14 was over-expressed in E. coli and isolated by affinity chromatography on Ni-NTA agarose. Most of the protein was

Results associated with inclusion bodies. The soluble fraction (see Methodology, Section: 2.15) applied on the column did not show an efficient binding to the Ni-NTA agarose. SDS-PAGE analysis of each step of the purification is shown is supplementary Fig. S4. His-PEX14 was co-purified with tightly bound bacterial chaperons. The effective yield of His-PEX14 was less than ~1 mg from 1 liter of bacterial culture. The purification of His-PEX14 (1-147) and His-PEX14 (1-84) is described previously in Fig. 3.16A, B.

PEX19 has been shown to bind the N-terminal region of PEX14 in human (Neufeld et al., 2009). To determine this interaction in T. brucei, affinity purified His-PEX14 (1-84) was incubated with GST-PEX19 which was immobilized on GSH sepharose. After extensive washing, the proteins bound to the GST-PEX19 were eluted with 20mM glutathione. PEX14 (1-84) did not bind to PEX19 (Fig. 3.27B, lane 7, 9) as shown by coomassie stained SDS- PAGE and immunoblotting analysis of fractions recovered with GST-PEX19.

Figure 3.27 In vitro binding assays to elucidate the interaction of TbPEX19 and TbPEX14. Binding assays were performed by incubating 3uM GST-PEX19 or GST, as a control, and equivalent amounts of (A) full length PEX14 or (B) PEX14 (1-84). After extensive washing, GST-tagged proteins were eluted as 30X enriched fraction and samples from each step were analyzed by coomassie staining. Abbreviations: L, load; F, flow through; W, wash; E, eluates were 30x enriched. About 60% of GST-PEX19 was recovered in both the experiments.

An influence of fusion tag and stringent washing conditions of pull down experiment dissociate the binding was considered. Therefore, GST-PEX19 was cleaved with thrombin to release PEX19 which was subsequently used for gel filtration chromatography on Superdex 200. Different runs were performed with PEX19 alone, His-PEX14 (1-84), and PEX19 in

Results mixture with His-PEX14 (1-84), at various molar ratios. SDS/PAGE analysis revealed no higher molecular weight protein complexes, thus indicating PEX19 does not interact with PEX14(1-84) in vitro (data not shown).

Purified GST-PEX19 and full length PEX14 (His-PEX14) were mixed in equimolar ratio to test for possible interaction. PEX14 was not detected in fractions recovered by GST-PEX19 (Fig. 3.27 lane 8, 10). In addition, GST-PEX19 incubated with detergent lysed T. brucei cells and purified on GSH sepharose also yielded the negative results (data not shown). Altogether, different experimental approaches revealed no interaction, suggesting that binding affinity of PEX19 and PEX14 is too weak to be captured in vitro.

3.2.5 Identification of binding partners of PEX19

Relatively little is reported about the process of glycosomal biogenesis, especially no direct interactions have been demonstrated, involving T. brucei PEX19 and the PMPs. Furthermore, a number of critical components involved in maintenance and biogenesis of peroxisomal organelles have not been identified so far, in T. brucei e.g. PEX3 and PEX16. In order to establish existing PMPs as association partners of PEX19 and to identify potential binding partners of PEX19, different approaches were applied as described below.

3.2.5.1 Co-immunoprecipitation

Co-immunoprecipitation was performed, with PEX19 antisera to capture native PEX19 and associated complexes from T. brucei under conditions that did not compromise the integrity of these complexes. Bloodstream-form (5×106) cells were harvested at mid log phase (maximum density of 1×106 cells/ml). Optimization of cell lysis was carried out (see Section 3.2.5.3, Fig. 3.31) to release the glycosomal membrane proteins; the potential interacting partners of PEX19. Lysates were centrifuged and the supernatant was incubated either with PEX19 antisera (FB) or pre-immune serum (PI) as a control. Protein A sepharose beads were added to isolate the bound complexes. Western blotting analysis indicate the enrichment of endogenous PEX19 in fractions eluted with SDS sample buffer (Fig. 3.28). The absence of corresponding band in complexes isolated with (PI) exhibits the specificity of Co-IP experiment (Fig. 3.28). To test the interacting partners of PEX19, antisera raised against T. brucei PMPs (PEX14, PEX13, and PEX11) were applied to detect these proteins in PEX19 elution fraction but it could not detect these membrane proteins (data not shown). Silver

Results staining of the SDS-PAGE led to the conclusion that the amount of protein purified with PEX19 epitope is not sufficient for mass spectrometry (MS) analysis.

Fig 3.28 Co-immunoprecipitation to detect endogenous PEX19 and association partners. BSF cells were fractionated by centrifugation. Soluble portion was incubated with PI or FB and bound parts were eluted with Laemmli sample buffer (Eluates were 25X concentrated than input material) and analyzed by immunoblot analysis, using anti-PEX19 antisera. Heavy chain of IgG appeared at 55 kDa size and immuneprecipitated PEX19 appeared at 35 kDa region. Abbreviations: T. brucei cell homogenates (H), supernatant (S), Pellet (P), flow through (F), Wash (W), SDS Elute (E), BSF cells as a control (WT)

3.2.5.2 Complex Isolation

An alternate approach was applied to purify PEX19-associated complexes. The ORFs of GST and GST-PEX19 were sub-cloned from pGEX4T-1 and pGEX4T-1-PEX19 (described in materials and methods) in T. brucei expression plasmid, pHD1336. The resulting constructs, pHD1336-GST and pHD1336-GST-PEX19, specifies the constitutive expression of respective proteins under tetracycline promoter. Plasmid DNA was linearized and genomically integrated to produce stable cell lines of BSF T. brucei. As a control, empty plasmid pHD1336 was also transfected. The expression of all constructs was verified by Western blotting analysis, using antisera raised against PEX19 and GST. An immunodetection of ~60 kDa band recognized by anti PEX19 antibody indicate the expression of GST-tagged PEX19 (Fig. 3.29A, upper panel). The blot was stripped and

Results immunodetected using anti-GST antibodies. Again, the presence of GST and GST-PEX19 proteins expressed by pHD1336-GST and pHD1336-GST-PEX19 stable cell lines indicate the correct integration of the constructs (Fig.3.29A, lower panel).

Figure 3.29 Immunoblot analysis of BSF cells expressing genomically integrated GST or GST-PEX19. (A) Stable cell lines expressing empty plasmid (pHD), GST protein (pHDGST) or GST-PEX19 (pHD-GST-PEX19) have been induced with 2mM tetracyclin. Parallel cultures of uninduced (UN) or induced (IN) cells were harvested, loaded on SDS-PAGE and probed with anti PEX19 (upper panel) or anti GST antibodies (lower panel). As a second control, (WT) wild type BSF cell were also loaded. (B) GST-tagged proteins were purified on GSH sepharose from stably transfected T. brucei cells expressing either GST or GST-PEX19. (E) Eluate fractions were immune-detected by anti-GST antibodies.

For isolation of PEX19 interacting polypeptides, GST-tagged complexes were purified by GSH sepharose. Bound proteins were analyzed by immunoblotting (Fig. 3.29B) and visualized with blue silver staining (data not shown). The affinity chromatography did not yield sufficient amount for mass spectrometry analysis.

3.2.5.3 Pull down Assay

Finally, the strategy of in vitro binding assays was employed. Affinity purified GST-PEX19 was incubated with whole cell lysates of T. brucei to pull down PEX19 interacting

Results candidates. GST-PEX19 was heterologously expressed in E. coli and purified via GSH sepharose (Fig. 3.30A) and size exclusion chromatography (Fig. 3. 30B).

Figure 3.30 Purification of GST-PEX19 by affinity chromatography and size exclusion chromatography. (A) Heterologously expressed GST-PEX19 was purified from soluble cell lysates by GSH sepharose. GST- tagged proteins, bound to the column were eluated, as 10X concentrated fractions, by glutathione and analyzed by SDS-PAGE followed by coomassie staining and immunoblotting, using anti GST antisera. Abbreviations: H, homogentaes; S, supernatant; P, pellet; F, flow through; W, wash; E1-8 (eluates) (B) fraction enriched with purified GST-PEX19 was loaded (Load) on superdex 200 and gel filtrated fractions comprising purified recombinant proteins were visualized by coomassie staining. Arrows indicate the size of the marker proteins.

The putative binding partners of PEX19 include metabolite transporters and other PMPs. In order to release the glycosomal membrane components, the experimental protocol from (Leung et al., 2011) has been optimized with appropriate modifications. The membrane solubilization is briefly explained in Fig. 3.31A. Detergent mediated release of glycosomal membranes proteins was monitored by immunobloting, using antibodies raised against PEX11, PEX13 and GIM5 (Fig. 3.31 B). The distribution of other membrane proteins was also assessed and it was observed that digitonin concentration (0.50 mg/mg protein) is sufficient (correponding to effective ratio of 2% v/v ) to solubilize the glycosomal membrane proteins efficiently.

Results

Figure 3.31 Optimization of membrane preparation of T. brucei. (A) BSF cells were harvested at mid log phase and mechanically disrupted. The protein content was measured by Bradford assay and several aliquots of equal sizes were incubated with increasing amounts of digitonin. Triton X-100 (1 %), as a control, represents the complete disruption of cellular organelles. After 4 h of incubation, the supernatant (cytosolic and solubilized) and pellet (cell debris, membranes and nuclear extracts) fractions were separated by centrifugation. (B) Supernatant and the pellet fractions from individual aliquots with designated concentration of digitonin and untreated cells (L) were subjected to immunobloting, using antibodies raised against PEX11,PEX13 and GIM5.

To isolate PEX19 interacting complexes, overexpressed GST-PEX19 or GST, as a control, were incubated with digitonin treated cells of BSF T. brucei (schemetic presentation of the procedure is given in Fig. 3.32A. Unspecific interactions were washed away and GST fusion proteins were purified via GSH sepharose. Under optimized conditions, approximately 60% of GST-tagged proteins were recovered in the eluates.

Results

Figure 3.32 GST pull down assay. (A) A schematic presentation depicts the complete procedure of pull down assay (B) The putative binding partners of GST/GST-PEX19 were analyzed by SDS-PAGE and visualized by staining with colloidal coomassie. Abbreviations: L, load; F, flow through; E, eluates (10X).

The putative proteins captured by GST or GST-PEX19 were analyzed by SDS-PAGE followed by coomassie staining (Fig. 3.32 B). Proteins were digested in-gel with trypsin and eluted peptides were analyzed by LC-MS using an RSLCnano (HPLC) online-coupled to a VelosPro mass spectrometer (Dr. Katja Kuhlmann, MPC, Ruhr-Universität Bochum).

Results

Data was searched using the ProteomeDiscoverer Software with the sequest search engine and the TriTrypDB-8.0_TbruceiLister427_AnnotatedProteins database to which the Pex19- GST sequence and a list of known contaminant proteins (MaxQuant-contaminants fasta) were added. All the proteins identified are listed in supplementary Table. S1.

Figure 3.33 Pie chart showing the organeller localization of candidate partners of PEX19, as identified by MS analysis. (MS analysis was carried out by Dr. Katja Kuhlmann, MPC, Ruhr-Universität Bochum)

The nanoLC-MS/MS data led to the identification of 125 proteins of BSF T. brucei origin, out of which 95 proteins have a known function. The remaining 30 proteins had no assigned function, therefore are designated as “hypothetical proteins”. Seven of these hypothetical proteins have one or more TMDs. These could be good candidates for novel interaction partners of PEX19. Using gene ontology (GO) terms on TriTryp database, the localization was assigned to those proteins which did not have clear organellar sorting signals. In addition, we have matched our set of proteins with the reported localization informations of T. brucei proteins by Colasante et al., 2006, 2013; Güther et al., 2014.

MS analysis identified 21 glycosomal proteins. Of these, 11 proteins have transmembrane domains. The members of the family ABC (ATP binding cassette) transporters are required for the import of long chain fatty acid into the peroxisomes (Hettema et al., 1996; van Roermund et al., 2008). Of previously identified trypanosomal homologues of ABC transporters (GAT1, GAT2 and GAT3) (Yernaux et al., 2006), GAT1 and GAT2 were found in our pull down assays. Other enzymes related to fatty acid metabolism, Tb427tmp.160.2770 (fatty acyl CoA syntetase 1) and Tb427tmp.160.2810 (fatty acyl CoA synthetase 3), were also

Results present in the fractions recovered with GST-PEX19. Both of these proteins were considered as “possibly glycosomal” by Colasante et al., 2013.

Two other proteins of particular interest are Tb427tmp.01.2020 and Tb427tmp.01.1780, annotated as hypothetical proteins in TriTryp database. Both potentially expressed proteins lack obvious organellar targeting signals and might contain two TMDs as predicted by TMHMM and TOP. Using Blastp of NCBI website, these protein sequences were aligned with the complete proteomes of Saccharomyces cerevisiae, Homo sapiens and Arabidopsis thaliana but no particular candidate with significant similarity was detected. Noteworthy, using density gradient centrifugation, systematic proteome analysis of glycosomes revealed that Tb427tmp.01.2020 was localized to the glycosomal membrane (Colasante et al., 2013).

A dynamin related protein, Vps1 is involved in peroxisomal fission (Hoepfner et al., 2001). The association of Vps1 with peroxisomes is dependent on PEX19 (Vizeacoumar et al., 2006), thus supporting the role of PEX19 as an assembly factor and chaperon for PMPs. A candidate protein with gene ID Tb427.03.4720 was identified in MS analysis, named as dynamin protein. The orthologues of this polypeptide in other strains of T. brucei group (Tb927 and Tb972) are annotated as vacuole sorting protein1 on TriTryp database. The sequence analysis showed that identified protein displays high sequence identity to yeast Vps1 (6e-165).

Finally, a trypanosomal orthologue of rarely conserved PEX16 was identified. PEX16 is an integral membrane protein and acts as a receptor for PEX3-PEX19 complexes at peroxisomal membrane in mammals but homologues have not been identified in some well-studied eukaryotes (Kiel et al., 2006). The protein encoded by Tb427tmp.160.4700 shows a very week match with PEX16 domain (E-value is equal to 9e-3). The number of TMDs varies from two to four depending largely on the type of prediction algorithm used. Sequence alignment of this gene with known PEX16s of mammals and plants has shown a low sequence homology. Unpublished localization and functional studies support the view that the protein is indeed the orthologue of PEX16 (Kalel et al., submitted for publication).

The current work has given an additional evidence that candidate protein is a binding partner of PEX19, suggesting it as an authentic orthologue of PEX16 in T. brucei.

Discussion

4.0 Discussion

4.1 Functional characterization of the peroxisomal import receptor PEX5

In trypanosomes, the docking of cargo-loaded PEX5 on peroxisomal membrane and the processes of receptor-docking and dissociation of cargo into the matrix are poorly understood at molecular level. In current studies, I have characterized the molecular events regarding PEX5-PTS1 interaction, domain mapping of components of the docking apparatus and their specificity to mediate interactions with cargo-loaded / unloaded PEX5.

4.1.1 Molecular characterization of PEX5

Quaternary structure of PEX5 is a matter of debate over years and the latest reports regarding the native conformation of this protein have demonstrated that Ld and Hp PEX5 are tetramers (Madrid and Jardim, 2005; Moscicka et al., 2007), HsPEX5 is a monomer (Shiozawa et al., 2009) and PpPEX5 as homo-oligomer (Ma et al., 2013).

SEC-MALS was employed to determine the molecular parameters of individual gel filtrated fractions in order to determine the absolute MM, conformation and shape of the molecule. The SEC profile revealed a single peak of TbPEX5. MALS estimated the MM of corresponding PEX5 fractions as 93 kDa (Fig. 3.2 and Table 3.1), which is an indicative of the monomeric form. The molecular weight predicted by standard globular protein markers was ≥ 210 kDa, pointing that PEX5 runs on the sizing column as a non-globular polypeptide. The slope of double logarithmic plot between MM and RMS depicts the shape of protein as globular-coiled coil. In this study, the quaternary structure of PEX5 was also validated by blue native gel (data not shown).

