Evolutionary Analysis of Minor Histocompatibility Genes in Hydra

Evolutionary Analysis of Minor Histocompatibility Genes In Hydra

Thesis By

Nojood Adel Ali Aalismail

In partial Fulfillment of the Requirements

For the Degree of Master

King Abdullah University of Science and Technology Thuwal, Kingdom of Saudi Arabia

Nojood Adel Ali Aalismail

EXAMINATION COMMITTEE APPROVALS FORM

Committee Chairperson: Prof. Takashi Gojobori Committee Members: Prof. Arnab Pain, Dr. Katsuhiko Mineta

ABSTRACT

Evolutionary Analysis of Minor Histocompatibility Genes In Hydra

Nojood Aalismail

Hydra is a simple freshwater solitary polyp used as a model system to study evolutionary aspects. The immune response of this organism has not been studied extensively and the immune response genes have not been identified and characterized. On the other hand, immune response has been investigated and genetic analysis has been initiated in other lower invertebrates.

In the present study we took initiative to study the self/nonself recognition in

hydra and its relation to the immune response. Moreover, performing

phylogenetic analysis to look for annotated immune genes in hydra gave us a

potential to analyze the expression of minor histocompatibility genes that have

been shown to play a major role in grafting and transplantation in mammals.

Here we obtained the cDNA library that shows expression of minor

histocompatibility genes and confirmed that the annotated sequences in

databases are actually present. In addition, grafting experiments suggested,

although still preliminary, that homograft showed less rejection response than in

heterograft. Involvement of possible minor histocompatibility gene orthologous in

immune response was examined by qPCR. 4

ACKNOWLEDGMENTS

I would like to express my gratitude to my supervisor Prof. Takashi Gojobori, my

peacemaker Dr. Katsuhiko Mineta for being there whenever I need him, Dr.

Hiroshi Shimizu, Dr. Yoshimoto Saito, and Dr. Hayedeh Behzad for their support,

time and effort and the whole group’s members for spending times to help and

assist me.

I am very grateful for the people who encouraging me to realize my dreams and

reach the stars, my parents and my sisters, I would never be able to thank them

enough. This work would not be possible without getting support, love and

patience from my superhero my husband and my little princesses my daughters. 5

TABLE OF CONTENTS

EXAMINATION COMMITTEE APPROVALS FORM ...... 2 ABSTRACT ...... 3 ACKNOWLEDGMENTS ...... 4 TABLE OF CONTENTS ...... 5 LIST OF ABBREVIATIONS ...... 7 LIST OF FIGURES ...... 8 LIST OF TABLES ...... 9 1. INTRODUCTION ...... 10 1.1 IMMUNOLOGY OF TRANSPLANTATION ...... 10 1.1.1 HISTOCOMPATIBILITY ...... 11 1.2 RECOGNITION OF SELF AND NON-SELF IN TRANSPLANT ...... 12 1.3 LOWER INVERTEBRATES HISTOCOMPATIBILITY ...... 13 1.4 HYDRA ...... 14 1.5 AIM AND OBJECTIVES ...... 15 2. MATERIALS AND METHODS ...... 17 2.1 BIOINFORMATICS ...... 17 2.1.1 DATABASE SEARCH ...... 17 2.1.2 PHYLOGENETIC ANALYSIS ...... 18 2.2 MOLECULAR BIOLOGY EXPERIMEMNTS ...... 19 2.2.1 MATERIAL: HYDRA ...... 19 2.2.2 cDNA LIBRARY ...... 19 2.2.2.1 RNA EXTRACTION ...... 20 2.2.2.2 REVERSE TRANSCRIPTION...... 21 2.2.2.3 PREPARING THE PRIMERS FOR CLONING AND qPCR ...... 21 2.2.2.4 POLYMERASE CHAIN REACTION ...... 23 2.2.2.5 GEL ELECTROPHORESIS ...... 23 2.2.2.6 A TAILING ...... 24 2.2.2.7 PURIFICATION ...... 24 2.2.2.8 TA CLONING ...... 25 2.2.2.9 TRANSFORMATION ...... 26 2.2.2.10 COLONY PCR ...... 26 2.2.2.11 PLASMID ISOLATION ...... 27 2.2.2.12 SEQUENCING ...... 28 2.2.3 GRAFTING ...... 28 2.2.4 qPCR ...... 29 3. RESULTS AND DISCUSSION ...... 31 6

3.1 DATABASE SEARCH FOR THE CANDIDATES ...... 31 3.1.1 PHYLOGENETIC ANALYSIS ...... 31 3.1.2 ALIGNMENT ...... 32 3.2 MOLECULAR EXPERIMENTS ...... 36 3.2.1 RNA EXTRACTION ...... 36 3.2.2 PCR AMPLIFICATION OF THE CANDIDATES ...... 36 3.3.3. CLONING OF THE CANDIDATES ...... 36 3.3.2 PLASMID ISOLATION ...... 37 3.3.3 SEQUENCING THE CLONED CANDIDATES ...... 39 3.3.4 GRAFTING HYDRA ...... 39 3.3.5 qPCR ...... 40 5.CONCLUSION ...... 47 SUPPLEMENTARY INFORMATION ...... 48 THE INNATE IMMUNE SYSTEM ...... 48 THE ADAPTIVE IMMUNE SYSTEM ...... 49 CORALS ...... 51 SPONGES ...... 52 PROTOCHORDATE ...... 52 AMOEBAE ...... 53 HYDROZOAN ...... 54 6. REFERENCES ...... 58

LIST OF ABBREVIATIONS

°C Degree Celsius ALF-1 Allograft Inflammatory Factor alr Alorecognition B cells Bone Marrow cDNA Complementary Deoxynucleic Acid cm Centimeters dH2O Distilled Water dNTPs Deoxyribonucleotides E.coli Escherichia Coli FuHC Fusion/Histocompatibility g Gram GO Gene Ontology IgSF Immunoglobulin Super Gene IPTG 5-Bromo-4-Chloro-3-Indolyl-Beta-D-Galactopyranoside Lag Lymphocyte Activation Gene LB Lysogeny Broth MEGA Molecular Evolutionary Genetics Analysis MgSO4 Magnesium Sulfate MHC Major Histocompatibility Complex MiHC Minor Histocompatibility complex ml Milliliter NCBI National Center for Biotechnology Information Pfam Protein families database Pfu Pyrococcus Furiosus rcf Relative Centrifugal Force RNA Ribonucleic Acid S.O.C Super Optimal Broth With Catabolite Repression T cells Thymus TAE Tris Acetate Ethylenediaminetetracetic Acid TCF T Cell-Like Transcription Factor Uniprot Universal Protein Resource X-Gal 5-Bromo-4-Chloro-3-Indolyl-Beta-D-Galactopyranoside μl Microliter 8

LIST OF FIGURES

Figure 1. The map of 3929 nucleotides linearized vector pCR2.1. M13 forward priming site: 380-404 bases. M13 reverse priming site: 205-221 bases. The insert site is labeled as PCR product...... 25 Figure 2. The phylogenetic tree of minor histocompatibility antigen H13. Hydra002156408.3 is annotated H13 in databases being in the same cluster with known H13 in Nematostella, Oyster and Human. Hydra004210749.2 is single peptide peptidase like3 and Hydra002165994.2 is single peptide peptidase 2B like are H13 candidates...... 33 Figure 3. Alignment result between Hydra HA-1 and Human HA-1 amino acids. Red indicates good alignment; yellow indicates average alignment while green indicates bad alignment...... 34 Figure 4. Alignment result between Hydra H13 and three Human H13 amino acids. Red indicates good alignment; yellow indicates average alignment while green indicates bad alignment...... 35 Figure 5. Gel electrophoresis of template cDNA PCR ...... 38 Figure 6. Gel electrophoresis of Colony PCR...... 41 Figure 7. Alignment result between annotated sequence of HA-1 in database (the first sequence) and the obtained sequence by Sanger sequencing. Red color shows 100% identity ...... 43 Figure 8. Alignment result between annotated sequences of H13 and single peptide peptidase like-3 in database (the first sequences) and the obtained sequences by Sanger sequencing. Red color shows 100% identity…………………………………………………….…………………………….44 Figure 9. Grafted individuals. A and B present grafted animals from the same species 105. C and D present grafted animals from swiss (the lighter color parts) and 105 ( the darker color parts)…………………………………………………………………………………….45 Figure 10. qPCR result. Showing three histocompatibility genes as a target for studying their expression in different samples. HA1, minor histocompatibility protein. H13, minor histocompatibility antigen. Like-3, single peptide peptidase like-3. Incompatible, grafted hydra by different strains. Compatible, grafted hydra by the same strain. Normal, non-grafted hydra…………………………………………………………..…………………….....46

