Studies on Salmonella Enterica Spp Isolated from Egg Farm Environment

Studies on Salmonella Enterica spp Isolated From Egg Farm Environment

Vivek Vinayakrao Pande

B.V.Sc. & A.H., M.V.Sc (Pathology), MPhil

A Thesis submitted for the fulfilment of the requirements of

the Doctor of Philosophy

School of Animal and Veterinary Sciences

Faculty of Sciences

The University of Adelaide

Adelaide, South Australia, Australia

August 2016 Table of Contents

Thesis Abstract ...... 4

Thesis Declaration ...... 6

Acknowledgements ...... 7

List of Publications ...... 9

CHAPTER 1 LITERATURE REVIEW ...... 10

1.1 Introduction to thesis ...... 11

1.1.1 Salmonella taxonomy and epidemiology ...... 14

1.1.2 Salmonella pathogenesis ...... 15

1.2 Antimicrobial resistance in Salmonella ...... 15

1.2.1 Mode of action of antimicrobial agents ...... 16

1.2.2 Mechanism of antibiotic resistance ...... 18

1.2.3 Mechanism of antimicrobial resistance in Salmonella to selected classes of

antimicrobials ...... 18

1.2.4 Antibiotic resistance in Salmonella from eggs or egg farm ...... 20

1.2.5 Antibiotic use in Australian poultry industry ...... 22

1.2.6 Antibiotic resistance in Salmonella from Australian poultry industry ...... 23

1.3 Egg contamination and S. Typhimurium infection in laying hens ...... 23

1.3.1 Mechanism of egg contamination ...... 24

1.3.2 S. Typhimurium infection in laying hens ...... 25

1.3.3 S. Typhimurium outbreaks related to egg and egg products across Australia .... 30

1.4 Salmonella biofilms ...... 42

1.4.1 Control measures against biofilm ...... 43

1.4.2 Salmonella biofilm formation and composition ...... 44

1.4.3 Identification of biofilm formation based on colony morphology ...... 46

1.4.4 Salmonella biofilm resistance to antimicrobials ...... 47

1.4.5 Intervention strategies for Salmonella control on farm ...... 48

1.5 Organic acids ...... 49

1.5.1 Mechanism of antimicrobial action of organic acids ...... 50

1.5.2 Effects of organic acid on survival and virulence of Salmonella ...... 50

1.5.3 Studies on efficacy of organic acids in poultry ...... 51

1.5.4 Use of organic acids against biofilms ...... 53

1.5.5 Salmonella acid tolerance response (ATR) ...... 55

1.6 Objectives of thesis ...... 56

1.7 References ...... 57

CHAPTER 2 ANTIMICROBIAL RESISTANCE OF NON-TYPHOIDAL SALMONELLA ISOLATES

FROM EGG LAYER FLOCKS AND EGG SHELLS ...... 81

CHAPTER 3 STUDY OF SALMONELLA TYPHIMURIUM INFECTION IN LAYING HENS ...... 92

CHAPTER 4 SALMONELLA ENTERICA ISOLATES FROM LAYER FARM ENVIRONMENTS ARE

ABLE TO FORM BIOFILM ON EGGSHELL SURFACES ...... 105

CHAPTER 5 ANTI-BACTERIAL AND ANTI-BIOFILM ACTIVITY OF COMMERCIAL ORGANIC

ACID PRODUCTS AGAINST S. ENTERICA ISOLATES RECOVERED FROM LAYER FARM

ENVIRONMENT ...... 121

5.1. Abstract ...... 124

5.2. Introduction ...... 125

5.3. Materials and Methods ...... 128

5.4. Results ...... 132

5.5. Discussion ...... 133

5.6. References ...... 139

CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS ...... 153

Thesis Abstract

Infection with Salmonella spp is among the most common causes of foodborne outbreaks of human gastrointestinal disease. Humans acquire Salmonella through the consumption of contaminated food items, including eggs and undercooked egg products. There are over 2500

Salmonella enterica serovars but globally, Salmonella Enteritidis and Salmonella Typhimurium are responsible for causing the majority of human disease. S. Enteritidis is, however, not endemic in Australia; strains of S. Typhimurium have filled this niche and are frequently isolated during cases of egg related foodborne illness. Over the last decade, cases of salmonellosis have increased, representing a significant public health issue. The experiments presented in this thesis were designed to investigate aspects of antimicrobial resistance, layer hen infection, biofilm forming ability of Salmonella spp on eggshell and the efficacy of organic acids on controlling Salmonella biofilms.

Antimicrobial resistance was characterised for multiple Salmonella isolated from the layer hen environment. The majority of Salmonella isolates (91.72%; 133/145) were susceptible to all antimicrobials tested. This finding indicates that there is minimal public health risk associated with emergence of antibiotic resistant Salmonella within the Australian layer industry.

An infection trial investigated the ability of S. Typhimurium to colonise reproductive organs and contaminate developing eggs. Intermittent but persistent faecal shedding of Salmonella after oral infection was observed for 15 weeks post infection. Further, S. Typhimurium caused eggshell contamination and colonised the reproductive tissue however, S. Typhimurium was not isolated from the internal egg contents. These findings indicate that horizontal transmission through contaminated faeces is the main route of egg contamination with S. Typhimurium in laying hens.

Biofilm formation was dependent on both temperature and serovar. At ambient temperature,

Salmonella isolates attached and formed biofilm on eggshells however, differences between strains of Salmonella serovars were evident in eggshell biofilm formation.

The anti-bacterial and anti-biofilm activity of commercial organic acid products against S. enterica isolates was further investigated. The result of this experiment showed no significant differences between isolates of representative Salmonella serovars in respect of inhibitory and bactericidal dilutions of each product. Two out of three commercial organic acid products tested in this study significantly reduced viable cells from 3 and 5 day old biofilms in a dose and time dependent manner. None of the tested products completely eliminated biofilm cells under any of the tested conditions.

In conclusion, the results presented here improve our understanding of the risks of egg associated S. enterica spp. Knowledge gained from these experiments could contribute to the development of improved guidelines for food safety and public health in Australia.

Thesis Declaration

I certify that this work contains no material which has been accepted for the award of any other degree or diploma in my name, in any university or other tertiary institution and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text. In addition, I certify that no part of this work will, in the future, be used in a submission in my name, for any other degree or diploma in any university or other tertiary institution without the prior approval of the

University of Adelaide and where applicable, any partner institution responsible for the joint- award of this degree.

I give consent to this copy of my thesis when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968.

I acknowledge that copyright of published works contained within this thesis resides with the copyright holder(s) of those works.

I also give permission for the digital version of my thesis to be made available on the web, via the University’s digital research repository, the Library Search and also through web search engines, unless permission has been granted by the University to restrict access for a period of time

Vivek Vinayakrao Pande

Acknowledgements

“I may not have gone where I intended to go, but I think I have ended up where

I intended to be” –Douglas Adams

First and foremost, I would like to express my sincere gratitude to my supervisor Dr Kapil

Chousalkar, for giving me an opportunity to pursue my PhD. Kapil has been a brilliant mentor and without his continuous guidance, this work would not have been possible. Kapil, you believed in me and my ability to complete this daunting task. I shall remain in your debt throughout my life for making my dream of PhD come true.

I would like to express my profound indebtedness to my co-supervisor Dr Andrea McWhorter, for her encouragement, critical evaluation, valuable suggestions, and excellent co-operation throughout my thesis.

My special thanks to Dr Gordon Howarth, Dr Milton McAllister, Dr Darren Trott, Dr Ryan

O'Handley, Dr Bec Forder, Dr Farhid Hemmatzadeh, Dr Manouchehr Khazandi, and Dr Charles

Caraguel for the guidance during my research work.

I would like to acknowledge The University of Adelaide for providing the Postgraduate

Research Scholarship to pursue my higher degree research.

I am thankful to Angela Mills, Marie Kozulic, Jeremy Winchester, and all other staff of Library at Roseworthy campus, The University of Adelaide for their help with Adobe and EndNote.

Words are few to owe my special and heartiest thanks to my friends for their moral support and refreshing company; Vaibhav Gole, Pardeep Sharma, Talia Moyle, Sasikumar, Vinod Kadam,

Lesley Menzel, Rebecca Dunbar, David Purdie, Saad Gilani, Rebecca Devon, Janet Pandi,

Michael Dom, Jane McNicholl, Noor Haliza Hasan, Sugiyono Saputra, Saad Gilani, Rebecca

Abraham, Sam Abraham, Amanda Kidsley and Elizabeth Hickey. 7

I do not have words to express my sincere thanks to Leena, Mahesh, Jaya, and Vaibhav for the wonderful family support. All of you have made my journey of PhD very joyful and a memorable one.

My special thanks to Hasmukh and Jignya Patel for their wonderful family support during critical periods of thesis writing.

I would also like to thank Dr Jaswinder Kaur and Dr Emad Ehsan from Gawler medical clinic for providing the best health care service to my family during PhD.

A special thanks to all my mentors and my professional colleagues in India for their tremendous motivation; Dr Kurkure, Dr Kalorey, Dr Vishal Pavitrakar, Dr Jaiprakash Bhelonde, Dr Pankaj

Shelar, Dr Swapnil Chilgunde, Anand Bokare, Dr Amol Fiske, and Dr Jitendra Ramgaokar. My heartfelt thanks to Dr Umesh Wankhade, Dr Pradyumna Baviskar and Dr Nitin Kamble for continued encouragement during my research work.

A big thank you to my family members who have always been supportive and proud of what I am today. My special thanks to my wife Poonam, my beautiful daughters Unnati and Aastha, my mother, father, brother and his wife for their great understanding, sacrifice, unconditional love and belief in my abilities. My all-family members have been my real pillars of emotional strength while pursuing this degree. My special thanks to my in-laws, Nilesh Tayde, Rucha

Kangte and Deepak Kangte for great support and love during my stay in Australia.

Finally, thanks to God for the joy and opportunity to worship him through learning more about this small part of his creation.

List of Publications

Pande, V. V., Gole, V. C., McWhorter, A. R., Abraham, S., & Chousalkar, K. K. (2015).

Antimicrobial resistance of non-typhoidal Salmonella isolates from egg layer flocks and egg shells. International Journal of Food Microbiology, 203, 23-26.

Pande, V. V., Devon, R. L., Sharma, P., McWhorter, A. R., & Chousalkar, K. K. (2016). Study of Salmonella Typhimurium Infection in Laying Hens. Frontiers in Microbiology, 7, 203.

