From the Falkland Islands

The Lichenologist (2021), 53, 307–315 doi:10.1017/S0024282921000244

Standard Paper

A new species of Aspicilia (Megasporaceae), with a new lichenicolous Sagediopsis (Adelococcaceae), from the Falkland Islands

Alan M. Fryday1 , Timothy B. Wheeler2 and Javier Etayo3 1Department of Plant Biology, Michigan State University, East Lansing, Michigan 48824, USA; 2Division of Biological Sciences, University of Montana, Missoula, Montana 59801, USA and 3Navarro Villoslada 16, 3° dcha., 31003 Pamplona, Navarra, Spain

Abstract The new species Aspicilia malvinae is described from the Falkland Islands. It is the first species of Megasporaceae to be discovered on the islands and only the seventh to be reported from South America. It is distinguished from other species of Aspicilia by the unusual secondary metabolite chemistry (hypostictic acid) and molecular sequence data. The collections of the new species support two lichenicolous fungi: Endococcus propinquus s. lat., which is new to the Falkland Islands, and a new species of Sagediopsis with small perithecia and 3-septate ascospores c. 18–20 × 4–5 μm, which is described here as S. epimalvinae. A total of 60 new DNA sequences obtained from species of Megasporaceae (mostly Aspicilia) are also introduced. Key words: DNA sequences, Endococcus, Lecanora masafuerensis, lichen, southern South America, southern subpolar region (Accepted 18 March 2021)

Introduction Materials and Methods Species of Megasporaceae Lumbsch et al. are surprisingly scarce Morphological methods in the Southern Hemisphere. Whereas 97 species are known Gross morphology was examined under a dissecting microscope from North America (Esslinger 2019), 104 from Russia and apothecial characteristics by light microscopy (compound (Urbanavichus 2010), 40 from Svalbard (Øvstedal et al. 2009) microscope) on hand-cut sections mounted in water, 10% KOH and 16 from the British Isles (Fletcher et al. 2009), only six species (K), 50% HNO (N) or Lugol’s reagent (0.15% aqueous IKI). have been reported from Australia (McCarthy 2016), seven from 3 Thallus sections were investigated in water, K and Lugol’s reagent. New Zealand (Galloway 2007) and only three from each of South Ascospore measurements of the new species are given as Africa (Fryday 2015) and Antarctica (Øvstedal & Lewis Smith (minimum value–)mean ± standard deviation(–maximum value). 2001). In southern South America, six taxa have been reported Thalline chemistry was investigated by thin-layer chromatography from Argentina (Aspicilia cinerea (L.) Körb., A. mendozae following the methods of Orange et al. (2001), and nomenclature Räsänen, Circinaria caesiocinerea (Nyl. ex Malbr.) A. Nordin of apothecial pigments follows Meyer & Printzen (2000). et al., C. calcarea (L.) A. Nordin et al., Lobothallia alphoplaca (Wahlenb.) Hafellner and Megaspora verrucosa (Ach.) Arcadia Additional comparative specimens examined. & A. Nordin; Calvelo & Liberatore 2002) and, because Lecanora Lecanora masa- masafuerensis Zahlbr. appears not to be a species of Aspicilia fuerensis. Chile: Juan Fernandez Islands: Mas Afuera, Quebrada as was suggested by Galloway & Quilhot (1998), only two (C. cal- de las Vacas, near two waterfalls of stream in narrow section of carea and Megaspora verrucosa) from Chile (Galloway & Quilhot canyon, 1965, H. A. Imshaug 36869, 36872; ibid., Quebrada de 1998). None have previously been reported from the Falkland las Casas, narrow section, 1965, H. A. Imshaug 36697, 36698, 36704 (MSC); ibid., Quebrada de las Casas, 10 iii 1917, C. & I. Islands (Fryday et al. 2019). Here we describe a new species — that is known from three localities on the Falkland Islands, Scottsberg s. n. (NY isotype). along with a lichenicolous fungus that is present on the holotype collection. Molecular methods

Taxon sampling. The majority of specimens used in this study were collected between 2007–2017, but further specimens were Author for correspondence: Alan Fryday. E-mail: [email protected] obtained from herbarium loans and the collecting efforts of Cite this article: Fryday AM, Wheeler TB and Etayo J (2021) A new species of Aspicilia (Megasporaceae), with a new lichenicolous Sagediopsis (Adelococcaceae), from the Falkland other researchers (Table 1). Additional sequences included in Islands. Lichenologist 53,307–315. https://doi.org/10.1017/S0024282921000244 the analysis were downloaded from GenBank (Table 1).

© The Author(s), 2021. Published by Cambridge University Press on behalf of the British Lichen Society. This is an Open Access article, distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives licence (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial re-use, distribution, and reproduc- tion in any medium, provided the original work is unaltered and is properly cited. The written permission of Cambridge University Press must be obtained for commercial reuse or in order to create a derivative work.

Downloaded from https://www.cambridge.org/core. IP address: 170.106.202.8, on 24 Sep 2021 at 09:11:56, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0024282921000244 308 Alan M. Fryday et al.

Table 1. Voucher information and GenBank Accession numbers of sequences used for construction of the phylogenetic tree in Fig. 3. Newly introduced sequences are in bold.