LIST OF TABLES

Table 1. Sequences of HA-1, H13, Single Peptide Peptidase-like3 orward and reverse primers...... 22 Table 2. Set of primers for real time PCR...... 22 Table 3. Polymerase Chain Reactions conditions ...... 23 Table 4. Colony PCR conditions...... 27 Table 5. qPCR coditions...... 30 Table 6. Wight of animals used to extract RNA and RNSA concentration ...... 36 Table 7. The PCR products sizes with HA-1 and H13 primers ...... 37 Table 8. White blue screening ...... 37 Table 9. Colony PCR results ...... 38 Table 10. Isolated plasmids concentrations by nanodrop...... 41 Table 11. Submitted samples data. Shows 8 plasmids samples of HA-1 inserts by different sites of primers, 2 plasmids samples of H13 inserts by different sites of primers and 2 plasmid samples of single peptide peptidase like 3 inserts by different sites of primers...... 42 Table 12. Accession numbers of matched expected sequences in NCBI...... 42 10

1. INTRODUCTION 1.1 IMMUNOLOGY OF TRANSPLANTATION

The immune system is distributed over the body, consisting of a combination of different cells that work as a team to protect the organism from infectious agents such as viruses and bacteria (Parham and Janeway 2009).

In human immunology, organ transplant that started in 1954 as kidney transplant was a trigger for the immune research to advance to the new phase. Although the first kidney transplant was carried out successfully between identical twins resulting in allograft, usual transplant called as heterograft caused massive immune response termed transplant rejection that is involved plural kinds of immune systems. Overcoming the transplant rejection has become a major issue in immunological medicine.

This also led to the progress of basic immunology research as well. Typically, histocompatibility mediated by major histocompatibility complex (MHC) and minor histocompatibility complex (MiHC) has been studied extensively as the key mechanism of immune response.

A question that arises from evolutionary point of view is how MHC and MiHC system appeared and developed during the evolution of multicellular organisms.

Information available about this issue is, in fact, quite limited. This is because the research was concentrated to studies in mammals for the medical purposes. 11

1.1.1 HISTOCOMPATIBILITY

Histocompatibility is an important factor in organ transplantation in human

medicine. Histocompatibility is the level of acceptance or rejection of tissues or

cells from different individuals to be grafted (Brown and Eklund 1994).

This response is controlled by one of proteins termed major histocompatibility complex (MHC) that exposed on the cell surface. The primary role of this protein

is to present a pathogen’s antigen on the surface of the infected cell or

macrophage that engulfed the pathogen to be detected by cells in the adaptive

immune system (Unanue 1984).

Furthermore, there are three classes of MHC family proteins: MHC class I, MHC

class II and MHC class III. MHC class I proteins present on nucleated cells; it

plays a role in differentiating the healthy cells from the infected ones. In other

words, healthy cells are presenting a self antigen onto its MHC class I, so that

the immune cells recognized that these are normal peptides (Vanbleek and

Nathenson 1991).

In particular, there are many studies that described the binding peptides to the

groove binding site in MHC class I. This peptide is called minor histocompatibility

antigen (Falk et al. 1991).

Minor histocompatibility antigens are peptides that are presented on the cell surfaces by MHC class I (York and Rock 1996). Complex of minor histocompatibility antigen and major histocompatibility complex play a role in allograft rejection and transplantation.

If amino acid sequences of minor histocompatibility antigens were mismatched even if the major histocompatibility complexes were matched between grafted donor and recipient in transplantation, rejection may occur (Auchincloss and

Sultan 1996). Matching and mismatching can be recognized by the different receptors on cells of the immune system (Litman and Dishaw 2013).

1.2 RECOGNITION OF SELF AND NON-SELF IN TRANSPLANT

Various studies have demonstrated that histocompatibility plays a critical role in the recognition system and its reactions in vertebrates and invertebrates (Goulmy et al. 1996) (Spierings 2014).

Grafting is, in general, a process where a tissue or part of one individual is transplanted to another individual either from the same strain or a different one.

The recipient has the ability to reject or accept the transplanted tissue as a function of minor histocompatibility complex as described in the case of human

(Dierselhuis, 2009).

The competition for the limited space on a substrate, for example, makes the histocompatibility reaction vary from fusion to rejection to transitory fusion

(Grosberg 1988) (Dishaw and Litman 2009).

1.3 LOWER INVERTEBRATES HISTOCOMPATIBILITY

Histocompatibility has been studied in many organisms in terms of diversity

(Piertney and Oliver 2006) and polymorphism (Lakkis, Dellaporta, and Buss

2008) (Potts and Wakeland 1990). (See supplementary information).

Here, a basic question arises: Apart from the medical and manmade organ transplant, were there other “surgeons” who, not only in human history but also in the history of multicellular organisms, made allografts and heterografts? Of course, the answer is NO! However, we can find a kind of similar phenomenon in reef building corals.

Corals belong to class Anthozoa of phylum Cnidaria, and Anthozoa is the most ancestral class of the phylum. Colonies of reef building corals, when they make direct contact with each other, show apparent immune response. They either fuse with each other as the same individual or reject each other as the different one.

In the former case, there is no apparent change in the appearance of the two colonies. In contrast, in the latter case, the defense system works on both sides of the contact surface, finally killing tissue.

This result is currently popular, so called “bleaching of corals” but only in a narrow bands along the contact surface (Notice that the popular “coral bleaching” occurs not as the result of immune response but because of high temperature of seawater, or attack by Acanthaster, for example). This phenomenon is similar to transplant rejection in heterograft.

This naturally suggests a possibility that immune response in reef building corals could be a possible experimental system to investigate the origin of allorecognition and heterorecognition. However, corals are not an easy material to deal with for many reasons.

1.4 HYDRA

Here in the present study, we chose Hydra as the assay system. Hydra belongs to class Hydrozoa of phylum Cnidaria and the descendant of Anthozoans. Hydra is a freshwater organism, which adapted to freshwater environment when freshwater lakes and ponds developed.

Hydra formed osmolality barrier on its surface, and this made direct contact between tissues from different individuals. To this end, it is unclear and hence it 15

is worth to examine whether Hydra immune system is activated when tissue from

different individuals come into direct contact with each other. Since heterograft caused transplant rejection in mammals, it could be a natural outcome that the analysis in Hydra could cause rejection of a sort.

There is supporting information for this possible undertaking:

1) Experimental analysis using allografts have been carried out extensively

(Shimizu, 2012).

2) There is evidence of phagocytosis activated by grafting (Terada et al., 1988).

3) Phylogenetically distant strains are available that could cause

histocompatibility.

4) Genome data is available which makes it easy to do genomic analysis

(Chapman et al. 2010). 16

1.5 AIM AND OBJECTIVES

Based on these backgrounds, we think that the immune system in hydra should

be examined extensively. The aim of this research in my master thesis is to study

the immune response of Hydra by conservation and expression analyses of

genes in hydra that are orthologous to human MiHC genes if they are.

Objectives in this study to attain the aim are described below.

1) Genomic search for MiHC class related genes in Hydra genome to find a

possible MiHC orthologous.

2) Construction of transplant of two Hydra tissues with phylogenetically distant

origins.

3) Examination of the immune response using qPCR under the grafting condition. 17

2. MATERIALS AND METHODS 2.1 BIOINFORMATICS

Bioinformatics is a field of study that used to analyze biological data and provide answers for intractable biological issues based on computer programing, mathematics, statistics and databases.

In particular, in silico works were applied to analyze the predicted minor histocompatibility genes in hydra genome by homology search and phylogenetic analysis.

2.1.1 DATABASE SEARCH

Homology search is an in silico process that is used to identify similar sequences in databases to an interest sequence of protein or DNA in order to study the evolutionary relationships between different species.

The process is as below:

(1) For keyword search in Uniprot database, I used “major histocompatibility complex” first, but there was no result in hydra. Then, I used “minor histocompatibility” as keywords. I, then, obtained amino acid sequences of Homo sapience HA-1 (Q92619) and H13 (Q8TCT9) that have been already reported as components of minor histocompatibility in human (Simpson and Roopenian

1997) (Mendoza et al. 1997) (Den Haan et al. 1998).