Pande, V. V., McWhorter, A. R., & Chousalkar, K. K. (2016). Salmonella enterica isolates from layer farm environments are able to form biofilm on eggshell surfaces. Biofouling, 32(7),

699-710.

Pande, V. V., McWhorter, A. R., & Chousalkar, K. K. (2016). Anti-bacterial and anti-biofilm activity of commercial organic acid products against S. enterica isolates recovered from layer farm environment. Journal of Applied Microbiology (Submitted)

Conference Oral Presentations

Vivek V. Pande, Andrea R. McWhorter, Kapil K. Chousalkar. Salmonella enterica spp isolated from egg farm environments are able to form biofilm on the eggshell. The Australian Society for Microbiology annual scientific meeting, 3-6 July 2016, Perth, Australia.

Vivek V. Pande, Rebecca Devon, Pardeep Sharma, Andrea R. McWhorter, and Kapil K.

Chousalkar. Salmonella Typhimurium shedding and egg contamination in experimentally infected laying hens. The 43rd Annual General Meeting of the Australian Society for

Microbiology 12-15 July 2015, Canberra, Australia.

CHAPTER 1 LITERATURE REVIEW

1.1 Introduction to thesis

Salmonella enterica subsp. enterica is a common cause of foodborne human gastroenteritis, a disease characterised by gut inflammation and diarrhoea (Winter et al., 2010). Consumption of contaminated food products such as pork, meat, egg and egg related products are among the most common sources of Salmonella infection (Hur et al., 2012). It is estimated that worldwide,

93.9 million cases of gastroenteritis and 155,000 deaths are caused annually by Salmonella spp

(Majowicz et al., 2010). In Australia, consumption of undercooked egg and egg products are frequently implicated in outbreaks of human salmonellosis (OzFoodNet Working Group,

2012a, 2015b). Over the past decade, human cases of Salmonella infection have increased in

Australia. A total of 11,992 Salmonella cases were reported in 2010, representing 53.7 cases per 100, 000 people. This is higher in comparison to the previous 5 years, with an average infection rate of 41.8 cases per 100,000 people (OzFoodNet Working Group, 2012a).

Non-typhoidal Salmonella infections are asymptomatic in adult birds (Mead & Barrow, 1990;

Revolledo et al., 2006). In humans, infection with nontyphoidal Salmonella is self-limiting and cause mild gastroenteritis however, severe infection is common in elderly and immunocompromised individuals (Parry & Threlfall, 2008). Generally, treatment for self- limiting gastroenteritis is not required however, in case of severe and systemic human salmonellosis, antimicrobials such as fluoroquinolones and extended-spectrum cephalosporins are commonly used (Parry & Threlfall, 2008). The use of antimicrobial agents in the prevention and treatment of many infectious diseases and as a growth promoter is a common practice both in veterinary and human medicine (Hur et al., 2012). Indiscriminate use of antibiotics in both animal and human populations has led to an emergence of multidrug resistant Salmonella strains (Anjum et al., 2011; Hur et al., 2012). The emergence and dissemination of antibiotic resistance to Salmonella is of significant global concern for both animal and public health (Hur et al., 2012).

Globally, Salmonella Enteritidis is the dominant serovar in commercial poultry industries, is often isolated from eggs, and is frequently associated with egg related food poisoning in humans

(Foley et al., 2011). S. Enteritidis, however, is not endemic in commercial Australian poultry flocks (OzFoodNet Working Group, 2009). This niche has been filled by S. Typhimurium, which is most frequently linked with egg related foodborne outbreaks (OzFoodNet Working

Group, 2009). Foodborne outbreaks associated with raw eggs or egg related products is a major public health issue and highlights the importance of understanding egg contamination in laying hens. One of the mechanisms Salmonella spp utilizes for survival in harsh physical and chemical environments is by forming biofilms (Costerton et al., 1999).

Salmonella spp are able to attach and form biofilm on a large number of abiotic surfaces including stainless steel, plastics, cement, rubber, and glass (Steenackers et al., 2012). Biofilm is a community of interacting bacterial cells attached to biotic or abiotic surfaces, embedded in self-produced extracellular polymeric matrix (Costerton et al., 1999). Bacteria in a biofilm remain viable and may lead to cross contamination of a variety of food products. Salmonella within a biofilm display higher resistance to environmental stressors, antibiotics and disinfectants, compared to planktonic counterparts, thus making the eradication of this bacteria extremely difficult from surfaces commonly used in food and poultry industry (Joseph et al.,

2001; Steenackers et al., 2012). The ability of Salmonella to form a biofilm represents a significant public health risk for many industries including those involved in food production and processing (Shi & Zhu, 2009). Food safety and public health impacts associated with biofilm forming foodborne pathogens emphasises the importance of understanding eggshell biofilm formation by Salmonella spp.

Several intervention strategies have been developed to reduce the risk of Salmonella at farm level. These intervention strategies include biosecurity, vaccination, cleaning, disinfection, prebiotics, probiotics, feed and water acidification with organic acids, and egg washing

(Chousalkar et al., 2015; Cox & Pavic, 2010; Ricke, 2014). Although the application of these 12 strategies has reduced the Salmonella contamination level, complete elimination of this pathogen is yet to be achieved.

In the poultry industry, several commercial organic acid products are commonly used in feed and water as preventive measures against Salmonella contamination. Organic acids are generally regarded as safe (GRAS) and have been used extensively for many years to ensure water hygiene and reduce feed contamination in poultry (Ricke, 2003). Due to increased antimicrobial resistance and a ban on antibiotic growth promoters in many countries, organic acids are a suitable alternative for pathogen control, under a wide variety of food processing conditions (Wales et al., 2010). Organic acids are relatively stable and naturally present in living organisms, especially in the gut environment. Organic acids are either metabolised by food animals or may be excreted unabsorbed, and thus do not present an issue of residues in food

(Wales et al., 2010). In addition to anti-microbial action, organic acids have ability to reduce biofilm development of foodborne pathogens on different surfaces (Akbas & Cag, 2016; Borges et al., 2012).

The following section of review summarises the literature relevant to the experiments conducted as a part of this thesis.

1.1.1 Salmonella taxonomy and epidemiology

The genus Salmonella is a member of Enterobacteriacae family and is a non-spore forming, motile, Gram-negative facultative anaerobe. Salmonella is oxidase negative, capable of reducing nitrates to nitrites, and ferments glucose (Ricke et al., 2015). This genus is comprised of two species, S. enterica, and S. bongori (V). S. enterica is further divided into six subspecies:

S. enterica subsp. Enterica (I), S. enterica subsp. Salamae (II), S. enterica subsp. Arizonae

(IIIa), S. enterica subsp. Diarizonae (IIIb), S. enterica subsp. Houtenae (IV) and S. enterica subsp. Indica (VI). There are more than 2500 serovars in Salmonella genus and more than 1500 serovars belong to species S. enterica (Dunkley et al., 2009; Grimont & Weill, 2007;

Guibourdenche et al., 2010).

S. Enteritidis and S. Typhimurium have dominated the epidemiology of Salmonella and are the most common causes of human salmonellosis (Hendriksen et al., 2011). Globally, S. Enteritidis is a dominant serovar isolated from eggshell and egg contents and is frequently involved in egg and egg product associated foodborne outbreaks (Wales & Davies, 2011). However, in

Australia, human disease caused by this serovar occur because of overseas travel. S.

Typhimurium, in contrast, is the predominant cause of Australian foodborne outbreaks and is often linked with the consumption of contaminated egg and egg related products

(OzFoodNetWorking Group, 2009; Wales 2011; OzFoodNetWorking Group, 2012a). The incidence of human cases of Salmonella infection have increased over the past few years in

2001 and 2011, S. Typhimurium was the predominant causative agent for 150 (90%) of the 166 egg associated outbreaks in Australia (Moffatt et al. 2016).

1.1.2 Salmonella pathogenesis

Once ingested, Salmonella attaches to oropharyngeal and intestinal epithelial cells via type 1 fimbriae or pili (Ricke et al., 2013b). The pathogenesis of Salmonella is mediated through type

III secretion system encoded by Salmonella pathogenicity islands 1 (SPI-1) and other SPI’s which play an important role in systemic Salmonella infection.

Efficient colonisation and invasion of the gastrointestinal tract is attributed to Salmonella

Pathogenicity Islands (SPI’s) that encode multiple virulence factors present in the Salmonella genome (Foley et al., 2013; Foley et al., 2008). For different serovars, several pathogenicity islands have been documented however, SPI-1 to SPI-5 are common in many serovars (Foley et al., 2008; Marcus et al., 2000). In general, SPI-1 is involved in host cell invasion and macrophage apoptosis by encoding type 3-secretion system (T3SS). SPI-2 is associated with systemic infection and intracellular survival. SPI-3 encoding genes are required for intracellular proliferation and Salmonella growth in low magnesium environments. SPI-4 harbours genes for toxin secretion and apoptosis or death of host cell. SPI-5 has been found to encode numbers of different T3SS effector proteins (Amavisit et al., 2003; Foley et al., 2008; van Asten & van

Dijk, 2005).

1.2 Antimicrobial resistance in Salmonella

In humans, Salmonella infection occurs 12-72 hours after ingestion of contaminated food and clinical symptoms include fever, abdominal pain, vomiting, nausea, diarrhoea, and headache.

In healthy adults symptoms of Salmonellosis are self-limiting and usually resolve in a week however, in infants or immunocompromised patients, symptoms are severe and could lead to life threatening septicaemia (Grant et al., 2016; Li et al., 2013; Olsen et al., 2001; Parry &

Threlfall, 2008; Ricke et al., 2013b). Severe, systemic salmonellosis may require treatment with effective antimicrobials such as fluoroquinolones and extended-spectrum cephalosporins (Parry

& Threlfall, 2008). However, the increased use of antibiotics in human and veterinary medicine

15 has led to an emergence of multidrug resistant Salmonella strains (Davies & Davies, 2010;

Marshall & Levy, 2011). Moreover, the transfer of multidrug resistant Salmonella spp to humans through food producing animals can further compromise the treatment options (Hur et al., 2012).

Compared with many other countries, Australia has a cautious approach to antibiotic usage in commercial egg layer flocks. Antimicrobials, such as fluoroquinolones, are prohibited and ceftiofur, a 3rd generation cephalosporin is not approved for mass administration in food producing animals (Cheng et al., 2012; Obeng et al., 2012). To date, there is little information available on the characterization of antimicrobial resistance (AMR) in Salmonella isolated from commercial Australian egg layer flocks. The emergence and dissemination of antibiotic resistance to the foodborne pathogen is a serious animal and public health concern for developed and developing countries (Bounar-Kechih et al., 2012; Parsons et al., 2013).