Collector number DNA Voucher/ Species (hb) Locality Publication nuITS nuLSU mtSSU Mcm7

Aspicilia Ismayil & Abbas Heilongjiang, Ismayil et al. NR_158307 ––– abbasiana 20111154 (HMAS-L) China (2015) A. angelica Wheeler 5468 Montana, USA TW213 MW435332 MW447407 MW424813 MW435341 (hb. Wheeler) A. aurantiaca Wheeler 7091 California, USA TW220 MW447387 MW447401 MW424807 MW435335 (hb. Wheeler) A. boykinii Wheeler 7274 Montana, USA TW277 MW447394 MW447409 MW424815 MW435343 (hb. Wheeler) A. cinerea Wheeler 7214 Montana, USA TW210 MW447398 MW447413 MW424819 MW435347 (hb. Wheeler) A. cinerea Wheeler 6277 Finnmark, TW219 MW447391 MW447405 MW424811 MW435339 (hb. Wheeler) Norway A. cuprea Knudsen 16336 California, USA TW331 MW447385 MW447399 MW424805 MW435333 (hb. Wheeler) A. cuprea Owe-Larsson 9112 California, USA Nordin et al. EU057902 HM060750 HM060712 – (UPS) (2007, 2010) A. cyanescens Owe-Larsson 9151 California, USA Nordin et al. EU057904 HM060745 HM060707 – (UPS) (2007, 2010) A. dudinesis Nordin 6036 (UPS) Torne Lappmark, Nordin et al. EU057906 HM060748 HM060710 – Sweden (2007, 2010) A. epiglypta Nelson s. n. Hoffellsjokull, TW276 MW447396 MW447411 MW424817 MW435345 (hb. Wheeler) Iceland A. fumosa Wheeler 3844 Montana, USA TW224 MW447395 MW447410 MW424816 MW435344 (hb. Wheeler) A. knudsenii Wheeler 6798 Montana, USA TW245 MW447386 MW447400 MW424806 MW435334 (hb. Wheeler) A. malvinae Fryday 11433 (MSC) East Falkland, TW260 MW447392 MW447406 MW424812 MW435340 Falkland Islands A. pacifica Knudsen 9241 California, USA TW334 MW447393 MW447408 MW424814 MW435342 (hb. Wheeler) A. santamonicae Wheeler 6648 California, USA TW230 MW447388 MW447402 MW424808 MW435336 (hb. Wheeler) Circinaria Nordin 5888 (UPS) Oland, Sweden Nordin et al. EU057898 HM060743 HM060705 – calcarea (2007, 2010) Lepra albescens Schmitt Bohemia, Schmitt et al. AF329177 AF329176 AF329175 – s. n. (ESS-20967) Czech Republic 2001 Lobothallia Nordin 6622 (UPS) Jämtland, Nordin et al. HQ259272 HM060726 HM060688 – melanaspis Sweden (2010, 2011) L. praeradiosa Wheeler 3414 Montana, USA TW269 MW447389 MW447403 MW424809 MW435337 (hb. Wheeler) Oxneriaria Wheeler 4463 Alaska, USA TW296 MW447390 MW447404 MW424810 MW435338 permutata (hb. Wheeler) O. supertegens Owe-Larsson 9002 Troms, Norway Nordin et al. EU057936 HM060742 HM060704 – (UPS) (2007, 2010) O. virginea Wheeler 7153 Montana, USA TW240 MW447397 MW447412 MW424818 MW435346 (hb. Wheeler)

DNA isolation and sequencing. Total DNA was extracted from Kit (Qiagen, Germany) according to the manufacturer’s instruc- samples of 10–15 healthy apothecia and surrounding tissue. tions except for the following modifications: in the first step, sam- Two 3 mm steel beads were added to the sample tubes and frozen ples were incubated in lysis buffer for 1 h and vortexed every 10 at −80 °C for 1 h. Samples were then mounted on the TissueLyser mins; in the final step, the samples were eluted in 50 μl AE buffer II (Qiagen, Germany) and ground in 30 s intervals for 1–2 min at twice. DNA quantity was tested on an Implen Nanodrop (Implen, 30/hz. DNA was extracted using the Qiagen DNeasy Plant Mini München, Germany).

Table 2. Primers used in this study.

Primer name Primer sequence (5ʹ–3ʹ) Reference

ITS1F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns (1993) ITS4 TCCTCCGCTTATTGATATGC White et al. (1990) LrlecF CCTCAGTAACGGCGAG Schneider et al. (2015) LR7 TACTACCACCAAGATCT R. Vilgalys (unpublished) mtSSU1 AGCAGTGAGGAATATTGGTC Zoller et al. (1999) mtSSU3R ATGTGGCACGTCTATAGCCC Zoller et al. (1999) MCM7for CGTCACTACAAAACAATTCACC This study MCM7rev CGCCCATCTCTTTTGTGAC This study

Table 3. PCR protocols used in this study for given loci.

