Elsevier Editorial System(tm) for BBA - Molecular and Cell Biology of Lipids Manuscript Draft
Manuscript Number: BBALIP-17-29R1
Title: Arachidonic acid is important for efficient use of light by the microalga Lobosphaera incisa under chilling stress
Article Type: Regular Paper
Keywords: chilling stress; dihomo-γ-linolenic acid; glycerolipid; long- chain polyunsaturated fatty acid; membrane fluidity; non-photochemical quenching
Corresponding Author: Professor Inna Khozin-Goldberg, Dr.
Corresponding Author's Institution: Agriculture and Biotechnology of Drylands
First Author: Boris Zorin, PhD
Order of Authors: Boris Zorin, PhD; Dipasmita Pal Nath, PhD; Alexander Lukyanov, PhD; Sviatlana Smolskaya, PhD; Sofiya Kolusheva, PhD; Shoshana Didi-Cohen, MSc; Sammy Boussiba, Prof; Zvi Cohen, Prof; Inna Khozin-Goldberg, Dr.; Alexei Solovchenko, Dr. Prof.
Abstract: The oleaginous microalga Lobosphaera incisa (Trebouxiophyceae, Chlorophyta) contains arachidonic acid (ARA, 20:4 n-6) in all membrane glycerolipids and in the storage lipid triacylglycerol. The optimal growth temperature of the wild-type (WT) strain is 25 °C; chilling temperatures (≤15 oC) slow its growth. This effect is more pronounced in the delta-5-desaturase ARA-deficient mutant P127, in which ARA is replaced with dihomo-γ-linolenic acid (DGLA, 20:3 n-6). In nutrient- replete cells grown at 25 °C, the major chloroplast lipid monogalactosylglycerol (MGDG) were dominated by C18/C16 species in both strains. Yet ARA constituted over 10% of the total fatty acids in the WT MGDG as a component of C20/C18 and C20/C20 species, whereas DGLA was only a minor component of MGDG in P127. Both strains increased the percentage of 18:3 n-3 in membrane lipids under chilling temperatures. The temperature downshift led to a dramatic increase in triacylglycerol at the expense of chloroplast lipids. WT and P127 showed a similarly high photochemical quantum yield of photosystem II, whereas non-photochemical quenching (NPQ) and violaxanthin de-epoxidation were drastically higher in P127, especially at 15 °C. Fluorescence anisotropy measurements indicated that ARA-containing MGDG might contribute to sustaining chloroplast membrane fluidity upon dropping to the chilling temperature. We hypothesize that conformational changes in chloroplast membranes and increased rigidity of the ARA-deficient MGDG of P127 at chilling temperatures is not compensated by trienoic fatty acids. This might 'lock' violaxanthin de-epoxidase in the activated state causing high constitutive NPQ and alleviate the risk of photodamage under chilling conditions in the mutant.
Response to Reviewers: We would like to thank two anonymous reviewers and Editor for positive evaluation of our work. The amendments have been performed as requested. Below please find our response to the comments raised by reviewers.
Reviewer #1: This is an important contribution to the role of polyunsaturated fatty acid during cold stress response. I found the paper easy to follow, and contains new and important information. I have to point out that there are at least three places, the authors described data as not shown. I think most journals now do not accept this any more. Would be nice if the authors provide such information as supplemental information.
///Response to Reviewer comment///
As suggested by Reviewer 1, we did our best to remove the void references (“not shown”) from the text. We supplied Fig. S3 to the online supplementary material depicting multiple protein alignment of microalgal omega-3 desaturases (please refer to page 24). In addition, we supplied Fig. S6 containing the data on maximum rate of photosynthetic O2 evolution by the transformant P2 (please refer to page 34). We decided to omit the reference to the violaxanthin de-epoxidation values for P2 recorded at +4 °C (the second “not shown”). The reason is that we did not follow the Vio DE in the same detail although the trends were very similar to those depicted in Fig. 9. Therefore, we were unable to make for the +4 °C data a plot consistent with that for +10 °C (Fig. 9).
Reviewer #2: The article by Boris Zorin and coworkers is an elegant study of the role of arachidonic acid (ARA) in the microalga Lobosphera incisa under chilling stress. The authors have used this recently sequenced oleaginous Chlorophyta model, accumulating high levels of ARA (20-carbon chained fatty acid with 4 double bonds), addressing firstly the question of the role of ARA in a well known process implying polyunsaturated FA, ie the low temperature adaptation via the increase of membrane fluidity. Authors have used a desaturase mutant to test hypotheses and unravel new roles. They thus shown that ARA accumulating in chloroplast galactolipids is also important for the violaxanthin de-epoxidation, and indirectly the non-photochemical quenching level. This study provides new evidence for the function of very-long chain PUFAs in galactolipids, in relation with photosynthesis. Overall the study is well conceived and achieved, combining WT and mutant analyses, from whole cell physiologcial analyses to in vitro demonstration of the role of PUFA-MGDG on membrane lateral fluidity via fluorescence anisotropy analyses with fluorescent probes. The text is well written.
I could not see Figs 1C and 1D: could this be fixed?
///RESPONSE/// We have inserted Fig.1 in a different format, now Figures 1C and 1D appear on pdf file as in original figure. We are submitting original Figures along with revision.
Editor's comments: Please check and revise all figure and table legends: they should state the number of independent experiments (or technical repeats) performed and the type of error bars shown (e.g. SD).
RESPONSE to Editor's comments ///The number of repeats and the error bar type have been stated in Figure legends///
Cover Letter
To: Dr. A. Nicolaou, Executive Editor BBA - Molecular and Cell Biology of Lipids
Dear Dr. A. Nicolaou,
please find enclosed revised manuscript by B. Zorin et al. entitled " Arachidonic acid is important for efficient use of light by the microalga Lobosphaera incisa under chilling stress ".
All comments have been addressed and requested amendments have been performed.
Yours sincerely,
Inna Khozin-Goldberg
Highlights (for review)
HIGHLIGHTS
ARA-deficient mutant of L. incisa is impaired in chilling tolerance.
Chilling acclimation leads to a decline chloroplast lipids and an increase in TAG.
MGDG fluidity is lower and violaxanthin cycle is always ‘on’ in the mutant.
High NPQ saves mutant from photodamage but impairs growth at chilling temperatures.
ARA is important but not crucial for chilling tolerance in L. incisa.
*REVISED Manuscript (text UNmarked) Click here to view linked References
Arachidonic acid is important for efficient use of light
by the microalga Lobosphaera incisa under chilling stress
Boris Zorina, Dipasmita Pal-Natha, Alexander Lukyanovb, Sviatlana Smolskayaa, Sofiya
Kolushevac, Shoshana Didi-Cohena, Sammy Boussibaa, Zvi Cohena, Inna Khozin-Goldberga*,
Alexei Solovchenkob*
aMicroalgal Biotechnology Laboratory, The French Associates Institute for Agriculture and
Biotechnology for Drylands, The J. Blaustein Institutes for Desert Research, Ben-Gurion
University of the Negev, Sede-Boqer Campus, Midreshet Ben-Gurion 84990, Israel
bDepartment of Bioengineering, Faculty of Biology, Moscow State University, GSP-1, Moscow
119234, Russia
cIlse Katz Institute for Nanoscale Science & Technology, Ben-Gurion University of the Negev,
Beersheba, Israel
Running title:
Arachidonic acid is important for low-temperature tolerance of L. incisa
*To whom correspondence should be addressed
E-mail: [email protected]
Phone: +972(8)656-34-78
E-mail: [email protected]
Phone: +7(495)939-25-87
2
ABSTRACT
The oleaginous microalga Lobosphaera incisa (Trebouxiophyceae, Chlorophyta) contains arachidonic acid (ARA, 20:4 n-6) in all membrane glycerolipids and in the storage lipid triacylglycerol. The optimal growth temperature of the wild-type (WT) strain is 25 °C; chilling temperatures (≤15 oC) slow its growth. This effect is more pronounced in the delta-5-desaturase
ARA-deficient mutant P127, in which ARA is replaced with dihomo-γ-linolenic acid (DGLA,
20:3 n-6). In nutrient-replete cells grown at 25 °C, the major chloroplast lipid monogalactosylglycerol (MGDG) were dominated by C18/C16 species in both strains. Yet ARA constituted over 10% of the total fatty acids in the WT MGDG as a component of C20/C18 and
C20/C20 species, whereas DGLA was only a minor component of MGDG in P127. Both strains increased the percentage of 18:3 n-3 in membrane lipids under chilling temperatures. The temperature downshift led to a dramatic increase in triacylglycerol at the expense of chloroplast lipids. WT and P127 showed a similarly high photochemical quantum yield of photosystem II, whereas non-photochemical quenching (NPQ) and violaxanthin de-epoxidation were drastically higher in P127, especially at 15 °C. Fluorescence anisotropy measurements indicated that ARA- containing MGDG might contribute to sustaining chloroplast membrane fluidity upon dropping to the chilling temperature. We hypothesize that conformational changes in chloroplast membranes and increased rigidity of the ARA-deficient MGDG of P127 at chilling temperatures is not compensated by trienoic fatty acids. This might ‘lock’ violaxanthin de-epoxidase in the activated state causing high constitutive NPQ and alleviate the risk of photodamage under chilling conditions in the mutant.
Keywords: chilling stress, dihomo-γ-linolenic acid, glycerolipid, long-chain polyunsaturated fatty acid, membrane fluidity, non-photochemical quenching
3
Abbreviations: ARA, arachidonic acid; Car, carotenoid; Chl, chlorophyll; DGDG, digalactosyldiacylglycerol; DGLA, dihomo-γ-linolenic acid; DGTS, diacylglyceryltrimethylhomoserine; DW, dry weight; EPA, eicosapentaenoic acid; FAD, fatty acid desaturase; LC-PUFA, long-chain polyunsaturated fatty acid; MGDG, monogalactosyldiacylglycerol; NPQ, Stern–Volmer non-photochemical quenching; PS, photosystem; SQDG, sulfoquinovosyldiacylglycerol; (T)FA, (total) fatty acids; TAG, triacylglycerol; VDE, violaxanthin de-epoxidase; WT, wild type; ZEP, zeaxanthin epoxidase.
HIGHLIGHTS
ARA-deficient mutant of L. incisa is impaired in chilling tolerance.
Chilling acclimation leads to a decline chloroplast lipids and an increase in TAG.
MGDG fluidity is lower and violaxanthin cycle is always ‘on’ in the mutant.
High NPQ saves mutant from photodamage but impairs growth at chilling temperatures.
ARA is important but not crucial for chilling tolerance in L. incisa.
4
1. Introduction
Physiological acclimation of organisms to environmental changes, specifically to low temperatures, requires rapid adjustments of critical cellular functions. This is achieved, in part, by retaining the overall level of membrane fluidity, thereby ensuring proper functioning of protein complexes, membrane transport, and lipid signaling [1, 2]. Numerous studies in cyanobacteria and higher plants have indicated the importance of fatty acid (FA) unsaturation level for low-temperature sensitivity or tolerance. Specifically, temperature-dependent adjustment of membrane fluidity maintains an environment suitable for the function of critical integral proteins, including photosynthetic electron carriers, translocators and ion channels [3-5].
Higher plant chloroplast lipids are generally enriched in trienoic FA (up to 70–80% of total acyl groups). High unsaturation level of the major chloroplast glycerolipids has been shown to be critical for functioning of the photosynthetic apparatus, prevention of photoinhibition at low temperatures [6-8], and regulation of chilling sensitivity in plants and cyanobacteria [9, 10].
FA composition and the unsaturation degree of the major thylakoid membrane lipid monogalactosyldiacylglycerol (MGDG), also play a crucial role in violaxanthin-cycle functioning, which offers photoprotection by dissipating the excess absorbed light energy as heat
[11-13]. Glycolipids constitute a major part of the ‘lipid shield’ surrounding violaxanthin de- epoxidase (VDE), the essential enzyme for operation of the cycle. MGDG also facilitates solubilization of the xanthophyll-cycle pigments, making them accessible to VDE (converting V to Z via A) and to zeaxanthin epoxidase (ZEP) catalyzing the reverse reaction of the cycle [14].
The unsaturation level of glycerolipids affects physicochemical properties of the membrane (fluidity, phase behavior, lipid dynamics) [15] and, in the case of photosynthetic membranes, the ability to cope with photoinhibition. Maintenance of a high unsaturation level of the chloroplast glycerolipids is imperative for the survival of unicellular microalgae in 5 permanently cold environments and under abrupt chilling stresses, especially on a background of fluctuating solar irradiance, salinity and nutrient availability [1-3, 16-19]. Thus, psychrotolerant polar diatoms feature a distinct increase in long-chain polyunsaturated FA (LC-PUFA, ≥20- carbon [C20] FA) [20], whereas the distribution of PUFA (C18 FA) in chlorophytes from arctic habitats is variable, depending upon other geographical and topological factors [21]. In these microalgae, PUFA seem to play a prominent role in protecting the membranes from rigidification or even solidification at low positive or freezing temperatures.
The function of FA desaturases (FAD) is implemented by different regulatory mechanisms. The activity of FAD might be regulated in response to temperature changes at the protein, transcriptional or post-transcriptional levels [1, 2, 4, 22, 23]. Furthermore, membrane- localized FAD may form functional complexes to exert their consequent activities, providing another mechanism of altering functionality. The short-lived endoplasmic reticulum (ER)- localized omega-3 FAD (FAD3) is regulated at the post-transcriptional level by both temperature-dependent changes in translational efficiency and modulation of protein half-life
[24]. Of note, transcriptional upregulation of desaturases involved in C18 PUFA biosynthesis has been reported in Antarctic chlorophytes at low temperatures [25].