(2) Blastp search against Hydra magnipapillata proteome were performed using 18 human HA1 and H13 amino acid sequences as query, and sequences hit with the e-value less than 1e-20 were extracted. We also conducted Blastp search against H. sapiens, Crassostrea gigas and Nematostella vectensis protomes using the same query with the e-value less than 1e-20. Domain searches were performed using Pfam (http://pfam.xfam.org/) and SMART (http://smart.embl- heidelberg.de/smart/set_mode.cgi?NORMAL=1 ) databases. Sequences that have 3 domains of FCH domain, C1 domain and RhoGAP domain (SMART) were picked up as homologues of HA1, whereas sequences containing

Peptidase_A22B domains (PF04258, Pfam) were selected as homologues of

H13 proteins.

2.1.2 PHYLOGENETIC ANALYSIS

Multiple sequence alignment with the same family of proteins in Human was applied to find the score of similarities. To check the orthologs of the candidate sequences, we performed phylogenetic analysis. First, we obtained the homologous sequences from the databases as described in 2.1.1. Then, we used a suit of molecular evolutionary analysis tools, MEGA version 6 for the following analysis. Multiple sequence alignment was constructed by clustal omega in MEGA packaged with default setting. Based on this multiple sequence analysis, we constructed the phylogenetic tree.

2.2 MOLECULAR BIOLOGY EXPERIMEMNTS

Based on a bioinformatics analysis (2.1), we performed molecular biology experiments as below.

2.2.1 MATERIAL: HYDRA

As a material in this study, we used Hydra magnipapillata105 strain (Chapman et al. 2010), which is one of the standard strains of Hydra. This strain was originally collected in Mishima in Japan. The animals were cultured in the laboratory at

18°C in fresh water media and fed with brine shrimps every three days. The media was changed three hours after feeding by picking up the animals from the old media to new one.

Eggs of brine shrimps were hatched in salt water at 29.5°C with aeration. After this hatchery process, empty eggshells were removed from the newly hatched shrimps in order to feed Hydra easily. For the following cDNA library construction

(2.2.2), eight animals were used. The fresh weight of these animals was 0.049 g.

2.2.2 cDNA LIBRARY cDNA library is an assemblage of complementary DNA. We used cDNA library to isolate the expressed candidate genes from Hydra.

2.2.2.1 RNA EXTRACTION

Thermo scientific GeneJET #K0731 kit was used to purify RNA from Hydra. We

followed the protocol of this kit as follow.

In 1.5ml plastic tube, eight animals were lysed by adding 300μl of lysis buffer with

β-mercaptoethanol and vortex, then 600μl of diluted Proteinase K was added.

The mixture was incubated for ten minutes at 25°C to digest proteins and to

remove any contaminants from the mixture. To precipitate the proteins, the

centrifugation was performed for five minutes at 12000rcf. The supernatant was

transferred to new tube and 450μl of 100-95% ethanol was added, which has an

effect to enhance the binding of RNA to Silica membrane when the solution was

transferred to the purification column in the kit.

After the transfer of the sample to the purification column, the column was centrifuged for one minute at 12000rcf and the flow-through was discarded.

According to the previous step, RNA was bounded to the membrane, however,

residual of proteins and salts were still contaminated with the RNA. To remove

the impurities, subsequent wash steps were performed by adding 700μl of wash

buffer once and wash buffer for two times, one with 600μl and one with 250μl.

After each washing step, the samples were centrifuged for 1 minute at 12000rcf

and the flow-through was discarded. To elute the RNA from the membrane, the

purification column was transferred to new sterile 1.5ml tube and 100μl of

nuclease free water was added to the center of the column. Then the tube and 21

the column were centrifuged for one minute at 12000rcf. At this stage, total RNA

was extracted from animal’s cells and ready to convert to cDNA by reverse

transcription reaction (2.2.2.2).

2.2.2.2 REVERSE TRANSCRIPTION

Reverse transcription is a technique to synthesis cDNA from mRNA by using the

reverse transcriptase. In 1.5ml plastic tube, we mixed the following reagents and

samples: 1μl of diluted exo resistant random primer number S0181 to prime

mRNA without poly-A tail, 1 μl of extracted RNA which is the template for the synthesis, 1μl of 10mM dNTPs and 10μl sterilized dH2O. Then the mixture was

heated in 65°C water bath for five minutes and then transferred to ice for one

minute after that. Next, we added the follows into the mixture: 4 μl of 5x first

strand buffer, 1μl of 0.1M DTT to inhibit RNase activity, 1μl of RNase inhibitor

(RNaseOUT recombinant ribonuclease inhibitor thermo fisher catalog number

10777-019) and 1μl of reverse transcriptase (SuperScript III reverse transcriptase

Invitrogen catalog number 18080-093). I mixed them by pipetting and incubated

them at 25°C for five minutes followed by incubating at 50°C for 50 min and

incubating at 70°C for 15 minutes.

2.2.2.3 PREPARING THE PRIMERS FOR CLONING AND qPCR

Primers for HA-1 and H13 and single peptide peptidase like-3 were designed by

using NCBI primer designing tool. The primers used in this study are as shown in

Table 1. Each primer was diluted to 1:10. 22

Table 1. Sequences of HA-1, H13, Single Peptide Peptidase-like3 forward and reverse primers.

Primer Sequence HA1like_F03 CCTTCCTTCGGCACACCATA HA1like_R03 CCAGTCTGAAGAGCATCGGG HA1like_F07 TCAGAACCAGGTCCGTTTCG HA1like_R07 AGGAGTTCGACAGCTTTGGT HA1like_F10 CACGGACAAAAGTCTGGGCA HA1like_R10 TGCTGGCCTTCTTCATAGCC H13like_F03 GTGGTGCATTGGGTAGAGCA H13like_R03 ACAAGCAGGCACCAGATACA Single Peptide Peptidase-like3_F1 GCAGTCTTGGCTACAATGGC Single Peptide Peptidase-like3_R1 TAAAAGAGCAGGCTGTGCGA

For qPCR the primers of the same genes were designed by using the same tool but with shorter sequences. The primer dimers were checked by primer3 tool, and lowest primer dimer sequences were selected as shown in Table 2.

Table 2. Set of primers for real time PCR.

Gene Primer F GAAGAAGGCCAGCAGTTTGC HA-1 R GAAGAAGGCCAGCAGTTTGC F AAACATGGCTGACACCGAAA H13 R AGGAGAAGTCCTTGAGGCGT F GCCAGGCATCCAATCCTGTT Peptidase llike-3 R TGGCCATCGTGTTTTGAACTT F CGTTTAGATTTGGCAGGGCG Actin R CAGAGCTTGAGGCAGCAGTA 23

2.2.2.4 POLYMERASE CHAIN REACTION

Polymerase chain reaction (PCR) is a technology used to amplify DNA throughout different thermo cycles by using mix of reagents, template and primers. For each reaction, we mixed the reagents as follow: 2μl of Pfu buffer with MgSo4, 2μl of 2 mM dNTPs, 1μl of diluted cDNA, 0.4μl of Pfu DNA polymerase (Fermentas number EP0572), 1μl of 10μM forward primer, 1μl of

10μM reverse primer and 12.6μl of dH2O to reach 20μl for each reaction. Then,

PCR was performed with the conditions shown in Table 3. After the PCR finished, the samples were analyzed by the gel electrophoresis (2.2.2.5).

Table 3. Polymerase Chain Reactions conditions

Steps Tm (ºC) Time Numbers of cycles Initial denaturation 95 3min 1 Denaturation 95 30 s 35 Annealing 55 30 s Extension 72 2 min/kb Final extension 72 15min 1

2.2.2.5 GEL ELECTROPHORESIS

Gel electrophoresis is a technology used to measure sizes of DNA, RNA or proteins by separation based on charge and size. Gel was prepared by adding

0.3g of Agarose to 30ml of 1x TAE buffer, dissolved and poured in gel tray with combs. After the gel solidified, 5 μl of each samples were loaded into a well after 24 mixing with 1μl of loading dye (MassRuler 6x DNA loading dye thermo scientific

#R0621). The gel was running in 1x TAE buffer at 110 volt for 30 minutes.

2.2.2.6 A TAILING

A tailing is a method to add poly A tail to the strands in order to ligate the insert into a vector with poly T ends. 0.2μl of Taq polymerase was added to each PCR reaction tube and incubated at 72°C for 25 minutes.

