(19) TZZ Z__T

(11) EP 2 744 901 B1

(12) EUROPEAN PATENT SPECIFICATION

(45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 31.05.2017 Bulletin 2017/22 (86) International application number: (21) Application number: 12746334.7 PCT/EP2012/065793

(22) Date of filing: 13.08.2012 (87) International publication number: WO 2013/024064 (21.02.2013 Gazette 2013/08)

(54) COMPOSITION AND METHODS FOR RT-PCR COMPRISING AN ANIONIC POLYMER ZUSAMMENSETZUNG UND VERFAHREN FÜR REVERSE TRANSKRIPTASE--KETTENREAKTION (RT-PCR )MIT EINEM ANIONISCHEN POLYMER COMPOSITION ET PROCÉDÉS DE RT-PCR COMPORTANT UN POLYMÈRE ANIONIQUE

(84) Designated Contracting States: (56) References cited: AL AT BE BG CH CY CZ DE DK EE ES FI FR GB EP-B1- 1 050 587 EP-B1- 1 069 190 GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO WO-A2-03/064605 US-A1- 2004 219 595 PL PT RO RS SE SI SK SM TR • FAN X Y ET AL: "A modified single-tube one-step (30) Priority: 17.08.2011 EP 11177730 product-enhanced (mSTOS-PERT) assay with heparin as DNA (43) Date of publication of application: polymerase inhibitor for specific detection of 25.06.2014 Bulletin 2014/26 RTase activity", JOURNAL OF CLINICAL VIROLOGY, ELSEVIER, AMSTERDAM, NL, vol. (73) Proprietor: Qiagen GmbH 37, no. 4, 1 December 2006 (2006-12-01), pages 40724 Hilden (DE) 305-312, XP028037944, ISSN: 1386-6532, DOI: 10.1016/J.JCV.2006.08.007 [retrieved on (72) Inventors: 2006-12-01] • FANG, Nan • SUSLOVOLEG ETAL: "PCRinhibition by reverse 40724 Hilden (DE) transcriptase leads to an overestimation of • MISSEL, Andreas amplification efficiency", NUCLEIC ACIDS 40724 Hilden (DE) RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 33, no. 20, 1 January 2005 (2005-01-01), page (74) Representative: Bohmann, Armin K. E181, XP009141716, ISSN: 1362-4962 Bohmann • PELT-VERKUIL: ’Principles and Technical Anwaltssozietät Aspects of PCR Amplifi cation’, [Online] 01 Nymphenburger Straße 1 January 2008, XP055313865 Retrieved from the 80335 München (DE) Internet: [retrieved on 2016-10-25]

Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations. Notice of opposition shall not be deemed to have been filed until the opposition fee has been paid. (Art. 99(1) European Patent Convention). EP 2 744 901 B1

Printed by Jouve, 75001 PARIS (FR) 1 EP 2 744 901 B1 2

Description polymerase or a mutant, variant or derivative thereof), and a thermostable DNA polymerase (e.g. Taq, Tbr, Tih, Field of the Invention Tfi, Tfl, Pfu, Pwo, Kod, VENT™, DEEPVENT™, Tma, Tne, Bst, Pho, Sac, Sso, ES4 and others or a mutant, [0001] The present invention is in the fields of molec- 5 variant or derivative thereof). ular biology. More specifically, the present invention is [0006] Coupled RT-PCR provides numerous advan- related to the use of an anionic polymer for suppressing tages over uncoupled RT-PCR. Coupled RT-PCR re- or reducing the inhibition of nucleic acid replication by quires less handling of the reaction mixture reagents and reverse transcriptase as observed in RT-PCR. nucleic acid products than uncoupled RT-PCR (e.g., 10 opening of the reaction tube for component or enzyme Background of the Invention addition in between the two reaction steps), and is there- fore less labor-intensive, and time-consuming, and has [0002] The detection, analysis, transcription and am- reduced risk of contamination. Furthermore, coupled RT- plification of nucleic acids are the most important proce- PCR also requires less sample, making it especially suit- dures in modem molecular biology. The application of 15 able for applications where the sample amounts are lim- such procedures for RNA analysis is especially important ited (e.g., with FFPE, biopsy, environmental samples). in the investigation of gene expression, diagnosis of in- [0007] Although single-enzyme-coupled RT-PCR is fectious agents or genetic diseases, the generation of easy to perform, this system is expensive to perform, cDNA and analysis of retroviruses, to name but a few however, due to the amount of DNA polymerase re- applications. The reverse transcription of RNA, followed 20 quired. In addition, the single enzyme coupled RT-PCR by polymerase chain reaction amplification, commonly method has been found to be less sensitive than uncou- referred to as RT-PCR, has become widely used for the pled RT-PCR, and limited to polymerizing nucleic acids detection and quantification of RNA. of less than one kilobase pair in length. Coupled RT-PCR [0003] The RT-PCR procedure involves two separate systems with two or more enzymes generally show in- molecular syntheses: First, the synthesis of cDNA from 25 creased sensitivity over the single enzyme system, even an RNA template; and second, the replication of the new- when coupled in a single reaction mixture. This effect ly synthesized cDNA through PCR amplification. RT- has been attributed to the higher efficiency of reverse PCR may be performed under three general protocols: transcriptase in comparison to the reverse transcriptase activity of DNA (Sellner and Turbett, Bio- 1) Uncoupled RT-PCR, also referred to as two-step 30 Techniques 25(2):230-234 (1998)). RT-PCR. [0008] Although the two-enzyme coupled RT-PCR 2) Single enzyme coupled RT-PCR, also referred to system is more sensitive than the single-enzyme system, as one-step RT-PCR or continous RT-PCR, in which reverse transcriptase has been found to interfere directly a single polymerase is used for both the cDNA gen- with DNA polymerase during the replication of the cDNA, eration from RNA as well as subsequent DNA am- 35 thus reducing the sensitivity and efficiency of this tech- plification. nique (Sellner et al., J. Virol. Methods 40:255-264 3) Two (or more) enzyme coupled RT-PCR, in which (1992)). A variety of solutions to overcome the inhibitory at least two separate polymerases are used for initial activity of reverse transcriptase on DNA polymerase cDNA synthesis and subsequent replication. This is have been tried, including: increasing the amount of tem- sometimes also referred to as one-step RT-PCR or, 40 plate RNA, increasing the ratio of DNA polymerase to alternatively, one-tube RT-PCR. reverse transcriptase, adding modifier reagents that may reduce the inhibitory effect of reverse transcriptase on [0004] In uncoupled RT-PCR, reverse transcription is DNA polymerase (e.g., non homologous tRNA, T4 gene performed as an independent step using buffer and re- 32 protein,sulphur or acetate-containing molecules),and action conditions optimal for reverse transcriptase activ- 45 heat-inactivation of the reverse transcriptase before the ity. Following cDNA synthesis, an aliquot of the RT reac- addition of DNA polymerase. tion product is used as template for PCR amplification [0009] Sellner et al. (Nucleic Acids Research with a thermostable DNA polymerase, such as Taq DNA 20(7):1487-1490) describe that the detection of viral RNA Polymerase, under conditions optimal for PCR amplifi- by polymerase chain reaction requires the prior reverse cation. 50 transcription of the viral RNA. In order to minimize the [0005] In coupled RT-PCR, reverse transcription and number of manual manipulations required for processing PCR amplification are combined into a single reaction large numbers of samples, Sellner et al. attempted to mixture. Singleenzyme RT-PCR utilizes the reverse tran- design a system whereby all the reagents required for scriptase activity of certain DNA polymerases, such as both reversetranscription and amplification can be added Tth DNA polymerase, whereas two-enzyme RT-PCR55 to one tube and a single, non-interrupted thermal cycling typically uses a retroviral or bacterial reverse tran- program can be performed. Whilst attempting to set up scriptase (e.g. AMV-RT, MMLV-RT, HIV-RT, EIAV-RT, such a one-tube system with and avian RAV2-RT, Carboxydothermus hydrogenoformans DNA myoblastis virus, they noticed a substantial decrease in