Initial Final Locus denaturation 35 cycles of: extension

nuITS 2 min at 94 °C 94 °C for 1 min, 54 °C 72° C for 7 min for 1 min, 72 °C for 45 s nuLSU 4 min at 95 °C 94 °C for 1 min, 54 °C 72 °C for 5 min for 1 min, 72 °C for 45 s mtSSU 4 min at 95 °C 94 °C for 1 min, 54 °C 72 °C for 5 min for 1 min, 72 °C for 45 s Mcm7 4 min at 95 °C 95 °C for 30 s, 50 °C for 72 °C for 5 min Fig. 1. Aspicilia malvinae (Fryday 11433, holotype). A, thallus with immersed apothe- 40 s, 72 °C for 1 min cia. B, thallus with ±emergent apothecia. Scales = 2 mm. In colour online.

Standard PCR amplifications were conducted in 25 μl reaction values ≥ 70% within one locus and the same group of taxa was volumes using Ready-To-Go PCR Beads (GE Healthcare, UK) fol- supported ≥ 70% as non-monophyletic within another locus lowing the manufacturer’s recommendations. All primers used in (Mason-Gamer & Kellogg 1996). Because no strongly supported this study are listed in Table 2. conflicts were observed between the four loci, downstream rela- Amplifications were carried out in an Eppendorf Mastercycler tionships and analyses were performed on the concatenated data- Pro thermal cycler (Eppendorf North America, New York, USA) set. Analyses were run using raxmlGUI 2.0 to reconstruct a and performed using the protocols in Table 3. PCR products were maximum likelihood concatenated 4-locus tree. We used Lepra cleaned using the Qiagen PCR Purification Kit (Qiagen, albescens as the root and ran 1000 thorough ML bootstraps Germany) or Agencourt AMPure XP beads (Beckman Coulter, with the model set to GTRGAMMAI. Inc., Brea, CA, USA), following the manufacturers’ instructions, and were visualized on 1% agarose gel stained with ethidium The Species bromide. Sequencing reactions were performed by Eurofins Genomics (Louisville, KY, USA). Aspicilia malvinae Fryday & T. B. Wheeler sp. nov.

Sequence alignment. Sequences were quality checked and MycoBank No.: MB 839030 sequence ends were manually trimmed in AliView (Larsson 2014; http://www.ormbunkar.se/aliview/). Each sequence was Distinguished from other species of Aspicilia by the thalline checked against the NCBI nucleotide database (https://blast.ncbi. chemistry (hypostictic acid) and sequence data. nlm.nih.gov/Blast.cgi) to verify that the desired organism was Type: Falkland Islands, East Falkland, Lafonia, 3.5 km west of sequenced. Alignments were visually checked in AliView and Walker Creek, east side of stream north of road, 51.97705°S, minor misalignments were manually adjusted. 58.82285°W, 21 m, low dolerite outcrop in Empetrum heath above stream, 12 November 2015, A. M. Fryday 11433 & Phylogenetic analyses. Maximum likelihood (ML) trees for each A. Orange (MSC0057604—holotype). locus (not shown) were constructed in raxmlGUI 2.0 (Stamatakis 2014; Edler et al. 2020), and the bootstrap support values for each (Figs 1 & 2) clade were compared. Using a 70% bootstrap value threshold, clades were compared and conflict was assumed to be significant Thallus effuse, several centimetres across, cream to grey, areolate; when a monophyletic group was supported with bootstrap areoles angular, convex, 0.2–0.5 mm across, usually contiguous

Fig. 2. Aspicilia malvinae (A–C, E & F, Fryday 11433, holotype; D, Fryday 11008). A, section through thallus and apothecium. B, section of apothecium. C, immature ascus. D, mature ascus with ascospores. E & F, paraphyses showing constricted septa in upper part (F). Scales: A = 2 mm; B = 100 μm; C & E = 20 μm;D&F=10μm. In colour online.

but sometimes singular or in small groups on a black hypothallus, immature, becoming epruinose, 0.1 mm wide; disc black, slightly areoles separated by deep cracks. Prothallus black, fimbriate at the concave, pruinose when immature, becoming epruinose when thallus edge, 0.5 mm wide. Upper cortex c. 50 μm thick with a thin mature. In section, exciple up to 250 μm wide at the surface, taper- epinecral layer 10–25 μm thick, upper 25 μm of cortex grey in vis- ing to nothing where it merges with the subhymenium, pale ible light due to medium-sized crystals that only partially dissolve brown but darker at the surface that is N+ green, composed of in K, crystals often most frequent between the cortex and the epi- narrow (1–1.5 μm wide) conglutinated hyphae that become necral layer; cortical cells not observed in pale-coloured areoles wider (c.5μm) and cellular with constricted septa for the final but grey areas had cortical cells 5–6 μm diam. with a thin, pale 4–5 cells towards the cortex. Hymenium 140–160 μm, I+ slowly grey-brown cap; lateral cortex pale brown due to numerous yellow and after c. 5 minutes greenish blue; paraphyses very fine minute crystals that do not dissolve in K, slightly POL+, cells c. 1 μm, the upper 20–25 μm (epihymenium) wider (5 μm) 5–8 μm diam. Photobiont layer c. 25 μm thick, cells chlorococcoid, with constricted septa, cells globose to oblong, 5 μm wide by 5– 6–16 μm diam. 7 μm long; epihymenium olive-brown (K+ brown, N+ bright aer- Apothecia abundant, usually immersed (aspicilioid) but some- uginose; Caesiocinerea-green); subhymenium hyaline, I+ slowly times becoming sessile with a prominent proper margin, black, (after c. 5 minutes) dark blue, composed of ±vertically aligned 0.4–0.5 mm diam. when mature, usually 1 per areole, (occasion- hyphae with the same kind of medium-sized hyaline crystals as ally two, rarely three); usually ±round, rarely oblong or linear, in the cortex, merging with the hypothecium. Hypothecium hya- angular if > 1 per areole; thalline margin not apparent, formed line, I+ slowly (after c. 5 minutes) bluish mauve, composed of by the thalline areole; proper margin densely pruinose when thick (c. 5 μm) randomly organized hyphae. Asci cylindrical

