FUNCTIONS AND REGULATORY MECHANISMS OF THE REL FAMILY
TRANSCRIPTION FACTORS, DORSAL AND DIF, AND THE UBC9 FAMILY
SUMO CONJUGASE, LESSWRIGHT, IN DROSOPHILA HEMATOPOIESIS
A dissertation presented to
the faculty of
the College of Arts and Sciences of Ohio University
In partial fulfillment
of the requirements for the degree
Doctor of Philosophy
Liang Huang
November 2006
This dissertation entitled
FUNCTIONS AND REGULATORY MECHANISMS OF THE REL FAMILY
TRANSCRIPTION FACTORS, DORSAL AND DIF, AND THE UBC9 FAMILY
SUMO CONJUGASE, LESSWRIGHT, IN DROSOPHILA HEMATOPOIESIS
by
LIANG HUANG
has been approved for
the Department of Biological Sciences
and the College of Arts and Sciences by
Soichi Tanda
Associate Professor of Molecular Development
Benjamin M. Ogles
Dean, College of Arts and Sciences
Abstract
HUANG, LIANG, Ph.D., November 2006, Molecular and Cellular Biology
FUNCTIONS AND REGULATORY MECHANISMS OF THE REL FAMILY
TRANSCRIPTION FACTORS, DORSAL AND DIF, AND THE UBC9 FAMILY
SUMO CONJUGASE, LESSWRIGHT, IN DROSOPHILA HEMATOPOIESIS. (210
pp.)
Director of Dissertation: Soichi Tanda
The Toll (Tl) signaling pathway plays important roles in Drosophila larval
hematopoiesis. The hallmark of Tl signaling activation is the degradation of the negative
regulator Cactus (Cact), which prevents the Rel family transcription factors Dorsal (Dl)
and Dorsal-related immunity factor (Dif) from working. Normally, Dl stimulates
plasmatocyte production, whereas Dif stimulates both plasmatocyte and lamellocyte
production. In this study, I demonstrated that the SUMO conjugase Lesswright (Lwr)
regulates hemocyte production through Dl and Dif. Firstly, mutations of lwr result in the
activation of Dl and Dif, leading to the overproduction of hemocytes. The loss-of-
function mutations of dl and Dif are suppressors of the lwr mutation; removal of both dl and Dif functions completely diminishes lwr-mutation-induced hemocyte overproduction.
These results suggest that Lwr protects Cact from degradation. Loss of lwr function leads to Cact-degradation-dependent activation of Dl and Dif. Secondly, Lwr modulates Dl and
Dif functions in a Cact-degradation-independent manner. Lwr directly regulates Dl and
Dif activities and specificities via sumoylation. Genetic analyses using wild type and mutant forms (lacking the ability to be sumoylated) of Dl and Dif shows that sumoylation of Dif causes a decrease in hemocytes, while sumoylation of Dl causes an increase in
hemocytes. Sumoylated Dif induces hemocyte apoptosis, while sumoylated Dl protects
hemocyte from apoptosis. Furthermore, unsumoylated Dif and sumoylated Dl are potent
in stimulating lamellocyte production. At the transcription level, Lwr represses Dif’s
transcriptional activity in a promoter-dependent manner. In addition, Lwr protects
hemocytes from apoptosis. Loss of lwr function causes apoptosis of the circulating hemocytes when their overproliferation is induced. Sumoylated-Dif-induced apoptosis was suppressed by DreddEP1412. Sumoylated-Dif- and lwr-mediated hemocyte apoptosis
can be suppressed by Df(3L)H99 (loss of pro-apoptotic genes hid, reaper, and grim) and
overexpressed basketDN (a dominant negative JNK allele). These results indicate that the
JNK pathway plays a role in Dif- and lwr-induced apoptosis. This study establishes a
central regulatory role of lwr in hemocyte production. The complex interaction between
Lwr and Tl signaling shows an example of a networking rather than a linear model of
signal transduction. This research also shows that lwr is required for cell survival.
Approved:
Soichi Tanda
Associate Professor of Molecular Development
Dedication
To my family.
Acknowledgments
My sincere thanks goes to my advisor, Dr. Soichi Tanda. Without his guidance and support, this dissertation would not be possible.
I thank my graduate committee members, Drs. Donald Holzschu, Susan Evans and Mark Berryman for their advice and encouragement. I benefited a lot from their kind help during the five years of my stay in Ohio University.
I appreciate Dr. Leonard Kohn for his help on the Dual-Luciferase assays.
My lab mates, Jinu Abraham, Ying Shen, Xiuli Sun, and Mark Van Doren made the lab a cheerful place to work in. Discussions with them were inspiring.
I thank Mark Van Doren and Mary Van Doren for editorial work on this dissertation.
Finally, I would like to express my thanks to my wife, Aiyun Li. Her company has helped me overcome many difficulties. 7 Table of Contents
Page
Abstract...... 3
Dedication ...... 5
Acknowledgments ...... 6
List of Tables...... 13
List of Figures ...... 14
List of Abbreviations...... 16
Chapter 1: Introduction...... 18
1.1 Drosophila hematopoiesis...... 20
1.1.1 Drosophila innate immunity and hematopoiesis ...... 20
1.1.2 Drosophila hemocytes...... 24
1.1.3 Drosophila hematopoiesis is regulated by conserved signaling pathways and
transcription factors ...... 29
1.2 Roles of Tl signaling in Drosophila hematopoiesis...... 34
1.2.1 Overview of the Tl pathway ...... 34
1.2.2 Tl activation leads to overproduction of larval hemocytes...... 38
1.2.3 Dorsal and Dif...... 38
1.3 Lesswright and sumoylation...... 42
1.3.1 SUMO modification plays important regulatory roles...... 42
1.3.2 Sumoylation stabilizes IB ...... 43
1.3.3 Lesswright is a Drosophila UBC9 family SUMO conjugase...... 44
1.3.4 Lesswright and Dorsal sumoylation...... 44 8 1.4 Apoptosis in Drosophila...... 45
1.4.1 Df(3L)H99 and DIAP...... 45
1.4.2 Drosophila caspases and the apoptosis pathway ...... 46
1.4.3 Sumoylation and apoptosis...... 49
1.5 The JNK pathway regulates apoptosis in both fruit flies and mammals...... 50
1.5.1 JNK pathway and its role in apoptosis...... 50
1.5.2 SUMO-1 inhibits JNK-dependent apoptosis in mammals ...... 52
1.6 Specific aims of this study...... 53
Chapter 2: The lesswright mutation activates Rel-related proteins, leading to overproduction of larval hemocytes in Drosophila melanogaster...... 55
2.1 Summary ...... 56
2.2 Introduction ...... 56
2.3 Materials and methods ...... 62
2.3.1 Drosophila culture conditions and stocks ...... 62
2.3.2 Transgenics...... 63
2.3.3 Genotyping larvae...... 64
2.3.4 Hemocyte counting ...... 65
2.3.5 Statistical tests...... 65
2.3.6 Histological procedures...... 66
2.4 Results...... 68
2.4.1 lesswright mutants develop melanotic tumors due to overproduction of
hemocytes...... 68 9 2.4.2 The overproduction of hemocytes is most likely due to the loss of lwr function
in the hematopoietic tissues...... 73
2.4.3 Nuclear localization of the Dorsal protein was promoted in lwr mutant
hemocytes...... 76
2.4.4 The dorsal and Dif mutations are suppressors of the lwr mutations in
hematopoiesis ...... 78
2.4.5 The dorsal mutation suppresses the production of plasmatocytes in the lwr
mutant background ...... 79
2.4.6 The Dif mutation suppressed the production of both plasmatocytes and
lamellocytes in the lwr mutant background ...... 80
2.4.7 Loss of both dl and Dif functions totally diminished the effects of the lwr
mutation on hemocyte production ...... 81
2.4.8 dl and Dif possess different functions in hematopoiesis ...... 82
2.4.9 Dif function can replace dl in hematopoiesis...... 84
2.5 Discussion ...... 87
2.5.1 The lwr mutation leads to the activation of Rel-related proteins in Drosophila
larval hemocytes...... 87
2.5.2 Loss of lwr function does not affect nuclear transport of Dl protein in
hemocytes...... 90
2.5.3 Dif and dl play different roles in hemocyte production ...... 90
2.5.4 Plasmatocytes can proliferate upon the activation of Dl and Dif ...... 92
Chapter 3: Lesswright regulates Drosophila larval hematopoiesis through direct interaction with Dorsal and Dif...... 94 10 3.1 Summary ...... 95
3.2 Introduction ...... 96
3.3. Materials and methods ...... 99
3.3.1 Drosophila culture conditions and stocks ...... 99
3.3.2 Transgenics...... 101
3.3.3 Site-directed Mutagenesis...... 101
3.3.4 Plasmid constructs...... 102
3.3.5 Genotyping larvae...... 104
3.3.6 Hemocyte counting ...... 105
3.3.7 Statistical tests...... 105
3.3.8 Histological procedures...... 106
3.3.9 Cell culture, transfection procedures and western blot ...... 107
3.3.10 Dual-Luciferase assays...... 108
3.4 Results...... 108
3.4.1 Overexpression of wild type lwr in the larva hematopoietic tissues induces
overproduction of hemocytes ...... 108
3.4.2 Lesswright regulates dl and Dif functions in hematopoiesis ...... 113
3.4.3 Sumoylation of Dl causes an increase in total number of hemocyte as well as
lamellocyte percentage...... 114
3.4.4 Sumoylation of Dif decreases its activity in hemocyte number ...... 118
3.4.5 Dif sumoylation ...... 120
3.4.6 The total number of circulating hemocytes is partly determined by hemocyte
apoptosis and division...... 123 11 3.4.7 Overexpression of dl, Dif, Difmut, and lwr affected cell death of Drosophila S2
cells ...... 125
3.4.8 Df(3L)H99, DreddEP1412, and overexpressed UAS-basketDN suppressed
sumoylated Dif-mediated hemocyte apoptosis...... 127
3.4.9 Regulation of Dif transcriptional activity by sumoylation...... 130
3.5 Discussion ...... 141
3.5.1 Lesswright-Tl pathway interaction regulates Drosophila hemocyte number.141
3.5.2 Dl and sumoylated Dif induces hemocyte apoptosis ...... 144
3.5.3 Promoter dependent regulation of Dif transcriptional activity by sumoylation
...... 145
Chapter 4: The lesswright mutation potentiates larval hemocyte apoptosis in Drosophila, possibly through the JNK pathway...... 148
4.1 Summary ...... 149
4.2 Introduction ...... 150
4.3. Materials and methods ...... 152
4.3.1 Drosophila culture conditions and stocks ...... 152
4.3.2 Transgenics...... 152
4.3.3 Site-directed Mutagenesis...... 153
4.3.4 Plasmid constructs...... 154
4.3.5 Genotyping larvae and hemocyte quantification ...... 155
4.3.6 Histological procedures...... 156
4.3.7 Cell culture and transfection procedures...... 157
4.4 Results...... 158 12 4.4.1 Plasmatocyte production was suppressed in the lwr mutant larvae...... 158
4.4.2 The lwr mutation caused an increase in cell death...... 161
4.4.3 The deficiency Df(3L)H99 partially suppressed apoptosis in the lwr mutants
and restored hemocyte number in the lwr Tl10B double mutants ...... 161
4.4.4 Overexpression of bskDN inhibits apoptosis in the lwr mutants...... 166
4.5 Discussion ...... 166
Chapter 5: Discussion...... 171
5.1 Interaction between Lwr and the Tl signaling pathway...... 172
5.2 Sumoylation represses Dif transcriptional activity in a promoter-dependent manner
...... 176
5.3 Lwr as a survival factor...... 177
5.4 Drosophila as a model for hematopoietic stem cell research...... 178
Chapter 6: Future Studies...... 181
References...... 185
Appendix A: Identification of Dl and Dif target genes through genome-wide microarray analysis...... 205
Appendix B: Summary of B sites...... 210 13 List of Tables
Page
Table 1.1: Antimicrobial peptides in Drosophila...... 21
Table 1.2: Comparison of Drosophila and mammalian homologs of JNK components ..51
Table 2.1: Hematopoietic defects of lwr, Tl10B, dl, and Dif mutants and their double and
triple combinations ...... 70
Table 2.2: Effect of a dominant negative lwr gene on the number of hemocytes...... 75
Table 2.3: Effect of dl, Dif, and Tl10B transgenes on larval hemocytes...... 83
Table 3.1: Effects of dl and Dif mutants on lwrWT transgene induced hemocyte production
...... 110
Table 3.2: Effect of dl, dlmut, Dif, Difmut and lwrWT2 transgenes on larval hemocytes.....115
Table 3.3: Analysis of B sites of the promoter regions of 26 genes ...... 132
Table 4.1: Hemocyte counts of Tl10B mutant larvae and larvae expressing dl, dlmut, Dif,
and Difmut transgenes in the lwr mutant background ...... 159
Table 4.2: Hemocyte counts and percentage of apoptotic hemocytes in lwr mutants
combined with H99 and overexpressed UAS-bskDN ...... 165 14 List of Figures
Page
Figure 1.1: Drosophila hemocytes...... 25
Figure 1.2: Transcriptional controls of Drosophila hemocytes...... 30
Figure 1.3: The Tl signaling pathway...... 36
Figure 1.4: The primary structures of Dl and Dif...... 40
Figure 1.5: The Drosophila apoptosis pathway...... 48
Figure 2.1: Lymph gland, plasmatocyte, and lamellocyte in Drosophila larva...... 58
Figure 2.2: Melanotic tumors observed in lwr mutants...... 69
Figure 2.3: Plasmatocyte and lamellocyte populations in different genetic backgrounds.72
Figure 2.4: Nuclear localization of Dorsal protein in Tl10B and lwr mutant hemocytes....77
Figure 2.5: Plasmatocyte and lamellocyte populations induced by different UAS
transgenes with the CgGAL4...... 85
Figure 2.6: Models of the Lwr-Cact interaction...... 89
Figure 3.1: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT1
with the CgGAL4 driver in dl and Dif single or double mutant background...... 112
Figure 3.2: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT2,
UAS-dl, and UAS-dlmut with the CgGAL4 driver...... 117
Figure 3.3: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT2,
UAS-Dif, and UAS-Difmut with the CgGAL4 driver...... 119
Figure 3.4: Western blot showing possible sumoylated form of Dif...... 122
Figure 3.5: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS-
lwrWT2 and UAS-dl with the CgGAL4 driver...... 124 15 Figure 3.6: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS-
lwrWT2, UAS-Dif, and UAS-Difmut with the CgGAL4 driver...... 126
Figure 3.7: Effects of dl, Dif, Difmut, SUMO and lwr expression on S2 cell death...... 128
Figure 3.8: Df(3L)H99 and DreddEP1412 mutations suppressed sumoylated Dif-induced
hemocyte apoptosis...... 129
Figure 3.9: Expression patterns of Group 1 genes...... 134
Figure 3.10: Expression patterns of Group 2 genes...... 137
Figure 3.11: Expression patterns of Group 3 genes...... 139
Figure 3.12: Model for Lwr-Tl signaling activation...... 143
Figure 3.13: Two proposed mechanisms for sumoylation-mediated repression of Dif
transcriptional activity...... 147
Figure 4.1: Plasmatocyte and lamellocyte populations of larvae expressing UAS-dl, UAS-
dlmut, UAS-Dif, and UAS-Difmut in wild type or lwr mutant background...... 160
Figure 4.2: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS-
dl, UAS-Dif, and UAS-Difmut with the CgGAL4 driver in the wild type or lwr mutant
backgroud...... 162
Figure 4.3: Effects of lwrDN expression on cell death of S2 cells...... 163
Figure 4.4: Abnormal lwr mutant hemocytes with multiple nuclei...... 168
Figure 4.5: The putative sumoylation sites of JNK cascade proteins...... 170
Figure 5.1: Interactions between Lwr and the Tl signaling pathway in the context of
Drosophila hematopoiesis...... 173
16
List of Abbreviations
Ca++ calcium ion
cDNA complementary DNA
cRNA complementary RNA
DAPI 4'-6-Diamidino-2-phenylindole
DNA deoxyribonucleic acid
DTT dithiothreitol
ECM extracellular matrix
GAL4 the yeast GAL4 transcription factor
GFP green fluorescent protein
h hour
HA hemagglutinin
Hsp70 heat shock protein 70
IP3 inositol 1,4,5-triphosphate
kB kilobase
kDa kilodalton
min minute
NEM N-ethylmaleimide
PBS phosphate buffered saline
PMSF phenylmethylsulphonylfluoride
RNA ribonucleic acid
s second 17 SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
UAS upstream activation sequence 18
Chapter 1: Introduction 19 Blood cells play important roles in host defense and development (Lavine and
Strand, 2002; Meister and Lagueux, 2003; Meister, 2004). Dysregulation of blood cell
production and differentiation can lead to serious diseases such as leukemia (Look, 1995;
Dearolf, 1998). The signaling pathways that control blood cell development are well
conserved among higher eukaryotes (Kimbrell and Beutler, 2001; Evans and Banerjee,
2003; Evans et al., 2003; Radtke et al., 2005). Understanding the regulatory mechanisms
of those signaling pathways in Drosophila melanogaster may provide insights into their regulation in other organisms.
Since Drosophila blood cell lineage is less complex than that of vertebrates, investigation of signaling pathways responsible for blood cell development is sometimes more straightforward. The Drosophila system may provide a clearer and simpler picture
of hematopoiesis in general (Dearolf, 1998; Meister, 2004). At the same time, the key
components that control the regulation of hematopoiesis are similar in Drosophila and vertebrates, information discovered from both systems can be cross-referenced in many cases.
In the following sections, I will review Drosophila immunity and hematopoiesis, the transcriptional control of hemocyte production, the role of the Toll (Tl) pathway and lesswright as well as apoptosis in Drosophila.
20 1.1 Drosophila hematopoiesis
1.1.1 Drosophila innate immunity and hematopoiesis
Drosophila is highly resistant to microbe infections owing to its strong innate immunity. Both humoral responses and cellular responses contribute to the innate immune response in fruit flies (Hultmark, 1993; Hoffmann et al., 1999; Kimbrell and
Beutler, 2001).
The humoral component of the innate immunity consists of three major mechanisms (Hoffmann et al., 1999; Hoffmann and Reichhart, 2002; Hoffmann, 2003).
The first mechanism is the activation of cascades of proteases, leading to localized melanization and coagulation, directly killing or neutralizing the microbes (Schmidt and
Theopold, 1997; Nagai and Kawabata, 2000; Goto et al., 2001; Theopold et al., 2002;
Bidla et al., 2005). The second mechanism is the activation of a complement-like cascade (C3/2-macroglobulin superfamily). The activation of the cascade may lead to opsonization of the infected microbes (Lagueux et al., 2000). The third mechanism is the production of the antimicrobial peptides. Shortly after infection or physical injury, fat bodies and hemocytes produce antimicrobial peptides including Cecropin, Diptericin,
Defensin, Attachin, Drosocin, Drosomycin and Metchnikowin (Table 1.1; Hetru et al.,
2003; Hoffmann, 2003). The production of these antimicrobial peptides is considered a major mechanism for host defense. Antimicrobial peptides are potent killers of microbes because of their ability to form channel-like structures on the cell membrane, resulting in permeabilization of the membranes (Matsuzaki, 1998). Interestingly, each of these peptides has a different antimicrobial spectrum (Table 1.1). At physiological 21 Table 1.1: Antimicrobial peptides in Drosophila Table adapted from Hoffmann et al., 2002
Antimicrobial Peptide Functions against Diptericin Gram-negative Bacteria Attacin Gram-negative Bacteria Drosocin Gram-negative Bacteria Cecropin Gram-negative Bacteria Defensin Gram-positive Bacteria Metchnikowin Fungi Drosomycin Fungi
22 concentrations, Drosomycin and Metchnikowin are antifungal. Defensin is anti-Gram- positive-bacterial whereas Diptericin, Attacin, Drosocin and Cecropin are anti-Gram- negative-bacterial (Lemaitre et al., 1997; Meister et al., 2000; Hetru et al., 2003). Two signaling pathways primarily control expression of the antimicrobial peptides: the Toll
(Tl) pathway and the immune deficiency (imd) pathway (Imler and Hoffmann, 2000;
Tauszig et al., 2000; Khush et al., 2001; De Gregorio et al., 2002). The Tl pathway (more details in section 1.2) is the signaling pathway for antifungal and anti-Gram-positive- bacterial defense (Lemaitre et al., 1995; Lemaitre et al., 1996). Mutations of the Tl pathway components that inactivate the Tl pathway impair the production of antifungal and anti-Gram-positive-bacterial peptides. Mutants are more susceptible to fungal and
Gram-positive-bacterial infection (Lemaitre et al., 1996; Michel et al., 2001; Gobert et al., 2003; Ferrandon et al., 2004; Hedengren-Olcott et al., 2004; Imler et al., 2004). The
Imd pathway, on the other hand, is mainly responsible for defense reactions against
Gram-negative bacteria. The Imd pathway controls the production of anti-Gram-negative- bacterial peptide (Lemaitre et al., 1995; Georgel et al., 2001; Kaneko and Silverman,
2005).
The cellular components of the Drosophila immune system consist of the three functional hemocytes, which perform two actions: phagocytosis and encapsulation
(reviewed in section 1.1.2). Cellular immunity is not only responsible for defense against microbe infection, but is also essential for the removal of cell debris generated during animal development (Tepass et al., 1994; Franc et al., 1996; Franc et al., 1999; Lanot et al., 2001; Holz et al., 2003). Therefore, hematopoiesis is an essential part of Drosophila development. 23 Drosophila hematopoiesis has two major phases. The first phase starts early
during embryogenesis. All the embryonic hemocytes are derived from a portion of head
mesoderm cells. These cells migrate from the head mesoderm and distribute to the whole
embryo (Tepass et al., 1994; Holz et al., 2003). The majority of these cells differentiate
into plasmatocytes. Plasmatocytes in the embryo phagocytose dead cells. A few crystal
cells are also differentiated during embryogenesis (Lebestky et al., 2000; Meister and
Lagueux. 2003). However, their function in the embryo stage is not clear. The second
phase of hematopoiesis is during the larval stage. In this stage, an organ called the lymph
gland is the primary site of hemocyte production (Rizki, 1978; Shresta and Gatteff, 1982;
Jung et al., 2005). The lymph gland precursors originate from a set of cells in the dorsal
mesoderm during embryogenesis. These precursors start differentiating and migrating
during late embryogenesis. Located along the dorsal vessel, the lymph gland contains 4-6
pairs of lobes (Lanot et al., 2001). At the late third-instar larva stage, the primary lobes
(the first pair of lobes) of the lymph gland are much larger than the secondary lobes and
contain mature hemocytes and prohemocytes. The secondary lobes are more compact and
are considered to contain mainly prohemocytes. During metamorphosis, the lymph gland
is degraded and all of the hemocytes contained in the lymph gland are released, including
hemocytes produced by the secondary lobes. This process is under the control of the hormone ecdysone (Sorrentino et al., 2002). It is obvious that the release of the hemocytes plays a very significant physiological role during metamorphosis. The structural change of the fly body produces a large amount of cell debris that needs to be removed by hemocytes. In the adult fly, no hematopoietic organ has been identified. All the hemocytes present in the adult stage are produced during the embryo and larva stages. 24 In fact, hemocytes produced in both embryo and larva stages survive through the adult stage (Holz et al., 2003).
1.1.2 Drosophila hemocytes
In Drosophila, blood cells are called hemocytes. One of the major differences between Drosophila immunity and vertebrate immunity is the lack of adaptive immune response in Drosophila (Kimbrell and Beutler, 2001). All of the Drosophila hemocytes resemble the myeloid lineage of vertebrate blood cells (Meister and Lagueux, 2003;
Meister, 2004). Characterized according to morphology and function, there are three types of functional hemocytes in Drosophila: plasmatocytes, lamellocytes and crystal cells. Prohemocytes and podocytes are also described in the literature (Rizki and Rizki,
1978; Shrestha and Gateff, 1986; Lanot et al., 2001).
Round in shape, 8-10 μm in diameter, plasmatocytes are professional phagocytes
(Figure 1.1B; Tepass et al., 1994; Evans and Banerjee, 2003). Similar to vertebrate macrophages or monocytes, plasmatocytes are responsible for the phagocytosis of microbes and cell debris produced during development. In the late third-instar larva stage, plasmatocytes constitute more than 95% of the total circulating hemocytes in the
Drosophila hemolymph (Rizki, 1978; Shrestha and Gateff, 1982; Lanot et al., 2001;
Evans et al., 2003). In accordance with their function, plasmatocytes express membrane receptors such as Croquemort, which is a homolog of the mammalian class B scavenger receptor CD36 (Franc et al., 1996; Franc et al., 1999). Peptidoglycan recognition 25 Figure 1.1: Drosophila hemocytes. Giemsa stained peripheral hemocytes. A) Prohemocyte, B) Plasmatocyte, C) Crystal Cell, D) Lamellocyte. Images were taken with DIC optics at 200. Detailed description of hemocytes is in the main text.
26 proteins, PGRP-LC, PGRP-SD and PGRP-SA and a scavenger receptor dSR-CI are also
expressed by plasmatocytes (Michel et al., 2001; Meister and Lagueux, 2003; Bischoff et
al., 2004). Plasmatocytes also play a role in the production of the extracellular matrix.
Extracellular matrix components such as Laminins, Collagen IV, Glutactin, Peroxdasin, and Hemolectin are highly expressed in plasmatocytes (Lunstrum et al., 1988; Fessleret
al., 1994; Nelson et al., 1994; Goto et al., 2001; Meister and Lagueux, 2003). However,
the exact role of plasmatocytes in extracellular matrx production is not very clear at
present. Nonetheless, some of these proteins can serve as plasmatocyte markers.
Another type of hemocyte is the crystal cell, named for the paracrystalline crystal
inclusions inside the cell. Crystal cells are slightly larger than plasmatocytes (10-12 μm
in diameter). They constitute about 5% of the total population of circulating hemocytes in
the larva (Rizki and Rizki, 1980; Shrestha and Gateff, 1982). Crystal cells are rather
fragile and are easily disrupted to release their cell contents into the hemolymph. The
essential contents of the crystal cells are prephenoloxidases that, once activated by a
cascade of serine proteases, trigger a reaction called melanization (Rizki et al., 1985;
Soderhall and Cerenius, 1998). Melanization is a unique humoral immune response in
arthropods, which can be activated by microbe cell wall components such as
peptidoglycan and lipopolysaccharide (LPS). Melanin and many molecules produced
during melanization are toxic to invading microbes, thus directly contributing to host
defense. In addition, melanization also contributes to wound healing in Drosophila
(Soderhall and Cerenius, 1998; Lavine and Strand, 2002; Ligoxygakis et al., 2002;
Meister and Lagueux, 2003; Bidla et al., 2005). Physical injury itself will activate
melanization onsite, resulting in a melanized spot. Melanization defective flies exhibit 27 defects in wound healing. Furthermore, wounded mutant flies show extended bleeding,
which implies that melanization may also play a role in coagulation (Ramet et al., 2002).
Crystal cells can be visualized by heating larva at 70°C for 10 minutes (Rizki et al.,
1980). The heat treatment induces melanization of crystal cells. The black spots observed
inside the larva body represent crystal cells. Another method of visualizing crystal cells is
to use the Black cell mutation, which induces premature melanization of crystal cells
(Rizki et al., 1980; Dearolf, 1998; Minakhina and Steward, 2006). However, because of their fragile nature, crystal cells are difficult to count. Therefore, crystal cells are not included in our analysis.
The third type of Drosophila hemocyte is the flat shaped lamellocyte. Compared to plasmatocytes and crystal cells, lamellocytes are much larger (15-40 μm in diameter;
Rizki and Rizki, 1992; Evans et al., 2003). In healthy larvae, very few lamellocytes are present. However, when larvae are infested with large foreign objects, e.g. parasitoid wasp (Leptopilina boulardi) eggs, a large number of lamellocytes are produced (Rizki and Rizki, 1992; Lanot et al., 2001). Because of their adherent property, lamellocytes are major players of encapsulation, which is another unique immune response in insects.
Lamellocytes attach to the surface of the foreign objects, form a multi-layered capsule, and subsequently activate melanization reaction (Rizki and Rizki, 1994; Vass and Nappi,
2000). Encapsulation and melanization kill or neutralize large invading objects that cannot be phagocytosed by plasmatocytes. Interestingly, encapsulation seemed to be stimulated solely by the size of the foreign object. Lanot et al. (2001) have shown that a
0.4-mm-long section of human hair can induce differentiation of lamellocytes and trigger encapsulation. Although lamellocytes can be easily identified morphologically, very few 28 molecular markers for their identification are available. One P-element-mediated enhancer trap line, P{PZ}msn06946 (msn-lacZ), has a PZ transposable element inserted into the misshapen gene. In P{PZ}msn06946 larvae, lacZ is expressed in the lamellocytes, not other hemocytes (Braun et al., 1997). The L1 antibody is a monoclonal antibody that specifically recognizes lamellocytes (Kurucz et al., 2003).
All vertebrate blood cell lineages are derived from one common hematopoietic stem cell (Kondo et al., 2003). In Drosophila the common hematopoietic stem cell is not clearly characterized. It is generally accepted that stem cells exist. The hematopoietic stem cells are called prohemocytes in Drosophila (Shrestha and Gateff, 1982; Tepass et al., 1994; Rehorn et al., 1996; Lanot et al., 2001; Evans et al., 2003). Prohemocytes are small hemocytes (4-6 m in diameter) with high nucleoplasmic ratio. These undifferentiated hemocytes are found in the first pair of lobes of the lymph gland (larval hematopoitic organ, see section 1.1.1) as well as in the posterior lobes (Lanot et al.,
2001).
Other types of hemocytes, e.g. podocytes, have been described in the literature
(Lanot et al., 2001; Shrestha and Gateff, 1982). I also observed morphologically distinct hemocytes in our experiments. However, their functions and definitive characteristics are unclear as to date. It is possible that those hemocytes are intermediate cells during hemocyte differentiation rather than cells of different categories.
29 1.1.3 Drosophila hematopoiesis is regulated by conserved signaling pathways and transcription factors
Several signaling pathways are known to regulate Drosophila hematopoiesis.
They are the Tl pathway, the Janus kinase (JAK)/ signal transducer and activator of
transcription (STAT) pathway, the Platelet-derived growth factor (PDGF)/ vascular
endothelial growth factor (VEGF) receptor (Pvr) pathway, the Ras pathway, and the
Notch (N) pathway. The GATA factor and the Lozenge/Runx1 factor are also known to control hemocyte development (reviewed in Dearolf, 1998; Evans and Banerjee, 2003;
Evans et al., 2003; Meister and Lagueux, 2003; Meister, 2004).
Figure 1.2 shows the known signaling pathways and proteins that control
Drosophila hemocyte lineage. In the following paragraphs, I will review transcriptional control of hematopoiesis by major signaling pathways and factors in Drosophila.
Although not discussed here, it is important to note that recent studies have shown that
microRNAs can regulate hematopoietic lineage differentiation as well (Chen and Lodish,
2005).
Hemocyte cell fate specification
Serpent (Srp), a member of the GATA family transcription factors, is expressed in
Drosophila prohemocytes as well as some differentiating and mature hemocytes (Rehorn
et al., 1996; Lebestky et al., 2000; Waltzer et al., 2003). GATA transcription factors are a
group of highly conserved zinc finger transcription factors in eukaryotes, which bind to
the consensus DNA sequence WGATAR, where W stands for A or T and R stands for A
or G (Fossett and Schulz, 2001). The timing of srp expression coordinates well with the 30 Figure 1.2: Transcriptional controls of Drosophila hemocytes. Figure adapted from Evans et al., 2003 and Meister, 2004.
Hop/Tl/Raf Lamellocyte Col/Ytr
Gcm/Gcm2
Plasmatocyte Prohemocyte
N/Lz Hop/Tl/N/Pvr/Ras
Crystal Cell
31 the timing of hemocyte fate determination during embryonic and larval hematopoiesis.
srp is expressed early during embryogenesis in the head mesoderm, where embryonic
hemocytes originate (Lebestky et al., 2000). No embryonic hemocytes are produced in
srp loss-of-function mutants, indicating that srp function is required for determination of the hemocyte fate (Rehorn et al., 1996). During late embryogenesis, srp is expressed in
the dorsal mesoderm, where the lymph gland precursors originate. srp function is
required for the expression of two transcription factors, Lozenge (Lz) and Glial-cells-
missing (Gcm) (Lebestky et al., 2000; Fossett et al., 2003; Waltzer et al., 2003;
Muratoglu et al., 2006). Lz is a Runx family protein that shares 71% identity to the
mammalian acute myeloid leukemia-1 protein (AML1) in the homologous domain
(Lebestky et al., 2000). Lz specifies the differentiation of the crystal cell lineage. Gcm
specifies the differentiation of plasmatocytes (Bernardoni et al., 1997; Lebestky et al.,
2000; Alfonso and Jones, 2002). Loss of both gcm and gcm2, a homolog of gcm,
functions cause abnormal morphologies of plasmatocytes and a reduction of presumptive
plasmatocytes. Ectopic expression of gcm in the lz-expression crystal cell precursors
changes cell fate to plasmatocytes. Besides Srp, the Drosophila genome contains four
other GATA factors. Their functions are less defined (Evans et al., 2003). The Friend-of-
GATA family transcription factor U-shaped (Ush) also regulates crystal cell and
plasmatocyte fate determination. Ush directly interacts with Srp and inhibits Srp function.
The ush mutation leads to an increase of the crystal cell population, indicating that Ush
represses crystal cell fate (Fossett et al., 2003).
The Drosophila orthologue of the mammalian early B-cell factor Collier (Col) is
required for lamellocyte production (Crozatier et al., 2004). Col is expressed in the lymph 32 gland precursor cells during embryogenesis as well as in the posterior portion of the
primary lobes of the lymph gland. Parasitization by wasp eggs does not induce
lamellocyte differentiation in col mutants. When overexpressed in the larval
hematopoietic tissues, Col can induce lamellocyte production even without immune
challenge (Crozatier et al., 2004). Another factor, Yantar, may also play a role in
lamellocyte differentiation (Sinenko et al., 2004).
The Notch (N) signaling pathway plays at least three roles in Drosophila
hematopoiesis: specification of the lymph gland, production of lamellocytes upon
parasitization and determination of crystal cell fate (Duvic et al., 2002; Lebestky et al.,
2003; Radtke, 2005). N is a membrane receptor. There are two membrane-bound ligands for N in Drosophila. Only one of the ligands, Serrate (Ser) plays a role in hematopoiesis
(Evans et al., 2003; Lebestky et al., 2003). Binding of the Ser to N eventually activates the downstream transcription factor Suppressor of Hairless (Su(H))(Lebestky et al.,
2003). N signaling is important for lz expression. Loss-of-function mutations of Ser, N or
Su(H) blocks crystal cell differentiation, causing a severe decrease in crystal cells.
Interestingly, Ser expression often clusters at the posterior portions of the primary lobes
of the lymph gland. It is proposed that these regions, termed posterior signaling center
(PSC), instruct crystal cell differentiation (Lebestky et al., 2003).
Hemocyte proliferation and differentiation
The Drosophila platelet-derived growth factor (PDGF)/vascular endothelial
growth factor (VEGF)-related receptor (PVR) plays a role in hemocyte survival and
proliferation (Cho et al., 2002; Munier et al., 2002; Martin et al., 2004). PVR is a receptor 33 tyrosine-kinase. Activation of PVR by the ligand PDGF/VEGF family 2 (PVF2) induces
hemocyte proliferation. Interestingly, PVR seems to be essential for hemocyte survival.
Inhibition of the PVR signaling leads to a steady reduction of plasmatocyte number, possibly due to apoptosis of these cells (Bruckner et al., 2003).
The loss-of-function mutation of the domino gene drastically hinders larval hemocyte production. Domino is a SWI2/SNF2 family DNA-dependent ATPase (Ruhf et al., 2001). The lymph gland of domino mutant larva is melanized, but the melanization process in general is depressed, possibly due to the lack of circulating hemocytes in the larva. The animal is less resistant to microbe infection. Presence of live microbes is observed in the domino mutants (Braun et al., 1998).
The Ras GTPase can also induce hemocyte overproliferation. Overexpression of an activated form of Ras (RasV12) in the larval hemotopoietic tissues leads to a 10- to 100-
fold increase of larva hemocytes. This huge increase in hemocyte number is caused by
active division of RasV12-expressing hemocytes and not by suppression of cell death
(Asha et al., 2003). Activated Ras works though DRaf, which also can be activated by the
JAK/STAT pathway (discussed below; Kwon et al., 2000).