2 3 EP 2 744 901 B1 4 the sensitivity of detection of viral RNA. They found out reduction of the inhibitory effect of reverse transcriptase a direct interference of reverse transcriptase with Taq on DNA polymerase by homopolymeric nucleic acids. polymerase. [0018] Although the methods described by Gong and [0010] All of these modified RT-PCR methods have Wang and Missel et al., respectively, successfully have significant drawbacks, however. Increasing the amount 5 shown a significant reduction, of the inhibitory effect of of template RNA is not possible in cases where only lim- reverse transcriptase, a further improved specificity and ited amounts of sample are available. Individual optimi- sensitivity of RT-PCR by a more effective reduction of zation of the ratio of reverse transcriptase to DNA the inhibitory effect of reverse transcriptase is still a need polymerase is not practicable for ready-to-use reagent in the art. kits for one-step RT-PCR. The net effect of currently pro- 10 [0019] Because of the importance of RT-PCR applica- posed modifier reagents to relive reverse transcriptase tions, a coupled RT-PCR system, in the form of a gen- inhibition of DNA polymerization is controversial and in eralized ready-to-use composition, which exhibits high dispute: positive effects due to these reagents are highly specificity and sensitivity, requires a small amount of in- dependent on RNA template amounts, RNA composi- itial sample, reduces the amount of practitioner manipu- tion, or may require specific reverse transcriptase-DNA 15 lation, minimizes the risks of contamination, minimizes polymerase combinations (Chandler et al., Appl. and En- the expense of reagents, is not restricted to the use of vironm. Microbiol. 64(2):669-677 (1998)). Finally, heat specific reaction buffers, and maximizes the amount of inactivation of the reverse transcriptase before the addi- nucleic acid end product is needed in the art. tion of the DNA polymerase negates the advantages of the coupled RT-PCR and carries all the disadvantages 20 Summary of the invention of uncoupled RT-PCR systems discussed earlier. Even if a reverse transcriptase is heat inactivated, it still may [0020] The problem underlying the present invention confer an inhibitory effect on PCR, likely due to binding is solved by the subject matter of the attached independ- of heat-inactivated reverse transcriptase to the cDNA ent claims. Preferred embodiments may be taken from template. 25 the attached dependent claims. [0011] European patent 1 069 190 is related to a meth- [0021] More specifically, the problem underlying the od for amplification of RNA including, among others, RT- present invention is solved by the use of an anionic pol- PCT, whereby the need for separating from an RNA ymer, wherein the anionic polymer comprises a net source containing sample the RNA source as well as charge of at least -1 at the pH used in RT-PCR, wherein RNA degradation is avoided. 30 the anionic polymer is selected from the group consisting [0012] Fan X et al. (Fan X et al., Journel of Clinical of dextran sulphate, sodium alginate, heparin, carra- Virology 37 (2006) 305-312) report on a modified single- geen, sodium carboxymethylcellulose, polyphloretin tube one-step product-enhanced reverse transcriptase phosphate, poly-L-glutamate, polyacrylic acid, poly(pro- (mSTOS-PERT) assay with heparin as DNA polymerase pylacrylic acid), poly(methyl-vinyl-ether-maelic anhy- inhibitor for specific detection of RTase activity. 35 dride), for suppressing or reducing the inhibition of nu- [0013] Published US patent application 2004/219595 cleic acid replication by reverse transcriptase as ob- is related to compositions and methods useful for the served in RT-PCR in a composition comprising one or amplification of nucleic acid molecules by reverse tran- more oligonucleotide primers, any one or more nucle- scriptase-polymerase chain reaction (RT-PCR) using otides or derivatives thereof, and two or more different combinations of reverse transcriptase and thermostable 40 polymerases, at least one of which has reverse tran- DNA polymerase enzymes in conjunction with sulphur scriptase activity and at least one of which has nucleic containing molecules or acetate-containing molecules. acid polymerase activity. [0014] International patent application WO 03/064605 [0022] In an embodiment, the anionic polymer is for is, among others, related to a method for producing cDNA use in RT-PCR. from one or more RNA containing biological units with 45 [0023] Inan embodiment, the compositionfurther com- the method comprising preparing an admixture of the bi- prises a buffering agent, a salt, and/or additives that are ological unit and a catabolic enzyme and incubating the useful in RT-PCR. admixture under conditions where the catabolic enzyme [0024] In an embodiment, said polymerase exhibiting is active. reverse transcriptase activity is selected from the group [0015] Some improvements to reduce the inhibitory ef- 50 of OmniScript, AMV-RT, M-MLV-RT, HIV-RT, EIAV-RT, fect ofreverse transcriptase on the activity of the polymer- RAV2-RT, C. hydrogenoformans DNA polymerase, Su- ase have been made. perScript I, SuperScript II, SuperScript III and/or mutants, [0016] In US 2009/0137008 A1, Gong and Wang de- variants and derivatives thereof. scribe the reduction of the inhibitory effect of reverse tran- [0025] In an embodiment, said polymerase exhibiting scriptase on DNA polymerase by proteins that bind dsD- 55 nucleic acid polymerase activity is selected from the NA in a non-specific way such as Sso7d, Sac7d, Sac7e group of Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, or Sso7e and by sulfonic-acid and by sulfonic acid salts. Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, [0017] In EP 1050587 B1, Missel et al. describe the ES4, VENT DNA polymerase, DEEPVENT DNA