when immature, c. 110 × 20 μm, becoming broadly clavate when from East Falkland (Fryday 11431), although these were frequent mature, 80–90 × 40–45 μm; ascospores 8 per ascus, hyaline, broadly in a collection from West Falkland (Fryday 11008). ellipsoid, (22–)24.55 ± 1.63(–30) × (11–)14.65 ± 1.53(–18) μm, l/w Aspicilia malvinae is in a highly supported group outside of ratio (1.28–)1.69 ± 0.19(–2.18), n = 20. the A. cinerea clade and was recovered as sister to the ‘cyanescens’ Pycnidia not observed. clade and the ‘americana’ clade, but with no support (Fig. 3). This ambiguity arises as the single gene trees of ITS and LSU place Chemistry. Thallus C−,K−,KC−,Pd−, but in section slowly K+ A. malvinae either within the unsupported ‘americana’ group or ‘ ’ yellow. TLC (solvent C): hypostictic acid (red spot at Rf 4), faint within the unsupported cyanescens group, respectively. The rela- red spot at Rf 1 (probably subhypostictic acid), UV(after char- tionships within Aspicilia s. str. are unresolved, not due to gene tree ring)++ cream spot at Rf 8. discordance, because none of the single gene trees are supported at any of these conflicting nodes, but due to a lack of data from within Notes. Of the species of Aspicilia reported from the Southern the group. More sampling is needed to resolve the relationships Hemisphere, only two (viz. Lecanora (Aspicilia) masafuerensis between the clades within Aspicilia s. str. However, the separation and A. mendozae) are candidates for an earlier name for our spe- of A. malvinae from the A. cinerea clade, which contains A. abbasi- cies. However, both are reported to have much smaller ascospores ana, the only other Aspicilia species containing hypostictic acid as a than our new species: those of L. masafuerensis are given as major substance, is highly supported. The relationships between 10–18 × 6–8 μm (Zahlbruckner 1924) and those of A. mendozae the genera Lobothallia, Circinaria, Oxneriaria and Aspicilia are as 9–14 × 8–9 μm (Räsänen 1941). Examination of specimens in also highly supported here (Fig. 3). MSC identified as L. masafuerensis and an isotype in NY, revealed slightly larger ascospores than those reported by Zahlbruckner Additional collections examined. Falkland Islands: West (16.7–22.4 × 8.6–9.5 μm), but the specimens also had a dilute Falkland: Chartres, Patricia Luxton NNR, 51.72560°S, 59.98474° brown epihymenium, apparently Porpidia-type asci and are prob- W, 15 m, sloping rock with Bucklandiella sp., 2015, Fryday ably referable to Xenolecia spadicomma (Nyl.) Hertel. In addition, 11008 (MSC); ibid., 51.72824°S, 59.98484°W, seasonally irrigated our species contains hypostictic acid as its primary secondary bedrock sloping at 40°, level with ground, unshaded, aspect 60°, metabolite, which is an uncommon metabolite in lichens and, with Pertusaria alterimosa, Pertusaria cerebrinula/spegazzinii, to the best of our knowledge, found as a major constituent in spe- Parmelia saxatilis, Massalongia patagonica, Bucklandiella sp., cies of Megasporaceae only in the Chinese species A. abbasiana 2015, A. Orange 23271 (NMW). (The amount of moss suggests S. Y. Kondr. et al. (Kondratyuk et al. 2016; syn. A. volcanica that this is a moist microhabitat by Falkland Islands standards). Ismayil et al. (Ismayil et al. 2015)). The ascospores of this species East Falkland: Mt Usborne, Camilla Creek, 51.716467°S, are a similar size ((13–)16–23(–26) × (10–)13–16 μm) to those 58.898183°W, 67 m, bare, stony area in grass/Empetrum heath, of A. malvinae and it also occurs on igneous rock. However, 2015, A. M. Fryday 11431 (MSC). it differs in the paraphyses being distinctly moniliform for their whole length, not just the upper cells as in our species, and in Lichenicolous fungi the thallus containing stictic and constictic acids in addition to hypostictic acid, which are apparently absent from the thallus of The collections of Aspicilia malvinae support two lichenicolous our species. In addition, A. abbasiana is phylogenetically closely fungi: an Endococcus that is best accommodated in Endococcus related to A. cinerea (Fig. 3) and so is quite distant from our propinquus s. lat. (Körb.) Trevis., reported here for the first time species. from the Falkland Islands, and a species of Sagediopsis that is The four collections of this species were all collected from frequent on the holotype and is described here as new to science. rocks close to streams, the holotype and the two collections from West Falkland (Fryday 11008, Orange 23271) from near Endococcus propinquus s. lat. (Körb.) Trevis. the coast, and the other collection from East Falkland (Fryday 11431) from a somewhat higher altitude (67 m) inland. The Conspect. Verruc., 17 (1860). two collections from East Falkland were on dolerite and although the site from which both the West Falkland collections were Ascomata 0.15–0.20 mm diam. with a depressed ostiole; ascospores made, the Patricia Luxton NNR, is also primarily dolerite, at brown, 1-septate, broadly ellipsoid (8–)9.45 ± 0.76(–10) × (5.5–) least one of the collections (Fryday 11008) was from sandstone. 6.6 ± 0.77(–8) μm; l/w ratio (1.125–)1.44 ± 0.14(–1.67); n =10 Unfortunately, the other collection from East Falkland (Orange (Fryday 11431—MSC). 23171) was not accessible for this study. The holotype and one of the West Falkland collections Two species of Endococcus were reported by Diederich et al. (2018) (Orange 23271) had a nearly identical ITS sequence and the as occurring only on Aspicilia: E. calcaricola (Mudd) Nyl. (as three coastal collections were also morphologically similar. The Microthelia calcaricola Mudd) and E. verrucosus Hafellner. The appli- inland collection (Fryday 11431) was also morphologically similar cation of the name Endococcus calcaricola is uncertain; it has been although the paraphyses appeared to be slightly more moniliform included as a synonym of E. rugulosus Nyl. (Index Fungorum (the area with constricted septa extending through the upper 5–6 Partnership 2021), which has ascospores 13–17 × 5–8 μm(Ihlen& cells, whereas for the other collections only the upper 3–4 cells Wedin 2008). Hafellner (1994) gives the ascospore dimensions of had constricted septa) but this appears to be a variable character. E. verrucosus as (13–)14–17(–18) × 7–9 μm, whereas Zhurbenko & However, the presence of hypostictic acid, an uncommon Notov (2015) report them as (7.5–)10–15 (–21) × (5–)6–8(–10) μm. substance in Aspicilia, as a major substance in all three available Therefore, the ascospores of both these species are notably larger collections (Fryday 11008, 11431 & 11433) strongly suggests than those of the species reported here. Two other species were men- that they represent a single taxon. Mature asci and ascospores tioned by Diederich et al. (2018) as occurring on several lichen genera were infrequent in the holotype collection and the other collection including Aspicilia, and by Ihlen & Wedin (2008)asoccurringon