Trienoic PUFA, such as hexadecatrienoic acid (16:3 n-3) and linolenic acid (18:3 n-3), are the major PUFA of chloroplast glycerolipids in higher plants and most of the evolutionarily close green microalgae [26]. Mutant studies in the cyanobacterium Synechocystis [3] and in
Arabidopsis thaliana [27] have illuminated the key role of FAD in maintaining the unsaturation level of chloroplast lipids during low-temperature acclimation. At the same time, there is only scarce information, from molecular and genetic studies, on the involvement of membrane lipids containing C20 and C22 LC-PUFA in low-temperature tolerance of photosynthetic microalgae.
The green microalga Lobosphaera incisa (formerly Parietochloris incisa) was isolated from water patches on the snowy slopes of the Tateyama mountain range [28], a habitat 6 characterized by swift changes in temperature, irradiance and nutrient availability. This microalga contains arachidonic acid (ARA, 20:4 n-6) at varied proportions in all membrane lipid classes and accumulates exceptionally high amounts of ARA in the storage lipid triacylglycerol
(TAG) under nitrogen starvation [29-31]. Upon abrupt short-term temperature downshift (from
25 °C to 4 °C), ARA shifts from TAG to the polar lipids, implying the significance of ARA depots in the provision of buffering capacity for the rapid increase in the membrane lipids' unsaturation level [29]. Furthermore, in response to nitrogen resupply, the nitrogen-depleted cells of L. incisa relocated a fraction of the ARA from TAG to MGDG and incorporated it into the eukaryotic-type 20:4 n-6/C18 PUFA molecular species, likely to boost the unsaturation level in chloroplast lipids and to support photosynthetic activity, as required for rapid growth recovery
[31]. Growth of the Δ5-desaturase mutant, which lacks ARA, was more affected at 10–15 °C than the wild type (WT), in agreement with substitution of ARA with the less unsaturated trienoic C20 PUFA dihomo-γ-linolenic acid (DGLA) (20:3 n-6) in cellular acyl lipids [32, 33].
In this report, we provide further insights into the importance of ARA for chilling tolerance and photosynthetic activity of L. incisa. We employed its Δ5-desaturase ARA-deficient mutant P127 (d5des) and a complemented strain with partially restored ARA biosynthesis, P2
(D5DES), to show that ARA-containing MGDG species are important for growth and efficient use of light under suboptimal lower temperatures and abrupt cold stress. Based on the results, we hypothesize that altered acyl group composition of the chloroplast membrane lipids is associated with constitutively elevated non-photochemical quenching (possibly mediated by permanently activated VDE) and impaired growth phenotype of P127 at suboptimal temperatures. 7
2. Materials and methods
2.1 Strain, cultivation conditions, and experimental design
The WT and d5des mutant P127 of L. incisa were obtained from the Microalgal
Biotechnology Laboratory, J. Blaustein Institutes for Desert Research, Ben-Gurion University.
The complemented strain, P2 (D5DES), was obtained by expression of a genomic copy of Δ5 desaturase as described in Zorin et al. [34]. The semi-continuous starter cultures of L. incisa were diluted every second day with fresh mBG11 [35] (to 10 μg mL–1 chlorophyll [Chl] and a dry weight [DW] of 0.5 mg mL–1) to supplement nutrients and maintain the cells in the exponential growth phase. For growth-curve determination (using Chl and DW contents) and FA profiling of total cell lipids and individual lipid classes, the WT and P127 strains were cultivated in 1-L glass columns (6.0 cm ID) placed in temperature-regulated water baths at 25 °C and 10
°C. The cultures were aerated by bubbling a mixture of 2% CO2 in air and illuminated with a set of cool white fluorescent lamps external to the water bath at a PAR of 170 µmol photon m–2 s–1
[29]. L. incisa forms cell clusters, making cell counting unattainable. For short-term cold stress experiments, the log-phase cultures (100 mL) in Erlenmeyer flasks (250 mL) were placed in an ice bath illuminated from the bottom at a PAR of 100 µmol photon m–2 s–1 with the same fluorescent lamps. For analysis of photosynthetic parameters and Stern–Volmer non- photochemical quenching (NPQ), the experiments were performed in Erlenmeyer flasks placed
–1 in an incubator shaker with CO2-enriched atmosphere (supplied at 200 mL min ) at 25, 10 or 4
°C. 8
2.2 Pigments analysis
Individual carotenoids (Car) were extracted and analyzed by HPLC according to a previously published protocol [36]. Briefly, the HPLC apparatus was comprised of a Prostar 240 solvent-delivery module and Prostar 330 photodiode-array detector (Varian Analytical
Instruments, Walnut Creek, CA, USA) and a C18 reverse-phase column (5 mm, 250 mm
Lichrosphere 100, Merck, Darmstadt, Germany). A system containing (A) acetonitrile:water
(85:12, v/v) and (B) ethylacetate was used for gradient elution of pigments. A flow rate of 1 mL min–1 and a two-step linear solvent gradient from 0 to 30% B (18 min), then from 30 to 100% B
(6 min), with a 6-min hold at the final concentration, was used. Pigments were identified and quantified using pure pigment standards (Sigma-Aldrich, St. Louis, MO, USA; Fluka,
Taufkirchen, Germany).
2.3 Chl a fluorescence recording and analysis
The rapid Chl fluorescence transient (OJIP) and NPQ levels were recorded in a quartz cell
(2 mm path length) with a Fluorpen FP100s PAM-fluorimeter (PSI, Drasov, Czech Republic) after 15 min dark adaptation according to the manufacturer’s protocol. The chlorophyll fluorescence was excited by a light-emitting diode (λ = 455 ± 5 nm) and detected in the range of
697–750 nm ([37, 38], see also Supplementary Table S1).
2.4 Measurement of photosynthetic oxygen evolution
9
Oxygen evolution by L. incisa under actinic irradiance increasing stepwise in the range
0–800 µE m–2 s–1 was monitored with a Clark-type oxygen electrode in the temperature- regulated chamber with a built-in computer-controlled LED light source (Chlorolab III;
Hansatech, King’s Lynn, Norfolk, UK) [39].
2.5 Fatty acid analysis
Fatty acid methyl esters (FAME) were obtained by direct transmethylation of freeze- dried biomass and isolated lipids in dry methanol containing 2% (v/v) H2SO4 at 80 °C for 1.5 h under argon atmosphere with continuous stirring. Heptadecanoic acid (C17:0) (Fluka, Buchs,
Switzerland) was added as an internal standard. The FAME were quantified on a Trace GC Ultra
(Thermo, Milan, Italy) equipped with a flame ionization detector (FID) and programmed temperature vaporizing injector as previously described [40].
2.6 Lipid extraction and analysis
Total lipids were extracted from the cells of the WT, P127 mutant and complemented strain P2 as previously described [41]. Briefly, 100 mg of freeze-dried cells were heated at 75 oC in the presence of 500 µL DMSO for 10 min under continuous stirring; 5 mL methanol was then added and extraction continued for 1 h at 4 oC under continuous mixing. DDW (5 mL) was added, followed by 10 mL of a hexane:diethyl ether mixture (1:2, v/v). Upon phase separation, the upper phase was collected, and the pH level of the bottom phase was adjusted to 3–4 by adding a few drops of 1 M HCl to facilitate extraction of acidic lipids. Extraction was repeated twice using a hexane:diethyl ether (1:1, v/v) mixture. All lipid fractions were collected and evaporated in a rotor vapor, transferred to a glass vial and stored under argon atmosphere in a 10 small volume of chloroform. This method recovers over 85% of total FA (TFA) compared to the direct transmethylation of dry biomass from L. incisa cells, which is impermeable to chloroform:methanol mixtures. All procedures were carried out in the presence of argon gas and under dimmed light to prevent oxidation of unsaturated lipids.
Total lipids were fractionated into neutral and polar lipids on silica cartridges (Bond
Elute, Agilent, USA). Polar and neutral lipid classes were resolved by TLC as previously described [41]. To visualize the lipid spots, TLC plates were briefly sprayed with 8-anilino-1- naphthalene-sulfonic acid (0.05 % w/v in methanol) (Sigma, St. Louis, MO, USA) and observed under UV light. Individual lipid spots were scraped off the TLC plate, and the FA content and composition were determined as their methyl esters by GC-FID. For qualitative assessment of molecular species distribution, galactolipids MGDG and digalactosyldiacylglycerol (DGDG) were extracted from the silica gel using several portions of chloroform:methanol (1:1, v/v) and subjected to matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
(MALDI-TOF-MS). Mass spectra were obtained on a Bruker Reflex-IV (Bruker Daltonic
GmbH, Bremen, Germany) TOF-MS operated in positive-ion reflection mode. The accelerating voltage, delayed extraction time, and laser power were adjusted to optimize sensitivity and resolution for ions between m/z 480 and 2300. The lipid samples, dissolved in chloroform, were spotted on a plate using a 2,5-dihydroxybenzoic acid (DHB) solution in methanol as the matrix.
2.7 Measurements of fluorescence anisotropy
The galactolipids MGDG and DGDG were isolated from the polar lipid fraction by 1D-
TLC using a solvent mixture of chloroform:methanol:water (65:25:4, v/v). The dried lipids were hydrated in 10 mM Tris-HCl buffer (pH 7.6) containing 50 mM NaCl, and sonicated on ice for
10 min with alternating cycles of 60 s sonication and 60 s stops until the suspension was 11 clarified. The galactolipid concentration in each sample was adjusted to 2 mg mL–1. Two fluorescent probes, 1,6-diphenyl 1,3,5-hexatriene (DPH) and 1-(4-(trimethylamino)phenyl)-6- phenylhexa-1,3,5-triene (TMA-DPH) (Sigma-Aldrich), were incorporated into the aqueous lipid dispersion by adding a 1 mM stock solution in tetrahydrofuran to a final concentration of 1.25
μM. Sonicated lipid suspensions were pre-incubated at the specified temperature (from 5 °C to
35 °C) for at least 10 min prior to measurement. Fluorescence anisotropy of DPH and TMA-
DPH was measured at 428 nm (excitation 360 nm) on an Edinburgh FL920 spectrofluorimeter
(http://www.edinst.com). Anisotropy values (r) were automatically calculated, recording the ratio of polarized components to the total intensity. Measurements were taken at least 10 times for each specified temperature.
2.8 RNA isolation, cDNA synthesis and gene cloning
Total RNA was isolated from the microalgal cells using a CV RNA isolation kit
(Promega, Madison, WI, USA); cDNA synthesis was performed with a Verso cDNA synthesis kit (Thermo scientific Lithuania) according to the manufacturer's instructions. Prior to the cDNA synthesis, total RNA was heated for 30 min at 65 °C to eliminate secondary structures.
2.8.1 Cloning ω3 desaturase for A. thaliana protoplast transformation
The LiFAD7 coding sequence was amplified from a cDNA template (WT, 25 °C) by PCR using the PfuUltra DNA polymerase (Stratagene, now Agilent) and the primers listed in
Supplementary Table S2. Two forward primers were designed to amplify the full-length and truncated (lacking 21 N-terminal amino acids) sequences, respectively. The PCR products were digested with BglII and ScaI and cloned into the BglII and ScaI sites of a pUC19-35S-GFP vector (kindly provided by Prof. G. Grafi, BGU) in-frame with GFP. The purified recombinant 12 plasmids were sequenced and used for transformation of A. thaliana protoplasts as described in
Iskandarov et al. [42] (see Supplementary material). After 24 h, protoplasts were inspected with a Zeiss confocal microscope (LSM 510 Meta) to capture in vivo localization of GFP signal. A
488-nm laser was used for the excitation of both eGFP and chlorophyll a, and the emitted fluorescent light was split using a NFT565 beam splitter and detected simultaneously in two channels with BP505-525 and LP650 filters, respectively.
2.8.2 Semi-quantitative PCR
RNA was isolated from the cultures grown in flasks at 25 °C and shifted to 10 °C for 7 days. RT-
PCR was carried out using cDNA, GoTaq Green Master Mix (Promega) and the gene-specific primers listed in Supplementary Table S2. PCR conditions were: initial denaturation of templates at 94 °C for 4 min, followed by 28 cycles of denaturation at 94 °C for 30 s, 30 s of primer annealing at 55 °C and 30 s of product synthesis at 72 °C, and a final extension at 72 ºC for 10 min.
2.8.3 Cloning putative VDE and ZEP
Two putative VDE and ZEP isoforms were cloned using L. incisa genomic sequence information
(https://giavap-genomes.ibpc.fr). PCR amplifications were carried out using cDNA as a template, high-fidelity Phusion Hot Start II DNA Polymerase (Thermo Scientific) and the oligonucleotide primers listed in Supplementary Table S2. Bands of the expected size were excised from the gel, eluted with AccuPrep Gel Purification Kit (Bioneer, Daejeon, Republic of
Korea) and sequenced on an Applied Biosystems (ABI) PRISM 3100 Genetic Analyzer.
13
2.9 Statistical treatment
The results of three independent experiments are presented in the figures. Where appropriate, averages and standard deviations of the mean were calculated and are displayed.
3. Results
3.1 Ablated Δ5 desaturation impairs growth at chilling temperature
The des5 mutant P127 was identified based on its compromised growth at 15 °C on a solid medium associated with the absence of ARA and its substitution with DGLA in all cell lipid classes [32]. In this report, we compared the growth patterns of the WT and the P127 mutant at 25 °C (the favored temperature for growth of both strains) and at a suboptimal temperature (10 °C). At 25 °C, the volumetric Chl content did not differ substantially between the strains, although a certain decrease was detected in the stationary-phase cultures of P127
(Fig. 1A). The biomass-accumulation pattern was also similar (Fig. 1B) with a maximal biomass of about 6.0 g L–1 by the end of the experiment. In contrast, a notable decline in growth rate (in terms of Chl and DW accumulation) was recorded in both strains at 10 °C as compared to 25 °C, although the WT performed somewhat better (Fig. 1A, B). 14
Fig. 1. Culture growth (A, B) at 25 °C (curves 1, 2) or 10 °C (curves 3, 4) and (C, D) changes in volumetric fatty acid content upon transfer to 10 °C of mid-exponential cultures of L. incisa wild type (WT) and its arachidonic acid-deficient mutant P127 grown at 25 °C. Data are shown as means of three independent experiments. Error bars (A and B) represent the standard deviation.