Gel filtration chromatography performed with varying length constructs have shown that the full length LdPEX5 and CT-LdPEX5 (303-625) exist as a tetramer and monomer subunits in solution, respectively (Madrid and Jardim, 2005). Recently, the biophysical parameters measured by small angle x-ray scattering (SAXS) led to the molecular modelling of HsPEX5 as an elongated monomer (Shiozawa et al., 2009). In contrast to this, only α- helical rich C- terminal domain behaves like a globular molecule as discovered by SAXS approach. It was hypothesized that non globular shape of TbPEX5 molecule on gel filtration is an attribute of the N-terminal region since carboxy terminus exhibits extremely high sequence identity with its human counterpart which was a spherical particle (Costa-Rodrigues et al., 2005). An

Discussion extended conformation of unfolded N-terminal portion is an added advantage to the receptor in mediating interactions with other complexes at longer distances (discussed in Shiozawa et al., 2009). This also explains why PEX5 is prone to degradation under standard preparation procedures.

Interestingly, studies using electron microscopy and SEC analysis in combination with non- reducing gels have shown that Fungus (Hansenula, Pichia) PEX5 is a globular tetramer and homo-oligomer, respectively (Ma et al., 2013; Moscicka et al., 2007). Oligomerization dependent binding features with respect to the function of PEX5 might have significantly been diverged in lower eukaryotes and trypanosomes e.g. HpPEX5 and PpPEX5 undergoes conformational alteration and discharge their cargo upon binding with PEX8 (Ma et al., 2013; Wang et al., 2003). There is no equivalent of PEX8 identified so far in trypanosomes. It remains to be investigated whether contrary results are due to the different taxonomical branches or variation in experimental approaches.

4.1.2 Modulation of Quaternary structure of GAPDH

An understanding of structural interactions among PEX5 and glycosomal isoenzymes would provide information not only on biogenesis of glycosomes but also on microbodies, in general. PEX5 expresses a wide range of binding to recognize a diverse class of peroxisomal matrix proteins in terms of their quaternary structures; from monomer (Shiozawa et al., 2009), dimers (Luo et al., 2008) to even hetero-oligomers (Tanaka et al., 2008). In this study, the oligomeric state of full length recombinant form of GAPDH and its modulation upon binding with PEX5 by SEC-MALS was investigated. The estimated MM of His-GAPDH and MBP-GAPDH by SEC-MALS is 93 and 143 kDa, respectively. These values correspond to the dimeric forms of the fusion proteins. Oligomerization of MBP-GAPDH is induced by the GAPDH structure since MBP is a monomeric protein (Sharff et al., 1993). Earlier, glycosomal isoforms of Leishmania and Trypanosoma GAPDH were considered as homo- tetramers (Kim et al., 1995; Pavão et al., 2002; Vellieux et al., 1993) and served as anti trypanocidal targets (Aronov et al., 1998; Bero et al., 2013; Ngantchou et al., 2009). Our finding may have implications for designing a drug, on the basis of structural parameters, to inhibit the activity of GAPDH in parasites.

In vitro binding studies using purified proteins have demonstrated the formation of stable complex between PEX5 and GAPDH. This is an indicative of functional construct with exposed PTS1 motif, sufficient to mediate stable interaction with proposed TPR domains of

Discussion

PEX5. The stoichiometry of this interaction was calculated by SEC-MALS analysis. In the presence of PEX5, PTS1 cargo (His-GAPDH or MPB-GAPDH) appear on sizing column as an early eluting species, suggesting the formation of receptor-cargo complex. The MALS demonstrated a mono-diverse and uniformly sized population of molecules within the peak fractions of the complex. Molecular weight analysis suggested the transition of oligomeric state of GAPH from dimer to monomer upon binding with PEX5. The absence of native conformation (homo-dimer) of GAPDH leads to the hypothesis that dimer-monomer transition is too quick to be observed on size exclusion chromatography. These findings suggest that PEX5 has the tendency to alter the conformation of its binding partner. Indeed, a cargo-free full length version or a WxxxF peptide derived from the mammalian PEX5 has been shown to inhibit the oligomerization of PEX14 (Itoh and Fujiki, 2006; Su et al., 2009). These authors have shown the modulation of PEX14 induced by the N-terminal portion of PEX5. This study indicates that PEX5 could modulate a PTS1 protein, though C-terminal region is involved in this interaction. In view of the fact that PEX5 import oligomeric and even folded form of cargos (Pires et al., 2003), configurational change in PTS1 ligand appears strange. It is speculated that dimeric-interface of GAPDH subunits could have been blocked by the bulk of PEX5 molecule, resulting in disruption of homo-dimer. However, this work has not addressed this issue.

4.1.3 Role of PEX14N as cargo dissociation factor

Previous studies have shown that the oligomerization of PEX14 is mainly regulated by coiled coil and trans-membrane domain regions (Itoh and Fujiki, 2006). In current work, TbPEX14 (1-147) is shown to exist as a dimer in native form. By sequence analysis, the corresponding regions of TbPEX14 comprising membrane anchoring residues and coiled-coil stretches are predicted to be limited in the residues, 150-165 and 220-320, respectively (Furuya et al., 2002). This suggests that homo-oligomerization in TbPEX14 is mediated by sequence elements other than those which are responsible in mammalian system.

The interaction of PEX5 and truncated versions of PEX14 is shown by pull down and SEC experiments. The SEC-MALS estimated the binding stoichiometry of PEX5-PEX14 (1-147) complex as 1:4. Similar kind of experiments conducted with comparatively smaller region of PEX14 (first 78 residues, GST-PEX14N) also yielded the strong interaction. Interestingly, the SEC profile demonstrated that GST-PEX14N eluted in complex with PEX5 as two sharp

Discussion peaks (Fig. 3.8B). The higher molecular weight complex was formed at the size of 700-800 kDa, the implications of which are yet to be investigated. PEX5 mediates interaction with PEX14 through conserved penta-peptide stretches (WxxxF/Y), limited to the N-terminal region of PEX5 (Nito et al., 2002; Otera et al., 2000; Schliebs et al., 1999). The number of these motifs varies among species. Recently, (Neuhaus et al., 2014) identified a significantly conserved and novel motif (LVXEF) in the mammalian PEX5 which displays comparable affinity to bind PEX14. This signature sequence is absent in T. brucei PEX5. Out of total three, only 1st and 3rd WxxxF/Y motifs of TbPEX5 could bind PEX14 (Choe et al., 2003). Conversely, no detectable binding was observed with 2nd WxxxF/Y motif. On the basis of these reports, it was assumed that two dimeric subunits of PEX14 are associated with PEX5, thus giving a molar stoichiometry to PEX5-PEX14 (1-147) complex as 1:4.

The presence of multiple binding sites in PEX5 to interact PEX14 play a significant role in PTS1 dependent import. Their implications have been discussed in detail by Schliebs et al., 1999. Under natural conditions, association of cargo-free PEX5 with PEX14 appears unlikely. In vivo, cargo-bound PEX5 docks at peroxisomal membrane where certain dynamic interactions lead to the detachment and subsequent translocation of the cargo. There are no informations available about this subject in T. brucei.

The observations that (i) reduction of PpPEX5 leads to the release of its cargo which is further facilitated in the presence of PEX8 (Ma et al., 2013) (ii) LdPEX5 shows low binding affinity to PTS1 proteins in the presence of PEX14 (Madrid et al., 2004) and (iii) HsPEX5- catalase complex is dissociated upon binding to the N terminus of PEX14 (Freitas et al., 2011) suggest that protein-protein interactions induce cargo unloading. In trypanosomes, a likely candidate to act as a cargo-releasing factor is PEX14 (although the potential role of PEX13 in cargo translocation process is also studied and discussed later in this section).

A ternary complex was obtained by pull down assay. The cargo-bound PEX5 forms a stable complex with PEX14N (Fig. 3.10). The capacity of PEX14N to dissociate receptor-cargo complex was not evident by pull down assays. But it provides the initial evidence that PEX14N act as a docking partner in T. brucei and receives cargo-loaded PEX5 on glycosomal membrane. Similar complexes were also analyzed by gel filtration chromatography. Distinct complexes of specific MMs were captured and estimated by MALS. However, a significant releasing activity of T. brucei PEX14 was not observed.

Discussion

Certain reports favour the role of PEX14 as a cargo dissociation factor (Madrid et al., 2004; Freitas et al., 2011). These authors have used a peptide or catalase enzyme as a PTS1 ligand in their assays, respectively. Conversely, I have used the full length polypeptide of GAPDH which harbors AKL as a PTS1 motif. The canonical tripeptide sequence, AKL has been shown as a strong PTS1 signal with comparatively high binding affinity with PEX5 (Stanley et al., 2006). Moreover, a PTS1 peptide derived from LdXPRT (xanthine phosphoribosyl transferase) displays ~75 fold lower binding affinity with PEX5 as compared to the full length enzyme (Jardim et al., 2002). These observations suggest that due to the high binding affinity, PEX5- GAPDH complex might not be completely dissociated under experimental conditions used in this study.

Furthermore, equimolar concentration of all the three components were used. Previously, It was shown that equilibrium is achieved between PEX5-PEX14N at 1:4 molar ratios. Very likely, excess PEX5 has been re-associated with GAPDH thus inhibiting the complete release of PTS1 ligand. This assay needs to be revised again in combination with different PTS1 ligands and with molar excess of PEX14N.

4.1.4 The dynamics of docking complex in PEX5 mediated import

Association of cargo-bound receptors to the peroxisomal membrane is enhanced by the presence of membrane proteins, PEX13, PEX14 and PEX17 which promote later steps of the matrix import (Agne et al., 2003). The orthologues of PEX13 and PEX14, components of the docking complex, have been identified in T. brucei. However, the nature of binding between docking partners and their role in cargo translocation is completely unknown.

Using yeast two hybrid assays, a physical interaction was demonstrated between the full length fusion constructs of T. brucei PEX13 and PEX14 (Fig. 3.27). To characterize this interaction, I have isolated overexpressed SH3 domain, a distinctive feature of PEX13, on an affinity column. In vitro binding experiments have shown that the TbPEX13-SH3 domain does not interact with the conserved N-terminal region of PEX14 (Fig. 3.17 A). In other organisms, the corresponding domain of PEX14 is involved in making distinct complexes with PEX13, PEX5 and PEX19 (Girzalsky et al., 1999; Neufeld et al., 2009; Su et al., 2009; Urquhart et al., 2000). A relatively larger fragment comprising residues 1-147 of PEX14 was recovered in the SH3 eluted fractions, obtained by pull down assays (Fig. 3.17B). The typical SH3 ligands are composed of PXXP motif in the binding partner. The sequence alignment with Hs and Sc PEX14 (their PXXP motifs are well characterized) identified a canonical

Discussion prolin rich motif, which is situated near the end of the primary sequence of His-PEX14 (1- 147) (Fig. 4.1). This leads to the assumption that PEX13-SH3 recognized PEX14 as a classical PXXP ligand. The PXXP stretch is located far away from the N-terminal conserved core, near the membrane anchoring region of PEX14. This indicates separate interface surfaces in PEX14 for binding with PEX5 and PEX13-SH3 domain.

Figure 4.1 Multiple sequence alignments of truncated versions of Hs, Sc and Tb PEX14 as performed with CLUSTALW. Conserved residues are shaded grey with asterisk below the corresponding positions. Similar residues are presented with 2 (highly similar) and 1 (less similar) dot below respective positions. The N- terminal region is well conserved among all the three species while PXXP motif (underlined with red color) is located in T. brucei far downstream as compared to the position of PXXP of its counterparts.

Leishmania PEX7 has been demonstrated to bind PEX14 in similar region which, in current studies, was assumed as a putative PXXP sequence (Pilar et al., 2008). Since PEX5 is a co- receptor for PEX7 and directly interact with PEX14, physical association between PEX7 and PEX14 is surprising. The role of PXXP region of PEX14 needs further investigation with respect to the involvement in PTS1 and PTS2 matrix proteins import.

The WxxxF/Y motifs limited to the natively unfolded N-terminal region of PEX5 serve as an atypical SH3 ligands (Bottger et al., 2000, 2000; Pires et al., 2003). A yeast two hybrid experiment performed with truncated versions of PEX5 has demonstrated an interaction between PEX13-SH3 and a region of 100 AA including 3rd WxxxY motif of PEX5 in T. brucei (Verplaetse et al., 2009). These authors found that the full length PEX13.1 and C- terminal version of recombinant protein are highly insoluble in their expression system. I was able to purify sufficient amount of SH3 domain to test their ability to recruit PEX5 in vitro. Contrary to these reports, the direct binding assay yielded negative results regarding the PEX13-SH3-PEX5 interaction (Fig.3.19). Indeed, the current work demonstrated that a tripeptide at the C-terminus, downstream to the SH3 domain, is a putative PTS1 sequence which is involved in mediating interaction with PEX5. PEX5 recognizes PTS1 signal by

Discussion means of TPR domains situated in the C-terminal portion. Therefore, this mode of interaction is in contrast to the previous reports demonstrating the involvement of N-terminal region of PEX5, especially conserved WxxxY/F residues to bind PEX13.1 at the domain level (Bottger et al., 2000, 2000).

The level of interaction/stability of these complexes was assessed by a competition binding assay. The formation of docking complex was completely inhibited in the presence of PEX5. Interestingly, docking complex was dissociated at a 4 fold less concentration of PEX5 as compared to the concentration of docking partners. This result is in good agreement with the previous findings that PEX5-PEX14 complex exist in a molar binding stoichiometry of 1:4 (Fig. 3.9). The configuration of PEX14 might have altered considerably upon binding with PEX5 which has resulted in loss of its interaction with SH3 domain since binding sites for PEX5 and SH3 are located in different portions of PEX14. This also implies that PEX5- PEX14 shares a high affinity binding as compared to the PEX14-PEX13.1 complex.

In Trypanosoma, two isoforms of PEX13 are identified; PEX13.1 and PEX13.2 (Brennand et al., 2012). Similar to plant PEX13s, TbPEX13.2 lacks the SH3 domain. The most unique feature of PEX13.1 is the occurrence of a tripeptide (TKL), a PTS1 resembling sequence, at the extreme C-terminus (Verplaetse et al., 2009). In an attempt to test whether PEX5 interaction with PEX13.1 depends on potential PTS1, two fusions constructs containing only SH3 domain or an SH3 domain along with a putative PTS1 sequence were created. Only the later recombinant protein, GST-PEX13SH3TKL has pulled down PEX5 in an immobilized assay (Fig. 3.19). These findings established that TKL is, indeed a PTS1 signal which is rarely found on peroxisomal matrix proteins. At least one enzyme with TKL as PTS1 variant; UDP-Galactose 4′-epimerase, has been localized to glycosomes in T. brucei (Mariño et al., 2010). The C-terminal TKL is found in almost all the Trypanosomatids but completely absent in all the PEX13s studied so far. The evolutionary conserved PTS1 motif among primary sequence of Trypanosomatids PEX13.1 suggests a particular function which is very likely in PEX5 mediated import. TbPEX13.1 has been shown as an integral membrane protein (Verplaetse et al., 2009) and its glycosomal targeting via PTS1 is unlikely. Indeed, in preliminary studies, I have shown that PEX19, a peroxisomal membrane protein receptor, physically interacts with PEX13.1 (Fig.3.26) presumably through its mPTS (residues 239- 254), predicted by mathematical algorithm developed by (Rottensteiner et al., 2004), though an mPTS of PEX13.1 has yet to be validated.

Discussion

Two putative transmembrane domains confer the topological configuration to PEX13.1 such that both N and C terminus are facing towards cytosol (Verplaetse et al., 2012). It was observed that addition of 7 terminal residues, including TKL motif, increased the solubility of PEX13 by three fold (Fig. 3.15, compare the supernatant fractions of GST-SH3 and GST- SH3TKL). The TKL, oriented towards the cytosol might function as a general docking partner of cargo loaded PEX5. To test this hypothesis, the binding activity of GST-SH3TKL with cargo-bound and unbound PEX5 was measured. In this assay, cargo-unloaded PEX5 interacts with SH3-TKL as compared to the cargo-loaded PEX5 where binding with SH3- TKL has been completely abolished. Interestingly, a preformed complex of PEX5 and an SH3-TKL has the capacity to bind the PTS1 ligand, GAPDH. The most likely explanation is that PEX5 has a lower binding affinity to SH3-TKL than GAPDH. Nonetheless, similar pattern of receptor docking is observed in mammals where cargo-unloaded PEX5 expresses higher affinity to PEX13 than cargo-loaded PEX5 (Costa-Rodrigues et al., 2005).