Fig. 3. Maximum likelihood (ML) tree of the concatenated (ITS, LSU, mtSSU and Mcm7) dataset for members of Aspicilia and related species. Analyses were performed using raxmlGUI 2.0 (Stamatakis 2014; Edler et al. 2020). Maximum likelihood bootstrap values are shown above each branch. The newly introduced species is in larger font and voucher information for all specimens is provided (see Table 1 for further details). Abbreviation: A.=Aspicilia.

Aspicilia: E. perpusillus Nyl., with ascospores (12–)15–25(–30) × 5–9 mm diam., smaller asci, 52–60 × 11–15 μm, and longer and μm, and E. propinquus s. lat., with ascospores 7–11 μmlong(Ihlen& narrower ascospores (16–)18–20(–22) × (3.5–)4–5(–6) μm. Wedin 2008). Although E. propinquus s. str. occurs only on the thalli Type: Falkland Islands, East Falkland, Lafonia, 3.5 km west of of Porpidia spp., E. propinquus s. lat. is widespread and has been Walker Creek, east side of stream north of road, 51.97705°S, recorded on a wide variety of crustose lichens, including Aspicilia 58.82285°W, 21 m, lichenicolous on Aspicilia malvinae on a low (Ihlen & Wedin 2008), and this would appear to be the best accom- dolerite outcrop in Empetrum heath above stream, 12 November modation for our fungus. 2015, A. M. Fryday 11433a & A. Orange (MSC0057605—holotype).

Specimen examined. Falkland Islands: East Falkland: Mt Usborne, (Fig. 4) Camilla Creek, 51.716467°S, 58.898183°W, 67 m, bare, stony area in grass/Empetrum heath, 2015, A. M. Fryday 11431 (MSC). Independent thallus not formed but apothecia production in the host is apparently suppressed, hyphae below ascomata hyaline. Ascomata perithecioid, not clypeate but with the wall markedly Sagediopsis epimalvinae Etayo, T. B. Wheeler & Fryday sp. nov. thickened above, 150–200 μm diam., obovate but flattened above, not radially split, with central ostiole sometimes not visible, black, MycoBank No.: MB 839031 matt, immersed, finally slightly protruding from the thallus of Aspicilia malvinae. Exciple entire, black, greatly thickened apically Lichenicolous fungus growing on Aspicilia malvinae. Similar to giving a flat surface up to 100 μm thick, in section surrounded by Sagediopsis fissurisedens that grows on Aspilidea (syn. Aspicilia) a hyaline, non-cellular coat 4–5 μm thick, dark brown above to myrinii, but differing in the much smaller perithecia, 0.15–0.20 somewhat lighter brown below, K−, hyphae around ostiole