3.2 Effect of temperature downshift on total cell lipid FA profile of L. incisa WT and P127
Besides the replacement of ARA with DGLA, a distinctive feature of the cell lipid FA profile of the P127 mutant strain as compared to its parent strain, both grown at 25 °C, was a notable increase in the proportions (% of TFA) of oleic acid (18:1 n–9) and α-linolenic acid
(18:3 n–3) (Table 1).
Notably, a rare n–3 LC-PUFA (20:4 n–3) replaced eicosapentaenoic acid (EPA; 20:5 n-3) in the mutant strain, but both of the n–3 LC-PUFA were present in minor amounts in the strains studied. At 25 °C, the increased proportion of 18:1 n–9 in the mutant was particularly evident in 15 the stationary phase (day 7) and was accompanied by relatively steady proportions of 18:2 n–6 and 18:3 n–6 (Table 1). The maximal proportion of DGLA reached about 26% of TFA in the mutant, whereas ARA amounted to approximately 37% of TFA in the WT after 7 days of growth at 25 °C. Noteworthy were the higher proportions of C16 and C18 n–3 PUFA in the FA profile of the mutant. The maximal TFA content (% of DW) did not differ substantially between the strains (Table 1).
Table 1. Fatty acid profile and content in wild-type (WT) and mutant (P127) L. incisa cells grown at 25 °C .
Days Fatty acid (% of total) TFA 16:0 16:1 16:2 16:3 18:0 18:1 18:1 18:2 18:3 18:3 20:3 20:4 20:4 20:5 22:0 % n-9 n-7 n-6 n-6 n-3 n-6 n-6 n-3 n-3 DW WT 0 17.4 4.7 3.8 3.7 3.7 9.1 2.1 19.1 2.3 8.6 0.8 21.8 - 0.8 0.6 8.7 2 17.7 5.5 3.6 3.6 3.1 7.6 2.0 20.2 1.7 8.4 0.6 23.1 - 0.9 0.6 8.7 7 13.5 2.4 2.1 1.8 3.6 10.2 2.6 18.0 1.4 4.5 0.9 36.7 - 0.6 0.4 18.6 P127 0 16.6 4.0 3.1 5.2 2.6 13.3 2.1 17.7 2.8 12.9 16.8 - 0.9 - 0.6 8.6 2 16.3 4.0 2.3 5.5 2.4 14.7 2.3 16.4 2.3 12.7 18.1 - 1.1 - 0.6 9.9 7 13.2 2.5 1.8 2.3 2.8 18.7 2.8 18.6 1.7 6.7 26.0 - 0.7 - 0.5 18.8
Means of two independent experiments analyzed in two technical repeats are shown. All samples have less than 5% variation between the duplicates.
Two days after transfer to 10 °C, the main alterations in the TFA profiles of both strains consisted of an increase in the share of 18:1 n–9 and a concomitant decrease in that of 18:2 n-6, while the proportions of 18:3 n-3 tended to increase in both strains (Table 2). The proportions of the major LC-PUFA, ARA and DGLA, in the WT and P127, respectively, decreased slightly. A twofold increase in the proportion of 18:1 n-7 occurred in both strains, as well a noticeable rise in the proportion of strain-specific n-3 C20 LC-PUFA (Table 2).
Table 2. Dynamic of changes in the FA profilea,b and content of wild-type (WT) and mutant
(P127) L. incisa cells after growth temperature (T) downshift from 25 °C (day 0) to 10 °C 16
Fatty acid (% of total) TFA T Days (oC) 16:0 16:1 16:2 16:3 18:0 18:1 18:1 18:2 18:3 18:3 20:3 20:4 20:4 20:5 22:0 % n-9 n-7 n-6 n-6 n-3 n-6 n-6 n-3 n-3 DW WT 0 25 17.4 4.7 3.8 3.7 3.7 9.1 2.1 19.1 2.3 8.6 0.8 21.8 - 0.8 0.6 8.7 2 10 14.9 3.2 1.0 5.2 2.5 16.9 4.7 11.5 3.0 13.2 1.1 19.8 - 1.3 0.6 8.0 3 10 13.9 2.8 0.7 4.8 2.0 20.0 5.5 11.2 2.9 12.3 1.0 19.5 - 1.6 0.5 9.3 6 10 12.9 1.8 0.7 4.3 1.5 22.7 5.9 12.2 2.3 10.8 1.0 19.7 - 2.3 0.5 12.1 7 10 12.6 2.0 0.7 4.4 1.4 21.5 5.9 12.3 2.2 11.0 1.0 20.7 - 2.6 0.4 12.3 9 10 12.6 1.9 0.7 4.5 1.2 18.5 5.6 12.6 2.2 11.2 1.0 23.2 - 3.1 0.4 11.3 P127 0 25 16.6 4.0 3.1 5.2 2.6 13.3 2.1 17.7 2.8 12.9 16.8 - 0.9 - 0.6 8.6 2 10 14.4 3.0 0.9 5.8 2.1 22.3 4.0 11.4 3.0 14.6 15.3 - 1.3 - 0.6 8.6 3 10 13.9 2.8 0.7 4.8 1.9 26.6 4.7 11.0 2.7 12.9 14.7 - 1.5 - 0.5 9.8 6 10 12.9 2.2 0.5 4.1 1.5 31.7 5.2 11.2 2.2 11.0 13.8 - 1.9 - 0.4 12.5 7 10 12.4 2.0 0.5 3.9 1.5 32.4 5.3 11.4 2.1 10.7 14.1 - 2.1 - 0.4 13.2 9 10 12.2 1.8 0.5 4.1 1.3 31.6 5.2 11.4 2.0 11.0 14.5 - 2.4 - 0.4 11.9 a Fatty acids 20:0, 20:1, 20:2 made up less than 0.5%. b Means of two independent experiments analyzed in two technical repeats are shown. All samples have less than 5% variation between the duplicates.
A primary and conspicuous difference between the strains was greater enrichment in
oleic acid in P127 at 10 °C, exceeding the proportion of DGLA. In contrast, 18:1 n-9 and 20:4 n-
6 constituted a similar percentage of TFA in the WT cell lipids. Due to a substantial rise in the
relative proportion of 18:1 n-9, the volumetric accumulation of this FA increased markedly in the
mutant as compared to the WT (Fig. 1C, D). Moreover, volumetric production of oleic acid in
P127 dominated that of the other FA. The WT showed a similar pattern of 18:1 n-9 and ARA
accumulation in culture, indicating that both FA were produced at a similar rate upon transfer to
10 °C (Fig. 1C, D).
3.3 Effect of the temperature downshift on FA composition of major L. incisa lipid classes
Next, we examined the effects of growth temperature on the dynamics of changes in FA
composition of individual lipid classes in the WT and P127 mutant 3 and 6 days after transfer to 17
10 oC. The mid-log phase culture grown at 25 °C served as the control. We also quantified the
distribution of the major lipid classes using 2D-TLC coupled to acyl group quantification by GC-
FID.
3.3.1 Chloroplast lipids
At 25 °C, the major glycerolipid constituents of the chloroplast membrane—the
galactolipids MGDG and DGDG—contained high proportions of dienoic and trienoic C16 and
C18 PUFA in both L. incisa strains. At this temperature, the relative level of 18:3 n-3 in the
MGDG of P127 was higher than that in the WT, implying a predominance of 18:3 n-3/16:3 n-3
and 18:3 n-3/18:3 n-3 molecular species (Fig. 2A, B; Supplementary Fig. S1). ARA was present
at a greater percentage in the MGDG of the WT as compared to the DGLA percentage in the
mutant (17% vs. 4.5%, respectively). The apparent increases in the proportions of 18:3 n-3 and
18:1 n-7 noted in the chloroplast lipids were also seen in the extraplastidial lipids. Considerably
elevated levels of 18:1 n-7 were seen in PE of the WT, indicating that 18:1 n-7/20:4 n-6 took
over the 20:4/20:4 species [43] that seemed to decline at 10 °C, along with an overall decrease in
ARA. Another manifestation of the low-temperature response was a slight increase in the
proportion of n-3 LC-PUFA (EPA or 20:4 n-3 in the WT and P127, respectively).
WT
50 50 MGDG 2d 25oC MGDG 40 3d 10oC 40
30 6d 10oC 30
20 20
10 10 % of total fatty acids fattytotal of %
0 0
16:0 16:1 16:2 18:0
16:0 16:1 16:2 18:0
20:4n-6 16:3n-3 18:1n-9 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:3n-6 20:4n-3 20:5n-3
18:1n-9 20:3n-6 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:4n-6 20:4n-3 20:5n-3 16:3n-3 P127
18
60 60 DGDG DGDG 50 50 40 40 30 30 20 20
of total fatty acids fattytotal of 10 10 % %
0 0
0 1 2 0
: : : :
16 16 16 18
16:2 16:0 16:1 18:0
16:3n-3 18:1n-9 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 20:5n-3
18:3n-6 18:1n-9 18:1n-7 18:2n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 20:5n-3 16:3n-3 60 60 SQDG SQDG 50 50 40 40 30 30 20 20
10 10 % of total fatty acids fattytotal of %
0 0
16:1 16:0 16:2 18:0
16:0 16:1 16:2 18:0
16:3n-3 18:1n-9 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 20:5n-3
18:2n-6 18:1n-9 18:1n-7 18:3n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 20:5n-3 16:3n-3 50 50
PG PG 40 40
30 30
20 20
of total fatty acids fatty total of 10 10 % %
0 0
t t
3 3
Δ Δ
16:0 16:1 18:0 16:0 16:1 18:0
2 2
: :
20:5n-3 16:3n-3 18:1n-9 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 20:5n-3 16:3n-3 18:1n-9 18:1n-7 18:2n-6 18:3n-6 18:3n-3 20:3n-6 20:4n-6 20:4n-3 16 16
Fig. 2. Changes in fatty acid profiles of chloroplast lipid classes (indicated on each graph) of wild-type (WT) and arachidonic acid-deficient mutant (P127) L. incisa cells upon transfer to 10 °C. Means of three independent experiments each analysed in two analytical repeats are shown. Error bars represent the standard deviation.
The relative enrichment of trienoic FA in the MGDG of P127 occurred mainly at the
expense of DGLA. This finding was consistent with the results of MALDI-TOF MS analysis
demonstrating that P127 MGDG is composed mainly of 18:3/16:3 (34:6) molecular species, 19 while ARA-containing 20:4/18:2 (38:6) and 20:4/20:4 (40:8) MGDG species were abundant in the WT (Fig. S1). ARA-containing molecular species were also detected at higher percentages in the DGDG of the WT as compared to its DGLA-containing counterpart in the mutant
(Supplementary Fig. S2).
A drastic increase in the proportions of trienoic FA (16:3 n-3 and 18:3 n-3) at the expense of their respective precursors (16:2 n-6 and 18:2 n-6) occurred in the FA composition of MGDG in both in the WT and P127 in response to the temperature downshift. Notably, while 16:3 n-3 was a minor component of DGDG at the optimal temperature, it increased at 10 °C, along with an increase in the proportion of 16:3 n-3 in MGDG. The proportions of either ARA or DGLA decreased in the galactolipids of the two strains (Fig. 2). This decrease was more substantial in
MGDG as compared to DGDG, the latter containing ca. 11% ARA and 6% DGLA, respectively, after 6 days at 10 °C.
In agreement with the prominent role of 16:1 Δ3t in phosphatidylglycerol (PG) in response to low temperature in higher plants and algae, the relative share of this FA (in parallel to that of 18:3 n-3) increased dramatically in both strains at 10 °C (Fig. 2). Interestingly, the proportion of another monounsaturated C18 FA, 18:1 n–7, increased markedly in two acidic chloroplast glycerolipids, sulfoquinovosyldiacylglycerol (SQDG) and PG, with the biggest rise documented in SQDG (Fig. 2).
3.3.2 Extraplastidial polar lipids
Three membrane lipids—the betaine lipid diacylglyceryltrimethylhomoserine (DGTS) and the phospholipids phosphatidylcholine (PC) and phosphatidylethanolamine (PE)—are considered to be involved in ARA biosynthesis in L. incisa [29, 30]. PC and DGTS are likely substrates for the ∆6 desaturation of 18:2 n-6, whereas PE is mainly involved in the ∆5 desaturation of DGLA to ARA, the terminal step in ARA biosynthesis. A penultimate elongation 20 step mediated by ∆6 PUFA elongase connects the major lipids and the cytoplasmic pool of acyl-
CoAs. In agreement with our previous assumptions [29, 30], intermediates of ARA biosynthesis were seen in the respective lipid classes. As shown in Fig. 3, DGLA substituted ARA in PC, PE and DGTS.