Therefore, understanding and monitoring antimicrobial resistance in Salmonella spp would help to understand the spread and control of Salmonella infection both in animal and human population.

1.2.1 Mode of action of antimicrobial agents

Since the middle of the 21st century, antimicrobials have been successfully used to treat various diseases and extensively used in human and veterinary medicine. The antimicrobial agents are classified according to their mechanism of action. The four important mechanisms of action of antimicrobial agents are; (1) inhibition of cell wall synthesis, (2) protein synthesis inhibition,

(3) interference with nucleic acid synthesis and (4) metabolic pathway inhibition (Frye &

Jackson, 2013; Tenover, 2006). Antimicrobial agents along with their mode of action are illustrated in Table 1.

Table 1. Mode of action of various antimicrobial agents

Mode of action Antimicrobial and or its class

I. Interference of cell wall synthesis β- lactams

Penicillins

- Cephalosporins

- Carbapenem

- Monobactams

Glycopeptides

- Vancomycin

- Teicoplanin

II. Protein synthesis inhibition

- Binds to 30S subunit of ribosome Aminoglycosides

Tetracyclines

- Binds to 50S subunit of ribosome Chloramphenicol

Macrolides

III. Interference of nucleic acid synthesis

- DNA synthesis inhibition Fluoroquinolones

- Ciprofloxacin

- Levofloxacin

- RNA synthesis inhibition Rifampin

IV. Metabolic pathway inhibition Sulfonamides and Trimethoprim

- Folic acid synthesis pathway

1.2.2 Mechanism of antibiotic resistance

Bacteria may become resistant to various antimicrobial agents through several mechanisms.

Major mechanisms of antibiotic resistance in bacteria includes : (1) modification in target site so the antibiotic cannot recognise the target; (2) enzyme production that will inactivate or modify the drug before its effect; (3) expelling or extruding the antibiotic outside the cell by one or more efflux pumps so the drug is unable to reach the target site to exert its antibacterial action; and (4) alterations in the cell membrane permeability that inhibits the access of drug into the cell (Périchon & Courvalin, 2009; Verraes et al., 2013).

Antimicrobial resistance could be intrinsic or acquired. Intrinsic resistance is an inherent capacity of organisms making them insensitive to all antibiotics, whereas acquired resistance is a result of chromosomal mutation in bacterial genome or acquisition of resistance conferring genetic material from a different source (Périchon & Courvalin, 2009; Sefton, 2002; Tenover,

2006). Some bacteria are intrinsically or naturally resistant to many antimicrobials. This type of antimicrobial resistance in bacteria is often due to the absence of target site for the action of antibiotic or the inability of the drug to pass through the cell wall or bacterial membrane for its action. Bacteria, which are sensitive to antimicrobials, may become resistant by mutation in genetic material or acquire new genetic material from resistant bacteria by horizontal gene transfer (HGT) (Verraes et al., 2013). There are three mechanisms of HGT among bacteria: conjugation, transformation, and transduction (Davies, 1994; McManus, 1997; Verraes et al.,

2013).

1.2.3 Mechanism of antimicrobial resistance in Salmonella to selected classes of antimicrobials

The development of antimicrobial resistance in Salmonella is determined by one of multiple mechanisms such as: enzyme production to deactivate antimicrobial agent through degradation or structural modification, decrease in cell permeability to antimicrobial agents, efflux pumps activation by antibiotics and modifications of the cellular target site of drug action (Sefton, 18

2002). Resistance to cephalosporins and penicillin by Salmonella is related to production of β- lactamase enzymes produced by different Salmonella serovars. The chemical structures of limited antimicrobial agents are degraded by β-lactamase enzymes, whereas a wide array of antimicrobial agents are degraded by broad spectrum β- lactamases (Finch et al., 2003). The most common and important mechanism for β-lactam antibiotic resistance is attributed to β- lactamases production by Salmonella spp (Finch et al., 2003; Revathi et al., 1998). AmpC enzyme is one of the β-lactamase enzymes, which are encoded by blaCMY and has been shown to mediate resistance to most β-lactam antibiotics including ampicillin, ceftiofur and ceftriaxone (Aarestrup et al., 2004).

In Salmonella, resistance to tetracycline is encoded by the tet genes. Most of the tet genes code for efflux pumps and several others code for ribosomal protection proteins. The majority of tet genes in bacteria are present on the mobile genetic elements such as plasmids, transposons, conjugative trasnposons and integrons (Chopra & Roberts, 2001). Antimicrobial resistance in

Salmonella to chloramphenicol is encoded by flor or cml (Butaye et al., 2003; Chopra &

Roberts, 2001). Resistance to tetracycline and chloramphenicol is accomplished by the reduction in intracellular levels of antimicrobial agent by expelling the antibiotic from the cell at a rate equal or higher than its uptake. The resistance by efflux mechanism is the most common and well-studied mechanism for tetracycline (Foley & Lynne, 2008; Speer et al., 1992). In addition, chloramphenicol resistance in Salmonella is associated with the production of chloramphenicol acetyltransferases encoded by cat genes (Murray & Shaw, 1997). The cat genes are further divided into cat A and cat B groups, which differ from each other (Nogrady et al., 2005).

Resistance to aminoglycoside compounds in Salmonella is mediated by three classes of enzymes; phosphotransferases, acetyltransferases and adenyltransferases. This chemical modification by enzymes interferes with dry transport or binding of the drug at the site of action

(Poole, 2005; Smith & Baker, 2002). Aminoglycoside acetyltransferase encoded by aaac can 19 cause gentamicin resistance, whereas aminoglycoside phosphotransferase encoded by aphA leads to kanamycin resistance. Similarly, aminoglycoside adenyltransferases encoded by aadA and aadB are involved in streptomycin and gentamycin resistance respectively (Randall et al.,

2004; Welch et al., 2007).

Resistance to quinolone and fluroquinolone in bacteria is associated with mutations in bacterial

DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE) genes. These mutations prevent binding of antimicrobial agents at the target site to carry out the antimicrobial action

(Bebear et al., 2003; Dutta et al., 2005; Hooper, 1999). Both, trimethoprim and sulphonamide drugs affect the function of enzymes involved in folic acid synthesis pathway of bacterium

(Eliopoulos & Huovinen, 2001).

Resistance to sulphonamides is mediated by drug resistant plasmid encoded by dihydrofolate reductase or dihydropteroate synthetase, which is encoded by sulI or sulII genes. Both, sulI and sulII genes are identified in Gram-negative enteric bacteria resistant to sulphonamides with almost equal frequency (Eliopoulos & Huovinen, 2001; Huovinen et al., 1995). Resistance to trimethoprim is mediated by expression of dhfr genes that inhibit binding of trimethoprim

(Huovinen et al., 1995). The dihydrofolate reductase genes dhfr1, dhfr12, and dhfr13 were identified in trimethoprim resistant Salmonella isolates (Chen et al., 2004; Doublet et al., 2003).

1.2.4 Antibiotic resistance in Salmonella from eggs or egg farm

In order to prevent antimicrobial residues in egg and egg related products, the use of antimicrobials in layer flocks is restricted. As a result, in developed countries the occurrence of antimicrobial resistance in layers is low compared to broilers (Gyles, 2008). In the USA

Salmonella isolates (n=45) from eight different serovars, recovered from commercial layer farm, were characterised for antibiotic resistance profile. Thirty-five percent (16 of 45) of the

Salmonella isolates were resistant to at least one antibiotic. A high percentage of the Salmonella isolates were resistant to tetracycline, ampicillin, streptomycin, and ceftiofur, whereas no

20 resistance was detected to gentamycin, kanamycin, and nalidixic acid. Among the eight identified serotypes, S. Kentucky, untypeable, Typhimurium (var. 5- ), and Montevideo were antibiotic resistant, whereas S. Heidelberg and Senftenberg, 8, (20): Nonmotile and 8, (20):-:z6 were susceptible to all of the antibiotics tested (Li et al., 2007). Another study in the USA characterised antimicrobial resistance in Salmonella recovered from shell eggs collected from three commercial egg-processing plants. The results of this study showed that 60.1%

Salmonella isolates were resistant to more than 11 antimicrobial compounds (Musgrove et al.,

2006). Antibiotic resistance was predominantly found in S. Typhimurium isolates for tetracycline (63.4%), nalidixic acid (63.4%), and streptomycin (61%), whereas S. Kentucky isolates exhibited susceptibility to all antimicrobials (Musgrove et al., 2006). In the UK, between 2004 and 2005, the analysis of antimicrobial susceptibility pattern of

177 Salmonella isolates from commercial layer flocks holdings showed 77.4% of Salmonella isolates were susceptible to all 16 antimicrobials tested (Snow et al., 2007).

The most frequent resistance was observed to ampicillin (15.3%), tetracycline (13.6%), sulphamethoxazole/trimethoprim (11.3%), sulphonamide compounds (10.7%), chloramphenicol (6.8%), and nalidixic acid (5.1%). Salmonella isolated in this study did not show resistance to amikacin, amoxicillin/clavulonic acid, apramycin, ceftazidine, ciprofloxacin, cefotaxime, gentamycin, and neomycin. Most antimicrobial resistance was observed amongst S. Enteritidis and S. Typhimurium isolates (Snow et al., 2007). In Japan, a total of 28 Salmonella isolates were recovered from faeces of layer hens from 2000 to 2003

(Asai et al., 2006). The antimicrobial resistance rates of layer chicken isolates to two or more antimicrobials (10.7%, 3/28) were the lowest as compared to Salmonella isolates from cattle, pig and broilers (Asai et al., 2006). In the Morocco regions, Salmonella strains (n=64) were isolated from three different egg laying farms and tested for antimicrobial susceptibility. Result of antimicrobial susceptibility testing showed that 65.6% (42/64) of Salmonella were resistant to at least 1 antibiotic and 29.70% (19/64) of Salmonella strains were resistant to two or more antimicrobial agents (Ziyate et al., 2016). Salmonella strains showed the highest percentage of 21 resistance to nalidixic acid (61%), ciprofloxacin (25%), amoxicillin (21%), tetracycycline

(25%), cephalothin (25%), streptomycin (18%), sulphonamides (14%), and gentamycin (8%).

The level of resistance to antimicrobial agents was highest in S. Kentucky isolates (25%) followed by S. Typhimurium (4.6%) (Ziyate et al., 2016). Altogether, this data suggests that resistance to antimicrobials is serovar dependent and shell eggs could pose a risk of resistant bacteria in the environment and food chain.

