Perl tutorial

Working with DNA Sequences

#!/usr/bin/perl -w # Storing DNA in a variable, and printing it out # First we store the DNA in a variable called $DNA

$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Next, we print the DNA onto the screen print $DNA;

# Finally, we'll specifically tell the program to exit. exit;

Concatenating the DNA sequences

#!/usr/bin/perl -w # Concatenating DNA # Store two DNA fragments into variables called $DNA1 #and $DNA2

$DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC'; $DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';

# Print the DNA onto the screen print "Here are the original two DNA fragments:\n\n"; print $DNA1, "\n"; print $DNA2, "\n\n";

# Concatenate the DNA fragments into a third variable and #print them Using "string interpolation"

$DNA3 = "$DNA1$DNA2"; print "Here is the new DNA of the two fragments version 1):\n\n"; print "$DNA3\n\n";

# An alternative way using the "dot operator": # Concatenate the DNA fragments into a third variable and # print them

$DNA3 = $DNA1 . $DNA2; print "Here is the concatenation of the first two fragments (version 2):\n\n"; print "$DNA3\n\n";

# Print the same thing without using the variable $DNA3 print "Here is the concatenation of the first two fragments (version 3):\n\n"; print $DNA1, $DNA2, "\n"; exit;

TRANSCRIPTION: DNA -> RNA

#!/usr/bin/perl -w

# Transcribing DNA into RNA # The DNA

$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen print "Here is the starting DNA:\n\n"; print "$DNA\n\n";

# Transcribe the DNA to RNA by substituting all T's with U's.

$RNA = $DNA; $RNA =~ s/T/U/g;

# Print the RNA onto the screen print "Here is the result of transcribing the DNA to RNA:\n\n"; print "$RNA\n";

# Exit the program. exit;

Reverse Complement

#!/usr/bin/perl -w # Calculating the reverse complement of a strand of DNA

# The DNA $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen print "Here is the starting DNA:\n\n"; print "$DNA\n\n";

# Calculate the reverse complement

# First, copy the DNA into new variable $revcom # (short for REVerse COMplement) # # It doesn't matter if we first reverse the string and then # do the complementation; or if we first do the complementation # and then reverse the string. Same result each time. # So when we make the copy we'll do the reverse in the same statement.

$revcom = reverse $DNA;

----- The DNA is now reversed.. we neeed to complement the bases in revcom - substitute all bases by their complements. # A->T, T->A, G->C, C->G

####Attempt 1:

$revcom =~ s/A/T/g; $revcom =~ s/T/A/g; $revcom =~ s/G/C/g; $revcom =~ s/C/G/g; # Print the reverse complement DNA onto the screen print "Here is the reverse complement DNA:\n\n"; print "$revcom\n";

#################

Does this work?? Why?

# See the text for a discussion of tr/// $revcom =~ tr/ACGTacgt/TGCAtgca/;

# Print the reverse complement DNA onto the screen print "Here is the reverse complement DNA:\n\n"; print "$revcom\n"; print "\nThis time it worked!\n\n"; exit;

Reading Proteins in files

#!/usr/bin/perl -w # Reading protein sequence data from a file # The filename of the file containing the protein sequence data

$proteinfilename = 'Name_Of_your_sequence_file.txt';

# First we have to "open" the file, and associate # a "filehandle" with it. We choose the filehandle # PROTEINFILE for readability. open(PROTEINFILE, $proteinfilename) || Die ("cannot open file");

# Now we do the actual reading of the protein sequence data from the file, by using the angle brackets < and > to get the input from the filehandle. We store the data into our variable $protein.

@protein = ;

# Now that we've got our data, we can close the file. close PROTEINFILE;

# Print the protein onto the screen print "Here is the protein:\n\n"; print @protein; exit;

Pattern matching: Motifs and Loops

Proceed ONLY if condition is true...

code layout.. if (condition)

{

do something

}

Finding Motifs #!/usr/bin/perl -w # if-elsif-else

$word = 'MNIDDKL';

# if-elsif-else conditionals if($word eq 'QSTVSGE') { print "QSTVSGE\n"; } elsif($word eq 'MRQQDMISHDEL') { print "MRQQDMISHDEL\n"; }

GC CONTENT

In PCR experiments, the GC-content of primers are used to predict their annealing temperature to the template DNA. A higher GC-content level indicates a higher melting temperature.

GC % = G + C x100

A+G+C+T

Logical: for each base in the DNA if base is A count_of_A = count_of_A + 1 if base is C count_of_C = count_of_C + 1 if base is G count_of_G = count_of_G + 1 if base is T count_of_T = count_of_T + 1 done

print count_of_A, count_of_C, count_of_G, count_of_T

the script #!/usr/bin/perl -w # Determining frequency of nucleotides # Get the name of the file with the DNA sequence data

$dna_filename = File_name.txt;

# Remove the newline from the DNA filename chomp $dna_filename;

# open the file, or exit open(DNAFILE, $dna_filename) || die ("Cannot open file \"$dna_filename\"); exit; }

# Read the DNA sequence data from the file, and store it # into the array variable @DNA @DNA = ; # Close the file close DNAFILE;

# From the lines of the DNA file, # put the DNA sequence data into a single string. $DNA = join( '', @DNA);

# Remove whitespace $DNA =~ s/\s//g;

# Now explode the DNA into an array where each letter of # the original string is now an element in the array. # This will make it easy to look at each position. # Notice that we're reusing the variable @DNA for this purpose. @DNA = split( '', $DNA );

# Initialize the counts. # Notice that we can use scalar variables to hold numbers. $count_of_A = 0; $count_of_C = 0; $count_of_G = 0; $count_of_T = 0; $errors = 0;

# In a loop, look at each base in turn, determine which of # the four types of nucleotides it is, and increment the # appropriate count. foreach $base (@DNA) { if ( $base eq 'A' ) { ++$count_of_A; } elsif ( $base eq 'C' ) { ++$count_of_C; } elsif ( $base eq 'G' ) { ++$count_of_G; } elsif ( $base eq 'T' ) { ++$count_of_T; } else { print "!!!!!!!! Error - I don\'t recognize this base: $base\n"; ++$errors; } }

# print the results print "A = $count_of_A\n"; print "C = $count_of_C\n"; print "G = $count_of_G\n"; print "T = $count_of_T\n"; print "errors = $errors\n"; # exit the program exit;

---using regex ---

while($DNA =~ /a/ig){$a++} while($DNA =~ /c/ig){$c++} while($DNA =~ /g/ig){$g++} while($DNA =~ /t/ig){$t++} while($DNA =~ /[^acgt]/ig){$e++} print "A=$a C=$c G=$g T=$t errors=$e\n";

----

Next is a new kind of loop, the foreach loop. This loop works over the elements of an array. The line: foreach $base (@DNA)

Wrtiting to files # Also write the results to a file called "countbase" $outputfile = "countbase"; ( unless open(COUNTBASE, ">$outputfile") || die ("Cannot open file \"$outputfile\" to write to!!\n\n"); print COUNTBASE "A=$a C=$c G=$g T=$t errors=$e\n"; close(COUNTBASE);