Fig. 4. Sagediopsis epimalvinae (Fryday 11433a, holotype). A, habitus of several Sagediopsis perithecia on areolae of Aspicilia malvinae. B, upper part of exciple showing elongated hyphae disposition and periphysoids in ostiolar channel. C & D, upper part of asci and paraphyses (in I). E, ascus with simple and branched paraphyses (in water). F, upper part of a perithecium showing the thickened upper exciple and periphysoids. G, ascospores. Scales: A = 1 mm; B–E&G=10μm; F=25 μm. In colour online.

elongated; base and lateral parts of exciple 15–20(–35) μm thick, at the septa, 1–1.5 μm thick, with many small colourless oil dro- composed of several layers of more or less elongated cells with a plets. Asci clavate to cylindrical, with a short ‘foot’, thin-walled thick cell wall and small lumina, 4–7 × 1.5–2 μm. Periphysoids laterally (1 μm) but thicker apically, 2–3 μm, 8-spored, 52–60 × growing down from around ostiole, abundant, immersed in a col- 11–15 μm(n = 6), wall I+ reddish, turning bluish in part and ourless gel, simple to branched, even anastomosed, especially at KI+ pale blue, tholus I−, ascoplast I+ orange. Ascospores biseriate the base, 10–30 × 1 μm. Hymenial gel I+ reddish, KI+ blue; subhy- in the asci, hyaline only finally slightly brownish, ellipsoid to fusi- menium with large colourless oil droplets, 1–6 μm diam. form to slightly soleiform, with upper part wider than lower, (0–) Hamathecium of persistent paraphysoids, flexuose, not thickened 3-septate, not or hardly constricted at the septa, with a large oil at the apex, septate, simple or sparingly branched, not constricted droplet in each cell occupying most of the cell except the very