At 25 °C, DGLA and ARA accounted for more than 40% of TFA in the PE of both strains. The cell response to the chilling temperatures was manifested in a marked decline in the proportion of ARA in PC, PE and DGTS of the WT, whereas in P127, the decline in the proportion of DGLA in these lipids was less pronounced. In the WT, a decrease in the ARA percentage in PC was accompanied by a commensurate increase in the proportion of γ-linolenic acid (18:3 n-6), indicative of a bottleneck at Δ6 elongation under suboptimal chilling temperature. Similar changes have been documented in the betaine lipid DGTS, which seems to share its function in ARA biosynthesis with PC [30]. Of note, a similar phenomenon was also observed in where 18:3 n-6 increased at the expense of 18:2, implying that the extraplastidial PG may also participate in lipid-linked Δ6 desaturation. Other mechanisms, such as phosphatidic acid (PA) or diacylglycerol-mediated exchange between extraplastidial lipids or acyl group remodeling, may be involved in concerted modifications at the membrane lipidome level as well.
Overall, these data indicate that exposure of both strains to 10 °C results in substantial modifications in the acyl group composition of plastidial and extraplastidial membrane lipids. A major response of the plastid lipids was enhanced ω-3 desaturation. The examined extraplastidial lipid classes in the WT were remodeled in favor of the species containing precursors of ARA biosynthesis. The low-temperature-induced ramifications were less prominent in P127 on the background of its intrinsically compromised Δ5 desaturation and reduced expression of the genes involved in ARA biosynthesis [33].
21
WT P127
Fig. 3. Changes in fatty acid profiles of extraplastidial lipids of wild-type (WT) and arachidonic acid-deficient mutant (P127) L. incisa cells upon transfer to 10 °C. Lipid classes are indicated on each bar graph. Means of three independent experiments are shown. Error bars represent the standard deviation. 22
3.3.3 TAG
At 25 °C, DGLA comprised ca. 27% (of TFA) in the TAG of P127, compared to 43% of
ARA in the TAG of the WT (Fig. 3); after 6 days at 10 °C, ARA and DGLA decreased to ca.
13% and 23%, respectively. The proportion of oleic acid (18:1 n–9) in TAG dramatically increased in both strains following the transfer to 10 °C. However, this increase was less conspicuous in P127 than in the WT (1.5-fold vs. >2-fold) as the TAG of P127 exhibited higher levels of 18:1 n–9 at 25 °C. Congruent changes (decrease and increase, respectively) in the proportions of 18:0 and 18:2 were recorded. Based on these data and the analysis of TFA production (Fig. 1C, D), it is conceivable that the observed accumulation of oleic acid in the cultures of both strains following the temperature shift occurred to a large extent due to TAG accumulation. Importantly, ARA accumulated in the WT TAG at the same rate as 18:1 n-9, whereas this pattern was not observed in the mutant where DGLA lag behind 18:1 n-9 ). The
TAG of both strains featured an increased share of n-3 FA and 18:1 n-7 at 10 °C, indicating a shared pool of these acyl groups between the polar lipids and TAG.
3.4 Subcellular localization of L. incisa ω-3 desaturase
The FA profiling of lipid classes showed that ω-3 desaturation is predominantly enhanced in the chloroplast lipids but is also apparent in the extraplastidial lipids. The L. incisa genome (https://giavap-genomes.ibpc.fr) encodes a single ω-3 desaturase, designated LiDES7 based on the similarity to a higher plant FAD7 engaged in plastidial desaturation of dienoic FA.
This in fact implies that LiFAD7 may desaturate both chloroplast and extraplastidial lipids, as posited for the Chlamydomonas homolog CrFAD7 [44]. The putative protein is predicted to be an integral membrane protein, featuring the characteristic three histidine boxes; it is most closely 23 related to ω-3 glyceroipid desaturases of green microalgae (Supplementary Figs. S3 and S4).
Different prediction algorithms (TargetP and ChloroP, available at http://www.cbs.dtu.dk/services, as well as Predalgo, https://giavap-genomes.ibpc.fr/cgi- bin/predalgodb.perl?page=main) inferred that LiFAD7 may possess a short chloroplast transit peptide. We cloned LiFAD7 (GenBank accession number KY499838) to assess its cellular localization in a well-developed heterologous system: A. thaliana protoplasts. A stable system for the expression of fluorescent proteins in L. incisa has yet to be established, although a transformation system for this organism has been developed in our laboratory [34]. We expressed the LiFAD7 fused to GFP at the C terminus using the plasmid vector pUC19-35S-GFP
(see section 2.8.1) to investigate its subcellular localization. As depicted in Fig. 4, using the plasmid construct expressing the full-length LiFAD7 (including 21 N-terminal amino acids predicted by ChloroP), the GFP signal did not overlap with the Chl autofluorescence but rather showed a punctate pattern at the chloroplast periphery.
24
Fig. 4. Confocal images of A. thaliana protoplasts expressing GFP fused to truncated (lacking 21
N-terminal amino acids; LiFAD7-21AA) and full-length LiFAD7.
This pattern became more apparent after N-terminal truncation of LiDES7. These data indicated that at least in a heterologous plant system, the mature protein encoded by LiFAD7 seems to be concentrated in certain domains of the chloroplast periphery, in proximity to both plastidial and extraplastidial lipids. We should note that A. thaliana FAD7 has a longer chloroplast transit sequence, hence the short pre-sequence of LiFAD7 might not be sufficient for proper spatial localization. Additional evidence of chloroplast localization of LiFAD7 should be derived upon stable expression in a photosynthetic host or in L. incisa to assign the cellular localization and function of this gene.
To evaluate gene-expression patterns of LiFAD7 as compared to the two previously characterized desaturases—LiDesD6 (GenBank accession number GU390532) and LiDesD5
(GenBank accession number GU390533)—involved in ARA biosynthesis [45], we performed semi-quantitative RT-PCR on cDNA synthesized from RNA (WT) sampled at 25 oC and again 1 week after transfer to 10oC. As shown in Fig. 5, none of the transcripts for the examined desaturases were upregulated upon transfer to 10 oC, with LiFAD7 showing rather stable expression in the WT and somewhat higher expression in P127. This finding is consistent with the above-described alterations in ARA biosynthesis for the individual lipid classes, indicating that ARA synthesis is not triggered during acclimation to chilling temperatures. 25
WT P127 10oC 25oC 10oC 25oC
LiFAD7
0.57 0.64 0.74 0.72 0.79 0.88 0.44 0.36
LiDES5
0.74 0.63 1.04 0.86 0.28 0.32 0.44 0.36
LiDES6
0.47 0.44 0.86 0.88 0.43 0.50 1.02 1.1 LiACT1
Fig. 5. Semi-quantitative RT-PCR analysis of L. incisa desaturase expression in wild-type (WT) and arachidonic acid-deficient mutant (P127) strains. Numbers below the lanes reflect the quantity of three L. incisa desaturases RT-PCR products relative to those of actin 1 (ACT1) after
30 cycles of amplification (processed using gel-imaging system). GenBank accession numbers:
LiFAD7 (KY499838); LiDES5 (GU390533); LiDES6 (GU390532); ACT1
(ACL81014).Representative experiment is shown.
3.5 Chilling stress promotes a decline in membrane lipids and formation of TAG
We also quantified the major lipid class distribution in the studied strains to further dissect the effect of the downshift to chilling temperatures. In the cells grown at 25 °C, MGDG and TAG accounted for ca. 25% of total acyl lipids in the WT and P127. Exposure to chilling temperature for 6 days promoted a drastic enrichment in TAG (up to 70% of total lipids). The 26 absolute (µg mg–1 DW) and relative contents of the membrane lipids declined during culture at
10 °C in both strains in favor of TAG formation (Fig. 6).
Fig. 6. Lipid class distribution upon transfer of L. incisa WT and arachidonic acid-deficient mutant (P127) to 10 °C. Exposure to chilling temperature promoted a drastic increase in triacylglycerol (TAG) at the expense of membrane lipids. See Abbreviations section for key. WT
(A) and P127 (B) at day 2 at 25oC; WT (C) and P127 (D) ─ 3 days after transfer to 10oC; WT (E) 27 and P127 (F) ─ 6 days after transfer to 10oC. Means of three independent experiments are shown.
On the background of augmented TAG formation, the relative proportion of MGDG and DGDG decreased to approximately 5% and 7% of total lipids (by day 3 and 6, respectively) in both strains. Three days after the transfer to 10 °C, chloroplast lipid (MGDG, DGDG, and SQDG) and
PE contents decreased markedly, while TAG became the dominant glycerolipid class in both strains (Fig. 6). This trend continued to day 6, indicating the significance of TAG formation for coping with chilling temperature stress.
3.6 ARA deficiency alters the fluidity of the isolated galactolipids
We also validated experimentally the potential impact of the observed changes in the LC-PUFA in the major galactolipids of L. incisa on their physicochemical properties. We isolated the galactolipids and determined the changes in fluorescence anisotropy of two fluorescent probes, DPH and TMA-DPH, in the hydrated resuspensions of MGDG and DGDG.
Changes in fluorescence anisotropy of these probes are associated with their rotational motion and hence to the unsaturation level and fluidity of the membrane [46] (Fig. 7, inserts).
In this part of the work, we included DES5-complemented strain P2 obtained previously by insertion of the genomic sequence of DES5 into the genome of P127 by electroporation [34].
Strain P2 features stable expression of DES5, partially restored ARA biosynthesis and reconstituted ARA content in the lipid classes. Unexpectedly, a prior analysis of lipid classes revealed that this strain lacks SQDG, seemingly as a consequence of a random plasmid DNA integration (the off-target effect) and disruption of one of the critical steps of SQDG biosynthesis. A slow growth phenotype of this transgenic line under favorable and low temperatures illuminated the central physiological role of SQDG but did not permit its comprehensive comparison with the other strains studied; nevertheless, it was suitable for the 28 characterization of isolated MGDG and DGDG (Fig. S5). The galactolipids were isolated from the three L. incisa lines grown in shaken flasks at 25 °C. These preparations were used to elucidate the effect of FA composition on fluorescence anisotropy in the relevant range of temperatures (from 2–5 °C to 30–35 °C).
MGDG DGDG
TMA-DPH 0.32 B TMA-DPH 0.35
0.30
0.30
0.28
0.25 0.26
0.20 WT M 0.24 A P2 0.15 0.22 5 10 15 20 25 30 34 0 5 10 15 20 25 30 35 0.22 DPH D DPH Anisotropy (a.u.) Anisotropy 0.24
0.20
0.20
0.18 0.16
0.16 C 0.12
5 10 15 20 25 0 5 10 15 20 25 30 Temperature (oC)
Fig. 7. Fluorescence anisotropy recorded in monogalactosyldiacylglycerol (MGDG) and digalactosyldiacylglycerol (DGDG) resuspensions from wild-type (WT) and arachidonic acid- deficient P127 mutant of L. incisa (A, B) using TMA-DPH probe and (C, D) using DPH probe.
Results of representative experiment are shown. Measurements were taken at least 10 times for 29 each specified temperature and means are shown. Error bars represent the standard deviation between the technical repeats.
30
The most remarkable difference between the fluorescence anisotropy of the sonicated
MGDG resuspensions was demonstrated using the polar probe TMA-DPH (Fig. 7A). The steady-state measurements conducted at 5 °C using MGDG isolated from the WT produced anisotropy values of 0.24 that did not change up to 25 °C. Phase transition, manifesting as a decrease in anisotropy values to ca. 0.17, occurred above 25 °C (the optimal growth temperature for L. incisa under laboratory conditions). In contrast, TMA-DPH anisotropy values in the
MGDG preparations from P127 were substantially higher than those of the WT, ca. 0.35 in the
5–20 °C range, suggesting lower mobility of the probe and hence lesser fluidity. Importantly, phase transition occurred in the P127-derived MGDG at a lower temperature than in that from the WT (Fig. 7). The anisotropy of TMA-DPH fluorescence in the MGDG from strain P2 featuring partially restored ARA content displayed an intermediate trend. The phase-transition temperature of the MGDG from both WT and P2 was close to the optimal growth temperature
(25 °C), but above this temperature, MGDG of P2 demonstrated higher anisotropy values, close to those of the MGDG from P127.
TMA-DPH probe localizes closer to the water–lipid interface in artificial liposomes.
Although MGDG is not a typical bilayer-forming lipid, the probe seems to sense the change in acyl-group ordering (indicative of higher fluidity) due to the presence of a double bond at the Δ5 position near the carboxyl end. The measurements carried out with the more hydrophobic probe
DPH revealed no substantial differences between the MGDG preparations from the examined strains. This might be due to the propensity of DPH to localize to a deeper part of the hydrophobic core, i.e., closer to the ω-end of FA chains where no difference between the two n–
6 LC-PUFA is expected (Fig. 7C, D).
In a temperature range of 5–20 °C, a similar but less pronounced difference between the strains was observed in DGDG liposomes (Fig. 7B, D), with the DGDG isolated from P2 also displaying intermediate values. However, unlike the DGDG from the WT and P2, the anisotropy 31 of TMA-DPH fluorescence in the DGDG liposomes from P127 demonstrated a monotonous decline with no detectable phase-transition point in a higher temperature range. In contrast, in the
DGDG from both WT and P2, the phase transition was evident at around 20 °C.
3.7 Effects of chilling stress on photosynthesis and photoprotection
To reveal the effects of the chilling stress on the light-use efficiency of the studied organisms as a function of temperature and ARA presence in the cell lipids, we compared a number of Chl fluorescence-based parameters (Supplementary Table S1; [47, 48]) in the cells grown at 25, 10 and 4 °C, as well as in the cells subjected to temperature downshift from 25 to 4
°C.
Under the favorable growth temperature (25 °C), potential maximum quantum yield of photosystem (PS) II, Fv/Fm (Fig. 8A), was 0.73 in the WT and 0.65 in P127, presumably indicating a higher level of non-photochemical quenching in the latter organism. Analysis of the irradiance response curves of photosynthetic O2 evolution (Fig. 8B–D) reflecting activity of the donor side of PS II and the sink capacity of dark enzymatic reactions, turned out to reveal more about the low-temperature stress effects on WT and P127 physiological condition. Under the favorable growth temperature, the photosynthetic capacity of the strains was similar, although the quantum yield of O2 evolution was twofold lower in P127 (Fig. 8B). As expected, growth under the chilling conditions brought about a temperature-dependent decline in net photosynthesis. This decline was more pronounced in P127 even though the saturating irradiance tended to be higher (Fig. 8D).
