Targeting and Regulation of the HER-2/Neu Oncogene Promoter with Bis-Peptide Nucleic Acids

OLIGONUCLEOTIDES 15:36–50 (2005) © Mary Ann Liebert, Inc.

Targeting and Regulation of the HER-2/neu Oncogene Promoter with Bis-Peptide Nucleic Acids

AMY J. ZIEMBA, ZHANNA V. ZHILINA, YULIA KROTOVA-KHAN, LENKA STANKOVA, and SCOT W. EBBINGHAUS

ABSTRACT

Antigene oligonucleotides have the potential to regulate gene expression through site-specific DNA binding. However, in vivo applications have been hindered by inefficient cellular uptake, degradation, and strand displacement. Peptide nucleic acids (PNAs) address several of these problems, as they are resistant to degradation and bind DNA with high affinity. We designed two cationic pyrimidine bis-PNAs (cpy-PNAs) to target the polypurine tract of the HER-2/neu promoter and compared them to an unmodified phosphodiester triplex-forming oligonucleotide (TFO1) and a TFO-nitrogen mustard conjugate (TFO2). PNA1 contains a 2 charge and bound two adjacent 9-bp target sequences with high affinity and specificity, but only at low pH. PNA2 contains a 5 charge and bound one 11-bp target with high affinity up to pH 7.4, but with lower specificity. The PNA:DNA:PNA triplex formed by these cpy-bis-PNAs presented a stable barrier to DNA polymerase extension. The

cpy-bis-PNAs and the TFO-alkylator conjugate prevented HER-2/neu transcription in a reporter gene assay (TFO2 PNA1 PNA2 TFO1). Both PNAs and TFOs were effective at binding the target sequence in naked genomic DNA, but only the TFO-alkylator (TFO2) and the more cationic PNA (PNA2) were detected at the endogenous HER-2/neu promoter in permeabilized cells. This work demonstrates the potential for preventing HER-2/neu gene expression with cpy-bis-PNAs in tumor cells.

INTRODUCTION (dsDNA). Triplex-forming oligonucleotides have been demonstrated to recognize and bind target sequences LIGONUCLEOTIDES (OLIGOS) have the potential to within the structured chromatin of permeabilized cells Otarget DNA site specifically and regulate gene ex- (Giovannangeli 1997) or isolated nuclei (Besch et al., pression, prevent DNA replication, and induce site-spe- 2002). Further evidence of the ability of TFOs to bind to cific mutations (Guntaka et al., 2003). These properties target sequences within living cells comes from the abil- could ultimately lead to new treatments for a wide vari- ity of TFOs to mediate mutagenesis at the target site in ety of genetic and infectious diseases, including cancer yeast cells (Barre et al., 2000), cultured mammalian cells and HIV infection (Cho-Chung, 2002; Laskin and San- (Vasquez et al., 1999, 2001; Wang et al., 1996), and mice dler, 2004; Orr, 2001; Rudin et al., 2004). Oligos that (Vasquez et al., 2000). TFO binding to the target se- are designed to target DNA in order to interfere with quence in intact mammalian cells was also demonstrated gene expression are known as antigene oligos. Triplex- by site-specific, TFO-directed strand cleavage (Sedel- forming oligos (TFOs) are antigene oligos that bind to nikova et al., 2002). Although mutagenesis or cleavage polypurine-polypyrimidine DNA tracts and form base events are infrequent, they have unambiguously demon- triplets by Hoogsteen bonding to double-stranded DNA strated that a TFO can bind to a target sequence in living

Arizona Cancer Center, Tucson, AZ 85724.

36 TARGETING THE HER-2/NEU PROMOTER 37 cells. TFOs have also been shown to prevent transcrip- base (pseudoisocytosine) substitutions (Egholm et al., tion initiation or elongation from plasmid DNA trans- 1995). fected into cells (Faria et al., 2001; Kim et al., 1998; In cell-free models and in tissue culture, PNAs can Ziemba et al., 2003), but few studies have evaluated the both inhibit and activate transcription, prevent DNA regulation of endogenous gene expression by TFOs. One replication, and induce mutations in chromosomal DNA promising study demonstrated biologic activity in cells (Diviacco et al., 2001; Faruqi et al., 1998; Larsen and by a TFO and also indicated specific target interactions Nielsen, 1996; Mollegaard et al., 1994; Nielsen et al., (Majumdar et al., 2003). Other recent reports demon- 1994; Wang et al., 1999, 2001; Zhao et al., 2003). One strated antigene effects of TFOs at endogenous targets in drawback is that PNAs are more difficult to deliver cell culture (Besch et al., 2002; Carbone et al., 2003, to cultured cells than DNA oligos because their neutrally 2004) but did not confirm site-specific binding in viable charged backbone (Chinnery et al., 1999) is not amenable cells. To date, antigene activity by a TFO has not been to PNA inclusion in most of the commonly used DNA demonstrated to be caused by direct interactions at the in- transfection reagents. Recently, several groups have tended target sequence in living cells. shown that PNAs conjugated to either lipophilic moieties Peptide nucleic acids (PNAs) are DNA mimics in or to cell-penetrating peptides (CPPs) can effectively de- which the sugar-phosphate backbone of DNA is replaced liver PNAs to cultured cells (Kaihatsu et al., 2004a; Kop- by an uncharged aminoethylglycine backbone. PNAs pelhus and Nielsen, 2003). The HER-2/neu oncogene is were first reported in 1991 (Nielsen et al., 1991) and have overexpressed in numerous types of human cancer, and since been shown to interact with single-stranded, dou- its overexpression often correlates with poor clinical out- ble-stranded, hairpin, and quadruplex DNA, as well as come (Cirisano and Karlan, 1996; Jardines et al., 1993). RNA (Armitage, 2003). PNAs have great potential as an The apparent involvement of HER-2/neu in tumor pro- antigene therapy for targeting of chromosomal DNA gression and metastasis makes it an attractive target for (Kaihatsu et al., 2004b). Compared with DNA and many cancer therapeutics. The HER-2/neu promoter contains a DNA analogs, PNAs have a higher affinity for comple- polypurine tract within a region of transcriptional impor- mentary DNA and RNA sequences, bind less to proteins, tance, overlapping a transcription initiator sequence and and are less susceptible to degradation by nucleases or just upstream of the TATAA box, both of which are ca- proteases (Demidov et al., 1994; Uhlmann, 1998). The pable of independently controlling transcription initiation DNA:DNA:DNA triple helix is recognized by DNA re- (Mizuguchi et al., 1994). TFOs targeting this polypurine pair proteins (Vasquez et al., 2002) and displaced by he- tract can disrupt transcription factor binding and prevent licases (Maine and Kodadek, 1994), but PNAs are less transcription (Ebbinghaus et al., 1993; Noonberg et al., susceptible to unwinding by helicases (Bastide et al., 1994; Porumb et al., 1996; Ziemba et al., 2003). How- 1999; Tackett et al., 2002) and block DNA polymerase ever, we have observed previously that a triple helix elongation when bound to duplex DNA (Smolina et al., formed within this sequence does not persist in cells un- 2003). Pyrimidine-rich PNAs can bind to a polypur- less third strand binding is stabilized by covalent adducts ine DNA sequence by strand invasion and form a with the target sequence using a TFO-alkylator conjugate PNA:DNA:PNA triple helix, differentiating PNAs from (Ziemba et al., 2003). In the present work, we designed DNA-binding oligos described to date. In this complex, bis-PNAs predicted to bind to the HER-2/neu promoter one PNA molecule binds the purine-rich DNA strand by with sufficient stability to mediate antigene effects in Hoogsteen bonds while a second PNA molecule binds by cells without the need for covalent binding to the target Watson-Crick base pairing, displacing the noncomple- sequence. We demonstrate that two different bis-PNA mentary pyrimidine DNA strand (Egholm et al., 1993; molecules can target the HER-2/neu promoter and inhibit Nielsen, 2001; Nielsen et al., 1991). A theoretical analy- HER-2 transcription comparable to a TFO-alkylator con- sis indicated that the Hoogsteen base pairing occurs first, jugate in a reporter plasmid. PNA binding was detected followed by strand invasion and Watson-Crick base pair- at the endogenous HER-2/neu promoter in permeabilized ing, resulting in formation of a P-loop (Kuhn et al., breast cancer cells with an amplified HER-2/neu gene. 1999). Local distortion of the double helix appears to be the rate-limiting step for PNA invasion (Bentin and Nielsen, 1996; Demidov et al., 1995; Larsen and Nielsen, 1996). The rate of PNA binding and strand invasion may MATERIALS AND METHODS be improved by linking the two single pyrimidine-rich Oligonucleotide synthesis PNA molecules by a flexible linker (bis-PNAs) and the inclusion of cationic lysine residues (cationic pyrimidine PNAs were purchased from Applied Biosystems (Fos- PNAs, cpy-PNAs) (Griffith et al., 1995). Finally, the for- ter City, CA) (PNA1) and Biosynthesis, Inc. (Lewisville, mation of a pyrimidine motif triple helix requires proto- TX) (PNA2) and the sequences are PNA1, NH2-TC- nation of cytosines and is facilitated at neutral pH by J- CTCCTCC-OOO-Lys-CCTCCTCCT; PNA2, NH2-Lys- 38 ZIEMBA ET AL.