2.2.2.7 PURIFICATION

To purify the samples after the reaction, GeneJET PCR purification kit number

K0702 was used. First, equal volume of PCR reactions and binding buffer were added to help the DNA to bind to the column filter after mixing. The whole amount of reaction was transferred to the GeneJET column that provided with the kit and centrifuged at 12000rcf for 60 seconds. The flow-through was discarded. Then 700μl of wash buffer was added to the column in order to wash any residual binds to the DNA, and samples were centrifuged again at 12000rcf for 60 seconds. The flow-through was discarded and the samples were centrifuged again for one minute to dry out the filters. To elute the DNA from the filters, columns were placed in clean 1.5ml tubes, and then 50μl of ultra water was added to the center of column membrane and centrifuged at 12000rcf for 60 seconds.

2.2.2.8 TA CLONING

TA cloning is a method that is used to ligate specific sequence of gene into a

vector. In this project TA cloning was used for white blue screening to distinguish

inserted from non-inserted vectors.

The vector that used in this study was pCR®2.1 (TA cloning kit Invitrogen

#K204001) as shown in Figure 1. The ligation reaction was prepared by mixing

the reagents as follow: 1μl of 10x ligation buffer, 2μl of pCR®2.1 vector 25ng/μl

and 1μl of T4 ligase to ligate the insert were added to 6μl of each purified PCR

sample. These mixtures were incubated at 14°C overnight to be ready for

transformation.

Figure 1. The map of 3929 nucleotides linearized vector pCR2.1. M13 forward priming site: 380- 404 bases. M13 reverse priming site: 205-221 bases. The insert site is labeled as PCR product.

2.2.2.9 TRANSFORMATION

To transform vectors with inserts to cells, transformation method was needed.

(One Shot® competent cells TA cloning kit Invitrogen #K204001) were used. I

added 2μl of each ligation reaction to 25μl of competent cells and incubated the

cells on ice for 30 minutes after mixing. Next step was the heat chock, which is

very critical for transformation. In this step, samples were transferred from ice to

42°C heat block for 30 seconds and transferred to ice immediately.

To start culturing, 125μl of S.O.C media was added to each tube and incubated

for one hour at 37°C. This media is a nutrient rich broth that increases the

efficiency of transformation in E.coli. After the incubation in the SOC media, the

whole volume of each mixture was streaked on LB agar plates containing X-Gal, ampicillin and IPTG. Plates were incubated overnight at 37°C.

2.2.2.10 COLONY PCR

The colony PCR is a method used to check if the colonies have the insert or not.

We used this method to confirm the transformation.

After culturing the transformed cells, four colonies from each plate were selected

to be inoculated into PCR mixtures, which contain 2μl of 10x PCR buffer, 1.6μl of

2.5mM dNTPs, 0.1μl of hot start Taq DNA polymerase (TaKaRa), 0.4μl of M13 forward primer GTAAAACGACGGGCAAG, 0.4μl M13 reverse primer

CAGGAAACAGCTATGAC and 15.5μl of dH2O. M13 primers were used to check 27 the cloned inserts in pCR®2.1 vector. After mixing each colony in the PCR reactions, PCR was performed with the conditions as shown in (Table 4). After the PCR, the samples were analyzed by the gel electrophoresis to check if there is an insertion or not by bands sizes. Then, we selected the clones with expected insert size for the plasmid isolation.

Table 4. Colony PCR conditions.

Steps Tm (ºC) Time Numbers of cycles Denaturation 98 10 s 30 Annealing 50 30 s Extension 72 1min/kb Final extension 72 15min 1

2.2.2.11 PLASMID ISOLATION

Plasmid isolation is a method used to isolate plasmids from cultured transformed cells. To isolate pure colonies, selected colonies were streaked on LB agar plates containing X-Gal, ampicillin and IPTG, and incubated overnight at 37°C.

On the day after, pure colonies were inoculated into 3 ml of LB liquid media and incubated with shaking overnight at 37°C. At this stage, colonies were cultured to isolate plasmids from them by using GeneJET plasmid miniprep kit number

K0503. First, liquid cultures were centrifuged at 6800rcf for two minutes to obtain pellets from cells. Precipitated pellets were suspended in 250μl of resuspention buffer by vortex, and 250μl of lysis solution was added to lysate the cells. Then, after adding 350μl of neutralization solution, centrifugation was performed at

12000rcf for five minutes to precipitate any cell debris and chromosomal DNA in 28

order to transfer just the plasmid DNA to the provided columns with the kit. Steps

after transferring were centrifuging for one minute, adding 500μl of wash buffer

and centrifuging again for one minute. After that, columns were placed in clean

1.5ml tubes to elute the plasmids DNA by adding 50μl of elution buffer and

centrifuging for two minutes. Finally, plasmids DNA were ready to sequence.

2.2.2.12 SEQUENCING

We performed nucleotide sequencing by the Sanger method. 10μl of each

plasmid DNA was used for the sequencing. In this process, DNA polymerase

copies single stranded DNA templates by adding nucleotides to growing chain.

2.2.3 GRAFTING

In order to construct homograft and heterograft in Hydra, the following

procedure was employed. For allografts, two polyps of the wild type strain

of H. magnipapillata (strain 105) were prepared. The body was surgically

divided into pieces by transversally cutting the body column at the

midpoint. The upper half of one animal and the lower half of the other were

threaded onto a nylon fish line so that the wound opening of the two tissue

pieces attach to each other and cover each other. The two tissue pieces

were, then, pressed from both ends with small sheet of parafilm section to heal the wound opening. 29

2.2.4 qPCR qPCR was performed for examining the expression level of minor histocompatibility genes in grafting and non-grafting hydras. Four lines of RNA have been extracted from two grafted animals swiss, grafted with 105 and 105 grafted with 105, and two lines from normal hydras. RNA has reverse transcribed to cDNA by using high capacity reverse transcription kit (Thermo Fisher, catalog number 4368814). Then, 1:10 cDNA samples were used as a template to measure the expression of minor histocompatibility protein HA-1, minor histocompatibility antigen H13 and single peptide peptidase like-3 in compatible grafted hydras, non-compatible grafted hydras, and normal hydras.

qPCR was performed by (Applied Biosystem StepOne Plus System #4376600) and analysis was followed by the manufacture’s instructions. I used 3 sets of

Power SYBR® Green PCR master mix (Applied Biosystem #4367659) mixed with

HA-1, H13 and single peptide peptidase like-3 primers, and nuclease free water.

Then, we made triplicate from each cDNA sample as follows: two triplicate lines of incompatible grafted animals (swiss oligactis with magnipapillata 105 strains), two triplicates lines of compatible grafted animals (magnipapillata 105 with magnipapillata 105 strain) and two triplicates lines of non-grafted animals.

Samples were placed in a 96 well plate, and qPCR was performed with the conditions as shown in Table 5.

Table 5. qPCR conditions.

Steps Tm (ºC) Time Numbers of cycles Enzyme activation 95 10min 1 Denaturation 95 15s 45 Annealing 60 60 s 31

3. RESULTS AND DISCUSSION

3.1 DATABASE SEARCH FOR THE CANDIDATES

From the database searches, I found HA-1 and H13 as the candidates of minor histocompatibility that are related genes in hydra. These genes showed similarity to HA-1 and H13 in human. Single peptide peptidase like-3 showed to have the same domain as in H13 that make it a candidate to minor histocompatibility antigen.

3.1.1 PHYLOGENETIC ANALYSIS

For phylogenetic analysis, human, oyster and nematostella were selected to analyze the evolutionary relationship of HA-1 and H13 against hydra genes. I selected oyster (Mollusca) species because of their evolutionary relation to hydra and nematostells, since it is in the same phylum as hydra (Cnidarian). These species and humans are reported to have HA-1 and H13 as minor histocompatibility genes. The phylogenetic tree has shown a high evolutionary relationship between hydra genes and other species genes as shown in Figure 2.

In this phylogenetic tree, three clusters obtained contain a wide rang of taxonomic units.

3.1.2 ALIGNMENT

Pairwise sequence alignment of HA-1 amino acid sequence between human and hydra showed highly conserved domains as presented in Figure 3.

In addition, multiple alignment of H13 amino acid sequences from human and hydra have shown that there is a highly conserved domains as presented in

Figure 4.

Figure 2. The phylogenetic tree of minor histocompatibility antigen H13. Hydra002156408.3 is annotated H13 in databases being in the same cluster with known H13 in Nematostella, Oyster and Human. Hydra004210749.2 is single peptide peptidase like3 and Hydra002165994.2 is single peptide peptidase 2B like are H13 candidates.