3 5 EP 2 744 901 B1 6 polymerase, and/or mutants, variants and derivatives polypeptide an acid or an anhydride. thereof. [0029] The amount of anionic polymer used for RT- [0026] The present disclosure directed generally to all PCR may be greater than 1pg/ml, preferably between reaction mixtures that can be used in the generation and 1pg/ml to 1mg/ml, more preferably between 10pg/ml to replication of a nucleic acid from an RNA template. One 5 100mg/ml, most preferably between 1ng/m to 10mg/ml. aspect of the disclosure is directed to a composition com- Depending on the anionic polymer used, the concentra- prising an anionic polymer that is not a nucleic acid and tion of the anionic polymer used for RT-PCR might vary. one or more of the following reaction components: a re- [0030] According to the present invention, the concen- verse transcriptase, a nucleic acid polymerase, one or tration of the anionic polymer may be higher than the more oligonucleotide primers, any one or more nucle- 10 preferred final concentrations given above, which are in- otide base, an appropriate buffering agent, a salt solution, tended to achieve the preferred final concentrations by or other additives useful in RT-PCR. dilution, e.g. by combination with further components of [0027] The present invention offers several advantag- the reaction mixture. es compared to known methods for generating cDNA [0031] The reverse transcriptase may be any polymer- from an RNA target, including, but not limited to: 15 ase that exhibits reverse transcriptase activity. Prefera- bly, the reverse transcriptase is OminiScript™, AMV-RT, - permitting coupled RT-PCR, involving one reaction MMLV-RT, HIV-RT, EIAV-RT, RAV2-RT, C. hydrogeno- solution and reduced handling of reagents and prod- formans DNA polymerase, SuperScript I™, SuperScript ucts; II™, SuperScript III™ or mutants, variants and deriva- - permitting use of a small initial sample of RNA tem- 20 tives thereof having reverse transcriptase activity. plate; [0032] As used herein, mutants, variants and deriva- - permitting use of a wide range of different reverse tives refer to all permutations of a chemical species, transcriptases; which may exist or be produced, that still retain the de- - permitting use of a wide range of different DNA finitive chemical activity of that chemical species. Exam- polymerases; 25 ples include, but are not limited to compounds that may - permitting use of a wide range of different reaction be detectably labelled or otherwise modified, thus alter- mixture buffers and salt solutions, including buffers ing the compound’s chemical or physical characteristics. containing additional specialized reaction additives; [0033] In a preferred embodiment, the nucleic acid - reducing adverse effects on the specificity and prod- polymerase may be a DNA polymerase. The DNA uct yield, as observed e.g. with tRNA additives; 30 polymerase may be any polymerase capable of replicat- - operating with reagents that are commercially avail- ing a DNA molecule. Preferably, the DNA polymerase is able, easily synthesized, and inexpensive. a thermostable polymerase useful in PCR. More prefer- ably, the DNA polymerase is Taq, Tbr, Tth, Tih, Tfi, Tfl, [0028] The invention thus facilitates the rapid and effi- Pfu, Pwo, Kod, VENT, DEEPVENT, Tma, Tne, Bst, Pho, cient generation of nucleic acid molecules from a sample 35 Sac, Sso, Poc, Pab, ES4 or mutants, variants and deriv- containing ribonucleic acids (RNA) as well as the detec- atives thereof having DNA polymerase activity. tion and quantitation of RNA molecules. The invention is [0034] Oligonucleotide primers may be any oligonucle- also useful in the rapid production and amplification of otide of two or more nucleotides in length. Primers may cDNAs that may be used for a variety of industrial, med- be random primers, homopolymers, or primers specific ical and forensic purposes. An anionic polymer according 40 toa target RNA template,e.g. a sequencespecific primer. to the present invention is defined as an anionic polymer [0035] Additional embodiments comprise an anionic selected from the group consisting of dextran sulphate, polymer and other reaction mixture components such as sodium alginate, heparin, carrageen, sodium car- one or more nucleotides or derivatives thereof. Prefera- boxymethylcellulose, polyphloretin phosphate, poly-L- bly the nucleotide is a deoxynucleotide triphosphate, glutamate, polyacrylic acid, poly(propylacrylic acid), po- 45 dNTP, e.g. dATP, dCTP, dGTP, dTTP, dITP, dUTP, α- ly(methyl-vinyl-ether-maelic anhydride) and that com- thio-dTNP, biotin-dUTP, fluorescein-dUTP, digoxigenin- prises a net charge of at least -1 at the pH used in the dUTP. enzymatic reactions according to the present invention [0036] Buffering agents, salt solutions and other addi- and an equivalent amount of counter-cations. In one em- tives for use in the present invention comprise those so- bodiment of the present invention, the net charge of the 50 lutions useful in RT-PCR. Preferred buffering agents in- anionicpolymers atthe pHused in theenzymatic reaction clude e.g. TRIS, TRICINE, BIS-TRICINE, HEPES, is in the range from -1 to -10.000, preferable in the range MOPS, TES, TAPS, PIPES, CAPS. Preferred salt solu- of-5 to -5.000, more preferable in the range of -10 to tions include e.g. potassium chloride, potassium acetate, -1.000 and most preferable in the range of-20 to - 200. potassium sulphate, ammonium sulphate, ammonium In all cases, an equivalent amount of counter-ions is55 chloride, ammonium acetate, magnesium chloride, mag- present. In one embodiment of the present invention, the nesium acetate, magnesium sulphate, manganese chlo- anionic polymer is a polysaccharide. In accordance with ride, manganese acetate, manganese sulphate, sodium the present disclosure, the anionic polymer may be a chloride, sodium acetate, lithium chloride, and lithium ac-

4 7 EP 2 744 901 B1 8 etate. Preferred additives include e.g. DMSO, glycerol, Brief description of the drawings formamide, betain, tetramethylammonium chloride, PEG, Tween 20, NP 40, extoine, polyoles, E. coli SSB [0040] protein, Phage T4 gene 32 protein, and BSA. Additional embodiments comprise other components that have5 Figure 1: been shown to reduce the inhibitory effect of reverse tran- scriptase on DNA polymerase, e.g. homopolymeric nu- ViralRNA from the pandemic H1N1/09 virus was cleic acids as described in EP 1050587 B1. reverse transcribed and then PCR-amplified [0037] Furtheraspects of thisdisclosure relate to meth- with gene specific primers for the Matrix gene ods for generating nucleic acids from an RNA template 10 of influenza Type A viruses. Dextran sulphate and further nucleic acid replication. The method compris- was either absent (lanes 1-2) or added to a final es: a) adding an RNA template to a reaction mixture com- concentration of 3,2 ng/ml (lanes 3-4), 32 ng/ml prising at least one reverse transcriptase and/or mutants, (lanes 5-6), 160 ng/ml (lanes 7-8), 320 ng/ml variants and derivatives thereof and at least one nucleic (lanes 9-10) and 640 ng/ml (lanes 11-12). acid polymerase, and/or mutants, variants and deriva- 15 tives thereof, and an anionic polymer that is not a nucleic Figure 2: acid, and one or more oligonucleotide primers, and b) incubating the reaction mixture under conditions suffi- ViralRNA from the pandemic H1N1/09 virus was cient to allow polymerization of a nucleic acid molecule reverse transcribedand then PCRamplified with complementary to a portion of the RNA template. The 20 gene specific primers for the Matrix gene. Dex- method may include replication of the DNA molecule tran sulphate was either absent (lanes 1-2) or complementary to at least a portion of the RNA template. added at a concentration of 320 ng/ml (lanes Such as polymerase chain reaction (PCR) and coupled 3-4), 640 ng/ml (lanes 5-6), 1,6m g/ml (lanes reverse transcriptase-polymerase chain reaction (RT- 7-8), 3,2 mg/ml (lanes 9-10), 6,4 mg/ml (lanes PCR). 25 11-12) and 16 mg/ml (lanes 13-14). [0038] An anionic polymer as used in accordance with the present invention defined by the claims, is an anionic Figure 3: polymer selected from the group consisting of dextran sulphate, sodium alginate, heparin, carrageen, sodium ViralRNA from the pandemic H1N1/09 virus was carboxymethylcellulose, polyphloretin phosphate, poly- 30 reverse transcribed with gene-specific primers L-glutamate, polyacrylic acid, poly(propylacrylic acid), for the Matrix gene. The RT mix was then mixed poly(methyl-vinyl-ether-maelic anhydride) and that com- with PCR master mix to amplify the Matrix gene. prises a net charge of at least -1 at the pH used in the The reaction was performed in duplicate either enzymatic reactions and an equivalent amount of coun- in the complete absence of dextran sulphate ter-cations. In one embodiment of the present invention, 35 (lanes 1-2), with 480 ng/ml dextran sulphate only the net charge of the anionic polymers at the pH used in in the PCR (lanes 3-4) or with dextran sulphate the enzymatic reaction is in the range from -1 to -10.000, in the reverse transcription (lanes 5-6). preferable in the range of -5 to -5.000, more preferable in the range of -10 to -1.000 and most preferable in the Figure 4: range of -20 to - 200. In all cases, an equivalent amount 40 of counter-ionsis present.The amount ofanionic polymer 10 ng HeLa total RNA were reverse transcribed used for RT-PCR may be greater than 1pg/ml, preferably and then PCR amplified with gene-specific prim- between 1pg/ml to 1mg/ml, more preferably between ers for Lamin A/C, either in the absence of dex- 10pg/ml to 100mg/ml, most preferably between 1ng/m to tran sulphate (lanes -DS) or with 640 ng/ml dex- 10mg/ml. 45 tran sulphate (lanes +DS). Depending on the anionic polymer used, the concentra- tion of the anionic polymer used for RT-PCR might vary. Figure 5: [0039] In more specific embodiments, RT-PCR occurs between about 4 °C to about 100 °C. Preferably, reverse 10 ng HeLa total RNA were reverse transcribed transcription occurs between about 25 °C to about 75 °C, 50 and then PCR amplified with gene-specific prim- followed by PCR occurring between about 40 °C to about ers for TNFR1, either in the absence of dextran 98 °C. Under the most preferred conditions, reverse tran- sulphate (lanes 1-2) or with 640 ng/ml dextran scription occurs between about 37 °C to about 60 °C, sulphate (lanes 3-4). denaturation occurs at about 94 °C, annealing occurs at about 60 °C and polymerization occurs at about 72 °C. 55 Figure 6:

10 ng HeLa total RNA were reverse transcribed and then PCR amplified with gene-specific prim-

5 9 EP 2 744 901 B1 10

ers for TNFR1, either in the absence of sodium and the appropriate nucleotide building blocks needed alginate (lanes 1-2) or with sodium alginate add- for nucleic acid synthesis. For the purpose of this inven- ed to a final concentration of 40ng/ml (lanes 3-4), tion, cDNA is defined as any DNA molecule whose nu- 8ng/ml (lanes 5-6) and 4ng/ml (lanes 7-8). cleic acid sequence is complementary to an RNA mole- 5 cule. An RNA template is defined as any RNA molecule Detailed description of the invention used to provide a nucleic acid sequence from which a cDNA molecule may be synthesized. The synthesis of [0041] The present invention is related to the use of an cDNA from an RNA template is typically accomplished anionic polymer, wherein the anionic polymer comprises by utilizing a nucleic acid polymerase that exhibits re- a net charge of at least -1 at the pH used in RT-PCR, 10 verse transcriptase activity. For the purpose of this in- wherein the anionic polymer is selected from the group vention, reverse transcriptase activity refers to the ability consisting of dextran sulphate, sodium alginate, heparin, of an enzyme to polymerize a cDNA molecule from an carrageen, sodium carboxymethylcellulose, polyphlore- RNA template, and reverse transcriptase broadly refers tin phosphate, poly-L-glutamate, polyacrylic acid, po- to any enzyme possessing reverse transcriptase activity. ly(propylacrylic acid), poly(methyl-vinyl-ether-maelic an- 15 Reverse transcription typically occurs in a temperature hydride), for suppressing or reducing the inhibition of nu- range from about 20 °C to about 75 °C, preferably from cleic acid replication by reverse transcriptase as ob- about 35 °C to about 70 °C. served in RT-PCR in a composition comprising one or [0044] After reverse transcription of an RNA template more oligonucleotide primers, any one or more nucle- to produce a cDNA molecule, the cDNA is incubated (in otides or derivatives thereof, and two or more different 20 an appropriate buffering agent) under conditions suffi- polymerases, at least one of which has reverse tran- cient for replication of the cDNA molecule. The reaction scriptase activity and at least one of which has nucleic mixture may be the same as that of the previous reverse acid polymerase activity. The composition may include transcription reaction mixture, as employed in coupled an appropriate buffering agent, a salt or other additives (also called continuous, or one-step) RT-PCR, or the re- useful in RT or RT-PCR including nucleic acids such as 25 action mixture may comprise an aliquot of the previous homopolymeric nucleic acids as described in EP reverse transcription reaction mixture and may be further 1050587 B1. Methods of the disclosure utilize anionic modified for nucleic acid replication, as in uncoupled (or polymers in combination with other reagents to generate two-step) RT-PCR. Components of a replication reaction nucleic acid from an RNA template, and preferably also mixture typically include a nucleic acid template (in this to replicate the newly synthesized nucleic acid. The com- 30 instance the cDNA); a nucleic acid polymerase; and the positions and methods of the present disclosure useful appropriate nucleotide building blocks needed for nucleic to generate, replicate, analyze, quantitate and otherwise acid synthesis. Nucleic acid replication refers to the po- manipulate nucleic acid molecules are most useful in lymerization of a nucleic acid whose sequence is deter- coupled or uncoupled RT-PCR procedures. mined by, and complementary to, another nucleic acid. [0042] RT-PCR is one molecular manipulation used to 35 DNA replication, as used herein, is synonymous with generate and replicate a nucleic acid derived from an DNA amplification. Preferably, DNA amplification occurs RNA template. RT-PCR is described herein as an exem- repetitively, thus replicating both strands of the nucleic plary protocol capable of utilizing the compositions and acid sequence, i.e., DNA complementary to the RNA methods of the present invention without limitation. It is template, and DNA whose nucleic acid sequence is sub- understood by one of ordinary skill in the art that the40 stantially identical to the RNA template. Repetitive, or present invention has utility in other processes which in- cyclic, DNA replication may be advantageously accom- volve a combination of reverse transcriptase and DNA plished using a thermostable polymerase in a Polymer- polymerase activity. RT-PCR involves two separate mo- ase Chain Reaction (PCR). lecular syntheses: 1) the synthesis of cDNA from an RNA [0045] PCR is a technique well known in the art. PCR template; 2) the replication of the newly synthesized cD- 45 is used to amplify nucleic acids by subjecting a reaction NA through PCR amplification. mixture to cycles of: 1) nucleic acid denaturation, 2) oli- gonucleotide primer annealing, and 3) nucleic acid po- Reverse Transcriptase=Polymerase Chain Reaction lymerization. Preferred reaction conditions for amplifica- (RT-PCR) tion comprise thermocycling, i.e., alternating the temper- 50 ature of the reaction mixture to facilitate each of the steps [0043] In RT-PCR, the reaction mixture is first incubat- of the PCR cycle. PCR is typically extended through mul- ed (in an appropriate buffering agent) at a temperature tiple cycles of denaturation, annealing and replication, sufficient to allow synthesis of a DNA molecule comple- augmented (optionally and preferably) with an initial pro- mentary to at least a portion of an RNA template. Com- longed denaturation step and a final prolonged extension ponents of a reverse transcription reaction mixture typi- 55 (polymerization) step. Thermocycling typically occurs cally include an RNA template, from which the comple- within a temperature range of between about 23 °C to mentary DNA (cDNA) is transcribed; a nucleic acid about 100 °C, and preferably between about 37 °C to polymerase that exhibits reverse transcriptase activity; about 95 °C. Nucleic acid denaturation typically occurs

6 11 EP 2 744 901 B1 12 between about 90 °C to about 100 °C, preferably about ferred reverse transcriptases include: OmniScript (QIA- 94 °C. Annealing typically occurs between about 37 °C GEN), Avian Myeloblastosis Virus reverse transcriptase to about 75 °C, preferably about 55 °C. Polymerization (AMV-RT), Moloney Murine Leukemia Virus reverse typically occurs between about 55 °C to about 80 °C, transcriptase (MMLV-RT), Human Immunovirus reverse preferably about 72 °C. The number of thermocycles var- 5 transcriptase (HIV-RT), EIAV-RT, RAV2-RT, C. hydrog- ies immensely, depending upon practitioner preference enoformans DNA polymerase, Tth DNA polymerase, Su- and the quantity of DNA product desired. Preferably, the perScript I, SuperScript II, SuperScript III, and muntants, number of PCR cycles ranges from about 5 to about 99, variants and derivatives thereof. It is to be understood more preferably greater than about 20 cycles, most pref- that a variety of reverse transcriptases may be used in erably about 40 cylces. 10 the present invention, including reverse transcriptases not specifically disclosed above, without departing from Template RNA the scope or preferred embodiments thereof.