Lys-CCTCCTCCTCC-OOO-CCTCCTCCTC-Lys-Lys. sion (pGL3 basic) (Promega, Madison, WI). The restric- The PNA arms were separated by three linker molecules tion fragment was end-labeled on the top strand down- (O, 2-amino-ethoxy-2-ethoxyacetic acid). Lysine (lys) stream of the target sequence by Klenow fill-in, and 0.1 residues were incorporated where indicated. The PNAs M labeled probe was incubated with 0.01–1.0 M were aliquoted in siliconized tubes, stored at 4°C for less PNA, representing a 0.1–10 molar ratio of PNA, at pH than 2 months, and preheated to 50°C for 10 minutes 6.5, or with 1 M (10 molar ratio) of TFO1 in prior to use. DNA oligos were purchased from Qiagen 1TBM (90 mM Tris, pH 7.4, 90 mM borate, 10 mM Operon (Chatsworth, CA) and gel purified before use. MgCl2). The reactions (0.01 M final) were incubated TFO sequences are TFO1, 3-AGGAGAAGGAGGAG- with 2 G dIdC in balance buffer (75 mM KCl, 20 mM GCGGAGGAGGAGGG; TFO2, 3-PAM-GAGAAG- Tris, pH 7.4) for 2 minutes at ambient temperature. An GAGGAGGCGGAGGAGGAGG-PAM. TFO2 was syn- equal volume (10 l) of DNase dilution buffer (10 mM thesized with a C6-amino group at both the 5 -end and MgCl2, 10 mM CaCl2) containing 0.1 U DNase I (Invit- 3-end, conjugated to phenylacetic acid mustard (PAM), rogen, San Diego, CA) was added for 30 seconds at and purified by reverse-phase high-performance liquid ambient temperature. Reactions were immediately termi- chromatography (HPLC) as previously described nated in formamide containing 20 mM EDTA and sepa- (Ziemba et al., 2003). Guanine residues in TFO2 were rated on a denaturing 8% sequencing gel. A Maxam and substituted with 8-aza-7-deazaguanine (PPG) to prevent Gilbert G-reaction was performed to identify the pro- self-association of the TFO (Ebbinghaus et al., 1999; tected guanine residues (Sambrook et al., 2001). Compe- Lampe et al., 1997). tition experiments were performed by incubating 0.1 M PNA2 (1) with the labeled HER-2/neu promoter re- Electrophoretic mobility shift assays (EMSAs) striction fragment and either wild-type or purine-rich control duplexes as cold competitors. The cold competi- Synthetic duplexes were formed with complementary tor duplexes were added at 10-fold molar excess to the oligos that were end-labeled on either the pyrimidine or radiolabeled HER-2/neu promoter, either just before in- the purine strand, annealed, and gel purified. The du- cubation with PNA2 or for 4 hours after the PNA was al- plexes represented the native HER-2/neu promoter se- ready bound to the radiolabeled HER-2/neu promoter. quence from 214 to 249 (Fig. 1), the HER-2/neu For S1 probing of the pyrimidine strand, a 280-bp promoter sequence with 1-bp mismatches in the PNA EcoRI/SmaI fragment of the pGL3/HNP410 plasmid was binding sites (at 223 and 234), or a purine-rich con- end-labeled on the bottom strand upstream of the target trol containing a PNA binding site with a 3-bp mismatch. sequence by Klenow fill-in. The fragment was incubated In addition, an asymmetric HER-2/neu duplex (51-mer with the indicated concentration of PNA1 or TFO1 at pyrimidine strand and 65-mer purine strand) was end-la- 37°C for 4 hours or overnight. The reaction was incu- beled on both strands to simultaneously demonstrate bated with 10 U S1 endonuclease in 0.5 S1 endonucle- PNA binding to the purine strand and dissociation of the ase buffer (Fisher Scientific, Pittsburgh, PA) at ambient pyrimidine strand. Labeled duplexes (0.01 M) were in- temperature for 20 minutes. The reaction conditions were cubated with increasing concentrations of PNA (0.1 optimized so that 50% of the full-length fragment was nM–1 M). PNA binding reactions were performed in 10 cleaved by S1 endonuclease. Reactions were terminated mM NaPO buffer, pH 6.5–7.4, at 37°C for 4 hours. The 4 in formamide containing 50 mM EDTA and separated on complexes were separated on a 12% native polyacry- a denaturing 8% sequencing gel. A Maxam and Gilbert lamide gel and visualized by autoradiography. Because C-reaction was performed to identify the location of the bis-PNA-induced invasion complexes form with high S1 sensitive sites (Sambrook et al., 2001). stability, the dissociation rate is low and often unmeasur- able (Bentin et al., 2003). Therefore, true thermodynamic equilibrium constants are not practical. In these experi- DNA polymerase arrest assay ments, the PNA binding affinity is described by the PNA DNA polymerase arrest assays are a variation of a de- concentration leading to conversion of 50% of the dou- scribed technique (Han et al., 1999; Weitzmann et al., ble-stranded target to single-stranded pyrimidine strand 1996). The 86-mer template strand for primer extension plus PNA:DNA complexes (C ). 50 contains the polypurine tract of the HER-2/neu promoter from 249 to 212 flanked by a primer binding DNase I and S1 digestions (TCCAACTATGTATAC) and tail sequence (AGCG- For DNase I footprinting on the purine strand, a 250-bp GCACGCAATTGCTATAGTGAGTCGTATTA) (Fig. PstI/XmaI fragment of the HER-2/neu promoter was ex- 4A). End-labeled primer (0.67 M) and template strand cised from pGL3/HNP410. The pGL3/HNP410 construct (0.33 M) were annealed in a 30-l final volume. This contains the HER-2/neu promoter from 410 to 1 rela- primer-template heteroduplex was used for PNA binding tive to the translation start site driving luciferase expres- and primer extension. For TFO binding, end-labeled TARGETING THE HER-2/NEU PROMOTER 39

primer and a 36-mer complement (0.67 M) to the poly- 37°C, separated on an agarose gel, and transferred to a purine tract of the HER-2/neu promoter were both an- nylon membrane. High stringency Southern hybridiza- nealed to the 86-mer template. Annealed heteroduplexes tion was performed using a 300-bp internally radiola- were gel purified to remove excess primer or pyrimidine beled PstI/ApaI fragment of the HER-2/neu promoter complement. (Sambrook et al., 2001). PNAs were mixed with 0.01 M template-primer mixture in a 10- l final volume (NaPO4, pH 6.5 or 7.4) and Digitonin permeabilization incubated for 4 hours at 37°C before adding 1 mM MgCl 2 Digitonin permeabilization was a slight modification for DNA polymerase extension. TFOs were mixed with of previously published methods (Duverger et al., 1995; 0.01 M promoter primer-template mixture in a final vol- Giovannangeli et al., 1997). Briefly, SK-BR-3 cells were ume of 10 l 1TBM and incubated for 4 hours at 37°C. trypsinized and washed in phosphate-buffered saline DNA polymerase extension was performed by adding (PBS) prior to treatment. Two million cells were incu- 0.15 mM dNTPs and 5 U Taq DNA polymerase (Fermen- bated with 40 g/ml digitonin (Sigma, St. Louis, MO) in tas, Hanover, MD) for 20 minutes at 37°C. Taq was se- permeabilization buffer (Giovannangeli et al., 1997) at lected for these assays so that future studies could be per- ambient temperature for 5 minutes, washed in digitonin- formed to evaluate PNA stability at higher temperatures, free buffer, and tested for permeabilization efficiency by but only 37°C was used here. The reactions were stopped trypan blue staining. Permeabilized cells were then incu- by adding formamide loading buffer with 10 mM EDTA bated with 1 M TFO2 in triplex-forming buffer (10 mM and 10 mM NaOH, and the extension products were re- Tris, pH 7.4, 50 mM NaCl, 10 mM MgCl ) or with 10 solved on a denaturing 8% sequencing gel. To identify the 2 M PNA in NaPO buffer (10 mM NaPO , pH 6.5–7.0, sites of polymerase arrest, a chain termination sequencing 4 4 50 mM NaCl) at 37°C for 4 hours with gentle rocking. reaction was performed with the same primer-template Prior to genomic DNA isolation, cells were washed three mixture using ThermoSequenase (USB, Cleveland, OH) times with 1 PBS, and gDNA was isolated, digested according to the manufacturer’s instructions. with BbvI, and subjected to Southern hybridization as de- Transient transfections scribed. HeLa cells were purchased from the American Type