32
0.020 0.8 A B
0.016 0.6 E 6 0.012 3.0 0.4 0.008 2.5
0.2 0.004 4
evolution quantum yield
2
PS II max.quantum PSyield II O * 2.0 0.0 0.000 25 10 4 140 25 10 4
0.4 ) 5 -1
-1 D C s
-2 120 1.5 NPQ
0.3 m E
100
( Chl min Chl -1 1.0
80 3 mg 2 0.2 60 0.5 2
40 mmol O mmol
( 0.1 1
20 0.0 Pmax * Saturatingirradiance 10 100 1000 0.0 0 25 10 4 -- 25 10 4 Actinic PFD (E m-2 s-1) Growth t° (°C)
Fig. 8. Responses of L. incisa wild type (closed symbols and bars) and arachidonic acid-deficient mutant P127 (open symbols and bars) photosynthesis to long-term (7-day exposure) chilling stress. (A) Maximum photochemical quantum yield of PS II. (B) Photosynthetic O2 evolution quantum yield and (C) maximum rate. (D) Saturating light intensity. (E) Stern–Volmer non- photochemical quenching (NPQ) as a function of actinic irradiance. Data are shown as means of three biological replicates. Error bars represent the standard deviation.
We also observed a striking difference in the WT vs. P127 strains' thermal dissipation of absorbed light energy, as revealed by irradiance-induced buildup of non-photochemical quenching (estimated as Stern–Volmer NPQ, Supplementary Table S1) of Chl fluorescence (Fig.
8E). Regardless of the growth temperature and actinic irradiance, NPQ was higher in P127 than in the WT, and this difference was significantly more pronounced in the cultures grown at 10 °C 33 or 4 °C. Notably, the cultures of P127 displayed three to five times higher NPQ than those of the
WT under the growth irradiance (100 µmol photon m–2 s–1) evidencing a high level of constitutive (i.e., occurring even under favorable conditions) NPQ.
This response to chilling stress was accompanied by a consistent increase in violaxanthin de-epoxidation during cultivation at a chilling temperature (see representative data in Fig. 9). In
–2 –1 the cultures of the WT and P127 grown at 25 °С and irradiated with 100 µmol photon m s , de-epoxidation was roughly constant, remaining at 25% and 35%, respectively. At the same time, little, if any, difference in the size of the violaxanthin cycle Car pool was recorded between
P127 and WT in the first 2–3 days after the temperature downshift (see, e.g., Fig. 9, open symbols).
90
60
WT DE P127 DE WT VAZ
30 P127 VAZ DE (%) or VAZ (% of total Car) total of (% VAZ or (%)DE
0 12 24 36 48 60 72 Cultivation time (h)
Fig. 9. Representative trends of changes in violaxanthin de-epoxidation (DE, closed symbols) and violaxanthin cycle xanthophyll pool size (VAZ, open symbols) during the course of cultivation of L. incisa wild type (WT, squares) and arachidonic acid-deficient mutant P127 34
(circles) at 10 °C under 100 µmol photon m–2 s–1. Data are shown as means of three biological replicates. Error bars represent the standard deviation.
To gain insight into the role of ARA in L. incisa's acclimation to abrupt chilling stresses, we tested the effects of a temperature downshift from 25 °C to 0 °C (see Materials and Methods section). In these experiments, we also employed the complemented DES5 strain, P2. As in the case of cultivation at the chilling temperature, only a slight decline in the primary photochemistry of PS II was recorded upon abrupt temperature downshift (1 h of incubation at 0
°C). At the same time, the net photosynthesis measured as O2 evolution declined, to the level typical of cells grown at 4 °C (Fig. 8). These effects were also more pronounced in P127 than in the WT cells, whereas in P2 the effects of the cold treatment were at the level of the WT (Fig.
S6).
We further compared the induction of NPQ as a function of actinic irradiance in the cultures grown at 25 °C and cold-stressed at 0 °C under 100 µmol photon m–2 s–1 for 1 h (Fig.
10). The kinetics and amplitude of the actinic irradiance-induced NPQ buildup did not differ significantly between the WT and complemented DES5 strain, P2, in either the intact or cold- stressed cells (see squares and triangles in Fig. 10). In contrast, a rapid increase in NPQ occurred in the P127 cells, which was particularly rapid in the cold-stressed cells (circles in Fig. 10), reaching a level of 1, even at 150 µmol photon m–2 s–1. 35
2.0 control (25 °C) after 60' at 0 °C
1.6 WT WT P127 P127 P2 P2
1.2 NPQ 0.8
0.4 A B 0.0 0 300 600 900 1200 1500 0 300 600 900 1200 1500
-2 -1 PFD (E m s )
Fig. 10. Induction of non-photochemical quenching (calculated by Stern–Volmer approach,
NPQ) by increasing irradiances in the intact control (A) grown at 25 °C and (B) stressed for 1 h at 0 °C. Cells are of L. incisa wild type (WT, squares), arachidonic acid-deficient mutant P127
(circles) and the complemented strain P2 with partially restored ARA biosynthesis (triangles).
PFD, photon flux density. Data are shown as means of three biological replicates. Error bars represent the standard deviation.
3.8 L. incisa VDE and ZEP genes do not harbor mutations
We further tried to rule out possible mutations in the genes encoding the key enzymes of the violaxanthin cycle (VDE and ZEP), as the P127 mutant was obtained by random chemical mutagenesis. We cloned the cDNA sequences for genes encoding VDE and ZEP from P127 based on the L. incisa genome information (Tourasse et al. in preparation) and compared them to the same genes from the WT. In the L. incisa genome, we identified two putative VDE genes 36 positioned in tandem (GenBank accession numbers KY499834, KY499835) suggesting the importance of their function in the cell, as well as two putative ZEP genes (GenBank accession numbers KY499836, KY499837). Amplification and sequencing of the cDNA for those four genes did not reveal any mutations in P127, implying that genomic alterations within them were not responsible for the described effects on NPQ.
4. Discussion
Studies, using mutants, on the role of unsaturation level of membrane glycerolipids in acclimation to different environmental stresses are very rare in the LC-PUFA-producing microalgae. At the same time, a high abundance of LC-PUFA in the major chloroplast and extraplastidial membrane glycerolipids in various microalgal groups, though seldom in the green lineage, argues for their importance in maintaining membrane fluidity and chloroplast functionality in response to temperature fluctuations. The distribution of the planktonic LC-
PUFA-producing microalgae from diverse taxonomic groups does not seem to be related to temperate or cold environments, but many of these microalgae respond to a temperature decline by increasing the proportions of n–3 LC-PUFA [49-51]. Furthermore, mechanisms for coping with variable ambient temperatures may differ considerably in microalgae between ecological groups (e.g., planktonic, aero-terrestrial, etc.). Prevention of membrane rigidification at low temperatures by LC-PUFA has been shown to be particularly important for the survival of microalgae in permanently cold environments to sustain adequate photosynthetic activity [5].
We previously demonstrated in a short-term experiment (24 h) that a fraction of the ARA deposited in TAG in exponential-phase cells is shuffled to polar membrane lipids upon an abrupt decline in growth temperature to 4 °C [29]. The present study aimed to dissect the longer-term 37 role of ARA in the chilling response of L. incisa and to evaluate its impact on the fate of the light energy absorbed under chilling conditions.
4.1 Presence of ARA in glycerolipids is beneficial but not essential for growth of L. incisa at chilling temperatures
L. incisa is a rather rare representative of the Trebouxiophyceae and of the green algal lineage (Chlorophyta) in general, whose membrane and storage lipids contain high proportions of LC-PUFA [29, 52]. It was isolated from snow water samples taken in an alpine environment
[28]; it is therefore conceivable that enrichment of L. incisa cell lipids with ARA is somehow related to its low-temperature response and tolerance to fluctuating temperatures. Supporting this assumption, growth of the ARA-devoid mutant P127 is impaired at low temperature ([33], Fig.
1). Under mild chilling stress (10 °C), growth of the WT decreased, but more pronounced growth impairment was documented in P127. These data confirmed our previous findings that the absence of ARA and its replacement with DGLA render this strain more susceptible to chilling temperatures [13, 32]. This observation is consistent with the fact that the melting temperature of
ARA is lower than that of DGLA, as the absence of one double bond may influence physicochemical properties of membranes harboring the acyl groups with equal carbon-chain lengths, thereby impacting photosynthetic activity and growth rate. On the one hand, ARA deficiency indeed impaired growth at 10 °C; on the other, the growth of P127 at 10 °C was not halted or drastically inhibited. This implies that ARA is important but not essential for L. incisa acclimation to chilling temperatures. A similar conclusion was drawn in a study on desaturase mutants of the ARA-producing fungus Mortierella alpina: its DGLA-producing mutant only showed a defect in spore germination at 12 °C and a somewhat longer lag phase at both optimal and chilling temperatures [53]. The impact of reducing one double bond was studied in an EPA- 38 deficient mutant of the eustigmatophyte microalga Nannochloropsis sp. [54], where ARA substituted EPA in all lipid classes. EPA deficiency manifested itself by a change in the phase- transition temperature of the thylakoid membrane compared to that determined for the WT (17
°C for the ARA-rich mutant and 10 °C for the WT) [54]. In addition, the mutant grew more slowly than the WT and exhibited substantially altered ultrastructure and distribution of membrane lipid classes, and a reduction in cellular photosynthetic capacity [55].
The phenomenon of EPA abundance and its significance for low-temperature adaptation have been intensively studied in psychrophilic deep-water marine bacteria, but the results were controversial. EPA was shown to be important for low-temperature tolerance in only a few species, for example, Shewanella livingstonensis [56, 57], whereas in some other cold-adapted deep-sea bacteria, EPA deficiency could be complemented by monounsaturated FA [58].
Interestingly, in addition to 18:1 n-9, L. incisa increased the levels of monounsaturated vaccenic acid 18:1 n-7 in response to decreasing temperature, implying the potent role of this modification in low-temperature tolerance. Notably, the boiling point of 18:1 n-7 differs by almost 20 °C from that of the common isomer oleic acid 18:1 n-9.
Regulation of membrane fluidity by modifying the unsaturation levels of plastidial glycerolipids is among the main strategies for coping with the impacts of low temperature on chloroplast membranes [15, 23]. A major lipid of the chloroplast membrane, MGDG, is not a bilayer-forming lipid in the hydrated state when present alone; rather, it tends to form non- lamellar inverted hexagonal (HII) structures [59]. This property is associated with a high content of highly bent PUFA introducing curvature and a relatively small-sized headgroup (a single galactose group). It is distinct in this regard from DGDG, which is a typical bilayer-forming lipid owing to a bigger headgroup and a generally lower level of FA unsaturation [60]. Both MGDG and DGDG are major components of thylakoids and PS I and II, so their acyl group composition influences the spatial organization of photosynthetic complexes and their ratio is of critical 39 importance for bilayer stabilization in vivo. Our comparative study of fluorescence anisotropy emphasized the importance of the ARA-containing MGDG species for maintaining an adequate level of fluidity upon transfer to chilling temperature. It is conceivable that these MGDG species provide a suitable fluid microenvironment and an appropriate membrane conformation for functioning of the (integral) membrane proteins. We found a substantial difference between the
MGDG of the WT and P127 in terms of phase-transition temperature and overall fluidity over a wide range of temperatures when the galactolipids were isolated from the cells grown at 25 °C.
Interestingly, this was not the case in the JS 1 mutant of Nannochloropsis sp., where ARA supplanted EPA. The mutant revealed no alterations in fluorescence anisotropy of MGDG, but a difference in the phase-transition temperature was detected [54].
Remarkably, the primary effect of chilling growth temperatures in this study was an increase in C18 trienoic FA in the total cellular lipids, as well as in individual lipid classes of the
WT and P127. This might not be surprising since, aside from the presence of ARA, the chloroplast lipid composition of L. incisa is very similar to that of the typical green microalgae, which rarely contain LC-PUFA in their glycerolipids, and whose acyl group composition is generally dominated by C16 and C18 PUFA [61]. However, LC-PUFA are present in various terrestrial and freshwater species of green algae [52].
There is a large body of evidence of the pivotal role of trienoic FA in chilling tolerance in cyanobacteria and higher plants. The absence of trienoic FA renders the photosynthetic process highly vulnerable to stress [27]. In contrast, genetic enhancement of unsaturation level by recombinant expression of ω-3 desaturase results in enhanced tolerance to chilling temperatures in higher plants [62-64]. A deteriorative effect of decreased trienoic FA levels on photosynthetic parameters under short-term heat stress was demonstrated in an ω-3 desaturase mutant of the green microalga Chlamydomonas reinhardtii [44]. In line with those findings, the share of 16:3 and 18:3 along with n-3 C20 PUFA, either EPA or 20:4 n-3, increased in L. incisa at 10 °C, 40 indicating the involvement of enhanced ω-3 desaturation in the chilling temperature acclimation regardless of the presence of ARA.