[0046] The template RNA can be any ribonucleic acid DNA Polymerases of interest, known or unknown to the practitioner. Tem- 15 plate RNA can be artificially synthesized or isolated from [0049] DNA polymerases useful in the present inven- natural sources. In some embodiments, the RNA tem- tion may be any polymerase capable of replicating a DNA plate can be a ribonucleic acid such as RNA, mRNA, molecule. Preferred DNA polymerases are thermostable piRNA, tRNA, rRNA, ncRNA, shRNA, siRNA, snRNA, polymerases, which are especially useful in PCR. Ther- miRNA, snoRNA and viral RNA. Preferably, the RNA is 20 mostable polymerases are isolated from a wide variety mRNA. More preferably the RNA is biologically active or of thermophilic bacteria, such asThermus aquaticus encodes a biologically active polypeptide. (Taq), Thermus brockianus (Tbr), Thermus flavus (Tfl), Thermus rubber (Tru), Thermus thermophilus (Tth), Anionic polymers. Thermococcus litoralis (Tli) and other species of the 25 Thermococcus genus, Thermoplasma acidophilum [0047] The present invention relates to the discovery (Tac), Thermotoga neapolitana (Tne), Thermotoga mar- that anionic polymers serve as an inhibition-relieving itime (Tma), and other species of the Thermotoga genus, agent capable of suppressing, or otherwise reducing, the Pyrococcus furiosus (Pfu), Pyrococcus woesei (Pwo) inhibition of nucleic acid replication by reverse tran- and other species of thePyrococcus genus, Bacullus scriptase as observed in RT-PCR. and that comprises a 30 sterothermophilus (Bst), Sulfolobus acidocaldarius net charge of at least -1 at the pH used in the enzymatic (Sac), Sulfolobus solfataricus (Sso), Pyrodictium occul- reactions and an equivalent amount of counter-cations. tum (Poc), Pyrodictium abyssi (Pab), and Methanobac- In one embodiment of the present invention, the net terium, thermoautotrophicum (Mth), and mutants, vari- charge of the anionic polymers at the pH used in the ants or derivatives thereof. enzymatic reaction is in the range from -1 to -10.000, 35 [0050] Several DNA polymerases are known in the art preferable in the range of -5 to -5.000, more preferable and are commercially available. Preferably the ther- in the range of -10 to -1.000 and most preferable in the mostable DNA polymerase is selected from the group of range of -20 to - 200. In all cases, an equivalent amount Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, of counter-ions is present. 1): An anionic polymer used Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, in accordance with the present invention as defined in 40 VENT, DEEPVENT, and mutants, variants and deriva- the claims is an anionic polymer selected from the group tives thereof. It is to be understood that a variety of DNA consisting of dextran sulphate, sodium alginate, heparin, polymerases may be used in the present invention, in- carrageen, sodium carboxymethylcellulose, polyphlore- cluding DNA polymerases not specifically disclosed tin phosphate, poly-L-glutamate, polyacrylic , acid, po- above, without departing from the scope or preferred em- ly(propylacrylic acid), poly(methyl-vinyl-ether-maelic an- 45 bodiments thereof. hydride) The amount of anionic polymer used for RT- PCR may be greater than 1pg/ml, preferably between Oligonucleotide Primers 1pg/ml to 1mg/ml, more preferably between 10pg/ml to 100mg/ml, most preferably between 1ng/ml to 10mg/ml. [0051] Oligonucleotide primers useful in the present Depending on the anionic polymer used, the concentra- 50 invention may be any oligonucleotide of two or more nu- tion of the anionic polymer used for RT-PCR might vary. cleotides in length. Preferably, PCR primers are about 15 to about 30 bases in length, and are not palindromic Reverse Transcriptases (self-complementary) or complementary to other primers that may be used in the reaction mixture. Primers may [0048] Reverse transcriptases useful in the present in- 55 be, but are not limited to, random primers, homopoly- vention may be any polymerase that exhibits reverse mers, or primers specific to a target RNA template (e.g., transcriptase activity. Several reverse transcriptases are a sequence specific primer). Oligonucleotide primers are known in the art and are commercially available. Pre- oligonucleotides used to hybridize to a region of a target