1.2.5 Antibiotic use in Australian poultry industry

Use of antibiotics in food animals as a growth promoter and for prevention and treatment of infectious diseases is well known. After a recommendation of the Swann report, Australia has adopted a very cautious approach to registration of antibiotics for use in commercial intensive production industry (Barton et al., 2003; Ndi & Barton, 2011; Swann et al., 1969). The antibiotics important for both animals and humans are not used as growth promotants. The intention is to minimise the amount of antibiotic residues in animal products and to minimise the transfer of antibiotic resistance from animals to humans through the food chain.

In Australia, antibiotics prohibited for use in all classes of poultry include ampicillin-clavulanic acid, fluoroquinolones, gentamycin, chloramphenicol, and nitrofurans (Australian Veterinary

Association, 2014; Barton et al., 2003; Barton & Wilkins, 2001). Only, first, third and fourth generation cephalosporin (Ceftiofur) products are specifically registered for use in cattle to treat respiratory infections (Barton et al., 2003). Antibiotics such as ampicillin, tetracycline, neomycin, spectinomycin, erythromycin lincomycin and tylosin are used as therapeutic and prophylactic agents in meat chicken industry. Bacitracin zinc, virginiamycin, avoparcin, and flavophospholipol are growth-promoting antibacterial used in the chicken meat industry for the control of chronic enteric infections (Barton et al., 2003; Barton & Wilkins, 2001). In layers, antibacterial agents such as bacitracin zinc, chlortetracycline, flavophospholipol, neomycin tylocin phosphate, tylocin tartarate, amoxicillin trihydrate, and sulfadiazine/trimethoprim are used under permit or prescribed by only registered veterinarians (Wilson, 2012). Ionophore 22 compounds such as narasin, lasalocid and salinomycin are used as coccidiostats in poultry

(Barton et al., 2003; Barton & Wilkins, 2001; Wilson, 2012).

1.2.6 Antibiotic resistance in Salmonella from Australian poultry industry

Egg and chicken meat are the two major sectors of the Australian poultry industry. Poultry products are a major source of Salmonella infection in humans. In Australia, currently there is less information describing antimicrobial resistance patterns in Salmonella isolated from commercial egg farms or eggs. The results from the Australian Reference Centre have shown differences in resistance pattern in Salmonella isolates recovered from egg and meat producing chickens (Australian Salmonella Reference Centre, 2009). Of the 1475 meat chicken isolates,

31, 10, 7 and 6 % were resistant to streptomycin, tetracycline, sulphonamides and ampicillin respectively. Whereas, of the 265 isolates from egg farms, 2, 4, 2 and 5% were resistant to streptomycin, tetracycline, sulphonamides and ampicillin respectively (Australian Salmonella

Reference Centre, 2009). Resistance to fluoroquinolones and ceftiofur was not detected in any of the isolates tested. Multidrug resistance (resistance to 4 or more antibiotics) was observed in

3% and 0.4% of chicken meat and egg farm isolates respectively (Australian Salmonella

Reference Centre, 2009; Ndi & Barton, 2011). In Australia, antimicrobial resistance in

Salmonella spp isolated from poultry is low compared to other parts of the world due to the restricted use of antibiotics however, the contamination of egg and egg products remains a significant concern for the industry (Chousalkar et al., 2015).

1.3 Egg contamination and S. Typhimurium infection in laying hens

During 2014-15, total commercial egg production in Australia was 421.3 million dozen eggs with per capita consumption of 221 eggs per year (Australian Egg Corporation Limited, 2015).

Egg contamination by Salmonella spp remains a significant challenge to the Australian poultry industry. In 2011, egg associated outbreaks comprised 48% (29/61) of all foodborne Salmonella

23 outbreaks, affecting 498 people in Australia (OzFoodNet Working Group, 2015a). Egg contamination can occur when eggs come in contact with different contaminated sources such as faeces, blood, soil, water, cage, egg belts, insects, and hands (Board & Tranter, 1995; Davies

& Breslin, 2003b). Egg and egg related products are the major vehicles of Salmonella foodborne outbreaks in Australia. Thus, improvement in egg safety standards is a major challenge to the

Australian poultry industry, public health professionals, and Government agencies.

1.3.1 Mechanism of egg contamination

Previous experimental studies have shown that both S. Enteritidis and S. Typhimurium are able to colonise reproductive organs (ovary and oviduct) and contaminate egg and contents. In most parts of the world, S. Enteritidis is a common cause of foodborne illness linked to contaminated eggs however, in Australia, the majority of the egg and egg related outbreaks are caused by S.

Typhimurium (Moffatt et al., 2016; Wales & Davies, 2011).

External and internal egg contamination by Salmonella during poultry production is influenced by many variables such as; cleaning and disinfection routines, flock size, flock age, stress, feed, vaccination, egg production process, storage, and handling of eggs (Whiley & Ross, 2015). As a result, implementation of appropriate control measures is extremely difficult. Egg contamination can occur by two routes, vertical or horizontal. Vertical transmission is a result of reproductive organ colonization (ovary and oviduct) before shell formation, whereas horizontal transmission occurs when Salmonella penetrates the eggshell membrane and contaminates egg contents after the egg is laid (De Reu et al., 2006).

Previous studies have demonstrated a relationship between increased Salmonella shedding in faeces and subsequent eggshell contamination (Gole et al., 2014b). There are several environmental stressors, which could contribute to Salmonella shedding and egg contamination in laying hens. Throughout the production cycle, birds encounter many stress events, which have negative effects on both cellular and humoral immunity of birds (El-Lethey et al., 2003).

Decreased immunity as a result of stress could make birds more susceptible to Salmonella infection, which could lead to increased shedding of Salmonella in faeces (Ricke et al., 2013a).

Onset of lay or sexual maturity is stressful for hens and may induce Salmonella shedding in faeces and egg (Gole et al., 2014a; Okamura et al., 2010). Previous longitudinal survey determined shedding of Salmonella in caged commercial layer flocks at the onset of lay (18 weeks), at 24 and 30 weeks (Gole et al., 2014a). The highest shedding of Salmonella coincided with the onset of sexual maturity. The work indicated that the load of Salmonella in faeces was highest (82.14%) at 18 weeks of age and significantly reduced to 38.88 % and 12.95% at the age of 24 and 30 weeks respectively (Gole et al., 2014a). The influence of onset of sexual maturity on egg contamination after oral infection of pullets with S. Typhimurium DT104 was examined in an earlier study and results showed that egg contamination risk increased in hens when infected at the onset of lay (Okamura et al., 2010).

1.3.2 S. Typhimurium infection in laying hens

The ability of S. Enteritidis to colonise the reproductive organs of laying hens and contaminate forming egg is well known (Gantois et al., 2009). Previous epidemiological investigations have also demonstrated links between S. Enteritidis and egg contamination (Doorduyn et al., 2006;

Gillespie et al., 2005; Marcus et al., 2007; Molbak & Neimann, 2002). Unlike US and parts of

Europe, S. Enteritidis is not endemic in commercial Australian poultry flocks, instead, S.

Typhimurium is frequently implicated in egg and egg product related outbreaks (Dyda et al.,

2009; Jardine et al., 2011; Moffatt & Musto, 2013; Reynolds et al., 2010; Stephens et al., 2007).

A recent Australian study analysed outbreak data between 2001 and 2010 and found a significant increase in the proportion of foodborne Salmonella outbreaks linked to egg and egg products (Moffatt et al., 2016).

In Australia, given the absence of S. Enteritidis in commercial flocks, soiling of eggshell with faeces and contamination of layer farm environment could be the likely sources of egg contamination. In addition, other factors such as, cross contamination of food products, 25 improper handling of eggs in the food processing area, and undercooking may likely contribute to multiple egg related outbreaks (Moffatt et al., 2016). Horizontal route of egg contamination cannot solely explain the outbreak situation in Australia, therefore transfer of S. Typhimurium by the vertical route has been hypothesised as a possible mechanism of egg contamination

(Wales & Davies, 2011). In order to improve the understanding of horizontal and vertical egg contamination by S. Typhimurium, infection studies are required in laying hens.

Experimental Salmonella infection of commercial laying hens helps to determine the course of reproductive organ invasion and subsequent contamination of egg and egg contents (Cox et al.,

2002). Previous experimental infection studies have examined reproductive organ colonisation and egg contamination by S. Typhimurium in laying hens and in comparison with other

Salmonella serovars. Results from these experiments are inconsistent due to variation in experimental design, age of birds, route of inoculation, inoculum dose as well as the strain of

S. Typhimurium selected (Baker et al., 1980; Williams et al., 1998; Leach et al., 1999; Okamura et al., 2001a; Okamura et al., 2001b; Okamura et al., 2010). The majority of earlier infection studies examined the capability of S. Typhimurium to colonise reproductive organs or egg contamination frequency up to 3 weeks post-infection (p.i.), which could fail to unveil the ability of S. Typhimurium to cause egg contamination over a prolonged period (Wales, 2011).

Altogether, there is a lack of published data arising from long-term experiments aimed at faecal shedding, reproductive organ colonisation, and egg contamination by S. Typhimurium in laying hens. The next section of this review describes the experimental S. Typhimurium infection studies in laying hens.

1.3.2.1 S. Typhimurium infection studies in laying hens with intravenous route

A number of previous studies have examined reproductive organ colonisation and egg contamination by S. Typhimurium after intravenous infection of laying hens. The intravenous injection of 4.65x106 CFU of S. Typhimurium strain in laying hens did not result in faecal shedding during the experiment and bacteria was not isolated from shell or egg contents of laid 26 eggs (Baker et al., 1980). In another experimental study by Okamura et al., (2001a), mature laying hens were intravenously inoculated with 5x106 CFU of S. Enteritidis, S. Typhimurium,

S. Heidelberg, S. Hadar, S. Infantis and S. Montevideo. On necropsy, S. Enteritidis was isolated more frequently and in higher numbers from cloaca, vagina, liver, spleen, caecal contents, ovaries, and reproductive tract organs than other serovars. Further, internal egg contamination was only observed in hens inoculated with S. Enteritidis (Okamura et al., 2001a). These findings suggest that S. Enteritidis has the ability to cause colonisation of reproductive organs, contamination of eggshell and egg contents amongst six serovars used in this study. In contrast, intravenous infection of 22 week old laying hens at higher doses (1x108CFU) of S. Enteritidis,

S. Typhimurium, S. Heidelberg, S. Virchow, and S. Hadar, showed no significant differences in colonisation of spleen and reproductive organs ( oviduct and ovaries) between S. Enteritidis and S. Typhimurium, 4, 7 and 14 days p.i. (Gantois et al., 2008). Both S. Enteritidis and S.