Figure 3. Alignment result between Hydra HA-1 and Human HA-1 amino acids. Red indicates good alignment; yellow indicates average alignment while green indicates bad alignment.

Figure 4. Alignment result between Hydra H13 and three Human H13 amino acids. Red indicates good alignment; yellow indicates average alignment while green indicates bad alignment.

3.2 MOLECULAR EXPERIMENTS

3.2.1 RNA EXTRACTION

I examined the expression of HA-1, H13 and single peptide peptidase like-3 genes from hydra. First, I extracted RNA from Hydra magnipapellata 105 with

concentrations as shown in Table 6.

Table 6. Wight of animals used to extract RNA and RNSA concentration

Sample Animals Wight (g) RNA conc. (ng/μl) 1 1.013 66 2 1.014 87.1

3.2.2 PCR AMPLIFICATION OF THE CANDIDATES

The RNA was converted to cDNA by the reverse transcriptase. Here, I checked

the combination of primers designed. The expected results are shown in Table 7.

The results of a gel electrophoresis for the PCR product are shown in Figure 5.

I found that there is clear correlation between the expected and actual results as

the products sizes showed the same as expected.

3.3.3. CLONING OF THE CANDIDATES

The results of white blue screening are shown in Table 8. The white-blue

screening is a method to select inserted colonies with white color and non-

inserted colonies with blue color. Therefore, white colonies were selected and 37

inoculated in PCR reaction, and the results of gel electrophoresis of colony PCR

are shown in Table 9 and Figure 6.

3.3.2 PLASMID ISOLATION

Selected samples from colony PCR were used to isolate the plasmids. I

successfully obtained the plasmid, and their concentrations have been shown in

Table 10.

Table 7. The PCR products sizes with HA-1 and H13 primers

Gene Samples Primer Annealing Tm (ºC) PCR product size (bp) HA-1-like 1 and 2 9F-10R 50 and 55 819 3 and 4 10F-10R 50 and 55 720

5 and 6 7F-7R 50 and 55 829

7and 8 3F-3R 50 and 55 848

H13-like 9 and 10 3F-3R 50 and 55 925

11 and 12 10F-3R 50 and 55 283

Table 8. White blue screening

Samples White colonies Blue colonies 2 26 25 4 23 11 6 114 15 8 105 54 10 98 12 38

Figure 5. Gel electrophoresis of template cDNA PCR

Table 9. Colony PCR results

Samples PCR product PCR product size + the distance between size (bp) M13forward and M13 reverse in pcr2.1 vector which is 199bp (bp) 2 819 1018 4 720 919 6 829 1028 8 848 1047 10 925 1124

3.3.3 SEQUENCING THE CLONED CANDIDATES

Sanger sequencing was performed for the cloned candidates in the plasmid isolated. The details of the sequenced samples are shown in Table 11. The sequences obtained were searched against the hydra genome by BLASTN.

Then, I found that all the sequenced clones are 100% matched to the genes of

HA-1, H13 and single peptide peptidase like-3 in Figures 7 and 8. These genes are exactly the same as what I intentionally cloned. The correspondence between the sequenced clone and the gene with the highest match score is listed in Table 12.

3.3.4 GRAFTING HYDRA

Grafting between Swiss strain of H. oligactis and 105 strain of H. magnipapillata was carried out as heterograft (Figure 9C and 9D), and the result was compared with the allograft constructed by grafting two tissues from 105 strain (Figures 9A and 9B). In short, both grafts showed that the two wound openings made by cutting healed to each other in both ectodermal and endodermal tissue layers. Although preliminary, a slight tendency was observed that in retrografts the healing in the ectodermal layer was not obvious and optically convincing. This observation, however, is still preliminary and needs to be tested extensively in large sample sizes. 40

The tendency of imperfect healing of the wound in retrografts is consistent

with a former observation.

3.3.5 qPCR

The result of qPCR analysis is shown, demonstrating that there is no significant

difference of minor histocompatibility gene expression between grafting and normal hydras, as shown in Figure 10. Interestingly, minor histocompatibility

genes in Hydra may not be involved in the immune response that is caused by

grafting, though they are conserved well with the known immune-related genes. 41

Figure 6. Gel electrophoresis of Colony PCR.

Table 10. Isolated plasmids concentrations by nanodrop.

Sample Conc. ng/ μl 2x 63.3 4x 61.5 6w 71.6 8z 72.1 10y 82.8

Table 11. Submitted samples data. Shows 8 plasmids samples of HA-1 inserts by different sites of primers, 2 plasmids samples of H13 inserts by different sites of primers and 2 plasmid samples of single peptide peptidase like 3 inserts by different sites of primers.

Gene Plasmid Conc. Volume Volume for PCR Colony (ng/μl) (μl) sequencing product PCR (μl) size (bp) product size (bp) HA1 2x 63.3 50 20 819 1018 HA1 21 100.9 50 20 819 1018 HA1 4x 61.5 50 20 720 919 HA1 48 99.1 50 20 720 919 HA1 6w 71.6 50 20 829 1028 HA1 6y 166 50 20 829 1028 HA1 8x 72.1 50 20 848 1047 HA1 8z 301 50 20 848 1047 H13 10y 82.8 50 20 925 1124 H13 10z 130 50 20 925 1124 Peptidase W2 77.4 50 20 699 898 Like3 Peptidase W4. 91.7 50 20 699 898 Like3

Table 12. Accession numbers of matched expected sequences in NCBI.

Sample Accession number 2x (HA-1) XM_012701154.1 21 (HA-1) XM_012701154.1 4x (HA-1) XM_012701154.1 48 (HA-1) XM_012701154.1 6w (HA-1) XM_012701154.1 6y (HA-1) XM_012701154.1 8x (HA-1) XM_012701154.1 8z (HA-1) XM_012701154.1 10y (H13) XM_002156372.3 10z (H13) XM_002156372.3 W2 (peptidase like-3) XM_004210701.2 W4. (peptidase like-3) XM_004210701.2 43

Figure 8

Figure 7. Alignment result between annotated sequence of HA-1 in database (the first sequence) and the obtained sequence by Sanger sequencing. Red color shows 100% identity.

Figure 8. Alignment result between annotated sequences of H13 and single peptide peptidase like-3 in database (the first sequences) and the obtained sequences by Sanger sequencing. Red color shows 100% identity.

A B

C D

Figure 9. Grafted individuals. A and B present grafted animals from the same species 105. C and D present grafted animals from swiss (the lighter color parts) and 105 ( the darker color parts).

5 Cycle threshold Cycle

Figure 10. qPCR result. Showing three histocompatibility genes as a target for studying their expression in different samples. HA1, minor histocompatibility protein. H13, minor histocompatibility antigen. Like-3, single peptide peptidase like-3. Incompatible, grafted hydra by different strains. Compatible, grafted hydra by the same strain. Normal, non-grafted hydra.

5.CONCLUSION

In conclusion, I found three minor histocompatibility-related genes (minor histocompatibility protein HA-1, minor histocompatibility antigen H13 and single peptide peptidase like-3) in Hydra magnipapellata 105 by the bioinformatics analyses. Three genes are evolutionarily well conserved with the functionally known genes in human and another animals. These minor histocompatibility-like

genes are expressed in Hydra.

To examine the function, I cloned and measure the expression level by qPCR.

Interestingly, their expressions levels were similar between the animals in

grafting and non-grafting, suggesting that these genes might not be involved in

the immune response in hydra, at least by grafting.

From the evolutionary viewpoint, I found that these Hydra genes are considered

as ancestor of the known immune-response genes, and the function may have

differentiated after the emergence of Hydra. Therefore, it is of particular interest

to see the function of these genes in hydra as future studies of my thesis

research. 48

SUPPLEMENTARY INFORMATION

THE INNATE IMMUNE SYSTEM

The innate immune system is considered as a nonspecific system because its

defense mechanisms are not antigen specific. This means that cells of this

system have the ability to work as a physical protection within hours to protect

the body of the organism once an infectious agent attacks it in addition to various

secreted soluble proteins (Murphy et al. 2012).

There are different types of cells that play important roles to operate the

defending processes against the agents that are capable of causing infections or

disease. These cells are natural killer, macrophages, neutrophils, mast cells,

eosinophils, basophils and dendritic cells.