On the basis of these findings, it could be suggested that PEX14 serves as a first docking site at the glycosomal membrane. The cytosolic SH3-TKL serves as a measure to differentiate cargo-bound and unbound PEX5 on the cytoplasmic side of the glycosomal membrane. Other possible role assigned to the SH3-TKL is that it binds empty PEX5 once the cargo is released inside the lumen. This later function might be implicated in the recycling of the receptor back to the cytosol. On the basis of these findings and assumptions thereafter, I herein proposed a working model for the glycosomal matrix proteins import, facilitated by PEX5 in T. brucei.

4.1.5 Development of glycosomal proteins import model

In current study, several interactions were demonstrated involving docking partners and peroxisomal import receptor in the presence/absence of cargo: (i) PEX5 modulates the conformation of full length matrix enzyme, GAPDH from homo-dimer to a monomer. Then this receptor-ligand binary complex docks at the N-terminal region of PEX14 (ii) the interaction of docking partners was mapped at a domain level which is allosterically disrupted by PEX5 (iii) It is shown that a PTS1 resembling motif at the C-terminus of PEX13.1 regulates its binding with PEX5 which is not detected when PEX5 is preloaded with a PTS1 protein. In sum, these dynamic molecular interactions are adjusted in a model for glycosomal matrix proteins import (Fig. 4.2). PEX5 recognizes PTS1 cargo in the cytosol through C- terminally

Discussion located TPR fold and transfers it to the glycosomal membrane. The docking complex mediated by the SH3 domain of PEX13.1 and PXXP motif of PEX14 is dissociated once PEX5 docks at PEX14 through N-terminal region. One possibility is that cargo- free/improperly loaded PEX5 binds cytosolic SH3-TKL while cargo-loaded PEX5 docks at PEX14N to discharge its cargo by a mechanism which is not yet known in trypanosomes. Alternatively, once the cargo is released inside the lumen of glycosomes, PEX13.1, through its TKL motif, binds TPR domains of PEX5 and assist in shuttling the empty receptor back to the cytosol.

Figure 4.2 A working model for glycosomal matrix proteins import, mediated by PEX5 in T. brucei. (1) PEX5-PTS1 complex is formed in the cytosol. Peroxisomal membrane proteins, PEX13.1 and PEX14 organize a docking apparatus through SH3-PXXP binding, in glycosomal membrane. (2) cargo-loaded PEX5 docks at PEX14, involving the N-terminal region of both the proteins. Concomitantly, docking complex is dissociated and cargo is released into the peroxisomes. (3) After the release of cargo, SH3-TKL interact with PEX5 through TPR domain and mediates its cycling back to cytosol. Alternatively, (4) cargo free PEX5 interacts SH3-TKL at cytosolic face and (5) recycled back. While cargo loaded PEX5 is implicated in normal import process.

Discussion

4.1.6 Summary and Outlook

Current studies have reported the oligomerization of TbPEX5 and the modulation of quaternary structure of GAPDH; a glycolytic enzyme, influenced by PEX5. Using MALS analysis and different fusion constructs of GAPDH, I was able to reproduce the conformational alteration of GAPDH upon binding with PEX5. This molecular interaction could further be characterized by analytical ultracentrifugation or blue native PAGE.

In current study, the N-terminal region of PEX14 is demonstrated as a docking site for cargo- loaded PEX5. To determine the probable role of PEX14N in cargo-dissociation, molar excess of PEX14N and variable PTS1 motifs should be analyzed.

A unique kind of interaction was observed between PEX5 and a membrane protein PEX13.1, mediated through a putative PTS1 motif of PEX13.1. The present work has addressed the possible role of this motif in matrix import. However, the role of SH3-TKL needs further investigation, especially in vivo.

4.2 Functional characterization of peroxisomal membrane receptor PEX19

PEX19 is mainly a cytosolic protein (Sacksteder et al., 2000a) that recognizes membrane destined proteins through their targeting sequences (mPTS) (Fransen et al., 2002). T. brucei PEX19 shares a modest level of sequence identity to its yeast and human counterparts (15% and 16%), respectively (Yernaux et al., 2006). Surprisingly, it lacks farnesylation motif (CAAX), present on the C-terminal region of all PEX19s identified so far (Banerjee et al., 2005).

The similarity of function of T. brucei PEX19 in yeast was tested. A plasmid-encoded TbPEX19 failed to restore the import defect in ∆pex19 Saccharomyces cerevisiae. Furthermore, yeast deletion strain, clearly expressing PEX19 polypeptide does not grow on oleic acid medium. Earlier reports have demonstrated that post-translational modification of PEX19 is essential for efficient functioning as peroxisomal biogenesis factor (Rucktäschel et al., 2009). To address this, the same assay was performed with CAAX moiety of ScPEX19 added at the end of TbPEX19. This resulted in negative response again. The inability of TbPEX19 to complement the lacking function of its counterpart in yeast deletion mutants is consistent with its reported function in human cells (Yernaux et al., 2006). Immunoblot analysis revealed that wild type TbPEX19 and TbPEX19CAAX show exactly similar

Discussion mobility on SDS-PAGE (Fig. 3.22B). This presents a non-modified form of PEX19 upon the introduction of CAAX box since prenylated PEX19 appears as a fast migrating species on denaturing gel (Götte et al., 1998).

These results seem to contradict the proposed evolutionary conserved function of PEX19. Indeed, cross-species targeting of PMPs have been demonstrated e.g. yeast and human PMPs appropriately targeted to mammals and yeast peroxisomes, respectively (Elgersma et al., 1995; Halbach et al., 2005). Since trypanosomes are an evolutionary diverged branch of organisms, the function of PEX19, to some aspects, might have been deviated as compared to its orthologues.

4.2.1 Molecular characterization of PEX19

The molecular and structural characterization of T. brucei PEX19 was performed. Thrombin cleaved GST-PEX19 migrated on SEC corresponding to the size of 80kDa, more than twice the MM of PEX19 ORF. However, MALS analysis estimated the MM of peak fractions equal to calculated MM of PEX19. A low value of IPD index and a symmetric elution profile of PEX19 indicate a uniform, monomeric population of PEX19 in vitro.

SEC and immunodetection of crude cell extracts have shown that AtPEX19 exist as a homo- dimer which is linked by disulfide bond (Hadden et al., 2006). Consistent with this, Otzen et al., 2004 have also observed that HpPEX19-GFP appeared as 250 kDa complex, suggesting a homo-tetrameric structure. The presence of GFP which tends to dimerize at higher concentration (Zacharias et al., 2002) and prediction of MM in comparison with globular protein markers lead to the complicated results with respect to the molecular weight analysis. Indeed, analytical ultracentrifugation experiments have shown that HsPEX19 is a monomer despite its behavior as dimeric species on SEC (Sato et al., 2010). Nonetheless, these authors have suggested that dimeric conformation of AtPEX19 facilitates the efficient targeting of PMPs, especially of those which bears two independent targeting signals (mPTSs).

Contrary findings related to the structure of PEX19 suggest that certain aspects regarding the PMPs targeting are different in distantly related organisms; plants (Arabidopsis) and trypanosomes.

Discussion

4.2.2 PEX19-PEX14 interaction

Glycosomal biogenesis is considered as a promising drug target in combating Trypanosomiasis. The formation and maintenance of this organelle involved the synthesis of glycosomal membrane and transport of glycolytic enzymes across this bilayer. PEX19 is a cycling receptor that carries newly synthesized PMPs to the peroxisomal membrane (Jones et al., 2004). PEX19 deficient human and yeast cells do not contain peroxisomal structures (Hettema et al., 2000; Sacksteder et al., 2000b). It has been shown that GFP-TbPEX14 is mislocalized in human peroxisomes, although the same fusion protein is located in glycosomes when expressed in T. brucei (Saveria et al., 2007). This implies that peroxisomal membrane targeting of PEX14 is not mediated by respective human import mechanism.

Figure 4.3 Multiple sequence alignments of PEX19 orthologues of Saccharomyces cerevisiae (Sc), Homo sapiens (Hs) and Trypanosoma brucei (Tb) as performed with CLUSTALW. The blue circle depicts the sequence peptide involved in interaction with PEX14 whereas red circles indicate the potential diaromatic motifs of ScPEX19. No such motif was viewed in TbPEX19 sequence. Conserved residues are shaded grey with asterisk below the sequence. Similar residues are presented with 2 (highly similar) and 1 (less similar) dot below the respective positions.

100

Discussion

Using a variety of experimental approaches (yeast two hybrid assays, SEC and pull down experiments), no interaction was identified between T. brucei orthologues of PEX19 and PEX14. Structural basis of the molecular interaction of HsPEX19 and HsPEX14 revealed a conserved diaromatic motifs (F/YFxxxF) located in the N-terminal region of PEX19 which are responsible for binding with PEX14 (Neufeld et al., 2009). The sequence analysis of T. brucei PEX19 did not produce any comparable diaromatic motif although two putative regions resembling the diaromatic penta-peptide motifs of HsPEX19 are observed in the sequence of ScPEX19 (Fig. 4.3).

4.2.3 Identification of putative binding partners of PEX19

Several orthologues of peroxisomal proteins have already been identified by homology searches in Trypanosomatids, using yeast or human counterparts as queries. These include; peroxisomal receptors, PEX5 and PEX7, components of the docking complex, PEX14 and PEX13, members of the ring finger proteins, PEX2, PEX10 and PEX12, PEX11 family members including GIM5A and GIM5B along with PEX19, PEX4, PEX6 and PEX22. Other peroxins, which are essential for peroxisomal biogenesis, PEX3 and PEX16 could not be recognized by combined bioinformatics approaches. It was considered that the sequences of these proteins are largely diverged and therefore could not be exploited by sequence similarity. This also implies that these genes could serve as targets for potential glycosomal biogenesis inhibitors (Saveria et al., 2007).

Unlike matrix proteins, peroxisomal membrane proteins do not contain a general consensus targeting sequence. Nevertheless, PEX19 binds most of the PMPs through a stretch of basic residues and transport them to the peroxisomal membrane. To identify novel components of the glycosomal membrane, the approach of in vitro binding assays was employed. The BSF parasites were lysed under mild detergent conditions and in vitro expressed recombinant PEX19 was used to isolate PEX19-bound complexes by affinity chromatography. Mass spectrometry analysis of prospective candidates for PEX19 binding was performed by Dr. Katja Kuhlman (MPC, Ruhr-Universität Bochum).

A number of membrane PEX proteins which have been demonstrated as PEX19 ligands, in other organisms, were missing. There could be several reasons to explain this failure; (i) PEX19 transiently interacts with PMPs and this interaction is rarely captured in vitro, (ii) the binding affinity of interacting partners and PEX19 is generally low and might not withstand the laborious procedure of affinity purification which also involve digitonin treatment.

101

Discussion

Consistent with this experimental limitation of membrane proteins, earlier attempts to identify PEX13 from purified complexes remained unsuccessful (Verplaetse et al., 2009).

A number of known as well as the potential binding partners of PEX19 were isolated, demonstrating the success of this approach. Peroxisomes house the catabolism of long chain fatty acids which are transported through a family of ABC transporters. Three members of this family have been identified in T. brucei (Yernaux et al., 2006). Current analysis provide an evidence of direct binding of two of these family members with PEX19. A hypothetical protein, Tb427tmp.01.2020 has been reported by (Colasante et al., 2013) as glycosomal membrane protein. This polypeptide lacks functional domain, however two TMDs are predicted by TMHH. Another putative candidate having transmembrane anchoring region was identified under the gene ID, tb427tmp.01.1780. This protein has also been shown to be localized to glycosomes (Colasante et al., 2006, 2013; Güther et al., 2014). Both of these potential PMPs interact probably as cargo proteins with the PMP receptor PEX19.

PEX19 has been reported to interact with constituents of the cell division machinery; a vacuole sorting protein, Vps1 directly interacts with one of its two binding sites of PEX19 (Vizeacoumar et al., 2006). Interestingly, a peroxisomal localization of Vps1 has not yet been reported. A dynamin-like protein, Tb427.03.4720 which displays high sequence identity to yeast Vps1 (6e-165) has been identified as potential binding partner of T. brucei PEX19. Indeed, the orthologues of Tb427.03.4720, in other strains of T. brucei are annotated as vacuolar sorting protein 1 in TriTryp database. The sequence alignment of this putative Vps1 with known Vps1 of yeast demonstrate significantly higher sequence identity (Fig. 4.4).

102

Discussion

Figure 4.4 Multiple Sequence alignments of Vps1. Multiple sequence alignment of Vps1 orthologues of T.brucei (Tb), L. majora and known sequence of S. cerevisiae Vps1 was performed with CLUSTALW. Sequence alignment presents a high sequence identity (31%) among the sequences analyzed. The conserved residues are marked with asterisk below the respective positions. The PEX19 binding sites of S. serevisiae Vps1, as predicted by mathematical matrix, are underlined. Only the first binding site (509-523 aa) has been demonstrated to interct with PEX19 while second binding site ( 633-647 residues) is not involved in binding with PEX19 (Vizeacouma et al., 2006).

103

Discussion

Cargo-loaded PEX19 approaches to the membrane where PEX16 and PEX3; class II PMPs act as potential docking factors to mediate the unloading and subsequent recycling of PEX19. PEX16 was identified in mammals but its obvious orthologue is missing in number of organisms containing peroxisomes (Kim et al., 2006). A membrane protein, Tb427tmp.160.4700, with 4 TMDs was identified. The putative protein presents a weak resemblance with PEX16 domain (E-value 9e-3). Sequence alignment of this protein (Fig. 4.5) with other putative PEX16 of Trypanosomatids and known sequences of corresponding proteins of plant and mammals indicate that identified protein is PEX16.

104

Discussion

Figure 4.5 Multiple sequence alignment of various orthologues of PEX16. Multiple sequence alignment of TbPEX16 orthologues of T. brucei (Tb), L. donovano and L. tarentolae with known PEX16s of Arabidopsis thaliana (At), Mus musculus (Mm) and Human (Hs) as performed with CLUSTALW. The conserved regions are underlined while the identical residues are marked with asterisk below the respective positions.

105

Discussion

Using similar approach, A Trypanosoma homologue of PEX3 could not be identified. While PEX19 interacts with PMPs through C-terminus, its interaction with PEX3 is mediated through N-terminal region (Fransen et al., 2005). The cargo-loaded PEX19 exhibits a high affinity towards PEX3 at the membrane (Fang et al., 2004). The binding sites for PEX3 are well characterized in human PEX19 (Sato et al., 2010; Schmidt et al., 2010). T. brucei PEX19 shares maximum sequence similarity (41%) with HsPEX19 in PEX3 binding region (Saveria et al., 2007). Indeed, Yernaux et al., 2006 have shown that a truncated version of TbPEX19 (1-60 AA) interact with HsPEX3 by using bacterial two hybrid assays. This depicts that an orthologue of PEX3 likely exists in T. brucei although the sequence would have considerably been diverged.

4.2.4 Summary and Outlook

Using antisera raised against recombinant PEX19, the endogenous T. brucei PEX19 was immunologically detected at the size of 35 kDa. This value is significantly larger than the theoretical molar mass, suggesting post-translational modifications. Co-immunoprecipitated PEX19 could be tested for possible post-translational modifications.

The proteomic approach used in this study revealed several membrane proteins with unknown functions. The intracellular localization and function of these proteins could be analyzed in future studies and thereby, might lead to the identification of missing peroxins. In light of the central role of PEX19 interacting proteins in glycosomal biogenesis and obvious differences to human peroxisomal biogenesis machinery, the identified proteins could serve as a good targets for trypanocidal drugs. Regarding the identification of PEX3, a cargo- loaded PEX19 or an N-terminally truncated version of PEX19 (containing the conserved binding region of PEX3) could be applied to pull down putative PEX3, if present.

106

References

5.0 References

Agne, B., Meindl, N.M., Niederhoff, K., Einwächter, H., Rehling, P., Sickmann, A., Meyer, H.E., Girzalsky, W., and Kunau, W.H. (2003). Pex8p: an intraperoxisomal organizer of the peroxisomal import machinery. Mol. Cell 11, 635–646.

Alibu, V.P., Storm, L., Haile, S., Clayton, C., and Horn, D. (2005). A doubly inducible system for RNA interference and rapid RNAi plasmid construction in Trypanosoma brucei. Mol. Biochem. Parasitol. 139, 75–82.