Culture Collection (ATCC, Rockville, MD) and cultured RESULTS as recommended. Site-directed mutagenesis was performed (Quickchange, Stratagene, La Jolla, CA) to gen- PNA design and target sequences erate mutant promoter plasmids using the normal plas- The target sequence for PNA binding (Fig. 1) is a poly- mid pGL3/HNP410, and 6-bp mutations were introduced purine-polypyrimidine tract in the HER-2/neu promoter by engineering an SphI restriction site at target 1 from (218–245 relative to the translation start site) that 237 to 232 (237 plasmid) or at target 2 from 225 overlaps an initiator-like sequence and lies between the to 220 (225 plasmid). Oligos (1–10 M) were incu- TATA and CCAAT boxes (Mizuguchi et al., 1994). In bated with plasmids (2 g) at 37°C for 4 hours in either our recent work targeting this polypurine tract with 10 mM NaPO buffer at pH 6.5 (for PNAs) or 1TBM at 4 TFOs, we demonstrated that an unmodified TFO (TFO1) pH 7.4 (for TFOs) and then mixed with lipofectamine rapidly dissociated from the target sequence in a plasmid (Invitrogen) and the internal control pRLSV40 renilla lu- that was transfected into tumor cells. To prevent HER- ciferase vector (Promega) for transfection into HeLa 2/neu transcription, it was necessary to modify the TFO cells. Dual luciferase Assays (Promega) were performed at both ends with a DNA alkylating agent, and triplex at 24–72 hours, HER-2/neu-driven luciferase activity formation with this TFO-alkylator conjugate (TFO2) pre- was normalized for transfection efficiency, and the data vented recombinant helicase activity and persisted in are presented relative to luciferase activity from un- cells for up to 72 hours (Ziemba et al., 2003). For this treated pGL3/HNP410 as previously described (Ziemba reason, we designed cpy-bis-PNAs (PNA1, PNA2) to de- et al., 2003). termine if the strand invasion complex was sufficiently Southern blot protection assay stable to alleviate the need for covalent modification of the target sequence. Genomic DNA (gDNA) from SK-BR-3 cells (15 g) PNA1 contains two linked 9-mer with the sequence

was heated to 50°C for 20 minutes and was incubated (TCC)3-(CCT)3 designed to target (AGG)3 sequences by with PNAs in 10 mM NaPO4 buffer (pH 6.5 or 7.4) for the formation of a PNA:DNA:PNA triple helix. The tar- up to 24 hours. The TFO reaction was performed in get sequence contains two adjacent runs of AGG repeats 1TBM without prior heating of gDNA. The gDNA was (target 1 and target 2), so that two PNAs could bind then digested with 1 U BbvI/g DNA for 2 hours at simultaneously to the target sequence. PNA2 contains 40 ZIEMBA ET AL.

FIG. 1. PNA binding targets. (A) Schematic of PNA1 interactions with the HER-2/neu promoter duplex targets. The individual bis-PNA targets are shown in bold. The sequence illustrated from 249 to 214 represent the oligos used in mobility shift assays. The TATAA (201 to 205) and CCAAT (249 to 253) boxes are shown relative to the translation start site (double arrow). The major transcription start site (single arrow) is located at 120. (B) Schematic of PNA2 invasion complex with the HER-2/neu promoter. PNA2 was designed to target an 11-bp stretch of target 2. (C) Single base pair mutations (transition G to A) were incorporated in the center of each PNA target sequence to generate a 1-bp mismatch duplex. The target was assured to contain no introduced PNA target sites. A random purine-rich duplex was also generated containing a 3-bp mismatch. linked 10-mer and 11-mer arms designed to bind to target duces 50% strand invasion under a given set of experi- 2 in order to increase binding specificity (Fig. 1B). Ap- mental conditions, is presented (Fig. 2D) (Bentin et al., pending multiple lysine residues to cpy-bis-PNAs accel- 2003). PNA1 demonstrated pH-dependent strand inva- erates invasion complex formation (Egholm et al., 1995; sion, with a high affinity for the target duplex at slightly Griffith et al., 1995), and we compared binding affinity acid or neutral pH (C50 5 nM at pH 6.5 and 30 nM at and specificity of PNA1 with a single lysine residue in pH 7.0) and a sharp decrease in binding at slightly alka- the linker to PNA2 with four lysine residues, two on each line pH (C50 1 M at pH 7.4). In contrast, PNA2 dem- terminus. PNA binding and the level of HER-2/neu pro- onstrated a high affinity for the target sequence over this moter suppression in plasmid DNA in cells was compared pH range (C50 2 nM at pH 6.5 and 40 nM at pH 7.4). with purine motif TFOs that were either unmodified Higher PNA concentrations caused the formation of sev- (TFO1) or modified to contain 8-aza-7-deazaguanine sub- eral low mobility complexes with the purine strand. Mul- stitutions and C6-PAM at the 5 and 3 termini (TFO2). tiple low mobility complexes are formed and explained Mismatched target sequences were designed to contain by bis-PNA orientation, number of interacting mole- either a 1-bp alteration in the center of each target or a cules, direction of linker wrapping, and degree of disso- polypurine tract from an unrelated sequence containing a ciation of the labeled duplexes (Hansen et al., 2001). 3-bp mismatch (Fig. 1C). PNA binding was rapid, and strand invasion with the short 36-mer duplex at pH 6.5 appeared to be complete at 1 hour (data not shown). PNA binding affinity and specificity Binding studies with the single mismatched target du- Pyrimidine-rich PNAs invade duplex DNA in a pH-de- plex demonstrate that PNA1 has approximately 1000- pendent manner (Demidov et al., 1995; Griffith et al., fold higher specificity for the native duplex target than 1995). Therefore, EMSAs were performed at different for the single mismatch. In contrast, PNA2 was less spe- pHs using an end-labeled duplex target (Fig. 2). Figure cific, with only 5–10-fold higher affinity for the native 2A illustrates the duplex target end-labeled on the pyrim- duplex than for the single base pair mismatch. Binding idine strand and incubated with PNAs at pH 6.5, and the studies with an unrelated polypurine-polypyrimidine se- duplex is end-labeled on the purine-rich strand and incu- quence containing three mismatches demonstrated no bated with PNAs at pH 7.4 in Figure 2B. For comparison binding by PNA1 at any pH. In contrast, PNA2 bound of relative binding by PNAs under different conditions, this unrelated sequence with moderate affinity at low pH the C50, defined as the concentration of PNA that pro- (C50 0.1 M at pH 6.5) but not at pH 7.4 (C50 1 TARGETING THE HER-2/NEU PROMOTER 41

A B

C D

FIG. 2. EMSAs of bis-PNA binding to normal vs. mutated HER-2/neu duplex targets. Reactions were incubated in NaPO4 and isolated on native polyacrylamide gels containing 1 Tris-acetate buffer, pH 6.5 (A) vs. pH 7.4 (B). The radiolabeled duplexes were incubated with increasing 10-fold concentrations of PNA1 or PNA2 from 0.1 nM to 100 nM (A) or 1 nM to 1 M (B). An asymmetric radiolabeled duplex (C) was also incubated with 0.1 nM–10 M PNA1. Single-stranded (ss) and duplex (ds) DNA were included as mobility markers. (D) The C50 values (nM) are demonstrated for PNA1 vs. PNA2 on the native and mismatched HER-2/neu duplexes.