Typhimurium showed higher frequency (40 to 70%) of internal egg contamination than other serovars used in this study (Gantois et al., 2008). The results of these studies suggest that colonisation of reproductive organs and egg contamination is not serovar specific.

1.3.2.2 S. Typhimurium infection studies in laying hens with oral and crop route

The oral route is the most realistic and natural way of Salmonella infection, in comparison to intravenous administration. Oral infection of mature hens with 106 CFU of S. Typhimurium, S.

Senftenberg and S. Thompson for 10 consecutive days was not associated with contamination of egg contents and visceral organs. However, shedding of all Salmonella strains in faeces was recorded in almost all birds and frequency of eggshell contamination ranged from 6.3 to 9.5 % for all three serovars (Cox et al., 1973). In a short term experiment (4 days), the ability of various strains of S. Enteritidis and S. Typhimurium by oral inoculation with 1x108 CFU was compared to colonise internal organs, oviduct and forming eggs of young and mature laying hens (Keller et al., 1997). The results of this study revealed both S. Enteritidis and S.

Typhimurium were capable of colonising internal organs, oviduct, and forming eggs however,

27 only S. Enteritidis was recovered from internal egg contents of laid eggs (Keller et al., 1997).

In this study, significant differences in tissue invasiveness was observed between S.

Typhimurium and two of the three S. Enteritidis strains (Keller et al., 1997). Studies were also performed using oral infection of point in lay pullets with 107 CFU/ml of eight wild type strains of S. Typhimurium DT104 (Williams et al., 1998). The results showed both colonisation and internal egg contamination by the strains of S. Typhimurium however, variations in the frequency of internal egg contamination were evident among the strains. Faecal contamination was significantly different between strains and decreased over the two-week period. Faecal carriage of Salmonella was not correlated with contamination of egg contents in this study

(Williams et al., 1998). Based on the studies described above, substantial variations in degree of systemic and reproductive organ colonisation by S. Typhimurium and or S. Enteritidis were evident after oral infection. However, these variations were not associated with the probability of colonisation of eggs forming in the oviduct (Keller et al., 1997) or with the contamination of freshly laid eggs (Keller et al., 1997; Williams et al., 1998).

The relationship between oral dose and egg contamination is still unclear and lack of a positive correlation has been observed in previous studies. Oral infection with S. Typhimurium at the point of lay and in older hens with 1010 CFU resulted in substantial mortality and morbidity, along with decreased egg production (Brown & Brand, 1978). Although invasion of tissues including ovaries was frequent, contamination of eggshell was not detected up to three-week p.i. (Brown & Brand, 1978). In another study, oral inoculation of mature laying hens with

2.3x108 CFU of S. Typhimurium did not result in contamination of eggshell and egg contents for up to 17 days p.i., even though Salmonella was excreted in faeces (Baker et al., 1980). A recent study investigated the potential of 10 different Japanese isolates of S. Typhimurium

DT104 to contaminate egg after oral infection of old (319 or 329 day old) and point in lay (139 day old) hens at high doses (Okamura et al., 2010). Oral infection of 1x108 to 1x1010 CFU caused a significant drop in egg production however, no internal egg contamination was

28 observed in old hens. In contrast, oral infection of pullets at the onset of lay resulted in internal egg contamination of 1.7% eggs (11 of 634) in two weeks and inoculated strains were recovered from the liver, spleen, cecal contents, ovary, and follicles (Okamura et al., 2010).

1.3.2.3 S. Typhimurium infection studies in laying hens with other routes

In addition to oral and intravenous administration, contamination of egg by S. Typhimurium has also been examined with aerosol and intravaginal routes. Aerosol delivery of S.

Typhimurium DT104 with 2x102 to 2x104 CFU in point of lay pullets caused systemic infection and shedding in faeces for up to 14 days p.i. (Leach et al., 1999). The frequency of internally contaminated eggs and muscle was significantly higher following aerosol challenges compared to oral challenge with S. Typhimurium strain (Leach et al., 1999). These findings suggest greater virulence of S. Typhimurium by the aerosol route than oral infection. Similarly, aerosol infection of S. Enteritidis phage type 4 in pullets was associated with systemic colonisation, including reproductive organs (ovary and oviduct) however, S. Enteritidis was not isolated from eggs examined up to 28 day p.i. (Baskerville et al., 1992).

Mature laying hens were inoculated intravaginally with 5x106 CFU of S. Enteritidis, S.

Typhimurium, S. Infantis, S. Hadar, S. Heidelberg, and S. Montevideo to compare their abilities to invade reproductive organs and to contaminate eggs (Okamura et al., 2001b). All Salmonella strains were recovered from the outer surface of eggshells however, the contamination rate was significantly higher in hens inoculated with S. Enteritidis in comparison to S. Typhimurium or any of the other four strains. Egg contents were contaminated with S. Enteritidis (7.5%) and S.

Typhimurium (3.1%). The rate of cloaca and vaginal contamination was higher for S. Enteritidis compared with other serovars up to one week. S. Enteritidis was recovered from ovaries and all portions of oviduct however, S. Typhimurium was not recovered from any portion of the oviduct. In the same study, in vitro adherence to the vaginal epithelium by all six serovars was investigated and the results indicated the attachment of S. Enteritidis to the vaginal epithelium was significantly higher than all other serovars examined. The results of this study suggested 29 that S. Enteritidis had high affinity to attach to vaginal epithelium of reproductive tissues and may have a significant role in production of S. Enteritidis contaminated eggs (Okamura et al.,

2001b).

It has been hypothesized that inoculation of semen contaminated with Salmonella could infect ovaries and reproductive organs of hens and result in egg contamination. Experiments were conducted to determine the effect of insemination of hens with semen contaminated with 1x103

CFU of S. Enteritidis or S. Typhimurium (Reiber et al., 1995). The result of this study showed that eggshell contamination was much higher in hens challenged with S. Enteritidis than hens challenged with S. Typhimurium (Reiber et al., 1995). Both, S. Enteritidis and S. Typhimurium were recovered from ovaries and different parts of the oviduct. Both, S. Enteritidis and S.

Typhimurium were found in faecal samples taken 24 hours after insemination however, only S.

Enteritidis was recovered from faeces 7 days after insemination. There was no correlation between faecal shedding, oviduct infection and production of contaminated eggs. This data suggests that semen could serve as a vehicle to infect ovaries and reproductive organs of laying hens and result in production of contaminated eggs (Reiber et al., 1995).

The above literature suggests that S. Typhimurium was able to colonise reproductive organs and contaminate eggs either at a similar or lower frequency compared with S. Enteritidis.

However, most of the experimental infection studies in laying hens with S. Typhimurium were conducted for a very short duration and used relatively high doses. These conditions may fail or mask the real potential of S. Typhimurium in terms of its infectivity over the whole production cycle (Wales & Davies, 2011).

1.3.3 S. Typhimurium outbreaks related to egg and egg products across Australia

In 2002, OzFoodNet was established to enhance the surveillance, management and prevention of foodborne diseases across Australia (Hundy et al., 2002). The number of Salmonella

30 outbreaks linked to egg and egg products increased significantly in Australia between 2001 and

2011. These outbreaks had a significant public health impact, affected more than 3200 people, and resulted in 20% of those affected being hospitalised (Moffatt et al., 2016). Several phage types of S. Typhimurium were responsible for the egg associated S. Typhimurium outbreaks in

Australia (Moffatt et al., 2016).

Data obtained from January 2010 to January 2014 by OzFoodNet suggested, a total of 121 outbreaks of S. Typhimurium were related to the consumption of raw egg and egg related products in different food preparation settings across Australia (OzFoodNet Working Group

Quaterly Reports, from 2010 to 2015). These outbreaks resulted in 2343 cases with 347 hospitalisations. S. Typhimurium phage type 170/108 was most frequently (n=37/121, 30.57%) identified followed by phage type 9 (n=26/121, 21.48%) and phage type 135/135a (20/121,

16.52%). Together, these three phage types were responsible for 69% of 121 egg related S.

Typhimurium outbreaks (Table 2). The rate of outbreak occurrence was variable across

Australian states and territories. Highest outbreak rate was reported in Victoria (49/121,

40.49%) followed by New South Wales (38/121, 31.40%). The three most populous states of

Australia, New South Wales, Queensland, and Victoria accounted for 80% of 121 outbreaks.

Commercial food providers including restaurant, commercial caterers, takeaways, and bakeries accounted for 69.42% (78/121) of outbreaks. Twenty six percent of outbreaks occurred in private residences but total number of affected individuals were lower than commercial settings.

In all outbreak events, raw eggs, or partially cooked egg products containing food items such as aioli, hollandaise and desserts (tiramisu, fried ice cream, and mousse) were the most commonly identified food vehicles (Table 2). This data highlights the importance of eggs as a major source of S. Typhimurium outbreaks in Australia.