ends, thin and smooth-walled, without perispore, straight, rarely several other features. Sagediopsis lomnitzensis (Stein) Orange on curved, (16–)18–20(–22) × (3.5–)4–5(–6) μm(n = 40). Ionaspis lacustris (With.) Lutzoni and I. odora (Ach.) Th. Fr. Conidiomata not observed. (Orange 2002) has a perithecial wall that is I+ sometimes violet to blue in part, and smaller, 1-septate, halonate ascospores, (9.5–)11– Notes. Our new species fits well with the genus Sagediopsis by 18 × 5–7(–8) μm. Sagediopsis vasilyevae Zhurb. on Rhizocarpon having immersed perithecioid ascomata with a flattened upper has much larger ascospores, (37.5–)41.7–50.3(–53.0) × (2.5–)2.9– zone; a thickened upper exciple formed by elongated hyphae 3.5(–3.8) μm (Zhurbenko & Yakovchenko 2014). around the ostiole; periphysoids immersed in gel growing down from around the ostiole; abundant paraphysoids intermixed Acknowledgements. Fieldwork on the Falkland Islands by the first author with the asci; a hymenial gel reacting reddish to blue with was funded by the UK Government through DEFRA and the Darwin ’ Initiative as part of the project Lower Plants Inventory and Conservation in Lugol s reagent or IKI; Verrucaria-type asci that are thickened the Falkland Islands (Reference number DPLUS017). Support for fieldwork apically and 8-spored; ellipsoid to fusiform, transversally septate and advice regarding landowners was provided by Falklands Conservation. ascospores. We are grateful to Alan Orange (Cardiff) for sharing his unpublished No other species of Sagediopsis are known from Aspicilia, sequences of Aspicilia malvinae with us and to Kerry Knudsen (Prague) for although two were reported from Aspilidea myrinii (Fr.) additional specimens included in this study. We also thank the curators of Hafellner before it was transferred from Aspicilia to Aspilidea: NY for the loan of their isotype of Lecanora masafuerensis, and the curators S. fissurisedens Hafellner (Hafellner 1993) and S. aspiciliae of BM, GB, UPS & W for details of the type specimens of this species housed Nik-Hoffm. & Hafellner (Hoffmann & Hafellner 2000). in their herbaria. Sagediopsis fissurisedens has several features in common with Author ORCIDs. Alan Fryday, 0000-0002-5310-9232; Timothy Wheeler, our new species: ascomata with the exciple markedly thickened 0000-0003-0668-8662; Javier Etayo, 0000-0003-0392-0710. above, a similar hamathecium, 8-spored asci and 3-septate ascos- – pores. However, it differs in the much larger perithecia (0.4 0.7 References mm diam.), the larger asci (60–80 × 13–17 μm) that are I−, and the slightly shorter but notably wider ascospores, 12–17 × 5–8 Calvelo S and Liberatore S (2002) Catálogo de los líquenes de la Argentina – μm. Sagediopsis aspiciliae is very different, also with larger asco- [Checklist of Argentinean Lichens]. Kurtziana 29(2), 7 170. Diederich P, Lawrey JD and Ertz D (2018) The 2018 classification and check- mata (120–360(–400) μm diam.), larger asci (60–100 × 9–13.5 μ list of lichenicolous fungi, with 2000 non-lichenized, obligately lichenico- m) and ascospores that are simple to rarely 1-septate and ellips- 121 – – – – – – – μ lous taxa. Bryologist , 340 425. oidal, (10 )10.5 14.1( 15) × (5 )5.2 6.9( 8) m, but it has a Edler D, Klein J, Antonelli A and Silvestro D (2021) raxmlGUI 2.0: a graph- hemiamyloid hymenium gel similar to S. epimalvinae. ical interface and toolkit for phylogenetic analyses using RAxML. Methods Sagediopsis species have also been reported from other genera of in Ecology and Evolution 12, 373–377. Pertusariales. Sagediopsis pertusariicola Zhurb. was described Esslinger TL (2019) A cumulative checklist for the lichen-forming, lichenico- growing on Pertusaria (Zhurbenko 2009). This species has larger, lous and allied fungi of the continental United States and Canada, version glossy perithecia, (200–)250–400(–500) μm diam., and ascospores 23. Opuscula Philolichenum 18, 102–378. with upper and lower parts mostly equal in width, sometimes with Fletcher A, Purvis OW and Coppins BJ (2009) Aspicilia A. Massal. (1852). In pointed ends. Sagediopsis campsteriana (Lindsay) D. Hawksw. & Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW and Wolseley PA (eds), The Lichens of Great Britain and Ireland. London: R. Sant. is very similar to our new species but seems to be an exclu- British Lichen Society, pp. 181–188. sive parasite of Ochrolechia sp. Hawksworth (1975) and Triebel Fryday AM (2015) A new checklist of lichenised, lichenicolous and allied fungi – – (1993) described it with ellipsoid ascospores, (1 )3( 4)-septate, reported from South Africa. Bothalia 45,59–122. (12–)15–20(–25) × 4–6 μm. According to the most recent descrip- Fryday AM, Orange A, Ahti T, Øvstedal DO and Crabtree DE (2019) An tion by Zhurbenko (2009), its ascomata are larger, 150–250(–400) annotated checklist of lichen-forming and lichenicolous fungi reported μm diam., and usually immersed to sometimes erumpent to almost from the Falkland Islands (Islas Malvinas). Glalia 8,1–100. superficial (a sessile, obpyriform perithecium is drawn in Galloway DJ (2007) Flora of New Zealand Lichens. Revised Second Edition Hawksworth (1975)) and it has slightly larger asci, 60–73 × 10– Including Lichen-Forming and Lichenicolous Fungi. Volumes 1 and 2. 13 μm. In all of these species growing on Pertusariales, a subhyme- Lincoln, New Zealand: Manaaki Whenua Press. nium with many colourless oil droplets has not been recorded. Galloway DJ and Quilhot W (1998) Checklist of Chilean lichen-forming and lichenicolous fungi [Lista patron de los liquenes y hongos liquenicolas de Other species of Sagediopsis are known from species of Chile]. Gayana Botanica 55, 111–185. Lecideaceae. Sagediopsis aquatica (Stein) Triebel (Rambold et al. Gardes M and Bruns TD (1993) ITS primers with enhanced specificity for 1990), which occurs on Koerberiella wimmeriana (Körb.) Stein and basidiomycetes – application to the identification of mycorrhizae and is known only from Europe, has ascospores (22–)27–36(–45) × rusts. Molecular Ecology 2, 113–118. (2.5–)3–3.5(–4) μm that are narrowly fusiform to acicular and acu- Hafellner J (1993) Über Funde von lichenicolen Pilzen und Flechten im minate at the basal end. Sagediopsis barbara (Th. Fr.) R. Sant. & südlichen Norwegen. Herzogia 9, 749–768. Triebel, which is restricted to Porpidia spp. (Triebel 1989), has Hafellner J (1994) Beiträge zu einem Prodromus der lichenicolen Pilze larger ascomata (to 450 μm diam.) and larger ascospores (20–)27– Österreichs und angrenzender Gebiete. I. Einige neue oder seltene Arten. – 39.5(–46) × (3–)3.5–4.5(–5) μm. Sagediopsis dissimilis Triebel was Herzogia 10,1 28. ı ı described growing on Paraporpidia leptocarpa (Nyl.) Rambold & Hal c MG, Güllü M and Parnikoza I (2017) Sagediopsis bayozturkii sp. nov. on the lichen Acarospora macrocyclos from Antarctica with a key to the Hertel in Australasia (Triebel 1993)andhas0–1-septate ascospores, – – – – – – μ known species of the genus (Ascomycota, Adelococcaceae). Polar Record (7.5 )8 10.5( 12) × (4 )4.5 6( 6.5) m. 53, 271–275. Other species of the genus have been reported from a range of Hawksworth DL (1975) Notes on British lichenicolous Fungi, I. Kew Bulletin unrelated host genera. Sagediopsis bayozturkii Halıcı et al.was 30, 183–203. described on Acarospora macrocyclos (Halıcı et al. 2017). It differs Hoffmann N and Hafellner J (2000) Eine Revision der lichenicolen Arten der from S. epimalvinae by its smaller perithecia (90–150 μmdiam.) Sammelgattungen Guignardia und Physalospora. Bibliotheca Lichenologica and smaller ascospores ((10–)11–14(–15) × 4–5 μm),aswellasin 77,1–190.