M). Together, these data demonstrate that increasing experiments were performed with PNA2 to determine if the length and number of positive charges in a cpy-bis- an excess of specific targets or nonspecific DNA inter- PNA increases the binding affinity and at least partially feres with PNA binding (FIg. 3B). Once bound to the overcomes the need for low pH for pyrimidine-rich HER-2/neu promoter, neither an excess of the specific PNAs to bind DNA. The improved binding, however, is competitor (the native duplex target, WT) nor an excess at the cost of a fairly dramatic loss of target specificity. of the nonspecific competitor (purine-rich control, MM) EMSAs were also performed with a longer, asymmetric could displace PNA2 from its binding sites. In contrast, a duplex containing a 5 overhang on the purine strand and 10-fold excess of specific competitor prevented PNA2 with both strands labeled to demonstrate that these PNAs from binding to the HER-2/neu promoter when added bind to the purine strand and displace the pyrimidine immediately prior to incubation with the radiolabeled strand (Fig. 2C) in a concentration-dependent manner. HER-2/neu promoter fragment, whereas a 10-fold excess DNase I footprinting was performed to determine the of the nonspecific competitor did not prevent binding to precise PNA binding sites for PNA1 and PNA2 (Fig. the labeled promoter fragment. These data suggest that 3A). A 280-bp promoter fragment was end-labeled on the PNA2 binding to the specific target sequence in the purine-rich strand and incubated with PNA or TFO. HER-2/neu promoter occurs more rapidly than binding to Complete protection of both target 1 and target 2 was de- the nonspecific competitor DNA. tected within 30 minutes using a 10-fold molar excess of S1 endonuclease was used to demonstrate strand dis- PNA1, and no nonspecific interactions were detected up placement after PNA binding by digesting the exposed to 24 hours. The HER-2/neu promoter target sequence ssDNA loop (Demidov et al., 1993). PNA1 caused site- was also incubated with a concentration gradient result- specific pyrimidine strand cleavage of the HER-2/neu ing in a 0.1–10 molar ratio of both PNAs (0.01–1 M). promoter in both PNA target sites (Fig. 3C). The region Complete protection of both targets was detected at a 1:1 of cleavage extended a few base pairs upstream of the molar ratio for both PNA1 and PNA2, further demosntrat- target sequences at high PNA concentrations (Fig. 3C), ing that PNA2 can bind with relatively high affinity to but no other sites in the 280-bp promoter fragment were the single mismatch target sequence. The DNase I pro- sensitive to S1 cleavage. No significant difference in the tection included both PNA targets, the 3 intervening cleavage pattern was identified between 4-hour and bases, and partial protection of 4–6 bases on each side of overnight reaction times at any PNA concentration, fur- the targets (FIg. 3D). The PNA2 footprint appears to ex- ther indicating a rapid rate of invasion complex forma- tend a few nucleotides farther upstream of target 1, likely tion. TFO1 did not displace the pyrimidine strand, as due to interaction with another naturally occurring 1-bp expected. Taken together, these data show the site speci- mismatch target between 244 and 234. Competition ficity of strand invasion for the target sequence and dem- 42 ZIEMBA ET AL.

ABC

FIG. 3. Binding specificity and displaced-loop probing. (A) DNase I footprint analysis was performed in the absence of oligo (Unt) or with TFO1 or PNA. A Maxam-Gilbert G-reaction was performed to identify the protected guanine bases. PNA1 was incubated at a 10-fold excess (1 M) and incubated with the 250-bp radiolabeled target for 30 minutes, 4 hours, or overnight. Con- centration gradients of PNA2 and PNA1 were also performed, ranging from 0.1 to 10 (0.1 M–10 M). (B) DNase I footprint analysis with competing target DNA. Equimolar ratios of PNA2 and the radiolabeled target were incubated with a 10-fold excess of the native (WT) or 3-bp mismatch (MM) duplexes (from EMSA analysis). The competitor duplex was added either after a 4- hour incubation of the PNA and radiolabeled fragment or just before their incubation. (C) S1 endonuclease was used to probe for single-stranded regions in the pyrimidine-rich strand of a radiolabeled fragment. Invasion complexes were formed using 10–0.01 (10 M–0.01 M) PNA1. (D) Illustration of the PNA binding site on the purine strand and the displacement loop on the pyrimidine strand of the HER-2/neu promoter. S1 cleavage sites are illustrated with an x. PNA binding sites are from 229 to 219 and 239 to 231. A third hypersensitive region (*) is detected at high concentrations of PNA1. onstrate that the mechanism of PNA binding to duplex same region. When the PNA is in molar excess (1 M) DNA involves the formation of a D-loop by the pyrimi- relative to the template, only the first arrest site is ob- dine strand. served, with no full-length primer extension product. These results demonstrate that the PNA:DNA:PNA triple helix is very resistant to displacement by DNA poly- Inhibition of DNA polymerase extension merase and that PNA2 can form this structure at physio- The ability of the bis-PNAs to inhibit the extension of logic pH, whereas PNA1 cannot. We estimate the oligo a DNA polymerase was evaluated using a Taq poly- concentration leading to 50% polymerase arrest (EC50) merase arrest assay. Figure 4B demonstrates concentra- relative to full-length primer extension product for both tion-dependent arrest of labeled primer extension by PNAs is approximately 5 nM at pH 6.5 and 1 M for Taq DNA polymerase due to the binding of both PNAs PNA1 and 100 nM for PNA2 at pH 7.4. to a single-stranded template and formation of a Figure 4D depicts the ability of an unmodified or bis- PNA:DNA:PNA triple helix. At 0.01 M PNA, the tem- alkylating TFO to arrest Taq polymerase elongation. For plate is in excess, and polymerase extension was partially these experiments, a double-stranded template was re- blocked at both PNA binding sites. PNA1 and PNA2 quired for triple helix formation, and a 36-mer pyrimi- demonstrated similar arrest patterns at pH 6.5 (FIg. 4B), dine-rich complement was annealed to the template to whereas at pH 7.4 (Fig. 4C), only PNA2 blocked poly- form a double-stranded region of the template for TFO merase extension. PNA1 appears to have multiple poly- binding. The complementary strand did not present a bar- merase stop sites at the downstream site due to the pres- rier to Taq polymerase elongation (untreated control ence of two overlapping binding sequences within target lanes, 0, Fig. 4C). The triple helix formed by TFO1 par- 2. PNA2 has only a single target sequence within the tially blocked polymerase elongation at the highest con- TARGETING THE HER-2/NEU PROMOTER 43

B CD

FIG. 4. DNA polymerase arrest assay for stability of PNA and TFO binding. (A) Schematic of the Taq polymerase cassette. The PNAs bind to the polypurine tract within the template strand. A complementary pyrimidine-rich strand was annealed to the purine strand only for TFO reactions. (B) The single-stranded template-primer mix was incubated in the absence () or presence of 0.1–10 (0.001–0.1 M) PNAs at pH 6.5 (B) or pH 7.4. (C) The double-stranded template-primer mix was incubated in the absence () or presence of 1–100 TFO (0.01, 0.1, and 1 M TFOs (D). Chain termination sequencing G-reactions were performed to identify Taq polymerase arrest sites.

centration tested (1 M), representing a 100-fold molar (Fig. 5). TFO2 was previously found to significantly sup-

excess of the TFO. The EC50 for TFO1 was approxi- press HER-2/neu promoter activity from a reporter plas- mately 500 nM. The triple helix and covalent guanine mid in cells compared with TFO1 (Ziemba et al., 2003). A adducts formed by TFO2 present a more effective barrier 10-M concentration of the PNAs was used to rapidly to polymerase elongation than TFO1, with an EC50 for saturate the PNA binding sites in the HER-2/neu pro- TFO2 for approximately 50 nM. Collectively, these data moter and demonstrate that PNA1 suppressed promoter demonstrate that an effectively bound bis-PNA presents activity by approximately 55%, whereas PNA2 sup- a more stable barrier to displacement by an elongating pressed HER-2/neu expression by approximately 40% at DNA polymerase than a bis-alkylating TFO by an order 24 hours (Fig. 5A). TFO2 (at 1 M) suppressed HER- of magnitude (EC50 of 5 nM for PNA1 and PNA2 com- 2/neu expression by approximately 60%, whereas TFO1 pared with 50 nM for TFO2). had no effect. Target specificity was demonstrated by showing that expression from an SV40-driven luciferase Inhibition of intracellular HER-2/neu plasmid was not affected by treatment with PNAs (data transcription from reporter plasmid not shown). These data indicate that the PNA:DNA:PNA invasion complex remains formed after transfection Inhibition of HER-2/neu expression was analyzed by in tumor cells and presents a barrier to the formation of transient transfection analysis with plasmid DNA that was the transcription initiation complex. In contrast, the incubated with PNAs or TFOs prior to transfection into DNA:DNA:DNA triple helix requires covalent adduct HeLa cells, an easily transfected cervical cancer cell line formation with TFO2 to prevent HER-2/neu expression in 44 ZIEMBA ET AL.