The JAK/STAT pathway is another major pathway that regulates hemocyte
proliferation and differentiation (Harrison et al., 1995; Luo et al., 1995; Luo et al., 2002;
Agaisse and Perrimon, 2004). A dominant mutation of the JAK kinase, Hopscotch
Tumorous-lethal (HopTum-l) causes overproliferation of plasmatocytes, abnormal
differentiation of lamellocytes and formation of melanotic tumors even without immune
challenge (Harrison et al., 1995; Luo et al., 1995). HopTum-l is a constitutively active form
of Hopscotch. In HopTum-l mutant larvae, the Drosophila signal transducer and activator 34 of transcription (D-STAT/Marelle) is activated (Hou et al., 1996). D-STAT is required for the development of the mutant phenotypes. Accordingly, mutations in the D-STAT inhibitor D- Protein Inhibitor of Activated STAT (D-PIAS) enhance D-STAT function, thus inducing abnormal hematopoietic phenotypes such as the formation of melanotic tumors (Betz et al., 2001).
Similar to the JAK/STAT pathway, mutations activating the Tl signaling pathway lead to overproduction of plasmatocytes, abnormal differentiation of lamellocytes and formation of melanotic tumors (Qiu et al., 1998). As the Tl signaling is the subject of this study, the details of the pathway are reviewed in the next section.
1.2 Roles of Tl signaling in Drosophila hematopoiesis
1.2.1 Overview of the Tl pathway
The Drosophila Tl pathway is homologous to the mammalian nuclear factor B
(NF-B) pathway. The signaling that regulates the Rel/NF-B in mammals and
Drosophila is strikingly similar. Most of the signaling components of the pathway are well conserved in mammals and flies (Kimbrell and Beutler, 2001).
A single-pass transmembrane receptor, Tl contains a leucine-rich repeat in its extracellular domain and a cytoplasmic Tl/Interleukin-1 Receptor domain (TIR domain)(Hashimoto et al., 1988; Gay and Keith, 1991; Belvin and Anderson, 1996;
Anderson, 2000). Although Tl plays roles in immune response, it is not a pattern- recognition receptor like some other immune receptors, which recognize microbial cell wall components. In fact, the ligand of Tl is a cysteine knot family protein Spätzle. 35 Activation of the Tl signaling starts at the proteolytic cleavage of Spätzle by serine
proteases (Morisato and Anderson, 1994; Lemaitre et al., 1996; Weber et al., 2003). This
cleaved form of Spätzle binds to and activates the Tl receptor. The Tl receptor transduces
the signal to the downstream proteins such as Pelle and Tube through the adaptor protein
dMyD88 (Shen and Manley, 1998; Horng and Medzhitov. 2001; Shen et al., 2001; Towb
et al., 2001; Shen and Manley, 2002; Tauszig-Delamasure et al., 2002).
The hallmark event of Tl signaling activation is the degradation of the inhibitor
Cactus (Cact), a homolog of IB, and subsequent nuclear localization of the Rel/NFB family transcription factors Dorsal (Dl) and Dorsal-related immunity factor (Dif) (Roth et al., 1991; Kidd, 1992; Bergmann et al., 1996; Reach et al., 1996; Nicolas et al., 1998;
Fernandez et al., 2001). Cact sequesters Dl and Dif in the cytoplasm in a quiescent state.
Fllowing Tl activation, Cact is phosphorylated and then polyubiquitinated.
Polyubiquitination subjects Cact to degradation through ubiquitin-mediated proteolysis.
Degradation of Cact releases Dl and Dif, hence they enter the nucleus and activate their downstream genes (Figure 1.3).
Tl is one of the Tl-like receptor (TLR) family proteins. At least nine TLRs have been identified in the Drosophila genome (Aderem and Ulevitch, 2000; Luna et al., 2002;
Ooi et al., 2002; Imler and Hoffmann, 2003). TLRs and the multiple Rel family transcription factors provide a more complex but versatile signaling pathway. However, little is known about the functions of the other TLRs in Drosophila.
Several mechanisms are in place to maintain a stable state of Tl signaling. The
expression of the Rel proteins is self-regulated. When targeted into the nucleus under
immune challenge, Dl can induce its own expression (Lemaitre et al., 1995). This 36 Figure 1.3: The Tl signaling pathway. The activated ligand Spätzle binds to the extra-cellular domain of the Tl receptor. Tl interacts with the adaptor protein dMyD88 through the TIR domain (magenta). MyD88 interacts with Tube and Pelle through the death domain (green). The Tl signaling ends with proteolytic degradation of Cact and nuclear localization of Dl and Dif. Figure adapted from Hoffmann and Reichhart, 2002 and Hoffmann, 2003.
Spätzle
(TLRs) Tl
(TRAF6) Tube
(MyD88) dMyD88 (TAK1) Pelle
K-Ub-Ub K-Ub-Ub Cact Cact (IB) (NFB) CactDl Dl Cact Dif Dif
Cytoplasm
Nucleus
Dl Dl Dif Dif
37 mechanism provides a positive feedback to enhance the activation of Tl signaling. At the same time, Cact biosynthesis is also induced upon Tl activation (Kubota and Gay. 1995).
This mechanism provides a negative feedback to limit the activation of Tl signaling.
Direct interaction between Cact and Dl also plays a role in stabilizing Cact. Without Dl binding, the half-life of Cact is only about 40 minutes, whereas the half-life of Cact in the
Cact-Dl protein complex is more than 24 hours (Kubota and Gay, 1995). Therefore, although Dl can induce Cact biosynthesis, the excess Cact is rapidly degraded, maintaining an optimal ratio of Cact, Cact-Dl complex and Dl. Recently, a feedback inhibitor of Dl, WntD, was discovered. WntD expression is also controlled by Tl signaling. An increased level of WntD proteins causes a Cact-independent inhibition of
Dl nuclear localization (Ganguly et al., 2005; Gordon et al., 2005). Feedback not only exists at the transcription level but is also present at a more upstream level. Activated
Pelle kinase suppresses the recruitment of Tube, hence negatively affecting the Tl
signaling (Towb et al., 2001).
Tl pathway is also essential for the dorsal-ventral axis formation in the Drosophila
embryo (Hashimoto et al., 1988; Steward and Govind, 1993; Govind, 1999). Much
progress has been made in elucidating the role of Tl signaling in Drosophila humoral
immunity (De Gregorio et al., 2002; Hoffmann, 2003; Ferrandon et al., 2004; Govind and
Nehm, 2004; Imler et al., 2004). Tl signaling is the major pathway that is responsible for
antifungal and anti-Gram-positive bacterial defense. Activation of Tl signaling leads to
the induction of antimicrobial peptides. Although Tl is known to play a role in
Drosophila cellular immunity (reviewed in the next section), the regulatory mechanisms
are not well understood. 38
1.2.2 Tl activation leads to overproduction of larval hemocytes
Mutations that activate Tl signaling lead to “leukemia”-like phenotypes in
Drosophila larvae (Gerttula et al., 1988; Braun et al., 1997; Qiu et al., 1998). For
example, dominant mutations of Tl, such as Tl10B and Tl3, cause a large increase of
hemocyte number as well as the proportion of lamellocytes in the larval hemolymph. In
the Tl10B larvae, more than10% are lamellocytes, which is seldom observed in the wild
type larvae. These mutations also show a melanotic tumor phenotype (Lemaitre et al.,
1995). Unlike tumors in mammals, the melanotic tumors in Drosophila are generally
considered as non-invasive melanized masses of foreign- or self-objects produced by
cellular immune response mechanisms. The melanotic tumor phenotype is an indication
of abnormal hemocyte proliferation and differentiation in the mutant larvae (Rizki and
Rizki, 1979; Rizki and Rizki, 1983; Govind, 1996; Minakhina and Steward, 2006).
Similarly, loss-of-function mutations of cact also lead to similar hematopoietic
abnormalities. Mutant larvae carrying strong cact alleles are unable to develop into pupa.
Loss-of-function mutations of Tl, tube or pelle can suppress the lethality of the cact
mutants (Govind, 1996; Qiu et al., 1998). These results strongly indicate the essential role
of Tl signaling in Drosophila hemocyte production.
1.2.3 Dorsal and Dif
Although it is natural to speculate about the functions of the Rel-related
transcription factors Dl and Dif in hemocyte production, little work had been done prior 39 to this study. Some studies suggested a role of Dl in hemocyte proliferation.
Overexpression of dl with a heat-shock promoter induces an increase in hemocytes in the
larvae (Govind, 1996; Govind, 1999). However, dl mutations do not suppress the melanotic tumor phenotype of cact- or Tl10B mutants (Lemaitre et al., 1995). These results indicate that Dl may contribute to some but not all of the functions of Tl signaling in hematopoiesis. Therefore, it is interesting to investigate the functions of Dif, which is another transcription factor activated by Tl signaling, in hematopoiesis. Dif was first identified through a screening for proteins containing the highly conserved Rel homology domain (Ip et al., 1993). Dif is involved in the biosynthesis of the antifungal peptide
Drosomycin. Dif mutant flies are more susceptible to fungal infections (Meng et al.,
1999; Rutschmann et al., 2000). Moreover, Dif is required for the de novo synthesis of the prophenoloxidase activation enzyme (PPAE). PPAE depletes the phenoloxidase inhibitor Spn27A, thus participating in the melanization process (Ligoxygakis et al.,
2002; Ligoxygakis et al., 2002). The role of Dif in hematopoiesis was unknown. Relish is another Rel-related protein in Drosophila; however, it is not involved in the cellular immune response (Hedengren et al., 1999).
Dl and Dif are structurally and sometimes functionally related transcription factors (Govind, 1999). The major structural features of both proteins are illustrated in
Figure 1.4. The Dl protein is 677 amino acids in length, whereas Dif is 667 amino acids in length. Like other Rel family proteins, both Dl and Dif contain one Rel homology
(RH) domain (approximately 300 amino acid in length) in the amino-terminal region
(Steward et al., 1985; Steward, 1987; Ip et al., 1993). The RH domain is a conserved multifunctional protein domain responsible for dimerization and DNA binding (Chen and 40 Figure 1.4: The primary structures of Dl and Dif. (A) This figure illustrates the relative positions of the nuclear localization signal (NLS), sumoylation consensus sequence (SCS), and the highly conserved Rel homology domain (RH Domain; filled blocks) of Dl and Dif. The structure features are drawn according to the primary sequences of Dl and Dif. Picture not drawn to scale. (B) The sumoylation consensus sequences of Dl and Dif (underlined).
A NLS SCS RH Domain Dl 677aa
NLS SCS RH Domain Dif 667aa
B
Dl NIPPIKTEPRDT 377 382 Dif FVQDIKMENGFM 430 435
41 Ghosh. 1999). Cact interacts with Dl and Dif through their RH domains. Dl and Dif
contain nuclear localization signals (NLS) located immediately after the RH domain.
Although the NLS is not required for Cact-Dl interaction, it has been proposed that Cact
binding masks the NLS and prohibits nuclear import of Dl (Kidd, 1992). The carboxy-
terminal region of Dl and Dif is less conserved. However, this region of both proteins is
rich in proline, glutamine and hydrophobic residues, and functions as the transactivation
domain. More interestingly, Dl and Dif each has a sumoylation (reviewed in section 1.3)
consensus sequence in the middle of the protein, 40 and 51 amino acid residues
downstream from the NLS, respectively. It would be interesting to investigate the effects of Dl or Dif sumoylation.
Like mammalian NF-Bs, Dl and Dif binds to specific cis-elements termed the
B sites. Insect B sites share the consensus sequence “GGGRAYYYYY”, where R stands for A or G and Y stands for C or T (Engstrom et al., 1993; Chen and Ghosh,
1999). B sites are present in promoter regions of many genes, including all the antimicrobial peptide genes. Analysis of the interaction between the NF-Bs and the B sites in mammals and Drosophila reveals that NF-Bs work as homo- or hetero-dimers.
Different combinations of these transcription factors bind to different optimal B motifs
as well as overlapping B sites (Han and Ip. 1999). Therefore, Dl and Dif are redundant in some situations but functionally distinct in other situations (Gross et al., 1996; Stein et al., 1998; Manfruelli et al., 1999).
42 1.3 Lesswright and sumoylation
1.3.1 SUMO modification plays important regulatory roles
The Small Ubiquitin-related Modifier (SUMO) is a member of the growing small ubiquitin-like protein family (Reviewed in Schwartz and Hochstrasser, 2003; Gill, 2004;
Johnson, 2004; Marx, 2005; Welchman et al., 2005). The SUMO family is present in all eukaryotes from yeast to mammals. SUMO is a ~90-amino acid long protein with a molecular weight of about 11 kDa. SUMO regulates protein function through covalent attachment of its C-terminus to a lysine residue of the substrate protein. In most proteins, sumoylation takes place at the lysine residue located in the sumoylation consensus motif
KxE, where represents a large hydrophobic amino acid residue and x stands for any amino acid residue (Sampson et al., 2001). Sumoylation involves three steps. In the first step, SUMO attaches to the activating (E1) enzyme. This step requires energy input from
ATP hydrolysis. Activated SUMO is then transferred to the UBC9 family conjugating enzyme (E2). Finally, an isopeptide bond is formed between SUMO and its target protein with the aid of a SUMO ligase (E3). A single enzyme, Ulp1, which is also involved in
SUMO maturation, catalyzes the desumoylation process in Drosophila (Smith et al.,
2004).
Sumoylation occurs on many important proteins, including p53, c-Jun, Mouse
Double Minute 2 (MDM2), RanGAP1, Promyelocytic Leukemia (PML), Proliferating
Cell Nuclear Antigen (PCNA) and histone deacetylases (HDACs) (Sampson et al., 2001).
Although the effects of sumoylation of some proteins are not clear at present, SUMO modification regulates a variety of cellular processes. Established regulatory roles of 43 sumoylation include protein subcellular localization, transcription, chromatin segregation, chromatin structure, DNA repair, nuclear transport and signal transduction (Hoege et al.,
2002; Pichler and Melchior, 2002; Holmstrom et al., 2003; Melchior et al., 2003; Yang et al., 2003; Haracska et al., 2004; Hilgarth et al., 2004; Muller et al., 2004; Steffan et al.,
2004; Gill, 2005; Nacerddine et al., 2005). Sumoylation most likely regulates these processes by affecting the stability of proteins and protein-protein interactions.
Intriguingly, sumoylation usually occurs to a small percentage of the target proteins, but has drastic effects on protein functions (Johnson, 2004).
1.3.2 Sumoylation stabilizes IB
Studies in the mammalian NF-B pathway provide some valuable hints about how sumoylation regulates the Tl/NF-B pathway. IB directly interacts with UBCh9, a
SUMO conjugase (Desterro et al., 1997). UBCh9 conjugates SUMO-1 to IB at lysine-
21 residue, which is the same lysine residue where ubiquitination takes place. SUMO-1 modification blocks the ubiquitination of IB, thus preventing IB from ubiquitin- mediated proteolysis (Desterro et al., 1998). In Drosophila, it is not clear whether Cact can be sumoylated or not. However, because of the parallel between the mammalian and the Drosopila NFB signaling, it is quite possible that the Drosophila system shares the same regulatory mechanism. In fact, a yeast two-hybrid screening showed that the
Drosophila UBC9 homolog, Lesswright (Lwr), physically interacts with Cact (Bhaskar et al., 2000).
44 1.3.3 Lesswright is a Drosophila UBC9 family SUMO conjugase
The Drosophila lwr gene encodes an UBC9 family SUMO conjugase. Lwr is a
159-amino acid protein, which shows very high sequence identity to the mammalian, the
Caenorhabditis elegans, and the yeast homologs (Epps and Tanda, 1998).
Knowledge about Lwr function is still fragmentary. Lwr interacts with proteins such as Cact, Dl, small heat shock proteins and Groucho (Joanisse et al., 1998; Bhaskar et al., 2000). Lwr can also induce sumoylation of Tramtrack and Dl (Lehembre et al., 2000;
Bhaskar et al., 2002; Giot et al., 2003). Analysis of lwr mutations suggests that Lwr is also involved in the nuclear import of Bicoid during embryogenesis as well as disjunction of homologs in meiosis (Epps and Tanda, 1998; Apionishev et al., 2001).
1.3.4 Lesswright and Dorsal sumoylation
In a yeast two-hybrid screening, Lwr was identified as a Dl interacting protein. As a SUMO conjugase, Lwr mediates SUMO conjugation to lysine 382 within the sumoylation consensus sequence of Dl. SUMO conjugation causes nuclear import of Dl in Drosophila S2 cells. Dl sumoylation significantly increases its transcriptional activity when Dl is constitutively localized in the nucleus (Bhaskar et al., 2000; Bhaskar et al.,
2002).
Lwr-mediated sumoylation of Dl adds another layer of complexity to Tl signaling.
There are at least two layers of interactions between Lwr and Tl signaling. First, Lwr may stabilize Cact by sumoylation. Since Cact is the negative regulator of Dl, Lwr in this case inhibits the activation of Tl signaling. Second, Lwr interacts directly with Dl and possibly 45 Dif via sumoylation. The effects of Lwr-Dl or Lwr-Dif interactions are unknown because the functions of sumoylated Dl and Dif in hematopoiesis are not clear prior to this study.
1.4 Apoptosis in Drosophila
Apoptosis plays important roles in Drosophila development. However, it is less clear about whether apoptosis plays a role in regulating hemocyte number. Owing to the fact that both NF-B pathway and UBC9 can regulate apoptosis in mammals (Baeuerle and Baltimore. 1996; Lee et al., 2005; Lu and Yi, 2005; Babic et al., 2006; Shao et al.,
2006), it is highly likely that the Tl pathway and Lwr regulate apoptosis in flies as well.
In the context of hematopoiesis, proliferation and apoptosis may antagonize against each other to maintain the homeostasis of hemocyte number. The following sections review programmed cell death in Drosophila and the functions of UBC9 and sumoylation in apoptosis.
1.4.1 Df(3L)H99 and DIAP
Df(2L)H99 (H99) is a small deficiency of the 75C1-75C2 region on the
Drosophila third chromosome. Homozygous H99 flies are embryonic lethal and almost all apoptotic events during normal embryogenesis are blocked (White et al., 1994). H99 deletes three genes, reaper (rpr), head involution defect (hid), and grim, which are involved in both natural occurring apoptosis and induced cell death in Drosophila (Steller et al., 1994; Chen et al., 1996; Chen et al., 1996; Nordstrom et al., 1996; White et al.,
1996). Although no mammalian homologs have been identified, Rpr, Hid, and Grim are 46 possibly the functional equivalents of the mammalian apoptosis inducer Smac/Diablo.
Ectopic expression of reaper, hid, and grim in vivo or in cultured insect or mammalian
cells induces apoptosis. Furthermore, rpr-, hid-, and grim-induced apoptosis can be
suppressed by caspase inhibitors such as baculovirus protein p35 and anti-apoptotic
chemicals, indicating that these genes regulate apoptosis through the caspase pathway
(McCarthy and Dixit, 1998; Haining et al., 1999). Two additional pro-apoptotic genes,
sickle and jafrac2, have been identified recently (Christich et al., 2002; Srinivasula et al.,
2002; Tenev et al., 2002; Wing et al., 2002; Zachariou et al., 2003). Both of them have
similar functions to the H99 genes. All of the five fly pro-apoptotic proteins as well as the mammalian Smac/Diablo proteins contain a small RHG domain (Wing et al., 2001). The
RHG domain interacts with the BIR domains of the Drosophila Inhibitor of Apoptosis
Proteins 1(DIAP1). The high affinity binding of RHG domain to the BIR domain of
DIAP1 results in the release of the Caspase Dronc from DIAP1 (Zachariou et al., 2003).
Therefore, Rpr, Hid, Grim, Sickle and Jafrac2 act as antagonists of DIAP.
1.4.2 Drosophila caspases and the apoptosis pathway
The Drosophila genome encodes seven caspases. Three of them, Strica, Dronc
and Dredd, are initiator caspases. The other four caspases, Dcp-1, Decay, Drice and
Damm, are effector caspases (Kumar and Doumanis, 2000; Richardson and Kumar, 2002;
Hay and Guo, 2006).
Dronc contains a caspase activation and recruitment domain (CARD), and is thus
related to the mammalian caspase-9. As an initiator caspase, Dronc can activate effector 47 caspases such as Drice in vitro. Analysis of Dronc functions in vivo using dominant -
negative Dronc and RNA-interference-mediated gene silencing of Dronc confirmed the
role of Dronc in apoptosis. Dronc genetically interacts with H99 and diap1. H99
dominantly suppresses Dronc-induced apoptosis whereas diap1 loss-of-function mutation
enhances Dronc-induced apoptosis, suggesting that Dronc works downstream of H99 and
diap1 (Dorstyn et al., 1999; Hawkins et al., 2000; Meier et al., 2000; Quinn et al., 2000;
Wilson et al., 2002; Leulier et al., 2006).
Dredd, on the other hand, has two death effector domains (DED), and is thus
related to the mammalian capase-8. Dredd also interacts with Rpr, Hid, and Grim and
activates apoptosis mediated by Rpr, Hid, and Grim (Chen et al., 1998). Interestingly,
Dredd seemed to be more important in Drosophila humoral immunity. Defense against
Gram-negative bacteria requires Dredd function. Dredd mediates the proteolytic cleavage
and activation of a Rel family transcription factor Relish (Leulier et al., 2000; Stoven et
al., 2003).
The Drosophila apoptosis pathway is very similar to mammalian pathways.
Besides caspases and IAPs, major regulators of the pathway have been identified in
Drosophila (Hay et al., 2004). As illustrated in Figure 1.5, the Drosophila apoptosis
pathway involves pro-apoptotic factors and anti-apoptotic factors. The inputs of the
apoptosis protein network are the internal and external death signals and the output of the
network is the activation of the caspases and apoptosis. The pro-apoptotic factors activate
caspases by inhibiting caspase inhibitors or by activating an adaptor protein, Dark
(Rodriguez et al., 1999). Drosophila Dark is homologous to the mammalian Apaf1.
Interestingly, Dark can bind to cytochrome c, which plays a central role in mammalian 48 Figure 1.5: The Drosophila apoptosis pathway. This figure illustrates the major components of the Drosophila apoptosis pathway. Rpr, Hid, Grim, Debcl, and Dark are pro-apoptotic proteins. DIAP and Buffy are anti- apoptotic. Debcl and Buffy are members of the Bcl-2 family. Debcl and Buffy play pro- and anti-apoptotic roles in Drosophila respectively. The function of cytochrome c in Drosophila apoptosis is not as important as its mammalian counter parts. It is possibly regulated by Debcl and Buffy. Figure adapted from Richardson and Kumar, 2002.
Internal Death Rpr, Hid, Grim Signals
Debcl Dark Cytochrome c DIAP Buffy Dredd Dronc
External Initiator Caspases Death Signals
Dcp-1 Drice Apoptosis
Effector Caspases 49 cell death pathways. However, the significance of this interaction is not clear in
Drosophila. It is necessary to note that microRNA also plays regulatory roles in
Drosophila apoptosis (Xu et al., 2004; Chen et al., 2006). A 21-nucleotide microRNA
encoded by bantam can inhibit Hid-mediated apoptosis (Brennecke et al., 2003).
1.4.3 Sumoylation and apoptosis
Although little is known about the role of sumoylation in Drosophila apoptosis,
growing evidence shows SUMO modification can regulate apoptosis in mammals.
SUMO-1 modification regulates the nuclear localization of human procaspase-2,
caspase-7 and caspase-8 (Besnault-Mascard et al., 2005; Shirakura et al., 2005).
Sumoylation of these caspases targets them to the nucleus. Sumoylation of procaspase-2 also affects its activation. In the case of caspase-7, sumoylated protein is subject to specific locations within the nucleus and may contribute to neuronal apoptosis (Hayashi
et al., 2006).
PML sumoylation is required for the assembly of the PML nuclear bodies (NBs).
Several PML-NB components can also be sumoylated. Therefore, sumoylation regulates
PML-NB-mediated apoptosis (Hofmann and Will, 2003).
Induction of apoptosis in periovulatory granulose cells leads to an increase of
SUMO-1 expression and the protein SUMO-1 conjugation level in the cell. These results suggest the role of sumoylation in apoptosis (Shao et al., 2006).
50 1.5 The JNK pathway regulates apoptosis in both fruit flies and mammals
1.5.1 JNK pathway and its role in apoptosis
The c-Jun N-terminal kinase (JNK) belongs to the mitogen-activated protein
kinase (MAPK) superfamily (Ip and Davis, 1998; Stronach, 2005). The JNK pathway
includes a cascade of MAP kinases (Table 1.2). Cell signals are transduced through
sequential phosphorylation, and ends at the activation of the transcription factors, such as
c-jun. The JNK pathway plays multiple roles in both fruit flies and mammals, including
inflammation, dorsal closure, tissue polarity, immune response, wound healing and
apoptosis (Ip and Davis, 1998; Adachi-Yamada et al., 1999; Kockel et al., 2001; Ramet et
al., 2002; Lin, 2003). The mechanism of JNK-mediated apoptosis is poorly understood in
mammals. There are also reports about the anti-apoptotic function of the JNK pathway
(Lin, 2003; Varfolomeev and Ashkenazi, 2004). Interestingly, whether JNK is pro-
apoptotic or anti-apoptotic might be dependent on the presence of p53 in some tumor cells. JNK prevents apoptosis of p53-deficient tumor cells but not p53-positive ones
(Potapova et al., 2000; Shaulian et al., 2000). Since JNK is both pro-apoptotic and anti-
apoptotic depending on the cellular and environmental context, the role of JNK in
mammalian apoptosis remains controversial.
However, the role of the JNK pathways in Drosophila apoptosis is mostly limited
to the induction of apoptosis. There is no report about an anti-apoptotic role of JNK in
flies. In Drosophila, apoptosis during embryogenesis and pattern formation requires
basket (bsk, Drosophila JNK, see Table 1.2) function. Bsk, together with other 51 Table 1.2: Comparison of Drosophila and mammalian homologs of JNK components Table adapted from Stronach, 2005.
JNK component Drosophila Mammals JNKKKK misshappen MINK, NIK/HGK, TNIK JNKKK Protein kinase at 92B ASK1 TGF- activated kinase 1 TAK slipper MLK CG8789 DLK, ZPK Mekk1 MEKK1, MEKK2, MEKK3, MEKK4 JNKK hemipterous MKK7 MAP kinase kinase 4 MKK4 JNK basket JNK1, JNK2, JNK3 Transcription Jun-related antigen c-JUN Factor kayak c-FOS
52 components of the fly JNK pathway, regulates apoptosis during wing, eye, and gut
development (Adachi-Yamada et al., 1999; Kockel et al., 2001; Moreno et al., 2002). The
JNK pathway activates the expression of the fly pro-apoptotic genes hid and rpr (see section 1.4.1). Hid and Rpr suppress the caspase inhibitor DIAP1, and thus mediate apoptosis. JNK activation is negatively regulated by DIAP1 and by the negative feedback of its own downstream gene, puckered (puc)(Liu et al., 1999; Kuranaga et al., 2002; Cha
et al., 2003; Varfolomeev and Ashkenazi, 2004). In addition, JNK-mediated apoptosis
can be activated by the Drosophila homolog of Tumor necrosis factor (TNF), Eiger.
Eiger-induced apoptosis requires JNK function (Moreno et al., 2002). Interestingly,
although Dronc and Dark are required for Eiger-induced apoptosis, another initiator
caspase, Dredd, is not required (Moreno et al., 2002). Furthermore, JNK-induced
apoptosis during wing development seems to occur only in response to abnormal
signaling. During normal wing development, JNK signaling is not required (Adachi-
Yamada et al., 1999).
1.5.2 SUMO-1 inhibits JNK-dependent apoptosis in mammals
A resent discovery by Lee et al. (2005) highlighted a regulatory role of SUMO in
JNK-mediated apoptosis as well as a mechanism of SUMO function. SUMO-1 inhibits
the activation of the mammalian apoptosis signal-regulating kinase 1 (ASK1), a JNK
kinase kinase. SUMO-1 overexpression suppresses apoptosis induced by activated ASK1.
Interestingly, although ASK1 physically interacts with SUMO-1 and the SUMO
conjugase UBC9, sumoylation is not required for ASK1 inhibition. A mutant form of 53 SUMO-1, SUMO-1(C6), which cannot be covalently ligated to the lysine residue, can still suppress ASK1 activity. However, the sumoylation consensus sequence in ASK1 is required for ASK1-SUMO-1 interaction and apoptosis suppression, suggesting that the physical attachment of SUMO-1 to target proteins may require the sumoylation consensus site. This result suggests that sometimes the covalent sumoylation may not be essential for SUMO function. Instead, physical binding of SUMO and SUMO conjugase is one of the mechanisms for SUMO function (Lee et al, 2005).
1.6 Specific aims of this study
Drosophila has been proven to be a powerful model organism to study a variety of cellular processes. In the past decades, knowledge gained through working in
Drosophila has contributed to the understanding of humoral immune response. In the last decade, Drosophila was used to study hematopoiesis. This study focuses on the production of hemocytes. The long-term goal of our laboratory is to answer three questions: i) Which signaling pathways or proteins control hemocyte number? ii) What are the specific functions of these pathways or proteins in hematopoiesis? iii) How are these pathways or proteins regulated? Several mutations can cause abnormal hemocyte phenotypes that resemble leukemia in humans, which is characterized as overproliferation of plasmatocytes, premature differentiation of lamellocytes and the formation of melanotic tumors. Among these mutations, the Tl gain-of-function mutations and the lwr loss-of-function mutations are particularly interesting because they share similar hematopoietic phenotypes. More importantly, the Tl signaling pathway and 54 lwr may interact with each other. However, the role of Tl signaling and lwr in hemocyte production is poorly understood. Using genetic and molecular approaches, this study seeked to elucidate the functions of the Tl signaling components, Dl and Dif, and the
SUMO conjugase Lwr in plasmatocyte and lamellocyte production. The interactions between Lwr and Tl signaling were closly examined.
The specific aims of this dissertation research are to understand how hematopoiesis is regulated by the Tl signaling pathway and lwr; to determine the functions of dl, Dif and lwr in hematopoiesis; to elucidate the interactions between Lwr and the Tl pathway; to examine cell proliferation and cell death during hemocyte production; and finally, to search for Dl and Dif downstream genes that are responsible for hemocyte proliferation and differentiation.
55
Chapter 2: The lesswright mutation activates Rel-related proteins, leading to
overproduction of larval hemocytes in Drosophila melanogaster
Liang Huang, Shunji Ohsako, and Soichi Tanda
Published in Developmental Biology 280 (2005): 407– 420 56
2.1 Summary
The lesswright (lwr) gene encodes an enzyme that conjugates a small ubiquitin-
related modifier (SUMO). Since the conjugation of SUMO occurs in many different
proteins, a variety of cellular processes probably require lwr function. Here, we
demonstrate that lwr function regulates the production of blood cells (hemocytes) in
Drosophila larvae. lwr mutant larvae develop many melanotic tumors in the hemolymph
at the third instar stage. The formation of melanotic tumors is due to a large number of
circulating hemocytes, which is approximately 10 times higher than those of wild type.
This overproduction of hemocytes is attributed to the loss of lwr function primarily in hemocytes and the lymph glands, a hematopoietic organ in Drosophila larvae. High incidences of Dorsal (Dl) protein in the nucleus were observed in lwr mutant hemocytes, and the dl and Dorsal-related immunity factor (Dif) mutations were found to be suppressors of the lwr mutation. Therefore, the lwr mutation leads to the activation of these Rel-related proteins, key transcription factors in hematopoiesis. We also demonstrate that dl and Dif play different roles in hematopoiesis. dl primarily stimulates plasmatocyte production, but Dif controls both plasmatocyte and lamellocyte production.
2.2 Introduction
The innate immune system is evolutionarily ancient and common among most eukaryotes and consists of humoral and cellular components (Evans et al., 2003;
Hoffmann et al., 1999; Hultmark, 1993; Kimbrell and Beutler, 2001). In Drosophila, the 57 humoral response primarily represents the production of antimicrobial peptides in the fat body. The cellular innate immunity is handled by circulating blood cells capable of recognizing and neutralizing foreign objects. These cells also work as scavengers of apoptotic cells in normal development. Because the balance of these functions is so important, the proliferation and differentiation of hemocytes must be tightly regulated.
The Drosophila larval hemocyte population consists of several cell types, some of which reside only in a blood-cell-forming organ, the lymph gland (Figure 2.1A; Lanot et al., 2001; Rizki, 1978). Three cell types, plasmatocytes, crystal cells, and lamellocytes, are present in hemolymph. The majority are plasmatocytes, which are able to phagocytose microbes and apoptotic cells (Figure 2.1B). A small fraction (<5%) are crystal cells, which are involved in melanization reactions. Rarely found in circulation in normal circumstances, lamellocytes are key defensive players when larvae are infested by parasitoid wasp eggs (Figure 2.1C; Lanot et al., 2001; Rizki and Rizki, 1984; Sorrentino et al., 2002). In addition to these cells, prohemocytes (hematopoietic stem cells) and secretory cells are found in the lymph glands (Lanot et al., 2001). A small number of prohemocytes circulate in hemolymph. The population structure of hemocytes changes as larvae develop and undergo metamorphosis (Lanot et al., 2001; Rizki, 1957). Several genes have been found to direct differentiation of specific hemocytes. A Drosophila
GATA homologue, serpent, is required for the expression of two lineage-specific genes, glial cell missing (gcm) and lozenge (lz) (Lebestky et al., 2000). The gcm gene encodes a transcription factor and is required for the plasmatocyte lineage. A Drosophila acute myeloid leukemia-1 homologue, lz, and the Notch pathway are required for the crystal cell lineage (Duvic et al., 2002; Lebestky et al., 2003). Recently, yantar and collier were 58 Figure 2.1: Lymph gland, plasmatocyte, and lamellocyte in Drosophila larva. (A) The right side of the lymph gland of the third instar larva. Lamellocytes are visible with msn-lacZ marker (blue cells). An arrow indicates the position of the dorsal vessel, and the cells marked with asterisks are pericardial cells that associate with the dorsal vessel. A large arrowhead indicates the first lobe of the lymph gland and small arrowheads point the secondary lobes. (B) Plasmatocytes in circulation are msn-lacZ negative. (C) Large and matured lamellocyte is msn-lacZ positive (blue pigments in the nucleus). Images were taken with DIC optics, and bars correspond to 20 μm.
59 found to direct lamellocyte differentiation (Crozatier et al., 2004; Sinenko et al., 2004.
However, precise mechanisms of the proliferation and differentiation of hemocytes still
remain elusive.
Three signal transduction pathways are known to influence the number of
hemocytes in circulation. They are the Ras, JAK/STAT, and Tl pathways (Asha et al.,
2003; Harrison et al., 1995; Luo et al., 1997; Qiu et al., 1998). Mutations that activate these pathways increase the total hemocyte numbers 10- to 100-fold and often stimulate lamellocyte production in the absence of parasitoid wasp infestation. Ras functions in the
MAP kinase pathway and stimulates cell division. It is one of the most common oncogenes found in many different human cancers (Bos, 1989; McCormick, 1994). When the Drosophila ras1 gene is overexpressed in the lymph gland and hemocytes, total hemocyte counts increase nearly 100-fold (Asha et al., 2003). The JAK-STAT pathway is a conserved signal transduction pathway and plays a variety of roles in Drosophila and many other eukaryotes including humans (Kisseleva et al., 2002; O’Shea et al., 2002;
Ward et al., 2000). A dominant mutation of JAK, hopscotchTum-l, causes a drastic increase
in plasmatocytes as well as lamellocytes in a temperature-dependent manner. Similarly,
dominant mutations of Tl, Tl10B, and Tl3, produce a large number of hemocytes (Braun et
al., 1997; Qiu et al., 1998). In this case, the lamellocyte population increases to 10–20%
of the entire hemocyte population. Several genes in the Tl signaling pathway also exhibit a similar defect when mutated. Although it is not clear if these signal transduction pathways possess lineage specific functions, they play some general role in Drosophila hematopoiesis. 60 The studies of the NF-B pathway, discovered in 1986 (Sen and Baltimore,
1986), have made a huge contribution to the understanding of mammalian immune systems, particularly in acquired (or adaptive) immunity (Baldwin, 1996; Ghosh et al.,
1998; Hatada et al., 2000). NF-B is a dimer of members of the Rel-related transcription factors. A unique aspect in the NF-B pathway is that Inhibitors of B, IBs, keep the
transcription factor NF-B in the cytoplasm from its action in the nucleus. Ubiquitination,
thus degradation, of IB is required for the activation of the NF-B pathway. A
Drosophila Rel-related gene, dl, was discovered to be an important component in the
establishment of the embryonic dorsal–ventral axis (Nusslein-Volhard et al., 1980;
Steward, 1987) and was found to be a part of Tl signaling (Anderson et al., 1985;
Schupbach, 1987). The activation of Tl signaling starts from the cell surface receptor Tl
and ends at the entrance of the Dl transcription factor into the nucleus. The function of Tl
signaling in innate immunity was later discovered indirectly. Sequence analysis of several
antimicrobial peptide genes spotted B sites, binding sites for NF-B and Dl, in their 5’
regulatory regions (Engstrom et al., 1993), which connected the Tl pathway to humoral
immunity. Discovery and subsequent studies of other Rel-related genes, Dif and Relish,
further support a key role of the Tl pathway in Drosophila immunity (Dushay et al.,
1996; Ip et al., 1993). Furthermore, the homology between mammalian IBs and Cactus
(Cact) (Geisler et al., 1992; Kidd, 1992) demonstrates that the parallelism extends to the
regulatory mechanism of mammalian and Drosophila NF-B activity. The presence of
multiple Rel-related proteins and Tl-like receptors in Drosophila as well as in other
eukaryotes makes the system more complex, but versatile in innate immune responses
and hematopoiesis. In the last decade, remarkable progress has been made toward the 61 understanding of Drosophila humoral immunity including the role of the Tl pathway
(Hoffmann and Reichhart, 2002; Meister et al., 1997; Silverman and Maniatis, 2001;
Tzou et al., 2002). On the other hand, the regulatory mechanisms of cellular immunity are
much less understood.