We previously surmised that at favorable temperatures, the ARA-devoid mutant compensates for the decreased level of unsaturation in the chloroplast lipids by enhancing ω-3 desaturation and increasing the production of C16 and C18 PUFA [32]. This assumption was confirmed in the present work by the analysis of molecular species of MGDG at 25 °C, which revealed enrichment of 18:3/16:3 MGDG in P127. A plausible explanation for the reduced content of C20/C18 MGDG is that import of LC-PUFA from the extraplastidial compartment to chloroplastic lipids is ablated in the mutant. The molecular mechanisms require further insight, but this alteration seems to correlate with the impaired chilling temperature tolerance. Hence, the slower growth of the mutant at 10 °C and the lack of ARA in both MGDG and DGDG argue for the benefit of ARA in chloroplast lipids for chloroplast function at decreased temperatures. At the same time, the results of the FA profiling of the key lipid classes of L. incisa showed that the trienoic FA are obviously as important as LC-PUFA at the chilling temperature. These findings are consistent with a well-documented key role of trienoic PUFA in the maintenance of chloroplast membrane fluidity at low temperatures and pinpoint the impact of low temperature on the substrate preference of DGDG synthase, which seems to utilize unsaturated MGDG species under these conditions.
A single copy of ω-3 desaturase is found in the L. incisa genome, implying that this enzyme can desaturate both C18 and C20 acyl substrates bound to chloroplast and extraplastidial membrane lipids. A single ω-3 desaturase gene can be found in many sequenced green microalgal genomes, whereas higher plants have distinct chloroplast and microsomal (ER- localized) isoforms due to a later evolutionary event that resulted in gene duplication. It has been suggested, using a mutant of C. reinhardtii, that a single desaturase can accomplish ω-3 desaturation in both chloroplast and endomembrane lipids [44]. We showed that expression of 41 the ω-3 desaturase gene is not upregulated in response to a temperature decrease, in line with ample evidence on post-translational and post-transcriptional regulation of ω-3 desaturation activity at chilling temperatures in higher plants [65]. Further studies are required to study genome-wide transcriptome alterations by chilling temperatures in L. incisa. Our data also indicate that at low temperature, the 18:3/16:3 MGDG is converted to DGDG, reminiscent of a known phenomenon in higher plants implicated in freezing tolerance and galactolipid remodeling in the outer chloroplast envelope membrane—removal of MGDG accompanied by
TAG generation [66].
4.2 Temperature downshift provokes a decline in membrane glycerolipids and buildup of TAG
Cell transfer to the chilling temperature was accompanied by a marked decrease in the amount of all membrane lipids, with MGDG removal from the chloroplast membranes as the most prominent change, and a marked increase in TAG. The remaining galactolipids (MGDG and DGDG) were highly enriched in trienoic PUFA, suggesting the latter's importance for acclimation of the photosynthetic apparatus to chilling temperatures. A decline in the growth temperature brought about an increase in the ratio of bilayer-forming to non-bilayer-forming lipids (DGDG to MGDG), implying the significance of the latter for membrane stability under stress. Importantly, along with the enhanced proportions of trienoic FA, DGDG contained substantial amounts of ARA or DGLA in the WT and P127, respectively. In view of the substantial increase in 16:3 in DGDG (which was nearly lacking in DGDG at 25 °C), it is conceivable that the conversion of 18:3/16:3 MGDG to DGDG is enhanced following the transfer to chilling temperature, similar to the freezing response described in higher plant cells
[67]. The conversion of MGDG to DGDG by the transfer of a galactosyl group from one MGDG molecule to another removes the highly bent MGDG, thereby stabilizing the chloroplast 42 envelope membrane, and simultaneously releasing diacylglycerol that can be used for the synthesis of TAG enriched in chloroplast-derived FA. A similar mechanism has been widely discussed as an important contributor to TAG formation in microalgae [68].
The exposure to low temperature did not seem to enhance ARA biosynthesis; on the contrary, adjustments to low temperature seemed to curtail ARA biosynthesis in the extraplastidial lipids, where the precursors of ARA accumulated. A drastic increase in the proportion of 18:1 n-7 at the chilling temperature was documented in SQDG, PE and some other polar lipids, as well as in TAG, of both strains. The production of this FA markedly increased at
10 °C pointing to its significance for maintaining unsaturation level at decreased temperatures.
PE of the WT is comprised of two major acyl group combinations, 20:4/20:4 and 18:1 n-7/20:4
[43], so it seems that formation of the latter species is enhanced at low temperature. Another monounsaturated FA, 16:1Δ3t, markedly increased in PG, in line with the known role of this FA in low-temperature acclimation of plants [23]. It is conceivable that these FA affect the phase- transition temperature of the membrane lipids at low positive temperatures. These findings indicate that, apart from the apparent enhancement of ω3 desaturation, L. incisa deploys additional mechanisms for remodeling of acyl group composition of its glycerolipids to fluidize its cell membrane. The biosynthetic pathway leading to accumulation of 18:1 n-7, a potent fluidizer, in SQDG and PG under low temperature, as well as in other extraplastidial lipids (see below), remains to be elucidated.
An increase in TAG, congruent with the most pronounced decrease in MGDG, comprised the major change in lipid composition associated with the growth temperature decline. The net generation of TAG exceeded the decline in membrane lipid content, implying that de novo TAG biosynthesis contributed to this phenomenon. In agreement with this premise, a salient marker of neosynthesized TAG, 18:1 n-9, increased in both strains. The mutant demonstrated elevated 18:1 production under normal and low temperatures that could be explained by the concerted 43 downregulation of gene expression in the entire biosynthetic pathway [33]. In contrast to nitrogen starvation stress, the chilling temperature stress did not cause dramatic accumulation of
ARA, but sustained ARA production occurred in the WT. Overall, these results demonstrate that intensive TAG formation and modification of membrane lipid composition occurred in the cultures transferred to a suboptimal temperature of 10 °C. Membrane lipid turnover seemed to contribute a fraction of the total TAG pool, although it is likely that the bulk of the TAG accumulated in response to the chilling stress was synthesized de novo.
Reorganization of lipid metabolism (reduction in chloroplast lipids together with TAG buildup) along with growth retardation by the chilling temperature reflect the acclimatory changes aimed, in particular, at mitigating the risk of photooxidative damage.
4.3 ARA-containing MGDG are crucial for swift regulation of the violaxanthin cycle and hence for efficient use of light at low temperatures
Higher plants cope with low temperature by employing a multitude of mechanisms that integrate modifications into the transcriptome, metabolome and lipidome, as well as into regulatory and signaling responses [69]. Mutant studies in higher plants and cyanobacteria have indicated that a decline in membrane lipid FA unsaturation increases the vulnerability of photosynthetic organisms to photoinhibition [3], and this is exacerbated at low temperatures [5].
A common adjustment of plastid membrane lipids in higher plants and green microalgae to low temperature is an increased share of trienoic acids (C16 and C18 PUFA) [27]. Thus, replacement of polyunsaturated FA by monounsaturated FA in the membrane lipids causes a significant drop in tolerance to low-temperature photoinhibition [16].
An extensive body of evidence supports the relationship between membrane lipid FA unsaturation and PS II photoinhibition, but reports on the significance of FA unsaturation level 44 for quenching-related responses are more scarce. Krumova et al. [12] suggested that a major non-bilayer-forming lipid, MGDG, plays a key role in self-regulating the protein content of membranes and forms a non-bilayer lipid phase associated with the bilayer membrane and/or partially replacing it [11]. This evidence is consistent with the idea that low-temperature stress inhibits the repair of damaged PS II, slowing reinsertion of the newly synthesized D1 protein and leading to enhanced PS II photoinhibition [6].
The observed decrease in chloroplast lipids implied a reduction in the photosynthetic apparatus, which is compatible with the observed dynamics of Chl content and decreased Chl content of the cell biomass. Increased level of trienoic ω-3 PUFA in chloroplastic lipids and ω-6
γ-linolenic acid in extraplastidial membrane lipids was associated with the observed trends in
Chl dynamics. Admittedly, there is a considerable gap in our knowledge of the relationship between chloroplast membrane lipid unsaturation (especially lipids containing highly unsaturated
FA) and the operation of different photoprotective mechanisms, including different forms of
NPQ. At the same time, there is a large body of evidence linking membrane lipid composition and photosynthesis, mainly for higher plants (predominantly Arabidopsis) and cyanobacteria
[70]; however, the information available for eukaryotic microalgae is scarce and fragmented.
In this work, we obtained conclusive evidence of substitution of ARA by DGLA rendering L. incisa and, in particular, its photosynthetic apparatus, vulnerable to chilling stress.
The most deleterious effect was observed under long-term exposure to low positive temperatures, obviating an important role for ARA in thylakoid membrane functioning, particularly in the engagement and disengagement of photoprotective mechanisms. A striking feature of the ARA-deficient mutant of L. incisa, P127, was its elevated level of NPQ on the background of decreased fluidity of the major chloroplast membrane component MGDG (Fig.
7), and enhanced de-epoxidation of violaxanthin (Fig. 9), especially evident at chilling 45 temperatures. Notably, a similar role for EPA (C20:5) enrichment in MGDG in the regulation of
NPQ has been recently suggested in Nannochloropsis [71].
Since the genes encoding VDE and ZEP in L. incisa harbored no mutations, we believe that these phenomena can be understood in the framework of the currently accepted model explaining the dependence on MGDG of xanthophyll de-epoxidation in thylakoid membranes of higher plants outlined in a recent review by Garab et al. [14]. Briefly, high irradiance promotes disconnection and aggregation of light-harvesting complex II (LHC II) in the thylakoid membranes and the MGDG molecules surrounding the LHC II dissociate and form non-bilayer phases. The non-bilayer membrane regions attract VDE which forms a dimer upon its activation via acidification of the thylakoid lumen. This process facilitates the conversion of violaxanthin to zeaxanthin, eventually increasing NPQ. It is conceivable that reduced fluidity (increased rigidity) of MGDG due to the absence of ARA might result in retention of the non-bilayer-forming
MGDG near LHC II, especially under chilling temperatures, thereby ‘locking’ VDE in an activated state. This suggestion is compatible with enhanced accumulation of zeaxanthin in
P127. On the one hand, permanently high NPQ might result in starvation of light energy in the mutant and hence in its retarded growth. On the other, the exaggerated NPQ response might save it from photodamage by high light under chilling conditions. Indeed, judging from pigment and lipid content and composition, as well as from the photosynthetic activity, the mutant displayed no signs of photodamage of thylakoid membranes at 10 oC.
It is important to emphasize in this regard that the parameters related to photochemical quenching, e.g., quantum yield of PS II measured in the dark-adapted state, did not differ significantly (Fig. 8); the impact of cold stress on photosynthesis in P127 was only apparent in the light-adapted state. This is similar to the effect of the fad6 mutation in Arabidopsis, which has no detectable effect on its photosynthesis under optimal growth conditions. Therefore, one can conclude that the L. incisa P127 cells lacking ARA in the membrane lipids essentially retain 46 their potential photosynthetic capacity, whereas their ability to efficiently cope with excess light, especially under a combination of stresses, is obviously impaired [38].
Notably, the elevated NPQ response was not recorded in the complemented strain P2, which resembled the WT in this regard. This finding strongly suggests that the observed deteriorative effects of chilling temperature are specifically related to the presence of ARA in the membrane lipids, MGDG in particular. In addition, the virtual absence of SQDG in P2 did not interfere with complementation of ARA-dependent features of NPQ regulation. Taken together, these observations further support ARA as the key acyl component of MGDG conferring tolerance to the combination of chilling and high light in L. incisa.
The minor inconsistencies between the photosynthetic responses of P2 and the WT can be putatively ascribed to the pleiotropic effect(s) of loss of the ARA mutation and transformation consequences of P2. Hopefully, this question will be answered in the future by (re)sequencing of the P127 genome, more detailed lipidomics and transcriptomics analyses of both strains' responses.
5. Conclusion
A complex of acclimation mechanisms accounts for survival of L. incisa under the harsh conditions of its natural habitats. Our findings indicate the significance of (i) modulation of the membrane lipid FA composition and unsaturation, (ii) versatile regulation of thermal dissipation of the absorbed light, and (iii) formation of a potent sink for the excess photosynthates. Trienoic
PUFA seem to play a major role in the homeoviscous adaptation of L. incisa membranes to the chilling stress, whereas ARA in this microalga is likely responsible for modulation of the VDE activity via fine-tuning of its lipid microenvironment properties.
47
ACKNOWLEDGEMENTS
This research at MBL was financially supported in part by the European Commission's Seventh
Framework Program for Research and Technology Development (FP7), project GIAVAP (grant number 266401) and by a grant from the Ministry of Science, Technology and Space, Israel & the Russian Foundation for Basic Research, the Russian Federation (grant number 15-54-06004 to IKG, SB and AS). BZ and DP acknowledge support from the Kreitman School of Advanced
Graduate Studies at Ben-Gurion University. BZ acknowledges support from the Israeli Ministry of Absorption. The dedicated technical help of Dr. Konstantin Chekanov is gratefully acknowledged. The studies on photosynthetic activity were funded by the Russian Science
Foundation (grant number 14-50-00029). We are thankful to Olivier Vallon and Nicolas
Tourasse from the Institut de Biologie Physico-Chimique, University Pierre et Marie Curie
(CNRS), France, for their dedicated work on the assembly and analysis of the L. incisa genome.
The authors declare that they have no conflict of interest.