A bind to target 1 with a single mismatch, consistent with the relatively high affinity of PNA2 for a single mismatch target sequence (Fig. 2). These data also show that targeting the downstream portion of the polypurine tract is more robust than targeting the upstream region and suggest that target 2 is more important to HER-2/neu transcription. It is interesting to note that a well-characterized ets binding site (EBS) is 7 bp downstream from target 2 (Scott et al., 2000), and previous studies of TFOs targeting the polypurine tract demonstrated that a TFO could prevent PU.1 binding to the adjacent EBS in competition binding studies (Noonberg et al., 1994). The stability of PNA and TFO-alkylator binding in B cells was evaluated by time course analysis of HER- 2/neu luciferase activity (Fig. 5B). For this analysis, the plasmid was incubated with 1 M PNA or TFO, representing a 15-fold molar excess of oligo/plasmid. PNA2 at this concentration suppressed HER-2/neu transcription by only 30%–35%, but this level of suppression was re- tained up to 72 hours. PNA1 and TFO2 suppressed HER- 2/neu expression by 55%–60%, but the magnitude of suppression of HER-2/neu expression by both PNA1 and TFO2 decreased over time to a similar degree, so that at 72 hours, HER-2/neu expression was only reduced by FIG. 5. Transient transfection analysis. (A) Transient trans- 20%–30%, favoring TFO2. To test for the possibility of fection analysis in HeLa cells was performed to determine the plasmid degradation as a result of the presence of the effects of the PNAs on HER-2/neu promoter activity in HeLa PNA clamp, we performed restriction digestion and cells. Plasmid DNA (0.05 M) was incubated with an excess of Southern analysis on PNA1-treated vs. untreated plasmid PNA (10 M) or TFO (1 M) to ensure maximal suppression extracted from cells at 24–72 hours after transfection. We levels (TFO amount previously identified as maximal necessary did not observe degradation of the plasmid due to the concentration). Transfection analysis was used to determine presence of the PNA (data not shown), nor have we pre- PNA effect on promoter activity in plasmid DNA containing viously observed degradation of a transiently transfected mutations disrupting PNA target 1 (237 HER-2) vs. target 2 plasmid due to the presence of a TFO-alkylator (Faria et (225 HER-2). Untreated native or mutant plasmid was delin- eated as 100% promoter activity, and experiments were per- al., 2001; Kim, et al., 1998; Ziemba et al., 2003). Collec- formed in triplicate. (B) Time course analysis was performed tively, these data demonstrate that a PNA:DNA:PNA 24–72 hours posttransfection using 1 M oligonucleotides and complex can remain stably associated in cells and pre- the native HER-2 plasmid. vent transcription initiation from a reporter plasmid. An increase in the number of positive charges in a cpy-bis- PNA appears to decrease the specificity of PNA binding cells, likely because of intracellular dissociation of TFO1 but increase the stability of the invasion complex in this after transfection (Ziemba et al., 2003). To evaluate the model system to a degree that is comparable if not supe- specificity of PNA binding and the relative importance of rior to a TFO bound with dual covalent adducts. the two potential PNA binding sites, PNA invasion complexes were formed in HER-2/neu luciferase constructs PNA binding to HER-2/neu promoter in gDNA with mutations in either target 1, the upstream binding site (237 to 232, designated 237 HER-2), or in target 2, Oligonucleotide binding to the HER-2/neu target can the downstream binding site (225 to 220, designated be detected by preventing restriction endonuclease cleav- 225 HER-2). PNA1 and PNA2 both suppressed HER- age of an ideally located BbvI site within the PNA target 2/neu expression by approximately 40% when bound only sequence (Fig. 6). Digestion of the HER-2/neu promoter to target 2 in the 237 HER-2 construct. PNA1 binding with BbvI results in two fragments of 108 bp and 178 bp, only to target 1 had a small effect on HER-2/neu expres- whereas TFO or PNA binding prevents cleavage at the sion from the 225 HER-2 construct (10%), whereas internal BbvI site, resulting in a single 286-bp fragment PNA2 had a greater effect on HER-2/neu transcription (Fig. 6A). Restriction fragments are detected by Southern (30%), even though its intended binding site was dis- blot analysis, and the relative intensities of the 286-bp rupted in this construct. These data suggest that PNA2 can fragment compared to the 178-bp and 108-bp fragments TARGETING THE HER-2/NEU PROMOTER 45

FIG. 6. Southern blot protection assays. (A) Schematic of the HER-2/neu promoter and BbvI restriction sites. BbvI recognizes the sequence shown in italics and cleaves between the PNA target sites (arrows). In the absence of PNA binding, two restriction fragments of 108 bp and 178 bp are detected. In the presence of bound oligo, the internal BbvI site is protected from cleavage, and one 286-bp pair fragment is detected. (B) Naked gDNA from SK-BR-3 cells was preheated to 50°C for 20 minutes prior to PNA incubation. Reactions contained the indicated concentrations of PNA at either pH 6.5 or 7.4. (C) Digitonin-permeabilized SK-BR- 3 cells were incubated with 10 M PNA or 1 M TFO for 4 hours. gDNA was isolated and subjected to Southern blot analysis.

can be used to determine the amount of oligo binding 2/neu promoter is completely bound by PNA2 at 24 semiquantitatively. Southern blot protection assays were hours and approximately 50% bound by PNA1 at 24 performed to directly demonstrate PNA binding to the hours. To determine if TFO or PNA binding was de- HER-2/neu promoter in naked gDNA and in tumor cells tectable in the endogenous HER-2/neu promoter in tumor permeabilized with digitonin (Fig. 6B,C). gDNA was cells, we performed this assay in digitonin-permeabilized heated to 50°C for 20 minutes to promote duplex opening SK-BR-3 cells in which the HER-2/neu gene is amplified prior to incubation with PNAs at 37°C. gDNA was incu- approximately 8-fold (Fig. 6C). Permeabilized cells were bated with PNAs for 4 hours at pH 7.4, and efficient incubated with TFO2 (1 M) for 4 hours in a buffer con-