Recently, ubiquitin’s small cousins, SUMO molecules, were discovered to add
another layer of complexity in NF-B signaling (Desterro et al., 1998). SUMO
conjugation (sumoylation) regulates a variety of cellular functions (Melchior, 2000;
Muller et al., 2001; Yeh et al., 2000). Proteins subjected to sumoylation are involved in oncogenesis, transcriptional regulation, nuclear transport, and others. Ubiquitin and
SUMO molecules are biochemically quite similar to each other. Furthermore, they require a set of similar modifying enzymes, activating (E1), conjugating (E2), and ligating (E3) enzymes, which show high conservation among most eukaryotes. The similarity between ubiquitination and sumoylation creates an interesting situation where the same lysine residues on a given protein can be modified by both ubiquitin and
SUMO. Thus, ubiquitination and sumoylation can counteract each other. This scenario is seen in the regulation of IB degradation (Desterro et al., 1998). In addition to NF-B signaling, the activity of the JAK/STAT pathway might be regulated in part by sumoylation since a Protein inhibitor of activated STAT (Pias) possesses a RING finger motif, an E3 SUMO ligase signature (Schmidt and Muller, 2003; Shuai and Liu, 2003).
However, these possibilities have not yet been explored in Drosophila hematopoiesis.
Here, we report that the Lwr protein, a SUMO conjugase, plays an important role in regulation of larval hematopoiesis in Drosophila melanogaster. Recessive as well as dominant negative mutations of the lwr gene result in the overproliferation of hemocytes 62 in larvae. We found that the loss of lwr function led to the accumulation of the Rel-
related protein Dl in the nuclei of circulating hemocytes, and that dl and Dif mutations are suppressors of the lwr mutation. Taken together, our results indicate that the lwr function is inhibitory to dl and Dif activities. Furthermore, we demonstrate that dl and Dif possess different properties in hematopoiesis, particularly in lamellocyte production.
2.3 Materials and methods
2.3.1 Drosophila culture conditions and stocks
Flies were cultured in JAZZ mix (Fisher Scientific) supplemented with inactive brewer’s yeast (SAP Product Corporation) and soy flour (ADM). JAZZ mix was cooked in a steam kettle according to the manufacturer’s instructions. The stocks were maintained at room temperature, and the experiments were conducted in uncrowded conditions at 25°C except for the experiment with the e33CGAL4 driver, which was carried out at 28°C.
Hypomorphic alleles of lwr, lwr4-3, and lwr5, were introduced to lethal free
backgrounds of P{neoFRT}40A and b1 cn1 bw1, respectively, in order to minimize effects
of unwanted hidden mutations linked to these lwr alleles (Sun et al., 2003). The deficiency Df(2L)J4 is associated with a small, cytologically-invisible deletion at 36C8-9
(Meng et al., 1999), and the deficiency Df(2L)TW119 deletes a small section between
36C4-2 and 36E1. These deficiencies remove both the dl and Dif genes and were used to create the dl Dif double mutant combination. The CgGAL4, the e33CGAL4, and the
Lsp2GAL4 drivers were described previously (Asha et al., 2003; Cherbas et al., 2003; 63 Harrison et al., 1995). The UAS-Dif and the UAS-Tl10B lines were generous gifts from
Y.T. Ip, and the UAS-Tl10B lines were described elsewhere (Hu et al., 2004). Other mutations and aberrations used in this study are described in FlyBase
(http://flybase.bio.indiana.edu/).
2.3.2 Transgenics
pUAS transgene constructs (see below) were amplified on a large scale and
purified using MAXI Prep kit (Qiagen). DNA was resuspended in doubly distilled water
at a concentration of approximately 500 g/ml. We used the y w; Sb, P{2-3}99B/ TM6
stock as host (Robertson et al., 1988). Germline transformation was performed as
described (Spradling, 1986; Sullivan et al., 2000).
UAS-dl construct: A full-length dorsal cDNA in the pBluescript KS (Rushlow et
al., 1989) was excised with the restriction enzymes KpnI and XbaI. This fragment was
then cloned into the pUAST vector (Brand and Perrimon, 1993) between the KpnI and
XbaI sites.
UAS-lwrDN construct: We constructed a dominant negative form of lwr by replacing cys93 and leu97 in the conserved SUMO conjugation site with arginine and alanine residues, respectively. This strategy was successfully applied to the mouse Ubc9 gene (Tashiro et al., 1997). A single-stranded template for in vitro mutagenesis (Sculptor,
Amersham) was obtained from lwr cloned in the pBluscript SK vector (STRATAGENE).
The primer sequence for mutagenesis was the following: 5’-
CGGGCACCGTTCGCCTGTCGCTGGCCGACGAGG. The introduced mutations were 64 confirmed by DNA sequencing. The lwrDN allele was then isolated by PCR with primers
with added BamHI and XbaI sites and cloned into the pUAST vector between the BglII
and XbaI sites. The forward primer with BamHI site and the reverse primer with XbaI site
were the following: 5’-CGGGATCCACCATGTCCGGCATTGCT and 5’-
GCTCTAGATTTTATTGAAATTACATAGGTT. We tested a UAS-lwrDN transgene on
the third chromosome for its ability to counteract the wild type function. We crossed it
with the e22cGAL4 and the tubulinGAL4 drivers. In both cases, about 18% of embryos,
excluding unfertilized eggs, did not hatch of the 1000–1500 embryos examined. These
numbers were substantially higher than those with a UAS-lwr (wild type) transgene
(<3%). Furthermore, some exhibited cuticle defects similar to those of lwr mutants (Epps and Tanda, 1998). Therefore, we conclude that this lwrDN allele can be used to mimic effects of the lwr mutation.
2.3.3 Genotyping larvae
Genotypes of larvae homozygous for a given second-linked mutation were determined using the CyO balancer with a yellow+ ( y+) transgene in a y background. The
mutant larvae were distinguished by a lesser degree of pigmentation of the
cephalopharyngeal skeleton than those of heterozygous siblings. A similar approach was
used on the third-linked mutations using the TM6B balancer with Tubby (Tb), or the TM3 balancer with an actin-GFP transgene. The presence of GFP in larvae was monitored using a Nikon SMZ1000 stereoscopic microscope equipped with an epi-fluorescent apparatus. 65
2.3.4 Hemocyte counting
Egg collection was done daily, and the larvae were raised to the mid/late third instar stage. Feeding larvae with still-retracted anterior spiracles were harvested and used for this study. They are presumed to be those before receiving the first pulse of ecdysone, which triggers wandering behavior and stimulates hemocyte production. We found that variations in total blood cell counts were much larger among wandering larvae than feeding larvae.
Hemocytes were counted using a hemacytometer, and the total hemocyte counts were presented as the number of hemocytes per milliliter of hemolymph. Larvae were rinsed well in water and blotted on Kimwipes to remove excess water before bleeding. A small incision was made near the posterior spiracles and the hemolymph was directly loaded on a hemacytometer. After placing a coverslip over the hemolymph, all hemocytes but crystal cells were counted using differential-interference-contrast (DIC) optics at a magnification of 200.
2.3.5 Statistical tests
Averages of hemocyte counts were compared by t test or analysis of variance
(ANOVA). In most cases, we evaluated the differences between experimental genotype and corresponding internal control by t test. In order to assess the effects on total hemocyte counts among different genotypes, we applied ANOVA to our data sets. First, we compared the averages of the controls by ANOVA and confirmed that there were no 66 differences among the controls. When the differences among different genotypes were
significant, Bonferroni’s multiple comparison test was used to compare the averages of
different genotypes.
2.3.6 Histological procedures
Paraffin sections were prepared using standard procedure (Presnell and
Schreibman, 1997). Late third instar larvae were rinsed well in water and fixed in FAAG
(80% EtOH, 4% Formaldehyde, 5% Glacial acetic acid, 1% Glutaraldehyde) for 15 min
at room temperature. Small incisions were made 2 min after the larvae were immersed in
the fixing solution. The specimens were then transferred to a scintillation vial containing
fresh FAAG and further fixed overnight at 4°C. Fixed larvae were then processed
according to standard procedure for paraffin sections. Sectioning (5 m thick) was done
with a regular microtome equipped with a disposable razor blade. Mayer Hematoxylin/
Eosin Y staining was done using standard procedure. Dehydrated specimens were
mounted with Permount (Fisher Scientific).
-galactosidase staining was done according to the method described in Sullivan et al. (2000). Larvae were bled as described above and hemolymph was smeared on a 22
22 mm coverslip. Hemocytes were briefly dried and then fixed for 20 min with 4%
formaldehyde in Phosphate Buffered Saline (PBS). The specimens were rinsed a few
times in PBS (5 min each) and then stained for -galactosidase activity overnight at
37°C. After staining, hemocytes were rinsed in PBS and mounted in 70% glycerol. 67 For a Giemsa-stained blood smear, the hemolymph was bled directly into a drop of 2 l of PBS on a glass slide, spread using a pair of forceps and dried. The blood smear was fixed in 100% methanol for 5 min and stained for 20 min in 10% Giemsa stain
(Sigma) in water. The specimens were rinsed in water for a few minutes and destained in
2 10-4 N HCl for 75 s. After being rinsed in water, the blood smear was air-dried and mounted in Permount (Fisher Scientific).
Immunohistochemistry on hemocytes was carried out on the cells smeared on a coverslip. The cells were first dried for 20 min and fixed in 3.7% formaldehyde/PBS at room temperature. The specimens were washed for 3 min four times in PBS. The cells were then permeabilized in 0.1% Triton X-100/PBS for 5 min and washed for 3 min three times in PBS. After permeabilization, the cells were incubated in 5% normal goat serum/PBS (blocking solution) for 30 min at room temperature. Antibodies were diluted in the blocking solution, and hemocytes were incubated with primary antibodies overnight at 4°C in a moist chamber. The specimens were washed for 10 min five times at room temperature in PBS and then incubated for 1 h at room temperature with secondary antibodies diluted in the blocking solution. The cells were washed for 10 min 5 times at room temperature and mounted with VectaShield (Vector Laboratory) or Prolong
(Molecular Probes). Anti-Dl monoclonal antibodies (concentrated form from
Developmental Studies Hybridoma Bank) were diluted 100-fold. Antiphospho-Histone
H3 antibodies (1 g/l, Upstate) were diluted 200-fold. Secondary antibodies conjugated with either Alexa Fluor 488 or 594 (Molecular Probes) were diluted either 500- or 1000- fold. 68 A Nikon Optiphot-2 equipped with an epi-fluorescent apparatus was used for all specimens. Images were captured using a XM1200 digital camera (Nikon) and assembled using Adobe PhotoShop.
2.4 Results
2.4.1 lesswright mutants develop melanotic tumors due to overproduction of hemocytes
Mutants with amorphic lwr alleles die around the early third instar larval stage
(Sun et al., 2003). Mutant larvae with hypomorphic alleles develop to the late third instar
stage but rarely pupate, surviving an additional few days as larvae. They develop
melanotic tumors during this third instar stage. The tumors are usually free in the
hemolymph and become very large in the posterior half of the body (Figure 2.2). In some
cases, we observed excess hemocytes invade self-tissues such as fat body cells (Figure.
2.2). Such invasion is probably attributed to the abnormal property of hemocytes due to
the loss of lwr function. It can alternatively be interpreted as resulting from abnormal
properties of the fat body due to loss of lwr function since abnormal basement membranes can be targeted by normal hemocytes (Rizki and Rizki, 1974).
To investigate why lwr mutant larvae develop melanotic tumors, we first measured the number of circulating hemocytes of lwr mutants as well as several controls
including Oregon-R and Tl10B (Table 2.1). Total hemocyte counts of wild type and
heterozygous controls varied from 2.1 106 to 4.1 106 per ml of hemolymph. The
number of hemocytes of lwr mutant larvae was 23.0 106 per ml of hemolymph, which 69 Figure 2.2: Melanotic tumors observed in lwr mutants. Panel A shows typical melanotic masses observed in lwr mutant larvae near the end of their larval lives. Panel B shows an aggregate of overproliferated hemocytes in the hemocoel. Many lamellocytes (indicated with an arrow), which are flat in shape, surround the mass although the cell types in the center of the mass cannot be unambiguously determined. The fat body (indicated with arrowheads) is also visible in the same panel. Panel C shows hemocytes invading the fat body (indicated with arrowheads). Melanization associated with hemocytes (indicated with an arrow) is seen in the central portion of the fat body, suggesting the presence of crystal cells that supply phenoloxidase and its substrate. The bars in panels B and C correspond to 25 m.
70 Table 2.1: Hematopoietic defects of lwr, Tl10B, dl, and Dif mutants and their double and triple combinations
Genotype Controla Mutant Total hemocyte ± Total hemocyte ± % Lamellocyte SDb SDb ± SDb ( 106/ml of ( 106/ml of hemolymph) hemolymph) Oregon-R 2.1 ± 1.08 (35) N/Ac 0.7 ± 0.46(15)
Canton-S 4.1 ± 1.54 (35) N/Ac 1.0 ± 1.26(15)
Tl10B/+ N/Ac 20.1 ± 5.76 (32) 7.9 ± 4.04(11) lwr4-3/lwr5 2.2 ± 1.12 (35) 23.0 ± 3.00 (35)d 27.5 ± 5.24(15) lwr4-3 dl1/lwr5 Df(2L)J4 2.0 ± 0.61 (35) 10.0 ± 2.79 (35) d 44.1 ± 3.69(15) lwr4-3 Dif2/lwr5 Df(2L)J4 2.1 ± 0.69 (35) 6.8 ± 2.18 (35) d 12.2 ± 6.87(15) lwr5 Df(2L)J4/lwr4-3 Df(2L)TW119 2.2 ± 0.89 (35) 1.9 ± 1.34 (35) e 2.1 ± 1.46(15) dl1/Df(2L)J4 2.0 ± 0.99 (35) 2.0 ± 0.82 (35) e N/Df
Dif2/Df(2L)J4 2.2 ± 0.87 (35) 2.4 ± 1.43 (35) e N/Df
Df(2L)J4/Df(2L)TW119 2.1 ± 0.82 (35) 1.8 ± 0.96 (35) e N/Df Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. The deficiencies Df(2L)J4 and Df(2L)TW119 delete both the dl and Dif genes. a Heterozygous larvae of mixed genotypes in culture. b Standard deviation. c Not applicable. d Statistically significant differences between mutant and control (P < 0.01). e Statistically insignificant differences between mutant and control. f Not determined. 71 was statistically different from that of the heterozygous control animals (2.2 106 per ml of hemolymph, P < 0.01 in t test). This high hemocyte count was very similar to that of
Tl10B mutants (20.1 106 per ml of hemolymph). Therefore, as in Tl10B and Tl3 (Qiu et al.,
1998), an excess number of circulating hemocytes probably caused the development of
melanotic tumors in lwr mutant larvae.
Since three different hemocytes are known to be in the hemolymph, we also
examined how hemocyte populations were affected in these mutant larvae. We omitted
crystal cells from this study because they usually burst within 1 min or less after
bleeding, which leads to inaccurate estimates of crystal cells. We estimated the
proportion of lamellocytes in the total circulating hemocytes as a parameter to represent
differences in the hemocyte population. Lamellocytes were distinguished by using a lamellocyte specific marker, msn-lacZ (Figure. 2.1C; Braun et al., 1997), or by their
characteristic morphology (Rizki, 1957). The percentage of lamellocytes in the total
hemocyte pool significantly increased in lwr and Tl10B mutant larvae (Table 2.1 and
Figure. 2.3). We also noticed that most aggregated hemocytes in the hemolymph
consisted of lamellocytes, and that these aggregated masses were partially to fully
melanized in most cases (Figure 2.2). These observations strongly suggest that
lamellocytes are heavily involved in the formation of melanotic tumors in lwr mutant
larvae.
We also wonder whether the lwr mutant hemocytes divide in circulation. We measured the mitotic indexes of lwr mutant hemocytes as well as those of Tl10B and
Canton-S hemocytes as control. Cells in mitosis were identified using anti-phospho- 72 Figure 2.3: Plasmatocyte and lamellocyte populations in different genetic backgrounds. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages. OR, Oregon-R (wild type); CS, Canton-S (wild type); Tl10B, Tl10B/+; lwr, lwr4-3/lwr5; lwr dl, lwr4-3 dl1/lwr5 Df(2L)J4; lwr Dif, lwr4-3 Dif2/lwr5 Df(2L)J4; lwr dl Dif, lwr5 Df(2L)J4/lwr4-3 Df(2L)TW119.
73 Histone H3 antibodies. The mitotic index of lwr mutants was 10.4% in a total of 3109 cells from five larvae, which was slightly higher than that of Tl10B (7.1% in a total of
2515 cells from five larvae). On the other hand, we did not observe any dividing
hemocytes in Canton-S (a total of 1344 cells from ten larvae). Based on their sizes and morphologies, these dividing cells in lwr and Tl10B mutants were plasmatocytes and
prohemocytes, not lamellocytes. Therefore, some hemocytes do indeed divide in
circulation in lwr mutants. However, the excess number of mature lamellocytes in
circulation is due to proliferation of lamellocyte precursors, presumably in the lymph
gland. Taken together, we conclude that the effects of the lwr mutation on hemocytes are
similar to those of other known hematopoietic mutants in the Tl pathway such as cact and
Tl10B (Qiu et al., 1998).
2.4.2 The overproduction of hemocytes is most likely due to the loss of lwr function in the hematopoietic tissues
To determine whether the overproduction of hemocytes can be attributed to the loss of lwr function in hematopoietic tissues, we expressed a dominant negative form of lwr (lwrDN; see Materials and methods for the UAS-lwrDN construct) in the lymph gland
and hemocytes. Since the lwr mutation exhibits pleiotropic effects (Apionishev et al.,
2001; Epps and Tanda, 1998), it is possible that the increased number of hemocytes in
lwr mutant larvae is due to a secondary effect that might stimulate hemocyte production.
For this purpose, we used the GAL4/UAS system (Brand and Perrimon, 1993). Two GAL4
drivers, CgGAL4 and e33CGAL4, were chosen for this experiment because they are 74 known to induce expression of GAL4 in the lymph glands and hemocytes (Asha et al.,
2003; Harrison et al., 1995). Although these drivers induce GAL4 expression in multiple
tissues, the common cell types expressing GAL4 with these two drivers are hemocytes in
the lymph gland and in circulation. The e33CGAL4 driver induces a UAS-GFP transgene
in most cells in the lymph gland at different expression levels, while the CgGAL4
promotes GFP expression in a subset of the cells in the anterior lobes at a relatively
consistent level. The overall expression level of GFP by the e33CGAL4 is lower than that
of the CgGAL4 driver. Nevertheless, these GAL4 drivers exhibited similar effects on the
total hemocyte counts.
The CgGAL4 driver effectively increased the number of hemocytes to a level that
was higher than those of lwr and Tl10B (Tables 2.1 and 2.2). The total hemocyte count was
25.0 106 per ml of hemolymph, which was statistically higher than that of the
corresponding control (8.3 106 per ml of hemolymph, P < 0.01 in t test). The e33CGAL4 driver also induced many hemocytes at 28°C (16.0 106 per ml of
hemolymph), and this level was significantly different from that of the corresponding
heterozygous control (3.4 106 ml of hemolymph, P < 0.01 in t test). Since hemocytes in
the lymph gland and in circulation are the only common cell types that express GAL4
with these drivers, it is most likely that the loss of lwr function in hematopoietic tissues is
responsible for high hemocyte counts in lwr mutants. This conclusion is also supported
by the fact that a fat body specific driver, Lsp2GAL4 (Cherbas et al., 2003), did not show
any significant effect on hemocyte counts when the lwrDN allele was induced by this
driver (Table 2.2). 75 Table 2.2: Effect of a dominant negative lwr gene on the number of hemocytes
GAL4 driver Controla Experimental Total hemocyte ± Total hemocyte ± % Lamellocyte ± SDb ( 106/ml of SDb ( 106/ml of SDb hemolymph) hemolymph) CgGAL4 8.3 ± 5.43 (15) 25.0 ± 2.89 (15)c 15.5 ± 5.18 (12) e33CGAL4d 3.4 ± 0.76 (10) 16.0 ± 5.36 (13) c N/De
Lsp2GAL4 3.7 ± 1.40 (15) 3.3 ± 1.97 (15) f N/De Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. a Heterozygous larvae of mixed genotypes in culture. b Standard deviation. c Statistically significant differences between experimental and control ( P < 0.01). d Assayed at 28°C e Not determined. f Statistically insignificant differences between experimental and control. 76 In addition to the total hemocyte counts, the UAS-lwrDN/CgGAL4 combination
promoted lamellocyte production. We observed that lamellocyte levels rose to 15.5%
(Table 2.2). This value was lower than that of lwr mutants, but higher than that of Tl10B
mutants. Furthermore, most hemocytes expressing lwrDN showed nuclear localization of
Dl protein (Figure 2.4B), which is characteristic of the lwr mutant hemocytes (see
below). These observations strongly suggest that this lwrDN allele is very effective with
the CgGAL4 in mimicking effects of the lwr mutation on hemocyte production in larvae.
Thus, we conclude that the increase in the total hemocyte counts in the lwr mutant
background is attributed to the loss of lwr function in the hematopoietic tissues such as
the lymph gland.
2.4.3 Nuclear localization of the Dorsal protein was promoted in lwr mutant
hemocytes
How does the lwr mutation affect hemocyte production? Because the
hematopoietic defects of lwr mutants are similar to those of dominant Tl mutations, Tl10B and Tl3 (Qiu et al., 1998), we investigated possible interactions between lwr and the Tl
signal transduction pathway. Moreover, IB, a human Cact homologue, is subject to
sumoylation (Desterro et al., 1998), which suggests that the Cact protein may interact
with the Lwr protein. Since both dl and Dif are expressed in the hematopoietic tissues, we
used the entrance of Dl proteins as an indicator for Tl signaling activity. At this moment,
it is not yet clear whether other Tl-like receptors are involved in hematopoiesis. Hereby, 77 Figure 2.4: Nuclear localization of Dorsal protein in Tl10B and lwr mutant hemocytes. (A) Tl10B and lwr mutant (labeled with Tl10B and lwr, respectively) and wild type (labeled with WT) hemocytes were stained with anti-Dorsal monoclonal antibodies (middle column). The hemocytes were simultaneously stained with DAPI to localize DNA (left column). Merged images (right column) clearly show nuclear localization of Dl proteins in Tl10B and lwr mutant blood cells (arrowheads), but not in wild type blood cells. Some cells (indicated with *) do not show nuclear localization of Dl protein in hemocytes of either mutant. (B) Dorsal nuclear localization was examined in hemocytes expressing the lwrDN allele with the CgGAL4 driver. The lwrDN expressing cells were visualized with a UAS-GFP transgene (left panel). In the right panel, the cells with and without Dl nuclear localization are labeled with arrowheads and asterisks, respectively. Two lamellocytes are seen overlapping in the center of the panels. Notice that Dl nuclear localization is seen in GFP-positive cells, but not in GFP-negative cells. All photographs were taken at the same magnification, and the bar in white in the top left panel corresponds to 20 m.
78 the term Tl signaling in this report does not exclude possible signaling inputs from other
Tl-like receptors.
We observed nuclear localization of Dl protein in many lwr mutant hemocytes as
well as in Tl10B hemocytes (Figure 2.4A). In lwr mutants, nearly half of hemocytes
(46.9% in a total of 1960 cells from five larvae) showed accumulation of Dl proteins in the nuclei, which was comparable to that of Tl10B mutants (48.2% in a total of 2699 cells from five larvae). In contrast, nuclear localization of Dl protein was observed in only a few control heterozygous and wild type hemocytes, e.g., 3.6% in a total of 1291 cells from 10 Canton-S larvae. These observations indicate that the activation of the Tl pathway is a consequence of the loss of lwr function, which is manifested as abnormal production of larval hemocytes. Although some small lamellocytes were positive for Dl nuclear staining, little nuclear localization of Dl protein was observed in large matured lamellocytes of lwr and Tl10B mutants. Thus, there is not a mechanism to allow entrance
of Dl proteins to the nucleus in mature lamellocytes.
2.4.4 The dorsal and Dif mutations are suppressors of the lwr mutations in
hematopoiesis
To further investigate the relationship between the lwr mutation and Tl signaling, we examined genetic interactions of lwr with dl and Dif single mutants as well as with dl
Dif double mutants. The rationale here is that genetic interactions between lwr and dl as well as Dif would be clearly detected if lwr function modulates signaling from Tl receptor and possibly from other Tl-like receptors. We describe the results of these three 79 combinations separately in the following sections because the dl and the Dif mutations
showed different effects on the hematopoietic defects of the lwr mutation. Nonetheless,
the results described below indicate that the majority of lwr’s mutant effects on larval
hematopoiesis are manifested through the Tl signal transduction pathway, which agrees
with the results of our immunohistochemical study (see above).
2.4.5 The dorsal mutation suppresses the production of plasmatocytes in the lwr
mutant background
We created a double mutant combination of lwr with dl [lwr4-3 dl1/lwr5 Df(2L)J4].
The total hemocyte counts and lamellocyte percentages were measured (Table 2.1). The
total hemocyte counts were significantly reduced in the lwr dl double mutant background
(P < 0.01 in Bonferroni’s test). The numbers of plasmatocytes and lamellocytes were then calculated based on the total hemocyte counts and lamellocyte percentages. We noticed that plasmatocyte counts were reduced by approximately 50% in the double mutant combination. Interestingly, the production of lamellocytes was not overly affected in the same mutant background (Figure 2.3), which indicates that dl plays a minor role in lamellocyte production.
Although the production of plasmatocytes was suppressed by the complete loss of dl function, this suppression was not absolute, suggesting that Dif may contribute equally to larval plasmatocyte production. If Dif only played a minor role in this process, the lwr
mutation would affect plasmatocyte production via another pathway besides the Tl pathway. Note that the latter hypothesis was proven to be very unlikely (see below). 80 2.4.6 The Dif mutation suppressed the production of both plasmatocytes and lamellocytes in the lwr mutant background
To examine the effect of Dif in the lwr mutant background, we created a double mutant combination of lwr and Dif [lwr4-3 Dif2/lwr5 Df(2L)J4] and measured the total
hemocyte counts and lamellocyte percentages (Table 2.1). The loss of Dif function in the
lwr background significantly reduced total hemocyte counts (P < 0.01 in Bonferroni’s
test), and the effects were observed on both plasmatocyte and lamellocyte levels.
Plasmatocyte population was reduced to half the level caused by the lwr mutation, while the number of lamellocytes was similar to that found in wild type larvae (Figure 2.3).
Similar to what we observed in the lwr dl double mutants, the reduction of the plasmatocyte population due to the loss of Dif function in the lwr background was approximately 50%. This result strongly suggests, in conjunction with the results of the lwr dl double mutants, that the increase of hemocytes observed in the lwr mutation is mediated by the functions of both dl and Dif (also see below).
In contrast to the lwr dl double mutant, the lamellocyte population was considerably affected by the introduction of the Dif mutation into the lwr mutant background, and the number of lamellocytes observed in the lwr Dif double mutants was almost identical to those in wild type larvae (Figure 2.3). Therefore, lamellocyte production is primarily controlled by Dif function when the Tl pathway is activated. This in turn suggests that dl and Dif play different roles in hematopoiesis when it is stimulated by the lwr mutation.
81 2.4.7 Loss of both dl and Dif functions totally diminished the effects of the lwr
mutation on hemocyte production
To obtain a more conclusive answer as to whether the effects of the lwr mutation
are observed mostly through Rel-related proteins, Dl and Dif, we examined lwr dl Dif
triple mutants [lwr5 Df(2L)J4/lwr4-3 Df(2L)TW119]. We observed that the loss of both
gene functions almost completely cancelled the effects of the lwr mutation on
hematopoiesis.
We eliminated the functions of dl and Dif by combining the deficiencies Df(2L)J4 and Df(2L)TW119 (see Materials and methods). Total hemocyte counts of lwr5
Df(2L)J4/lwr4-3 Df(2L)TW119 trans-heterozygotes were significantly reduced from those
of the lwr single mutants (P < 0.01 in Bonferroni’s test) and were indistinguishable from those in wild type larvae as well as Df(2L)J4/Df(2L)TW119 trans-heterozygotes (Table
2.1). The number of lamellocytes was almost identical to those of wild type larvae
(Figure 2.3). These results indicate that the hematopoietic defects of the lwr mutation are manifested through dl and Dif function.
The loss of both dl and Dif functions with and without the lwr mutation did not lead to complete loss of hemocytes. This observation agrees with the fact that loss-of- function mutations of the Tl gene did not eliminate all hemocytes completely (Qiu et al.,
1998). Low levels of hemocytes in these mutant backgrounds can be explained by hemocyte production using other pathways such as JAK/STAT and Ras, which are known to be involved in hematopoiesis (Asha et al., 2003; Harrison et al., 1995; Luo et al., 1997). Therefore, these observations do not rule out the importance of dl and Dif
functions in hematopoiesis. 82 2.4.8 dl and Dif possess different functions in hematopoiesis
In order to obtain additional evidence that supports different but overlapping roles
of dl and Dif in hematopoiesis, we overexpressed UAS-dl and UAS-Dif transgenes in the
lymph glands and hemocytes using the CgGAL4 driver (Table 2.3). We observed that Dif promoted lamellocyte production more effectively than dl did, which shows good agreement with our genetic analysis (see above).
Since the CgGAL4 driver expresses the GAL4 transcription factor in the fat body,
we also used the Lsp2GAL4 driver, which is fat body specific (Cherbas et al., 2003), to express the UAS constructs used in this study. The combinations of all UAS transgenes
with the Lsp2GAL4 serve as a control to assess any possible additional effect of the
CgGAL4 driver. In all cases examined, while the differences between controls and
experimental sets were statistically significant in some cases (Table 2.3), total hemocyte
counts fell in the range of wild type, Oregon-R and Canton-S (Table 2.1). Therefore, the
results with the CgGAL4 driver, which are described in the following paragraphs, are
most likely to represent the effects of these genes in the hematopoietic tissues, the lymph
gland and hemocytes.
Both dl and Dif exhibited significant increases in total hemocyte counts when they
were overexpressed by the CgGAL4 driver. The average total hemocyte counts of these
UAS/GAL4 combinations were statistically different from those of the corresponding
heterozygous controls (P < 0.01 in t test). Interestingly, overexpression of Dif produced
more hemocytes than dl. After dividing the total hemocyte population into plasmatocytes
and lamellocytes, we noticed that plasmatocyte counts increased to levels similar to those
of lwr and Tl10B mutants in both UAS-dl/CgGAL4 and UAS-Dif/CgGAL4 combinations 83 Table 2.3: Effect of dl, Dif, and Tl10B transgenes on larval hemocytes
GAL4 driver UAS transgene Controla Experimental Total Total % Lamellocyte hemocyte ± hemocyte ± ± SDb SDb SDb ( 106/ml of ( 106/ml of hemolymph) hemolymph) CgGAL4 dorsal 2.6 ± 1.18 18.0 ± 4.53 1.7 ± 0.55 (35) (35)c (15) Dif 2.3 ± 1.25 30.8 ± 13.5 11.7 ± 1.58 (35) (35) c (15) dorsal +Dif 1.9 ± 0.78 26.0 ± 5.49 19.6 ± 2.87 (35) (35) c (15) Toll10B 1.8 ± 0.46 39.6 ± 9.62 11.4 ± 4.26 (35) (35) c (15) Lsp2GAL4 dorsal 1.7 ± 0.69 1.4 ± 0.59 N/De (12) (12) d Dif 3.6 ± 1.13 1.6 ± 0.96 N/De (11) (12) c dorsal +Dif 1.7 ± 0.44 3.3 ± 0.69 N/De (35) (35) c Toll10B 1.9 ± 0.61 3.1 ± 0.94 N/De (35) (35) c Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. a Heterozygous larvae of mixed genotypes in culture. b Standard deviation. c Statistically significant differences between experimental and control (P < 0.01). d Statistically insignificant differences between experimental and control. e Not determined.
84 (Figures 2.3 and 2.5). Unlike the plasmatocyte population, lamellocytes responded
differently (Figure 2.5). Overexpression of dl showed no effect on lamellocyte
production. In contrast, overexpression of Dif promoted lamellocyte production and its
effect was similar to that of a Tl10B transgene. These results indicate that dl and Dif share a similar function in plasmatocyte production, and that Dif is likely to be a sole factor for lamellocyte production in the Tl pathway.
2.4.9 Dif function can replace dl in hematopoiesis
To investigate how coordinately dl and Dif function in hematopoiesis, we examined effects on hemocyte production by overexpressing Tl10B and both dl and Dif
simultaneously. We found that dl may be dispensable in the production of both
plasmatocytes and lamellocytes when there were enough Dif proteins around.
Furthermore, the activation of Tl signaling by Tl10B, a constitutively active form of the Tl
receptor, showed an additional effect on plasmatocyte production compared to those by
the simultaneous expression of dl and Dif.
We overexpressed dl and Dif simultaneously with the CgGAL4 driver and
estimated the total hemocyte number and the proportion of lamellocytes in the total
hemocyte population (Table 2.3). Even though dl and Dif showed significant effects on
hemocyte production when they were individually overexpressed, they did not show any
synergistic effect when they were induced at the same time. We applied ANOVA to
analyze our date set presented in Table 3, and Bonferroni’s multiple comparison test was
used to measure the significance of the differences among the UAS transgene 85 Figure 2.5: Plasmatocyte and lamellocyte populations induced by different UAS transgenes with the CgGAL4. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages.
86 combinations. When both genes were expressed together, the total hemocyte counts did not differ from those when Dif was overexpressed by the CgGAL4 driver, but were statistically higher than those when dl was overexpressed by the same driver (P < 0.01 in
Bonferroni’s test). Thus, Dif is sufficient to represent the effect of the dl and Dif double expression combination, and dl did not suppress the effect of Dif.
As far as lamellocyte production is concerned, the combination of dl and Dif showed the highest lamellocyte estimate among all constructs tested including UAS-Tl10B.
Although a statistical test could not be applied, the differences among the constructs seemed to be marginal, indicating that the effect of dl on lamellocyte production may be small, if there is any. Taken together, dl only plays a minimal role in hematopoiesis when both dl and Dif are highly induced.
In order to verify whether the dl-Dif double combination represents the activation of the Tl pathway, we overexpressed a UAS-Tl10B transgene with the CgGAL4 driver.
While lamellocyte production appeared to be very similar to that of a dl–Dif double combination, the overexpression of Tl10B exhibited the most pronounced effect on plasmatocyte production among all the combinations used in this study (Figure 2.5). The results indicate that there are abundant Dl and Dif proteins in the CgGAL4 expressing cells and that these transcription factors can fully respond to the activation of the Tl pathway, i.e., the overexpression of Tl10B. It is also possible that the activation of the Tl receptor may stimulate plasmatocyte production, in part bypassing the Dl and Dif transcription factors. This possible bypass indicates that the Tl receptor might use a different set of transducers and transcription factors to control plasmatocyte production. 87 Alternatively, the differences might be due to the different levels of UAS transgene expression.
2.5 Discussion
We have demonstrated that the mutation of the lwr gene, which encodes a
SUMO-conjugating enzyme, causes the activation of Rel-related proteins, Dl and Dif, and leads to overproduction of larval hemocytes in D. melanogaster. Our genetic analysis also indicates that dl and Dif have different functions in larval hematopoiesis.