Table 2. Outbreaks of S. Typhimurium associated with egg or egg products reported by OzFoodNet Australia from January 2010 to January 2014

(OzFoodNet Working Group, 2010a, 2010b, 2010c, 2011a, 2011b, 2012b, 2012c, 2012d, 2013a, 2013b, 2013c, 2014a, 2014b, 2015b, 2015c, 2015d)

State/ Numbers Outbreak period Setting Causative agent Hospitalised Food vehicles Territory affected Private Suspected chocolate mousse ACT March 2010 S. Typhimurium PT 170 4 0 residence containing raw egg Private Suspected mayonnaise NSW January 2010 S. Typhimurium PT 170 5 4 residence prepared with raw eggs National NSW January 2010 S. Typhimurium PT 9 Unknown Unknown Aioli prepared with raw egg franchised fast Privatefood Suspected tiramisu prepared NSW March 2010 S. Typhimurium 9 1 residence with raw eggs Private VIC January 2010 S. Typhimurium PT 170 12 1 Suspected eggs residence VIC January 2010 Restaurant S. Typhimurium PT 9 13 1 Suspected eggs

VIC February 2010 Restaurant S. Typhimurium PT 9 8 1 Suspected eggs Private VIC March 2010 S. Typhimurium PT 135a 5 0 Suspected chicken or eggs residence WA December 2010 Restaurant S. Typhimurium PT 170 7 1 Scrambled eggs

WA January 2010 Restaurant S. Typhimurium PT 170 25 5 Aioli and Caesar salad

Tartare sauce, prepared with NSW March 2010 Restaurant S. Typhimurium 170 6 3 raw egg 32

Mayonnaise made with raw NSW April 2010 Takeaway S. Typhimurium 170 9 0 egg

NSW June 2010 Takeaway S. Typhimurium 170 45 8 Chicken, hummus, tabouli

QLD June 2010 Restaurant S. Typhimurium 34 1 Citrus aioli

Private S. Typhimurium (MLVA: 3-9-7-13- Unknown, possibly mousse NSW July 2010 9 5 residence 523) cake with raw eggs Private VIC August 2010 S. Typhimurium PT 170 4 2 Eggs residence Suspected Vietnamese pork NSW October 2010 Takeaway S. Typhimurium 170 15 3 rolls- commonly knows to contain egg Suspected salmon patties made NSW November 2010 Restaurant S. Typhimurium 2 1 with egg Suspected Vietnamese pork NSW December 2010 Takeaway Suspected S. Typhimurium 8 Unknown rolls Private Banana milkshake containing QLD December 2010 S. Typhimurium 4 2 residence raw egg Homemade ice cream TAS December 2010 Restaurant S. Typhimurium PT 170 38 2 containing raw egg

VIC October 2010 Restaurant S. Typhimurium PT 9 10 1 Hollandaise sauce

Caesar salad dressing – raw NSW January 2011 Restaurant S. Typhimurium 11 1 egg†

Vietnamese pork/chicken/salad NSW January 2011 Takeaway S. Typhimurium PT 44 85 17 rolls containing raw egg butter† Dessert containing raw egg NSW February 2011 Restaurant S. Typhimurium 10 0 custard† NSW February 2011 Restaurant S. Typhimurium PT 170 6 2 Fried ice cream† S. Typhimurium MLVA profile 1- QLD January 2011 Unknown 49 6 Eggs† 5-5-2-3 SA March 2011 Bakery S. Typhimurium PT 135 6 2 Egg wash†

Salty fish, pork and eggs VIC February 2011 Restaurant S. Typhimurium PT 170 15 6 Vietnamese dish S. Typhimurium PT 170 and S. Sushi made with raw egg VIC February 2011 Takeaway 26 6 Typhimurium RDNC A066 mayonnaise† Sushi made with raw egg VIC February 2011 Takeaway S. Typhimurium PT 9 84 19 mayonnaise† Vietnamese pork roll with raw WA January 2011 Takeaway S. Typhimurium PT 9, PFGE 0001 15 5 egg butter† Eggs in home-made Private S. Typhimurium (MLVA profile 3- NSW April 2011 3 0 hollandaise sauce and a residence 13-12-10-523) homemade semifreddo† Suspect prawn dumplings S. Typhimurium PT 135 (MLVA NSW May 2011 Restaurant 4 2 prepared with minced prawn, profile 3-13-11-9-523) coriander and egg to bind S. Typhimurium (MLVA profile 3- NSW May 2011 Restaurant 8 0 Chicken; eggs† 10-9-8-523)

SA April 2011 Community S. Typhimurium PT 9 48 11 Eggs†

Private VIC April 2011 S. Typhimurium PT 141 2 0 Chocolate mousse (raw eggs)† residence Private Potato salad with raw egg VIC April 2011 S. Typhimurium PT 135a 9 5 residence mayonnaise† Private VIC April 2011 S. Typhimurium PT 170 2 0 Raw muffin batter† residence Private VIC April 2011 S. Typhimurium PT 170 2 2 Raw pancake batter† residence VIC April 2011 Restaurant S. Typhimurium PT 170 15 2 Fried ice cream† S. Typhimurium MLVA profile 3- NSW July 2011 Restaurant 13 1 Raw egg tiramisu 9-8-14-523 S. Typhimurium MLVA profile 3- NSW August 2011 Restaurant 6 0 Raw egg dressing 9-7-13-523 S. Typhimurium MLVA profile 3- NSW August 2011 Restaurant 3 0 Raw egg mayonnaise 9-7-15-523 VIC August 2011 Restaurant S. Typhimurium PT 170 14 1 Raw egg chocolate mousse Private VIC August 2011 S. Typhimurium PT 135 4 2 Suspected eggs residence Private VIC September 2011 S. Typhimurium PT 44 11 0 Raw egg tiramisu residence S. Typhimurium PT 170 MLVA Chicken Caesar roll containing ACT December 2011 Restaurant 41 7 profile 03-09-07-14-523 raw egg mayonnaise Private VIC December 2011 S. Typhimurium PT 9 4 0 Raw egg chocolate mousse residence

Pizza containing egg and raw VIC December 2011 Takeaway S. Typhimurium PT 170 37 11 egg chocolate mousse

ACT February 2012 Restaurant S. Typhimurium PT 135a 7 3 Eggs

S. Typhimurium PT 170 / MLVA Raw egg mayonnaise ACT February 2012 Restaurant 10 1 profile 03-10-07-12-523 suspected S. Typhimurium PT 170 / MLVA ACT March 2012 Restaurant 22 0 Raw egg white emulsions profile 03-09-08-13-524 S. Typhimurium MLVA profile 03- NSW January 2012 Restaurant 14 2 Deep fried ice cream 09-07-12-523 (historically PT 170) S. Typhimurium MLVA profile 03- NSW January 2012 Restaurant 5 0 Eggs and omelettes 09-07-13-523 (historically PT 170)

S. Typhimurium MLVA profile 03- NSW February 2012 Restaurant 20 3 Raw egg mayonnaise 09-07-13-523 (historically PT 170) S. Typhimurium MLVA profile 03- NSW February 2012 Restaurant 9 0 Deep fried ice cream 09-09-12-523 S. Typhimurium PT 170 MLVA NSW March 2012 Restaurant 18 1 Raw egg products suspected profile 03-09-09-12-523

S. Typhimurium MLVA profile 03- NSW March 2012 Restaurant 4 2 Burger with egg and bacon 13-09-11-550 (historically PT 135)

S. Typhimurium PT 44 MLVA Vietnamese rolls with raw egg NSW March 2012 Takeaway 11 0 profile 03-10-08-09-523 butter Private S. Typhimurium MLVA profile 03- Chocolate cake with raw egg QLD January 2012 4 0 residence 13-10-10-524 meringue

S. Typhimurium MLVA profile 03- QLD March 2012 Restaurant 5 1 Deep fried ice cream suspected 12-13-09-524 Egg-based sauces (consumed TAS February 2012 Takeaway S. Typhimurium PT 141 8 3 with seafood) S. Typhimurium PT 135a (MLVA ACT April 2012 Restaurant 20 2 Eggs Benedict profile 03-13-11-10-523) S. Typhimurium MLVA profile 03- NSW April 2012 Restaurant 09-09-12-523 (historically 5 1 Deep fried ice-cream associated with PT 170) S. Typhimurium MLVA profile 03- NSW May 2012 Restaurant 09-09-12-523 (historically 12 0 Deep fried ice-cream associated with PT 170) S. Typhimurium MLVA profile 03- NSW June 2012 Restaurant 09-07-12-523 (historically 3 0 Ice-cream containing raw egg associated with PT 170) Suspect raw egg mayonnaise TAS April 2012 Other S. Typhimurium PT 135 44 2 and/or tartare sauce Private Salmonella sub species I ser VIC April 2012 14 2 Raw egg ice-cream cake residence 4,5,12:i:- PT 193 Private VIC April 2012 S. Typhimurium PT 4 4 4 Raw egg smoothies residence VIC April 2012 Aged care S. Typhimurium PT 170 12 1 Vitamised meals

Commercial S. Typhimurium PT 170 / MLVA NSW August 2012 14 0 Raw egg mayonnaise caterer profile 03-09-08-14-523 S. Typhimurium PT 16 / MLVA Chicken Caesar salad with raw QLD August 2012 Restaurant 3 3 profile 03-13-11-11-524 egg dressing

Fried ice cream made using SA September 2012 Restaurant S. Typhimurium PT 9 11 1 raw eggs Private Chocolate mousse containing VIC July 2012 S. Typhimurium PT 135a 7 0 residence raw eggs Private VIC October 2012 S. Typhimurium PT 12a 7 1 Noodles with chicken and egg residence Private Suspected chocolate mousse VIC November 2012 S. Typhimurium PT 135a 5 1 residence made with raw eggs Scrambled eggs or chicken VIC December 2012 Unknown S. Typhimurium PT 170 3 1 teriyaki Private VIC December 2012 S. Typhimurium PT 170 3 3 Raw egg drink residence S. Typhimurium MLVA profile 03- NSW February 2013 Restaurant 7 3 Fried ice cream with raw egg 09-07/08-14-523 Private S. Typhimurium MLVA profile 03- NSW March 2013 4 4 Raw egg smoothies residence 17-09-12-523 Private Caesar salad dressing NT February 2013 S. Typhimurium PT 9 4 2 residence containing raw egg S. Typhimurium PT 9 MLVA SA March 2013 Restaurant 9 1 Eggs profile of 03-15-06-11-550 Correctional VIC January 2013 S. Typhimurium PT 135 3 1 Raw egg drink facility Private VIC January 2013 S. Typhimurium PT 135a 10 1 Tiramisu containing raw eggs residence VIC March 2013 Restaurant S. Typhimurium PT 44 22 2 Scrambled eggs

S. Typhimurium PT 170/108, Potato salad containing raw ACT May 2013 Restaurant 161 17 MLVA profile 03-09-07-13-523 egg mayonnaise

VIC April 2013 Bakery S. Typhimurium PT 170/108 21 1 Cake Private VIC April 2013 S. Typhimurium PT 64 3 1 Frittata residence

VIC May 2013 Restaurant S. Typhimurium PT 44 36 7 Tartare sauce/aioli (raw eggs)

Private VIC June 2013 S. Typhimurium PT 9 2 0 Raw egg mayonnaise residence S. Typhimurium PT 16, MLVA 03- QLD July 2013 Restaurant 30 3 Eggs Benedict 13-10-11-524 S. Typhimurium PT 135a, MLVA SA August 2013 Restaurant 9 3 Tartare sauce 03-14-10-10-523 S. Typhimurium PT 9, MLVA 03- SA September 2013 Restaurant 15 1 Coleslaw made with raw egg 24-12-10-523