Aman, R.A., Kenyon, G.L., and Wang, C.C. (1985). Cross-linking of the enzymes in the glycosome of Trypanosoma brucei. J. Biol. Chem. 260, 6966–6973.

Aronov, A.M., Verlinde, C.L., Hol, W.G., and Gelb, M.H. (1998). Selective tight binding inhibitors of trypanosomal glyceraldehyde-3-phosphate dehydrogenase via structure-based drug design. J. Med. Chem. 41, 4790–4799.

Baker, A., Graham, I.A., Holdsworth, M., Smith, S.M., and Theodoulou, F.L. (2006). Chewing the fat: beta-oxidation in signalling and development. Trends Plant Sci. 11, 124– 132.

Bakker, B.M., Mensonides, F.I., Teusink, B., van Hoek, P., Michels, P.A., and Westerhoff, H.V. (2000). Compartmentation protects trypanosomes from the dangerous design of glycolysis. Proc. Natl. Acad. Sci. U. S. A. 97, 2087–2092.

Balasegaram, M., Harris, S., Checchi, F., Hamel, C., and Karunakara, U. (2006). Treatment outcomes and risk factors for relapse in patients with early-stage human African trypanosomiasis (HAT) in the Republic of the Congo. Bull. World Health Organ. 84, 777– 782.

Banerjee, S.K., Kessler, P.S., Saveria, T., and Parsons, M. (2005). Identification of trypanosomatid PEX19: functional characterization reveals impact on cell growth and glycosome size and number. Mol. Biochem. Parasitol. 142, 47–55.

Barrett, M.P., Burchmore, R.J.S., Stich, A., Lazzari, J.O., Frasch, A.C., Cazzulo, J.J., and Krishna, S. (2003). The trypanosomiases. Lancet 362, 1469–1480.

Bashari, M., Lagnika, C., Ocen, D., Chen, H., Wang, J., Xu, X., and Jin, Z. (2013). Separation and characterization of dextran extracted from deteriorated sugarcane. Int. J. Biol. Macromol. 59, 246–254.

Bero, J., Beaufay, C., Hannaert, V., Hérent, M.-F., Michels, P.A., and Quetin-Leclercq, J. (2013). Antitrypanosomal compounds from the essential oil and extracts of Keetia leucantha leaves with inhibitor activity on Trypanosoma brucei glyceraldehyde-3-phosphate dehydrogenase. Phytomedicine Int. J. Phytother. Phytopharm. 20, 270–274.

Biebinger, S., Wirtz, L.E., Lorenz, P., and Clayton, C. (1997). Vectors for inducible expression of toxic gene products in bloodstream and procyclic Trypanosoma brucei. Mol. Biochem. Parasitol. 85, 99–112.

107 References

Blattner, J., Dörsam, H., and Clayton, C.E. (1995). Function of N-terminal import signals in trypanosome microbodies. FEBS Lett. 360, 310–314.

Boteva, R., Koek, A., Visser, N.V., Visser, A.J.W.G., Krieger, E., Zlateva, T., Veenhuis, M., and van der Klei, I. (2003). Fluorescence analysis of the Hansenula polymorpha peroxisomal targeting signal-1 receptor, Pex5p. Eur. J. Biochem. FEBS 270, 4332–4338.

Bottger, G., Barnett, P., Klein, A.T., Kragt, A., Tabak, H.F., and Distel, B. (2000). Saccharomyces cerevisiae PTS1 receptor Pex5p interacts with the SH3 domain of the peroxisomal membrane protein Pex13p in an unconventional, non-PXXP-related manner. Mol. Biol. Cell 11, 3963–3976.

Bray, P.G., Barrett, M.P., Ward, S.A., and de Koning, H.P. (2003). Pentamidine uptake and resistance in pathogenic protozoa: past, present and future. Trends Parasitol. 19, 232–239.

Brennand, A., Rigden, D.J., and Michels, P.A.M. (2012). Trypanosomes contain two highly different isoforms of peroxin PEX13 involved in glycosome biogenesis. FEBS Lett. 586, 1765–1771.

Bringaud, F., Rivière, L., and Coustou, V. (2006). Energy metabolism of trypanosomatids: adaptation to available carbon sources. Mol. Biochem. Parasitol. 149, 1–9.

Carvalho, A.F., Costa-Rodrigues, J., Correia, I., Costa Pessoa, J., Faria, T.Q., Martins, C.L., Fransen, M., Sá-Miranda, C., and Azevedo, J.E. (2006). The N-terminal Half of the Peroxisomal Cycling Receptor Pex5p is a Natively Unfolded Domain. J. Mol. Biol. 356, 864–875.

Celis, J.E., Carter N., Hunter T., Simons K., Small J.V. and Shotton D. 2006. Cell Biology: A Laboratory Handbook. 3rd Edition. v.4 Eds:Elsevier. Academic Press.

Chang, J., Mast, F.D., Fagarasanu, A., Rachubinski, D.A., Eitzen, G.A., Dacks, J.B., and Rachubinski, R.A. (2009). Pex3 peroxisome biogenesis proteins function in peroxisome inheritance as class V myosin receptors. J. Cell Biol. 187, 233–246.

Chappuis, F. (2007). Melarsoprol-free drug combinations for second-stage Gambian sleeping sickness: the way to go. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 45, 1443–1445.

Chappuis, F., Udayraj, N., Stietenroth, K., Meussen, A., and Bovier, P.A. (2005). Eflornithine is safer than melarsoprol for the treatment of second-stage Trypanosoma brucei gambiense human African trypanosomiasis. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 41, 748–751.

Chevray, P.M., and Nathans, D. (1992). Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun. Proc. Natl. Acad. Sci. U. S. A. 89, 5789–5793.

Choe, J., Moyersoen, J., Roach, C., Carter, T.L., Fan, E., Michels, P.A.M., and Hol, W.G.J. (2003). Analysis of the sequence motifs responsible for the interactions of peroxins 14 and 5, which are involved in glycosome biogenesis in Trypanosoma brucei. Biochemistry (Mosc.) 42, 10915–10922.

108 References

Colasante, C., Ellis, M., Ruppert, T., and Voncken, F. (2006). Comparative proteomics of glycosomes from bloodstream form and procyclic culture form Trypanosoma brucei brucei. Proteomics 6, 3275–3293.

Colasante, C., Voncken, F., Manful, T., Ruppert, T., Tielens, A.G.M., van Hellemond, J.J., and Clayton, C. (2013). Proteins and lipids of glycosomal membranes from Leishmania tarentolae and Trypanosoma brucei. F1000Research 2, 27.

Costa-Rodrigues, J., Carvalho, A.F., Fransen, M., Hambruch, E., Schliebs, W., Sá-Miranda, C., and Azevedo, J.E. (2005). Pex5p, the peroxisomal cycling receptor, is a monomeric non- globular protein. J. Biol. Chem. 280, 24404–24411.

Cyr, N., Madrid, K.P., Strasser, R., Aurousseau, M., Finn, R., Ausio, J., and Jardim, A. (2008). Leishmania donovani peroxin 14 undergoes a marked conformational change following association with peroxin 5. J. Biol. Chem. 283, 31488–31499.

Dammai, V., and Subramani, S. (2001). The human peroxisomal targeting signal receptor, Pex5p, is translocated into the peroxisomal matrix and recycled to the cytosol. Cell 105, 187– 196.

Van Deursen, F.J., Shahi, S.K., Turner, C.M., Hartmann, C., Guerra-Giraldez, C., Matthews, K.R., and Clayton, C.E. (2001). Characterisation of the growth and differentiation in vivo and in vitro-of bloodstream-form Trypanosoma brucei strain TREU 927. Mol. Biochem. Parasitol. 112, 163–171.

Diseases, U.B.S.P. for R. and T. in T. (2001). Tropical disease research : progress 1999- 2000 : fifteenth programme report.

De Duve, C. (1969). The peroxisome: a new cytoplasmic organelle. Proc. R. Soc. Lond. Ser. B Contain. Pap. Biol. Character R. Soc. G. B. 173, 71–83.

De Duve, C., and Baudhuin, P. (1966). Peroxisomes (microbodies and related particles). Physiol. Rev. 46, 323–357.

Dyer, N.A., Rose, C., Ejeh, N.O., and Acosta-Serrano, A. (2013). Flying tryps: survival and maturation of trypanosomes in tsetse flies. Trends Parasitol. 29, 188–196.

Eckert, J.H., and Erdmann, R. (2003). Peroxisome biogenesis. Rev. Physiol. Biochem. Pharmacol. 147, 75–121.

Eitzen, G.A., Szilard, R.K., and Rachubinski, R.A. (1997). Enlarged peroxisomes are present in oleic acid-grown Yarrowia lipolytica overexpressing the PEX16 gene encoding an intraperoxisomal peripheral membrane peroxin. J. Cell Biol. 137, 1265–1278.

Elgersma, Y., van Roermund, C.W., Wanders, R.J., and Tabak, H.F. (1995). Peroxisomal and mitochondrial carnitine acetyltransferases of Saccharomyces cerevisiae are encoded by a single gene. EMBO J. 14, 3472–3479.

Erdmann, R., and Blobel, G. (1996). Identification of Pex13p a peroxisomal membrane receptor for the PTS1 recognition factor. J. Cell Biol. 135, 111–121.

109 References

Erdmann, R., and Schliebs, W. (2005). Peroxisomal matrix protein import: the transient pore model. Nat. Rev. Mol. Cell Biol. 6, 738–742.

Erdmann, R., Veenhuis, M., Mertens, D., and Kunau, W.H. (1989). Isolation of peroxisome- deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 86, 5419– 5423.

Faber, K.N., van Dijk, R., Keizer-Gunnink, I., Koek, A., van der Klei, I.J., and Veenhuis, M. (2002). Import of assembled PTS1 proteins into peroxisomes of the yeast Hansenula polymorpha: yes and no! Biochim. Biophys. Acta 1591, 157–162.

Fairlamb, A.H. (2003). Chemotherapy of human African trypanosomiasis: current and future prospects. Trends Parasitol. 19, 488–494.

Fang, Y., Morrell, J.C., Jones, J.M., and Gould, S.J. (2004). PEX3 functions as a PEX19 docking factor in the import of class I peroxisomal membrane proteins. J. Cell Biol. 164, 863–875.

Fields, S., and Song, O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245–246.

Franken, T. (1995). Identifizierung und Charakterisierung peroxisomaler Membranen in pas- Mutanten vom Typ 1 aus Saccharomyces cerevisiae.

Fransen, M., Brees, C., Ghys, K., Amery, L., Mannaerts, G.P., Ladant, D., and Van Veldhoven, P.P. (2002). Analysis of mammalian peroxin interactions using a non- transcription-based bacterial two-hybrid assay. Mol. Cell. Proteomics MCP 1, 243–252.

Fransen, M., Vastiau, I., Brees, C., Brys, V., Mannaerts, G.P., and Van Veldhoven, P.P. (2005). Analysis of human Pex19p’s domain structure by pentapeptide scanning mutagenesis. J. Mol. Biol. 346, 1275–1286.

Freitas, M.O., Francisco, T., Rodrigues, T.A., Alencastre, I.S., Pinto, M.P., Grou, C.P., Carvalho, A.F., Fransen, M., Sá-Miranda, C., and Azevedo, J.E. (2011). PEX5 protein binds monomeric catalase blocking its tetramerization and releases it upon binding the N-terminal domain of PEX14. J. Biol. Chem. 286, 40509–40519.

Furuya, T., Kessler, P., Jardim, A., Schnaufer, A., Crudder, C., and Parsons, M. (2002). Glucose is toxic to glycosome-deficient trypanosomes. Proc. Natl. Acad. Sci. 99, 14177– 14182.

Gatto, G.J., Geisbrecht, B.V., Gould, S.J., and Berg, J.M. (2000). Peroxisomal targeting signal-1 recognition by the TPR domains of human PEX5. Nat. Struct. Biol. 7, 1091–1095.

Ghaedi, K., Tamura, S., Okumoto, K., Matsuzono, Y., and Fujiki, Y. (2000). The Peroxin Pex3p Initiates Membrane Assembly in Peroxisome Biogenesis. Mol. Biol. Cell 11, 2085– 2102.

Gietz, R.D., and Schiestl, R.H. (2007). High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 31–34.

110 References

Girzalsky, W., Rehling, P., Stein, K., Kipper, J., Blank, L., Kunau, W.H., and Erdmann, R. (1999). Involvement of Pex13p in Pex14p localization and peroxisomal targeting signal 2- dependent protein import into peroxisomes. J. Cell Biol. 144, 1151–1162.

Girzalsky, W., Saffian, D., and Erdmann, R. (2010). Peroxisomal protein translocation. Biochim. Biophys. Acta 1803, 724–731.

Gonzalez, N.H., Felsner, G., Schramm, F.D., Klingl, A., Maier, U.-G., and Bolte, K. (2011). A single peroxisomal targeting signal mediates matrix protein import in diatoms. PloS One 6, e25316.

Götte, K., Girzalsky, W., Linkert, M., Baumgart, E., Kammerer, S., Kunau, W.H., and Erdmann, R. (1998). Pex19p, a farnesylated protein essential for peroxisome biogenesis. Mol. Cell. Biol. 18, 616–628.

Gould, S.G., Keller, G.A., and Subramani, S. (1987). Identification of a peroxisomal targeting signal at the carboxy terminus of firefly luciferase. J. Cell Biol. 105, 2923–2931.

Gould, S.J., Keller, G.A., Hosken, N., Wilkinson, J., and Subramani, S. (1989). A conserved tripeptide sorts proteins to peroxisomes. J. Cell Biol. 108, 1657–1664.

Gould, S.J., Kalish, J.E., Morrell, J.C., Bjorkman, J., Urquhart, A.J., and Crane, D.I. (1996). Pex13p is an SH3 protein of the peroxisome membrane and a docking factor for the predominantly cytoplasmic PTs1 receptor. J. Cell Biol. 135, 85–95.

Gouveia, A.M., Reguenga, C., Oliveira, M.E., Sa-Miranda, C., and Azevedo, J.E. (2000). Characterization of peroxisomal Pex5p from rat liver. Pex5p in the Pex5p-Pex14p membrane complex is a transmembrane protein. J. Biol. Chem. 275, 32444–32451.

Grunau, S., Schliebs, W., Linnepe, R., Neufeld, C., Cizmowski, C., Reinartz, B., Meyer, H.E., Warscheid, B., Girzalsky, W., and Erdmann, R. (2009). Peroxisomal targeting of PTS2 pre-import complexes in the yeast Saccharomyces cerevisiae. Traffic Cph. Den. 10, 451–460.

Gualdrón-López, M., and Michels, P.A.M. (2013). Processing of the glycosomal matrix- protein import receptor PEX5 of Trypanosoma brucei. Biochem. Biophys. Res. Commun. 431, 98–103.

Guo, L., Du, X., Lan, J., and Liang, Q. (2010). Study on molecular structural characteristics of tea polysaccharide. Int. J. Biol. Macromol. 47, 244–249.

Gurvitz, A., Wabnegger, L., Langer, S., Hamilton, B., Ruis, H., and Hartig, A. (2001). The tetratricopeptide repeat domains of human, tobacco, and nematode PEX5 proteins are functionally interchangeable with the analogous native domain for peroxisomal import of PTS1-terminated proteins in yeast. Mol. Genet. Genomics MGG 265, 276–286.

Güther, M.L.S., Urbaniak, M.D., Tavendale, A., Prescott, A., and Ferguson, M.A.J. (2014). High-confidence glycosome proteome for procyclic form trypanosoma brucei by epitope-tag organelle enrichment and SILAC proteomics. J. Proteome Res. 13, 2796–2806.

Hadden, D.A., Phillipson, B.A., Johnston, K.A., Brown, L.-A., Manfield, I.W., El-Shami, M., Sparkes, I.A., and Baker, A. (2006). Arabidopsis PEX19 is a dimeric protein that binds the peroxin PEX10. Mol. Membr. Biol. 23, 325–336.

111 References

Halbach, A., Lorenzen, S., Landgraf, C., Volkmer-Engert, R., Erdmann, R., and Rottensteiner, H. (2005). Function of the PEX19-binding site of human adrenoleukodystrophy protein as targeting motif in man and yeast. PMP targeting is evolutionarily conserved. J. Biol. Chem. 280, 21176–21182.