2.5.1 The lwr mutation leads to the activation of Rel-related proteins in Drosophila larval hemocytes
Our immunochemical and genetic analyses indicate that the lwr mutation results in the activation of Dl and Dif primarily in plasmatocyte and prohemocytes, leading to overproliferation of plasmatocytes and lamellocytes in larvae. Dl nuclear localization in the lwr mutant hemocytes was observed as frequently as those in the Tl10B mutant
hemocytes (Figure 2.4A). The high hemocyte counts of the lwr mutant larvae were
almost completely suppressed by removing both dl and Dif functions from the lwr mutant
background (Table 2.1). Therefore, the present study proposes that the wild type lwr
function negatively regulates the activity of the Tl pathway and/or the pathways of Tl-like
genes.
What is a possible molecular mechanism of this regulation? The Lwr protein can
regulate activities of its target proteins by conjugating SUMO molecules. For example, 88 the human Cact homologue, IB, is known to be sumoylated, and the sumoylated IB molecules were shown to be resistant to ubiquitination because the ubiquitination sites on
IB are occupied by SUMO molecules (Desterro et al., 1998). In other words, sumoylation stabilizes IB, which in turn represses NF-B activity. Alternatively, their physical associations alone can control physiological functions of Lwr’s targets.
Recently, the Paired-like homeobox protein Vsx-1 was reported to physically interact with Ubc9 (the vertebrate Lwr homologue) and to require Ubc9 function for Vsx-1’s nuclear localization. However, sumoylation of the Vsx-1 protein was not detected
(Kurtzman and Schechter, 2001). In this case, physical association with Ubc9 itself is a key for Vsx-1 function.
In the Tl (or Tl-like) pathway of Drosophila, the above two different mechanisms
are possible (Figure 2.6A, B). The Dl protein was shown to physically interact with Lwr
and to be sumoylated in a transfection experiment using Schneider L2 cells. Sumoylated
Dl proteins dissociated from Cact and entered the nucleus, where they exhibited an
increased level of transactivation (Bhaskar et al., 2000, 2002). However, this model does
not fit our observations that showed a higher incidence of Dl nuclear localization in lwr
mutant hemocytes than in wild type hemocytes (Figure 2.4A).
Another possible target protein is Cact (Figure 2.6). As in IB, the Cact protein
was shown to physically associate with Lwr (Bhaskar et al., 2000). Unlike IB,
sumoylated Cact proteins were not detected in the same study. However, physical
association of Lwr and Cact might stabilize Cact proteins in the cytoplasm by
counteracting ubiquitination or phosphorylation, a prerequisite for ubiquitination of Cact
(Reach et al., 1996). In this scenario, the loss of lwr function would make Cact be 89 Figure 2.6: Models of the Lwr-Cact interaction. These models show how the Lwr protein possibly interacts with its targets using the Cact protein as an example. Model in (A) represents interaction via SUMO conjugation, and Model in (B) represents simple physical interference. For simplicity, either Dl or Dif is depicted in each model, and each model can be applied to both Dl and Dif. In lwr mutants, Cact becomes more susceptible for ubiquitin-mediated degradation in the cytoplasm (two paths in the middle), which leads to the activation of Dl and Dif downstream genes in the nucleus. Letter K on the Cact protein represents a lysine residue that can be modified by both SUMO and ubiquitin. Panel C shows different roles of Dl and Dif in Drosophila larval hematopoiesis.
90 susceptible to degradation, which results in migration of Dl and Dif to the nucleus
(Figure 2.6B). Other components in the Tl pathway could be regulated similarly, although they have not been reported to interact with Lwr. These possibilities are under study in our laboratory.
2.5.2 Loss of lwr function does not affect nuclear transport of Dl protein in hemocytes
Our previous study demonstrated that lwr function was required for the Ran- dependent nuclear transport system (Epps and Tanda, 1998). This raises a question of how efficiently Dl and Dif proteins are transported to the nucleus in lwr mutant hemocytes. Our observations indicate that nuclear import of Dl and Dif was not overly impaired. These contrary observations can be explained by functional redundancy of lwr with 25 other Drosophila E2 enzymes. Since functions of most E2 enzymes have not been clearly defined, some of them may be SUMO conjugases. This possibility was also suggested in the embryo, particularly in the posterior half of the embryo in the previous study (Epps and Tanda, 1998). Alternatively, the residual lwr function may be sufficient to mediate nuclear import of Dl proteins because we used hypomorphic lwr alleles in this study. In any case, a possible negative effect on nuclear transport appeared minimal in lwr mutant hemocytes.
2.5.3 Dif and dl play different roles in hemocyte production
The loss of dl function in the lwr mutant background resulted in a reduction of plasmatocyte, not lamellocyte counts (Table 2.1), and the overexprssion of dl with the
CgGAL4 driver stimulated plasmatocyte production only (Table 2.3). Therefore, the role 91 of dl in hematopoiesis is limited to plasmatocyte production (Figure 2.6C). Although dl
plays a role in plasmatocyte production in the wild type background, the contribution of
dl to plasmatocyte production seems minimal when Dif is overexpressed (Table 2.3). In
other words, Dif can replace dl function in Drosophila hematopoiesis.
On the other hand, Dif is capable of stimulating the production of both
plasmatocytes and lamellocytes (Figure 2.6C). Because the loss of Dif function in the lwr
mutant background led the lamellocyte population to a level very close to those of wild
type strains (Table 2.1), Dif is most likely to play an essential and sole role in lamellocyte
production when the Tl signaling is activated by the lwr mutation. Furthermore, when Dif
was overexpressed by the CgGAL4, the levels of plasmatocytes and lamellocytes were
similar to those reached when Tl10B was overexpressed by the same driver. Taken
together, we conclude that Dif is necessary and sufficient to promote the production of
plasmatocytes and lamellocytes in larvae in the Tl (Tl-like) pathway. This also means that
Dl-responsive genes can be regulated by Dif.
We hypothesize that the genes for plasmatocyte production can be divided into at least two classes. The first class consists of genes regulated primarily by Dl. The genes in this class can be stimulated by Dif in the absence of Dl. It is known that Dl proteins bind to more strictly defined B sites than Dif, and that Dif can bind more broadly to B consensus sequences including Dl-binding sites (Engstrom et al., 1993; Gross et al.,
1996; Han and Ip, 1999; Petersen et al., 1995). Several humoral immunity genes were found to belong to this class (Engstrom et al., 1993; Gross et al., 1996). Thus, it is possible that such genes exist among genes essential for plasmatocyte production. The 92 other class includes genes regulated only by Dif. In these genes, consensus B sites are
probably responsible for their expression via the Dif protein.
The Dl protein can function as a repressor in a context-dependent manner (Huang et al., 1993; Jiang et al., 1993; Kirov et al., 1993; Markstein et al., 2002). A good example in the Drosophila immunity is the Cecropin gene, whose expression depends
heavily on Dif (Engstrom et al., 1993). Co-expression of Dl expression along with Dif
strongly repressed the expression of the Cecropin gene. However, we did not observe any
significant dominant negative effect of dl on plasmatocyte production in our
overexpression experiments (Table 2.3). At the same time, we did not observe any
synergistic effect on plasmatocyte production when both dl and Dif were co-expressed
(Table 2.3). Therefore, regulatory mechanisms of plasmatocyte-specific genes are not so
complex.
2.5.4 Plasmatocytes can proliferate upon the activation of Dl and Dif
The collagen IV (Cg25C) gene, whose promoter was used for the CgGAL4 driver,
is expressed in embryonic and larval hemocytes (Yasothornsrikul et al., 1997). These
larval hemocytes are most likely plasmatocytes, although the authors of the study did not
distinguish plasmatocytes and prohemocytes. Nonetheless, our results show that these
Cg25C-expressing hemocytes are capable of proliferating and differentiating into
plasmatocytes when Dl and Dif is activated. It was surprising that the CgGAL4 driver
induced a relatively large number of lamellocytes because this driver is not capable of
inducing GAL4 in lamellocytes (Asha et al., 2003) and because the collagen IV gene is
expressed primarily in plasmatocytes. This can be interpreted in two different ways. The 93 first one is that the Cg25C gene is expressed in lamellocyte precursors in the lymph gland, where these precursor cells can divide. In addition to different cell types distinguished by their morphologies, the cells in the lymph gland can be classified based on expression of different genes. For example, the Posterior Signaling Center, which is important for crystal cell differentiation, was defined as Serrate-expressing cells in the first lobe of the lymph gland (Lebestky et al., 2003). Thus, it is conceivable that the
Cg25C gene might be expressed in the cells that have not been clearly defined in the lymph gland. The second interpretation is that plasmatocytes can differentiate into lamellocytes when Dif are highly activated. This interpretation supports a classical view of lamellocyte differentiation (Rizki and Rizki, 1984). Further investigations are necessary to answer these questions. 94
Chapter 3: Lesswright regulates Drosophila larval hematopoiesis through direct
interaction with Dorsal and Dif
95
3.1 Summary
Mutations of the Drosophila SUMO conjugase Lwr lead to overproliferation of larval hemocytes by activating the Rel-family transcription factors Dl and Dif (Huang et al., 2005). The activation is characterized by a more than 10-fold increase in hemocytes and a high incidence of Dl nuclear staining in lwr mutants. Since typical sumoylation sites are present in Dl and Dif, I explored the effects of direct interactions between Lwr and Dl and between Lwr and Dif. Together with Jinu Abraham, I generated transgenic flies with mutant forms of Dl and Dif, whose lysine residues in the sumoylation consensus sequences were changed to alanine (KA mutant) or arginine (KR mutant) residues. Genetic analysis using flies expressing wild type and mutant forms of the transcription factors showed that co-overexpression of lwr and wild type Dif, but not mutant Dif, caused a decrease in hemocytes, while co-overexpression of lwr and wild type dl, but not mutant dl, caused an increase in hemocytes. Mutant forms of Dl and Dif cannot be sumoylated; therefore, lwr directly regulates Dl and Dif functions by sumoylation. Sumoylation of Dif suppresses hemocyte proliferation and induces hemocyte apoptosis in larvae overexpressing Dif. In contrast to Dif, sumoylated Dl protects hemocytes from apoptosis. Furthermore, unsumoylated Dif and sumoylated Dl are potent in stimulating lamellocyte production. Dual-Luciferase reporter assays were performed to investigate the SUMO-dependent activity of Dif at the transcriptional level.
Several B-site-containing promoters were analyzed. As in my in vivo analysis, sumoylation suppressed the transcriptional activity of Dif. More importantly, my results strongly suggest that the effects of sumoylation were promoter dependent. For some 96 promoters, e.g. the Drosomycin promoter, the expression of the reporter gene was
repressed by sumoylation of Dif, whereas for other promoters the expression remained
the same regardless of Dif sumoylation. The different responses of various promoters to
sumoylation of Dif suggest an interesting regulatory mechanism. In the context of
Drosophila hematopoiesis, hemocyte proliferation and differentiation might be regulated
in a complex manner. I propose two possible models to illustrate how sumoylation could
affect transcription.
3.2 Introduction
Drosophila hemocytes play an essential role in cellular immune response and
larval development (Lavine and Strand, 2002; Meister and Lagueux, 2003; Meister,
2004). Therefore the production of hemocytes must be tightly regulated during
Drosophila development. Of the three functional hemocytes, the phagocytic
plasmatocytes constitute more than 95% of the total circulating hemocytes. The
remaining hemocytes are crystal cells and lamellocytes, which normally play roles in
melanization and encapsulation of parasitoid wasp eggs, respectively (Rizki and Rizki,
1984; Lanot et al., 2001; Sorrentino et al., 2002). Another type of hemocyte, the prohemocyte, is found in the larval lymph gland and, rarely, in the hemolymph. It is proposed that all of the functional hemocytes differentiate from prohemocytes, the
Drosophila hematopoietic stem cells (Lanot et al., 2001).
The signaling pathways that control hemocyte production, such as the Toll (Tl) and JAK/STAT pathways, are well conserved among higher eukaryotes (Harrison et al., 97 1995; Luo et al., 1995; Luo et al., 1997; Qiu et al., 1998). Once activated, these pathways stimulate hemocyte proliferation and differentiation. For example, T110B, a dominant
mutation of Tl, produces ten times as many hemocytes as the wild type larvae. In these
larvae, a large number of lamellocytes differentiate even without immune challenge (Qiu et al., 1998; Huang et al., 2005).
The Tl pathway, which is homologous to the mammalian NF-B signaling
pathway, was found to be involved in dorsal-ventral axis formation during Drosophila
embryogenesis as well as humoral immune response (Gerttula et al., 1988; Steward and
Govind, 1993; Lemaitre et al., 1996; Hoffmann, 2003). Key components of the pathway
include the membrane receptor Tl, the inhibitor Cact, and the Rel-related transcription
factors Dl and Dif. A crucial step of Tl signaling activation is the degradation of the
inhibitor Cact. Because Cact sequesters Dl and Dif in the cytoplasm, degradation of Cact
releases Dl and Dif to enter the nucleus and activate transcription. Both of them can bind
to a cis-element called the B site. Most of the antimicrobial peptide genes contain B
sites in their 5’ regulatory regions; hence, Dl and Dif can control the expression of these genes (Engstrom et al., 1993; Ip and Reach, et al, 1993; Meng et al., 1999). Dl and Dif
also play important roles in hemocyte production. Dl is capable of stimulating
plasmatocyte production, whereas Dif is capable of stimulating plasmatocyte and lamellocyte production. Thus, effective hemocyte production may require both dl and Dif
functions, although Dif function alone might be sufficient for the production of
plasmatocytes and lamellocytes (Huang et al., 2005). In canonical Tl signaling, Cact
degradation activates both Dl and Dif. However, it is not clear whether or how Dl and Dif
stimulate plasmatocytes and lamellocytes production differently. 98 In my previous study I found that the loss of lwr function in larval hematopoietic
tissues activates Dl and Dif in the Tl pathway, leading to overproduction of hemocytes
(Huang et al., 2005). In the lwr mutant hemocytes, a high incidence of Dl nuclear localization was observed. Loss-of-function mutations of dl and Dif were found to be suppressors of the lwr mutation. When both dl and Dif functions were lost the number of hemocyte in the lwr mutant larvae returned to wild type level. Thus, the loss of lwr function leads to the activation of Dl and Dif and thus causes hematopoietic defects.
Since both Cact-degradation-dependent and Cact-degradation-independent activation of
Dl and Dif have been reported (Bergmann et al., 1996; Wu and Anderson, 1998; Cantera et al., 1999; Drier, Govind and Steward, 2000; Bhaskar et al., 2000), I reasoned that the wild type lwr function regulates Dl and Dif activation by protecting Cactus from degradation or by interacting directly with Dl and Dif or by both.
Lwr is a conjugase for the small ubiquitin-like modifier (SUMO). Recent studies in yeast, fruit flies and mammals have demonstrated that sumoylation plays important regulatory roles in diverse cellular processes (Melchior, 2000; Yeh et al., 2000; Muller et al., 2001). Like ubiquitination, sumoylation requires a set of three enzymes: the activating enzyme (E1), the conjugating enzyme (E2/Lwr), and the SUMO ligase (E3). The mature
SUMO molecule is covalently ligated to the lysine residue through an isopeptide bond within the sumoylation consensus sequence, KxE where stands for a large
hydrophobic residue and x stands for any amino acid residue. Interestingly, sumoylation
consensus sequences are present in both Dl and Dif, and Dl sumoylation was reported
(Bhaskar et al., 2000; Bhaskar et al., 2002). All this information warrants investigation of
the functional significance of Dl and Dif sumoylation in Drosophila hematopoiesis. 99 The results in this chapter reveal a complex regulatory mechanism of Tl signaling
by lwr in hemocyte number. In addtion to its protective role in Cact degradation, Lwr
modulates the activities of Dl and Dif via sumoylation. Sumoylation has opposite effects on Dl and Dif functions. Dl sumoylation leads to an increase in the total number of circulating hemocytes, which is probably caused by the suppression of hemocyte apoptosis. Furthermore, sumoylated Dl stimulates lamellocyte differentiation. This function was not observed in my previous experiments (Huang et al., 2005). Distinct from Dl, sumoylation of Dif suppresses its activity in hemocyte production and results in a low level of hemocyte proliferation. Sumoylated Dif can also induce hemocyte apoptosis. In addition, sumoylation suppresses Dif-mediated lamellocyte differentiation.
Overexpression of Dl and Dif with or without co-expression of Lwr in Drosophila S2
cells showed similar results. I demonstrated that sumoylation affects Dif function at the transcription level. Regulation of Dif transcriptional activity by sumoylation is promoter dependent. These findings may suggest a new regulatory mechanism of sumoylation.
3.3. Materials and methods
3.3.1 Drosophila culture conditions and stocks
Flies were cultured in JAZZ mix (Fisher Scientific) supplemented with inactive brewer’s yeast (SAP Product Corporation) and soy flour (ADM). JAZZ mix was cooked in a steam kettle according to the manufacturer’s instructions. The stocks were maintained at room temperature, and the experiments were conducted in uncrowded conditions at 25°C. 100 Hypomorphic alleles of lwr, lwr4-3, and lwr5, were introduced to lethal free
backgrounds of P{neoFRT}40A and b1 cn1 bw1, respectively, in order to minimize effects
of unwanted hidden mutations linked to these lwr alleles (Sun et al., 2003). The deficiency Df(2L)J4 is associated with a small, cytologically-invisible deletion at 36C8-9
(Meng et al., 1999), and the deficiency Df(2L)TW119 deletes a small section between
36C4-2 and 36E1. These deficiencies remove both the dl and Dif genes and were used to create the dl Dif double mutant combination.
Because Dif mutations are viable and do not exhibit visible phenotype, a DD1 transgene were used to screen for Dif loss-of-function mutations (Rutschmann, and Jung, et al, 2000). The DD1 stock contains a Drosomycin promoter-driven Green fluorescent protein (GFP) gene and a Diptericin promoter-driven LacZ gene (P{w+mC Drom::GFP =
pDrs-GFP S65T} and P{w+mC Dipt:: LacZ = pDipt-LacZ}). Since Dif is required for the expression of Drosomycin, GFP is expressed after septic injury with the Gram-positive bacteria Micrococcus luteus in wild type flies carrying DD1. In Dif mutants, GFP is not expressed upon septic injury. The pDipt-lacZ is expressed upon septic injury, serving as a positive control.
The CgGAL4 driver and the UAS-dl lines were described previously (Asha et al.,
2003; Huang et al., 2005)). The UAS-Dif line was a generous gift from Y.T. Ip. The UAS-
lwrWT lines were gifts from S. Ohsako. Other fly stocks used in this study are described in
FlyBase (http://flybase.bio.indiana.edu/). 101 3.3.2 Transgenics
The UAS-DifK435A and UAS-DifK435R transgene constructs (see section 3.3.4) were
amplified on a large scale and purified using MAXI Prep kit (Qiagen). DNA was
resuspended in doubly distilled water at a concentration of approximately 500 g/ml. We used the y w; Sb, P{2-3}99B/ TM6 stock as host (Robertson et al., 1988). Germline
transformation was performed as described (Spradling, 1986; Sullivan et al., 2000).
3.3.3 Site-directed Mutagenesis
The QuickChange Site-directed mutagenesis (SDM) Kit (Stratagene) was used to
mutate the sumoylation consensus sequence of Dif. The Dif mutants were constructed by
replacing lys435 with an alanine or an arginine residue. The template for Dif SDM is
pNB40-Dif, a cDNA library vector containing a full-length cDNA of wild type Dif. The
reactions were performed according to the manufacturer’s instructions. For each reaction,
about 10 ng of double stranded DNA template were used. The primer sequences for
mutagenesis are listed as follows:
For DifK435A:
5'--- GTGCAGGATATCGCGATGGAGAATGGATTCATGGATGTG ---3' and
5'--- CACATCCATGAATCCATTCTCCATCGCGATATCCTGCAC ---3'.
For DifK435R:
5'--- GCAGGATACAGGATGGAGAATGGATTCATGGATG ---3' and 5'---
CATCCATGAATCCATTCTCCATCCTGATATCCTGC ---3' 102 The introduced mutations were confirmed by sequencing.
3.3.4 Plasmid constructs
pUAST vectors
UAS-DifK435A, UAS-DifK435R constructs: Mutations were introduced to a full-length
Dif cDNA in the pNB40-Dif vector (see section 3.3.3). The cDNA was excised with the restriction enzymes BglII and NotI. This fragment was then cloned into the pUAST vector between the BglII and NotI sites.
pPac expression vectors
pPacFLAG-Dif, pPacFLAG- DifK435A and pPacFLAG-DifK435R: Coding region of
wild type Dif without the first ATG codon was PCR amplified and cloned into the pCRII-
TOPO vector. KpnI and SacI sites were introduced to 5’ and 3’ ends of the Dif coding
region respectively. The Dif fragment was excised with KpnI and SacI and cloned into
the pPacFLAG vector (a gift from A.J. Courey) between the KpnI and the SacI sites. The
other two Dif constructs, pPacFLAG- DifK435A and pPacFLAG-DifK435R, are constructed
using similar methods. Mutagenized pNB40-Dif constructs (described in section 3.3.3)
were used.
pPacFLAG-lwr: The coding region of lwr without the start ATG codon was
amplified with LA PCR and cloned into the pCRII-TOPO vector. BamHI and KpnI sites
were added at the 5’ and the 3’ ends of the lwr coding region respectively. A BamHI-
KpnI fragment was excised from pCRII-lwr and cloned into the pPacFLAG vector. 103
pRL-Act5C and pGL3-Hsp70 vectors for Dual-Luciferase assay
In order to use the Dual-Luciferase reporter assay system in Drosophila S2 cells, some modifications were made to the commercial pRL-null and pGL3 Basic vectors
(Promega).
pRL-Act5C: The Drosophila actin 5C promoter (Act5C) of the pPac vector was cloned into the pRL-null vector. The pPac vector was digested with the restriction enzyme BamHI. Then the sticky end was filled in with Klenow fragment. The filled-in vector fragment was digested again with EcoRI. This Act5C fragment was inserted into the pRL-null between the EcoRI and the SmaI sites.
pGL3-Hsp70: The minimal promoter of the Drosophila Hsp70 gene
(Hsp70TATA) was cloned into the pCRII-TOPO vector by PCR. BglII and HindIII sites were introduced to the ends of the Hsp70TATA. The Hsp70TAT was excised from the pCRII-TOPO vector with restriction enzymes BglII and HindIII and inserted into the pGL3-Basic vector treated with the same restriction enzyme pair.
Reporter assay vectors (pGL3-Hsp70-x): The promoter regions of 26 genes
(Appendix C) were amplified by LA PCR and cloned into the pCRII-TOPO vector. Three strategies were used to clone these promoter sequences into the pGL3-Hsp70 vector. If the cloned sequence was in the same 5’ to 3’ orientation in the pCRII-TOPO vector as in its native chromosome, the promoter sequence was excised with KpnI (or SacI) and XhoI.
The excised fragment was cloned into pGL3-Hsp70 between the KpnI (or the SacI) and 104 the XhoI sites. If the cloned sequence was in the reverse 5’ to 3’ orientation in the pCRII-
TOPO vector as in its native chromosome, the promoter sequence was excised with
BamHI and XbaI and cloned into pGL3-Hsp70 between the BglII and the NheI sites. NheI
and XbaI, BglII and BamHI share compatible ends. Since BamHI is upstream of XbaI in
the pCRII-TOPO vector sequence and BglII is downstream of NheI sequence, the ligation
would orient the promoter sequence into its native orientation. A third strategy was used
if the above two methods were not applicable. The pCRII vectors were digested with
KpnI, filled in with Klenow Fragment and digested again with XbaI. This half sticky-end
half blunt-end fragment was inserted between the NheI and the SmaI sites of the pGL3-
Hsp70.
3.3.5 Genotyping larvae
Genotypes of larvae homozygous for a given second-linked mutation were
determined using the CyO balancer with a yellow+ ( y+) transgene in a y background. The
mutant larvae were distinguished by a lesser degree of pigmentation of the
cephalopharyngeal skeleton than those of heterozygous siblings. Alternatively, the CyO
balancer with a Kr-GFP transgene was used. A similar approach was used on the third-
linked mutations using the TM6B balancer with Tubby (Tb), or the TM3 balancer with an
actin-GFP transgene. The presence of GFP in larvae was monitored using a Nikon
SMZ1000 stereoscopic microscope equipped with an epi-fluorescent apparatus. In a few
cases, the translocation balancer T(2;3)CyO; TM6B was used as a 2nd chromosome and 105 3rd chromosome double balance. T(2;3)CyO; TM6B carries a dominant mutation, Tb, which can be used for genotyping.
3.3.6 Hemocyte counting
Egg collection was done daily, and the larvae were raised to the mid/late third instar stage. Feeding larvae with still-retracted anterior spiracles were harvested and used for this study. They are presumed to be those before receiving the first pulse of ecdysone, which triggers wandering behavior and stimulates hemocyte production. We found that variations in total blood cell counts were much larger among wandering larvae than feeding larvae.
Hemocytes were counted using a hemacytometer, and the total hemocyte counts were presented as the number of hemocytes per milliliter of hemolymph. Larvae were rinsed well in water and blotted on Kimwipes to remove excess water before bleeding. A small incision was made near the posterior spiracles and the hemolymph was directly loaded on a hemacytometer. After placing a coverslip over the hemolymph, all hemocytes but crystal cells were counted using differential-interference-contrast (DIC) optics at a magnification of 200.
3.3.7 Statistical tests
Averages of hemocyte counts were compared by t test. In most cases, we evaluated the differences between experimental genotype and corresponding internal control by t test. 106 3.3.8 Histological procedures
For a Giemsa-stained blood smear, the hemolymph was bled directly into a drop of 2 l of PBS on a glass slide, spread using a pair of forceps and dried. The blood smear was fixed in 100% methanol for 5 min and stained for 20 min in 10% Giemsa stain
(Sigma) in water. The specimens were rinsed in water for a few minutes and destained in
2 10-4 N HCl for 75 s. After being rinsed in water, the blood smear was air-dried and mounted in Permount (Fisher Scientific).
Immunohistochemistry on hemocytes was carried out on the cells smeared on a coverslip. The cells were first dried for 20 min and fixed in 3.7% formaldehyde/PBS at room temperature. The specimens were washed for 3 min four times in PBS. The cells were then permeabilized in 0.1% Triton X-100/PBS for 5 min and washed for 3 min three times in PBS. After permeabilization, the cells were incubated in 5% normal goat serum/PBS (blocking solution) for 30 min at room temperature. Antibodies were diluted in the blocking solution, and hemocytes were incubated with primary antibodies overnight at 4°C in a moist chamber. The specimens were washed for 10 min five times at room temperature in PBS and then incubated for 1 h at room temperature with secondary antibodies diluted in the blocking solution. The cells were washed for 10 min 5 times at room temperature and mounted with Prolong (Molecular Probes). Antiphospho-
Histone H3 antibodies (1 g/l, Upstate) were diluted 200-fold. Secondary antibodies conjugated with either Alexa Fluor 594 (Molecular Probes) were diluted either 500- or
1000-fold.
Acridine Orange (AO) staining was used to detect apoptosis of hemocytes. Larvae were bled directly onto the hemacytometer. AO stock solution (10 mg/mL) was diluted 107 2000-fold into PBS. For each hemolymph specimen, 2 L of the diluted AO solution were applied directly. A glass colverslip was placed over the hemacytometer. After 5 minutes incubation in the dark, the specimen was observed with a Nikon Optiphot-2 microscope equipped with an epi-fluorescent apparatus. Apoptotic cells have a bright
nuclear staining.
3.3.9 Cell culture, transfection procedures and western blot
Drosophila Schneider L2 cells (S2 cells) were cultured in Drosophila-SFM serum
free media (GIBCO) supplemented with L-glutamine (GIBCO), antibiotic and
antimycotic on an orbital shaker at 27.5°C. Cells were subcultured every 4 days and the
4th day cells were used for transfection. I use CellFECTIN reagent (Invitrogen) for
transfection. For each transfection, 1 106 cells were transfected with 1 g plasmid DNA
respectively. Cell are cultured on an orbital shaker at 27.5°C for 36-48 hours and
harvested for experiments.
For western blots, S2 cells were spun down and resuspended with resuspension
buffer (ice cold 1 PBS with 10 mM NEM, 10 mM Idoacetamide, PMSF and protease inhibitor cocktail). Cells were lysed with SDS sample buffer supplemented with DTT.
Cell lysates were heated in a boiling water bath for 10 minutes. 25 l of the cell lysate
were used for SDS PAGE (7.5% gel). Anti-FLAG monoclonal antibody (1 to 10,000
dilution; Sigma) and Anti-PolyHistidine monoclonal antibody (1 to 3000 dilution; Sigma)
were used in the western blot. 108 S2 cell viability was monitored by staining with Trypan Blue (Sigma) for 10 min
and observation under a microscope with DIC optical. Each experiment is repeated three
times.
3.3.10 Dual-Luciferase assays
Dual-Luciferase assays were performed according to manufacturer’s instructions
(Promega). For each assay, 0.5 106 cells were co-transfected with 20 ng of pGL3-
Hsp70 construct, 1 ng of pRL-Act5C construct and 0.5 g of pPac constructs (when needed). Cells were harvested 40 hours after transfection. For each construct, 3 or 2 replica assays were performed.
3.4 Results
3.4.1 Overexpression of wild type lwr in the larva hematopoietic tissues induces overproduction of hemocytes
To further characterize the wild type function of lwr in hematopoiesis, I took a different strategy from the previous chapter. Instead of investigating lwr loss-of-function mutations, I overexpressed UAS-lwrWT in the lymph gland and hemocytes using the
CgGAL4 driver. The CgGAL4 driver expresses the GAL4 transcription factor in the larval
lymph gland and hemocytes (Asha et al., 2003). Since the lwr mutation leads to
overproduction of larvae hemocytes possibly by making Cact susceptible to degradation,
I expected lwr overexpression would suppress Cact-degradation-dependent activation of 109 Dl and Dif and thus would cause a decrease in hemocyte number. To my surprise, I
observed an increase of hemocyte number compared to wild type controls (Table 3.1). In
the UAS-lwrWT2/CgGAL4 larvae, the total hemocyte number reached 25.3 106 per ml of
hemolymph, which is comparable to lwr loss-of-function mutants and Tl10B mutants.
Overexpression of another UAS-lwrWT line (UAS-lwrWT1, on the X chromosome) with the
CgGAL4 driver also stimulated significant increase of hemocyte counts when compared
to the wild type controls (P < 0.01). The different levels of hemocytes are probably due to
the position effect of different UAS transgenes. Lamellocyte differentiation was also stimulated in the UAS-lwrWT1/CgGAL4 and the UAS-lwrWT2/CgGAL4 larvae. The
lamellocyte percentages of UAS-lwrWT2/CgGAL4 (15.8%) and UAS-lwrWT2/CgGAL4 larvae (7.5%) are lower than that of the lwr mutants (27.5%), but are comparable to that of the Tl10B mutants (7.9%). The mitotic index of the UAS-lwrWT2/CgGAL4 hemocytes is
4.54%, which indicates that the lwr-expressing hemocytes are dividing in circulation.
These results strongly suggest that overexpression of lwr stimulates hematopoiesis in a
manner similar to the activation of the Tl signaling pathway.
Either loss-of-function mutations of lwr or overexpression of wild type lwr can stimulate hemocyte production. What would be the mechanism for this phenomenon?
One possible explanation is that, as a SUMO conjugase, Lwr may regulate hemocyte production through pathways other than the canonical Cact-degradation-dependent Tl
pathway. As reported previously, Lwr can promote Cact-degradation-independent Dl
nuclear localization in the Drosophila S2 cells (Bhaskar et al., 2000). Overexpression of
wild type lwr in the S2 cells caused accumulation of Dl in the nuclei even with co-
overexpression of Cact, suggesting that sumoylation of Dl triggers the release of Dl from 110 Table 3.1: Effects of dl and Dif mutants on lwrWT transgene induced hemocyte production
Total hemocyte ± %Lamellocyte ± SDa SDa ( 106/ml of Genotype hemolymph)
UAS-lwrWT2/CgGAL4b 25.3 ± 11.60 (18) d 7.5 ± 2.95 (5)
UAS-lwrWT1; CgGAL4c 10.2 ± 1.31 (6) d 15.8 ± 4.17 (5)
UAS-lwrWT1; CgGAL4 Df(2L)J4/Df(2L)TW119c 2.8 ± 0.72 (12) e, f 2.1 ± 3.04 (5)
UAS-lwrWT1; dl1/ CgGAL4 Df(2L)J4c 6.9 ± 1.36 (12) d, f 33.4 ± 9.50 (5)
UAS-lwrWT1; Dif2/ CgGAL4 Df(2L)J4c 17.8 ± 5.08 (18) d, f 27.9 ± 3.22 (5)
Oregon-R* 2.1 ± 1.08 (35) 0.5 ± 0.66 (2)
Canton-S* 4.1 ± 1.54 (35) 1.0 ± 1.26 (15)
Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. The deficiencies Df(2L)J4 and Df(2L)TW119 delete both the dl and Dif genes. a Standard deviation. b UAS-lwrWT2: UAS transgene on the 2nd chromosome. c UAS-lwrWT1: UAS transgene on the X chromosome. d Statistically significant different from wild type (P < 0.01). e Statistically insignificant different from wild type. f Statistically significant different from UAS-lwrWT1; CgGAL4 (P < 0.01). * Data from Huang et al., 2005. 111 Cact. In hemocytes overexpressing lwr, Dl is evenly distributed in the cytoplasm and nucleus (Jinu Abraham, personal communication), which suggests some free Dl is in the nucleus. Therefore, I attributed the overproduction of hemocytes with excess lwr to the
activation of Dl and possibly Dif even in the presence of Cact.
To determine whether overexpressed lwr stimulates hemocyte production through
activation of Dl and Dif, I overexpressed wild type lwr in dl and Dif single as well as
double mutant backgrounds (Table 3.1). To remove both dl and Dif, I used the
deficiencies Df(2L)J4 and Df(2L)TW119; both of them delete dl and Dif (see chapter 2).
When lwr was overexpressed in the dl and Dif double mutant background [UAS-lwrWT1;
CgGAL4 Df(2L)J4/Df(2L)TW119], the total hemocyte number almost returned to the wild
type level. Very few lamellocytes were observed (Figure 3.1). These results suggest that
overexpressed wild type lwr leads to overproduction of plasmatocytes and lamellocytes primarily through activating Dl and Dif.
As previously demonstrated, dl and Dif loss-of-function mutations are suppressors of the lwr mutation (Huang et al., 2005). The dl mutation suppressed plasmatocyte
production in the lwr mutants, whereas the Dif mutation suppressed both plasmatocyte
and lamellocyte production. I did similar experiments to examine the effects of either the
dl or Dif single mutation on hemocyte production in larvae overexpressing wild type lwr.
The results strongly suggest a more sophisticated regulatory mechanism of hemocyte
production by lwr functions. The dl mutation significantly reduced the level of
plasmatocyte production caused by lwr overexpression (Table 3.1). The total hemocyte
counts of the UAS-lwrWT1; dl1/CgGAL4 Df(2L)J4 larvae were significantly lower than that 112 Figure 3.1: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT1 with the CgGAL4 driver in dl and Dif single or double mutant background. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages. OR, Oregon-R (wild type); CS, Canton-S (wild type); UAS-lwrWT, UAS-lwrWT1; CgGAL4 / CyO, Kr-GFP; UAS-lwrWT dl- Dif-, UAS-lwrWT1; CgGAL4 Df(2L)J4/Df(2L)TW119; UAS-lwrWT dl-, UAS-lwrWT1; dl1/CgGAL4 Df(2L)J4; UAS-lwrWT Dif-, UAS-lwrWT1; Dif2/CgGAL4 Df(2L)J4.
113 of the UAS-lwrWT1; CgGAL4/CyO, Kr-GFP larvae (P <0.01). The production of
lamellocytes was not affected. These results support my previous conclusion that dl
primarily functions as a plasmatocyte inducer (Huang et al, 2005) and that lwr
overexpression activates Dl.
Interestingly, loss of Dif function in larvae overexpressing lwr did not suppress
hemocyte production. Rather, the total hemocyte counts of the UAS-lwrWT1; Dif2/CgGAL4
Df(2L)J4 larvae were significantly higher than that of the UAS-lwrWT1; CgGAL4/CyO, Kr-
GFP larvae (P <0.01). In this case, the production of both plasmatocytes and
lamellocytes was enhanced. I previously demonstrated that Dif, but not dl, is responsible
for the production of lamellocytes (Huang et al., 2005). In the UAS-lwrWT1; Dif2/CgGAL4
Df(2L)J4 larvae, Dif function was completely removed. Since loss of both dl and Dif totally diminished the effects of lwr overexpression on hemocyte production, dl must be responsible for lamellocyte production in the UAS-lwrWT1; Dif2/CgGAL4 Df(2L)J4 larvae.