VIC July 2013 Restaurant S. Typhimurium PT 135a 6 0 Suspected bacon and egg pie

WA July 2013 Restaurant S. Typhimurium PT 135a, PFGE 39 12 4 Eggs Vietnamese-style rolls S. Typhimurium PT 170 MLVA NSW October 2013 Bakery 49 21 containing raw egg 03-10-07-14-523 mayonnaise Commercial S. Typhimurium PT 16 MLVA 03- Potato salad containing raw QLD November 2013 350 12 caterer 13-10-12-524 egg mayonnaise S. Typhimurium PT 170/108 Chocolate mousse containing QLD November 2013 Restaurant 20 5 MLVA 03-09-07-14-524 raw egg

S. Typhimurium PT 9 MLVA 03- SA October 2013 Restaurant 11 4 Aioli made with raw egg 24-12-10-523 VIC November 2013 Hospital S. Typhimurium PT 135 27 0 Suspected undercooked eggs

Private Suspected pasta carbonara VIC November 2013 S. Typhimurium PT 9 3 0 residence containing undercooked eggs S. Typhimurium MLVA profile 03- NSW January 2014 Bakery 24 9 Vietnamese rolls 17-10-11-523 S. Typhimurium MLVA profile 03- NSW January 2014 Restaurant 2 0 Raw egg Caesar salad dressing 24-12-12-523 S. Typhimurium MLVA profile 03- Vietnamese rolls with raw egg NSW February 2014 Bakery 26 3 16-09-12-523 butter S. Typhimurium MLVA 03-10/11- NSW February 2014 Other 8 2 Raw egg mayonnaise 07-12-523 S. Typhimurium PT 135a MLVA QLD January 2014 Restaurant 10 1 Suspected raw egg sauce profile 03-12-12-09-524 SA February 2014 Restaurant S. Typhimurium PT 135 4 2 Raw egg aioli

Suspected raw egg SA March 2014 Restaurant S. Typhimurium PT 9 33 5 contamination of pesto Lightly cooked eggs and/or VIC February 2014 Camp S. Typhimurium PT 9 4 0 hollandaise sauce Lightly cooked eggs and/or VIC February 2014 Restaurant S. Typhimurium PT 135a 2 0 hollandaise sauce VIC February Restaurant S. Typhimurium PT 9 2 1 Raw egg aioli

VIC February 2014 Restaurant S. Typhimurium PT 9 3 1 Undercooked eggs

VIC February 2014 Restaurant S. Typhimurium PT 9 6 0 Undercooked eggs

VIC February 2014 Restaurant S. Typhimurium PT 9 15 26 Raw egg mayonnaise

VIC February 2014 Restaurant S. Typhimurium PT 9 13 1 Suspect raw egg aioli

VIC February 2014 Restaurant S. Typhimurium PT 9 242 5 Lightly cooked eggs Private Suspect undercooked eggs in VIC February 2014 S. Typhimurium PT 44 6 3 residence pasta dish Private VIC Mar 2014 S. Typhimurium PT 9 3 0 Raw egg tiramisu residence VIC Mar 2014 Restaurant S. Typhimurium PT 9 3 2 Raw egg aioli Undercooked eggs in VIC Mar 2014 Restaurant S. Typhimurium PT 9 14 5 hollandaise sauce

The month of outbreak represents the month of onset of outbreak * No foodborne outbreaks were reported by the Northern Territory † Suspected/confirmed egg associated outbreaks MLVA- Multi-locus variable number of tandem repeat analysis PFGE- Pulsed-field gel electrophoresis PT- Phage type ACT- Australian Capital Territory NSW- New South Wales NT- Northern Territory QLD- Queensland SA- South Australia TAS- Tasmania VIC- Victoria

Several intervention strategies are described in the literature to reduce the risk of Salmonella contamination both at pre-harvest and post-harvest level. Although, application of single or a combination of intervention strategies has reduced levels of Salmonella contamination, complete elimination of this pathogen has yet to be achieved (Galiş et al., 2013; Ricke et al.,

2015). Biofilm formation could be one of the mechanisms that Salmonella spp utilizes for overcoming some interventions and surviving harsh physical and chemical environments. A biofilm is a community of bacterial cells attached to surfaces, and encased in self-produced extracellular polymeric matrix (Costerton et al., 1999). Previous studies have shown that

Salmonella spp are able to form biofilm on food processing surfaces and remain viable for prolonged periods. It is well known that the cells in biofilm are resistant to commonly used disinfectants and as a result, their elimination is difficult. Biofilm formation is a serious food safety concern as cells in biofilm could act as a continuous source of infection and cross contaminate other food products in the food production environment (Steenackers et al., 2012).

In Australia, there is limited information available in the literature on the biofilm formation ability of Salmonella enterica spp isolated from layer farm environments.

1.4 Salmonella biofilms

Salmonella spp are able to form biofilm on many surfaces, such as stainless steel (Hood &

Zottola, 1997; Joseph et al., 2001; Nguyen et al., 2014; O'Leary et al., 2015), plastics, cement

(Joseph et al., 2001), rubber (Arnold & Yates, 2009) glass, (De Oliveira et al., 2014; Prouty &

Gunn, 2003; Solano et al., 2002), epithelial cells (Boddicker et al., 2002) and gall stones (Prouty

& Gunn, 2003). However, there is limited information available in the literature on the ability of Salmonella spp to form a biofilm on eggshell surface. Biofilm formation is a serious concern for water, shipping, food industry and human and animal health (Simm et al., 2014). Biofilms formed on food preparation surfaces and equipment in domestic and industrial settings could act as a vehicle for contaminating food products, reducing their shelf life, or further spreading the pathogenic bacteria to other hosts risking public health (Shi & Zhu, 2009). Additionally, it 42 has been demonstrated that cells in biofilms are more resistant to commonly used disinfectants, antibiotics and environmental stressors compared to their planktonic counterparts (Corcoran et al., 2014; Olson et al., 2002; Steenackers et al., 2012; Wong et al., 2010a). Understanding the mechanism of Salmonella biofilm formation, composition and its susceptibility to various antimicrobials, will aid in the management of this pathogen.

1.4.1 Control measures against biofilm

There are several conventional methods such as physical and or mechanical removal, chemical removal and the use of antimicrobials, disinfectants, or sanitizers to control and remove biofilms in food industry. However, none of these procedures is fully effective against biofilms due to the emergence of resistant phenotypes (Sadekuzzaman et al., 2015). Recent advances in the area of biofilm research has led to the development of novel strategies for prevention and control of biofilms. Several new methods such as quorum sensing antagonistic molecules, bacteriophages, enzyme based detergents, pulsed light /laser decontamination devices, ultra- sonication, nanotechnology, photodynamic therapy, biosurfactants, bacteriocin, and natural compounds (plant extracts, essential oils and organic acids) have been successfully shown to be an effective alternative against biofilm formation (Sadekuzzaman et al., 2015; Simões et al.,

2010). Moreover, combination of these innovative anti-biofilm approaches coupled with conventional techniques (chemical and physical) could mitigate the losses associated with biofilm formation in the near future (Sadekuzzaman et al., 2015).

In recent years, most of the research focus has shifted towards developing active biofilm targeted treatments using natural compounds. These compounds are easily degradable in the environment, efficiently penetrate biofilm structure, and have a high level of activity against pathogens (Bridier et al., 2015). Moreover, with the changing regulatory requirements, antimicrobial agents considered as standard today could be banned in coming years (Reach EU directive on biocides, 98/8EC). Therefore, it would be appropriate to find suitable alternatives, which are environmentally friendly and residue free, for efficient eradication of surface biofilms 43

(Bridier et al., 2011). In recent years, use of antimicrobials derived from natural sources against biofilms has gained much attention due to their accepted safe status. Organic acids are generally recognised as safe and are approved by Food and Drug Administration (Mani-López et al.,

2012). Antimicrobial properties of organic acids are well known however, their activity against biofilms is less studied.

1.4.2 Salmonella biofilm formation and composition

Biofilm formation is a complex process divided into several stages: 1) initial reversible attachment of bacterial cells, driven by weak interactions (van der Walls forces) with surface;

2) irreversible attachment to the surface occurs via hydrophilic or hydrophobic interaction with the help of several attachment structures such a flagella, fimbriae, lipopolysaccharides or adhesive proteins; 3) early development of biofilm architecture (micro colony formation) resulting from proliferation and production of extracellular matrix; 4) formation of mature biofilm containing open water channels through which nutrients and signalling molecules are effectively distributed within the biofilm; 5) detachment of biofilm cells individually or in clumps due to increased fluid shear, endogenous enzymatic degradation, release of exopolysaccharides or surface binding proteins; and 6) dispersion of cells is the last step in biofilm formation cycle that allows colonisation of new niches (Sadekuzzaman et al., 2015;

Srey et al., 2013). The formation of biofilm is influenced by several factors such as, Salmonella strain (Castelijn et al., 2012; Lianou & Koutsoumanis, 2012), serovar (Schonewille et al., 2012;

Vestby et al., 2009), geographic location of isolates (Seixas et al., 2014), type of surface material (De Oliveira et al., 2014; Nguyen et al., 2014; O'Leary et al., 2013), temperature (De

Oliveira et al., 2014; Nguyen et al., 2014) and nutrients available (Castelijn et al., 2012).

Biofilm matrix is mainly composed of extracellular material containing polymeric substances.

The composition of biofilm may differ between bacterial species and environmental conditions.

The rdar (red, dry and rough) morphotype defining the composition of extracellular matrix components is the most studied morphotype of Salmonella multicellular behaviour. Salmonella 44 biofilms are structurally composed of proteinaceous compounds and exopolysaccharides. The proteinaceous fraction consists of adhesive curli fimbriae (Tafi or aggregative fimbriae (agf) in

Salmonella), and secreted large surface protein BapA. The exopolysaccharide fraction is mainly composed of cellulose, the O-antigen capsule, capsular polysaccharides, and lipopolysaccharides (Steenackers et al., 2012).

Curli fimbriae and cellulose are the predominant components of biofilm matrix and their co- expression results in formation of a highly hydrophobic network with tightly packed cells embedded in rigid matrix (Solano et al., 2002; Zogaj et al., 2001). Previous studies have shown that curli fimbriae and cellulose enhances resistance of Salmonella to desiccation and is linked to long-term survival of Salmonella in the harsh environment (White et al., 2006).