Halbach, A., Rucktäschel, R., Rottensteiner, H., and Erdmann, R. (2009). The N-domain of Pex22p can functionally replace the Pex3p N-domain in targeting and peroxisome formation. J. Biol. Chem. 284, 3906–3916.

Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166, 557-580. Hayashi, M., Yagi, M., Nito, K., Kamada, T., and Nishimura, M. (2005). Differential Contribution of Two Peroxisomal Protein Receptors to the Maintenance of Peroxisomal Functions in Arabidopsis. J. Biol. Chem. 280, 14829–14835.

Hazra, P.P., Suriapranata, I., Snyder, W.B., and Subramani, S. (2002). Peroxisome remnants in pex3delta cells and the requirement of Pex3p for interactions between the peroxisomal docking and translocation subcomplexes. Traffic Cph. Den. 3, 560–574.

Heiland, I., and Erdmann, R. (2005). Biogenesis of peroxisomes. Topogenesis of the peroxisomal membrane and matrix proteins. FEBS J. 272, 2362–2372.

Hettema, E.H., van Roermund, C.W., Distel, B., van den Berg, M., Vilela, C., Rodrigues- Pousada, C., Wanders, R.J., and Tabak, H.F. (1996). The ABC transporter proteins Pat1 and Pat2 are required for import of long-chain fatty acids into peroxisomes of Saccharomyces cerevisiae. EMBO J. 15, 3813–3822.

Hettema, E.H., Girzalsky, W., van den Berg, M., Erdmann, R., and Distel, B. (2000). Saccharomyces cerevisiae Pex3p and Pex19p are required for proper localization and stability of peroxisomal membrane proteins. EMBO J. 19, 223–233.

Hirumi, H., and Hirumi, K. (1989). Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J. Parasitol. 75, 985–989.

Hoepfner, D., van den Berg, M., Philippsen, P., Tabak, H.F., and Hettema, E.H. (2001). A role for Vps1p, actin, and the Myo2p motor in peroxisome abundance and inheritance in Saccharomyces cerevisiae. J. Cell Biol. 155, 979–990.

Hoepfner, D., Schildknegt, D., Braakman, I., Philippsen, P., and Tabak, H.F. (2005). Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122, 85–95.

Hogenboom, S., Romeijn, G.J., Houten, S.M., Baes, M., Wanders, R.J.A., and Waterham, H.R. (2002). Absence of functional peroxisomes does not lead to deficiency of enzymes involved in cholesterol biosynthesis. J. Lipid Res. 43, 90–98.

Holmes, P. (2013). Tsetse-transmitted trypanosomes--their biology, disease impact and control. J. Invertebr. Pathol. 112 Suppl, S11–S14.

Holmes, P.H., Eisler, M.C., and Geerts, S. (2004). Current chemotherapy of animal trypanosomiasis. 431–444.

112 References

Honsho, M., Hiroshige, T., and Fujiki, Y. (2002). The membrane biogenesis peroxin Pex16p. Topogenesis and functional roles in peroxisomal membrane assembly. J. Biol. Chem. 277, 44513–44524.

Huber, P.A.J., Birdsey, G.M., Lumb, M.J., Prowse, D.T.R., Perkins, T.J., Knight, D.R., and Danpure, C.J. (2005). Peroxisomal import of human alanine:glyoxylate aminotransferase requires ancillary targeting information remote from its C terminus. J. Biol. Chem. 280, 27111–27120.

Ikeda, M., Kanouchi, H., and Minatogawa, Y. (2008). Characterization of peroxisomal targeting signals on alanine: glyoxylate aminotransferase. Biol. Pharm. Bull. 31, 131–134.

Islinger, M., Li, K.W., Seitz, J., Völkl, A., and Lüers, G.H. (2009). Hitchhiking of Cu/Zn superoxide dismutase to peroxisomes--evidence for a natural piggyback import mechanism in mammals. Traffic Cph. Den. 10, 1711–1721.

Itoh, R., and Fujiki, Y. (2006). Functional domains and dynamic assembly of the peroxin Pex14p, the entry site of matrix proteins. J. Biol. Chem. 281, 10196–10205.

Jardim, A., Rager, N., Liu, W., and Ullman, B. (2002). Peroxisomal targeting protein 14 (PEX14) from Leishmania donovani. Molecular, biochemical, and immunocytochemical characterization. Mol. Biochem. Parasitol. 124, 51–62.

Jedd, G., and Chua, N.H. (2000). A new self-assembled peroxisomal vesicle required for efficient resealing of the plasma membrane. Nat. Cell Biol. 2, 226–231.

Jones, J.M., Morrell, J.C., and Gould, S.J. (2004). PEX19 is a predominantly cytosolic chaperone and import receptor for class 1 peroxisomal membrane proteins. J. Cell Biol. 164, 57–67.

Karnik, S.K., and Trelease, R.N. (2007). Arabidopsis peroxin 16 trafficks through the ER and an intermediate compartment to pre-existing peroxisomes via overlapping molecular targeting signals. J. Exp. Bot. 58, 1677–1693.

Karpichev, I.V., and Small, G.M. (2000). Evidence for a novel pathway for the targeting of a Saccharomyces cerevisiae peroxisomal protein belonging to the isomerase/hydratase family. J. Cell Sci. 113 ( Pt 3), 533–544.

Kennedy, P.G.E. (2004). Human African trypanosomiasis of the CNS: current issues and challenges. J. Clin. Invest. 113, 496–504.

Kiel, J.A.K.W., Emmrich, K., Meyer, H.E., and Kunau, W.-H. (2005). Ubiquitination of the peroxisomal targeting signal type 1 receptor, Pex5p, suggests the presence of a quality control mechanism during peroxisomal matrix protein import. J. Biol. Chem. 280, 1921– 1930.

Kiel, J.A.K.W., Veenhuis, M., and van der Klei, I.J. (2006). PEX genes in fungal genomes: common, rare or redundant. Traffic Cph. Den. 7, 1291–1303.

Kim, H., Feil, I.K., Verlinde, C.L., Petra, P.H., and Hol, W.G. (1995). Crystal structure of glycosomal glyceraldehyde-3-phosphate dehydrogenase from Leishmania mexicana:

113 References implications for structure-based drug design and a new position for the inorganic phosphate binding site. Biochemistry (Mosc.) 34, 14975–14986.

Kim, P.K., Mullen, R.T., Schumann, U., and Lippincott-Schwartz, J. (2006). The origin and maintenance of mammalian peroxisomes involves a de novo PEX16-dependent pathway from the ER. J. Cell Biol. 173, 521–532.

Klein, A.T.J. , van den Berg, M., Bottger, G., Tabak, H.F., Distel, B. Saccharomyces cerevisiae acyl-CoA oxidase follows a novel, non-PTS1, import pathway into peroxisomes that is dependent on Pex5p, J. Biol. Chem. 277 (2002) 25011–25019

Kovacs, W.J., and Krisans, S. (2003). Cholesterol biosynthesis and regulation: role of peroxisomes. Adv. Exp. Med. Biol. 544, 315–327.

Kovacs, W.J., Olivier, L.M., and Krisans, S.K. (2002). Central role of peroxisomes in isoprenoid biosynthesis. Prog. Lipid Res. 41, 369–391.

Kragt, A., Voorn-Brouwer, T., van den Berg, M., and Distel, B. (2005a). Endoplasmic reticulum-directed Pex3p routes to peroxisomes and restores peroxisome formation in a Saccharomyces cerevisiae pex3Delta strain. J. Biol. Chem. 280, 34350–34357.

Kragt, A., Voorn-Brouwer, T., van den Berg, M., and Distel, B. (2005b). The Saccharomyces cerevisiae peroxisomal import receptor Pex5p is monoubiquitinated in wild type cells. J. Biol. Chem. 280, 7867–7874.

Krazy, H., and Michels, P.A.M. (2006). Identification and characterization of three peroxins- -PEX6, PEX10 and PEX12--involved in glycosome biogenesis in Trypanosoma brucei. Biochim. Biophys. Acta 1763, 6–17.

Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. Lametschwandtner, G., Brocard, C., Fransen, M., Van Veldhoven, P., Berger, J., and Hartig, A. (1998). The difference in recognition of terminal tripeptides as peroxisomal targeting signal 1 between yeast and human is due to different affinities of their receptor Pex5p to the cognate signal and to residues adjacent to it. J. Biol. Chem. 273, 33635–33643.

Legros, D., Ollivier, G., Gastellu-Etchegorry, M., Paquet, C., Burri, C., Jannin, J., and Büscher, P. (2002). Treatment of human African trypanosomiasis--present situation and needs for research and development. Lancet Infect. Dis. 2, 437–440.

Lejon, V., Bentivoglio, M., and Franco, J.R. (2013). Human African trypanosomiasis. Handb. Clin. Neurol. 114, 169–181.

Leung, K.F., Riley, F.S., Carrington, M., and Field, M.C. (2011). Ubiquitylation and developmental regulation of invariant surface protein expression in trypanosomes. Eukaryot. Cell 10, 916–931.

Lugli, E.B., Pouliot, M., Portela, M.D.P.M., Loomis, M.R., and Raper, J. (2004). Characterization of primate trypanosome lytic factors. Mol. Biochem. Parasitol. 138, 9–20.

114 References

Luo, B., Norris, C., Bolstad, E.S.D., Knecht, D.A., and Grant, D.F. (2008). Protein quaternary structure and expression levels contribute to peroxisomal-targeting-sequence-1- mediated peroxisomal import of human soluble epoxide hydrolase. J. Mol. Biol. 380, 31–41.

Ma, C., and Reumann, S. (2008). Improved prediction of peroxisomal PTS1 proteins from genome sequences based on experimental subcellular targeting analyses as exemplified for protein kinases from Arabidopsis. J. Exp. Bot. 59, 3767–3779.

Ma, C., Hagstrom, D., Polley, S.G., and Subramani, S. (2013). Redox-regulated cargo binding and release by the peroxisomal targeting signal receptor, Pex5. J. Biol. Chem. 288, 27220–27231.

MacGregor, P., and Matthews, K.R. (2010). New discoveries in the transmission biology of sleeping sickness parasites: applying the basics. J. Mol. Med. Berl. Ger. 88, 865–871.

Madrid, K.P., and Jardim, A. (2005). Peroxin 5–peroxin 14 association in the protozoan Leishmania donovani involves a novel protein–protein interaction motif. Biochem. J. 391, 105–114.

Madrid, K.P., De Crescenzo, G., Wang, S., and Jardim, A. (2004). Modulation of the Leishmania donovani peroxin 5 quaternary structure by peroxisomal targeting signal 1 ligands. Mol. Cell. Biol. 24, 7331–7344.

Mariño, K., Güther, M.L.S., Wernimont, A.K., Amani, M., Hui, R., and Ferguson, M.A.J. (2010). Identification, subcellular localization, biochemical properties, and high-resolution crystal structure of Trypanosoma brucei UDP-glucose pyrophosphorylase. Glycobiology 20, 1619–1630.

Marzioch, M., Erdmann, R., Veenhuis, M., and Kunau, W.H. (1994). PAS7 encodes a novel yeast member of the WD-40 protein family essential for import of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxisomes. EMBO J. 13, 4908–4918.

Matsuzaki, T., and Fujiki, Y. (2008). The peroxisomal membrane protein import receptor Pex3p is directly transported to peroxisomes by a novel Pex19p- and Pex16p-dependent pathway. J. Cell Biol. 183, 1275–1286.

Matsuzono, Y., and Fujiki, Y. (2006). In vitro transport of membrane proteins to peroxisomes by shuttling receptor Pex19p. J. Biol. Chem. 281, 36–42.

Matsuzono, Y., Kinoshita, N., Tamura, S., Shimozawa, N., Hamasaki, M., Ghaedi, K., Wanders, R.J., Suzuki, Y., Kondo, N., and Fujiki, Y. (1999). Human PEX19: cDNA cloning by functional complementation, mutation analysis in a patient with Zellweger syndrome, and potential role in peroxisomal membrane assembly. Proc. Natl. Acad. Sci. U. S. A. 96, 2116– 2121.

Mayerhofer, P.U., Kattenfeld, T., Roscher, A.A., and Muntau, A.C. (2002). Two splice variants of human PEX19 exhibit distinct functions in peroxisomal assembly. Biochem. Biophys. Res. Commun. 291, 1180–1186.

McNew, J.A., and Goodman, J.M. (1996). The targeting and assembly of peroxisomal proteins: some old rules do not apply. Trends Biochem. Sci. 21, 54–58.

115 References

McTigue, M.A., Williams, D.R., and Tainer, J.A. (1995). Crystal structures of a schistosomal drug and vaccine target: glutathione S-transferase from Schistosoma japonica and its complex with the leading antischistosomal drug praziquantel. J. Mol. Biol. 246, 21–27.

Moscicka, K.B., Klompmaker, S.H., Wang, D., van der Klei, I.J., and Boekema, E.J. (2007). The Hansenula polymorpha peroxisomal targeting signal 1 receptor, Pex5p, functions as a tetramer. FEBS Lett. 581, 1758–1762.

Motley, A.M., Hettema, E.H., Ketting, R., Plasterk, R., and Tabak, H.F. (2000). Caenorhabditis elegans has a single pathway to target matrix proteins to peroxisomes. EMBO Rep. 1, 40–46.

Moyersoen, J., Choe, J., Kumar, A., Voncken, F.G.J., Hol, W.G.J., and Michels, P.A.M. (2003). Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins. Eur. J. Biochem. FEBS 270, 2059–2067.

Muntau, A.C., Mayerhofer, P.U., Paton, B.C., Kammerer, S., and Roscher, A.A. (2000). Defective Peroxisome Membrane Synthesis Due To Mutations in Human PEX3 Causes Zellweger Syndrome, Complementation Group G. Am. J. Hum. Genet. 67, 967–975.

Neufeld, C., Filipp, F.V., Simon, B., Neuhaus, A., Schüller, N., David, C., Kooshapur, H., Madl, T., Erdmann, R., Schliebs, W., et al. (2009). Structural basis for competitive interactions of Pex14 with the import receptors Pex5 and Pex19. EMBO J. 28, 745–754.

Neuhaus, A., Kooshapur, H., Wolf, J., Meyer, N.H., Madl, T., Saidowsky, J., Hambruch, E., Lazam, A., Jung, M., Sattler, M., et al. (2014). A novel Pex14 protein-interacting site of human Pex5 is critical for matrix protein import into peroxisomes. J. Biol. Chem. 289, 437– 448.

Ngantchou, I., Nkwengoua, E., Nganso, Y., Nyasse, B., Denier, C., Hannaert, V., and Schneider, B. (2009). Antitrypanosomal activity of polycarpol from Piptostigma preussi (Annonaceae). Fitoterapia 80, 188–191.

Nito, K., Hayashi, M., and Nishimura, M. (2002). Direct interaction and determination of binding domains among peroxisomal import factors in Arabidopsis thaliana. Plant Cell Physiol. 43, 355–366.

Nuttall, J.M., Motley, A., and Hettema, E.H. (2011). Peroxisome biogenesis: recent advances. Curr. Opin. Cell Biol. 23, 421–426.

Oberle, M., Balmer, O., Brun, R., and Roditi, I. (2010). Bottlenecks and the maintenance of minor genotypes during the life cycle of Trypanosoma brucei. PLoS Pathog. 6, e1001023.

Odiit, M., Kansiime, F., and Enyaru, J.C. (1997). Duration of symptoms and case fatality of sleeping sickness caused by Trypanosoma brucei rhodesiense in Tororo, Uganda. East Afr. Med. J. 74, 792–795.

Opperdoes, F.R., and Borst, P. (1977). Localization of nine glycolytic enzymes in a microbody-like organelle in Trypanosoma brucei: the glycosome. FEBS Lett. 80, 360–364.

Osumi, T., Tsukamoto, T., Hata, S., Yokota, S., Miura, S., Fujiki, Y., Hijikata, M., Miyazawa, S., and Hashimoto, T. (1991). Amino-terminal presequence of the precursor of

116 References peroxisomal 3-ketoacyl-CoA thiolase is a cleavable signal peptide for peroxisomal targeting. Biochem. Biophys. Res. Commun. 181, 947–954.