binding to the HER-2/neu promoter was observed with taining 10 mM MgCl2, and binding to the HER-2/neu PNA2 at a high concentration (10 M) but was not ob- promoter was observed at a level of approximately 50%. served with PNA1 at any concentration. With prolonged Permeabilized SK-BR-3 cells were suspended with 10 incubation and lower pH, PNA binding to the HER-2/neu M PNA1 or PNA2 in a buffer adjusted to pH 6.5 or 7.0 promoter in gDNA was demonstrated at 1 M for both for 4 hours. Binding to the endogenous HER-2/neu pro- PNA1 and PNA2. Under these conditions, the HER- moter by PNA2, but not PNA1, was detectable (approxi- 46 ZIEMBA ET AL. mately 5% at pH 6.5, trace at pH 7.0) in permeabilized pression provides an indirect measurement of the stabil- cells. ity of the invasion complex within cells and demonstrate In summary, these studies demonstrate site-specific that the PNA invasion complex is at least as stable in targeting of the HER-2/neu promoter with cpy-bis-PNAs. cells as a TFO stabilized by the formation of dual gua- PNA1 can bind to two adjacent polypurine repeat se- nine adducts and may be moreso with more cationic quences in the HER-2/neu promotor with high affinity PNAs. and specificity, leading to significant suppression of The pyrimidine bis-PNAs used in these studies have HER-2/new transcription, but this PNA lacks a sufficient the drawback of pH dependence in the formation of the number of positive charges to bind to gDNA efficiently invasion complex because of the need for cytosine proto- and binds only at a low pH. PNA2 can also target the nation for the Hoogsteen bonds involved in forming the HER-2/neu promoter with high affinity and because of a invasion triple helix, a problem that may be overcome by greater number of lysines, can bind efficiently to gDNA incorporating a modified cytosine base, such as the J- as well as short synthetic sequences at physiologic pH, base, in place of cytosine (Demidov and Frank-Kamen but at the expense of a loss of specificity. The improve- etskii, 2001). Only recently has the synthesis of PNA ment in binding affinity allows for PNA2 to bind to its in- molecules containing the J-base substitution become tended target sequence in the HER-2/neu promoter in commercially available. In the present studies, the addi- permeabilized cells. tion of three more positive charges dramatically in- creased target binding at neutral pH, but at the expense of lower target specificity. The optimal number of lysines DISCUSSION for a given sequence will balance high affinity against specificity. Increasing the number of positive charges in In spite of obstacles to the development of effective ther- a cpy-bis-PNA molecule also accelerates strand invasion apeutic nucleic acid drugs, the ability to control specific by improving the electrostatic interaction of the other- gene expression using antigene oligos remains of substan- wise neutrally charged PNA with the phosphodiester tial interest. In fact, a great deal of current research focuses backbone of DNA (Griffith et al., 1995; Kuhn et al., on understanding the molecular mechanisms of nucleic 1998). This concept was demonstrated in our studies acid interactions and developing new high-affinity oligonu- where a PNA with four lysines bound to its genomic tar- cleotides and oligonucleotide mimics (Demidov and Frank- get more effectively than a PNA with one lysine even at Kamenetskii, 2004). The current study directly compares low pH. The binding of both PNAs to the HER-2/neu tar- two antigene oligo strategies, a DNA-based TFO conju- get sequence in gDNA was slower than the binding of gated to covalent DNA-modifying agents and bis-PNAs TFO, likely due to the presence of an increase in poten- designed to form a stable strand invasion triple helix tial binding sites for this PNA, a large increase in nontar- without conjugation to additional agents, all targeting the get DNA, and the need for strand opening (Abibi et al., same polypurine tract in the HER-2/neu promoter. These 2004). Some groups are currently designing PNA modifi- data demonstrate the ability of bis-PNAs to strand invade cations that should improve binding to duplex DNA tar- at this polypurine tract and prevent HER-2/neu transcrip- gets of both homopurine and mixed sequence motifs tion in tumor cells when the strand invasion complex is (Pokorski et al., 2004; Smolina and Demidov, 2003). preformed in a reporter plasmid. Interestingly, these data In vivo applications of antigene oligos of any composi- demonstrate the relative importance of targeting the dis- tion remain hindered by inefficient uptake in cells. In tal portion of the polypurine tract, suggesting that strand spite of demonstrating the uptake of fluorescently labeled invasion and alteration of the double helix at this location PNA conjugated to the well-characterized Antennapedia may be more likely to disrupt transcription factor binding cell-penetrating peptide, we have been unable to demon- to an adjacent EBS. PNA1, designed to bind to two adja- strate any antigene effects on endogenous HER-2/neu ex- cent polypurine repeats, is able to prevent HER-2/neu pression thus far. In these studies, we have directly dem- transcription from plasmid DNA to a degree similar to onstrated that a cpy-bis-PNA is capable of binding to the that of a TFO-alkylator conjugate, whereas PNA2, de- HER-2/neu promoter in permeabilized tumor cells, sug- signed to bind to only one of these sites, is slightly less gesting that with effective delivery and optimal PNA de- effective. The resistance of the PNA:DNA:PNA triple sign, antigene effects might be observed. In our studies, a helix to displacement by DNA helicases has been de- TFO bound to the endogenous target sequence much scribed previously (Bastide et al., 1999; Tackett et al., more efficiently, suggesting that this region of DNA is 2002). Our studies expand on these observations and probably accessible to antigene oligo binding. A caution- demonstrate that the PNA:DNA:PNA triple helix is more ary note has been raised in the interpretation of data stable to displacement by an elongating DNA poly- demonstrating intracellular binding by a TFO when liga- merase than a DNA:DNA:DNA triple helix with guanine tion-mediated PCR (LM-PCR) is used (Becker and Ma- adducts at both ends. The persistence of promoter sup- her, 1999). Contamination of the DNA preparations with TARGETING THE HER-2/NEU PROMOTER 47 the TFO was found to inhibit ligation of the unidirec- strand of the bis-PNA to a covalent DNA-modifying tional linker in an apparently site-specific manner. agent, such as a DNA alkylator, will improve the effi- Oligonucleotide adherence to the cell surface is a well-rec- ciency of strand invasion. We believe that the current ognized source of artifact with fluorescently labeled data provide a foundation for such improvements and oligonucleotides and can be minimized by careful wash- demonstrate the potential of an optimally designed bis- ing. In our studies, we washed cell pellets twice prior to PNA to suppress HER-2/neu overexpression. DNA extractions. In experiments in which TFO2 was added to the permeabilized cells in a mock treatment just prior to pelleting and washing, we observed no evidence ACKNOWLEDGMENTS of TFO binding (data not shown). We believe that this assay is a powerful tool for detecting site-specific binding This work was supported by grants from the NIH by TFOs and PNAs in cells, and this method is readily (CA85306) and the Flinn Foundation (1580). applicable to correlate reports of antigene activity with DNA binding by the oligonucleotide. It is possible that the nuclear membrane is an addi- REFERENCES tional barrier to PNA uptake. Whereas DNA oligos and analogs microinjected into the cytoplasm rapidly distrib- ABIBI, A., PROTOZANOVA, E., DEMIDOV, V.V., and ute to the nucleus (Leonetti et al., 1991) and, in fact, un- FRANK-KAMENETSKII, M.D. (2004). Specific versus dergo active transport into the nucleus through nuclear nonspecific binding of cationic PNAs to duplex DNA. Bio- pores (Lorenz et al., 2000), the subcellular trafficking of phys. J. 86, 3070–3078. PNA oligomers is poorly characterized, and nuclear up- ARMITAGE, B.A. (2003). The impact of nucleic acid sec- take may be less efficient (Gray et al., 1997). Some stud- ondary structure on PNA hybridization. Drug Discov. Today ies have demonstrated that a nuclear localization signal 8, 222–228. improves the uptake and antisense or antigene activity of BARRE, F.X., AIT-SI-ALI, S., GIOVANNANGELI, C., PNAs (Cutrona et al., 2000; Gait, 2003; Rapozzi et al., LUIS, R., ROBIN, P., PRITCHARD, L.L., HÉLÈNE, C., 2002). Nuclear localization signals are generally com- and HAREL-BELLAN, A. (2000). Unambiguous demon- posed of cationic amino acids, and these molecules may stration of triple helix-directed gene modification. Proc. Natl. Acad. Sci. USA 97, 3084–3088. also promote strand invasion. More likely, PNA binding

BASTIDE, L., BOEHMER, P.E., VILLANI, G., and LEBLEU, is rate limited by transient opening of the duplex for ef- B. (1999). Inhibition of a DNA-helicase by peptide nucleic fective strand invasion, whereas TFO binding is not. acids. Nucleic Acids Res. 27, 551–554. Prior studies have demonstrated that bis-PNA binding BECKER, N.A., and MAHER, L.J., 3rd. (1999). LMPCR for de- can be accelerated more than 10-fold by a DNA-binding tection of oligonucleotide-directed triple helix formation: A agent that probably does so by inducing distortions of the cautionary note. Antisense Nucleic Acid Drug Dev. 9,313–316. double helix to promote PNA invasion (Mollegaard et BENTIN, T., LARSEN, H.J., and NIELSEN, P.E. (2003). al., 2000). Combined triplex/duplex invasion of double-stranded DNA In summary, these data demonstrate that bis-PNAs by “tail-clamp” peptide nucleic acid. Biochemistry 42, have some advantages over TFOs as antigen oligos in the 13987–13995. formation of stable invasion complexes but have some BENTIN, T., and NIELSEN, P.E. (1996). Enhanced peptide nucleic acid binding to supercoiled DNA: Possible implica- drawbacks in the efficiency and specificity of complex tions for DNA “breathing” dynamics. Biochemistry 35, formation under physiologic conditions. In order to over- 8863–8869. come these drawbacks, the length and charge of a cpy- BESCH, R., GIOVANNANGELI, C., KAMMERBAUER, C., bis-PNA must be optimized to balance specificity against and DEGITZ, K. (2002). Specific inhibition of ICAM-1 ex- efficient DNA binding. We infer from the marked effect pression mediated by gene targeting with triplex-forming of pH on strand invasion by PNA1, a cpy-bis-PNA with oligonucleotides. J. Biol. Chem. 277, 32473–32479. only a single lysine, that Hoogsteen binding precedes CARBONE, G.M., McGUFFIE, E.M., COLLIER, A., and and, in fact, drives strand invasion. Thus, modification of CATAPANO, C.V. (2003). Selective inhibition of transcrip- the Hoogsteen strand of the bis-PNA with the J-base im- tion of the Ets2 gene in prostate cancer cells by a triplex- proves triplex formation and may speed the formation of forming oligonucleotide. Nucleic Acids Res. 31, 833–843. the strand invasion complex. However, once formed, CARBONE, G.M., McGUFFIE, E., NAPOLI, S., FLANAGAN, C.E., DEMBECH, C., NEGRI, U., ARCAMONE, F., CAPO- even without the J-base, the invasion complex is highly BIANCO, M.L., and CATAPANO, C.V. (2004). DNA bind- stable even under conditions not favorable to the initial ing and antigene activity of a daunomycin-conjugated formation of the complex (as shown by the persistence of triplex-forming oligonucleotide targeting the P2 promoter of inhibition of HER-2/neu transcription by the bis-PNA in the human c-myc gene. Nucleic Acids Res. 32, 2396–2410. cells). We postulate that further improvements in triplex CHINNERY, P.F., TAYLOR, R.W., DIEKERT, K., LILL, R., formation, for example, by conjugation of the Hoogsteen TURNBULL, D.M., and LIGHTOWLERS, R.N. (1999). 48 ZIEMBA ET AL.