7 13 EP 2 744 901 B1 14 nucleic acid to facilitate the polymerization of a comple- timize the generation and replication of nucleic acids from mentary nucleic acid. In preferred RT-PCR techniques, an RNA template. Additives may be organic or inorganic primers serve to facilitate reverse transcription of a first compounds. Inhibition-reliving agents useful in the nucleic acid molecule complementary to a portion of an present invention include, but are not limited to polypep- RNA template (e.g., a cDNA molecule), and also to fa- 5 tides such as human serum albumin, bovine serum al- cilitate replication of the nucleic acid (e.g., PCR amplifi- bumin (BSA), ovalbumin, albumax, casein, gelatine, col- cation of DNA). Any primer may be synthesized by a prac- lagen, globulin, lysozyme, transferrin, myoglobin, hae- titioner of ordinary skill in the art or may be purchased moglobin, α-lactalbumin, fumarase, glyceraldehyde-3- from any of a number of commercial vendors. It is to be phosphate dehydrogenase (GAPDH), amyloglucosi- understood that a vast array of primers may be useful in 10 dase, carbonic anhydrase, ß-lactoglobulin, aprotinin, the present invention, including those not specifically dis- soybean trypsin inhibitor, trypsinogen, phosphorylase b, closed herein, without departing from the scope or pre- myosin, actin, ß-galactosidase, catalase, tryptic soy di- ferred embodiments thereof. gestes, tryptose, lectins, E. coli single-stranded binding protein (SSB), phage T4 gene 32 protein, and the like, Nucleotide Bases 15 or fragments or derivatives thereof. Examples of non- polypeptide additives include, but are not limited to [0052] Nucleotidebases usefulin thepresent invention homopolymeric nucleic acids, tRNA, rRNA, sulphur-con- may be any nucleotide useful in the polymerization of a taining compounds, acetate-containing compounds, nucleic acid. Nucleotides may be naturally occurring, un- dimethylsulfoxide (DMSO), glycerol, formamide, betain, usual, modified, derivative, or artificial. Nucleotides may 20 tetramethylammonium chloride (TMAC), polyethylene be unlabeled, or detectably labeled by methods known glycol (PEG), Tween 20, NP 40, ectoine, and polyoles. in the art (e.g., using radioisotopes, vitamins, fluorescent Preferred additives include homopolymeric nucleic ac- or chemiluminescent moieties, digoxigenin). Preferably, ids, DMSO, glycerol, formamide, betain, TMAC, PEG, the nucleotides are deoxynucleoside triphosphates, Tween 20, NP 40, extoine, polyoles, E. coli SSB protein, dNTPs (e.g., dATP, dCTP, dGTP, dTTP, dITP, dUTP, α- 25 Phage T4 gene 32 protein, and BSA. thio-dNTPs, biotin-dUTP, fluorescin-dUTP, digoxigenin- dUTP, 7deaza-dGTP). dNTPs are well known in the art Regaent kits for coupled RT-PCR and are commercially available. [0055] A further aspect of the present disclosre is a Buffering Agents and Salt Solutions 30 reagent kit for coupled RT-PCR, comprising at least one reverse transcriptase, at least one DNA polymerase, and [0053] Buffering agents and salts useful in the present at least one anionic polymer that is not a nucleic acid. In invention provide appropriate stable pH and ionic condi- such a reagent kit, said reverse transcriptase, DNA tions for nucleic acid synthesis, e.g., for reverse tran- polymerase and anionic polymer may be combined in scriptase and DNA polymerase activity. A wide variety 35 one container. Alternatively, said reverse transcriptase of buffers and salt solutions and modified buffers are and DNA polymerase may be combined in one container known in the art that may be useful in the present inven- and said anionic polymer may be in a second container. tion, including agents not specifically disclosed herein. Alternatively, said reverse transcriptase and said anionic Preferred buffering agents include, but are not limited to, polymermay becombined in one container and said DNA TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, 40 polymerase may be in a second container. Alternatively, TAPS, PIPES, CAPS. Preferred salt solutions include, said DNA polymerase and said anionic polymer may be but are not limited to solutions of potassium acetate, po- combinedin onecontainer andsaid reverse transcriptase tassium sulphate, ammonium sulphate, ammonium chlo- may bein a second container. Alternatively,all three com- ride, ammonium acetate, magnesium chloride, magne- ponents may be in separate containers. Such a reagent sium acetate, magnesium sulphate, manganese chlo- 45 kitmay furthercomprise amixture of two ormore of dATP, ride, manganese acetate, manganese sulphate, sodium dCTP, dGTP, and dTTP, and/or one or more additives chloride, sodium acetate, lithium chloride, and lithium ac- useful in RT-PCR and/or a buffering agent. All compo- etate. nents mentioned above may be in separate containers, ortwo or more ofthem maybe combined in onecontainer. Other Additives useful in RT-PCR 50 Preferably, the two enzymes are combined in one con- tainer, either together with the anionic polymer or the [0054] Other additives capable of facilitating reverse anionic polymer being in a separate container, and a buff- transcription, replication, and/or a combination of both ering agent, a dNTP mix, and one or more useful addi- reactions (e.g., agents for facilitating RT-PCR), other tives, if present, are provided in the kit in separate con- than those disclosed for the first time by this invention, 55 tainers. A further aspect of the present disclosure is the are known in the art. In accordance with the present in- use of a reagent kit as above for coupled RT-PCR. vention as defined in the claims , one or more of these [0056] Particular aspects of the present disclosure are additives may be incorporated in the compositions to op- as follows:

8 15 EP 2 744 901 B1 16

A composition suitable for the generation of nucleic molecule complementary to a portion of said RNA acids from an RNA template, comprising an anionic template. polymer that is not a nucleic acid, one or more oli- gonucleotide primers, any one or more nucleotides [0065] The method as above, wherein the anionic pol- or derivatives thereof, and two or more different5 ymer is not a nucleic acids and comprises a net charge polymerases, at least one of which has reverse tran- of at least -1 at the pH used in RT-PCR and comprises scriptase activity and at least one of which has nu- an equivalent amount of counter-ions. cleic acid polymerase activity. [0066] The method as above, wherein the net charge of the anionic polymer is in the range from -1 to -10.000, [0057] The composition as above further comprising a 10 preferable in the range of -5 to -5.000, more preferable buffering agent, a salt, and/or additives that are useful in in the range of -10 to -1.000 and most preferable in the RT-PCR. range of -20 to - 200. In all cases, an equivalent amount [0058] The composition as above, wherein the anionic of counter-ions is present. polymer is not a nucleic acids and comprises a net charge [0067] The method as above, wherein the anionic pol- of at least -1 at the pH used in RT-PCR and comprises 15 ymer is a polysaccharide, a polypeptide, an acid or an an equivalent amount of counter-ions. anhydride. [0059] The composition as above, wherein the net [0068] The method as above, wherein the anionic pol- charge of the anionic polymer is in the range from -1 to ymer is selected from the group consisting of dextran -10.000, preferable in the range of -5 to -5.000, more sulphate, sodium alginate, heparin, carrageen, sodium preferable in the range of -10 to - 1.000 and most pref- 20 carboxymethylcellulose, polyphloretin phosphate, poly- erable in the range of -20 to - 200. In all cases, an equiv- L-glutamate, polyacrylic acid, poly(propylacrylic) acid, alent amount of counter-ions is present. poly(methyl-vinyl-ether-maleic anhydride, or a mixture of [0060] The composition as above, wherein the anionic two or more of these anionic polymers. polymer is a polysaccharide, a polypeptide, an acid or [0069] The method asabove, wherein saidnucleic acid an anhydride. 25 is DNA and said polymerase is DNA polymerase. [0061] The composition as above, wherein the anionic [0070] The method as above, wherein said DNA polymer is selected from the group consisting of dextran polymerase is selected from the group of Taq, Tbr, Tfl, sulphate, sodium alginate, heparin, carrageen, sodium Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, carboxymethylcellulose, polyphloretin phosphate, poly- Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT DNA polymer- L-glutamate, polyacrylic acid, poly(propylacrylic) acid, 30 ase, DEEPVENT DNA polymerase, and/or mutants, var- poly(methyl-vinyl-ether-maleic anhydride, or a mixture of iants and derivatives thereof. two or more of these anionic polymers. [0071] The method as above, wherein said reverse [0062] The composition as above, wherein said transcriptase is selected from the group of OmniScript, polymerase exhibiting reverse transcriptase activity is AMV-RT, M-MLV-RT, HIV-RT, EIAV-RT, RAV2-RT, C. selected from the group of OmniScript, AMV-RT, MMLV- 35 hydrogenoformans DNA polymerase, SuperScript I, Su- RT, HIV-RT, EIAV-RT, RAV2-RT, C. hydrogenoformans perScript II, SuperScript III, and/or mutants, variants and DNA polymerase, SuperScript I, SuperScript II, Super- derivatives thereof. Script III, and/or mutants, variants and derivatives there- [0072] A kit for performing coupled RT-PCR compris- of. ing at least one reverse transcriptase, at least one DNA [0063] The composition as above, wherein said40 polymerase, and at least one anionic polymer that is not polymerase exhibiting nucleic acid polymerase activity a nucleic acid. is selected from the group of Taq, Tbr, Tfl, Tru, Tth, Tli, [0073] A kit for performing coupled RT-PCR, further Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, comprising a mixture of two or more of dATP, dCTP, Poc, Pab, Mth, Pho, ES4, VENT DNA polymerase, dGTP, and dTTP, and/or one or more additives useful in DEEPVENT DNA polymerase and/or mutants, variants 45 RT-PCR and/or a buffering agent. and derivatives thereof. [0064] A method for generating a nucleic acid from an Examples RNA template comprising the steps: Example 1: a) adding said RNA template to a reaction mixture, 50 said reaction mixture comprising at least one reverse [0074] To demonstrate the specificity of RT-PCR is im- transcriptase and/or mutants, variants and deriva- proved by the use of anionic polymers, increasing tives thereof and at least one nucleic acid polymer- amounts of dextran sulphate 8000 (Sigma), were added ase, and/or mutants, variants and derivatives there- to samples containing RNA from the influenza A virus. of, and an anionic polymer that is not a nucleic acid, 55 The matrix gene of the influenza A virus was selected as and one or more oligonucleotide primers; and the RNA template for RT-PCR. b) incubating said reaction mixture under conditions [0075] Viral RNA from the pandemic H1N1/09 virus, sufficient to allow polymerization of a nucleic acid belongingto thegroup of influenza Aviruses, was reacted