Otera, H., Okumoto, K., Tateishi, K., Ikoma, Y., Matsuda, E., Nishimura, M., Tsukamoto, T., Osumi, T., Ohashi, K., Higuchi, O., et al. (1998). Peroxisome targeting signal type 1 (PTS1) receptor is involved in import of both PTS1 and PTS2: studies with PEX5-defective CHO cell mutants. Mol. Cell. Biol. 18, 388–399.

Otera, H., Harano, T., Honsho, M., Ghaedi, K., Mukai, S., Tanaka, A., Kawai, A., Shimizu, N., and Fujiki, Y. (2000). The mammalian peroxin Pex5pL, the longer isoform of the mobile peroxisome targeting signal (PTS) type 1 transporter, translocates the Pex7p.PTS2 protein complex into peroxisomes via its initial docking site, Pex14p. J. Biol. Chem. 275, 21703– 21714.

Otzen, M., Perband, U., Wang, D., Baerends, R.J.S., Kunau, W.H., Veenhuis, M., and Van der Klei, I.J. (2004). Hansenula polymorpha Pex19p is essential for the formation of functional peroxisomal membranes. J. Biol. Chem. 279, 19181–19190.

Otzen, M., Wang, D., Lunenborg, M.G.J., and van der Klei, I.J. (2005). Hansenula polymorpha Pex20p is an oligomer that binds the peroxisomal targeting signal 2 (PTS2). J. Cell Sci. 118, 3409–3418.

Parsons, M. (2004). Glycosomes: parasites and the divergence of peroxisomal purpose. Mol. Microbiol. 53, 717–724.

Pavão, F., Castilho, M.S., Pupo, M.T., Dias, R.L.A., Correa, A.G., Fernandes, J.B., da Silva, M.F.G.F., Mafezoli, J., Vieira, P.C., and Oliva, G. (2002). Structure of Trypanosoma cruzi glycosomal glyceraldehyde-3-phosphate dehydrogenase complexed with chalepin, a natural product inhibitor, at 1.95 A resolution. FEBS Lett. 520, 13–17.

Peterson, G.C., Sommer, J.M., Klosterman, S., Wang, C.C., and Parsons, M. (1997). Trypanosoma brucei: identification of an internal region of phosphoglycerate kinase required for targeting to glycosomal microbodies. Exp. Parasitol. 85, 16–23.

Pilar, A.V.C., Madrid, K.P., and Jardim, A. (2008). Interaction of Leishmania PTS2 receptor peroxin 7 with the glycosomal protein import machinery. Mol. Biochem. Parasitol. 158, 72– 81.

Pinto, M.P., Grou, C.P., Alencastre, I.S., Oliveira, M.E., Sá-Miranda, C., Fransen, M., and Azevedo, J.E. (2006). The import competence of a peroxisomal membrane protein is determined by Pex19p before the docking step. J. Biol. Chem. 281, 34492–34502.

Pires, J.R., Hong, X., Brockmann, C., Volkmer-Engert, R., Schneider-Mergener, J., Oschkinat, H., and Erdmann, R. (2003). The ScPex13p SH3 domain exposes two distinct binding sites for Pex5p and Pex14p. J. Mol. Biol. 326, 1427–1435.

Platta, H.W., Girzalsky, W., and Erdmann, R. (2004). Ubiquitination of the peroxisomal import receptor Pex5p. Biochem. J. 384, 37–45.

Platta, H.W., El Magraoui, F., Bäumer, B.E., Schlee, D., Girzalsky, W., and Erdmann, R. (2009). Pex2 and pex12 function as protein-ubiquitin ligases in peroxisomal protein import. Mol. Cell. Biol. 29, 5505–5516.

117 References

Purdue, P.E., and Lazarow, P.B. (1996). Targeting of human catalase to peroxisomes is dependent upon a novel COOH-terminal peroxisomal targeting sequence. J. Cell Biol. 134, 849–862.

Purdue, P.E., Yang, X., and Lazarow, P.B. (1998). Pex18p and Pex21p, a novel pair of related peroxins essential for peroxisomal targeting by the PTS2 pathway. J. Cell Biol. 143, 1859–1869.

Rachubinski, R.A., and Subramani, S. (1995). How proteins penetrate peroxisomes. Cell 83, 525–528.

Raper, J., Fung, R., Ghiso, J., Nussenzweig, V., and Tomlinson, S. (1999). Characterization of a novel trypanosome lytic factor from human serum. Infect. Immun. 67, 1910–1916.

Rehling, P., Marzioch, M., Niesen, F., Wittke, E., Veenhuis, M., and Kunau, W.H. (1996). The import receptor for the peroxisomal targeting signal 2 (PTS2) in Saccharomyces cerevisiae is encoded by the PAS7 gene. EMBO J. 15, 2901–2913.

Reumann, S., Babujee, L., Ma, C., Wienkoop, S., Siemsen, T., Antonicelli, G.E., Rasche, N., Lüder, F., Weckwerth, W., and Jahn, O. (2007). Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. Plant Cell 19, 3170–3193.

Reumann, S., Quan, S., Aung, K., Yang, P., Manandhar-Shrestha, K., Holbrook, D., Linka, N., Switzenberg, R., Wilkerson, C.G., Weber, A.P.M., et al. (2009). In-Depth Proteome Analysis of Arabidopsis Leaf Peroxisomes Combined with in Vivo Subcellular Targeting Verification Indicates Novel Metabolic and Regulatory Functions of Peroxisomes. Plant Physiol. 150, 125–143.

Rhodin, J.A.G. (1954). Correlation of ultrastructural organization: and function in normal and experimentally changed proximal convoluted tubule cells of the mouse kidney: an electron microscopic study. Dept. of Anatomy, Karolinska Institutet.

Roditi, I., and Lehane, M.J. (2008). Interactions between trypanosomes and tsetse flies. Curr. Opin. Microbiol. 11, 345–351.

Van Roermund, C.W.T., Visser, W.F., Ijlst, L., van Cruchten, A., Boek, M., Kulik, W., Waterham, H.R., and Wanders, R.J.A. (2008). The human peroxisomal ABC half transporter ALDP functions as a homodimer and accepts acyl-CoA esters. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 22, 4201–4208.

Van Roermund, C.W., Elgersma, Y., Singh, N., Wanders, R.J., and Tabak, H.F. (1995). The membrane of peroxisomes in Saccharomyces cerevisiae is impermeable to NAD(H) and acetyl-CoA under in vivo conditions. EMBO J. 14, 3480–3486.

Rottensteiner, H., Kramer, A., Lorenzen, S., Stein, K., Landgraf, C., Volkmer-Engert, R., and Erdmann, R. (2004). Peroxisomal membrane proteins contain common Pex19p-binding sites that are an integral part of their targeting signals. Mol. Biol. Cell 15, 3406–3417.

Rotureau, B., and Van Den Abbeele, J. (2013). Through the dark continent: African trypanosome development in the tsetse fly. Front. Cell. Infect. Microbiol. 3.

118 References

Rucktäschel, R., Thoms, S., Sidorovitch, V., Halbach, A., Pechlivanis, M., Volkmer, R., Alexandrov, K., Kuhlmann, J., Rottensteiner, H., and Erdmann, R. (2009). Farnesylation of Pex19p Is Required for Its Structural Integrity and Function in Peroxisome Biogenesis. J. Biol. Chem. 284, 20885–20896.

Sacksteder, K.A., Jones, J.M., South, S.T., Li, X., Liu, Y., and Gould, S.J. (2000a). PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis. J. Cell Biol. 148, 931–944.

Sacksteder, K.A., Jones, J.M., South, S.T., Li, X., Liu, Y., and Gould, S.J. (2000b). PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis. J. Cell Biol. 148, 931–944.

Santos, M.J., Imanaka, T., Shio, H., Small, G.M., and Lazarow, P.B. (1988). Peroxisomal membrane ghosts in Zellweger syndrome--aberrant organelle assembly. Science 239, 1536– 1538.

Sato, Y., Shibata, H., Nakatsu, T., Nakano, H., Kashiwayama, Y., Imanaka, T., and Kato, H. (2010). Structural basis for docking of peroxisomal membrane protein carrier Pex19p onto its receptor Pex3p. EMBO J. 29, 4083–4093.

Saveria, T., Halbach, A., Erdmann, R., Volkmer-Engert, R., Landgraf, C., Rottensteiner, H., and Parsons, M. (2007). Conservation of PEX19-binding motifs required for protein targeting to mammalian peroxisomal and trypanosome glycosomal membranes. Eukaryot. Cell 6, 1439–1449.

Schliebs, W., Saidowsky, J., Agianian, B., Dodt, G., Herberg, F.W., and Kunau, W.H. (1999). Recombinant human peroxisomal targeting signal receptor PEX5. Structural basis for interaction of PEX5 with PEX14. J. Biol. Chem. 274, 5666–5673.

Schmidt, F., Treiber, N., Zocher, G., Bjelic, S., Steinmetz, M.O., Kalbacher, H., Stehle, T., and Dodt, G. (2010). Insights into peroxisome function from the structure of PEX3 in complex with a soluble fragment of PEX19. J. Biol. Chem. 285, 25410–25417.

Schrader, M., and Fahimi, H.D. (2008). The peroxisome: still a mysterious organelle. Histochem. Cell Biol. 129, 421–440.

Sharff, A.J., Rodseth, L.E., and Quiocho, F.A. (1993). Refined 1.8-A structure reveals the mode of binding of beta-cyclodextrin to the maltodextrin binding protein. Biochemistry (Mosc.) 32, 10553–10559.

Shibata, H., Kashiwayama, Y., Imanaka, T., and Kato, H. (2004). Domain architecture and activity of human Pex19p, a chaperone-like protein for intracellular trafficking of peroxisomal membrane proteins. J. Biol. Chem. 279, 38486–38494.

Shinozaki, A., Sato, N., and Hayashi, Y. (2009). Peroxisomal targeting signals in green algae. Protoplasma 235, 57–66.

Shiozawa, K., Konarev, P.V., Neufeld, C., Wilmanns, M., and Svergun, D.I. (2009). Solution structure of human Pex5.Pex14.PTS1 protein complexes obtained by small angle X-ray scattering. J. Biol. Chem. 284, 25334–25342.

119 References

Simarro, P.P., Jannin, J., and Cattand, P. (2008). Eliminating human African trypanosomiasis: where do we stand and what comes next? PLoS Med. 5, e55.

Simarro, P.P., Diarra, A., Ruiz Postigo, J.A., Franco, J.R., and Jannin, J.G. (2011). The human African trypanosomiasis control and surveillance programme of the World Health Organization 2000-2009: the way forward. PLoS Negl. Trop. Dis. 5, e1007.

Sommer, J.M., Cheng, Q.L., Keller, G.A., and Wang, C.C. (1992). In vivo import of firefly luciferase into the glycosomes of Trypanosoma brucei and mutational analysis of the C- terminal targeting signal. Mol. Biol. Cell 3, 749–759.

Stanley, W.A., Filipp, F.V., Kursula, P., Schüller, N., Erdmann, R., Schliebs, W., Sattler, M., and Wilmanns, M. (2006). Recognition of a functional peroxisome type 1 target by the dynamic import receptor pex5p. Mol. Cell 24, 653–663.

Stewart, M.Q., Esposito, R.D., Gowani, J., and Goodman, J.M. (2001). Alcohol oxidase and dihydroxyacetone synthase, the abundant peroxisomal proteins of methylotrophic yeasts, assemble in different cellular compartments. J. Cell Sci. 114, 2863–2868.

Su, J.-R., Takeda, K., Tamura, S., Fujiki, Y., and Miki, K. (2009). Crystal structure of the conserved N-terminal domain of the peroxisomal matrix protein import receptor, Pex14p. Proc. Natl. Acad. Sci. U. S. A. 106, 417–421.

Swinkels, B.W., Gould, S.J., Bodnar, A.G., Rachubinski, R.A., and Subramani, S. (1991). A novel, cleavable peroxisomal targeting signal at the amino-terminus of the rat 3-ketoacyl- CoA thiolase. EMBO J. 10, 3255–3262.

Tanaka, N., Aoki, K.-I., Ishikura, S., Nagano, M., Imamura, Y., Hara, A., and Nakamura, K.T. (2008). Molecular basis for peroxisomal localization of tetrameric carbonyl reductase. Struct. Lond. Engl. 1993 16, 388–397.

Terlecky, S.R., Nuttley, W.M., McCollum, D., Sock, E., and Subramani, S. (1995). The Pichia pastoris peroxisomal protein PAS8p is the receptor for the C-terminal tripeptide peroxisomal targeting signal. EMBO J. 14, 3627–3634.

Terlecky, S.R., Koepke, J.I., and Walton, P.A. (2006). Peroxisomes and Aging. Biochim. Biophys. Acta 1763, 1749–1754.

Tetley, L., and Vickerman, K. (1991). The glycosomes of trypanosomes: number and distribution as revealed by electron spectroscopic imaging and 3-D reconstruction. J. Microsc. 162, 83–90.

Titorenko, V.I., Nicaud, J.-M., Wang, H., Chan, H., and Rachubinski, R.A. (2002). Acyl- CoA oxidase is imported as a heteropentameric, cofactor-containing complex into peroxisomes of Yarrowia lipolytica. J. Cell Biol. 156, 481–494.

Tolbert, N.E., and Essner, E. (1981). Microbodies: peroxisomes and glyoxysomes. J. Cell Biol. 91, 271s – 283s.

Urquhart, A.J., Kennedy, D., Gould, S.J., and Crane, D.I. (2000). Interaction of Pex5p, the type 1 peroxisome targeting signal receptor, with the peroxisomal membrane proteins Pex14p and Pex13p. J. Biol. Chem. 275, 4127–4136.

120 References

Vellieux, F.M., Hajdu, J., Verlinde, C.L., Groendijk, H., Read, R.J., Greenhough, T.J., Campbell, J.W., Kalk, K.H., Littlechild, J.A., and Watson, H.C. (1993). Structure of glycosomal glyceraldehyde-3-phosphate dehydrogenase from Trypanosoma brucei determined from Laue data. Proc. Natl. Acad. Sci. U. S. A. 90, 2355–2359.

Verplaetse, E., Rigden, D.J., and Michels, P.A.M. (2009). Identification, characterization and essentiality of the unusual peroxin 13 from Trypanosoma brucei. Biochim. Biophys. Acta 1793, 516–527.

Verplaetse, E., Gualdrón-López, M., Chevalier, N., and Michels, P.A.M. (2012). Studies on the organization of the docking complex involved in matrix protein import into glycosomes of Trypanosoma brucei. Biochem. Biophys. Res. Commun. 424, 781–785.

Vickerman, K. (1985). Developmental cycles and biology of pathogenic trypanosomes. Br. Med. Bull. 41, 105–114.

Vickerman, K., Tetley, L., Hendry, K.A., and Turner, C.M. (1988). Biology of African trypanosomes in the tsetse fly. Biol. Cell Auspices Eur. Cell Biol. Organ. 64, 109–119.

Vizeacoumar, F.J., Vreden, W.N., Fagarasanu, M., Eitzen, G.A., Aitchison, J.D., and Rachubinski, R.A. (2006). The dynamin-like protein Vps1p of the yeast Saccharomyces cerevisiae associates with peroxisomes in a Pex19p-dependent manner. J. Biol. Chem. 281, 12817–12823.

De Walque, S., Kiel, J.A.K.W., Veenhuis, M., Opperdoes, F.R., and Michels, P.A.M. (1999). Cloning and analysis of the PTS-1 receptor in Trypanosoma brucei. Mol. Biochem. Parasitol. 104, 107–119.

Wanders, R.J.A. (2004). Metabolic and molecular basis of peroxisomal disorders: a review. Am. J. Med. Genet. A. 126A, 355–375.

Wanders, R.J.A., and Waterham, H.R. (2006). Biochemistry of mammalian peroxisomes revisited. Annu. Rev. Biochem. 75, 295–332.

Wang, D., Visser, N.V., Veenhuis, M., and van der Klei, I.J. (2003). Physical interactions of the peroxisomal targeting signal 1 receptor pex5p, studied by fluorescence correlation spectroscopy. J. Biol. Chem. 278, 43340–43345.

Weller, S., Gould, S.J., and Valle, D. (2003). Peroxisome biogenesis disorders. Annu. Rev. Genomics Hum. Genet. 4, 165–211.

Williams, C., van den Berg, M., Sprenger, R.R., and Distel, B. (2007). A conserved cysteine is essential for Pex4p-dependent ubiquitination of the peroxisomal import receptor Pex5p. J. Biol. Chem. 282, 22534–22543.