Ihlen PG and Wedin M (2008) An annotated key to the lichenicolous Rambold G, Hertel H and Triebel D (1990) Koerberiella wimmeriana Ascomycota (including mitosporic morphs) of Sweden. Nova Hedwigia (Lecanorales, Porpidiaceae) and its lichenicolous fungi. Lichenologist 22, 86, 275–365. 225–240. Index Fungorum Partnership (2021) Index Fungorum [WWW resource] URL Räsänen V (1941) La flora liquenologica de Mendoza (Argentina). Anales de http://www.indexfungorum.org. [Accessed 4 January 2021]. la Sociedad Científica Argentina, Buenos Aires 131,97–110. Ismayil G, Abbas A and Guo S-Y (2015) Aspicilia volcanica, a new saxicolous Schmitt I, Messuti MI, Feige GB and Lumbsch HT (2001) Molecular data lichen from Northeast China. Mycotaxon 130, 543–548. support rejection of the generic concept in the Coccotremataceae Kondratyuk SY, Lőkös L, Park J-S, Jang S-H and Jeong M-H (2016) New (Ascomycota). Lichenologist 33, 315–321. Aspicilia species from South Korea proved by molecular phylogeny with a Schneider K, Resl P, Westberg M and Spribille T (2015) A new, highly effect- key to the Eastern Asian aspicilioid lichens. Studia Botanica Hungarica ive primer pair to exclude algae when amplifying nuclear large ribosomal 47, 227–249. subunit (LSU) DNA from lichens. Lichenologist 47, 269–275. Larsson A (2014) AliView: a fast and lightweight alignment viewer and editor Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and for large data sets. Bioinformatics 30, 3276–3278. post-analysis of large phylogenies. Bioinformatics 30, 1312–1313. Mason-Gamer R and Kellogg EA (1996) Testing for phylogenetic conflict Triebel D (1989) Lecideicole Ascomyceten. Eine Revision der obligat licheni- among molecular data sets in the tribe Triticeae (Gramineae). Systematic colen Ascomyceten auf lecideoiden Flechten. Bibliotheca Lichenologica 35, Biology 45, 524–545. 1–278. McCarthy P (2016) Checklist of the Lichens of Australia and its Island Triebel D (1993) Notes on the genus Sagediopsis (Verrucariales, Adelococcaceae). Territories. [WWW resource] URL https://id.biodiversity.org.au/reference/ Sendtnera 1,273–280. lichen/30005164 [Accessed 10 November 2020]. Urbanavichus G (2010) A Checklist of the Lichen Flora of Russia.St Meyer B and Printzen C (2000) Proposal for a standardized nomenclature Petersburg: Nauka. and characterization of insoluble lichen pigments. Lichenologist 32, White TJ, Bruns TD, Lee SB and Taylor JW (1990) Amplification and direct 571–583. sequencing of fungal ribosomal RNA genes for phylogenetics. In Innis MA, Nordin A, Tibell LB and Owe-Larsson BR (2007) A preliminary phylogeny Gelfand DH, Sninsky JJ and White TJ (eds), PCR Protocols: a Guide to of Aspicilia in relation to morphological and secondary product variation. Methods and Applications. New York: Academic Press, pp. 315–322. Bibliotheca Lichenologica 96, 247–266. Zahlbruckner A (1924) Die Flechten der Juan-Fernandez-Inseln. In Nordin A, Savic S and Tibell L (2010) Phylogeny and taxonomy of Aspicilia Skottsberg C (ed.), The Natural History of Juan Fernandez and Easter and Megasporaceae. Mycologia 102, 1339–1349. Island, Vol. II. Uppsala: Almqvist & Wiksells, pp. 315–408. Nordin A, Owe-Larsson B and Tibell L (2011) Two new Aspicilia species Zhurbenko M (2009) Sagediopsis pertusariicola (Verrucariales), a new licheni- from Fennoscandia and Russia. Lichenologist 43,27–37. colous ascomycete from the Arctic. Nova Hedwigia 88, 549–555. Orange A (2002) Lichenicolous fungi on Ionaspis lacustris. Mycotaxon 81, Zhurbenko M and Notov A (2015) The lichenicolous lichen Placocarpus 265–279. americanus and some noteworthy lichenicolous fungi from Russia. Folia Orange A, James PW and White FJ (2001) Microchemical Methods for the Cryptogamica Estonica 52,95–99. Identification of Lichens. London: British Lichen Society. Zhurbenko MP and Yakovchenko LS (2014) A new species, Sagediopsis vasi- Øvstedal DO and Lewis Smith RI (2001) Lichens of Antarctica and South lyevae, and other lichenicolous fungi from Zabaikal’skii Territory of Russia, Georgia: A Guide to Their Identification and Ecology. Cambridge: southern Siberia. Folia Cryptogamica Estonica 51, 121–130. Cambridge University Press. Zoller S, Scheidegger C and Sperisen C (1999) PCR primers for the amplifi- Øvstedal DO, Tønsberg T and Elvebakk A (2009) The lichen flora of cation of mitochondrial small subunit ribosomal DNA of lichen-forming Svalbard. Sommerfeltia 33,1–393. ascomycetes. Lichenologist 31, 511–516.