REFERENCES
[1] R. Upchurch, Fatty acid unsaturation, mobilization, and regulation in the response of plants to stress, Biotechnol. Lett, 30 (2008) 967-977. [2] R. Morgan-Kiss, J. Priscu, T. Pocock, L. Gudynaite-Savitch, N. Huner, Adaptation and acclimation of photosynthetic microorganisms to permanently cold environments, Microbiol. Mol. Biol. Rev., 70 (2006) 222-252. [3] D.A. Los, N. Murata, Membrane fluidity and its roles in the perception of environmental signals, Biochimica et Biophysica Acta (BBA)-Biomembranes, 1666 (2004) 142-157. [4] D.A. Los, K.S. Mironov, S.I. Allakhverdiev, Regulatory role of membrane fluidity in gene expression and physiological functions, Photosynth. Res., 116 (2013) 489-509. [5] T. Mock, B.M. Kroon, Photosynthetic energy conversion under extreme conditions—II: the significance of lipids under light limited growth in Antarctic sea ice diatoms, Phytochem., 61 (2002) 53-60. 48
[6] Z. Gombos, E. Kanervo, N. Tsvetkova, T. Sakamoto, E. Aro, N. Murata, Genetic enhancement of the ability to tolerate photoinhibition by introduction of unsaturated bonds into membrane glycerolipids, Plant Physiol., 115 (1997) 551-559. [7] N. Mizusawa, H. Wada, The role of lipids in photosystem II, Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1817 (2012) 194-208. [8] J.-M. Routaboul, S.F. Fischer, Trienoic fatty acids are required to maintain chloroplast function at low temperatures, Plant Physiol., 124 (2000) 1697-1705. [9] I. Nishida, N. Murata, Chilling sensitivity in plants and cyanobacteria: the crucial contribution of membrane lipids, Annu. Rev. Plant Biol., 47 (1996) 541-568. [10] D. Los, K. Mironov, S. Allakhverdiev, Regulatory role of membrane fluidity in gene expression and physiological functions, Photosynth. Res., (2013) 1-21. [11] G. Garab, Hierarchical organization and structural flexibility of thylakoid membranes, Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1837 (2014) 481-494. [12] S.B. Krumova, C. Dijkema, P. de Waard, H. Van As, G. Garab, H. van Amerongen, Phase behavior of phosphatidylglycerol in spinach thylakoid membranes as revealed by 31 P-NMR, Biochimica et Biophysica Acta (BBA)-Biomembranes, 1778 (2008) 997-1003. [13] S. Schaller, D. Latowski, M. Jemioła-Rzemińska, C. Wilhelm, K. Strzałka, R. Goss, The main thylakoid membrane lipid monogalactosyldiacylglycerol (MGDG) promotes the de- epoxidation of violaxanthin associated with the light-harvesting complex of photosystem II (LHCII), Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1797 (2010) 414-424. [14] G. Garab, B. Ughy, R. Goss, Role of MGDG and non-bilayer lipid phases in the structure and dynamics of chloroplast thylakoid membranes, in: Lipids in Plant and Algae Development, Springer, 2016, pp. 127-157. [15] M. Chen, J.J. Thelen, ACYL-LIPID DESATURASE2 is required for chilling and freezing tolerance in Arabidopsis, The Plant Cell, 25 (2013) 1430-1444. [16] J.R. Hazel, E.E. Williams, The role of alterations in membrane lipid composition in enabling physiological adaptation of organisms to their physical environment, Progress in lipid research, 29 (1990) 167-227. [17] J.R. Hazel, Thermal adaptation in biological membranes: is homeoviscous adaptation the explanation?, Annual review of physiology, 57 (1995) 19-42. [18] I.A. Guschina, J.L. Harwood, Mechanisms of temperature adaptation in poikilotherms, Febs Letters, 580 (2006) 5477-5483. 49
[19] B.R. Lyon, T. Mock, Polar microalgae: new approaches towards understanding adaptations to an extreme and changing environment, Biology, 3 (2014) 56-80. [20] M.-L. Teoh, W.-L. Chu, H. Marchant, S.-M. Phang, Influence of culture temperature on the growth, biochemical composition and fatty acid profiles of six Antarctic microalgae, J. Appl. Phycol., 16 (2004) 421-430. [21] E. Spijkerman, A. Wacker, G. Weithoff, T. Leya, Elemental and fatty acid composition of snow algae in arctic habitats, Frontiers in Microbiology, 3 (2012). [22] K.S. Mironov, R.A. Sidorov, M.S. Trofimova, V.S. Bedbenov, V.D. Tsydendambaev, S.I. Allakhverdiev, D.A. Los, Light-dependent cold-induced fatty acid unsaturation, changes in membrane fluidity, and alterations in gene expression in Synechocystis, Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1817 (2012) 1352-1359. [23] K. Iba, Acclimative response to temperature stress in higher plants: approaches of gene engineering for temperature tolerance, Annu. Rev. Plant Biol., 53 (2002) 225-245. [24] J.B. O'Quin, L. Bourassa, D. Zhang, J.M. Shockey, S.K. Gidda, S. Fosnot, K.D. Chapman, R.T. Mullen, J.M. Dyer, Temperature-sensitive post-translational regulation of plant omega-3 fatty-acid desaturases is mediated by the endoplasmic reticulum-associated degradation pathway, Journal of Biological Chemistry, 285 (2010) 21781-21796. [25] P. Zhang, S. Liu, B. Cong, G. Wu, C. Liu, X. Lin, J. Shen, X. Huang, A novel omega-3 fatty acid desaturase involved in acclimation processes of polar condition from Antarctic ice algae Chlamydomonas sp. ICE-L, Marine biotechnology, 13 (2011) 393-401. [26] I.A. Guschina, J.L. Harwood, Algal Lipids and Their Metabolism, in: M.A. Borowitzka, N.R. Moheimani (Eds.) Algae for Biofuels and Energy, Springer, Dordrecht, Heidelberg, New York, London, 2013, pp. 17-36. [27] J.-M. Routaboul, C. Skidmore, J.G. Wallis, Arabidopsis mutants reveal that short-and long- term thermotolerance have different requirements for trienoic fatty acids, Journal of experimental botany, (2011) err381. [28] S. Watanabe, S. Hirabayashi, S. Boussiba, Z. Cohen, A. Vonshak, A. Richmond, Parietochloris incisa comb. nov.(Trebouxiophyceae, Chlorophyta), Phycol. Res., 44 (1996) 107- 108. [29] C. Bigogno, I. Khozin-Goldberg, Z. Cohen, Accumulation of arachidonic acid-rich triacylglycerols in the microalga Parietochloris incisa (Trebuxiophyceae, Chlorophyta), Phytochem., 60 (2002) 135-143. 50
[30] C. Bigogno, I. Khozin-Goldberg, S. Boussiba, A. Vonshak, Z. Cohen, Lipid and fatty acid composition of the green oleaginous alga Parietochloris incisa, the richest plant source of arachidonic acid, Phytochem., 60 (2002) 497-503. [31] I. Khozin-Goldberg, P. Shrestha, Z. Cohen, Mobilization of arachidonyl moieties from triacylglycerols into chloroplastic lipids following recovery from nitrogen starvation of the microalga Parietochloris incisa, BBA-Molecular and Cell Biology of Lipids, 1738 (2005) 63-71. [32] Z. Cohen, I. Khozin-Goldberg, Searching for PUFA-rich microalgae, in: Z. Cohen, C. Ratledge (Eds.) Single Cell Oils, American Oil Chemists’ Society, Champaign IL, 2010, pp. 201-224. [33] U. Iskandarov, I. Khozin-Goldberg, Z. Cohen, Selection of a DGLA-producing mutant of the microalga Parietochloris incisa: I. Identification of mutation site and expression of VLC- PUFA biosynthesis genes, Appl. Microbiol. Biotechnol., 90 (2011) 249-256. [34] B. Zorin, O. Grundman, I. Khozin-Goldberg, S. Leu, M. Shapira, Y. Kaye, N. Tourasse, O. Vallon, S. Boussiba, Development of a Nuclear Transformation System for Oleaginous Green Alga
[40] D. Pal, I. Khozin-Goldberg, Z. Cohen, S. Boussiba, The effect of light, salinity, and nitrogen availability on lipid production by Nannochloropsis sp., Appl. Microbiol. Biotechnol., 90 (2011) 1429-1441. [41] I. Khozin-Goldberg, S. Didi-Cohen, I. Shayakhmetova, Z. Cohen, Biosynthesis of eicosapentaenoic acid (EPA) in the freshwater eustigmatophyte Monodus subterraneus (Eustigmatophyceae), J Phycol, 38 (2002) 745-756. [42] U. Iskandarov, S. Sitnik, N. Shtaida, S. Didi-Cohen, S. Leu, I. Khozin-Goldberg, Z. Cohen, S. Boussiba, Cloning and characterization of a GPAT-like gene from the microalga Lobosphaera incisa (Trebouxiophyceae): overexpression in Chlamydomonas reinhardtii enhances TAG production, J. Appl. Phycol., 28 (2016) 907-919. [43] P. Shrestha, Biosynthesis and mobilization of arachidonic-acid-rich triacylglycerols in the green microalga Parietochloris incisa, in, vol. Ph.D., Publisher not identified, Beer-Sheva, 2005. [44] H.M. Nguyen, S. Cuiné, A. Beyly-Adriano, B. Légeret, E. Billon, P. Auroy, F. Beisson, G. Peltier, Y. Li-Beisson, The green microalga Chlamydomonas reinhardtii has a single ω-3 fatty acid desaturase that localizes to the chloroplast and impacts both plastidic and extraplastidic membrane lipids, Plant physiology, 163 (2013) 914-928. [45] U. Iskandarov, I. Khozin-Goldberg, Z. Cohen, Identification and Characterization of Δ12, Δ6, and Δ5 Desaturases from the Green Microalga Parietochloris incisa, Lipids, (2010). [46] M. Shinitzky, Membrane fluidity and cellular functions, in: Physiology of membrane fluidity, vol. 1, 1984, pp. 1-51. [47] D.M. Kramer, G. Johnson, O. Kiirats, G.E. Edwards, New fluorescence parameters for the determination of QA redox state and excitation energy fluxes, Photosynth. Res., 79 (2004) 209- 218. [48] R. Strasser, M. Tsimilli-Michael, A. Srivastava, Analysis of the chlorophyll a fluorescence transient, in: G. Papageorgiou, Govindjee (Eds.) Chlorophyll a fluorescence: a signature of photosynthesis, Springer, 2004, pp. 321–362. [49] V.J. Dodson, J.-L. Mouget, J.L. Dahmen, J.D. Leblond, The long and short of it: temperature-dependent modifications of fatty acid chain length and unsaturation in the galactolipid profiles of the diatoms Haslea ostrearia and Phaeodactylum tricornutum, Hydrobiologia, 727 (2014) 95-107. [50] I. Khozin, D. Adlerstein, C. Bigongo, Y.M. Heimer, Z. Cohen, Elucidation of the Biosynthesis of Eicosapentaenoic Acid in the Microalga Porphyridium cruentum (II. Studies with Radiolabeled Precursors), Plant Physiol., 114 (1997) 223-230. 52
[51] M.L. Hamilton, R.P. Haslam, J.A. Napier, O. Sayanova, Metabolic engineering of Phaeodactylum tricornutum for the enhanced accumulation of omega-3 long chain polyunsaturated fatty acids, Metab. Eng., 22 (2014) 3-9. [52] I. Lang, L. Hodac, T. Friedl, I. Feussner, Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection, BMC Plant Biology, 11 (2011) 1. [53] S. Jareonkitmongkol, S. Shimizu, H. Yamada, Fatty acid desaturation-defective mutants of an arachidonic-acid-producing fungus, Mortierella alpina 1S-4, Microbiology, 138 (1992) 997- 1002. [54] J.C. Schneider, A. Livne, A. Sukenik, P.G. Roessler, A mutant of Nannochloropsis deficient in eicosapentaenoic acid production, Phytochemistry, 40 (1995) 807-814. [55] A. Sukenik, J. Schneider, P. Roessler, A. Livne, T. Berner, Z. Kolber, K. Wyman, O. Prasil, P. Falkowski, Photosynthetic characterization of a mutant of Nannochloropsis deficient in the synthesis of eicosapentaenoic acid, Isr. J. Plant Sci., 46 (1998) 101-108. [56] J. Kawamoto, T. Kurihara, K. Yamamoto, M. Nagayasu, Y. Tani, H. Mihara, M. Hosokawa, T. Baba, S.B. Sato, N. Esaki, Eicosapentaenoic acid plays a beneficial role in membrane organization and cell division of a cold-adapted bacterium, Shewanella livingstonensis Ac10, Journal of bacteriology, 191 (2009) 632-640. [57] X.-Z. Dai, J. Kawamoto, S.B. Sato, N. Esaki, T. Kurihara, Eicosapentaenoic acid facilitates the folding of an outer membrane protein of the psychrotrophic bacterium, Shewanella livingstonensis Ac10, Biochemical and biophysical research communications, 425 (2012) 363- 367. [58] E.E. Allen, D. Facciotti, D.H. Bartlett, Monounsaturated but Not Polyunsaturated Fatty Acids Are Required for Growth of the Deep-Sea BacteriumPhotobacterium profundum SS9 at High Pressure and Low Temperature, Applied and Environmental Microbiology, 65 (1999) 1710-1720. [59] J.M. Seddon, Structure of the inverted hexagonal (H II) phase, and non-lamellar phase transitions of lipids, Biochimica et Biophysica Acta (BBA)-Reviews on Biomembranes, 1031 (1990) 1-69. [60] P. Dörmann, C. Benning, Galactolipids rule in seed plants, Trends Plant Sci., 7 (2002) 112- 118. [61] G. Thompson, Lipids and membrane function in green algae, Biochimica et Biophysica Acta (BBA)/Lipids and Lipid Metabolism, 1302 (1996) 17-45. 53
[62] M. Khodakovskaya, R. McAvoy, J. Peters, H. Wu, Y. Li, Enhanced cold tolerance in transgenic tobacco expressing a chloroplast ω-3 fatty acid desaturase gene under the control of a cold-inducible promoter, Planta, 223 (2006) 1090-1100. [63] T. Domínguez, M.L. Hernández, J.C. Pennycooke, P. Jiménez, J.M. Martínez-Rivas, C. Sanz, E.J. Stockinger, J.J. Sánchez-Serrano, M. Sanmartín, Increasing ω-3 desaturase expression in tomato results in altered aroma profile and enhanced resistance to cold stress, Plant Physiol., 153 (2010) 655-665. [64] C. Yu, H.-S. Wang, S. Yang, X.-F. Tang, M. Duan, Q.-W. Meng, Overexpression of endoplasmic reticulum omega-3 fatty acid desaturase gene improves chilling tolerance in tomato, Plant Physiol. Biochem., 47 (2009) 1102-1112. [65] M. Takemura, T. Hamada, H. Kida, K. Ohyama, Cold-induced accumulation of ω-3 polyunsaturated fatty acid in a liverwort, Marchantia polymorpha L, Biosci. Biotechnol. Biochem., 76 (2012) 785-790. [66] E.R. Moellering, B. Muthan, C. Benning, Freezing tolerance in plants requires lipid remodeling at the outer chloroplast membrane, Science, 330 (2010) 226-228. [67] E.R. Moellering, C. Benning, Galactoglycerolipid metabolism under stress: a time for remodeling, Trends Plant Sci., 16 (2011) 98-107. [68] K. Zienkiewicz, Z.-Y. Du, W. Ma, K. Vollheyde, C. Benning, Stress-induced neutral lipid biosynthesis in microalgae—Molecular, cellular and physiological insights, Biochimica et Biophysica Acta (BBA)-Molecular and Cell Biology of Lipids, (2016). [69] F. Kaplan, J. Kopka, D.W. Haskell, W. Zhao, K.C. Schiller, N. Gatzke, D.Y. Sung, C.L. Guy, Exploring the temperature-stress metabolome of Arabidopsis, Plant Physiol., 136 (2004) 4159-4168. [70] M. Norio, H. Wada, Membrane Lipids in Cyanobacteria, in: Govindjee (Ed.) Lipids in Photosynthesis: Structure, Function and Genetics, vol. 6, Springer Netherlands, 2004, pp. 65-81. [71] L.J. Dolch, C. Rak, G. Perin, G. Tourcier, R. Broughton, M. Leterrier, T. Morosinotto, F. Tellier, J.-D. Faure, D. Falconet, A palmitic acid elongase affects eicosapentaenoic acid and plastidal monogalactosyldiacylglcerol levels in Nannochloropsis, Plant Physiol., (2016) 01420.02016.