Peptide nucleic acid delivery to human mitochondria. Gene pseudoisocytosine-containing bis-PNA. Nucleic Acids Res. Ther. 6, 1919–1928. 23, 217–222. CHO-CHUNG, Y.S. (2002). Antisense DNAs as targeted ther- FARIA, M., WOOD, C.D., WHITE, M.R., HÉLÈNE, C., and apeutics for cancer: No longer a dream. Curr. Opin. Invest. GIOVANNANGELI, C. (2001). Transcription inhibition in- Drugs 3, 934–939. duced by modified triple helix-forming oligonucleotides: A CIRISANO, F.D., and KARLAN, B.Y. (1996). The role of the quantitative assay for evaluation in cells. J. Mol. Biol. 306, HER-2/neu oncogene in gynecologic cancers. J. Soc. Gy- 15–24. necol. Invest. 3, 99–105. FARUQI, A.F., EGHOLM, M., and GLAZER, P.M. (1998). CUTRONA, G., CARPANETO, E.M., ULIVI, M., RON- Peptide nucleic acid-targeted mutagenesis of a chromosomal CELLA, S., LANDT, O., FERRARINI, M., and BOFFA, gene in mouse cells. Proc. Natl. Acad. Sci. USA 95, 1398– L.C. (2000). Effects in live cells of a c-myc anti-gene PNA 1403. linked to a nuclear localization signal. Nat. Biotechnol. 18, GAIT, M.J. (2003). Peptide-mediated cellular delivery of anti- 300–303. sense oligonucleotides and their analogues. Cell. Mol. Life DEMIDOV, V.V., and FRANK-KAMENETSKII, M.D. Sci. 60, 844–853. (2001). Sequence-specific targeting of duplex DNA by pep- GIOVANNANGELI, C., DIVIACCO, S., LABROUSSE,V., tide nucleic acids via triplex strand invasion. Methods 23, GRYAZNOV, S., CHARNEAU, P., and HÉLÈNE, C. 108–122. (1997). Accessibility of nuclear DNA to triplex-forming DEMIDOV, V., and FRANK-KAMENETSKII, M.D. (2004). oligonucleotides: The integrated HIV-1 provirus as a target. Two sides of the coin: Affinity and specificity of nucleic acid Proc. Natl. Acad. Sci. USA 94, 79–84. interactions. Trends Biochem. Sci. 29, 62–71. GRAY, G.D., BASU, S., and WICKSTROM, E. (1997). Trans- DEMIDOV, V.V., FRANK-KAMENETSKII, M.D., EGHOLM, formed and immortalized cellular uptake of oligodeoxynucleo- M., BUCHARDT, O., and NIELSEN, P.E. (1993). Sequence side phosphorothioates, 3-alkylamino oligodeoxynucleo- selective double-strand DNA cleavage by peptide nucleic tides, 2-O-methyl oligoribonucleotides, oligodeoxynucleoside acid (PNA) targeting using nuclease S1. Nucleic Acids Res. methylphosphonates, and peptide nucleic acids. Biochem. 21, 2103–2107. Pharmacol. 53, 1465–1476. DEMIDOV, V.V., POTAMAN, V.N., FRANK-KAMENET- GRIFFITH, M.C., RISEN, L.M., GREIG, M.J., LESNIK, E.A., SKII, M.D., EGHOLM, M., BUCHARD, O., SONNICH- SPRANKLE, K.G., GRIFFERY, R.H., KIELY, J.S., and SEN, S.H., and NIELSEN, P.E. (1994). Stability of peptide FREIER, S.M. (1995). Single and bis-peptide nucleic acids nucleic acids in human serum and cellular extracts. Biochem. as triplexing agents: Binding and stoichiometry. J. Am. Pharmacol. 48, 1310–1313. Chem. Soc. 117, 831–832.

DEMIDOV, V.V., YAVNILOVICH, M.V., BELOTSERKOV- GUNTAKA, R.V., VARMA, B.R., and WEBER, K.T. (2003). SKII, B.P., FRANK-KAMENETSKII, M.D., and NIELSEN, Triplex-forming oligonucleotides as modulators of gene ex- P.E. (1995). Kinetics and mechanism of polyamide (“pep- pression. Int. J. Biochem. Cell Biol. 35, 22–31. tide”) nucleic acid binding to duplex DNA. Proc. Natl. Acad. HAN, H., HURLEY, L.H., and SALAZAR, M. (1999). A DNA Sci. USA 92, 2637–2641. polymerase stop assay for G-quadruplex-interactive com- DIVIACCO, S., RAPOZZI, V., XODO, L., HÉLÈNE, C., pounds. Nucleic Acids Res. 27, 537–542. QUADRIFOGLIO, F., and GIOVANNANGELI, C. (2001). HANSEN, G.I., BENTIN, T., LARSEN, H.J., and NIELSEN, Site-directed inhibition of DNA replication by triple helix P.E. (2001). Structural isomers of bis-PNA bound to a target formation. FASEB J. 15, 2660–2668. in duplex DNA. J. Mol. Biol. 307, 67–74. DUVERGER, E., PELLERIN-MENDES, C., MAYER, R., JARDINES, L., WEISS, M., FOWBLE, B., and GREENE, M. ROCHE, A.C., and MONSIGNY, M. (1995). Nuclear import (1993). neu(c-erbB-2/HER2) and the epidermal growth fac- of glycoconjugates is distinct from the classical NLS path- tor receptor (EGFR) in breast cancer. Pathobiology 61, way. J. Cell Sci. 108, 1325–1332. 268–282. EBBINGHAUS, S.W., FORTINBERRY, H., and GAMPER, KAIHATSU, K., HUFFMAN, K.E., and COREY, D.R. H.B., Jr. (1999). Inhibition of transcription elongation in (2004a). Intracellular uptake and inhibition of gene expres- the HER-2/neu coding sequence by triplex-directed cova- sion by PNAs and PNA-peptide conjugates. Biochemistry lent modification of the template strand. Biochemistry 38, 43, 14340–14347. 619–628. KAIHATSU, K., JANOWSKI, B.A., and COREY, D.R. EBBINGHAUS, S.W., GEE, J.E., RODU, B., MAYFIELD, (2004b). Recognition of chromosomal DNA by PNAs. C.A., SANDERS, G., and MILLER, D.M. (1993). Triplex Chem. Biol. 11, 749–758. formation inhibits HER-2/neu transcription in vitro. J. Clin. KIM, H.G., REDDOCH, J.F., MAYFIELD, C., EBBING- Invest. 92, 2433–2439. HAUS, S., VIGNESWARAN, N., THOMAS, S., JONES, EGHOLM, M., BUCHARDT, O., CHRISTENSEN, L., D.E., Jr., and MILLER, D.M. (1998). Inhibition of transcrip- BEHRENS, C., FREIER, S.M., DRIVER, D.A., BERG, R.H., tion of the human c-myc proto-oncogene by intermolecular KIM, S.K., NORDEN, B., and NIELSEN, P.E. (1993). PNA triplex. Biochemistry 37, 2299–2304. hybridizes to complementary oligonucleotides obeying the KOPPELHUS, U., and NIELSEN, P.E. (2003). Cellular deliv- Watson-Crick hydrogen-bonding rules. Nature 365, 566–568. ery of peptide nucleic acid (PNA). Adv. Drug Deliv. Rev. 55, EGHOLM, M., CHRISTENSEN, L., DUEHOLM, K.L., 267–280. BUCHARDT, O., COULL, J., and NIELSEN, P.E. (1995). KUHN, H., DEMIDOV, V.V., FRANK-KAMENETSKII, Efficient pH-independent sequence-specific DNA binding by M.D., and NIELSEN, P.E. (1998). Kinetic sequence discrim- TARGETING THE HER-2/NEU PROMOTER 49