9 17 EP 2 744 901 B1 18 in a final volume of 25 ml comprising 5 ml viral RNA eluate the reaction on ice. An aliquot of the reverse transcription as template, reverse transcriptase (OmniScript, QIA- (12,5 ml) was mixed with a 12,5 ml PCR master mix, in- GEN), 2.5U of HotStar Fast Taq One-step RT-PCR buffer cluding 2,5 U HotStar Taq Plus (QIAGEN), 0,6 mM of the (QIAGEN) (1X final concentration) 0,4 mM each of dNTP primers (SEQ ID NO: 1 and 2), 0,4 mM dNTP mix and mix, 0,6 mM each of forward (SEQ ID NO: 1) and reverse 5 1x One-Step RT-PCR buffer (QIAGEN). PCR was con- primer (SEQ ID NO: 2) for the matrix gene of influenza ducted with the cycling conditions as shown in Example A virus and dextran sulphate at concentrations of 3,2 1. Dextran sulphate 8000 (Sigma) was added either to ng/ml to 640 ng/ml. The reverse transcription reaction the reverse transcription reaction or to the PCR reaction mix was incubated at 50 °C for 30 minutes, followed by to give a final concentration of 480 ng/ml. In a control heating for 5 min at 95 °C. After that, 45 cycles of 30 s 10 reaction, no dextran sulphate was added. at 94 °C, 30 s at 50 °C and 1 min at 72 °C were run. [0081] The samples were analyzed in duplicate on an [0076] The samples (in duplicate) were analyzed on agarose gel (Figure 3). In the reaction, in which no dex- an agarose gel (Figure 1). A clear improvement in effi- tran sulphate was added, the yield of the matrix gene ciency and specificity upon addition of dextran sulphate was very low and very high amounts of unspecific prod- was observed. The yield of RT-PCR product significantly 15 ucts were detectable (lanes 1-2). The addition of dextran increased with increasing amounts of dextran sulphate. sulphate to the PCR reaction slightly improved the yield In this experiment, 320 and 640 ng/ml dextran sulphate of the matrix gene, but had little or no effect on the spe- showed the best results (lanes 9-12), but even very low cificity.In contrast, addition ofdextran sulphate to reverse concentrations of dextran sulphate (3,2 ng/ml, lanes 3-4) transcription reaction gave significantly higher efficiency showed a clear positive effect compared to the control 20 and specificity of the reaction. The positive effect of dex- reaction (lanes 1-2), in which no dextran sulphate had tran sulphate is thus mainly due to its effect during the been added to the RT-PCR. reverse transcription, although a slight positive effect could also be detected in the PCR. Example 2: 25 Example 4: [0077] To determine whether dextran sulphate in high- er concentrations could have a negative effect on the RT- [0082] To demonstrate that not only viral RNA but also PCR, higher concentrations of dextran sulphate were mRNA can serve as a template, 10 ng HeLa mRNA were used. Reaction conditions were the same as described used as a template for RT-PCR. Reaction conditions in Example 1, except for the concentration of dextran 30 were the same as in Example 1, except that HeLa mRNA sulphate. The concentrations of dextran sulphate in this was used as template and primer pairs for the amplifica- example were from 0,32 mg/ml to 16 mg/ml. tion of Lamin A/C (SEQ ID NOs: 3 and 4) and TNFR1 [0078] The samples were again analyzed on an agar- (SEQ ID NOs: 5 and 6), respectively, were used; and the ose gel (Figure 2). Again, a clear improvement in effi- annealing temperature in PCR was 55°C instead of 50°C. ciency and specificity upon addition of dextran sulphate 35 As anionic polymer, 640 ng/ml dextran sulphate 8000 was observed (lanes 3-12) compared to the control in were used. Again, the samples were analyzed on an aga- which no dextran sulphate was added (lanes 1-2). Only rose gel in duplicate (Figure 4 and Figure 5). This exam- at very high concentrations of dextran sulphate (16 ple again proves the positive effect of anionic polymers mg/ml) (lanes 13-14) a negative effect on the RT-PCR on the efficiency and the specificity of the RT-PCR. While could be detected as this concentration failed to yield any 40 without the addition of dextran sulphate, in addition to product in RT-PCR. However, the positive effect of dex- the specific amplicon for Lamin A/C many unspecific am- tran sulphate on efficiency and specificity could be de- plicons could be detected (Figure 4, lanes -DS), essen- tected over a wide range of concentrations (0,32 mg/ml tially only the specific amplicon for Lamin A/C could be - 6,4 mg/ml) (lanes 3-12), demonstrating the robustness detected when dextran sulphate was added to the RT- of the positive effect of anionic polymers on RT-PCR. 45 PCR (Figure 4, lanes +DS). The situation is similar, when TNFR1 was amplified. Without the addition of dextran Example 3: sulphate, in addition to the specific amplicon for TNFR1, many unspecific amplicons were detected (Figure 5, [0079] To determine whether the positive effect of an- lanes -DS), while a significant improvement on specificity ionic polymers on RT-PCR were on the reverse transcrip- 50 and efficiency could be detected by the addition of dex- tion, on the replication of the cDNA or on both, a two- tran sulphate (Figure 5, lanes +DS). step RT-PCR was performed with adding the anionic pol- ymers at the reverse transcription step, at the replication Example 5: step or not at all. [0080] Template RNA and all other reaction compo- 55 [0083] To demonstrate that other anionic polymers in nents were the same as in Example 1. The reverse tran- addition to dextran sulphate are suited for the improve- scription reaction was incubated for 30 min at 50 °C. After ment of specificity and efficiency, 1 ng, 200 pg and 100 that, the reverse transcription was stopped by cooling pg, respectively, of sodium alginate were used as anionic

10 19 EP 2 744 901 B1 20 polymer in the RT-PCR. Reaction conditions were the group of OmniScript, AMV-RT, M-MLV-RT, HIV-RT, same as described in Example 4, except that sodium EIAV-RT, RAV2-RT, C. hydrogenoformans DNA alginate was used as anionic polymer and that only the polymerase, SuperScript I, SuperScript II, Super- primer pairs for the amplification of TNFR1 (SEQ ID NOs: Script III and/or mutants, variants and derivatives 5 and 6) were used. Again, the samples were analyzed 5 thereof. in duplicate on an agarose gel (Figure 6). The results clearly demonstrate that the addition of sodium alginate 5. Use of claim 1, wherein said polymerase exhibiting in various amounts also leads to an improvement of ef- nucleic acid polymerase activity is selected from the ficiency and specificity in RT-PCR. The results with so- group of Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, dium alginate as anionic polymer are similar to the results 10 Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, that were obtained with dextran sulphate as anionic pol- Pho, ES4, VENT DNA polymerase, DEEPVENT ymer (Figure 5). DNA polymerase, and/or mutants, variants and de- [0084] Therefore, it could be shown that the improve- rivatives thereof. ment in efficiency and specificity of RT-PCR is a general feature of anionic polymers as two chemically distinct 15 anionic polymers show a similar positive effect. Patentansprüche