Woodward, A.W., and Bartel, B. (2005). The Arabidopsis Peroxisomal Targeting Signal Type 2 Receptor PEX7 Is Necessary for Peroxisome Function and Dependent on PEX5. Mol. Biol. Cell 16, 573–583.

Yaffe, M.P., and Schatz, G. (1984). Two nuclear mutations that block mitochondrial protein import in yeast. Proc. Natl. Acad. Sci. U. S. A. 81, 4819–4823.

121 References

Yernaux, C., Fransen, M., Brees, C., Lorenzen, S., and Michels, P.A.M. (2006). Trypanosoma brucei glycosomal ABC transporters: identification and membrane targeting. Mol. Membr. Biol. 23, 157–172.

Zacharias, D.A., Violin, J.D., Newton, A.C., and Tsien, R.Y. (2002). Partitioning of lipid- modified monomeric GFPs into membrane microdomains of live cells. Science 296, 913– 916.

122 Annexure

6.0 Annexure

Figure S1 Heterologous expression and purification of recombinant GAPDH by affinity chromatography. MBP-GAPDH was expressed in E. coli and expression was induced by IPTG. After 6 h of incubation on 30°C, the cells were harvested and separated into supernatant and sediment fractions by centrifugation. The soluble portion was applied on amylose resin and bound parts were eluted by 10mM maltose. Samples from each step were analyzed by SDS-PAGE followed by coomassie staining. About 80% of the recombinant protein was insoluble. Typically, 1 liter of bacterial culture yielded ~5 mg of purified MBP-GAPDH. Abbreviations used are: I0, before induction; I6, 6 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions ( 30X ) each having 1ml volume.

Figure S2 Purification of GST-GAPDH. E. coli cells expressing recombinant protein were centrifuged to separate supernatant and pellet fraction. GST-tagged protein was isolated from the soluble part by GSH sepharose and analyzed by SDS-PAGE followed by coomassie staining. Almost 95% of the recombinant protein was insoluble under conditions used (see methodology, Section: 2.14) and remaining 5 % could not bind to the column. Virtually no GAPDH was purified in this approach. Abbreviations used are: H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions (30X) each having 1ml volume.

123 Annexure

Figure S3 Isolation of in vitro formed complexes between MBP-GAPDH and His-PEX5. Size exclusion chromatography analysis was performed with MBP-GAPDH alone (A) and in mixture with PEX5 (B). Gel filtrated fractions were separated on 12.5 % SDS-PAGE and analyzed by coomassie staining. A higher molecular weight complex was observed in an apparent stoichiometry of 1:1. Calibration standard protein markers, indicated by arrows, depict the estimated molar mass corresponding to the eluted fractions.

Figure S4 Heterologous expression and purification of recombinant T. brucei PEX14. (A) Expression of His-PEX14 was achieved by inducing the culture with IPTG for 3 h at 37°C (B) and purification was performed with Ni-NTA agarose. Bound proteins were eluted by 300mM immidazol, analyzed by 12.5% SDS-PAGE, and stained with coomassie brilliant blue. Less than 1mg of recombinant His-PEX14 was co-purified with bacterial chaperons. Abbreviations used are: I0, before induction; I3, 3 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions ( 30X ) each having 1ml volume

124 Annexure

Figure S5 Isolation of His-PEX19 by metal affinity chromatography. (A) His-TbPEX19 was overproduced in E. coli and purified by linear gradient (1-100%) of 300mM immidazol. Fractions from individual steps during purification procedure were analyzed on 12.5% SDS-PAGE followed by coomassie staining. Recombinant His- PEX19 was almost completely soluble and yielded an estimated amount of ~25 mg purified protein from 300 ml E. coli culture. (B) Fractions enriched with His-PEX19 were loaded on superdex 200 and allowed to flow at a rate of 0.5ml/min. Gel filtrated fractions were visualized by coomassie staining. Arrows indicate the molar weight of standard protein markers. Abbreviations used are: I0, before induction; I5, 5 h after induction; H, homogenates; S, supernatant; P, pellet; F, flow through; W, wash; numbers indicate eluted fractions (30X) each having 1ml volume. Immidazol gradient is indicated as a bar above the coomassie stained gel.

Table S6 The position of the gel-bands analyzed by mass spectrometry. Identification of the proteins is given with respect to their presence in the gel in Table S1. Gel-bands form 1-5 indicate the contaminants pulled down by GST (–ve control). The proteins found in position 6-10 depict the real binding partners of PEX19. Molar mass marker corresponds to the size of protein for which the peptides are analyzed.

125 Gene ID Protein Spectral Count Present Mol.WT / PI Localization Tb427tmp.211.3300 Peroxin 19 10 6,9 30.9/4.23 Glycosome Tb427.01.2390 Beta tubulin 59 7,8,9 49.7/4.83 Microtubule Tb427.06.4000 Small glutamine-rich tetratricopeptide repeat protein, putative (SGT) 39 7,8,9,10 45.9/5.25 Cytosol Tb427.10.10360 Microtubule-associated protein, putative 30 1,2,3,6 366.5/5.96 Cytoplasm Tb427tmp.02.5500 Glucose-regulated 33 3,8 71.4/5.48 Cytoskeleton Tb427.01.2360 Alpha tubulin 27 3,8,9 49.8/5.06 Microtubule Tb427.10.10280 Microtubule-associated protein, putative 3 8 3,7 266.4/5.59 Cytoplasm Tb427.10.2110 Elongation factor 1-alpha (TEF1) 26 4,7,8,9 49.1/8.90 Cytoplasm Tb427.10.6510 Chaperonin HSP60, mitochondrial precursor (HSP60) 24 3,5,7,9 59.5/5.44 Mitochondria Tb427.04.560 Dynein heavy chain, putative 15 6 479.6/6.0 Microtubule Tb427.07.710 Heat shock 70 kDa protein, putative (HSP70) 14 8 70.2/5.07 Tb427.10.14890 C-terminal motor kinesin, putative (TBKIFC1) 14 7,8 90.7/7.39 Microtubule Tb427.08.3530 Glycerol-3-phosphate dehydrogenase [NAD+], Glycosome 13 6,7,8,9 37.8/8.62 Glycosome Tb427.06.3740 Heat shock 70 kDa protein, mitochondrial precursor, putative 13 8 71.4/6.02 Mitochondria Tb427tmp.211.3570 Glycerol kinase 13 8 56.3/8.16 Glycosome Tb427.10.6050 Clathrin heavy chain (CHC) 12 6 190.5/5.94 Tb427tmp.01.2020 Hypothetical protein, conserved 12 7,8,9 51.8/5.31 Glycosome (1,2) cited by 2013 Tb427tmp.01.3080 Heat shock protein 70, putative 12 3,7,8 73.5/5.26 Tb427.10.10910 Unspecified product 11 7 80.6/5.20 Tb427.10.8940 Hypothetical protein, conserved 11 3,8 45.4/8.91 Plasma membrane Tb427.10.2010 Hexokinase (HK1) 10 8,9 51.478.82 Glycosome Tb427.10.2890 Enolase 9 3,9 46.6/6.28 Cytoplasm Tb427tmp.02.5280 Glycerol-3-phosphate dehydrogenase (FAD-dependent) 9 8 66.9/8.29 Mitochondria Tb427.01.3830 Glucose-6-phosphate isomerase, (PGI) 9 8 67.5/7.53 Glycosome Tb427.04.4050 ABC transporter, putative (ABCD3) 8 7,8 76.0/9.01 Glycosome GAT2 Tb427tmp.01.4740 Hypothetical protein, Conserved 8 8 61.2/5.49 Mitochondria Tb427tmp.01.5120 Hypothetical protein, Conserved 8 7 105.4/8.16 Plasma membrane Tb427.06.4320 Hypothetical protein, Conserved 7 8,9 44.47/7.71 Plasma membrane Tb427.10.1510 Unspecified product (NOT1) 7 6 259.1/7.77 Plasma membrane Tb427.10.3260 Long-chain acyl-coa ligase LACS 5, putative 7 8 78.9/6.62 Plasma membrane Tb427.10.770 Hypothetical protein, Conserved 7 8 69.0/8.91 Mitochondria Tb427tmp.02.0210 Hypothetical protein, Conserved 6 8 50.9/5.10 Plasma membrane Tb427tmp.02.1120 Adenylosuccinate synthetase, Putative 6 8 66.6/8.03 Glycosome 2013 Tb427tmp.244.1580 Variant surface glycoprotein(VSG), putative 6 8 58.6/7.97 Plasma membrane Tb427tmp.39.0004 Hypothetical protein, Conserved 6 8,9 45.6/6.92 Cytoskeletal protein Tb427.07.300 UDP-Gal-dependent Glycosyltransferase, putative 5 8,9 43.1/9.19 Glycosome Tb427.10.1170 Intraflagellar transport protein IFT172, putative (IFT172) 5 6,7 196.5/6.13 Cytoskeleton Tb427.06.1770 Kinesin, putative 5 8 69.4/7.17 Cytoskeleton Tb427.10.14150 Hypothetical protein, conserved 5 8 55.1/5.96 Endoplasmic reticulum Tb427.07.3370 Hypothetical protein, conserved 5 8 67.4/7.44 Tb427tmp.01.5860 T-complex protein 1, epsilon subunit, putative (TCP-1-epsilon) 5 8 59.3/5.33 Cytoplasm Tb427.10.5620 Fructose-bisphosphate aldolase, Glycosome (ALD) 5 4,9 41.0/8.78 Glycosome Tb427.03.3560 Hypothetical protein, conserved 5 8 69.0/6.07

126 Tb427tmp.160.4250 Tryparedoxin peroxidase (TRYP1) 5 5,10 22.4/6.54 Cytoplasm Tb427.06.1500 Alkyl-dihydroxyacetone phosphate synthase (DHAP) 5 8 69.0/8.57 Glycosome Tb427.03.4330 73 kDa paraflagellar rod protein (PFR1) 4 3,8 68.6/6.07 Flagellar Tb427.04.5310 Serine/threonine-protein kinase a, putative 4 8,9 50.2/8.40 Tb427.10.4560 Elongation factor 2 4 7 94.3/6.18 Tb427.10.2440 Metacaspase MCA4 (MCA4) 4 9 38.9/4.89 Nucleus Tb427tmp.02.0030 Dynein heavy chain, putative (DHC1b) 4 6 484.9/6.70 Tb427.05.360 75 kDa invariant surface glycoprotein (ISG75) 4 8 58.3/5.71 Tb427.05.3810 Orotidine-5-phosphate decarboxylase/orotate phosphoribosyltransferase, putative 4 9 49.9/9.11 Glycosome pyrimidine metabolism Tb427.04.2070 Antigenic protein, putative 4 6 510.0/4.46 Cytoplasm Tb427.10.5810 Hypothetical protein, conserved 4 3 48.2/5.83 Tb427.10.14140 Pyruvate kinase 1 (PYK1) 4 8 54.4/7.85 Cytoplasm Tb427tmp.01.8770 Hypothetical protein, conserved 4 2,7 110.1/4.65 Tb427.10.8230 Protein disulfide isomerase 4 8 55.5/5.39 Cytoplasm Tb427.08.6030 60S ribosomal protein L12, putative 4 10 17.6/9.92 Ribosome Tb427.07.2650 Hypothetical protein, conserved 4 8 62.1/5.97 Tb427.03.1380 ATP synthase beta chain, mitochondrial precursor 3 8 55.7/5.49 Mitochondria Tb427.10.540 ATP-dependent DEAD/H RNA helicase, putative 3 8 49.2/6.64 Nucleus Tb427.06.1920 Hypothetical protein, conserved 3 8 42.3/8.97 Tb427.03.4720 Dynamin, putative 3 8 73.3/6.99 Tb427.10.8190 T-complex protein 1, theta subunit, putative (TCP-1-theta) 3 8 58.1/5.53 Cytoplasm Tb427tmp.160.2770 Fatty acyl coa syntetase 1 (ACS1) 3 8 78.9/7.20 Glycosome Tb427.08.3150 T-complex protein 1, gamma subunit, putative (TCP-1-gamma) 3 8 60.8/6.76 Cytoplasm Tb427.07.4900 5'-3' exonuclease XRNA, putative (XRNA) 3 7 158.5/7.87 Intracellular Tb427tmp.01.0170 NADPH--cytochrome p450 reductase, putative (CPR) 3 8 70.8/6.07 Tb427.02.470 Retrotransposon hot spot (RHS) protein, putative 3 7 98.0/7.84 Nucleus Tb427.01.5000 Hypothetical protein, conserved 3 9 30.5/6.25 Glycosome 3 Tb427.05.2940 Stress-induced protein sti1, putative 3 8 62.3/6.32 Tb427.08.6580 Succinate dehydrogenase flavoprotein, putative 3 8 66.8/6.90 Mitochondria Tb427tmp.01.3290 Hypothetical protein, conserved 3 8 69.0/5.57 Tb427.10.14030 Hypothetical protein, conserved 3 8 50.4/5.48 Tb427tmp.01.2460 Hypothetical protein, conserved 3 8 45.2/8.38 Tb427tmp.01.1780 Short-chain dehydrogenase, putative 3 10 34.0/9.45 Glycosome 2,3,4 (TMD2 new)LTA Tb427.07.4500 Hypothetical protein, conserved 3 8 58.4/5.66 Tb427tmp.160.4200 60S acidic ribosomal protein, putative 3 10 11.1/4.46 Ribosome Tb427tmp.211.2150 Polyadenylate-binding protein 2 (Poly(A)-binding protein 2) 3 8 62.2/9.31 Nucleus Tb427tmp.02.0630 ABC transporter, putative (ABCD1) 3 8 71.0/9.47 Glycosome (2, 4 TMD GAT 2 ALDP) Tb427.04.2530 Hypothetical protein, conserved 3 10 16.8/10.14 Tb427.05.1210 Short-chain dehydrogenase, putative 3 9 33.9/9.51 Mitochondria IFA Tb427tmp.211.1620 Hypothetical protein, conserved 3 7 160.6/7.46 Tb427.07.3040 Hypothetical protein, conserved 3 8 69.0/6.40 Tb427.10.2640 Intraflagellar transport protein IFT81, putative 2 7 84.6/5.63 Tb427.02.3030 ATP-dependent Clp protease subunit, heat shock protein 78 (HSP78), putative 2 7 90.6/7.49 Tb427tmp.160.2810 Fatty acyl coa synthetase 3 (ACS3) 2 8 77.8/6.51 Glycosome (1,2)