ination of cationic bis-PNAs upon targeting of double- ORR, R.M. (2001). Technology evaluation: Fomivirsen, Isis stranded DNA. Nucleic Acids Res. 26, 582–587. Pharmaceuticals Inc/CIBA vision. Curr. Opin. Mol. Ther. 3, KUHN, H., DEMIDOV, V.V., NIELSEN, P.E., and FRANK- 288–294. KAMENETSKII, M.D. (1999). An experimental study of POKORSKI, J.K., WITSCHI, M.A., PURNELL, B.L., and AP- mechanism and specificity of peptide nucleic acid (PNA) PELLA, D.H. (2004). (S,S)-Trans-cyclopentane-constrained binding to duplex DNA. J. Mol. Biol. 5, 1337–1345. peptide nucleic acids. A general backbone modification that LAMPE, J.N., KUTYAVIN, I.V., RHINEHART, R., REED, improves binding affinity and sequence specificity. J. Am. M.W., MEYER, R.B., and GAMPER, H.B., Jr. (1997). Fac- Chem. Soc. 126, 15067–15073. tors influencing the extent and selectivity of alkylation PORUMB, H., GOUSSET, H., LETELLIER, R., SALLE, V., within triplexes by reactive G/A motif oligonucleotides. Nu- BRIANE, D., VASSY, J., AMOR-GUERET, M., ISRAEL, cleic Acids Res. 25, 4123–4131. L., and TAILLANDIER, E. (1996). Temporary ex vivo inhi- LARSEN, H.J., and NIELSEN, P.E. (1996). Transcription-me- bition of the expression of the human oncogene HER2 diated binding of peptide nucleic acid (PNA) to double- (NEU) by a triple helix-forming oligonucleotide. Cancer stranded DNA: Sequence-specific suicide transcription. Nu- Res. 56, 515–522. cleic Acids Res. 24, 458–463. RAPOZZI, V., BURM, B.E., COGOI, S., VAN DER MAREL, LASKIN, J.J., and SANDLER, A.B. (2004). Epidermal growth G.A., VAN BOOM, J.H., QUADRIFOGLIO, F., and factor receptor: A promising target in solid tumours. Cancer XODO, L.E. (2002). Antiproliferative effect in chronic Treat Rev. 30, 1–17. myeloid leukaemia cells by antisense peptide nucleic acids. LEONETTI, J.P., MECHTI, N., DEGOLS, G., GAGNOR, C., Nucleic Acids Res. 30, 3712–3721. and LEBLEU, B. (1991). Intracellular distribution of mi- RUDIN, C.M., KOZLOFF, M., HOFFMAN, P.C., EDEL- croinjected antisense oligonucleotides. Proc. Natl. Acad. Sci. MAN, M.J., KARNAUSKAS, R., TOMEK, R., SZETO, L., USA 88, 2702–2706. and VOKES, E.E. (2004). Phase I study of G3139, a bcl-2 LORENZ, P., MISTELI, T., BAKER, B.F., BENNETT, C.F., antisense oligonucleotide, combined with carboplatin and and SPECTOR, D.L. (2000). Nucleocytoplasmic shuttling: etoposide in patients with small-cell lung cancer. J. Clin. On- A novel in vivo property of antisense phosphorothioate oligo- col. 22, 1110–1117. deoxynucleotides. Nucleic Acids Res. 28, 582–592. SAMBROOK, J.A.R., and RUSSELL, D.W. (2001). Molecular MAINE, I.P., and KODADEK, T. (1994). Efficient unwinding Cloning, A Laboratory Manual. Cold Spring Harbor, NY: of triplex DNA by a DNA helicase. Biochem. Biophys. Res. Cold Spring Harbor Laboratory Press. Commun. 204, 1119–1124. SCOTT, G.K., CHANG, C.H., ERNY, K.M,. XU, F., FRED- MAJUMDAR, A., PURI, N., McCOLLUM, N., RICHARDS, ERICKS, W.J., RAUSCHER, F.J., 3rd, THOR, A.D., and

S., CUENOUD, B., MILLER, P., and SEIDMAN, M.M. BENZ, C.C. (2000). Ets regulation of the erbB2 promoter. (2003). Gene targeting by triple helix-forming oligonu- Oncogene 19, 6490–6502. cleotides. Ann. NY Acad. Sci. 1002, 141–153. SEDELNIKOVA, O.A., KARAMYCHEV, V.N., PANYUTIN, MIZUGUCHI, G., KANEI-ISHII, C., SAWAZAKI, T., I.G., and NEUMANN, R.D. (2002). Sequence-specific gene HORIKOSHI, M., ROEDER, R.G., YAMAMOTO, T., and cleavage in intact mammalian cells by 125I-labeled triplex- ISHII, S. (1994). Independent control of transcription initia- forming oligonucleotides conjugated with nuclear localiza- tions from two sites by an initiator-like element and TATA tion signal peptide. Antisense Nucleic Acid Drug Dev. 12, box in the human c-erbB-2 promoter. FEBS Lett. 348, 43–49. 80–88. SMOLINA, I.V., and DEMIDOV, V.V. (2003). Sequence-uni- MOLLEGAARD, N.E., BAILLY, C., WARING, M.J., and versal recognition of duplex DNA by oligonucleotides via NIELSEN, P.E. (2000). Quinoxaline antibiotics enhance pseudocomplementarity and helix invasion. Chem. Biol. 10, peptide nucleic acid binding to double-stranded DNA. Bio- 591–595. chemistry 39, 9502–9507. SMOLINA, I.V., DEMIDOV, V.V., and FRANK-KAMENET- MOLLEGAARD, N.E., BUCHARDT, O., EGHOLM, M., and SKII, M.D. (2003). Pausing of DNA polymerases on duplex NIELSEN, P.E. (1994). Peptide nucleic acid. DNA strand DNA templates due to ligand binding in vitro. J. Mol. Biol. displacement loops as artificial transcription promoters. 326, 1113–1125. Proc. Natl. Acad. Sci. USA 91, 3892–3895. TACKETT, A.J., COREY, D.R., and RANEY, K.D. (2002). NIELSEN, P.E. (2001). Targeting double-stranded DNA with Non-Watson-Crick interactions between PNA and DNA in- peptide nucleic acid (PNA). Curr. Med. Chem. 8, 545–550. hibit the ATPase activity of bacteriophage T4 Dda helicase. NIELSEN, P.E., EGHOLM, M., BERG, R.H., and BUCHARDT, Nucleic Acids Res. 30, 950–957. O. (1991). Sequence-selective recognition of DNA by strand UHLMANN, E. (1998). Peptide nucleic acids (PNA) and PNA- displacement with a thymine-substituted polyamide. Science DNA chimeras: From high binding affinity towards biologi- 254, 1497–1500. cal function. Biol. Chem. 379, 1045–1052. NIELSEN, P.E., EGHOLM, M., and BUCHARDT, O. (1994). VASQUEZ, K.M., CHRISTENSEN, J., LI, L., FINCH, R.A., Sequence-specific transcription arrest by peptide nucleic acid and GLAZER, P.M. (2002). Human XPA and RPA DNA re- bound to the DNA template strand. Gene 149, 139–145. pair proteins participate in specific recognition of triplex-in- NOONBERG, S.B., SCOTT, G.K., HUNT, C.A., HOGAN, duced helical distortions. Proc. Natl. Acad. Sci. USA 99, M.E., and BENZ, C.C. (1994). Inhibition of transcription 5848–5853. factor binding to the HER2 promoter by triplex-forming VASQUEZ, K.M., DAGLE, J.M., WEEKS, D.L., and oligodeoxyribonucleotides. Gene 149, 123–126. GLAZER, P.M. (2001). Chromosome targeting at short poly- 50 ZIEMBA ET AL.

purine sites by cationic triplex-forming oligonucleotides. J. arrest assay for the evaluation of parameters affecting Biol. Chem. 276, 38536–38541. intrastrand tetraplex formation. J. Biol. Chem. 271, 20958– VASQUEZ, K.M., NARAYANAN, L., and GLAZER, P.M. 20964. (2000). Specific mutations induced by triplex-forming ZHAO, X., KAIHATSU, K., and COREY, D.R. (2003). Inhibi- oligonucleotides in mice. Science 290, 530–533. tion of transcription by bisPNA-peptide conjugates. Nucleo- VASQUEZ, K.M., WANG, G., HAVRE, P.A., and GLAZER, sides Nucleotides Nucleic Acids 22, 535–546. P.M. (1999). Chromosomal mutations induced by triplex- ZIEMBA, A.J., REED, M.W., RANEY, K.D., BYRD, A.B., forming oligonucleotides in mammalian cells. Nucleic Acids and EBBINGHAUS, S.W. (2003). A bis-alkylating triplex- Res. 27, 1176–1181. forming oligonucleotide inhibits intracellular reporter gene WANG, G., JING, K., BALCZON, R., and XU, X. (2001). expression and prevents triplex unwinding due to helicase Defining the peptide nucleic acids (PNA) length requirement activity. Biochemistry 42, 5013–5024. for PNA binding-induced transcription and gene expression. J. Mol. Biol. 313, 933–940. WANG, G., SEIDMAN, M.M., and GLAZER, P.M. (1996). Address reprint requests to: Mutagenesis in mammalian cells induced by triple helix Dr. Scot W. Ebbinghaus formation and transcription-coupled repair. Science 271, Arizona Cancer Center 802–805. 1515 North Campbell Avenue WANG, G., XU, X., PACE, B., DEAN, D.A., GLAZER, P.M., Tucson, AZ 85724 CHAN, P., GOODMAN, S.R., and SHOKOLENKO, I. (1999). Peptide nucleic acid (PNA) binding-mediated induc- tion of human gamma-globin gene expression. Nucleic Acids E-mail: [email protected] Res. 27, 2806–2813. WEITZMANN, M.N., WOODFORD, K.J., and USDIN, K. Received December 20, 2004; accepted in revised (1996). The development and use of a DNA polymerase form January 24, 2005. This article has been cited by:

1. Victor Meidan, Judith Glezer, Sharona Salomon, Yechezkel Sidi, Yechezkel Barenholz, Jack Cohen, Gila Lilling. 2006. Specific Lipoplex-Mediated Antisense Against Bcl-2 in Breast Cancer Cells: A Comparison between Different Formulations. Journal of Liposome Research 16:1, 27-43. [CrossRef]