Phagocytes are white blood cells that have the power to ingest any body which is

recognized as a foreign object (Aderem and Underhill 1999). Macrophages, the

large eaters are the soldiers of the immune system in the organism. They can

move to the detected particle and change their shapes to engulf and fuse the

prey with the lysosomes to degrade it (Ganz 2009). In addition, macrophages

have the ability to secrete chemical signals to tell the others that an attacker has

been identified (Diegelmann and Evans 2004).

Neutrophils exist in large quantities, and they are the richest phagocytes in the

body. Moreover they have a lot of granules in the cytoplasm and the granule 49 includes different toxic materials. Therefore, they are called as granulocytes, which have a function to dispatch or suppress the proliferation of Bactria and fungi (Nathan 2006). Mast cells that are present in the connective tissue and mucous membranes when active, produce histamine, heparin and chemokines, which are chemical signs for inflammation (Gordon, Burd, and Galli 1990).

Eosinophils and basophil have a role in allergic disease by releasing histamine

(Humbles et al. 2004).

Natural killers play important roles in destroying the infected or cancer cells under the consideration of missing self recognition, meaning that the attacked cells should express a low level of MHC class I (Biron et al. 1999) (Shifrin,

Raulet, and Ardolino 2014) (Raulet, 2006). Dendritic cells function as antigen- presenting cells in the tissue that have direct contact with the environment (Clark et al. 2000); these cells play a role in cleaving the pathogen proteins to peptides and present them in the cell surface by moving to the lymph node to activate T cells in order to start the acquired response (Banchereau and Steinman 1998).

Under these circumstances, dendritic cells act as a linkage between both sub immune systems in the innate immune system and the adaptive immune system

(Novak, 2010).

THE ADAPTIVE IMMUNE SYSTEM

The adaptive immune system is obtained after contacting with particular pathogens. It is highly specific, unlike the innate immune system (Flajnik and 50

Kasahara 2010). The antigen-specific immune system has a function in acting

quickly for defense against the same pathogen that once attacked the same body before. It was recognized by the innate immune system (Hedrick 2004).

The building blocks of this system are B lymphocyte cells, T lymphocyte cells and their products. B cells are a type of white blood cells that are formed in the bone marrow, and they become mature and play a major role in antibody mediated immune response. There are different types of B cells; plasma cells and memory cells. Both of them produce antibodies that can recognize antigens, bind the

antigens with specific binding sites, and kill them (LeBien and Tedder 2008).

T cells are also a type of white blood cells, which are formed in the bone marrow

but matured in thymus. They play a role in cell-mediated immune response.

There are different types of T cells; killer T cells, suppressor T cells, memory T

cells and helper T cells. These cells recognize pathogens and infected cells by

their specific antigens with special surface proteins (Springer 1990).

The adaptive response starts when the dendritic cell present a pathogen

antigens on its surface and is recognized by the B cell receptors (Kupfer and

Singer 1989), which subsequently forms a complex termed the helper T cells to

release interleukins and interferans (Kupfer et al. 1986). Both chemicals are

stimulating the B cell to divide and mature to plasma cells that generate antigen

specific antibodies as well as memory B cells that store copies of that antibody in 51

the case of secondary immune response of the same pathogen (Liu and

Banchereau 1997) (Kurosaki, Kometani, and Ise 2015).

In the same way, helper T cells stimulate the T cells to differentiate to the

different types of T cells. They are killer T cells that have T cell receptors, which

bind to the presenting antigens on the surface of infected cells to call

macrophages to engulf these cells (Sallusto, Geginat, and Lanzavecchia 2004),

and memory T cells that store a copy of the same antibody in the case of

secondary immune response and suppressor T cells which have a function in

down regulate the immune response (Paul and Benacerraf 1977).

Moreover, the immune system has the capability to distinguish the self cells from the non-self and the infected cells from the healthy cells by protein markers present on the membrane of cells, called major histocompatibility complex

(Benacerraf 1981).

INVERTEBRATES HISTOCOMPATIBILITY

CORALS

The first evidence of histocompatibility recognition system in Fungia scutaria was demonstrated by grafting experiments on it (Jokiel and Bigger 1994). Subsequent studies demonstrated that corals have the ability to distinguish pathogens and allografts by adaptive like immunological reactions beside the innate immune system responding against infections (Reed, Muller, and van Woesik 2010). 52

SPONGES

Many studies of sponge’s strains manifest that allogeneic individuals are

histocompatible. Grafting experiments have been performed on different species

in order to examine the histocompatibility responses. Some species showed

cytotoxic reactions while others showed compatible fusion and incompatible rejection (Curtis, Kerr, and Knowlton 1982). For example, Suberites domuncula has two genes (ALF-1) and (TCF) that are involved in histocompatibility reactions

as shown in (Muller et al. 2002).

PROTOCHORDATE

Botryllus has been studied as a model to study the histocompatibility reactions

between colonies, which sharing a common vascular network. A study of

protochordate allorecognition demonstrated that fusion and rejection in Botryllus

are controlled by genetic region, showing a polymorphism as the MHC region in

vertebrates (Weissman, Saito, and Rinkevich 1990).

Moreover, the histocompatibility genes in this organism play a role in somatic

recognition reactions and in gamete fertilization as MHC does in vertebrate

(Scofield et al. 1982), which provided support to the hypothesis that Botryllus is one of invertebrate species, which have an ancestral genes of major histocompatibility complex in vertebrates (Scofield, Schlumpberger, and

Weissman 1982). 53

There are two genes that play roles in histocompatibility response in Botryllus,

FuHC (fusion and histocompatibility) and fester (Rosa et al. 2010). In the case of fusion, two colonies have to share one or two FuHC alleles, while in rejection case no common alleles are present between colonies. These non-vertebrate histocompatibility genes give a vision of the evolution of adaptive immune system in vertebrates (De Tomaso et al. 2005).

AMOEBAE

Dictyostelium discoideum; a model for social evolution studies is a unicellular amoeba accumulates to create fruiting bodies, spores and dead cells, which introduce the organism to danger of chimerism (Strassmann, Zhu, and Queller

2000). Because of that, Dictyostelides had to find a way to survive in nature and reduce the dangerous of chimerism (Foster et al. 2002). Kin recognition processes are the way used to avoid the chimerism, this mechanism control the genetic similarity between individuals while an aggregation within similar cells are more than dissimilar to ones (Gilbert et al. 2007) (Ostrowski et al. 2008).

In D. discoideum, interactions and signaling between cells are controlled by the

Lag genes, which encode the transmembrane proteins and immunoglobulin

(Dynes et al. 1994). Some regions in lagB1 and lagC1 found to have a ratio of the numbers of non-synonymous and synonymous substitution similar to that are 54 in MHC genes, which is considered as an indicator of adaptive evolutionary

(Hughes and Nei 1988) (Benabentos et al. 2009).

HYDROZOAN

Hydrozoa is a class of Cnidarian phylum, which provides a critical understanding evolution of the immune system because of its life diversity. Including more than

3700 species, the vast majority of them are marine species and few are freshwaters with different structures, life cycles and growth ways. However, all species lack a hard outer skeleton and have a stem like feature called polyp, which carry tentacles and a mouth.

Moreover, there are two main types of hydrozoans: An immobile form that is called polypoid and free-swimming form which is called medusoid, while many polypoids may have a medusoid larval stage that in the end fix to a substrate.

Some of the hydrozoan species are living alone as solitary, but the larger numbers of them are colonial species. It grows from the single basal root which fixes on a substrate and forms individual polyps. Each of these individual polyps has its role. Some of them are gastrozooids responsible for feeding, while others are gonozooids that play a role in reproduction.

Cnidarians have a body that are derived from two embryonic cell layers

(ectoderm and endoderm). An extracellular matrix called mesoglea separates both layers. In Hydra, the freshwater polyp, the two layers have fulfilling several 55 functions. Epithelial cells mediated the most of the innate immune responses.

Epithelial cells in endodermal layer have function in digesting, phagocytosing and destroying bacteria in the gastric cavity. Gland cells in the endodermal layer help the epithelial cells in the innate immune responses by manufacturing powerful antimicrobial serine protease inhibitors. Multiplying stem cells is very important to repair a damaged tissue in some hydrozoa. Moreover, if some cells are infected or damaged, they will be removed by apoptosis and new cells are used to take the place. By these ways, the whole colony, but not just single polyp, is going to be protected.