Therefore, overexpression of lwr presumably sumoylates Dl and affects its ability to participate in lamellocyte production. At the same time, loss of dl function only partially suppressed the effects of lwr overexpression, thus Dif still contributes to larval hemocyte production.
3.4.2 Lesswright regulates dl and Dif functions in hematopoiesis
Lwr is a SUMO conjugating enzyme and has been shown to affect dl and possibly
Dif functions in S2 cells (Bhaskar et al., 2000; Bhaskar et al., 2002). To test whether sumoylation would affect dl and Dif function in hematopoiesis, I, in collaboration with 114 Jinu Abraham who did the dl mutant experiments, mutated the typical sumoylation sites
in both proteins by replacing the lysine residue in the sumoylation consensus with
arginine (DlK382R, DifK435R) or alanine (DlK382A, DifK435A) residues. I examined the functions of these mutants and wild type alleles with or without lwr overexpression. Our in vivo experiments indicate that Lwr indeed regulates dl and Dif functions via sumoylation (Table 3.2). While overexpression of wild type lwr altered the functions of both Dl and Dif, it did not affect the functions of their mutant forms. Although mutations in the sumoylation consensus sequences enhanced the transcriptional activity of both Dl and Dif, as previously described (Bhaskar et al., 2002), my results still suggest a regulatory role for Lwr on Dl and Dif functions. The different effects of sumoylation on
Dl and Dif are described in separate sections below. Since the different mutant forms
(KR and KA) of Dif (or Dl) showed similar results, I only present the DifK435R (or
DlK382R) data for simplicity. The DifK435R and DlK382R mutants are designated as Difmut and Dlmut, respectively.
3.4.3 Sumoylation of Dl causes an increase in total number of hemocyte as well as
lamellocyte percentage
I combined UAS-dl and UAS-lwrWT2 transgenes and overexpressed both
transgenes in the hemocytes and the lymph gland using the CgGAL4 driver
[CgGal4/UAS-dl UAS-lwrWT2]. When both dl and wild type lwr were overexpressed in the larvae, they produced twice as many hemocytes as larvae overexpressing dl alone. The difference was statistically significant (P < 0.01 in t test). Compared with overexpression 115 Table 3.2: Effect of dl, dlmut, Dif, Difmut and lwrWT2 transgenes on larval hemocytes
UAS transgene Controla Experimental Total hemocyte Total hemocyte %Lamellocyte ± ± SDb ± SDb SDb ( 106/ml of ( 106/ml of hemolymph) hemolymph)
lwrWT2 2.6 ± 1.23 (11) 25.3 ± 11.60 (18) 7.5 ± 2.95 (5)
dorsal* 2.6 ± 1.18 (35) 18.0 ± 4.53 (35)c 1.7 ± 0.55 (15)
dorsal +lwrWT2 2.7 ± 0.77 (24) 40.9 ± 7.32 (24)c 23.0 ± 13.38 (15)
dorsalmut ** 4.6 ± 1.65 (12) 32.0 ± 5.67 (15)d 1.2 ± 0.35 (5)
dorsalmut +lwrWT2 ** 3.1 ± 2.54 (15) 27.5 ± 8.58 (15)d N/Dg
Dif* 2.3 ± 1.25 (35) 30.8 ± 13.5 (35)e 11.7 ± 1.58 (15)
Dif +lwrWT2 2.1 ± 0.89 (24)h 14.0 ± 3.91 (24)eh 6.9 ± 2.36 (14)
Difmut 3.5 ± 1.21 (24) 89.6 ± 13.9 (24)f 17.3 ± 4.01 (10)
Difmut +lwrWT2 3.3 ± 1.19 (24) 94.1 ± 15.00 (24)f 25.2 ± 2.88 (10)
Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. All the transgenes were driven by the CgGAL4 driver. a Heterozygous larvae of mixed genotypes in culture. b Standard deviation. ceh Statistically significant differences between each other (P < 0.01). df Statistically insignificant differences between each other. g Not determined. * Data from Huang et al., 2005. ** Jinu Abraham, unpublished data. 116 of Dlmut alone, no significant increase of hemocytes was observed when Dlmut and Lwr
are co-expressed using the same GAL4 driver (P >0.05 in t test). These results indicate
that sumoylation of Dl probably enhances hemocyte production. Since overexpression of
UAS-lwrWT2 alone can cause hemocyte overproduction, it is possible that the increase in
hemocyte number is due to additive effect when I co-expressed UAS-lwrWT2 and UAS-dl.
However, this possibility is less likely because co-expression of UAS-lwrWT2 and UAS-
dlmut didn’t cause any increase in hemocyte number. The increase in hemocyte number in
this case requires the interaction between Dl and Lwr through the sumoylation consensus
sequence. It is important to note that overexpression of Dlmut produced more hemocytes
than overexpression of Dl wild type. It was previously reported that the K382R and
K382A mutations of Dl, which cannot be sumoylated, led to enhancement of Dl
transcriptional activity (Bhaskar et al., 2002). Thus the increase is most probably caused
by the mutation itself, independent of Dl sumoylation.
Sumoylated Dl also promotes lamellocyte differentiation. The number of
lamellocytes and the proportion of lamellocytes in the total hemocyte population in the
CgGal4 UAS-dl UAS-lwrWT2 larvae were much higher than that of the CgGal4 UAS-dl
and the CgGal4 UAS-lwrWT2 larvae (Figure 3.2). In contrast, co-expression of dlmut and lwrWT2 transgenes did not cause any increase in lamellocyte production when compared to
overexpression of dlmut alone (Jinu Abraham, personal communication). Dl normally does
not play a role in lamellocyte differentiation in the lwr loss-of-function mutants (Huang et al., 2005). Overexpression of UAS-dl alone has little effect on lamellocyte production
(Huang et al., 2005; Figure 3.2). However, here, I show that co-expression of dl and wild
type lwr can induce lamellocyte production, and this induction does not require Dif 117 Figure 3.2: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT2, UAS-dl, and UAS-dlmut with the CgGAL4 driver. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages. The lamellocyte percentage of CgGAL4/UAS-lwrWT2 UAS-dlmut is not determined.
118 function (see section 3.4.1). The mutation of the lysine residue in the sumoylation
consensus sequence of Dl protein abolished the Dl’s function in lamellocyte production.
Thus, I conclude that sumoylated Dl can stimulate lamellocyte differentiation.
3.4.4 Sumoylation of Dif decreases its activity in hemocyte number
I combined UAS-Dif and UAS-lwrWT2 transgenes to examine the functions of Dif
in the overexpressed lwr background. When both Dif and lwr were overexpressed using
the CgGal4 driver [CgGal4/UAS-Dif UAS-lwrWT2], the larvae produced fewer hemocytes
than larvae overexpressing Dif or lwr alone (Table 3.2), which suggests that sumoylated
Dif has an inhibitory effect on hemocyte production. This result agrees with my previous observation that the loss of Dif function led to an increase in hemocytes when lwr was overexpressed (see section 3.4.1). Co-expression of Difmut and lwr did not cause any
decrease in hemocytes compared to overexpression of Difmut alone. This result
demonstrates that the sumoylation consensus sequence is required for Dif-mediated
inhibition of hemocyte production when lwr is overexpressed, further supporting
sumoylation of Dif rather than some other mechanism causing the inhibition. Note that
even though the hemocyte number in the larvae expressing both Dif and lwr is lower than
that of the larvae expressing Dif alone, the total hemocyte number is still significantly higher than that of the heterozygous controls (Table 3.2). Therefore, Dif sumoylation does not completely suppress Dif-mediated hemocyte production.
Sumoylation also suppressed Dif mediated lamellocyte differentiation (Table 3.2 and Figure 3.3). Co-expression of lwr and Dif reduced lamellocyte production. The 119 Figure 3.3: Plasmatocyte and lamellocyte populations of larvae expressing UAS-lwrWT2, UAS-Dif, and UAS-Difmut with the CgGAL4 driver. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages.
120 lamellocyte percentage of these larvae was 6.9%, which is significantly lower than that of
the CgGal4/UAS-Dif larvae (Table 3.2). On the other hand, overexpression of lwr did not
undermine lamellocyte differentiation in the UAS-Difmut-expressing larvae (Table 3.2 and
Figure 3.3). Altogether, my results show that Dif sumoylation makes Dif less effective in both plasmatocyte and lamellocyte production.
Overexpression of UAS-Difmut in the larval hematopoietic tissues using the
CgGAL4 driver dramatically stimulated the production of plasmatocytes and
lamellocytes. The hemocyte count reached nearly 90 106 cells per ml of hemolymph
and more than 17% of the hemocytes were lamellocytes. This substantial increase might
be attributed to the loss of Dif’s ability to be sumoylated. It is also possible that similar to
Dl, the mutation of the lysine residue in the sumoylation consensus sequence itself
enhances Dif’s transcriptional activity. The position effect of different UAS insertions might play a role as well. Nonetheless, since I did pairwise comparisons of UAS-Dif vs
UAS-Dif + UAS-lwrWT2 and UAS-Difmut vs UAS-Difmut + UAS-lwrWT2, my results are
consistent with the notion that sumoylation of Dif can regulate its function.
3.4.5 Dif sumoylation
My genetic data show that Dif can be sumoylated. Biochemical detection of
sumoylated proteins is particularly difficult because sumoylation is known to be a
transient modification (Johnson, 2004). The desumoylation process happens in a short
period of time. Usually very small fractions of the SUMO target proteins are sumoylated
(Johnson, 2004; Marx, 2005). Therefore, the amount of sumoylated proteins in the cells is 121 very low. It is even more problematic to detect sumoylated Dif, since sumoylated Dif
induces cell death (see section 3.4.6). Nonetheless, I have repeatedly detected a faint
band with slower mobility than FLAG-Dif (Figure 3.4A and B). This band was present inthe cell lysate of S2 cells transfected with FLAG-Dif, His-SUMO and FLAG-Lwr expression vectors but not in the cell lysate of S2 cells transfected with FLAG-Dif
expression vector alone or with FLAG-Difmut, His-SUMO and FLAG-Lwr expression
vectors. Because the presence of this band was dependent on co-expression of SUMO
and Lwr and the wild type sumoylation consensus sequence, I conclude that this faint
band is probably the sumoylated Dif. The molecular weight of this band is about 30-40 kDa larger than FLAG-Dif. Although the molecular weight of the band is larger than expected (mono-sumoylation often adds about 20 kDa molecular weight to its target proteins), it is possible that a secondary modification such as phosphorylation
accompanied sumoylation. I attempted to detect the sumoylated Dif with anti-poly(His)
antibody. However, although I observed multiple high-molecular weight bands of
abundant proteins, sumoylated Dif was not detected (Figure 3.4C). This is probably due
to a universal SUMO modification of SUMO target proteins. Immunoprecipitation
experiments were unsuccessful. A large-scale pull-down assay targeting His-SUMO
modified FLAG-Dif is planned. My laboratory is currently trying other methods to
biochemically demonstrate sumoylated Dif proteins, such as in vitro sumoylation assays,
using RNA interference to remove SUMO protease activity, and using proteosome
inhibitors. 122 Figure 3.4: Western blot showing possible sumoylated form of Dif. (A)(B) 1 106 S2 cells were transfected with 1g each of pPacFLAG-Dif or pPacFLAG- Difmut with or without the co-transfection of pAC-His-SUMO and pPacFLAG-lwr. Cell lysates were prepared as described in the material and methods section. For each sample, 25 l of the cell lysate was loaded. Dif indicates both wild type and mutant forms of the Dif protein; Dif* indicates the modified form of wild type Dif. (C) Western blot using the anti-poly(His) antibody.
123
3.4.6 The total number of circulating hemocytes is partly determined by hemocyte
apoptosis and division
Increase in cell number happens in two ways: increase in cell division and/or decrease in cell death. Under normal circumstances, I seldom observed any dividing hemocytes in the hemolymph; the occurrence of hemocyte apoptosis was also rare (about
1%). However, in some mutants, such as lwr loss-of-function or Tl gain-of-function mutant hemocytes, a high level of cell division was observed (Huang et al., 2005).
Therefore, I examined how cell division and apoptosis are affected in the genotypes used in this study. I measured the mitotic index and the percentage of apoptotic cells of the circulating hemocytes in larvae expressing combinations of UAS-lwrWT, UAS-dl, UAS-
Dif, and UAS-Difmut.
I used the anti-phospho-Histone H3 antibody, a mitosis marker, to identify
dividing cells in circulation. The mitotic indexes of larvae overexpressing UAS-dl alone and UAS-dl + UAS-lwrWT2 are about 9% and the difference is not statistically significant
(Figure 3.5A). This result indicates that overexpression of lwr does not enhance dl-
stimulated cell division. To estimate the number of apoptotic hemocytes, I used a vital
dye, acridine orange (AO). Co-expression of lwr with dl caused a significant decrease in
apoptotic hemocytes (Figure 3.5B). The percentage of AO positive hemocytes of
CgGAL4/UAS-lwrWT2 UAS-dl larvae was only half of that of CgGAL4/UAS-dl larvae.
Thus the increase of hemocyte number in CgGAL4/UAS-lwrWT2 UAS-dl larvae is primarily caused by a decrease in apoptotic hemocytes. These results suggest that sumoylated Dl promotes cell survival. 124 Figure 3.5: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS- lwrWT2 and UAS-dl with the CgGAL4 driver. (A) Mitotic indexes. (B) % Apoptosis. Error bars indicate the standard deviation. a Statistically insignificant differences between each other. b Statistically significant differences between each other.
125 I observed a significant decrease in the mitotic index of the CgGAL4/UAS-lwrWT2 UAS-
Dif larvae. The mitotic index of CgGAL4/UAS-lwrWT2 UAS-Dif was 3.59%, roughly half
the mitotic index of CgGAL4/UAS-Dif alone (6.34%, Figure 3.6A). At the same time, co-
expression of lwr and Dif led to an increase of apoptosis in the circulating hemocytes
(Figure 3.6B). The rates of hemocyte cell division and apoptosis remained the same in
CgGAL4/UAS-Difmut larvae regardless of the presence of excess Lwr protein. Therefore,
the decrease in cell division and increase in cell death can be attributed to the presence of
sumoylated Dif. I conclude that the decrease of hemocytes in CgGAL4/UAS- lwrWT2 UAS-
Dif larvae is caused by the combined effects of decrease in cell division and increase in
hemocyte apoptosis. These results also indicate that Dif sumoylation not only decreases
Dif’s activity in hemocyte proliferation but also induces sumoylated-Dif-dependent cell
death.
Overexpression of UAS-lwrWT2 using the CgGAL4 driver also causes an increase
in hemocyte division (Figure 3.6A). The percentage of apoptotic hemocytes in the
CgGAL4/UAS-lwrWT2 is the same as the wild type. This result suggests that
overexpression of lwr itself does not induce hemocyte apoptosis.
3.4.7 Overexpression of dl, Dif, Difmut, and lwr affected cell death of Drosophila S2 cells
To determine whether sumoylated Dl and Dif affect cell death, I overexpressed different forms of dl and Dif in the Drosophila S2 cells, a cell line of hematopoietic origin. Expression of genes was under the control of a strong promoter from the Actin5C 126 Figure 3.6: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS- lwrWT2, UAS-Dif, and UAS-Difmut with the CgGAL4 driver. (A) Mitotic indexes. (B) % Apoptosis. Error bars indicate the standard deviation. a Statistically significant differences between each other. b Statistically insignificant differences between each other.
127 the Actin5C gene. After 40 hours of incubation, S2 cells were stained with Trypan Blue
to identify dead cells. I observed that co-expression of dl, SUMO, and lwr significantly decreased the number of dead cells in the S2 cell culture whereas expression of dl alone did not. Compared to co-expression of SUMO and lwr, co-expression of dl, SUMO, and lwr had a more prominent effect on protecting S2 cells from cell death (Figure 3.7).
Together with my previous observation (see section 3.4.5), this result suggests that sumoylated Dl may decrease hemocyte cell death. In contrast, co-expression of Dif,
SUMO, and lwr caused an increase in the number of dead cells. On the other hand, co-
expression of Difmut, SUMO, and lwr did not have any effect on cell death (Figure 3.7),
indicating that sumoylated Dif may promote cell death. These results also agree with the
in vivo data (see section 3.4.6).
3.4.8 Df(3L)H99, DreddEP1412, and overexpressed UAS-basketDN suppressed
sumoylated Dif-mediated hemocyte apoptosis
To test whether sumoylated Dif induces hemocyte apoptosis, I combined the
overexpressed UAS-lwrWT2 and UAS-Dif with Df(3L)H99 (H99) and DreddEP1412. H99 is a
deficiency that deletes three Drosophila pro-apoptotic genes: reaper, hid, and grim.
Homozygous H99 prevents all apoptosis events during embryogenesis and causes late
embryonic lethality (White et al., 1994). Therefore, I can only examine the dominant
effect of heterozygous H99. A significant increase in total number of hemocytes was
observed in CgGAL4/UAS-lwrWT2 UAS-Dif; Df(3L)H99/TM6 larvae (Figure 3.8A). The
percentage of AO positive hemocytes of this genotype was indistinguishable from the 128 Figure 3.7: Effects of dl, Dif, Difmut, SUMO and lwr expression on S2 cell death. The relative ratio of cell death is calculated using non-transfected cells as a control. Positive values indicate a higher percentage of cell death compared to non-transfected controls. Negative values indicate a lower percentage of cell death. The blue bars correspond to cells without lwr and SUMO expression. The purple bars correspond to cells with lwr and SUMO expression. No DNA, non-transfected cells; LacZ, pPac-LacZ; SL, pPacHA-SUMO and pPacHA-lwr; Dl, pPacFLAG-dl; Dif, pPacFLAG-Dif; Difmut, pPacFLAG-DifK435A. Error bars show standard deviation. * Statistically significant difference between the experiment and control (P < 0.01, t test).
*
*
129 Figure 3.8: Df(3L)H99 and DreddEP1412 mutations suppressed sumoylated Dif-induced hemocyte apoptosis. (A) Hemocyte counts of mutants and heterozygous controls in mixed culture. (B) Percentage of apoptotic hemocytes in circulation. Apoptotic cells were identified with Acridine Orange staining. WT, wild type; Dif lwrWT2, CgGAL4/UAS-Dif UAS-lwrWT2; Dif lwrWT2 H99, CgGAL4/UAS-Dif UAS-lwrWT2; Df(3L)H99/TM6; Dredd Dif lwrWT2, DreddEP1412; CgGAL4/UAS-Dif UAS-lwrWT2 ab Statistically significant differences between each other.
130 wild type controls (1.52%; Figure 3.8B).
DreddEP1412 is a hypomorphic allele of the Drosophila initiator caspase gene
Dredd. It was reported that Dredd plays a role in Drosophila immune response (Leulier
et al., 2000; Stoven et al., 2000). Dredd, as a caspase-8 homolog, is also activated by the
pro-apoptotic proteins, Rpr, Hid and Grim (Chen et al., 1998). When combined with
DreddEP1412, the negative effect of overexpressed UAS-lwrWT2 and UAS-Dif on hemocyte production was drastically diminished (Figure 3.8A). The total hemocyte count increased from 14.0 to 27.8 106 cells per ml of hemolymph (Table 3.2; Figure 3.8A).
Accordingly, the number of apoptotic hemocytes in circulation decreased (Figure 3.8B).
Interestingly, overexpression of a dominant negative form of basket, the
Drosophila JNK, inhibited sumoylated-Dif-induced hemocyte apoptosis. The total
hemocyte count (34.8 106 cells per ml hemolymph) and the percentage of apoptotic
hemocytes in circulation (1.01%) in the CgGAL4/UAS-Dif UAS-lwrWT2; UAS-bskDN/TM6 larva are comparable to those of the CgGAL4/UAS-Dif larvae.
These results demonstrate that apoptosis indeed plays a role in regulating hemocyte number.
3.4.9 Regulation of Dif transcriptional activity by sumoylation
It is possible that transcriptional activity of Dif differs depending on its sumoylation state, because co-expression of Dif together with lwr led to a substantial decrease in hemocyte production when compared to overexpression of Dif alone (Table
3.2). To investigate whether sumoylation affects Dif’s transcriptional activity, I used 131 Dual-Luciferase reporter assays to measure the transcriptional activity of Dif and
sumoylated Dif. I selected the upstream regulatory regions of 26 genes, including the
known Dif-specific target gene Drosomycin. To choose these genes, I searched for B sites in the 5’ 2-kB-long regulatory regions of genes that showed a significant change in expression in a series of microarray assays using Tl10B, lwr and lwr Cact mutant larvae as samples (See Appendix A). Table 3.3 lists B site patterns of these genes. Predicted gene
functions were retrieved from Affimatrix gene annotation data or from the FlyBase
(http://flybase.org/). Each selected gene contains at least one B site in its promoter
region. The distance between the B sites and the transcription start site varies from +93
to -2082 (a positive value indicates that the B site is located downstream of the
transcription start site; a negative value indicates that the B site is upstream of the
transcription start site). The regulatory regions were cloned and inserted into the pGL3-
Hsp70 vector, which served as a reporter construct to investigate the effect of
sumoylation on Dif’s transcriptional activity. I measured the reporter luciferase activity
upon the transfection or co-transfection of pPacFLAG-Dif, pPacFLAG-Difmut, pPacHA-
SUMO and pPacFLAG-lwr. By comparing the relative luciferase activity of S2 cells expressing Dif to that of S2 cells co-expressing Dif and SUMO+Lwr, I can examine the effects of lwr expression on Dif’s activity. At the same time, by comparing the reporter activity of S2 cells expressing Difmut to that of S2 cells expressing Difmut and SUMO+
Lwr, I may be able to discover whether the effect of lwr expression on Dif transcriptional
activity is sumoylation dependent. According to the expression pattern of the reporter gene (firefly luciferase), these 26 genes were divided into four groups. I named these
genes group 1, group 2, group 3 and group 4 genes. Three of the four groups, groups 1 to 132 Table 3.3: Analysis of B sites of the promoter regions of 26 genes
Positions of B sites relative to the transcription start Gene 1st site 2nd site 3rd site Predicted Gene Function CG8913 -78 Peroxidase CG6788 -195 Cell adhesion CG14499 -401 Unknown iHog -385 Hh receptor
Mthl3 -565 G-protein coupled receptor Dox-A3 -601 Monophenol monooxygenase Damm -619 Caspase crm -518 DNA binding 1 B site
Thor -715 eIF4E binding Dif -863 Transcription factor CG16827 -996 Heterophilic cell adhesion, integrin complex CG13405 -1259 Exocytosis Prat2 -1924 Amino acid metabolism
Fmo-2 +58 N-oxide production CG5866 +93 Unknown Tep II -116 -1815 Protease inhibitor Lectin24A -702 -2082 Galactose binding Pof -969 -1746 RNA binding 2 B IM10 -88 -135 Defense response sites Drosomycin -26 -158 Antimicrobial peptide niki -1217 -1660 Serine/Threonine kinase CG3610 -234 -2030 CG16719 -210 -1237 -1689 Unknown Multiple CG15109 -121 -754 -1151 Unknown B sites Deptericin -53 -149 -181 Antimicrobial peptide twist 7 B sites Transcription factor
133 3, had characteristic expression patterns (Figures 3.9 – 3.11).
Group 1 genes consists of Drosomycin, CG3610, CG16827, Dif, Deptericin, and
CG15109. The characteristic expression pattern of group 1 genes is that co-transfection
of lwr, SUMO, and wild type Dif repressed the reporter gene expression when compared
to transfection of Dif alone, whereas co-transfection of lwr, SUMO, and Difmut did not
have any effect when compared to transfection of Difmut alone (Figure 3.9). With the exception of CG3610 and CG15109, each the assays were repeated three times. The luciferase activities of S2 cells expressing lwr, SUMO, and Dif were significantly lower
than those of S2 cells expressing Dif alone (P<0.01 in t test). There was no significant
difference in reporter activity between the S2 cells transfected with lwr, SUMO, and
Difmut and with Difmut alone. Although statistical tests are not applicable for CG3610 and
CG15109 due to small sample size, a 31% and 16% decrease of luciferease activity was
observed, respectively. It is most likely that lwr repressed Dif activity on these promoters
as well. These results suggest that sumoylation of Dif repressed its transcriptional
activity. Co-expression of lwr, SUMO, and Difmut did not lead to a decrease in the reporter
activity, suggesting that this repression is dependent on Dif-sumoylation. Therefore, I
conclude that sumoylated Dif is less potent in driving the expression of certain genes.
This may be one of the molecular mechanisms of how sumoylation suppressed Dif’s
functions in hemocyte production.
Group 2 genes consists of IM10, methuselah-like 3 (Mthl3), interference
Hedgehog (iHog), CG16719, and CG14499. Distinct from the group 1 genes described
above, sumoylation of Dif did not affect the expression of group 2 genes. The
characteristic expression pattern of group 2 genes is that co-transfection of lwr, 134 Figure 3.9: Expression patterns of Group 1 genes. Co-expression of lwr with wild type Dif but not with mutant Dif represses reporter activity. The relative luciferase activities are normalized according to non-transfected controls, arbitrarily assigned as 1. C: non-transfected control; SL: SUMO + Lwr; DSL: Dif + SUMO + Lwr; Difm: Difmut; DMSL: Difmut + SUMO + Lwr.
135 Figure 3.9: continued
136 SUMO, and wild type Dif did not repress the reporter gene expression when compared to
transfection of Dif alone. Co-transfection of lwr, SUMO, and Difmut also did not repress
the reporter gene expression when compared to transfection of Difmut alone (Figure 3.10).
Due to the small sample size (two replica), statistical tests were not applicable for these
experiments; however, no large changes in luciferase activity were observed. Hence,
these results indicate that Dif sumoylation does not affect its transcriptional activity on
group 2 genes. Since sumoylation usually has a negative effect on the activity of a
transcription factor (Gill, 2005) as observed in group 1 genes, the existence of group 2
genes strongly suggests that the effects of Dif sumoylation are promoter dependent.
The group 3 genes consists of CG8913, Dox-A3, Lectin24A, Tep II, Pof, niki,
cramped (crm), Damm, and CG13405. The regulatory regions of these genes promoted reporter gene expression regardless of the combinations of the transfected pPac vectors.
Transfection of any single or combination of lwr+SUMO, Dif, and Difmut led to an increase of the reporter luciferase activity (Figure 3.11). The nature of these genes is not clear at this point. However, they might be genes that respond to cellular stresses such as ectopic overexpression of proteins. Likewise, these promoters might be more sensitive to
Dif. The activation of endogenous Dif might be sufficient to trigger the gene expression controlled by these promoters.
The fourth group contains the rest of the tested genes. There were no consistent characteristics of reporter expression pattern for the group 4 genes (data not shown).
137 Figure 3.10: Expression patterns of Group 2 genes. Co-expression of lwr with wild type Dif and mutant Dif does not repress reporter activity. The relative luciferase activities are normalized according to non-transfected controls, arbitrarily assigned as 1. C: non-transfected control; SL: SUMO + Lwr; DSL: Dif + SUMO + Lwr; Difm: Difmut; DMSL: Difmut + SUMO + Lwr.
138 Figure 3.10: continued
139 Figure 3.11: Expression patterns of Group 3 genes. Reporter luciferase activity is increased upon expression of lwr or Dif or both. The relative luciferase activities are normalized according to non-transfected controls, arbitrarily assigned as 1. C: non-transfected control; SL: SUMO + Lwr; DSL: Dif + SUMO + Lwr; Difm: Difmut; DMSL: Difmut + SUMO + Lwr.
140 Figure 3.11: continued
141
3.5 Discussion
In this study, I demonstrated that the lwr gene can control Drosophila larval
hemocyte production through regulating the Rel-related proteins, Dl and Dif, via
sumoylation. Sumoylation of Dl enhanced hemocyte production, while sumoylation of
Dif suppressed hemocyte production. I further demonstrated that apoptosis plays a role in
regulating the number of hemocytes. Finally I showed that sumoylation of Dif represses
its transcriptional activities in a promoter dependent manner.
3.5.1 Lesswright-Tl pathway interaction regulates Drosophila hemocyte number
The overexpression experiments with UAS-Dl, UAS-Dlmut, UAS-Dif, UAS-Difmut,
and lwr show that one of the lwr functions in hematopoiesis is to regulate Tl signaling by directly interacting with Dl and Dif. Overexpression of the wild type lwr induces overproduction of both plasmatocytes and lamellocytes. This induction requires the functions of both dl and Dif. Removing both dl and Dif functions completely suppressed lwr- induced hemocyte production. Lwr catalyzes the sumoylation of Dl (Bhaskar et al.,
2002) and Dif, and thus regulates the functions of both transcription factors. This discovery adds complexity to the current model of Lwr-Tl signaling interaction (Huang et al., 2005). Our work has revealed at least two layers of interactions between Lwr and the
Tl signaling pathway.
Firstly, Lwr might interact and stabilize Cact, the inhibitor of Tl signaling (Huang et al., 2005; Jinu Abraham and Soichi Tanda, personal communication). This stabilization may be achieved by either sumoylation of Cact or physical binding of Lwr to Cact. 142 Therefore in lwr loss-of-function mutants, Tl signaling is activated, leading to overproduction of larval hemocytes and formation of melanotic tumors (Huang et al.,
2005; Figure 2.7 and Figure 3.12).
Secondly, as a SUMO conjugase, Lwr directly regulates the Rel-family
transcription factors Dl and Dif by sumoylation. As far as sumoylation is concerned, Dl
and Dif exist in the cell with four different forms: unsumoylated Dl and Dif and
sumoylated Dl and Dif. Each of the four forms plays different roles in Drosophila
hematopoiesis. Unsumoylated Dl is primarily involved in plasmatocyte production,
whereas unsumoylated Dif is a strong inducer of both plasmatocyte and lamellocyte
production. Sumoylation of Dl and Dif affects the activity as well as the specificity of
both proteins. Dl sumoylation enhances its activity in hemocyte production. In addition,
sumoylated Dl can stimulate lamellocyte differentiation. This function was not observed
in my previous experiments. On the other hand, Dif sumoylation decreases its activity in
both plasmatocyte and lamellocyte production (Figure 3.12). Furthermore, sumoylation
of Dl and Dif affects hemocyte survival in circulation. Sumoylated Dl inhibits hemocyte
apoptosis, while sumoylated Dif induces hemocyte apoptosis (Figure 3.12; also see
section 3.4.3). The above two mechanisms indicate that Lwr plays a central role of
regulating Tl signaling in hematopoiesis. Lwr is likely to regulate both Cact-degradation-
dependent and Cact-degradation-independent activation of the Rel-related transcription
factors Dl and Dif. At the same time, Lwr can alter the specificity of Dl and Dif via
sumoylation. The antagonizing functions of sumoylated Dl and Dif may help to prevent
uncontrolled production of hemocytes, which is potentially harmful to the organism. It is
possible that Lwr interacts with Tl-signaling components upstream of Cact. This 143 Figure 3.12: Model for Lwr-Tl signaling activation. Dashed arrows show the sumoylation pathways of Dl and Dif. Lwr catalyzes the SUMO modification of Dl and Dif. Desumoylation process is catalyzed by Ulp1. Black arrows and blunt arrows show the functions of different proteins. In my current model, Lwr stabilized Cact, which sequesters unsumoylated Dl and Dif in the cytoplasm. Sumoylation can induce Cact-degradation-independent nuclear localization of Dl and Dif. Unsumoylated Dl and sumoylated Dif primarily mediate plasmatocyte production and can induce cell death, whereas sumoylated Dl and unsumoylated Dif mediate both plasmatocyte and lamellocyte production. Sumoylated Dl also inhibits hemocyte apoptosis. Therefore it plays a role in hemocyte survival.
144 possiblity is currently under investigation in our lab.
What is the mechanism that determines the differences in the specificity of
unsumoylated and sumoylated forms of Dl and Dif? I hypothesize that the expression of
genes for plasmatocyte and lamellocyte production are controlled by different categories
of B sites. It is known that Dl generally binds to more stringent B sites than Dif
(Engstrom et al., 1993; Gross et al., 1996; Han and Ip, 1999; Petersen et al., 2005).
Therefore Dif regulates the expression of genes for both plasmatocyte and lamellocyte production due to its broader binding ability. On the other hand, Dl only regulates only a subset of Dif responsive genes. Sumoylation might change the binding specificity of Dl and Dif, thus changing the function of both proteins. In addition, sumoylation might affect the dimerization of Dl and Dif or affect the functions of the Dl/Dif homo- or hetero-dimers. Further study is needed to fully understand this regulatory system.
3.5.2 Dl and sumoylated Dif induces hemocyte apoptosis
I demonstrated that overexpression of UAS-dl and co-expression of UAS-Dif and
UAS-lwrWT induced apoptosis of hemocytes in circulation. Furthermore, I demonstrated
that the deficiency Df(3L)H99, A loss-of-function mutation of one of the Drosophila
caspases Dredd (DreddEP1412), and overexpressed bskDN all suppress apoptosis induced by
co-expression of UAS-Dif and UAS-lwrWT.
Does hemocyte overproduction itself trigger apoptosis? Overexpression of an
activated form of Ras, RasV12, caused a massive production of larval hemocytes (Asha et al., 2003). The total hemocyte number can reach 100 106 cells per ml of hemolymph. 145 However, apoptosis was not observed in circulating hemocytes. Larvae expressing
mutant forms of Dif also produced a large number of hemocytes. Hemocyte apoptosis again was not observed (Figure 3.6).
In the mammalian system, NF-B is generally considered as an inhibitor of
apoptosis (Baeuerle and Baltimore, 1996; Beg et al., 1995; Bubici et al., 2006; Munzert et
al., 2002; Papa and Zazzeroni, et al, 2004). NF-B protects cells from apoptosis induced
by death signals. However, some evidence of the pro-apoptotic role of NF-B has been
reported (Baeuerle and Baltimore, 1996). It is possible that the pro-apoptotic or anti-
apoptotic functions of the NF-Bs are regulated by posttranslational modifications such
as sumoylation, similar to the situation presented in this dissertation study. Investigation
of this possibility may help to explain some results that appear to be contradictory. For
example, in the mammalian system, activation of the Tumor Necrosis Factor (TNF)
can either induce or prevent apoptosis. TNF is an activator of NF-B. NF-B blocks
TNF-induced apoptosis by inhibiting JNK signaling which, too, is activated by TNF.
Inhibition of NF-B leads to JNK-signaling-mediated apoptosis upon TNF activation
(Papa et al., 2004). I demonstrated that inhibition of JNK signaling suppressed
sumoylated-Dif-mediated apoptosis. This result strongly suggests that Drosophila and
mammalian NF-Bs may employ a similar mechanism to control apoptosis.
3.5.3 Promoter dependent regulation of Dif transcriptional activity by sumoylation
Our reporter assays suggest that sumoylation represses Dif activity in a promoter
dependent manner. Of all the 26 genes I have tested (see section 3.3.9), I am particularly 146 interested in two groups of genes. Both group 1 and group 2 genes responded specifically to Dif expression. Sumoylation repressed Dif activity on only the group 1 genes but not
the group 2 genes. A closer look at the B site pattern of the regulatory regions of these
genes suggests that the number of B sites, the relative position of the B sites or
orientation of the B sites are not effective factors related to the repression of Dif activity
in this study. Eukaryotic promoters usually contain multiple cis-elements. Gene
transcription is the result of the interaction of multiple proteins that bind to their
corresponding cis-elements in the promoter region. Owing to this fact, I propose two
testable mechanisms for sumoylation-mediated repression of Dif transcriptional activity.
In the first model (Figure 3.13A), sumoylated Dif recruits SUMO binding
repressors, which inhibit transcription of some Dif target genes (group 1 genes). In the
case of group 2 genes, a protector protein binds to the promoter region of these genes,
canceling the inhibition of the SUMO binding repressors. In this model, I assume the
recruitment of the repressors depends on the sumoylation itself. No additional factors are
required for repressor binding. However, I cannot rule out the possibility that the
recruitment of the SUMO binding repressor requires another facilitator protein or a co-
repressor, which binds to a cis-element in the promoter region of group 1 genes. For
group 2 genes, this cis-element is not present in their promoter region. The facilitator
protein/co-repressor is not present. Without the facilitator, SUMO binding proteins do not
bind to sumoylated Dif, and therefore cannot inhibit transcription (Figure 3.13B). These
two mechanisms are currently being tested in our lab. 147 Figure 3.13: Two proposed mechanisms for sumoylation-mediated repression of Dif transcriptional activity. (A) Model 1; (B) Model 2. Detailed explanations are in the main text.