127 Tb427.05.3010 Hypothetical protein, conserved 2 9 57.7/8.98 Tb427.10.740 Structural maintenance of chromosome 4, putative (SMC4) 2 7 154.7/6.40 Nucleus Tb427tmp.211.3610 Ubiquitin-activating enzyme e1, putative (UBA2) 2 7 134.6/6.70 Nucleus Tb427.07.1130 Trypanothione/tryparedoxin dependent peroxidase 2 (TDPX2) 2 5 18.9/8.21 Tb427.02.3660 Paraflagellar rod component, putative (PFC10) 2 6 393.5/6.73 Tb427.10.14550 ATP-dependent DEAD/H RNA helicase, putative 2 8 71.2/9.25 Nucleus Tb427.03.5340 Hsc70-interacting protein (Hip), putative 2 9 41.8/5.03 Tb427tmp.160.3090 Heat shock protein, putative 2 7 90.8/8.65 Mitochondria Tb427.07.7520 Receptor-type adenylate cyclase GRESAG 4, putative 2 7 138.0/6.92 Nucleus Tb427.06.3050 Aldehyde dehydrogenase family, putative 2 8 59.7/6.96 Glycosome (1,2) Tb427tmp.02.0090 Kinesin, putative 2 7 172.3/8.03 Tb427.02.4230 NUP-1 protein, putative 2 6 406.0/5.08 Nucleus Tb427tmp.47.0007 Hypothetical protein, conserved 2 7 94.8/6.79 Tb427tmp.160.4590 Arginine kinase (AK) 2 9 40.2/6.37 Glycosome (3) Tb427.08.7100 Acetyl-coa carboxylase, putative 2 6 242.9/6.60 Mitochondria Tb427.05.1090 Threonyl-trna synthetase, putative 2 7 90.9/6.96 Cytoplasm Tb427.07.2100 GMP synthase, putative 2 8 71.7/6.71 Tb427.05.3400 Calcium-translocating P-type atpase 2 7 110.3/6.70 Mitochondria Tb427.04.1080 V-type atpase, A subunit, putative 2 8 67.7/5.74 Tb427.08.5000 69 kDa paraflagellar rod protein (PFR-B) 2 3 69.6/6.02 Cytoskeleton Tb427.07.230 40S ribosomal protein S33, putative 2 10 11.2/9.35 Ribosome Tb427.06.1880 Aspartyl-trna synthetase, putative 2 8 63.0/6.14 Cytoplasm Tb427.08.1870 Golgi/lysosome glycoprotein 1 (tglp1) 2 8 67.5/6.09 Golgi apparatus Tb427.01.420 Retrotransposon hot spot (RHS) protein, putative 2 7 76.3/8.06 Tb427.01.180 Unspecified product 2 7 94.2/6.02 Tb427.10.15530 ABC transporter, putative 2 8 67.5/6.28 Glycosome Tb427.08.4890 Endoplasmic reticulum oxidoreductin, putative 2 8 49.1/7.88 Nucleus Tb427tmp.01.3170 Guanine nucleotide-binding protein beta subunit- like protein (TRACK) 2 9 34.7/6.44 Ribosome Tb427.08.7970 Hypothetical protein 2 8 53.2/4.75 Tb427.07.900 Hypothetical protein, conserved 2 8 64.7/7.39 Tb427tmp.01.4660 Elongation factor 1 gamma, putative 2 9 46.2/6.11 Tb427tmp.160.4700 Hypothetical protein, conserved 2 8 50.4/8.57 Glycosome (PEX16) Tb427.07.7070 Hypothetical protein, conserved 2 8 49.5/6.68 Tb427.10.7570 Dihydrolipoamide acetyltransferase E2 subunit, putative 2 8 48.1/7.40 Mitochondria Tb427tmp.01.5100 Par1 2 8 68.3/5.44 Cytoskeleton Tb427tmp.02.5720 Ribonucleoside-diphosphate reductase large chain (RNR1) 2 7 94.6/7.08 Nucleus Tb427.08.1500 Hypothetical protein, conserved 2 8 63.2/8.84

Table S1. List of proteins identified by mass spectrometry analysis of PEX19-associated complexes. Shown are the gene IDs, name of the proteins, number of peptides present in the gel bands (shown in fig. S6), molar weight and isoelectric point along with organellar localization of the proteins. Mass spectrometry analysis was performed by Dr. Katja Kuhlmann (MPC, Ruhr-University Bochum)

128 Parameters Elution Volume MMexp (g/mol) MMth (g/mol) IPD RMS (ml) (nm) MBPGAPDH 13.4-14.05 1.43x105 7.80x104 1.000 25.5 PEX5-MBP- 11.4-12.2 1.44x105 1.60x105 1.008 32.3 GAPDH

Table S2 MALS analysis of His-PEX5-MBP-GAPDH complex as isolated by SEC. Molecular parameters of MBP-GAPDH or PEX5-MBP-GAPDH complex were estimated by MALS and shown here in terms of experimental molar mass (MMexp), polydispersity index (IPD), average root mean square radius (RMS) and theoretical molarmass (MMth) of the respective components.

Parameters Elution Volume MMexp (g/mol) MMth (g/mol) IPD RMS (nm) (ml) His-PEX19 13.0-13.8 3.39x104 3.09x104 1.003 3.5

Table S3 MALS analysis of His-PEX19. Shown are the molecular parameters of His-PEX19 as measured by MALS analysis and defined in terms of experimental molar mass (MMexp), polydispersity index (IPD) and root mean square radius (RMS) and theoretical molarmass (MMth) of TbPEX19.

129

Abbreviations

g Micro gram mg Milli gram l Micro liter ml Milli liter AAT Animal African Trypanosomiasis (v/v) (volume/volume) (w/v) (weight/volume) AA Amino acid AAA ATPases associated with diverse cellular activities ABC ATP-binding cassette AD Activation domain APS Ammonium per sulfate BD Binding domain BLAST Basic Local Alignment Search Tool BSA Bovine Serum Albumin BSF Bloodstream-form C- Carboxy cDNA Complementary DNA CIP Calf intestinal phosphatase conc. Concentration DMEM Dulbecco’s modified Eagle’s medium DMSO Dimethylsulfoxide DNA Deoxyribonucleic Acid dNTP Deoxyribonucleoside triphosphate DTT Dithiothreitol E. coli Escherichia coli e.g. For example ECL Enhanced Chemiluminescence EDTA Ethylenediaminetetraacetic acid ER Endoplasmic Reticulum FB Final bleed

130 Fig. Figure GAPDH Glycelaldehyde phosphate dehydrogenase GFP Green fluorescent protein GST Glutathione S-Transferase GTP Guanosine Triphosphate HAT Human African Trypanosomiasis His Histidine H Hour Hs. Homo sapiens IgG Immunoglobulin G IPD Polydispersity index IPTG Isopropyl β D-1-thiogalactopyranoside kDa Kilo-dalton KOH Potassium Hydroxide LB Luria-Broth Leu Leucine Lys Lysine M Molar MALS Multi Angle Light Scattering MBP Maltose binding protein MCS Multiple cloning site min Minute MM Molar mass MMexp Experimental molar mass MMth Theoretical molar mass mPTS peroxisomal membrane proteins targeting signal MS Mass spectrometry Mw Molar weight NaCl Sodium Chloride NaF Sodium Fluoride NCBI National Center for Biotechnology Information OD Optical density ORF Open reading frame

131 PAGE Polyacryl amide gel electrophoresis PBD Peroxisomal Biogenesis Disorders PBS Phosphate buffered saline PCR Polymerase Chain Reaction PEG Polyethylene glycol PEX Peroxins pex peroxins gene PF Procyclic form PI pre-immune serum PMP Peroxisomal Membrane Protein PMSF Phenylmethanesulphonyl fluoride PTS1/2 Peroxisomal Targeting Signal RI Refractive index RMS Root mean square radius RNA Ribonucleic Acid Rpm Rounds per minute SAXS Small Angle X-Ray Scattering Sc Saccharomyces cerevisiae SDS Sodium Dodecyl Sulphate sec Second SEC Size exclusion chromatography Ser Serine spp Species T. b. gambience Trypanosoma brucei gambience T. brucei Trypanosoma brucei TBE Tris borate EDTA TBS Tris buffered saline TCA Trichloroacetic acid TEMED N,N,N,N- (Tetramethylethylendiamine) UV Ultra-Violet WHO World Health Organization WT Wild Type Yl Yarrowia lipolytica

132 List of Figures

Figure 1.1 The number of cases of sleeping sickness, reported annually between 1940 and 2 2010 and geographical distribution of the disease in 2010, in Africa Figure 1.2 Life cycle of Trypanosoma brucei 3 Figure 1.3 Glycolysis in bloodstream-form of Trypanosoma brucei 5 Figure 1.4 Model of proteins import into the matrix of peroxisomes via PEX5 in yeast 9 Figure 1.5 Peroxisomal membrane proteins import model 15 Figure 3.1 Expression and purification of recombinant TbPEX5 by metal affinity 45 chromatography Figure 3.2 SEC-MALS analysis of His-PEX5 46 Figure 3.3 Heterologous expression and purification of His-TbgGAPDH by metal affinity 49 chromatography Figure 3.4 SEC-MALS analysis of His-GAPDH 50 Figure 3.5 Pull down assay to determine the interaction between PEX5 and GAPDH 52 Figure 3.6 SEC-MALS analysis of formation of the complex between PEX5 and GAPDH 53 Figure 3.7 Heterologous expression and purification of GST-PEX14N on GSH sepharose 55 Figure 3.8 Size exclusion chromatography of GST-PE14N in the absence and presence of 56 full length of recombinant PEX5 Figure 3.9 SEC elution profile and MALS measurements of His-PEX14 (1-147) and His- 57 PEX14 (1-147) -PEX5 complex Figure 3.10 Interactions of PEX14N with cargo-loaded and cargo-unloaded PEX5 59 Figure 3.11 SEC analysis of PEX14N as a PTS1-dissociation factor 60 Figure 3.12 Schematic presentations of interactions of PEX5 with PTS1-moiety and 62 PEX14N Figure 3.13 Structural features of TbPEX13.1 and TbPEX14 sequences 63 Figure 3.14 Schematic figures of truncated constructs of Trypanosoma brucei PEX14 and 63 PEX13.1 Figure 3.15 Expression and purification of GST-tagged SH3 domain and SH3TKL from E. 64 coli Figure 3.16 Heterologous expression and purification of His-tagged version of PEX14 (1- 65 147) and PEX14 (1-84) Figure 3.17 Domain mapping of PEX14 involved in interaction with PEX13SH3 66 Figure 3.18 Disassembly of the docking complex by competitive binding of PEX5 67 Figure 3.19 PTS1-dependent interactions of PEX5 and PEX13.1 68 Figure 3.20 PEX13.1 does not interact with cargo-loaded PEX5 in vitro 70

133 Figure 3.21 Expression of TbPEX19/PEX19CAAX does not restore peroxisomal import 72 defect in yeast deletion strains Figure 3.22 Growth and expression test of wild-type cells, pex19 mutants, and mutant cells 73 expressing T. brucei PEX19 or PEX19CAAX Figure 3.23 Molecular and biophysical characterization of thrombin cleaved PEX19 74 Figure 3.24 Optimization of immunological conditions for the detection of endogenous 76 PEX19 Figure 3.25 Recognition of PEX19 binding sites in PEX14 by two-hybrid assays 78 Figure 3.26 Yeast two hybrid assay to determine the interaction of PEX13.1 with PEX14 79 and PEX19 Figure 3.27 In vitro binding assays to elucidate the interaction of TbPEX19 and TbPEX14 80 Figure 3.28 Co-immunoprecipitation to detect PEX19 and association partners 82 Figure 3.29 Immunoblot analysis of BSF cells expressing genomically integrated GST or 83 GST-PEX19 Figure 3.30 Purification of GST-PEX19 by affinity chromatography and size Exclusion 84 Chromatography Figure 3.31 Optimization of membrane preparation of T. brucei 85 Figure 3.32 GST pull down assay 86 Figure 3.33 Pie chart showing the organellar localization of candidate partners of PEX19, 87 as identified by MS analysis. Figure 4.1 Multiple sequence alignments of truncated versions of Hs, Sc and Tb PEX14 94 as performed by CLUSTALW Figure 4.2 A working model for glycosomal matrix proteins import, mediated by PEX5 in 97 T. brucei Figure 4.3 Multiple sequence alignments of PEX19 orthologues of Saccharomyces 100 cerevisiae (Sc), Homo sapiens (Hs) and Trypanosoma brucei (Tb) as performed by CLUSTALW Figure 4.4 Multiple Sequence alignments of Vps1 103 Figure 4.5 Multiple sequence alignment of various orthologues of PEX16 105 Figure S.1 Heterologous expression and purification of recombinant GAPDH by affinity 123 chromatography Figure S.2 Purification of GST-GAPDH 123 Figure S.3 Isolation of in vitro formed complex between MBP-GAPDH and His-PEX5 124 Figure S.4 Heterologous expression and purification of recombinant T. brucei PEX14 124 Figure S.5 Isolation of His-PEX19 by metal affinity chromatography 125 Figure S.6 Position of the gel-bands digested and analyzed by mass spectrometry 125

134 List of Tables

Table 1.1 Available drugs to treat the Human African Trypanosomiasis 6

Table 1.2 Glycolytic enzymes with specific peroxisomal targeting signals 11

Table 3.1 Relevant molecular parameters as produced by MALS analysis 47

Table 3.2 Summary of different aspects of purification assays performed with varying 48

tagged constructs of GAPDH

Table 3.3 Biophysical parameters regarding the structure of His-GAPDH by MALS 51

analysis

Table 3.4 A comparison of biophysical parameters of His-GAPDH in the absence and 54

presence of PEX5 as calculated by MALS

Table 3.5 A summary of molecular parameters of HisPEX14 (1-147) and His-PEX14 58

(1-147) -PEX5 complex

Table 3.6 Comparison of the MALS measurements of PEX5-GAPDH complex in the 61

absence and presence of PEX14N

Table 3.7 Molecular parameters of PEX19 as produced by MALS detection 75

Table S.1 List of proteins identified by mass spectrometry analysis of PEX19 126

associated complexes

Table S.2 MALS analysis of His-PEX5-MBP-GAPDH complex as isolated by SEC 129

Table S.3 MALS analysis of His-PEX19 129

135 Publications

Imtiaz Ali, Wolfgang Schliebs and Ralf Erdmann. Organization and dynamics of docking complex in glycosomal membrane of Trypanosoma brucei in PEX5 dependent import.

Open European peroxisomes meeting, Neuss (D), 9-11th sep 2014.

(Poster)

Imtiaz Ali, Wolfgang Schliebs and Ralf Erdmann. The N-terminal domain of Trypanosoma brucei PEX14 can act as a releasing factor for PTS1 cargo proteins.

Open European peroxisomes meeting, Neuss (D), 9-11th sep 2014.

(Poster)

136 Curriculum Vitae

Imtiaz Ali M.S Zoology

Research/Experience

Oct. 2009 - PhD in Biochemistry

“Functional characterization of peroxisomal import receptors PEX5 and PEX19 in Trypanosoma brucei” Department of system biochemistry, Ruhr University Bochum, Germany Feb. 2011 – Jun. 2011 Teaching Assistantship Faculty of Medicine, Ruhr University Bochum, Germany. April, 2008 – Sep, 2009

Assistant Director Fisheries Department of Forestry, Wildlife and Fisheries, Government of Punjab, Pakistan Education

Oct. 2009 - PhD in Biochemistry

Department of System Biochemistry, Institute of Biochemistry and Pathobiochemistry, Ruhr University Bochum

Oct. 2007 – Sep. 2009

M.S Zoology University of the Punjab, Pakistan

Jan. 2003 – March, 2007

B.S Zoology University of the Punjab, Pakistan

Scholarships

HEC/DAAD Scholarship for Faculty development of UESTP/UET, Pakistan (Oct, 2009 – Sep, 2013).

STIBET- DAAD fellowship (Feb, 2011 – June, 2011)

137 Acknowledgement

I would like to thank my supervisor, Prof. Dr. Ralf Erdmann for giving me the opportunity to work in his lab. I am grateful to him for all the support and guidance without which this task would have not been possible. My special thanks for Prof. Dr. Wolfgang Schliebs for all the patience and humbleness he has shown during the whole period of this work. I would like to express my gratitude to PD. Dr. Mathias Lübben for accepting my request to be my co-supervisor. I am highly thankful to Dr. Katja Kuhlmann for Mass spectrometry analysis. It was a great pleasure to have the colleagues like Rezeda, Robert, Vishal Kalel, Jessica, Immanuel Grimm, Anna Chan, Fouzi, Misha, Thomas, Janina Wolf, Jivan Sharma, Anirbhan, Rebbeca, Christina and Vaibhau for their “ready to help” attitude. It would be unjust to not to mention the assistance of technical staff of our group. It was a great experience to work with them and I am highly thankful to; Frau Freimann for being so kind, Herr Rodemann for the number of Emulsiflexes, Frau Tomaschewski for SEC and multi angle light scattering, Frau Leberecht for providing media and materials, and in general all the technical staff which I believe is contributing significantly to the science of this lab. I would also like to mention my special companions, Waris Shah and Nusrat Fateh Ali Khan, who made it leisure to spend time in the lab, by their classical poetry and singing, respectively. Finally, I am thankful to my wife Sarah Imtiaz for all of her support and tons of advices to accomplish this work. My Special thanks to my daughters; Ayesha and Haniah who are the real love and achievement of my life.

Imtiaz Ali

138 ERKLÄRUNG

Hiermit erkläre ich, dass ich die Arbeit selbständig verfasst und bei keiner anderen Fakultät eingereicht und dass ich keine anderen als die angegebenen Hilfsmittel verwendet habe. Es handelt sich bei der heute von mir eingereichten Dissertation um sechs in Wort und Bild völ- lig übereinstimmende Exemplare.

Weiterhin erkläre ich, dass digitale Abbildungen nur die originalen Daten enthalten und in keinem Fall inhaltsverändernde Bildbearbeitung vorgenommen wurde.

Bochum, den

______(Unterschrift)

139