Hydractinia was the first cnidarian with available genetic data. Therefore, it has been used in different laboratories to study the mechanism of histocompatibility response, which provides a great chance to investigate the evolution of allorecognition and examine if there is any homologous present in vertebrate.

Recognition is the ability of some species to distinguish between self and nonself that is present in the most of invertebrate even if they lack T cells, MHC and

B cells.

In Hydractinia, if many colonies share the same underlying layer of substance, specialized cells in the tentacles of colonies, which called nematocysts, are in contact that may cause a size increasing and genetic diversity, compatible ones may combine and create chimeras but incompatible ones will reject each other.

There are two situations of the rejection response; passive allogenic rejection in 56

mat tissue contacting and active allogenic rejection in stolon tissue contacting

(Mokady and Buss 1996).

The first one leads to create a non-cellular obstacle to prevent any contact

between cells among colonies while the second one causes a huge damage to

some or all the participated colonies due to an expands in the number of

nematocytes, which accumulate and form hyperplastic stolons. These fusion and rejection reactions between genetically-related colonies are regulated by two histocompatibility genetic loci linked to each other, allorecognition 1 (alr1) and allorecognition 2 (alr2) (Rosa et al. 2010) (Powell et al. 2007).

The fusion reaction occurs if alr1 and alr2 shared one allele in minimum.

However, the rejection reaction occurs when alleles sharing is absent. The two

genes are encoding for several forms of transmembrane proteins like

immunoglobulin superfamily molecules (IgSF). Moreover, other ten IgSF-like

genes encloses the location of alr1.

MHC CLASSES STRUCTURES

Structurally, major histocompatibility complex class I protein consists of four

parts; alpha one and alpha two where a binding groove site is between them,

alpha three which anchored to the cell membrane, and beta two microglobulin

that bind to alpha one non-covalently (Xu et al. 2012). 57

However, MHC class II consists of two pairs, beta one and alpha one where a binding site is groove between them. Beta two and alpha two are anchored to the cell membrane (Cresswell 1994). In contrast, MHC class III is not an antigen presenting molecule, but it related to different proteins in the immune system. 58

6. REFERENCES

1. Aderem, A., and D. M. Underhill. 1999. 'Mechanisms of phagocytosis in macrophages', Annual Review of Immunology, Vol 31, 17: 593-623.

2. Banchereau, J., and R. M. Steinman. 1998. 'Dendritic cells and the control of immunity', Nature, 392: 245-52.

3. Benabentos, R., S. Hirose, R. Sucgang, T. Curk, M. Katoh, E. A. Ostrowski, J. E. Strassmann, D. C. Queller, B. Zupan, G. Shaulsky, and A. Kuspa. 2009. 'Polymorphic members of the lag gene family mediate kin discrimination in Dictyostelium', Curr Biol, 19: 567-72.

4. Benacerraf, B. 1981. 'Role of MHC gene products in immune regulation', Science, 212: 1229-38.

5. Biron, C. A., K. B. Nguyen, G. C. Pien, L. P. Cousens, and T. P. Salazar- Mather. 1999. 'Natural killer cells in antiviral defense: function and regulation by innate cytokines', Annual Review of Immunology, Vol 31, 17: 189-220.

6. Brown, J. L., and A. Eklund. 1994. 'Kin Recognition and the Major Histocompatibility Complex - an Integrative Review', American Naturalist, 143: 435-61.

7. Chapman, J. A., E. F. Kirkness, O. Simakov, S. E. Hampson, T. Mitros, T. Weinmaier, T. Rattei, P. G. Balasubramanian, J. Borman, D. Busam, K. Disbennett, C. Pfannkoch, N. Sumin, G. G. Sutton, L. D. Viswanathan, B. Walenz, D. M. Goodstein, U. Hellsten, T. Kawashima, S. E. Prochnik, N. H. Putnam, S. Shu, B. Blumberg, C. E. Dana, L. Gee, D. F. Kibler, L. Law, D. Lindgens, D. E. Martinez, J. Peng, P. A. Wigge, B. Bertulat, C. Guder, Y. Nakamura, S. Ozbek, H. Watanabe, K. Khalturin, G. Hemmrich, A. Franke, R. Augustin, S. Fraune, E. Hayakawa, S. Hayakawa, M. Hirose, J. S. Hwang, K. Ikeo, C. Nishimiya-Fujisawa, A. Ogura, T. Takahashi, P. R. Steinmetz, X. Zhang, R. Aufschnaiter, M. K. Eder, A. K. Gorny, W. Salvenmoser, A. M. Heimberg, B. M. Wheeler, K. J. Peterson, A. Bottger, P. Tischler, A. Wolf, T. Gojobori, K. A. Remington, R. L. Strausberg, J. C. Venter, U. Technau, B. Hobmayer, T. C. Bosch, T. W. Holstein, T. Fujisawa, H. R. Bode, C. N. David, D. S. Rokhsar, and R. E. Steele. 2010. 'The dynamic genome of Hydra', Nature, 464: 592-6. 59

8. Clark, G. J., N. Angel, M. Kato, J. A. Lopez, K. MacDonald, S. Vuckovic, and D. N. Hart. 2000. 'The role of dendritic cells in the innate immune system', Microbes Infect, 2: 257-72.

9. Cresswell, P. 1994. 'Assembly, transport, and function of MHC class II molecules', Annual Review of Immunology, Vol 31, 12: 259-93.

10. Curtis, A. S., J. Kerr, and N. Knowlton. 1982. 'Graft rejection in sponges. Genetic structure of accepting and rejecting populations', Transplantation, 33: 127-33.

11. De Tomaso, A. W., S. V. Nyholm, K. J. Palmeri, K. J. Ishizuka, W. B. Ludington, K. Mitchel, and I. L. Weissman. 2005. 'Isolation and characterization of a protochordate histocompatibility locus', Nature, 438: 454-9.

12. Den Haan, J. M., L. M. Meadows, W. Wang, J. Pool, E. Blokland, T. L. Bishop, C. Reinhardus, J. Shabanowitz, R. Offringa, D. F. Hunt, V. H. Engelhard, and E. Goulmy. 1998. 'The minor histocompatibility antigen HA-1: a diallelic gene with a single amino acid polymorphism', Science, 279: 1054-7.

13. Diegelmann, R. F., and M. C. Evans. 2004. 'Wound healing: an overview of acute, fibrotic and delayed healing', Front Biosci, 9: 283-9.

14. Dierselhuis, M., and E. Goulmy. 2009. 'The relevance of minor histocompatibility antigens in solid organ transplantation', Curr Opin Organ Transplant, 14: 419-25.

15. Dishaw, L. J., and G. W. Litman. 2009. 'Invertebrate allorecognition: the origins of histocompatibility', Curr Biol, 19: R286-8.

16. Dynes, J. L., A. M. Clark, G. Shaulsky, A. Kuspa, W. F. Loomis, and R. A. Firtel. 1994. 'LagC is required for cell-cell interactions that are essential for cell-type differentiation in Dictyostelium', Genes Dev, 8: 948-58.

17. Falk, K., O. Rotzschke, S. Stevanovic, G. Jung, and H. G. Rammensee. 1991. 'Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules', Nature, 351: 290-6.

18. Flajnik, M. F., and M. Kasahara. 2010. 'Origin and evolution of the adaptive immune system: genetic events and selective pressures', Nat Rev Genet, 11: 47-59.

19. Foster, K. R., A. Fortunato, J. E. Strassmann, and D. C. Queller. 2002. 'The costs and benefits of being a chimera', Proc Biol Sci, 269: 2357-62. 60

20. Ganz, T. 2009. 'Iron in innate immunity: starve the invaders', Curr Opin Immunol, 21: 63-7.

21. Gilbert, O. M., K. R. Foster, N. J. Mehdiabadi, J. E. Strassmann, and D. C. Queller. 2007. 'High relatedness maintains multicellular cooperation in a social amoeba by controlling cheater mutants', Proc Natl Acad Sci U S A, 104: 8913-7.

22. Gordon, J. R., P. R. Burd, and S. J. Galli. 1990. 'Mast-Cells as a Source of Multifunctional Cytokines', Immunology Today, 11: 458-64.

23. Goulmy, E., R. Schipper, J. Pool, E. Blokland, J. H. F. Falkenburg, J. Vossen, A. Gratwohl, G. B. Vogelsang, H. C. vanHouwelingen, and J. J. vanRood. 1996. 'Mismatches of minor histocompatibility antigens between HLA-identical donors and recipients and the development of graft-versus- host disease after bone marrow transplantation', New England Journal of Medicine, 334: 281-85.