A
B
148
Chapter 4: The lesswright mutation potentiates larval hemocyte apoptosis in
Drosophila, possibly through the JNK pathway
149
4.1 Summary
The Drosophila small ubiquitin-related modifier (SUMO) conjugase Lesswright
(Lwr) plays important regulatory roles in larval hemocyte production. Loss of lwr function or overexpression of lwr in the larvae hematopoietic tissues causes overproduction of circulating hemocytes through distinct mechanisms. In the search for the effect of loss of sumoylation on the functions of the Rel-related transcription factors
Dl and Dif, we overexpressed Dl, Dif or Difmut in the lwr mutant background.
Interestingly, even though the lwr mutation or overexpression of Rel-related factors alone leads to increases in hemocyte number, the combination of the two genetic elements did not enhance hemocyte production. Instead, the hemocyte number is restricted to a moderate level. Similar phenomena were observed when we combined hopTum-l or
overexpressed Ras85DV12 with the lwr mutation (Ying Shen and Jinu Abraham, personal
communication). To elucidate what causes the restriction of hemocyte number in the lwr
mutant background, I examined hemocyte cell division and apoptosis in these genotypes.
Acridine orange (AO) staining of circulating hemocytes showed that more hemocytes,
particularly plasmatocytes, were undergoing apoptosis. This result indicates that the lwr
mutation causes apoptosis of hemocytes. The decrease of hemocyte number in the lwr
mutant background can be suppressed by the deficiency Df(3L)H99 (H99) and the
expression of a dominant negative form basket (bsk), the Drosophila homolog of JNK.
H99 partially suppresses lwr-mutation-mediated hemocyte apoptosis in a dominant
manner. Overexpression of bskDN completely inhibits hemocyte apoptosis in the lwr 150 mutants. This result suggests that wild type Lwr may inhibit the activation of the JNK pathway and protect hemocytes from apoptosis during active proliferation.
4.2 Introduction
The lwr gene encodes a UBC9 family E2 enzyme whose function is to conjugate
SUMO to various target proteins. The SUMO conjugation (or sumoylation) process consists of three steps: activation of mature SUMO molecules with the E1 enzyme, transfer of the activated SUMO to the E2 enzyme and, finally, the ligation of SUMO to the lysine residues of the target proteins. In most situations, sumoylation targets the lysine residue in the sumoylation consensus sequence, KxE, where stands for a large hydrophobic residue and x stands for any amino acid residue. Sumoylation regulates many cellular processes such as nuclear transport, protein degradation, and transcription
(Melchior, 2000; Yeh et al., 2000; Muller et al., 2001). Interestingly, the SUMO conjugase (UBC9) can regulate protein functions through physical interactions. For example, physical interactions between the Paired-like homeobox protein Vsx-1 and
UBC9 is required for Vsx-1 nuclear localization (Kurtzman and Schechter, 2001).
SUMO-1/UBC9 also regulates the functions of ASK-1, RAD51, and dynamin functions without covalent modification (Lee et al., 2005; Li et al., 2000; Mishra et al., 2004).
lwr plays important roles in Drosophila hematopoiesis. Loss-of-function mutations of lwr activate the Rel-related transcription factors Dl and Dif, causing overproliferation of larval hemocytes even without any immune challenge (Huang et al.,
2005). Lwr regulates Dl and Dif functions through sumoylation. Dl sumoylation has a 151 positive effect on hemocyte production, whereas Dif sumoylation has a negative effect.
Hemocyte apoptosis can be regulated by sumoylated Dl and Dif as well (See Chapter 3).
Despite the fact that little is known in the Drosophila system, in the mammalian system, some evidence strongly suggests that sumoylation regulates apoptosis.
Sumoylation of human caspases, such as procaspase-2, caspase-7 and caspase-8 affects their nuclear localization and activation (Besnault-Mascard et al., 2005; Hayashi et al,
2005; Shirakura et al., 2006). Since the promyelocytic leukemia nuclear bodies (PML-
NBs) regulate apoptosis and the assembly of the PML-NBs requires sumoylation, sumoylation may play a regulatory role in PML-NB-mediated apoptosis (Hofmann and
Will, 2003). In addition, the protein sumoylation level in the periovulatory granulose cells is increased upon induction of apoptosis, indicating a role of sumoylation in apoptosis (Shao et al, 2006).
The mechanism of how sumoylation directly regulates apoptosis is less understood. Lee et al. (2005) reported that SUMO-1 and the SUMO conjugase UBC9 interact with apoptosis signal-regulating kinase 1 (ASK-1) and repress its activation.
ASK-1 is a one of the upstream kinases of the JNK cascade. Activation of ASK-1 leads to the activation of JNK signaling. In Drosophila, the JNK pathway controls the expression of the pro-apoptotic genes hid and rpr and regulates apoptosis during the wing, eye and gut development (Adachi-Yamada et al., 1999; Kockel et al., 2001;
Kuranaga et al., 2002; Moreno et al., 2002; Ryoo et al., 2004;Varfolomeev and
Ashkenazi, 2004). Therefore, SUMO-1/SUMO and UBC9/Lwr may inhibit apoptosis mediated by the JNK signaling pathway in both mammals and flies. 152 Here I demonstrate that loss of lwr function in the larvae overproducing
hemocytes leads to a decrease of total hemocyte number. This restriction is caused by
apoptosis of hemocytes. Heterozygosity of the Df(3L)H99 deficiency, which removed the
fly pro-apoptotic genes rpr, hid, and grim, increased hemocyte number and partially suppressed hemocyte apoptosis in the lwr mutants. Furthermore, blocking the JNK signaling pathway with a dominant negative form of bsk inhibited hemocyte apoptosis
induced by lwr mutations.
4.3. Materials and methods
4.3.1 Drosophila culture conditions and stocks
Flies were cultured in JAZZ mix (Fisher Scientific) supplemented with inactive
brewer’s yeast (SAP Product Corporation) and soy flour (ADM). JAZZ mix was cooked
in a steam kettle according to the manufacturer’s instructions. The stocks were
maintained at room temperature, and the experiments were conducted in uncrowded
conditions at 25°C.
The CgGAL4 driver and the UAS-dl lines were described previously (Asha et al.,
2003; Huang et al., 2005). The UAS-Dif line was a generous gift from Y.T. Ip. The UAS-
lwrWT lines were gifts from S. Ohsako. Other fly stocks used in this study are described in
FlyBase (http://flybase.bio.indiana.edu/).
4.3.2 Transgenics
The UAS-dlK382A, UAS-dlK382R, UAS-DifK435A, and UAS-DifK435R transgene
constructs (see section 3.3.4) were amplified on a large scale and purified using MAXI 153 Prep kit (Qiagen). DNA was resuspended in doubly distilled water at a concentration of approximately 500 g/ml. We used the y w; Sb, P{2-3}99B/ TM6 stock as host
(Robertson et al., 1988). Germline transformation was performed as described (Spradling,
1986; Sullivan et al., 2000).
4.3.3 Site-directed Mutagenesis
The QuickChange Site-directed mutagenesis (SDM) Kit (Stratagene) was used to
mutate the sumoylation consensus sequence of Dif and to generate a dominant negative form of Lwr (LwrDN). The Dif mutants were constructed by replacing lys435 with an alanine or an arginine residue. The LwrDN was constructed by replacing cys93 and leu97
with arginine and alanine residues respectively (Huang et al., 2005). The template for Dif
SDM is pNB40-Dif, a cDNA library vector containing a full-length cDNA of wild type
Dif. The coding region of the lwr gene is PCR amplified with the LA PCR Kit (Takara) and subsequently cloned into the TA cloning vector pCRII-TOPO (Invitrogen). The pCRII-lwr construct was used as the template for Lwr SDM. The reactions were performed according to the manufacturer’s instructions. For each reaction, about 10 ng of double stranded DNA template were used. The primer sequences for mutagenesis are listed as follows:
For DifK435A:
5'--- GTGCAGGATATCGCGATGGAGAATGGATTCATGGATGTG ---3' and
5'--- CACATCCATGAATCCATTCTCCATCGCGATATCCTGCAC ---3'.
For DifK435R: 154 5'--- GCAGGATATCAGGATGGAGAATGGATTCATGGATG ---3' and 5'---
CATCCATGAATCCATTCTCCATCCTGATATCCTGC ---3'
For LwrDN:
5'--- CTCGGGCACCGTTCGCCTGTCGCTGGCGGACGAGGAGAAGG ---3'
and 5'--- CCTTCTCCTCGTCCGCCAGCGACAGGCGAACGGTGCCCGAG ---3'
The introduced mutations were confirmed by sequencing.
4.3.4 Plasmid constructs
pUAST vectors
UAS-DifK435A and UAS-DifK435R constructs: Mutations were introduced to a full-
length Dif cDNA in the pNB40-Dif vector (see section 3.3.3). The cDNA was excised
with the restriction enzymes BglII and NotI. This fragment was then cloned into the
pUAST vector between the BglII and NotI sites.
pPac expression vectors
pPacFLAG-lwrDN: The coding region of lwr without the start ATG codon was
amplified with LA PCR and cloned into the pCRII-TOPO vector. Mutations were
introduced into the lwr coding region to create lwrDN (see section 2.3.2). BamHI and KpnI
sites were added at the 5’ and the 3’ ends of the lwr coding region respectively. A
BamHI-KpnI fragment was excised from pCRII-lwr and cloned into the pPacFLAG vector.
155 4.3.5 Genotyping larvae and hemocyte quantification
Genotypes of larvae homozygous for a given second-linked mutation were
determined using the CyO balancer with a yellow+ ( y+) transgene in a y background. The
mutant larvae were distinguished by a lesser degree of pigmentation of the
cephalopharyngeal skeleton than those of heterozygous siblings. A similar approach was
used on the third-linked mutations using the TM6B balancer with Tubby (Tb), or the TM3 balancer with an actin-GFP transgene. The presence of GFP in larvae was monitored using a Nikon SMZ1000 stereoscopic microscope equipped with an epi-fluorescent apparatus. In a few cases, the translocation balancer T(2;3)CyO; TM6B was used as a 2nd
chromosome and 3rd chromosome double balance. T(2;3)CyO; TM6B carries a dominant
mutation, Tb, which can be used for genotyping.
Egg collection was done daily, and the larvae were raised to the mid/late third
instar stage. Feeding larvae with still-retracted anterior spiracles were harvested and used
for this study. They are presumed to be those before receiving the first pulse of ecdysone,
which triggers wandering behavior and stimulates hemocyte production. We found that
variations in total blood cell counts were much larger among wandering larvae than
feeding larvae.
Hemocytes were counted using a hemacytometer, and the total hemocyte counts
were presented as the number of hemocytes per milliliter of hemolymph. Larvae were
rinsed well in water and blotted on Kimwipes to remove excess water before bleeding. A
small incision was made near the posterior spiracles and the hemolymph was directly
loaded on a hemacytometer. After placing a coverslip over the hemolymph, all hemocytes 156 but crystal cells were counted using differential-interference-contrast (DIC) optics at a magnification of 200.
4.3.6 Histological procedures
For a Giemsa-stained blood smear, the hemolymph was bled directly into a drop of 2 l of PBS on a glass slide, spread using a pair of forceps and dried. The blood smear was fixed in 100% methanol for 5 min and stained for 20 min in 10% Giemsa stain
(Sigma) in water. The specimens were rinsed in water for a few minutes and destained in
2 10-4 N HCl for 75 s. After being rinsed in water, the blood smear was air-dried and mounted in Permount (Fisher Scientific).
Immunohistochemistry on hemocytes was carried out on the cells smeared on a coverslip. The cells were first dried for 20 min and fixed in 3.7% formaldehyde/PBS at room temperature. The specimens were washed for 3 min four times in PBS. The cells were then permeabilized in 0.1% Triton X-100/PBS for 5 min and washed for 3 min three times in PBS. After permeabilization, the cells were incubated in 5% normal goat serum/PBS (blocking solution) for 30 min at room temperature. Antibodies were diluted in the blocking solution, and hemocytes were incubated with primary antibodies overnight at 4°C in a moist chamber. The specimens were washed for 10 min five times at room temperature in PBS and then incubated for 1 h at room temperature with secondary antibodies diluted in the blocking solution. The cells were washed for 10 min 5 times at room temperature and mounted with Prolong (Molecular Probes). Antiphospho-
Histone H3 antibodies (1 g/l, Upstate) were diluted 200-fold. Secondary antibodies 157 conjugated with Alexa Fluor 594 (Molecular Probes) were diluted either 500- or 1000- fold.
Acridine Orange (AO) staining was used to detect apoptosis of hemocytes. Larvae were bled directly onto the hemacytometer. AO stock solution (10 mg/mL) was diluted
2000-fold into PBS. For each hemolymph specimen, 2 L of the diluted AO solution were applied directly. A glass colverslip was placed over the hemacytometer. After 5 min incubation in the dark, the specimen was observed with a Nikon Optiphot-2 microscope equipped with an epi-fluorescent apparatus. Apoptotic cells have a bright nuclear staining.
4.3.7 Cell culture and transfection procedures
Drosophila Schneider L2 cells (S2 cells) were cultured in Drosophila-SFM serum free media (GIBCO) supplemented with L-glutamine (GIBCO), antibiotic and antimycotic on an orbital shaker at 27.5°C. Cells were subcultured every 4 days and the
4th day cells were used for transfection. We use CellFECTIN reagent (Invitrogen) for
transfection. For each transfection, 1 106 cells were transfected with 1 g plasmid DNA
respectively. Cell are cultured on an orbital shaker at 27.5°C for 36-48 hours and
harvested for experiments.
S2 cell viability was monitored by staining with Trypan Blue (Sigma) for 10 min
and observation under a microscope with DIC optical. Each experiment is repeated three
times.
158 4.4 Results
4.4.1 Plasmatocyte production was suppressed in the lwr mutant larvae
The lwr loss-of-function mutation and the Tl10B mutation cause overproduction of
larval hemocytes (Huang et al., 2005). Overexpression of Dl, Dlmut, Dif or Difmut also
increases hemocyte number (Chapter 3). Hence, I expected a high level of hemocyte
number when I overexpressed these Rel proteins in the lwr mutant background.
Surprisingly, the hemocyte number in the lwr mutants was limited to a moderate level
(usually around 20 106 cells per ml of hemolymph; Table 4.1). In most cases, the lwr
mutation led to a drastic decrease in hemocyte number. For example, the hemocyte count
of the CgGAL4/UAS-Difmut larvae reached 89.6 106 cells per ml of hemolymph. When
combined with the lwr mutation, the hemocyte number dropped to 24.4 106 cells per ml of hemolymph. Similar phenomena were observed when we combined hopTum-l or
overexpressed Ras85DV12 in the lwr mutant background (Ying Shen and Jinu Abraham,
personal communications). Despite the huge decrease in the total hemocyte number,
lamellocyte production was not decreased by the lwr mutation (Figure 4.1). Instead, I
observed an increase in lamellocytes except for the lwr4-3 CgGAL4/lwr5 UAS-Difmut larvae. These increases in lamellocytes are consistent with my previous finding that unsumoylated Dif is potent in lamellocyte production (See Chapter 3). The above results indicate that, regardless of which signaling pathway activated hemocyte overproduction, the lwr mutation limits but did not abolish plasmatocyte proliferation completely.
159 Table 4.1: Hemocyte counts of Tl10B mutant larvae and larvae expressing dl, dlmut, Dif, and Difmut transgenes in the lwr mutant background
Controla Experimental Total hemocyte Total hemocyte %Lamellocyte ± ± SDb ± SDb SDb ( 106/ml of ( 106/ml of Genotype hemolymph) hemolymph) Oregon-R* 2.1 ± 1.08 (35) N/Ac 0.7 ± 0.46 (15)
lwr4-3/lwr5* 2.2 ± 1.12 (35) 23.0 ± 3.00 (35) 27.5 ± 5.24 (15)
CgGAL4/UAS-dl* 2.6 ± 1.18 (35) 18.0 ± 4.53 (35)d 1.7 ± 0.55 (15) lwr4-3 CgGAL4 2.1 ± 0.80 (24) 16.9 ± 3.76 (24)d 22.4 ± 4.94 (10) /lwr5 UAS-dl CgGAL4/dlmut** 4.6 ± 1.65 (12) 32.0 ± 5.67 (15)e 1.2 ± 0.35 (5) lwr4-3 CgGAL4 3.3 ± 1.92 (15) 16.1 ± 6.39 (15)e 23.6 ± 7.85 (5) /lwr5 UAS-dlmut** CgGAL4/Dif* 2.3 ± 1.25 (35) 30.8 ± 13.5 (35)f 11.7 ± 1.58 (15) lwr4-3 CgGAL4 2.6 ± 0.87 (24) 16.8 ± 4.86 (24)f 53.6 ± 8.98 (10) /lwr5 UAS-Dif CgGAL4/Difmut 3.5 ± 1.21 (24) 89.6 ± 13.9 (24)g 17.3 ± 4.01 (10) lwr4-3 CgGAL4 3.3 ± 1.26 (24) 24.4 ± 4.11 (24)g 53.1 ± 7.27 (10) /lwr5 UAS-Difmut Tl10B* N/Ac 20.1 ± 5.76 (32)h 7.9 ± 4.04 (11)
lwr4-3/lwr5; Tl10B*** N/Ac 6.9 ± 2.6 (43)h 54.6 ± 14.13 (11) Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. a Heterozygous larvae of mixed genotypes in culture. b Standard deviation. c Not applicable. d Statistically insignificant differences between each other in t test. efgh Statistically significant differences between each other in t test ( P < 0.01). * Data from Huang et al., 2005. ** Jinu Abraham, unpublished data. *** Ying Shen, unpublished data. 160 Figure 4.1: Plasmatocyte and lamellocyte populations of larvae expressing UAS-dl, UAS- dlmut, UAS-Dif, and UAS-Difmut in wild type or lwr mutant background. Vertical bars represent the total hemocyte counts. Open space in the vertical bar corresponds to plasmatocyte population and filled space corresponds to lamellocyte population. The number of plasmatocytes and lamellocytes was calculated based on the total hemocyte counts and lamellocyte percentages. All UAS transgenes were driven by the CgGAL4 driver. OR, Oregon-R (wild type).
161
4.4.2 The lwr mutation caused an increase in cell death
To determine how lwr mutation affects hemocyte number, I measured the
percentages of apoptotic hemocytes and the mitotic indexes of circulating hemocytes in these mutant larvae. I found that in the lwr mutant background significantly more circulating hemocytes, mostly plasmatocytes, were undergoing apoptosis when compared to the wild type (Figure 4.2B). Except for UAS-dl, none of the genotypes we tested showed any significant difference in mitotic index between larvae with and without the lwr mutation (Figure 4.2A). Therefore, hemocyte proliferation was not affected by loss of lwr function. This result suggests that lwr function is essential for hemocyte survival.
I overexpressed a dominant negative form of lwr (lwrDN) in the Drosophila S2
cells. Expression of lwrDN can be used to mimic the effects of the lwr mutation (Huang et
al., 2005). Overexpression of lwrDN in the S2 cells caused an increase in cell death
(Figure 4.3). This result suggests that lwr function depleted cells are prone to undergo cell death.
4.4.3 The deficiency Df(3L)H99 partially suppressed apoptosis in the lwr mutants and restored hemocyte number in the lwr Tl10B double mutants
I attributed this decrease in hemocyte number in the lwr mutant background to the
increase of hemocyte apoptosis. Inhibition of the fly apoptotic pathways should restore
hemocyte number in these mutants. To test this hypothesis, I combined H99 with lwr
[lwr4-3/lwr5; Df(3L)H99/TM6] and the lwr Tl10B double mutation [lwr4-3/lwr5; 162 Figure 4.2: Mitotic indexes and percentage of apoptotic cells of larvae expressing UAS- dl, UAS-Dif, and UAS-Difmut with the CgGAL4 driver in the wild type or lwr mutant backgroud. (A) Mitotic indexes. (B) % Apoptosis. Error bars indicate the standard deviation.
163 Figure 4.3: Effects of lwrDN expression on cell death of S2 cells. The relative ratio of cell death is calculated using non-transfected cells as a control. Positive values indicate higher percentage of cell death compared to non-transfected controls. Negative values indicate lower percentage of cell death. No DNA, non- transfected cells; LacZ, pPac-LacZ; lwrDN, pPacFLAG-lwrDN. Error bars show standard deviation. * Statistically significant difference between the experiment and control (P < 0.01, t test).
*
164 Tl10B/Df(3L)H99]. The deficiency H99 deletes three Drosophila pro-apoptotic genes
reaper, hid, and grim, prevents all apoptotic events during embryogenesis, and causes
late embryonic lethality (White et al., 1994). I combined the H99 with lwr or lwr Tl10B to
examine the dominant effect of heterozygous H99. Indeed, H99 caused an increase in
total hemocyte number and partially suppressed apoptosis induced by the lwr mutation.
The total hemocyte count of the lwr4-3/lwr5; Df(3L)H99/TM6 larvae is 32.1 106 cells per ml of hemolymph (Table 4.2), which is a significantly higher than that of the lwr4-3/lwr5
larvae (23.0 106 cells per ml of hemolymph; t test, P < 0.01). The percentage of
apoptotic hemocyte in circulation decreased from 6.46% (in lwr4-3/lwr5) to 4.22% (in
lwr4-3/lwr5; Df(3L)H99/TM6; Table 4.2). H99 also restored the hemocyte number of the lwr Tl10B double mutants. The total hemocyte numbers of lwr4-3/lwr5 and Tl10B/+ are 23.0
and 20.1 106 cells per ml of hemolymph, respectively (Huang et al., 2005; Table 2.1).
When two mutations were combined [lwr4-3/lwr5; Tl10B/+], the total hemocyte number
decreased to 6.9 106 cells per ml of hemolymph (Ying Shen, unpublished data; Table
4.1). The total hemocyte number in the lwr4-3/lwr5; Tl10B/Df(3L)H99 larvae was 27.0
106 cells per ml of hemolymph (Table 4.2). Apoptosis in these larvae was also
suppressed. Therefore, I conclude that inhibition of apoptosis pathways restored
hemocyte number of lwr Tl10B double mutants. These results support our previous
observation that loss of lwr function led to apoptosis of hemocytes.
165 Table 4.2: Hemocyte counts and percentage of apoptotic hemocytes in lwr mutants combined with H99 and overexpressed UAS-bskDN
Controla Experimental Total hemocyte Total hemocyte % Apoptosis ± ± SDb ± SDb SDb ( 106/ml of ( 106/ml of Genotype hemolymph) hemolymph) lwr4-3/lwr5* 2.2 ± 1.12 (35) 23.0 ± 3.00 (35)d,f 6.46 ± 0.81 (6)g lwr4-3/lwr5; 6.2 ± 2.32 (12) 32.1 ± 8.62 (12)d 4.22 ± 0.47 (6)g Df(3L)H99/TM6 lwr4-3/lwr5; N/Ac 6.9 ± 2.60 (43)e N/Dh Tl10B /+** lwr4-3/lwr5; N/Ac 27.0 ± 9.88 (7)e 2.31 ± 0.61 (3)i Tl10B/Df(3L)H99 lwr4-3 CgGAL4/CyO, y+; 7.4 ± 2.18 (12) N/Ac N/Dh UAS-bskDN/TM6 lwr4-3 CgGAL4/lwr5; 5.2 ± 1.44 (12) 39.0 ± 4.89 (12)f 1.46 ± 0.30 (6)i UAS-bskDN/TM6 Note: The averages of total hemocyte counts excluding crystal cells were presented. The number of larvae examined is indicated in parentheses. a Larvae of mixed genotypes in culture b Standard deviation. c Not applicable. defg Statistically significant differences between each other in t test (P < 0.01). h Not determined. i Statistically significant differences between experiments and lwr4-3/lwr5 in t test (P < 0.01) * Hemocyte counts from Huang et al., 2005. ** Ying Shen, unpublished data. 166
4.4.4 Overexpression of bskDN inhibits apoptosis in the lwr mutants
To identify an apoptotic pathway activated in the lwr mutation, I first turned my
attention to the JNK pathway. It has been reported that SUMO-1 and UBC9 can inhibit
JNK-mediated apoptosis (Lee et al., 2005). To examine a possible interaction between
lwr and the JNK pathway, I overexpressed a dominant negative form of bsk, the
Drosophila JNK kinase, in the hematopoietic tissues of lwr mutants using the CgGAL4
driver. Overexpression of UAS-bskDN in the lwr mutants caused an increase in total
hemocyte number. The hemocyte count of the lwr4-3 CgGAL4/lwr5; UAS-bskDN/TM6
larvae (39.0 106 cells per ml of hemolymph) is significantly higher than that of the lwr
single mutants. Hemocyte apoptosis decreased to wild type level (1.46%; Table 4.2).
Although this result does not exclude the possibility that other pathways might be
involved in apoptosis induced by lwr mutation, it strongly suggests that the activation of the JNK pathway plays a pro-apoptotic role in the lwr mutant background. We are
currently investigating the genetic interactions between lwr and other components of the
JNK pathway. It is also important to demonstrate that JNK signaling is activated in the
lwr mutant hemocytes.
4.5 Discussion
I have demonstrated that Lwr is a cell survival regulator. Loss of lwr function
potentiates hemocyte apoptosis upon proliferation signals. It has been reported that loss
of the UBC9 function in chicken DT40 cells or in mouse embryos leads to apoptosis
(Hayashi et al., 2002; Nacerddine et al., 2005). These results suggest that UBC9 is 167 essential for the survival of higher eukaryotic cells. UBC9 interacts with a growing list of
proteins, including PML, p53, MDM2, RanGAP1, PCNA, c-Jun, and histone
deacetylases (Mahajan et al., 1997; Wang et al., 1998; Gostissa et al., 1999; Muller et al.,
2000; Sampson et al., 2001; Muller et al., 2001; Hoege et al., 2002; Miyauchi et al., 2002;
David et al., 2002), and thus regulates a variety of important cellular processes in
eukaryotic cells. Although it is not surprising that UBC9 (in this case, lwr) mutant cells die from apoptosis, identifying the mechanism could be challenging. Loss of lwr function may induce cell apoptosis in different ways. First, the lwr mutation may cause abnormalities of the cell, which indirectly activates apoptosis. For example, in higher eukaryotes, UBC9 function is required for nuclear integrity and chromosome segregation
(Hayashi et al., 2002; Muller et al., 2004; Nacerddine et al., 2005). Depletion of UBC9 function in the chicken DT40 cells leads to an increase in the number of cells with multiple or fragmented nuclei (Hayashi et al., 2002). In my experiments, a few abnormal hemocytes with multiple nuclei were observed (Figure 4.4). It is likely that loss of UBC9 function also impairs the cellular repair machinery. UBC9 deficient cells may not be able to recover from deteriorating defects and may indirectly trigger the apoptotic pathways.
Secondly, the lwr mutation may directly cause caspase activation. Although no research in the Drosophila system has been done, some evidence in the mammalian system suggests this possibility (Besnault-Mascard et al., 2005; Shirakura et al., 2005;
Hayashi et al., 2006). As discussed in the previous sections, UBC9 interacts directly with caspases. While definitive functions of these interactions are not clear at present, it is likely that UBC9 can regulate apoptosis through these caspases. For example, sumoylation of human procaspase-2, caspase-7 and caspase-8 targets them to the nucleus. 168 Figure 4.4: Abnormal lwr mutant hemocytes with multiple nuclei. Circulating hemocytes were stained with Giemsa staining. The arrowheads point to the abnormal hemocytes. The bar in the image corresponds to 20 m.
169 Sumoylation of procaspase-2 also affects its activation (Besnault-Mascard et al., 2005;
Shirakura et al., 2005). In the case of caspase-7, sumoylated protein is subject to specific locations within the nucleus and may contribute to neuronal apoptosis (Hayashi et al.,
2006).
A third possibility is that wild type lwr protects cells from apoptosis by inhibiting the apoptosis pathways. Loss of lwr function makes cells susceptible to apoptosis. A recent report shows that UBC9 and SUMO-1 interacts with ASK-1, a JNK kinase kinase
(Lee et al., 2005). SUMO-1 inhibits the activation of the mammalian ASK-1and thus suppresses apoptosis induced by activated ASK-1. Interestingly, although ASK-1 physically interacts with SUMO-1 and the SUMO conjugase UBC9, covalent SUMO modification is not required for ASK-1 inhibition. The genetic data presented in this chapter revealed that blocking the JNK signaling pathway with a dominant negative form of the Drosophila JNK (Bsk) inhibited hemocyte apoptosis in lwr mutants. This result suggests that JNK signaling is activated in the lwr mutants. However, due to the nature of the lwr mutation, it is difficult to determine whether the mutation itself or the cell defects caused by lwr led to JNK signaling activation. The genetic data presented in Table 4.2 does not provide evidence of whether wild type lwr function suppresses JNK signaling activation. Nonetheless, typical sumoylation consensus sequences are present in
Misshappen (Msn; JNK kinase kinase kinase), Slipper (Slpr; JNK kinase kinase),
CG8789 (JNK kinase kinase), MAP kinase kinase 4 (JNK kinase), Basket (JNK), and
DJun (c-Jun homolog, transcription factor) (Figure 4.5). Therefore, it is most likely that lwr regulates each step of the JNK cascade. Investigation on the interactions between lwr and the JNK pathway may be an interesting future direction. 170 Figure 4.5: The putative sumoylation sites of JNK cascade proteins. Red bold letters show the putative sumoylation sites. If multiple transcripts are present, only one of the transcripts is shown in this figure. The amino acid sequences were retrieved from Genebank using CLC workbench 3 software. The putative sumoylation sites were determined according to the consensus sequence KxE.
JNKKKK Msn(PA) EEEEIKLEINVL...KGQSLKEEWIAY...GYQPLKAEPSAS... 69 128 749 ...HFKIVKYERIKF 1290 JNKKK Slpr LFWALKHENIAA 192 CG8789(PA) FSGRLKNETVAV...LQNILKEEQVML 176 234 JNKK Mkk4 ALNYLKEELKII...NTCLIKKESDRP 235 365 JNK Bsk VDEALKHEYINV 311 Transcription Factor DJun(PA) GFSVIKDEPVNQ...AQEKIKLERKRQ...RVKVLKGENVDL 185 209 243
171
Chapter 5: Discussion 172 5.1 Interaction between Lwr and the Tl signaling pathway
One of the aims of this dissertation study is to determine the functions and the regulatory mechanisms of Lwr and the Rel-related transcription factors Dl and Dif in
Drosophila larval hematopoiesis. It had been shown that the Tl signaling pathway plays a role in Drosophila hematopoiesis (Gerttula et al., 1988; Govind, 1996; Braun et al., 1997;
Qiu et al., 1998). However, the actual functions of Dl and Dif, the transcription factors in
Tl signaling, were not clear prior to this study. My conclusion is that dl and Dif play different roles in hematopoiesis. Although their functions in hemocyte production can be modified by posttranslational modification (see below), Dl normally promotes plasmatocyte production, while Dif stimulates both plasmatocyte and lamellocyte production. The SUMO conjugase Lwr regulates hemocyte production primarily through interacting with the Tl signaling pathway at different levels. Figure 5.1 summarizes the current model for these interactions.
Dl and Dif are the effectors (transcription factors) of the Tl signaling pathway.
Both of them are sequestered by the inhibitor protein Cact in the cytoplasm. Activation of the Tl receptor triggers the degradation of Cact. Freed Dl and Dif enter the nucleus and activate their target genes. The lwr loss-of-function mutation results in the activation of
Dl and Dif and therefore leads to overproduction of plasmatocytes and lamellocytes. It is proposed that Lwr interacts with and stabilizes the inhibitor Cact through sumoylation or physical interaction. In the lwr mutants, Cact becomes more susceptible to degradation, and thus Dl and Dif are activated. This is the first level of Lwr-Tl pathway interaction.
Other examples of this type of regulation have been reported. Sumoylation and 173 Figure 5.1: Interactions between Lwr and the Tl signaling pathway in the context of Drosophila hematopoiesis. Dashed arrows show the sumoylation pathways of Dl and Dif. Lwr catalyzes the SUMO modifications of Dl and Dif. Desumoylation process is catalyzed by Ulp1. Black arrows and blunt arrows show the functions of different proteins.
174 ubiquitination of IB, Smad4, and PCNA happen on the same lysine residues in these proteins, preventing them from polyubiquitination-mediated degradation (Desterro et al.,
1998; Lin et al., 2003; Haracska et al., 2004). These findings indicate a common function of SUMO conjugation in both mammalian and Drosophila systems.
The fact that both Dl and Dif have typical sumoylation consensus sequences
suggests the possibility that their functions can be modified by sumoylation. This may
add another level of the Lwr-Tl pathway interaction: Lwr, a SUMO conjugase, can
catalyze sumoylation of Dl and Dif. Sumoylation triggers Cact-degradation-independent
release of Dl and possibly Dif as shown in a previous study by another group (Bhaskar et
al., 2000). The genetic data presented in this dissertation support this result.
Overexpression of wild type lwr led to Dl- and Dif-dependent increase in hemocyte production. The effects of sumoylation are not limited to freeing Dl and Dif from Cact.
Sumoylation of Dl and Dif also change the activities and the specificities of both proteins in hemocyte production. Unlike unsumoylated Dl, which primarily induces plasmatocyte production, sumoylated Dl can induce both plasmatocyte and lamellocyte production.
Sumoylated Dl also has a higher transcriptional activity than unsumoylated Dl (Bhaskar et al., 2002). In contrast to Dl, sumoylation significantly decreases Dif’s ability to stimulate the production of plasmatocytes and lamellocytes. Furthermore, I found that, while sumoylated Dl promotes cell survival, unsumoylated Dl and sumoylated Dif cause hemocyte apoptosis. The total number of hemocytes represents a combined effect of proliferation and apoptosis. When sumoylation is taken into consideration, four different forms of Dl and Dif proteins are present in the cell. Each of the four proteins has its own function in hemocyte production. Interestingly, the unsumoylated Dl and Dif, and the 175 sumoylated Dl and Dif, have somewhat antagonizing functions. It is likely that this
complex regulatory mechanism helps the organism maintain the homeostasis of hemocyte
production. For example, when Dl- and Dif-mediated hemocyte production is stimulated
by an elevated cellular sumoylation level, sumoylated Dif induces hemocyte apoptosis,
preventing unrestricted hemocyte production induced by sumoylated Dl.
Lwr plays a dual role in Dl and Dif regulation. It not only regulates the nuclear
localization of both proteins (Cact-degradation-dependent and Cact-degradation- independent), but also affects their specificities. Dl or Dif interacts with Cact and all of them interact with Lwr. In this case, Lwr regulates signal transduction at multiple layers rather than a simple linear pathway. Since many proteins are the targets of SUMO modification, this kind of interaction seems to be a common regulatory mechanism.
Another example is the tumor suppressor p53. Sumoylation of p53 increases its transcriptional activity (Gostissa et al., 1999; Rodriguez et al., 1999; Muller et al., 2000).
At the same time, regulators of p53, such as Mdm2, MdmX, ARF, and PML, are also
regulated by sumoylation. Some of these proteins even play a role in p53 sumoylation
(Fogal et al., 2000; Miyauchi et al., 2002; Xirodimas et al., 2002; Chen and Chen, 2003;
Pan and Chen, 2005). These results, together with the results presented in this dissertation, give several examples of how cellular proteins interact with each other to form a dynamic network rather than a linear pathway. Deciphering the effects of the complex regulation of protein function via sumoylation may help us understand the dynamics of the signaling network in future studies.
176 5.2 Sumoylation represses Dif transcriptional activity in a promoter-dependent manner
What is the molecular mechanism of change in Dif activity and specificity upon
sumoylation? One possible explanation is that sumoylation represses the expression of
some but not all Dif target genes. The reporter assay results I presented in Chapter 3
support this mechanism. Of the two groups of genes that responded specifically to Dif
expression, the expression levels of group 1 genes were repressed by Dif sumoylation,
whereas those of group 2 genes were not repressed. These results suggest that effects of
sumoylation are dependent on the sequence of the promoters. There are at least two
possible mechanisms for the promoter-dependent repression of Dif activity. First,
sumoylation can change the binding specificity and affinity to some B sites. Although the number, location and orientation of the B sites do not seem to be related to how promoters respond to sumoylated Dif, the sequence of the B sites varies. It is possible that the actual sequence differences might contribute to the promoter dependence of sumoylation-mediated transcriptional repression. This mechanism is less likely to be the true mechanism because the promoters I tested contain highly conserved B sites and no correlation between the B site sequence and gene group was found (Appendix B).