54
Supplementary material
Arachidonic acid is important for efficient use of light by the microalga Lobosphaera incisa
under chilling stress
Boris Zorina, Dipasmita Pal-Natha, Alexander Lukyanovb, Sviatlana Smolskaya a, Sofiya
Kolushevac, Shoshana Didi-Cohena, Sammy Boussibaa, Zvi Cohena, Inna Khozin-Goldberga*,
Alexei Solovchenkob,d
aMicroalgal Biotechnology Laboratory, The French Associates Institute for Agriculture and
Biotechnology for Drylands, The J. Blaustein Institutes for Desert Research, Ben-Gurion
University of the Negev, Sede-Boqer Campus, Midreshet Ben-Gurion 84990, Israel bDepartment of Bioengineering, Faculty of Biology, Moscow State University, 119234, GSP-1
Moscow, Russia cIlse Katz Institute for Nanoscale Science & Technology, Ben-Gurion University of the Negev,
Beersheba, Israel
55
Table S1. Characteristic points of OJIP and derivation of selected JIP test parameters [48].
Fo, Fm, Fm' Fluorescence intensity at point O and at the point of maximum
OJIP (m) in the dark-adapted state. Fm' represents Fm in the
light-adapted state.
Fm Fo Fv Maximum photochemical quantum yield of photosystem II in the Q y Fm Fm dark-adapted state; represents the potential for absorbed photon
energy transduction into electron transport.
Fm Stern–Volmer non-photochemical quenching. NPQ 1 Fm'
56
Table S2. Primers used for RT-PCR (Fig. 5 in the main text) and cloning of the two VDE and two ZEP isoforms from L. incisa; gene model IDs in the version 3.1 assembly of the
Lobosphaera incisa nuclear genome (https://giavap-genomes.ibpc.fr) are included in the primer name.
Primer Sequence 5'→3'
Semi-quantitative RT-PCR
LiFAD7_ 8488_Fw GCATGACGAGAACGAGAAGAT
LiFAD7_ 8488_Rv GTGGTGGATGTGGTTGAAGA
LiFAD6 _ 8131_Fw ACTTCCTGCACCAGGTCT
LiFAD6 _ 8131_Rv TCGTGCTTGCTCTTCCACCAG
LiFAD5_ 4602_FW TAAGTGCCAGGGCTGTGCTAGA
LiFAD5 _4602_Rv GAACTGACCCTCCTCTGTGTCCT
Actin_ 10221_Fw CGTCCAGCTCCACGATTGAGAAGA
Actin _10221_Fw ATGGAGTTGAAGGCGGTCTCGT
Primers used to clone the full-length LiFAD7 into the vector pUC19-35S-GFP
Fw* CGAGATCTATGCAGGCCCCCACTATGT
Fw (truncated) TGAGATCTATGGCTGGACACTCGCGCCCCAGA
Rv GCAGTACTCACATCCGAGCCACTG
VDE1_g14311_Fw GCTCTGCCTTGACTACCCG
VDE1_g14311_Rv GGCTGTTGGGAGAGAAGCAT
VDE2_g14312_Fw CGTGACATACTGCTGACGGT
VDE2_g14312_Rv CCATCGAAGATGCCCTGGAA
ZEP1_g15788_Fw TGTGACTGCAAGCACCTAGT
ZEP1_g15788_Rv ATACTGCATTGCTCCCACCC
ZEP2_g8594_Fw TCCGTTTGCCACTCCAACTT
ZEP2_g8594_Rv ACCAACAGTTCAAGCACCCA
*Restriction sites for BglII and ScaI are italicized, the start codon is underlined. 57
WTMGDG-20mg_ml-DHB-methanol0_1TFA\0_O4\1\1SRef
34:N Na+ 773.538 5000[a.u.] Intens.
771.523 WT 769.512 4000
3000 + + 775.557 34:N K 36:N Na+ 38:N Na 40:N Na+
2000
849.574
825.578 777.577
1000 851.556
823.561
789.533
787.520
827.566
785.502
801.547
779.579
803.521
799.539
797.529
805.557
817.501 853.547
0
x104 MGDG-mutant-chlorof-0_1TFA_methanol-DHB\0_A17\1\1SRef
3.0 768.979 Intens. [a.u.] Intens. _P127_
2.5
2.0 770.991
1.5
773.011
789.039 784.995
1.0 779.013
775.020
777.019
764.981
797.019
786.996
817.096
791.042
799.027 801.038
0.5
0.0 770 780 790 800 810 820 830 840 850 m/z
Fig. S1. MALDI-TOF-MS spectra of monogalactosyldiacylglycerol (MGDG) isolated from mid- log cultures of wild type (WT) and arachidonic acid-deficient mutant P127 of L. incisa grown at
25 oC. Molecular species are designated as total number of carbon atoms:number of double bonds: 34 (C18/C16), 36 (C18/C18), 38 (C20/C18), 40 (C20/C20). C20-PUFA-MGDG are evident in the WT. Mass spectra were obtained on a Bruker Reflex-IV (Bruker Daltonic GmbH,
Bremen, Germany) TOF-MS operated in positive-ion reflection mode. The accelerating voltage, delayed extraction time, and laser power were adjusted to optimize sensitivity and resolution for ions between m/z 480 and 2300. The lipid samples, dissolved in chloroform, were spotted on a plate using 2,5-dihydroxybenzoic acid (DHB) solution as a matrix.
x104 * DGDG-mutant-chlorof-0_1TFA_methanol-DHB-dil\0_B23\1\1SRef, "Baseline subt.", Smoothed
939.306 Intens. [a.u.] Intens.
1.5
963.291
941.314 937.314
1.0 959.318
931.267
965.324
935.291
987.396 955.329
0.5
967.360
977.305
991.391 981.344 58
0.0
WT-DGDG-20mg_ml-methanol-0_1TFA\0_O16\1\1SRef 939.690 Intens. [a.u.] Intens. + WT 5000 34:N Na
+ 4000 38:N Na
3000 941.734 36:N Na+ 987.668
935.654 +
2000 942.233 40:N Na
963.661
985.647 931.634
1000 955.661
991.717
1011.678
967.678
959.665
1003.676 979.636
0
920 930 940 950 960 970 980 990 1000 1010 1020 m/z
x104 * DGDG-mutant-chlorof-0_1TFA_methanol-DHB-dil\0_B23\1\1SRef, "Baseline subt.", Smoothed 939.306 Intens. [a.u.] Intens. _P127_
1.5
963.291
941.314 937.314
1.0 959.318
931.267
965.324
935.291
987.396 955.329
0.5
967.360
977.305
991.391 981.344
0.0
WT-DGDG-20mg_ml-methanol-0_1TFA\0_O16\1\1SRef 939.690 Fig.[a.u.] Intens. S2. MALDI-TOF-MS spectra of digalactosyldiacylglycerol (DGDG) isolated from mid-log 5000
cultures4000 of wild type (WT) and arachidonic acid-deficient mutant P127 of L. incisa grown at 25 o
C.3000 For details, refer to legend to Fig. S1.
941.734
987.668 935.654
2000 942.233
963.661
985.647 931.634
1000 955.661
991.717
1011.678
967.678
959.665
1003.676 979.636
0
920 930 940 950 960 970 980 990 1000 1010 1020 m/z 59
I
II
III
Fig. S3. Multiple protein alignment of Lobosphaera incisa omega-3 desaturase and two green microalgal homologs, Chlamydomonas reinhardtii (GenBank accession number
XP_001689663.1) and Chlorella vulgaris (GenBank accession number BAB78717.1), was performed using Clustal Omega (http://www.ebi.ac.uk) and visualized by BoxShade
(http://www.ch.embnet.org/software/BOX_form.html). Position of conserved histidine boxes is indicated by roman numerals.
60
Plastidial ER
Lobosphaera incisa
algae
Green Cyanobacteria
Fig. S4. Protein phylogenetic tree of LiFAD7 and some other candidate or characterized ω-3
FADs of higher plants, green microalgae and cyanobacteria. The unrooted phylogram was constructed by the neighbor-joining method using MEGA4.1 software. The scale bar represents
0.05 mutational changes per residue. GenBank accession numbers : AtFAD3 (A. thaliana microsomal, NP_850139), AtFAD7 (A. thaliana FAD7, NP_187727), AtFAD8 (A. thaliana,
NP_196177.1), Betula pendula plastidial (AAN17502), B. pendula ER (AAN17504),
Chlamydomonas reinhardtii (EDP09401), Chlorella sp. LKT-2007 (ABU54076), Chlorella vulgaris (BAB78717), Cucumis sativus (ACE80931), Descurainia sophia chloroplastic
(ABS86961), D. sophia ER (ABS86962), Glycine max chloroplastic (isoform 2 ACF19424), G. max ER (b) (BAB18135), G. max ER (a) (BAD36812), G. max ER (c) (ACH43027),
Lycopersicon esculentum (AAP82170), Microcystis aeruginosa NIES-843 (YP_001658476),
Nicotiana tabacum plastidial (BAA11475), Nostoc sp. 36 (CAF18425), Oryza sativa (Japonica cultivar-group ABF95395), Physcomitrella patens subsp. patens (putative protein
XP_001763955), Picea abies (CAC18722), Synechococcus sp. PCC 7002 (YP_001733429), 61
Synechocystis sp. PCC 6803 (NP_441622), Zea mays FAD8 (BAA22440), Z. mays (NP_35361),
Z. mays FAD 7 (1) (NP_001147636), Z. mays FAD7 (NP_001105303).
62
A TFA WT 25 P127
P2 20
15
10
oftotal acids fatty 5 % %
0
B 40
35 MGDG
30 25 20 15
10 %of total acids fatty 5 0
C 40
35 DGDG
30 25 20 15
10 %of total acids fatty 5 0
63
Fig. S5. Fatty acid composition of (A) three L. incisa strains and (B, C) galactolipids (MGDG and DGDG) used in the fluorescence anisotropy assay. Data represent means of two technical repeats.
0.4 PmaxWT PmaxP127
PmaxP2 -1
0.3
Chl min Chl -1
0.2
mg
2 mmol O mmol
( 0.1 Pmax
0.0 25 10 4 Growth t° (°C)
Fig. S6. Effect of 7-day exposure to the chilling stress on the maximum rate of photosynthetic O2 evolution in L. incisa wild type (closed bars), its arachidonic acid-deficient mutant P127 (open bars) and in the transformant P2 with partially restored arachidonic acid biosynthesis (hatched bars). Data are presented as means of three biological repeats. Error bars represent the standard deviation.
64
Supplementary methods
Amplification of LiFAD7 cDNA for insertion into pUC19-35S-GFP vector
PCR amplification was carried as follows: initial denaturation at 94 ºC for 2 min, followed by 30 cycles of 94 ºC for 30 s, 60 ºC for 45 s and 72 ºC for 1.5 min, and a final extension cycle of 72 ºC for 10 min; the reaction was terminated at 10 ºC. The amplified products were separated electrophoretically on a 1.5% agarose gel, the desired DNA band was excised, and the DNA was eluted from the agarose gel (QIAquick Gel Extraction Kit, Qiagen). The eluted DNA was ligated directly into the pGEM-T Easy Vector (pGEM-T and pGEM-T Easy Vector Systems, Promega).
The plasmids were used for transformation of Escherichia coli strain JM109 cells. The recombinant plasmids were isolated (QIAprep Spin Miniprep Kit, Qiagen, Hilden, Germany) and sequenced using the forward and reverse M13 sequencing primers.