Sequences referred to in the examples : 1. Verwendung eines anionischen Polymers, wobei das anionische Polymer eine Nettoladung von we- [0085] 20 nigstens -1 bei dem bei RT-PCR verwendeten pH umfasst, wobei das anionische Polymer ausgewählt SEQ ID NO: 1: ATGAGYCTTYTAACCGAGGTC- ist aus der Gruppe bestehend aus Dextransulfat, Na- GAAACG triumalginat, Heparin, Carrageen, Natriumcarboxy- SEQ ID NO: 2: TGGACAANCGTCTACGCTGCAG methylcellulose, Polyphloretinphosphat, Poly-L- SEQ ID NO: 3: CATCCTCGCAAACCACCCACTCA 25 Glutamat, Polyacrylsäure, Poly(Propylacrylsäure), SEQ ID NO: 4: CAGCGCCCACAAGCCACAGAG Poly(Methyl-Vinyl-Ether-Maleinsäure-Anhydrid), SEQ ID NO: 5: CAGCTCTCCGGCCTCCAGAAG zum Unterdrücken oder Verringern der Inhibierung SEQ ID NO: 6: TCCTCGGGTCCCCCTGTTGGT von Nukleinsäurereplikation durch reverse Trans- kriptase, wie bei RT-PCR in einer Zusammenset- 30 zung beobachtet, die ein oder mehrere Oligonukle- Claims otidprimer, irgendein oder mehrere Nukleotide oder Derivate davon und zwei oder mehr verschiedene 1. Use of an anionic polymer, wherein the anionic pol- Polymerasen umfasst, von denen wenigstens eine ymer comprises a net charge of at least -1 at the pH reverse Transkriptaseaktivität aufweist und wenigs- used in RT-PCR, wherein the anionic polymer is se- 35 tens eine Nukleinsäurepolymeraseaktivität aufweist. lected from the group consisting of dextran sulphate, sodium alginate, heparin, carrageen, sodium car- 2. Verwendung nach Anspruch 1, wobei das anioni- boxymethylcellulose, polyphloretin phosphate, poly- sche Polymer zur Verwendung bei RT-PCR be- L-glutamate, polyacrylic acid, poly(propylacrylic ac- stimmt ist. id), poly(methyl-vinyl-ether-maelic anhydride), for 40 suppressing or reducing the inhibition of nucleic acid 3. Verwendung nach Anspruch 1, wobei die Zusam- replication by reverse transcriptase as observed in mensetzung weiter ein Pufferagens, ein Salz RT-PCR in a composition comprising one or more und/oder Zusätze umfasst, die bei RT-PCR nützlich oligonucleotide primers, any one or more nucle- sind. otides or derivatives thereof, and two or more differ- 45 ent polymerases, at least one of which has reverse 4. Verwendung nach Anspruch 1, wobei die reverse transcriptase activity and at least one of which has Transkriptaseaktivität aufweisende Polymerase nucleic acid polymerase activity. ausgewählt ist aus der Gruppe bestehend aus Om- niScript, AMV-RT, M-MLV-RT, HIV-RT, EIAV-RT, 2. Use of claim 1, wherein the anionic polymer is for 50 RAV2-RT, C. hydrogenoformans DNA-Polymerase, use in RT-PCR. SuperScript I, SuperScript II, SuperScript III und/oder Mutanten, Varianten und Derivate davon. 3. Use of claim 1, wherein the composition further com- prises a buffering agent, a salt, and/or additives that 5. Verwendung nach Anspruch 1, wobei die Nuklein- are useful in RT-PCR. 55 säurepolymeraseaktivität aufweisende Polymerase ausgewählt ist aus der Gruppe aus Taq, Tbr, Tfl, Tru, 4. Use of claim 1, wherein said polymerase exhibiting Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, reverse transcriptase activity is selected from the Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT DNA-

11 21 EP 2 744 901 B1 22

Polymerase, DEEPVENT DNA-Polymerase, und/oder Mutanten, Varianten und Derivate davon.

Revendications 5

1. Utilisation d’un polymère anionique, dans laquelle le polymère anionique comprend une charge nette d’aumoins -1 aupH utiliséen RT-PCR,dans laquelle le polymère anionique est sélectionné dans le grou- 10 pe constitué du sulfate de dextrane, de l’alginate de sodium, de l’héparine, du carraghénane, de la car- boxyméthylcellulose sodique, du phosphate de po- lyphlorétine, du poly-L-glutamate, de l’acide polya- crylique, du polyacide propylacrylique, du polyanhy- 15 dride du méthyl-vinyl-éther maélique, pour suppri- mer ou réduire l’inhibition de la réplication de l’acide nucléique par la transcriptase inverse telle qu’obser- vée en RT-PCR dans une composition comprenant une ou plusieurs amorces oligonucléotidiques, un 20 ou plusieurs nucléotides ou dérivés quelconques de celles-ci, et deux polymérases différentes ou plus, dont au moins une a une activité transcriptase inver- se et au moins une a une activité acide nucléique polymérase. 25

2. Utilisation selon la revendication 1, dans laquelle le polymère anionique est destiné à être utilisé en RT- PCR. 30 3. Utilisation selon la revendication 1, dans laquelle la composition comprend en outre un agent tampon, un sel, et/ou des additifs qui sont utiles en RT-PCR.

4. Utilisation selon la revendication 1, dans laquelle la- 35 dite polymérase présentant une activité transcripta- se inverse est sélectionnée dans le groupe constitué d’OmniScript, de l’AMV-RT polymérase, de la M- MLV-RT polymérase, de la HIV-RT polymérase, de l’EIAV-RT polymérase, de la RAV2-RT polymérase, 40 de l’ADN polymérase de C. hydrogenoformans, de SuperScript I, de SuperScript II, de SuperScript III et/ou de mutants, de variants et de dérivés de ceux- ci. 45 5. Utilisation selon la revendication 1, dans laquelle la- dite polymérase présentant une activité acide nucléi- que polymérase est sélectionnée dans le groupe constitué des Taq polymérase, Tbr polymérase, Tfl polymérase, Tru polymérase, Tth polymérase, Tli 50 polymérase, Tac polymérase, Tne polymérase, Tma polymérase, Tih polymérase, Tfi polymérase, Pfu polymérase, Pwo polymérase, Kod polymérase, Bst polymérase, Sac polymérase, Sso polymérase, Poc polymérase, Pab polymérase, Mth polymérase, Pho 55 polymérase, ES4 polymérase, VENT ADN polymé- rase, DEEPVENT ADN polymérase, et/ou de mu- tants, de variants et de dérivés de celles-ci.

12 EP 2 744 901 B1

13 EP 2 744 901 B1

14 EP 2 744 901 B1

15 EP 2 744 901 B1

16 EP 2 744 901 B1

17 EP 2 744 901 B1

18 EP 2 744 901 B1

REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.

Patent documents cited in the description

• EP 1069190 A [0011] • US 20090137008 A1 [0016] • US 2004219595 A [0013] • EP 1050587 B1 [0017] [0036] [0041] • WO 03064605 A [0014]

Non-patent literature cited in the description

• SELLNER ; TURBETT. BioTechniques, 1998, vol. • CHANDLER et al. Appl. and Environm. Microbiol., 25 (2), 230-234 [0007] 1998, vol. 64 (2), 669-677 [0010] • SELLNER et al. J. Virol. Methods, 1992, vol. 40, •FANal.etX Journel of Clinical Virology, 2006, vol. 255-264 [0008] 37, 305-312 [0012] • SELLNER et al. Nucleic Acids Research, vol. 20 (7), 1487-1490 [0009]

19