It is also likely that other DNA binding proteins that bind to the promoter regions may mediate the effects of Dif sumoylation. In this scenario, I propose that proteins bound to specific cis-elements in the promoter region can either counter the repression by sumoylation or facilitate sumoylation-dependent repression. Possible models have been described in section 3.5.3 in Chapter 3 (Figure 3.13). It is reported that fusion of SUMO to a GAL4-fusion protein can repress gene expression (Ross et al., 2002; Yang et al.,
2003). The current theory for this phenomenon is that SUMO recruits SUMO-binding 177 repressors to the promoter region. This supports my idea that sumoylation may facilitate the binding of SUMO-binding repressors to the transcription factors.
It is not unique for multiple cis-elements to control transcription. The Drosophila antimicrobial peptide gene Cecropin A1 contains adjacent GATA and B sites.
Expression of Cecropin A1 induced by Dif is enhanced by the presence of the GATA site
(Kadalayil et al., 1997). This shows an example of how other cis-elements in the B-site- containing promoters affect gene expression.
Sumoylation can either enhance or repress the activities of the transcription factors (Johnson, 2004). What differentiates the two functions? Is it because of conformational change in target proteins caused by sumoylation itself? Is it due to the binding of different sumo-binding proteins? Is it caused by synergistic interactions of sumoylated proteins and other proteins? Is it caused by chromatin remodeling? The possibilities are wide open. It may be important to identify SUMO binding proteins that connect sumoylated proteins to the universal machinery.
5.3 Lwr as a survival factor
I demonstrate that loss of lwr function leads to an increase in hemocyte apoptosis in Drosophila larvae and that overexpression of lwr in S2 cells prevented cell death.
These results strongly suggest that Lwr is a hemocyte survival factor. The results presented in this dissertation only show lwr-mutation-induced apoptosis in hemocytes, but, besides hemocytes, lwr function may be required by other cells. It is not surprising because lwr is an essential gene. Sumoylation regulates major cellular processes. Loss of 178 lwr function can possibly impair a variety of cell functions and cause substantial damage to the cell. This damage can trigger the apoptotic pathways in the cell. Alternatively, lwr
may directly inhibit the apoptotic pathways in the cell. Knowledge about the roles of
lwr/UBC9 in apoptosis is still fragmentary, but in higher eukaryotes, UBC9 interacts with
a growing list of apoptosis-related proteins such as caspases (Besnault-Mascard et al.,
2005; Shirakura et al., 2005; Hayashi et al., 2006). This suggests that UBC9/lwr may
directly regulate apoptosis. Loss of UBC9/lwr function in the cell might potentiate apoptosis. The information obtained from the Drosophila hemocytes may have general
implications to other fields.
Apoptosis induced by the lwr mutation can be suppressed by mutations of pro- apoptotic genes. The JNK pathway is involved in lwr-induced apoptosis. Blocking the
JNK pathway inhibits apoptosis in the lwr mutants. Interestingly, JNK-pathway-mediated
apoptosis is negatively regulated by UBC9 in mammals (Lee et al., 2005). In Drosophila,
however, whether lwr directly interacts with the JNK pathway is unknown. Investigating
the interactions between Lwr and the JNK pathway components will provide valuable
information about how apoptosis is controlled by lwr.
5.4 Drosophila as a model for hematopoietic stem cell research
In this study, I primarily focused on the production of two terminally
differentiated hemocytes, namely plasmatocytes and lamellocytes. The control of
prohemocyte proliferation and differentiation were not thoroughly investigated in my
experiments. It is less clear whether different precursors of plasmatocytes and 179 lamellocytes exist. The hematopoietic stem cells (prohemocytes) have not been
thoroughly studied in Drosophila.
The lymph gland is the major hematopoietic organ in Drosophila larvae. The
primary lobe of the lymph gland can be divided into three parts: the cortical zone, the
medullary zone and the posterior signaling center (Jung et al., 2005). Maturing
hemocytes, which express markers of functional hemocytes, are restricted to the cortical
zone, whereas the medullary zone and the posterior signaling center contain
undifferentiated prohemocytes (Jung et al., 2005). The posterior signaling center
expresses Serrate and Collier (Lebestky et al., 2003; Crozatier et al., 2004), which
determine the differentiation of crystal cells and lamellocytes respectively. The CgGAL4
driver we used expresses the GAL4 transcription factor primarily in the cortical zone of
the lymph gland. Another lymph gland GAL4 driver, DotGAL4, expresses GAL4 in the
posterior signaling center (Jung et al., 2005).
I used the DotGAL4 driver to overexpress dl, Dif, and Tl10B in larvae. Similar to
the CgGAL4 driver results, overexpression of these proteins caused a significant increase in total hemocytes (6.4, 13.9 and 17.7 106 per ml of hemolymph, respectively). The
expression level of the DotGAL4 driver is lower than that of the CgGAL4 driver; hence
the total hemocyte number is lower when compared to CgGAL4-driven expression. More
importantly, despite the lower expression level of DotGAL4, I observed a huge increase
in lamellocyte percentage in DotGAL4 larvae when compared to CgGAL4 larvae (8.5%,
30.1%, and 47.1%, respectively with DotGAL4; CgGAL4 data in Table 2.3). These results
suggested that the expression of dl, Dif, and Tl10B in different locations of the lymph
gland induced varied amounts of lamellocytes. It is possible that the DotGAL4-expressing 180 cells contain more lamellocyte precursors than the CgGAL4-expressing cells.
Alternatively, differentiation of the prohemocytes might be affected by their location in the lymph gland, the posterior signaling center, which is responsible for lamellocyte differentiation. For example, the Notch receptor and its membrane bond ligand Serrate regulate crystal cell production. The Notch-Serrate interaction suggests that cell-cell interaction may control hemocyte fate. It is also possible that secreted factors, e.g. the
JAK/STAT pathway ligand Unpaired, control the differentiation of surrounding hemocytes. In both scenarios, the microenvironment in the lymph gland might influence prohemocyte differentiation. This aspect of hematopoiesis is currently under investigation in our lab. The Drosophila system can be established as a model system to study hematopoietic stem cells.
181
Chapter 6: Future Studies
182 My work had established the roles of Lwr, Dl and Dif in Drosophila
hematopoiesis. I demonstrated that Lwr can affect Dl and Dif functions via sumoylation,
and that the repression of Dif transcriptional activity by sumoylation is promoter
dependent. I found that lwr function is required for hemocyte survival. I also performed
microarray assays to identify hematopoiesis related genes. These results provide a solid
foundation for further studies. New questions have emerged after the completion of my
dissertation projects. Investigating these questions will help to further understand the
control of Drosophila hematopoiesis.
i) How does sumoylation alter the functions of Dl and Dif? Sumoylation may regulate Dl and Dif functions in at least two ways. First, sumoylation may affect the binding specificity of Dl and Dif. As discussed in Chapter 3, genes for plasmatocyte and lamellocyte production may be controlled by genes with different B sites. Dl generally binds to more strict B sites than Dif (Engstrom et al., 1993; Gross et al., 1996; Han and
Ip, 1999; Petersen et al., 2005). Sumoylation might change the binding specificity of Dl and Dif, thus changing the functions of both proteins. Gel shift assays can be used to examine the binding specificity of unsumoylated or sumoylated Dl and Dif. Sumoylated proteins can be generated by in vitro sumoylation assays (Hilgarth and Sarge, 2005).
Alternatively, SUMO fusion proteins may be used.
Another approach is to identify the DNA sequences that sumoylated Dl and Dif bind. Chromatin immunoprecipitation (ChIP) can be used to identify Dl and Dif targets under different sumoylation states. Comparing Dl or Dif binding sites in low sumoylation conditions and high sumoylation conditions may provide evidence on whether sumoylation changes Dl and Dif binding specificity. The beneficial byproduct of this 183 research would be the identification of possible genes that are related to hemocyte production.
Secondly, dimerization of Dl and Dif can be affected by sumoylation. Like all
NF-Bs, Dl and Dif act as homo- or hetero- dimers (Kunsch et al., 1992; Han and Ip,
1999). It is possible that sumoylation can affect the homo- or hetero-dimer formation, and
thus affect their functions. It would be interesting to see whether sumoylation could affect
Dl and Dif dimerization and the functional significance of it. However, this scenario is
less likely to be the bona fide mechanism because Dl or Dif functions are affected by lwr overexpression even in the Dif or dl mutant background (Table 3.1).
ii) What is the mechanism of promoter dependent repression of Dif activity by sumoylation? I had proposed two models to explain the possible mechanisms. These two models are testable. Series deletions of the regulatory regions can be made through restriction digest-religation or through using deletion kits. The cis-elements (DNA sequences) that are responsible for repression or lack of repression can be identified. It would be interesting to find out the nature of the cis-elements. Once the DNA sequence is determined, the corresponding trans-element may be discovered as well.
iii) Which pathways are responsible for lwr-induced hemocyte apoptosis?
Blocking the JNK pathway can inhibit apoptosis in lwr mutants. However, it is not clear whether there is a direct interaction between Lwr and the JNK signaling. The sumoylation consensus sequences are present in many components of the JNK cascade.
Investigating the interactions between Lwr and these proteins may provide answers to this question. It would equally important to search for other apoptotic pathways that are 184 regulated by lwr. To establish the role of lwr in apoptosis would certainly be an exciting
new field of study.
iv) What are the target genes of Dl and Dif that are related to Drosophila
hematopoiesis? The microarray data identified a list of candidate genes. Screening for
genes that control hemocyte production is a future task. Genes can be characterized by
examining the available mutants or transgenes from the public stock center. Some of the
genes can be cloned and tested in vivo as UAS transgenic flies. Together with I-Ju Lu, I developed a cell-culture-based method to screen possible genes related to lamellocyte
differentiation. S2 cells were transfected with pPacFLAG-lwrDN or LacZ control. After
incubation, we measured the expression level of molecular markers for different
hemocyte markers using quantitative RT-PCR. The plasmatocyte specific markers I used
were croquemort, eater, and Peroxidasin. The lamellocyte marker I used was misshapen.
Our pilot experiments showed that when S2 cell were transfected with lwrDN, the
expression level of plasmatocyte markers decreased, whereas the expression level of the
lamellocyte marker increased. These results agree with the function of lwrDN, which induces lamellocyte differentiation. More hemocyte markers can be used, especially the lamellocyte markers. Several genes, such as the integrin gene PS4, can be potential
markers. Real-time RT-PCR can be used to improve the assays. 185
References
Adachi-Yamada, T., Fujimura-Kamada, K., Nishida, Y., and Matsumoto, K. (1999). Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature 400, 166-169.
Aderem, A., and Ulevitch, R.J. (2000). Toll-like receptors in the induction of the innate immune response. Nature 406, 782-787.
Agaisse, H., and Perrimon, N. (2004). The roles of JAK/STAT signaling in Drosophila immune responses. Immunol. Rev. 198, 72-82.
Alfonso, T.B., and Jones, B.W. (2002). gcm2 promotes glial cell differentiation and is required with glial cells missing for macrophage development in Drosophila. Dev. Biol. 248, 369-383.
Anderson, K.V. (2000). Toll signaling pathways in the innate immune response. Curr. Opin. Immunol. 12, 13-19.
Apionishev, S., Malhotra, D., Raghavachari, S., Tanda, S., and Rasooly, R.S. (2001). The Drosophila UBC9 homologue lesswright mediates the disjunction of homologues in meiosis I. Genes Cells 6, 215-224.
Asha, H., Nagy, I., Kovacs, G., Stetson, D., Ando, I., and Dearolf, C.R. (2003). Analysis of Ras-induced overproliferation in Drosophila hemocytes. Genetics 163, 203-215.
Babic, I., Cherry, E., and Fujita, D.J. (2006). SUMO modification of Sam68 enhances its ability to repress cyclin D1 expression and inhibits its ability to induce apoptosis. Oncogene 25, 4955-4964.
Baeuerle, P.A., and Baltimore, D. (1996). NF-kappa B: ten years after. Cell 87, 13-20.
Beg, A.A., Sha, W.C., Bronson, R.T., Ghosh, S., and Baltimore, D. (1995). Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376, 167-170.
Belvin, M.P., and Anderson, K.V. (1996). A conserved signaling pathway: the Drosophila toll-dorsal pathway. Annu. Rev. Cell Dev. Biol. 12, 393-416.
Bergmann, A., Stein, D., Geisler, R., Hagenmaier, S., Schmid, B., Fernandez, N., Schnell, B., and Nusslein-Volhard, C. (1996). A gradient of cytoplasmic Cactus degradation establishes the nuclear localization gradient of the dorsal morphogen in Drosophila. Mech. Dev. 60, 109-123. 186 Bernal, A., and Kimbrell, D.A. (2000). Drosophila Thor participates in host immune defense and connects a translational regulator with innate immunity. Proc. Natl. Acad. Sci. U. S. A. 97, 6019-6024.
Bernardoni, R., Vivancos, V., and Giangrande, A. (1997). glide/gcm is expressed and required in the scavenger cell lineage. Dev. Biol. 191, 118-130.
Besnault-Mascard, L., Leprince, C., Auffredou, M.T., Meunier, B., Bourgeade, M.F., Camonis, J., Lorenzo, H.K., and Vazquez, A. (2005). Caspase-8 sumoylation is associated with nuclear localization. Oncogene 24, 3268-3273.
Betz, A., Lampen, N., Martinek, S., Young, M.W., and Darnell, J.E.,Jr. (2001). A Drosophila PIAS homologue negatively regulates stat92E. Proc. Natl. Acad. Sci. U. S. A. 98, 9563-9568.
Bhaskar, V., Smith, M., and Courey, A.J. (2002). Conjugation of Smt3 to dorsal may potentiate the Drosophila immune response. Mol. Cell. Biol. 22, 492-504.
Bhaskar, V., Valentine, S.A., and Courey, A.J. (2000). A functional interaction between dorsal and components of the Smt3 conjugation machinery. J. Biol. Chem. 275, 4033- 4040.
Bidla, G., Lindgren, M., Theopold, U., and Dushay, M.S. (2005). Hemolymph coagulation and phenoloxidase in Drosophila larvae. Dev. Comp. Immunol. 29, 669-679.
Bischoff, V., Vignal, C., Boneca, I.G., Michel, T., Hoffmann, J.A., and Royet, J. (2004). Function of the Drosophila pattern-recognition receptor PGRP-SD in the detection of Gram-positive bacteria. Nat. Immunol. 5, 1175-1180.
Braun, A., Hoffmann, J.A., and Meister, M. (1998). Analysis of the Drosophila host defense in domino mutant larvae, which are devoid of hemocytes. Proc. Natl. Acad. Sci. U. S. A. 95, 14337-14342.
Braun, A., Lemaitre, B., Lanot, R., Zachary, D., and Meister, M. (1997). Drosophila immunity: analysis of larval hemocytes by P-element-mediated enhancer trap. Genetics 147, 623-634.
Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, S.M. (2003). bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113, 25-36.
Bruckner, K., Kockel, L., Duchek, P., Luque, C.M., Rorth, P., and Perrimon, N. (2003). Blood cell survival and development by the Drosophila PDGF/ VEGF Receptor (PVR). Europ. Dros. Res. Conf. 18, M04
Bubici, C., Papa, S., Pham, C.G., Zazzeroni, F., and Franzoso, G. (2006). The NF- kappaB-mediated control of ROS and JNK signaling. Histol. Histopathol. 21, 69-80. 187 Cantera, R., Roos, E., and Engstrom, Y. (1999). Dif and cactus are colocalized in the larval nervous system of Drosophila melanogaster. J. Neurobiol. 38, 16-26.
Cha, G.H., Cho, K.S., Lee, J.H., Kim, M., Kim, E., Park, J., Lee, S.B., and Chung, J. (2003). Discrete functions of TRAF1 and TRAF2 in Drosophila melanogaster mediated by c-Jun N-terminal kinase and NF-kappaB-dependent signaling pathways. Mol. Cell. Biol. 23, 7982-7991.
Chen, C.H., Guo, M., and Hay, B.A. (2006). Identifying microRNA regulators of cell death in Drosophila. Methods Mol. Biol. 342, 229-240.
Chen, C.Z., and Lodish, H.F. (2005). MicroRNAs as regulators of mammalian hematopoiesis. Semin. Immunol. 17, 155-165.
Chen, F.E., and Ghosh, G. (1999). Regulation of DNA binding by Rel/NF-kappaB transcription factors: structural views. Oncogene 18, 6845-6852.
Chen, L., and Chen, J. (2003). MDM2-ARF complex regulates p53 sumoylation. Oncogene 22, 5348-5357.
Chen, P., Lee, P., Otto, L., and Abrams, J. (1996). Apoptotic activity of REAPER is distinct from signaling by the tumor necrosis factor receptor 1 death domain. J. Biol. Chem. 271, 25735-25737.
Chen, P., Nordstrom, W., Gish, B., and Abrams, J.M. (1996). grim, a novel cell death gene in Drosophila. Genes Dev. 10, 1773-1782.
Chen, P., Rodriguez, A., Erskine, R., Thach, T., and Abrams, J.M. (1998). Dredd, a novel effector of the apoptosis activators reaper, grim, and hid in Drosophila. Dev. Biol. 201, 202-216.
Cho, N.K., Keyes, L., Johnson, E., Heller, J., Ryner, L., Karim, F., and Krasnow, M.A. (2002). Developmental control of blood cell migration by the Drosophila VEGF pathway. Cell 108, 865-876.
Christich, A., Kauppila, S., Chen, P., Sogame, N., Ho, S.I., and Abrams, J.M. (2002). The damage-responsive Drosophila gene sickle encodes a novel IAP binding protein similar to but distinct from reaper, grim, and hid. Curr. Biol. 12, 137-140.
Comerford, K.M., Leonard, M.O., Karhausen, J., Carey, R., Colgan, S.P., and Taylor, C.T. (2003). Small ubiquitin-related modifier-1 modification mediates resolution of CREB-dependent responses to hypoxia. Proc.Natl.Acad.Sci.U.S.A. 100, 986-991.
Crozatier, M., Ubeda, J.M., Vincent, A., and Meister, M. (2004). Cellular immune response to parasitization in Drosophila requires the EBF orthologue collier. PLoS Biol. 2, E196. 188 David, G., Neptune, M.A., and DePinho, R.A. (2002). SUMO-1 modification of histone deacetylase 1 (HDAC1) modulates its biological activities. J. Biol. Chem. 277, 23658- 23663.
De Gregorio, E., Spellman, P.T., Tzou, P., Rubin, G.M., and Lemaitre, B. (2002). The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 21, 2568-2579.
Dearolf, C.R. (1998). Fruit fly "leukemia". Biochim. Biophys. Acta 1377, M13-23.
Desterro, J.M., Rodriguez, M.S., and Hay, R.T. (1998). SUMO-1 modification of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2, 233-239.
Desterro, J.M., Thomson, J., and Hay, R.T. (1997). Ubch9 conjugates SUMO but not ubiquitin. FEBS Lett. 417, 297-300.
Dorstyn, L., Colussi, P.A., Quinn, L.M., Richardson, H., and Kumar, S. (1999). DRONC, an ecdysone-inducible Drosophila caspase. Proc. Natl. Acad. Sci. U. S. A. 96, 4307- 4312.
Drier, E.A., Govind, S., and Steward, R. (2000). Cactus-independent regulation of Dorsal nuclear import by the ventral signal. Curr. Biol. 10, 23-26.
Duvic, B., Hoffmann, J.A., Meister, M., and Royet, J. (2002). Notch signaling controls lineage specification during Drosophila larval hematopoiesis. Curr. Biol. 12, 1923-1927.
Engstrom, Y., Kadalayil, L., Sun, S.C., Samakovlis, C., Hultmark, D., and Faye, I. (1993). kappa B-like motifs regulate the induction of immune genes in Drosophila. J. Mol. Biol. 232, 327-333.
Epps, J.L., and Tanda, S. (1998). The Drosophila semushi mutation blocks nuclear import of bicoid during embryogenesis. Curr. Biol. 8, 1277-1280.
Evans, C.J., and Banerjee, U. (2003). Transcriptional regulation of hematopoiesis in Drosophila. Blood Cells Mol. Dis. 30, 223-228.
Evans, C.J., Hartenstein, V., and Banerjee, U. (2003). Thicker than blood: conserved mechanisms in Drosophila and vertebrate hematopoiesis. Dev. Cell. 5, 673-690.
Fernandez, N.Q., Grosshans, J., Goltz, J.S., and Stein, D. (2001). Separable and redundant regulatory determinants in Cactus mediate its dorsal group dependent degradation. Development 128, 2963-2974.
Ferrandon, D., Imler, J.L., and Hoffmann, J.A. (2004). Sensing infection in Drosophila: Toll and beyond. Semin. Immunol. 16, 43-53. 189 Fessler, L.I., Nelson, R.E., and Fessler, J.H. (1994). Drosophila extracellular matrix. Methods Enzymol. 245, 271-294.
Fogal, V., Gostissa, M., Sandy, P., Zacchi, P., Sternsdorf, T., Jensen, K., Pandolfi, P.P., Will, H., Schneider, C., and Del Sal, G. (2000). Regulation of p53 activity in nuclear bodies by a specific PML isoform. EMBO J. 19, 6185-6195.
Fossett, N., Hyman, K., Gajewski, K., Orkin, S.H., and Schulz, R.A. (2003). Combinatorial interactions of serpent, lozenge, and U-shaped regulate crystal cell lineage commitment during Drosophila hematopoiesis. Proc. Natl. Acad. Sci. U. S. A. 100, 11451-11456.
Fossett, N., and Schulz, R.A. (2001). Functional conservation of hematopoietic factors in Drosophila and vertebrates. Differentiation 69, 83-90.
Franc, N.C., Dimarcq, J.L., Lagueux, M., Hoffmann, J., and Ezekowitz, R.A. (1996). Croquemort, a novel Drosophila hemocyte/macrophage receptor that recognizes apoptotic cells. Immunity 4, 431-443.
Franc, N.C., Heitzler, P., Ezekowitz, R.A., and White, K. (1999). Requirement for croquemort in phagocytosis of apoptotic cells in Drosophila. Science 284, 1991-1994.
Ganguly, A., Jiang, J., and Ip, Y.T. (2005). Drosophila WntD is a target and an inhibitor of the Dorsal/Twist/Snail network in the gastrulating embryo. Development 132, 3419- 3429.
Gay, N.J., and Keith, F.J. (1991). Drosophila Toll and IL-1 receptor. Nature 351, 355- 356.
Georgel, P., Naitza, S., Kappler, C., Ferrandon, D., Zachary, D., Swimmer, C., Kopczynski, C., Duyk, G., Reichhart, J.M., and Hoffmann, J.A. (2001). Drosophila immune deficiency (IMD) is a death domain protein that activates antibacterial defense and can promote apoptosis. Dev. Cell. 1, 503-514.
Gerttula, S., Jin, Y.S., and Anderson, K.V. (1988). Zygotic expression and activity of the Drosophila Toll gene, a gene required maternally for embryonic dorsal-ventral pattern formation. Genetics 119, 123-133.
Gill, G. (2005). Something about SUMO inhibits transcription. Curr. Opin. Genet. Dev. 15, 536-541.
Gill, G. (2004). SUMO and ubiquitin in the nucleus: different functions, similar mechanisms? Genes Dev. 18, 2046-2059.
Giot, L., Bader, J.S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y.L., Ooi, C.E., Godwin, B., and Vitols, E. et al. (2003). A protein interaction map of Drosophila melanogaster. Science 302, 1727-1736. 190 Gobert, V., Gottar, M., Matskevich, A.A., Rutschmann, S., Royet, J., Belvin, M., Hoffmann, J.A., and Ferrandon, D. (2003). Dual activation of the Drosophila toll pathway by two pattern recognition receptors. Science 302, 2126-2130.
Gordon, M.D., Dionne, M.S., Schneider, D.S., and Nusse, R. (2005). WntD is a feedback inhibitor of Dorsal/NF-kappaB in Drosophila development and immunity. Nature 437, 746-749.
Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S.E., Scheffner, M., and Del Sal, G. (1999). Activation of p53 by conjugation to the ubiquitin-like protein SUMO- 1. EMBO J. 18, 6462-6471.
Goto, A., Kumagai, T., Kumagai, C., Hirose, J., Narita, H., Mori, H., Kadowaki, T., Beck, K., and Kitagawa, Y. (2001). A Drosophila haemocyte-specific protein, hemolectin, similar to human von Willebrand factor. Biochem. J. 359, 99-108.
Govind, S. (1999). Control of development and immunity by rel transcription factors in Drosophila. Oncogene 18, 6875-6887.
Govind, S. (1996). Rel signalling pathway and the melanotic tumour phenotype of Drosophila. Biochem. Soc. Trans. 24, 39-44.
Govind, S., and Nehm, R.H. (2004). Innate immunity in fruit flies: a textbook example of genomic recycling. PLoS Biol. 2, E276.
Gross, I., Georgel, P., Kappler, C., Reichhart, J.M., and Hoffmann, J.A. (1996). Drosophila immunity: a comparative analysis of the Rel proteins dorsal and Dif in the induction of the genes encoding diptericin and cecropin. Nucleic Acids Res. 24, 1238- 1245.
Haining, W.N., Carboy-Newcomb, C., Wei, C.L., and Steller, H. (1999). The proapoptotic function of Drosophila Hid is conserved in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 96, 4936-4941.
Han, Z.S., and Ip, Y.T. (1999). Interaction and specificity of Rel-related proteins in regulating Drosophila immunity gene expression. J. Biol. Chem. 274, 21355-21361.
Haracska, L., Torres-Ramos, C.A., Johnson, R.E., Prakash, S., and Prakash, L. (2004). Opposing effects of ubiquitin conjugation and SUMO modification of PCNA on replicational bypass of DNA lesions in Saccharomyces cerevisiae. Mol. Cell. Biol. 24, 4267-4274.
Harrison, D.A., Binari, R., Nahreini, T.S., Gilman, M., and Perrimon, N. (1995). Activation of a Drosophila Janus kinase (JAK) causes hematopoietic neoplasia and developmental defects. EMBO J. 14, 2857-2865. 191 Hashimoto, C., Hudson, K.L., and Anderson, K.V. (1988). The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein. Cell 52, 269-279.
Hawkins, C.J., Yoo, S.J., Peterson, E.P., Wang, S.L., Vernooy, S.Y., and Hay, B.A. (2000). The Drosophila caspase DRONC cleaves following glutamate or aspartate and is regulated by DIAP1, HID, and GRIM. J. Biol. Chem. 275, 27084-27093.
Hay, B.A., and Guo, M. (2006). Caspase-Dependent Cell Death in Drosophila. Annu. Rev. Cell Dev. Biol., E-publication ahead of print.
Hay, B.A., Huh, J.R., and Guo, M. (2004). The genetics of cell death: approaches, insights and opportunities in Drosophila. Nat. Rev. Genet. 5, 911-922.
Hayashi, T., Seki, M., Maeda, D., Wang, W., Kawabe, Y., Seki, T., Saitoh, H., Fukagawa, T., Yagi, H., and Enomoto, T. (2002). Ubc9 is essential for viability of higher eukaryotic cells. Exp. Cell Res. 280, 212-221.
Hayashi, N., Shirakura, H., Uehara, T., and Nomura, Y. (2006). Relationship between SUMO-1 modification of caspase-7 and its nuclear localization in human neuronal cells. Neurosci. Lett. 397, 5-9.
Hedengren, M., Asling, B., Dushay, M.S., Ando, I., Ekengren, S., Wihlborg, M., and Hultmark, D. (1999). Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol. Cell 4, 827-837.
Hedengren-Olcott, M., Olcott, M.C., Mooney, D.T., Ekengren, S., Geller, B.L., and Taylor, B.J. (2004). Differential activation of the NF-kappaB-like factors Relish and Dif in Drosophila melanogaster by fungi and Gram-positive bacteria. J. Biol. Chem. 279, 21121-21127.
Hetru, C., Troxler, L., and Hoffmann, J.A. (2003). Drosophila melanogaster antimicrobial defense. J. Infect. Dis. 187 Suppl 2, S327-34.
Hilgarth, R.S., Murphy, L.A., Skaggs, H.S., Wilkerson, D.C., Xing, H., and Sarge, K.D. (2004). Regulation and function of SUMO modification. J. Biol. Chem. 279, 53899- 53902.
Hilgarth, R.S. and Sarge, K.D. (2005). Detection of sumoylated proteins. Methods Mol. Biol. 301, 329-38.
Hoege, C., Pfander, B., Moldovan, G.L., Pyrowolakis, G., and Jentsch, S. (2002). RAD6- dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO. Nature 419, 135-141.
Hoffmann, J.A. (2003). The immune response of Drosophila. Nature 426, 33-38. 192 Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., and Ezekowitz, R.A. (1999). Phylogenetic perspectives in innate immunity. Science 284, 1313-1318.
Hoffmann, J.A., and Reichhart, J.M. (2002). Drosophila innate immunity: an evolutionary perspective. Nat. Immunol. 3, 121-126.
Hofmann, T.G., and Will, H. (2003). Body language: the function of PML nuclear bodies in apoptosis regulation. Cell Death Differ. 10, 1290-1299.
Holmstrom, S., Van Antwerp, M.E., and Iniguez-Lluhi, J.A. (2003). Direct and distinguishable inhibitory roles for SUMO isoforms in the control of transcriptional synergy. Proc. Natl. Acad. Sci. U. S. A. 100, 15758-15763.
Holz, A., Bossinger, B., Strasser, T., Janning, W., and Klapper, R. (2003). The two origins of hemocytes in Drosophila. Development 130, 4955-4962.
Horng, T., and Medzhitov, R. (2001). Drosophila MyD88 is an adapter in the Toll signaling pathway. Proc. Natl. Acad. Sci. U. S. A. 98, 12654-12658.
Hou, X.S., Melnick, M.B., and Perrimon, N. (1996). Marelle acts downstream of the Drosophila HOP/JAK kinase and encodes a protein similar to the mammalian STATs. Cell 84, 411-419.
Huang, L., Ohsako, S., Tanda, S., 2005. The Lesswright Mutation Activates Rel-Related Proteins, Leading to Overproduction of Larval Hemocytes in Drosophila melanogaster. Dev Biol 280, 407-420.
Hultmark, D. (1993). Immune reactions in Drosophila and other insects: a model for innate immunity. Trends Genet. 9, 178-183.
Imler, J.L., Ferrandon, D., Royet, J., Reichhart, J.M., Hetru, C., and Hoffmann, J.A. (2004). Toll-dependent and Toll-independent immune responses in Drosophila. J. Endotoxin Res. 10, 241-246.
Imler, J.L., and Hoffmann, J.A. (2003). Toll signaling: the TIReless quest for specificity. Nat. Immunol. 4, 105-106.
Imler, J.L., and Hoffmann, J.A. (2000). Signaling mechanisms in the antimicrobial host defense of Drosophila. Curr. Opin. Microbiol. 3, 16-22.
Ip, Y.T., and Davis, R.J. (1998). Signal transduction by the c-Jun N-terminal kinase (JNK)--from inflammation to development. Curr. Opin. Cell Biol. 10, 205-219.
Ip, Y.T., Reach, M., Engstrom, Y., Kadalayil, L., Cai, H., Gonzalez-Crespo, S., Tatei, K., and Levine, M. (1993). Dif, a dorsal-related gene that mediates an immune response in Drosophila. Cell 75, 753-763. 193 Irving, P., Ubeda, J.M., Doucet, D., Troxler, L., Lagueux, M., Zachary, D., Hoffmann, J.A., Hetru, C., and Meister, M. (2005). New insights into Drosophila larval haemocyte functions through genome-wide analysis. Cell. Microbiol. 7, 335-350.
Joanisse, D.R., Inaguma, Y., and Tanguay, R.M. (1998). Cloning and developmental expression of a nuclear ubiquitin-conjugating enzyme (DmUbc9) that interacts with small heat shock proteins in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 244, 102-109.
Johnson, E.S. (2004). Protein modification by SUMO. Annu. Rev. Biochem. 73, 355- 382.
Jung, S.H., Evans, C.J., Uemura, C., and Banerjee, U. (2005). The Drosophila lymph gland as a developmental model of hematopoiesis. Development 132, 2521-2533.
Kadalayil, L., Peterson, U., and Engstrom, Y. (1997). Adjacent GATA and B-like motifs regulate the expression of a Drosophila immune gene. Nucleic Acids Res. 25, 1233-1239.
Kaneko, T., and Silverman, N. (2005). Bacterial recognition and signalling by the Drosophila IMD pathway. Cell. Microbiol. 7, 461-469.
Khush, R.S., Leulier, F., and Lemaitre, B. (2001). Drosophila immunity: two paths to NF-kappaB. Trends Immunol. 22, 260-264.
Kidd, S. (1992). Characterization of the Drosophila cactus locus and analysis of interactions between cactus and dorsal proteins. Cell 71, 623-635.
Kimbrell, D.A., and Beutler, B. (2001). The evolution and genetics of innate immunity. Nat. Rev. Genet. 2, 256-267.
Kockel, L., Homsy, J.G., and Bohmann, D. (2001). Drosophila AP-1: lessons from an invertebrate. Oncogene 20, 2347-2364.
Kondo, M., Wagers, A.J., Manz, M.G., Prohaska, S.S., Scherer, D.C., Beilhack, G.F., Shizuru, J.A., and Weissman, I.L. (2003). Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu. Rev. Immunol. 21, 759-806.
Kurucz, E., Zettervall, C.-J., Sinka, R., Vilmos, P., Pivarcsi, A., Ekengren, S., Hegedus, Z., Ando, I., and Hultmark, D. (2003). Hemese, a hemocyte-specific transmembrane protein, affects the cellular immune response in Drosophila. Proc. Natl. Acad. Sci. 100, 2622–2627.
Kubota, K., and Gay, N.J. (1995). The dorsal protein enhances the biosynthesis and stability of the Drosophila I kappa B homologue cactus. Nucleic Acids Res. 23, 3111- 3118. 194 Kumar, S., and Doumanis, J. (2000). The fly caspases. Cell Death Differ. 7, 1039-1044.
Kunsch, C., Ruben, S.M., Rosen, C.A. (1992). Selection of optimal kappa B/Rel DNA- binding motifs: interaction of both subunits of NF-kappa B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12, 4412-4421.
Kuranaga, E., Kanuka, H., Igaki, T., Sawamoto, K., Ichijo, H., Okano, H., and Miura, M. (2002). Reaper-mediated inhibition of DIAP1-induced DTRAF1 degradation results in activation of JNK in Drosophila. Nat. Cell Biol. 4, 705-710.
Kwon, E.J., Park, H.S., Kim, Y.S., Oh, E.J., Nishida, Y., Matsukage, A., Yoo, M.A., and Yamaguchi, M. (2000). Transcriptional regulation of the Drosophila raf proto-oncogene by Drosophila STAT during development and in immune response. J. Biol. Chem. 275, 19824-19830.
Lagueux, M., Perrodou, E., Levashina, E.A., Capovilla, M., and Hoffmann, J.A. (2000). Constitutive expression of a complement-like protein in toll and JAK gain-of-function mutants of Drosophila. Proc. Natl. Acad. Sci. U. S. A. 97, 11427-11432.
Lanot, R., Zachary, D., Holder, F., and Meister, M. (2001). Postembryonic hematopoiesis in Drosophila. Dev. Biol. 230, 243-257.
Lavine, M.D., and Strand, M.R. (2002). Insect hemocytes and their role in immunity. Insect Biochem. Mol. Biol. 32, 1295-1309.
Lebestky, T., Chang, T., Hartenstein, V., and Banerjee, U. (2000). Specification of Drosophila hematopoietic lineage by conserved transcription factors. Science 288, 146- 149.
Lebestky, T., Jung, S.H., and Banerjee, U. (2003). A Serrate-expressing signaling center controls Drosophila hematopoiesis. Genes Dev. 17, 348-353.
Lee, Y.S., Jang, M.S., Lee, J.S., Choi, E.J., and Kim, E. (2005). SUMO-1 represses apoptosis signal-regulating kinase 1 activation through physical interaction and not through covalent modification. EMBO Rep. 6, 949-955.
Lehembre, F., Badenhorst, P., Muller, S., Travers, A., Schweisguth, F., and Dejean, A. (2000). Covalent modification of the transcriptional repressor tramtrack by the ubiquitin- related protein Smt3 in Drosophila flies. Mol. Cell. Biol. 20, 1072-1082.
Lemaitre, B., Kromer-Metzger, E., Michaut, L., Nicolas, E., Meister, M., Georgel, P., Reichhart, J.M., and Hoffmann, J.A. (1995). A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc. Natl. Acad. Sci. U. S. A. 92, 9465-9469. 195 Lemaitre, B., Meister, M., Govind, S., Georgel, P., Steward, R., Reichhart, J.M., and Hoffmann, J.A. (1995). Functional analysis and regulation of nuclear import of dorsal during the immune response in Drosophila. EMBO J. 14, 536-545.
Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., and Hoffmann, J.A. (1996). The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973-983.
Lemaitre, B., Reichhart, J.M., and Hoffmann, J.A. (1997). Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. U. S. A. 94, 14614-14619.
Leulier, F., Ribeiro, P.S., Palmer, E., Tenev, T., Takahashi, K., Robertson, D., Zachariou, A., Pichaud, F., Ueda, R., and Meier, P. (2006). Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery. Cell Death Differ., 13, 1663-74.
Leulier, F., Rodriguez, A., Khush, R.S., Abrams, J.M., and Lemaitre, B. (2000). The Drosophila caspase Dredd is required to resist gram-negative bacterial infection. EMBO Rep. 1, 353-358.
Li, W., Hesabi, B., Babbo, A., Pacione, C., Liu, J., Chen, D.J., Nickoloff, J.A., and Shen, Z. (2000). Regulation of double-strand break-induced mammalian homologous recombination by UBL1, a RAD51-interacting protein. Nucleic Acids Res. 28, 1145- 1153.
Ligoxygakis, P., Pelte, N., Hoffmann, J.A., and Reichhart, J.M. (2002a). Activation of Drosophila Toll during fungal infection by a blood serine protease. Science 297, 114- 116.
Ligoxygakis, P., Pelte, N., Ji, C., Leclerc, V., Duvic, B., Belvin, M., Jiang, H., Hoffmann, J.A., and Reichhart, J.M. (2002b). A serpin mutant links Toll activation to melanization in the host defence of Drosophila. EMBO J. 21, 6330-6337.
Lin, A. (2003). Activation of the JNK signaling pathway: breaking the brake on apoptosis. Bioessays 25, 17-24.
Lin X., Liang M., Liang Y.Y., Brunicardi, F.C., Feng X.H. (2003). SUMO-1/Ubc9 Promotes Nuclear Accumulation and Metabolic Stability of Tumor Suppressor Smad4. J. Biol. Chem. 278, 31043–48
Liu, H., Su, Y.C., Becker, E., Treisman, J., and Skolnik, E.Y. (1999). A Drosophila TNF- receptor-associated factor (TRAF) binds the ste20 kinase Misshapen and activates Jun kinase. Curr. Biol. 9, 101-104.
Look, A.T. (1995). Oncogenic role of "master" transcription factors in human leukemias and sarcomas: a developmental model. Adv. Cancer Res. 67, 25-57. 196 Lu, X., and Yi, J. (2005). SUMO-1 enhancing the p53-induced HepG2 cell apoptosis. J. Huazhong Univ. Sci. Technolog Med. Sci. 25, 289-291.
Luna, C., Wang, X., Huang, Y., Zhang, J., and Zheng, L. (2002). Characterization of four Toll related genes during development and immune responses in Anopheles gambiae. Insect Biochem. Mol. Biol. 32, 1171-1179.
Lunstrum, G.P., Bachinger, H.P., Fessler, L.I., Duncan, K.G., Nelson, R.E., and Fessler, J.H. (1988). Drosophila basement membrane procollagen IV. I. Protein characterization and distribution. J. Biol. Chem. 263, 18318-18327.
Luo, H., Hanratty, W.P., and Dearolf, C.R. (1995). An amino acid substitution in the Drosophila hopTum-l Jak kinase causes leukemia-like hematopoietic defects. EMBO J. 14, 1412-1420.
Luo, H., Rose, P., Barber, D., Hanratty, W.P., Lee, S., Roberts, T.M., D'Andrea, A.D., and Dearolf, C.R. (1997). Mutation in the Jak kinase JH2 domain hyperactivates Drosophila and mammalian Jak-Stat pathways. Mol. Cell. Biol. 17, 1562-1571.
Luo, H., Rose, P.E., Roberts, T.M., and Dearolf, C.R. (2002). The Hopscotch Jak kinase requires the Raf pathway to promote blood cell activation and differentiation in Drosophila. Mol. Genet. Genomics 267, 57-63.
Mahajan, R., Delphin, C., Guan, T., Gerace, L., and Melchior, F. (1997). A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88, 97-107.
Manfruelli, P., Reichhart, J.M., Steward, R., Hoffmann, J.A., and Lemaitre, B. (1999). A mosaic analysis in Drosophila fat body cells of the control of antimicrobial peptide genes by the Rel proteins Dorsal and DIF. EMBO J. 18, 3380-3391.
Martin, R., Lahlil, R., Damert, A., Miquerol, L., Nagy, A., Keller, G., and Hoang, T. (2004). SCL interacts with VEGF to suppress apoptosis at the onset of hematopoiesis. Development 131, 693-702.
Marx, J. (2005). Cell biology. SUMO wrestles its way to prominence in the cell. Science 307, 836-839.
Matsuzaki, K. (1998). Magainins as paradigm for the mode of action of pore forming polypeptides. Biochim. Biophys. Acta 1376, 391-400.
McCarthy, J.V., and Dixit, V.M. (1998). Apoptosis induced by Drosophila reaper and grim in a human system. Attenuation by inhibitor of apoptosis proteins (cIAPs). J. Biol. Chem. 273, 24009-24015.
Meier, P., Silke, J., Leevers, S.J., and Evan, G.I. (2000). The Drosophila caspase DRONC is regulated by DIAP1. EMBO J. 19, 598-611. 197 Meister, M. (2004). Blood cells of Drosophila: cell lineages and role in host defence. Curr. Opin. Immunol. 16, 10-15.
Meister, M., Hetru, C., and Hoffmann, J.A. (2000). The antimicrobial host defense of Drosophila. Curr. Top. Microbiol. Immunol. 248, 17-36.
Meister, M., and Lagueux, M. (2003). Drosophila blood cells. Cell. Microbiol. 5, 573- 580.
Melchior, F., Schergaut, M., and Pichler, A. (2003). SUMO: ligases, isopeptidases and nuclear pores. Trends Biochem. Sci. 28, 612-618.
Meng, X., Khanuja, B.S., and Ip, Y.T. (1999). Toll receptor-mediated Drosophila immune response requires Dif, an NF-kappaB factor. Genes Dev. 13, 792-797.
Michel, T., Reichhart, J.M., Hoffmann, J.A., and Royet, J. (2001). Drosophila Toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414, 756-759.
Minakhina, S., and Steward, R. (2006). Melanotic mutants in Drosophila: pathways and phenotypes. Genetics 174, 253-63.
Mishra, R.K., Jatiani, S.S., Kumar, A., Simhadri, V.R., Hosur, R.V., and Mittal, R. (2004). Dynamin interacts with members of the sumoylation machinery. J.Biol.Chem. 279, 31445-31454.
Miyauchi, Y., Yogosawa, S., Honda, R., Nishida, T., and Yasuda, H. (2002). Sumoylation of Mdm2 by protein inhibitor of activated STAT (PIAS) and RanBP2 enzymes. J. Biol. Chem. 277, 50131-50136.
Moreno, E., Yan, M., and Basler, K. (2002). Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by Eiger, the Drosophila homolog of the TNF superfamily. Curr. Biol. 12, 1263-1268.
Morisato, D. and Anderson, K.V. (1994). The spatzle gene encodes a component of the extracellular signaling pathway establishing the dorsal-ventral pattern of the Drosophila embryo. Cell 76, 677-688
Muller, S., Berger, M., Lehembre, F., Seeler, J.S., Haupt, Y., and Dejean, A. (2000). c- Jun and p53 activity is modulated by SUMO-1 modification. J. Biol. Chem. 275, 13321- 13329.
Muller, S., Hoege, C., Pyrowolakis, G., and Jentsch, S. (2001). SUMO, ubiquitin's mysterious cousin. Nat. Rev. Mol. Cell Biol. 2, 202-210.
Muller, S., Ledl, A., and Schmidt, D. (2004). SUMO: a regulator of gene expression and genome integrity. Oncogene 23, 1998-2008. 198 Munier, A.I., Doucet, D., Perrodou, E., Zachary, D., Meister, M., Hoffmann, J.A., Janeway, C.A.,Jr, and Lagueux, M. (2002). PVF2, a PDGF/VEGF-like growth factor, induces hemocyte proliferation in Drosophila larvae. EMBO Rep. 3, 1195-1200.
Munzert, G., Kirchner, D., Stobbe, H., Bergmann, L., Schmid, R.M., Dohner, H., and Heimpel, H. (2002). Tumor necrosis factor receptor-associated factor 1 gene overexpression in B-cell chronic lymphocytic leukemia: analysis of NF-kappa B/Rel- regulated inhibitors of apoptosis. Blood 100, 3749-3756.
Muratoglu, S., Garratt, B., Hyman, K., Gajewski, K., Schulz, R.A., and Fossett, N. (2006). Regulation of Drosophila Friend of GATA gene, u-shaped, during hematopoiesis: A direct role for Serpent and Lozenge. Dev. Biol. 296, 561-579.
Nacerddine, K., Lehembre, F., Bhaumik, M., Artus, J., Cohen-Tannoudji, M., Babinet, C., Pandolfi, P.P., and Dejean, A. (2005). The SUMO pathway is essential for nuclear integrity and chromosome segregation in mice. Dev. Cell. 9, 769-779.
Nagai, T., and Kawabata, S. (2000). A link between blood coagulation and prophenol oxidase activation in arthropod host defense. J. Biol. Chem. 275, 29264-29267.
Nelson, R.E., Fessler, L.I., Takagi, Y., Blumberg, B., Keene, D.R., Olson, P.F., Parker, C.G., and Fessler, J.H. (1994). Peroxidasin: a novel enzyme-matrix protein of Drosophila development. EMBO J. 13, 3438-3447.
Nicolas, E., Reichhart, J.M., Hoffmann, J.A., and Lemaitre, B. (1998). In vivo regulation of the IkappaB homologue cactus during the immune response of Drosophila. J. Biol. Chem. 273, 10463-10469.
Nordstrom, W., Chen, P., Steller, H., and Abrams, J.M. (1996). Activation of the reaper gene during ectopic cell killing in Drosophila. Dev. Biol. 180, 213-226.
Ooi, J.Y., Yagi, Y., Hu, X., and Ip, Y.T. (2002). The Drosophila Toll-9 activates a constitutive antimicrobial defense. EMBO Rep. 3, 82-87.
Pan, Y., and Chen, J. (2005). Modification of MDMX by sumoylation. Biochem. Biophys. Res. Commun. 332, 702-709.
Papa, S., Zazzeroni, F., Pham, C.G., Bubici, C., and Franzoso, G. (2004). Linking JNK signaling to NF-kappaB: a key to survival. J. Cell. Sci. 117, 5197-5208.
Pichler, A., and Melchior, F. (2002). Ubiquitin-related modifier SUMO1 and nucleocytoplasmic transport. Traffic 3, 381-387.
Potapova, O., Gorospe, M., Dougherty, R.H., Dean, N.M., Gaarde, W.A., and Holbrook, N.J. (2000). Inhibition of c-Jun N-terminal kinase 2 expression suppresses growth and induces apoptosis of human tumor cells in a p53-dependent manner. Mol. Cell. Biol. 20, 1713-1722. 199 Qiu, P., Pan, P.C., and Govind, S. (1998). A role for the Drosophila Toll/Cactus pathway in larval hematopoiesis. Development 125, 1909-1920.
Quinn, L.M., Dorstyn, L., Mills, K., Colussi, P.A., Chen, P., Coombe, M., Abrams, J., Kumar, S., and Richardson, H. (2000). An essential role for the caspase dronc in developmentally programmed cell death in Drosophila. J. Biol. Chem. 275, 40416- 40424.
Radtke, F., Wilson, A., and MacDonald, H.R. (2005). Notch signaling in hematopoiesis and lymphopoiesis: lessons from Drosophila. Bioessays 27, 1117-1128.
Ramet, M., Lanot, R., Zachary, D., and Manfruelli, P. (2002). JNK signaling pathway is required for efficient wound healing in Drosophila. Dev. Biol. 241, 145-156.
Reach, M., Galindo, R.L., Towb, P., Allen, J.L., Karin, M., and Wasserman, S.A. (1996). A gradient of cactus protein degradation establishes dorsoventral polarity in the Drosophila embryo. Dev. Biol. 180, 353-364.
Rehorn, K.P., Thelen, H., Michelson, A.M., and Reuter, R. (1996). A molecular aspect of hematopoiesis and endoderm development common to vertebrates and Drosophila. Development 122, 4023-4031.
Richardson, H., and Kumar, S. (2002). Death to flies: Drosophila as a model system to study programmed cell death. J. Immunol. Methods 265, 21-38.
Rizki, T.M., 1978. The circulatory system and associated cells and tissues. In: Ashburner, M., Wright, T.R.F. (Eds.), The Genetics and Biology of Drosophila, vol. 2b. Academic Press, New York, pp. 397– 452.
Rizki, R.M., and Rizki, T.M. (1979). Cell interactions in the differentiation of a melanotic tumor in Drosophila. Differentiation 12, 167-178.
Rizki, T.M., Rizki, R.M., and Grell, E.H., 1980. A mutant affecting the crystal cells in Drosophila melanogaster. Rouxs Arch. Dev. Biol. 188, 91–99.
Rizki, T.M., and Rizki, R.M.,1980. Properties of the larval hemocytes of Drosophila melanogaster. Experientia 36, 1223–1226.
Rizki, T.M., and Rizki, R.M. (1994). Parasitoid-induced cellular immune deficiency in Drosophila. Ann. N. Y. Acad. Sci. 712, 178-194.
Rizki, T.M., and Rizki, R.M. (1992). Lamellocyte differentiation in Drosophila larvae parasitized by Leptopilina. Dev. Comp. Immunol. 16, 103-110.
Rizki, T., Rizki, R., 1984. The cellular defense system of Drosophila melanogaster. In: King, R., Akai, H. (Eds.), Insect Ultrastructure, vol. 2. Plenum Press, New York, pp. 579– 604. 200 Rizki, T.M., and Rizki, R.M. (1983). Blood cell surface changes in Drosophila mutants with melanotic tumors. Science 220, 73-75.
Rizki, T.M., Rizki, R.M., and Bellotti, R.A. (1985). Genetics of a Drosophila phenoloxidase. Mol. Gen. Genet. 201, 7-13.
Rodriguez, A., Oliver, H., Zou, H., Chen, P., Wang, X., and Abrams, J.M. (1999). Dark is a Drosophila homologue of Apaf-1/CED-4 and functions in an evolutionarily conserved death pathway. Nat. Cell Biol. 1, 272-279.
Rodriguez, M.S., Desterro, J.M., Lain, S., Midgley, C.A., Lane, D.P., and Hay, R.T. (1999). SUMO-1 modification activates the transcriptional response of p53. EMBO J. 18, 6455-6461.
Ross, S., Best, J.L., Zon, L.I., and Gill, G. (2002). SUMO-1 Modification Represses Sp3 Transcriptional Activation and Modulates Its Subnuclear Localization. Mol. Cell 10, 831- 842.
Roth, S., Hiromi, Y., Godt, D., and Nusslein-Volhard, C. (1991). cactus, a maternal gene required for proper formation of the dorsoventral morphogen gradient in Drosophila embryos. Development 112, 371-388.
Ruhf, M.L., Braun, A., Papoulas, O., Tamkun, J.W., Randsholt, N., and Meister, M. (2001). The domino gene of Drosophila encodes novel members of the SWI2/SNF2 family of DNA-dependent ATPases, which contribute to the silencing of homeotic genes. Development 128, 1429-1441.
Rutschmann, S., Jung, A.C., Hetru, C., Reichhart, J.M., Hoffmann, J.A., and Ferrandon, D. (2000). The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity 12, 569-580.
Sampson, D.A., Wang, M., and Matunis, M.J. (2001). The small ubiquitin-like modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is essential for SUMO-1 modification. J. Biol. Chem. 276, 21664-21669.
Schmidt, O., and Theopold, U. (1997). Helix pomatia lectin and annexin V, two molecular probes for insect microparticles: possible involvement in hemolymph coagulation. J. Insect Physiol. 43, 667-674.
Schwartz, D.C., and Hochstrasser, M. (2003). A superfamily of protein tags: ubiquitin, SUMO and related modifiers. Trends Biochem. Sci. 28, 321-328.
Shao, R., Rung, E., Weijdegard, B., and Billig, H. (2006). Induction of apoptosis increases SUMO-1 protein expression and conjugation in mouse periovulatory granulosa cells in vitro. Mol. Reprod. Dev. 73, 50-60. 201 Shaulian, E., Schreiber, M., Piu, F., Beeche, M., Wagner, E.F., and Karin, M. (2000). The mammalian UV response: c-Jun induction is required for exit from p53-imposed growth arrest. Cell 103, 897-907.
Shen, B., Liu, H., Skolnik, E.Y., and Manley, J.L. (2001). Physical and functional interactions between Drosophila TRAF2 and Pelle kinase contribute to Dorsal activation. Proc. Natl. Acad. Sci. U. S. A. 98, 8596-8601.
Shen, B., and Manley, J.L. (2002). Pelle kinase is activated by autophosphorylation during Toll signaling in Drosophila. Development 129, 1925-1933.
Shen, B., and Manley, J.L. (1998). Phosphorylation modulates direct interactions between the Toll receptor, Pelle kinase and Tube. Development 125, 4719-4728.
Shirakura, H., Hayashi, N., Ogino, S., Tsuruma, K., Uehara, T., and Nomura, Y. (2005). Caspase recruitment domain of procaspase-2 could be a target for SUMO-1 modification through Ubc9. Biochem. Biophys. Res. Commun. 331, 1007-1015.
Shrestha, R., and Gateff, E. (1982). Ultrastructure and Cytochemistry of the Cell Types in the Larval Hematopoietic Organs and Hemolymph of Drosophila Melanogaster. Dev. Growth Differ. 24, 65-82
Sinenko, S.A., Kim, E.K., Wynn, R., Manfruelli, P., Ando, I., Wharton, K.A., Perrimon, N., and Mathey-Prevot, B. (2004). Yantar, a conserved arginine-rich protein is involved in Drosophila hemocyte development. Dev. Biol. 273, 48-62.
Smith, M., Bhaskar, V., Fernandez, J., and Courey, A.J. (2004). Drosophila Ulp1, a nuclear pore-associated SUMO protease, prevents accumulation of cytoplasmic SUMO conjugates. J. Biol. Chem. 279, 43805-43814.
Soderhall, K., and Cerenius, L. (1998). Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23-28.
Sorrentino, R.P., Carton, Y., and Govind, S. (2002). Cellular immune response to parasite infection in the Drosophila lymph gland is developmentally regulated. Dev. Biol. 243, 65-80.
Sorrentino, R.P., Small, C.N., and Govind, S. (2002). Quantitative analysis of phenol oxidase activity in insect hemolymph. BioTechniques 32, 815-6, 818, 820, 822-3.
Srinivasula, S.M., Datta, P., Kobayashi, M., Wu, J.W., Fujioka, M., Hegde, R., Zhang, Z., Mukattash, R., Fernandes-Alnemri, T., Shi, Y., Jaynes, J.B., and Alnemri, E.S. (2002). sickle, a novel Drosophila death gene in the reaper/hid/grim region, encodes an IAP- inhibitory protein. Curr. Biol. 12, 125-130. 202 Steffan, J.S., Agrawal, N., Pallos, J., Rockabrand, E., Trotman, L.C., Slepko, N., Illes, K., Lukacsovich, T., Zhu, Y.Z., and Cattaneo, E. et al. (2004). SUMO modification of Huntingtin and Huntington's disease pathology. Science 304, 100-104.
Stein, D., Goltz, J.S., Jurcsak, J., and Stevens, L. (1998). The Dorsal-related immunity factor (Dif) can define the dorsal-ventral axis of polarity in the Drosophila embryo. Development 125, 2159-2169.
Steller, H., Abrams, J.M., Grether, M.E., and White, K. (1994). Programmed cell death in Drosophila. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 345, 247-250.
Steward, R. (1987). Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel. Science 238, 692-694.
Steward, R., Ambrosio, L., and Schedl, P. (1985). Expression of the dorsal gene. Cold Spring Harb. Symp. Quant. Biol. 50, 223-228.
Steward, R., and Govind, S. (1993). Dorsal-ventral polarity in the Drosophila embryo. Curr. Opin. Genet. Dev. 3, 556-561.
Stoven, S., Ando, I., Kadalayil, L., Engstrom, Y., Hultmark, D. (2000). Activation of the Drosophila NF-kappaB factor Relish by rapid endoproteolytic cleavage. EMBO Rep. 1, 347-352.
Stoven, S., Silverman, N., Junell, A., Hedengren-Olcott, M., Erturk, D., Engstrom, Y., Maniatis, T., and Hultmark, D. (2003). Caspase-mediated processing of the Drosophila NF-kappaB factor Relish. Proc. Natl. Acad. Sci. U. S. A. 100, 5991-5996.
Stronach, B. (2005). Dissecting JNK signaling, one KKKinase at a time. Dev. Dyn. 232, 575-584.
Tauszig, S., Jouanguy, E., Hoffmann, J.A., and Imler, J.L. (2000). Toll-related receptors and the control of antimicrobial peptide expression in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 97, 10520-10525.
Tauszig-Delamasure, S., Bilak, H., Capovilla, M., Hoffmann, J.A., and Imler, J.L. (2002). Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat. Immunol. 3, 91-97.
Tenev, T., Zachariou, A., Wilson, R., Paul, A., and Meier, P. (2002). Jafrac2 is an IAP antagonist that promotes cell death by liberating Dronc from DIAP1. EMBO J. 21, 5118- 5129.
Tepass, U., Fessler, L.I., Aziz, A., and Hartenstein, V. (1994). Embryonic origin of hemocytes and their relationship to cell death in Drosophila. Development 120, 1829- 1837. 203 Theopold, U., Li, D., Fabbri, M., Scherfer, C., and Schmidt, O. (2002). The coagulation of insect hemolymph. Cell Mol. Life Sci. 59, 363-372.
Towb, P., Bergmann, A., and Wasserman, S.A. (2001). The protein kinase Pelle mediates feedback regulation in the Drosophila Toll signaling pathway. Development 128, 4729- 4736.
Varfolomeev, E.E., and Ashkenazi, A. (2004). Tumor necrosis factor: an apoptosis JuNKie? Cell 116, 491-497.
Vass, E., and Nappi, A.J. (2000). Developmental and immunological aspects of Drosophila-parasitoid relationships. J. Parasitol. 86, 1259-1270.
Waltzer, L., Ferjoux, G., Bataille, L., and Haenlin, M. (2003). Cooperation between the GATA and RUNX factors Serpent and Lozenge during Drosophila hematopoiesis. EMBO J. 22, 6516-6525.
Wang, Z.G., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R., and Pandolfi, P.P. (1998). PML is essential for multiple apoptotic pathways. Nat. Genet. 20, 266-272.
Watt, F.M., and Hogan, B.L. (2000). Out of Eden: stem cells and their niches. Science 287, 1427-1430.
Weber, A.N., Tauszig-Delamasure, S., Hoffmann, J.A., Lelievre, E., Gascan, H., Ray, K.P., Morse, M.A., Imler, J.L., and Gay, N.J. (2003). Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling. Nat. Immunol. 4, 794-800.
Welchman, R.L., Gordon, C., and Mayer, R.J. (2005). Ubiquitin and ubiquitin-like proteins as multifunctional signals. Nat. Rev. Mol. Cell Biol. 6, 599-609.
White, K., Grether, M.E., Abrams, J.M., Young, L., Farrell, K., and Steller, H. (1994). Genetic control of programmed cell death in Drosophila. Science 264, 677-683.
White, K., Tahaoglu, E., and Steller, H. (1996). Cell killing by the Drosophila gene reaper. Science 271, 805-807.
Wilson, R., Goyal, L., Ditzel, M., Zachariou, A., Baker, D.A., Agapite, J., Steller, H., and Meier, P. (2002). The DIAP1 RING finger mediates ubiquitination of Dronc and is indispensable for regulating apoptosis. Nat. Cell Biol. 4, 445-450.
Wing, J.P., Karres, J.S., Ogdahl, J.L., Zhou, L., Schwartz, L.M., and Nambu, J.R. (2002). Drosophila sickle is a novel grim-reaper cell death activator. Curr. Biol. 12, 131-135.
Wing, J.P., Schwartz, L.M., and Nambu, J.R. (2001). The RHG motifs of Drosophila Reaper and Grim are important for their distinct cell death-inducing abilities. Mech. Dev. 102, 193-203. 204 Wu, L.P., and Anderson, K.V. (1998). Regulated nuclear import of Rel proteins in the Drosophila immune response. Nature 392, 93-97.
Xirodimas, D.P., Chisholm, J., Desterro, J.M., Lane, D.P., and Hay, R.T. (2002). P14ARF promotes accumulation of SUMO-1 conjugated (H)Mdm2. FEBS Lett. 528, 207-211.
Xu, P., Guo, M., and Hay, B.A. (2004). MicroRNAs and the regulation of cell death. Trends Genet. 20, 617-624.
Yamashita, Y.M., Fuller, M.T., and Jones, D.L. (2005). Signaling in stem cell niches: lessons from the Drosophila germline. J. Cell. Sci. 118, 665-672.
Yang, S.H., Jaffray, E., Hay, R.T., and Sharrocks, A.D. (2003). Dynamic interplay of the SUMO and ERK pathways in regulating Elk-1 transcriptional activity. Mol. Cell 12, 63- 74.
Yeh, E.T., Gong, L., and Kamitani, T. (2000). Ubiquitin-like proteins: new wines in new bottles. Gene 248, 1-14.
Zachariou, A., Tenev, T., Goyal, L., Agapite, J., Steller, H., and Meier, P. (2003). IAP- antagonists exhibit non-redundant modes of action through differential DIAP1 binding. EMBO J. 22, 6642-6652. 205
Appendix A: Identification of Dl and Dif target genes through genome-wide microarray analysis
A.1 Summary The lwr mutation and the Tl10B mutation lead to overproduction of plasmatocytes, premature differentiation of lamellocytes, and formation of melanotic tumors in Drosophila larva. Both lwr and Tl10B mutations activate the Rel-related transcription factors Dl and Dif. To identify genes responsible for hemocyte production, microarray assays were performed to measure the genome-wide expression changes in the lwr, lwr cactus and Tl10B mutant larvae (lwr cactus samples were prepared by Jinu Abraham). The microarray chip (Affymetrix) includes 13,500 genes, which covers all of known and predicted genes released in FlyBase (version 1). In the lwr, lwr cact and Tl10B mutants, 334, 91, and 202 genes showed significant increases in their expression levels, respectively. 260, 96, and 418 genes showed significant decreases in their expression levels, respectively. These genes included antimicrobial peptides, prophenoloxidases, transcription factors, membrane receptors, extracellular matrix proteins, proteases, microbe pattern recognition proteins, RNA binding proteins, and protein related to signal transduction. Since I was interested in the target genes of Dl and Dif, I reasoned that Dl and Dif downstream genes should contain B sites in their promoter regions. After analyzing the upstream regulatory regions of some genes, 26 genes with B sites in their regulatory regions were selected and tested using Dual-Luciferase assays (see Chapter 3).
A.2 Materials and methods A.2.1 Drosophila culture conditions and stocks Flies were cultured in JAZZ mix (Fisher Scientific) supplemented with inactive brewer’s yeast (SAP Product Corporation) and soy flour (ADM). JAZZ mix was cooked in a steam kettle according to the manufacturer’s instructions. The stocks were maintained at room temperature, and the experiments were conducted in uncrowded conditions at 25°C.
A.2.2 Microarray assays 30 frozen larvae were homogenized in 600 l of RNeasy lysis buffer (QIAGEN) supplement with -mercaptoethanol with a plastic pestle. Total RNA samples were prepared with the RNeasy kit (QIAGEN) according to the manufacturer’s instructions. Double-stranded cDNAs were synthesized from total RNA using the GeneChip T7- Oligo(dT) Promoter Primer Kit (Affymetrix) and the SupersScript Choice Kit (Invitrogen). Biotin-Labeled cRNAs were prepared, cleaned up, fragmented, and mixed with the eukaryotic hybridization control cocktail following Affymetrix’s instruction manual. All of the samples were hybridized with Affymetrix Drosophila GeneChip microarrays at the microarray core facility at University of Massachusetts. For each genotype, three independent samples were analyzed. Heterozygous larvae in the same culture with the corresponding experimental sample were used as controls for lwr and lwr Cactus mutants. The Canton-S (wild type) larvae were used as control for Tl10B mutants. 206 All of the microarray raw data were analyzed with the Affymetrix Microarray Suite and the Data Mining Tool (Affymetrix). In most cases, present calls are required in both experimental and control samples to be considered as valid data. I used a t-test to determine significant increases or decreases in expression level between the mutants and controls.
A.3 Results I used lwr4-3/lwr5, lwr4-3 cact4/lwr5 cact1, and Tl10B mutant larvae as starting material because all of these mutants produced excess amounts of hemocytes (23.0 106, 17.2 106 and 20.1 106 per ml of hemolymph, respectively; Huang et al., 2005, Jinu Abraham, personal communication). Many lamellocytes were also produced in these larvae, lwr cact double mutant in particular. By comparing the expression profiles of these mutants, genes related to plasmatocyte and lamellocyte production may be identified. In these three genotypes, more than 1,400 genes showed significant change in their expression level. An arbitrary level of 3-fold change in the expression was set to select genes that are most likely to be affect in the mutants. Some of these genes were structural genes of known function, such as Actin, Myosin and Tubulin. Others were genes related to humoral immunity, such as antimicrobial peptide genes and genes encoding bacteria pattern recognition protein. These genes are less likely to be hematopoiesis related genes. One important aspect of this study was that the samples I chose were whole larvae. Hematopoietic tissues occupied only a small portion of the total body mass so that the expression change of some genes could be masked by the global expression level. However, we still saw expression change of known immunity genes and hematopoietic genes, which in part, validated my data. Some of the genes identified in this research were also described in another genome-wide analysis (Irving et al, 2005). The microarray assay results provided a starting point for a more intensive characterization of candidate genes that play roles in hemocyte production. Later studies will be performed in a case- by-case manner. In the following two sections, I will describe selected genes that exhibited significant increases or decreases in expression level.
A.3.1 Genes showed significant increase in the mutant larvae Table A.1 lists selected genes that were upregulated in the mutants. These genes can be divided into several groups. Cell adhesion molecules, CG6788 and CG14762 were highly expressed in Tl10B and/or lwr cact mutants. The expression of the integrin PS4 gene was upregulated in the lwr mutants. The Extra-cellular matrix (ECM) protein CG5550 was strongly expressed in the Tl10B and lwr cact mutants. The expression of ECM proteins may be related to plasmatocyte and lamellocyte function. Plasmatocyte are known to play a role in extra-cellular matrix production (Fessler et al., 1994). Cell adhesion molecules and integrins may be involved in hemocyte migration and encapsulation. The integrin PS4 was found to express only in lamellocytes, but not plasmatocytes (Irving et al., 2005).
207 Table A.1 Genes showed significant increases in lwr, lwr cact and Tl10B mutant larvae. The function information was retrieved from Affymetrix probe annotation or FlyBase. The sequences within 2 kb upstream of the transcription start were analyzed for B sites. Gene Function Fold Increase B site Increase observed in the Tl10B mutants CG14762 Cell Adhesion 15.3 X 1 niki Serine/Threonine kinase 19.9 X 2 CG4753 IP3 pathway 5.6 X 0 Increase observed in the lwr mutants PS4 Integrin 13.3 X 1 CG13843 RNA binding protein 5.2 X 0 Androcam Ca++ binding 3.6 X 0 CG13405 Exocytosis 3.2 X 1 Fmo-2 N-oxide production 3.0 X 1 wunen-2 Germ cell migration 2.9 X 1 Rapgap1 GAP 2.6 X 0 Increase observed in the lwr cact double mutants CG4716 Cytoskeleton; Intracellular transport 8.8 X 2 IM10 Immune response 7.2 X 2 Lectin-24A Galactose binding 6.4 X 2 CG8093 Glycerolipid metabolism 3.9 X 4 PGRP-SD Peptidoglycan recognition 3.7 X 3 CG6687 Serpin 3.6 X 0 TepII Protease inhibitor 3.3 X 2 Pof RNA binding 3.3 X 2 Damm Caspase; Apoptosis 3.2 X 1 Mthl3 G protein-coupled receptor 3.0 X 1 Increase observed in both Tl10B and lwr cact double mutants CG6788 Cell Adhesion 41.5 X 1 CG5550 Extracellular Matrix 16.3 X 1 Increase observed in both lwr and lwr cact double mutants Mthl2 G protein-coupled receptor 11.8 X (lwr) 0 Mthl4 G protein-coupled receptor 6.6 X (lwr) 0 CG14610 Unknown 32 X (lwr) 0 Dox-A3 Prophenoloxidase 28.3 X (lwr) 1 Tsf1 Ion Transport 2.7 X (lwr) 4
Signaling proteins, such as the G protein-coupled receptors Mthl3, Mthl2, and Mthl4, kinases and the CG4753, which is involved in the inositol 1,4,5-triphosphate (IP3) pathway, were another group of genes upregulated in these mutants. The functions of these proteins await investigation.
A.3.2 Genes showed significant decrease in the mutant larvae Compared with genes showing increase in the mutant larvae, most genes showing decrease were not well characterized (Table A.2). When the expression profiles were 208 compared among the three mutant phenotypes, I recognized some divergence. Some genes were down regulated in one genotype, but were highly expressed in another genotype. For example, the expression level of CG18606, LvpL, and CG7658 were decrease by ~3-fold in lwr mutants, but increase 6.1-46 fold in the Tl10B larvae. Genes CG10859, CG13843, Pof, ocnus, Androcam, CG6304, CG7300, and CG4750 were downregulated in the Tl10B mutants, but were upregulated in either lwr or lwr cact mutants. These results suggest that even though Tl10B, lwr and lwr cact mutants exhibited similar phenotypes, substantial differences in gene expression were present among the three. For example, The percentage of lamellocyte in the lwr or lwr cact double mutant larvae is much higher than that of the Tl10B mutant larvae (Huang et al., 2005, Jinu Abraham, personal communication). The lwr mutation also causes an increase in hemocyte apoptosis.
Table A.2 Genes showed significant decrease in lwr, lwr cact and Tl10B mutant larvae The function information was retrieved from Affymetrix probe annotation or FlyBase. The sequences within 2 kb upstream of the transcription start were analyzed for B sites. Gene Function Fold Decrease B site Decrease observed in the Tl10B mutants ImpE2 Ecdysone related 55 X 0 CG5050 Unknown 42 X 0 CG14540 Unknown 31 X 0 CG31802 Calmodulin binding 14 X 0 Prat2 Amidophosphoribosyl transferase 11 X 1 CG16719 Unknown 7.8 X 3 CG9975 Unknown 7.5 X 0 Ama Cell adhesion; Antigen binding 6.4 X 3 Eig71Ee Ecdysone related 6.2 X 2 iHog Hh receptor 5.9 X 1 CG15109 Unknown 5.4 X 3 CG10862 Ubiquitin conjugase 5.3 X 1 CG3610 Unknown 5.2 X 2 Thor eIF4E binding 5 X 1 Decrease observed in the lwr mutants CG15308 Unknown 2.9 X 1 CG11300 Unknown 2.8 X 0 Decrease observed in the lwr cact double mutants cramped DNA binding -- 1 Decrease observed in both Tl10B and lwr mutants yellow-d2 Unknown 6.3 X 3 CG5866 Unknown 3.5 X 1 CG15404 Unknown 3.3 X 2 Tsp42Ep Unknown 3.3 X 0
Downregulation of the Ecdysone related genes, ImpE2 and Eig71Ee, were observed in the Tl10B mutant larvae. It was reported that immune challenge could 209 decrease the expression level of the Ecdysone related genes (Irving et al., 2005). Similarly the Tl10B mutation constitutively activates the Tl signaling, which mimics certain immune challenged situations. This result indicates that immune challenge repressed the expression of the Ecdysone related genes through the Tl signaling pathway.
A.3.3 B sites are present in most of the genes identified in the microarray assays Most of the genes in Table A.1 and Table A.2 contain B sites in their regulatory region. These were the genes that immediately drew my attention because they could be direct target genes of Dl and Dif. The functions of Dl and Dif in hemocyte production had been well established in our previous study (Huang et al., 2005). The target genes of Dl and Dif should include genes that are related to Drosophila hematopoiesis. To select candidate genes for further analysis, I cloned the regulatory regions of some of these genes and tested them using a Dual-Luciferase reporter assay. The reporter assay data were presented in Chapter 3 of this dissertation.
210
Appendix B: Summary of B sites
Note: 1. Multiple B sites of the same gene are labeled as xxx_1, xxx_2 etc. 2. Orientation: R, reverse; W, after transcription start. 3. Gene groups correspond to the gene groups in Chapter 3.