24. Grosberg, R. K. 1988. 'The Evolution of Allorecognition Specificity in Clonal Invertebrates', Quarterly Review of Biology, 63: 377-412.

25. Hedrick, S. M. 2004. 'The acquired immune system: a vantage from beneath', Immunity, 21: 607-15.

26. Hughes, A. L., and M. Nei. 1988. 'Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection', Nature, 335: 167-70.

27. Humbles, A. A., C. M. Lloyd, S. J. McMillan, D. S. Friend, G. Xanthou, E. E. McKenna, S. Ghiran, N. P. Gerard, C. N. Yu, S. H. Orkin, and C. Gerard. 2004. 'A critical role for eosinophils in allergic airways remodeling', Science, 305: 1776-79.

28. Jokiel, P. L., and C. H. Bigger. 1994. 'Aspects of histocompatibility and regeneration in the solitary reef coral Fungia scutaria', Biol Bull, 186: 72- 80.

29. Kupfer, A., and S. J. Singer. 1989. 'Cell Biology of Cyto-Toxic and Helper T-Cell Functions - Immunofluorescence Microscopic Studies of Single Cells and Cell Couples', Annual Review of Immunology, 7: 309-37.

30. Kupfer, A., S. L. Swain, C. A. Janeway, Jr., and S. J. Singer. 1986. 'The specific direct interaction of helper T cells and antigen-presenting B cells', Proc Natl Acad Sci U S A, 83: 6080-3.

31. Kurosaki, T., K. Kometani, and W. Ise. 2015. 'Memory B cells', Nature Reviews Immunology, 15: 149-59. 61

32. Lakkis, F. G., S. L. Dellaporta, and L. W. Buss. 2008. 'Allorecognition and chimerism in an invertebrate model organism', Organogenesis, 4: 236-40.

33. LeBien, T. W., and T. F. Tedder. 2008. 'B lymphocytes: how they develop and function', Blood, 112: 1570-80.

34. Litman, G. W., and L. J. Dishaw. 2013. 'Histocompatibility: clarifying fusion confusion', Curr Biol, 23: R934-5.

35. Liu, Y. J., and J. Banchereau. 1997. 'Regulation of B-cell commitment to plasma cells or to memory B cells', Semin Immunol, 9: 235-40.

36. Mendoza, L. M., P. Paz, A. Zuberi, G. Christianson, D. Roopenian, and N. Shastri. 1997. 'Minors held by majors: the H13 minor histocompatibility locus defined as a peptide/MHC class I complex', Immunity, 7: 461-72.

37. Mokady, O., and L. W. Buss. 1996. 'Transmission genetics of allorecognition in Hydractinia symbiolongicarpus (Cnidaria:Hydrozoa)', Genetics, 143: 823-7.

38. Muller, W. E., A. Krasko, A. Skorokhod, C. Bunz, V. A. Grebenjuk, R. Steffen, R. Batel, and H. C. Schroder. 2002. 'Histocompatibility reaction in tissue and cells of the marine sponge Suberites domuncula in vitro and in vivo: central role of the allograft inflammatory factor 1', Immunogenetics, 54: 48-58.

39. Murphy, Kenneth, Paul Travers, Mark Walport, and Charles Janeway. 2012. Janeway's immunobiology (Garland Science: New York).

40. Nathan, C. 2006. 'Neutrophils and immunity: challenges and opportunities', Nature Reviews Immunology, 6: 173-82.

41. Novak, N., S. Koch, J. P. Allam, and T. Bieber. 2010. 'Dendritic cells: bridging innate and adaptive immunity in atopic dermatitis', J Allergy Clin Immunol, 125: 50-9.

42. Ostrowski, E. A., M. Katoh, G. Shaulsky, D. C. Queller, and J. E. Strassmann. 2008. 'Kin discrimination increases with genetic distance in a social amoeba', PLoS Biol, 6: e287.

43. Parham, P., and Charles Janeway. 2009. The immune system (Garland Science: London ; New York)

44. Paul, W. E., and B. Benacerraf. 1977. 'Functional specificity of thymus- dependent lymphocytes', Science, 195: 1293-300.

45. Piertney, S. B., and M. K. Oliver. 2006. 'The evolutionary ecology of the major histocompatibility complex', Heredity (Edinb), 96: 7-21. 62

46. Potts, W. K., and E. K. Wakeland. 1990. 'Evolution of diversity at the major histocompatibility complex', Trends Ecol Evol, 5: 181-7.

47. Powell, A. E., M. L. Nicotra, M. A. Moreno, F. G. Lakkis, S. L. Dellaporta, and L. W. Buss. 2007. 'Differential effect of allorecognition loci on phenotype in Hydractinia symbiolongicarpus (Cnidaria: Hydrozoa)', Genetics, 177: 2101-7.

48. Raulet, D. H. 2006. 'Missing self recognition and self tolerance of natural killer (NK) cells', Semin Immunol, 18: 145-50.

49. Reed, K. C., E. M. Muller, and R. van Woesik. 2010. 'Coral immunology and resistance to disease', Dis Aquat Organ, 90: 85-92.

50. Rosa, S. F., A. E. Powell, R. D. Rosengarten, M. L. Nicotra, M. A. Moreno, J. Grimwood, F. G. Lakkis, S. L. Dellaporta, and L. W. Buss. 2010. 'Hydractinia allodeterminant alr1 resides in an immunoglobulin superfamily-like gene complex', Curr Biol, 20: 1122-7.

51. Sallusto, F., J. Geginat, and A. Lanzavecchia. 2004. 'Central memory and effector memory T cell subsets: function, generation, and maintenance', Annual Review of Immunology, Vol 31, 22: 745-63.

52. Scofield, V. L., J. M. Schlumpberger, L. A. West, and I. L. Weissman. 1982. 'Protochordate allorecognition is controlled by a MHC-like gene system', Nature, 295: 499-502.

53. Scofield, V. L., J. M. Schlumpberger, and I. L. Weissman. 1982. 'Colony Specificity in the Colonial Tunicate Botryllus and the Origins of Vertebrate Immunity', American Zoologist, 22: 783-94.

54. Shifrin, N., D. H. Raulet, and M. Ardolino. 2014. 'NK cell self tolerance, responsiveness and missing self recognition', Semin Immunol, 26: 138-44.

55. Shimizu, H. 2012. 'Transplantation analysis of developmental mechanisms in Hydra', Int J Dev Biol, 56: 463-72.

56. Simpson, E., and D. Roopenian. 1997. 'Minor histocompatibility antigens', Curr Opin Immunol, 9: 655-61.

57. Spierings, E. 2014. 'Minor histocompatibility antigens: past, present, and future', Tissue Antigens, 84: 374-60.

58. Springer, T. A. 1990. 'Adhesion receptors of the immune system', Nature, 346: 425-34. 63

59. Strassmann, J. E., Y. Zhu, and D. C. Queller. 2000. 'Altruism and social cheating in the social amoeba Dictyostelium discoideum', Nature, 408: 965-7.

60. Terada, H., T. Sugiyama, and Y. Shigenaka. 1988. 'Genetic analysis of developmental mechanisms in hydra. XVIII. Mechanism for elimination of the interstitial cell lineage in the mutant strain Sf-1', Dev Biol, 126: 263-9.

61. Unanue, E. R. 1984. 'Antigen-presenting function of the macrophage', Annual Review of Immunology, Vol 31, 2: 395-428.

62. Vanbleek, G. M., and S. G. Nathenson. 1991. 'The Structure of the Antigen-Binding Groove of Major Histocompatibility Complex Class-I Molecules Determines Specific Selection of Self-Peptides', Proc Natl Acad Sci U S A, 88: 11032-36.

63. Weissman, I. L., Y. Saito, and B. Rinkevich. 1990. 'Allorecognition histocompatibility in a protochordate species: is the relationship to MHC somatic or structural?', Immunol Rev, 113: 227-41.

64. Xu, S., X. Liu, Y. Bao, X. Zhu, C. Han, P. Zhang, X. Zhang, W. Li, and X. Cao. 2012. 'Constitutive MHC class I molecules negatively regulate TLR- triggered inflammatory responses via the Fps-SHP-2 pathway', Nat Immunol, 13: 551-9.

65. York, I. A., and K. L. Rock. 1996. 'Antigen processing and presentation by the class I major histocompatibility complex', Annual Review of Immunology, Vol 31, 14: 369-96.