The expression of curli and cellulose is regulated by a complex regulatory network (Figure 1). csgD is a transcriptional regulator of the LuxR superfamily that positively regulates the expression of Salmonella biofilm associated extracellular matrix components, including curli fimbriae and cellulose (Gerstel & Römling, 2003; Grantcharova et al., 2010; White et al., 2008). csgD stimulates the curli production through transcriptional activation of the csgBAC operon, which encodes the major curli subunit CsgA, as well as nucleator protein CsgB. csgD also indirectly regulates the cellulose synthesis by activating transcription of adrA. Being a member of the GGDEF protein family, AdrA synthesizes c-di-GMP as diguanylate cyclase and its transcription is regulated by csgD (Liu et al., 2014). BapA, a large surface protein involved in biofilm formation and the expression of bapA, is coordinated with that of genes encoding curli fimbriae and cellulose, through the action of csgD (Latasa et al., 2005; Wang et al., 2016).

Deletion of bapA resulted in the loss of capacity to form a biofilm, whereas the overexpression of bapA was associated with increased biofilm biomass formation (Latasa et al., 2005).

Figure 1. A diagrammatic illustration of the role of CsgD in the curli fimbriae and cellulose production during Salmonella biofilm formation. The curli subunits CsgA and CsgB are encoded by csgBAC operon which is positively regulated by the master regulator CsgD.

Cellulose synthesis is regulated by CsgD at post-transriptional level by controlling the activity of several cellulose synthases including BcsA through the synthesis of c-di-GMP by AdrA. C- di-GMP is synthesized as diguanylate cyclase by AdrA and its transription is regulated by CsgD

(Liu., 2014). BapA is a large surface protein required for biofilm formation. The expression of bapA are activated through the genes that encodes curli and cellulose via the action of CsgD

(Jonas et al., 2007).

1.4.3 Identification of biofilm formation based on colony morphology

A number of previous studies have examined biofilm development in Salmonella isolates by colony morphotypes on Congo red agar. This method involves growing Salmonella on Luria

Bertani agar plates supplemented with Congo red, coomassie brilliant blue and calcofluor dyes.

These indicator dyes aid in detection of curli fimbriae and cellulose, which are the major components of Salmonella biofilm (O'Leary et al., 2013; Romling et al., 1998; Zogaj et al.,

2001). Multicellular behaviour by Salmonella spp is often categorised according to the colony 46 morphology into rdar (red, dry and rough) expressing curli fimbriae and cellulose, bdar (brown, dry and rough) expressing only curli fimbriae, pdar (pink, dry and rough) expressing only cellulose and saw (smooth and white) expressing neither curli fimbriae nor cellulose (Giaouris

& Nesse, 2015). In addition to Congo red assays, there are several other methods such as, light microscopy, electron microscopy, atomic force microscopy, confocal microscopy, liquid-air pellicles and microtiter plate assay that are routinely used to demonstrate the role of key components of Salmonella biofilm (Castelijn et al., 2012; Giaouris et al., 2015; Jonas et al.,

2007; Simm et al., 2014). Biofilm formation is one of the major challenges in controlling

Salmonella contamination outside the host environment. Control of biofilm is complicated due to their inherent nature and resistance to commonly used antimicrobials.

1.4.4 Salmonella biofilm resistance to antimicrobials

Both in the host and non-host environments, biofilm formation confers resistance in Salmonella to numerous stress factors such as antimicrobial agents, desiccation, stress, heat, low pH and ionizing radiation (Steenackers et al., 2012). Several studies have investigated and compared the efficiency of different antimicrobial agents against Salmonella biofilms and planktonic cells. It has been concluded that cells in biofilm are more resistant to commonly used disinfectants compared to their planktonic counterparts (Joseph et al., 2001; Olson et al., 2002;

Wong et al., 2010a). Age of biofilms is one of the key factors that influences the susceptibility of biofilms to various antimicrobial compounds. There is a general consensus that age or maturity of biofilms is associated with increased resistance to antimicrobial substances however, conflicting results were observed between studies. Previous studies have documented increased resistance to antimicrobials with increasing age of biofilm (Anwar & Costerton, 1990;

Corcoran et al., 2014; Fraud et al., 2005; Nguyen & Yuk, 2013; Shen et al., 2011). In contrast, the age of biofilm was not associated with increased resistance to antimicrobials (Gilbert et al.,

2001; Kim et al., 2007; Wilson et al., 1996; Wong et al., 2010b).

Structure and physiological attributes of biofilm cells confer an inherent resistance to antimicrobial agents such as antibiotics, disinfectants and germicides (Donlan & Costerton,

2002). Several factors such as, reduced diffusion of antimicrobial agent through exopolysaccharide matrix, alterations in the growth rate of biofilm cells and other physiological changes such as specific gene expression in response to direct environmental conditions, development of stress response, expression of multi drug efflux pumps and presence of persister cells, have been suggested to contribute to antimicrobial resistance in biofilm cells (Bridier et al., 2015; Donlan & Costerton, 2002; Mah & O'Toole, 2001). Although commonly known mechanisms of biofilm resistance have been suggested above, exact mechanisms of resistance of biofilms remain unclear or not fully understood. Given that, biofilm development is a multicellular process, it could be possible that multiple defence mechanisms are involved in antimicrobial resistance in biofilms.

1.4.5 Intervention strategies for Salmonella control on farm

The environmental contamination of layer flocks by Salmonella is a worldwide issue. There are several pre-harvest and post-harvest methods that are widely used to reduce Salmonella contamination of layer flocks. Pre-harvest methods include; 1) genetic lines of laying hens resistant to Salmonella, 2) flock management such as biosecurity, pest control, cleaning and disinfection, 3) feed management practises, 4) vaccination and 5) natural antimicrobial products such as; bacteriophage, competitive exclusion flora, probiotics, prebiotics and organic acids.

Post-harvest methods involve; 1) egg storage at ambient temperature, 2) chemical methods such as; egg washing with sanitisers, electrolysed water, ozone and hydrogen peroxide, 3) physical methods such as irradiation, UV, microwave, pulsed light, gas plasma technology and 4) biological methods such as plant extracts (Galiş et al., 2013).

A common and basic control method is routine cleaning and disinfection of sheds in layer flocks, although its efficacy is highly variable. Previous studies have demonstrated reduction in Salmonella contamination in laying houses after cleaning and disinfection, but complete 48 elimination of Salmonella from layer farms was not achieved (Davies & Breslin, 2003a; Wales et al., 2007). Wildlife species have also been identified as an important vector of Salmonella contamination of layer farms (Davies & Breslin, 2003b; Wales et al., 2007). There is evidence of several wildlife vectors such as mice, rats, flies, litter beetles and foxes involved in maintaining Salmonella infection on farms (Davies & Breslin, 2003c; Liebana et al., 2003).

Therefore, control of these different vectors would reduce the introduction of Salmonella into layer flocks.

Another important method of Salmonella prevention in poultry is vaccination. There are currently two types of Salmonella vaccines, live, and killed (Howard et al., 2012). Live vaccines are produced by spontaneous mutations or attenuation by chemical or ultraviolet mutagenesis

(De Buck et al., 2004). In Australia, there is no recognised vaccination control program in layer flocks against Salmonella serovars that are relevant to human health. There are variations between individual producers and across the states in vaccination activities (Moffatt et al.,

2016) because long-term efficacy of the currently available S. Typhimurium vaccine in field conditions is uncertain. For post-harvest control, egg washing is extensively used in Australia,

Canada, USA, and Japan to reduce eggshell contamination (Galiş et al., 2013; Hutchison et al.,

2004). However, the advantages of egg washing have been debated due to risk of cuticle damage and Salmonella penetration from the shell surface into egg contents. Previous work has indicated that egg washing may increase the likelihood of penetration of S. Typhimurium through the eggshell, particularly during storage and drying conditions, if egg-washing procedures are below standard (Gole et al., 2014c).

1.5 Organic acids

Organic acids and their salts are widely used as food additives and preservatives, but also have applications in pre and post-harvest food production and processing (Ricke, 2003). Organic acids have several advantages as antimicrobials because they are a generally recognised as safe

(GRAS), have no acceptable daily intake, are low cost and easy to manipulate (Mani-López et al., 2012). Organic acids are a group of compounds with a –COOH bond and pH dependent proton dissociation property. There are different types of organic acids such as, simple short chain, medium chain, long chain fatty acids, side chained simple, complex acids and aromatic acids (Van Immerseel & Atterbury, 2013). Organic acids, such as acetate, propionate, and butyrate are produced in smaller quantities in the gut environment of food animals and humans, with higher concentration in regions where anaerobic microflora are abundant (Ricke 2003).

Organic acids are relatively stable and are usually metabolised by food animals or are excreted unabsorbed, therefore do not create an issue of residues in the food (Wales et al., 2010).

1.5.1 Mechanism of antimicrobial action of organic acids

The anti-microbial mechanism of organic acids is derived from their ability to cross bacterial cell membranes. Once internalised in the cell cytoplasm, organic acids dissociate into anions and protons and interfere with the pH homeostasis of the cell. In addition to alterations in cellular pH gradient, other toxicity effects of organic anions that attribute membrane structure, osmolality and macromolecule synthesis have also been investigated (Cherrington et al., 1990;

Ricke, 2003; Russell, 1992; Van Immerseel et al., 2006; Wales et al., 2010). The antibacterial activity of organic acids differs between molecules and is dependent on chemical structure.

There are large variations in minimum inhibitory concentrations (MIC) for certain acids when different bacterial species are exposed. For example, the MIC of acetic acid is 250 times lower for Bacillus subtilis than for lactobacilli (Hsiao & Siebert, 1999). The lactobacilli were much more resistant to acetic, benzoic, butyric and lactic acids while E. Coli was most resistant to citric, malic and tartaric acid.

1.5.2 Effects of organic acid on survival and virulence of Salmonella

Medium chain fatty acids (MCFA; caproic, caprylic, carpic and lauric acid-C6 to C12) are much more effective against Salmonella than short chain fatty acids (SCFA) such as formic, acetic,

50 propionic and butyric acid). As little as 25 mM concentration of C6-C10 acids were bacteriostatic to S. Enteritidis, but the same strain tolerated 100 mM of SCFA (Van Immerseel et al., 2003; Van Immerseel et al., 2004b). Similarly. S. Enteritidis and S. Typhimurium were incubated with low concentrations of monocaprin (5 nM) that had been combined with an emulsifier and the bacteria did not survive (Thormar et al., 2006). This data suggests MCFA are more effective against Salmonella however, large-scale studies are lacking to support this claim.

Organic acid products are generally used in poultry with the aim to reduce Salmonella shedding, internal organ and gut colonisation. Penetration of intestinal epithelial cells is the initial step in

Salmonella pathogenesis. Thus, invasion of intestinal epithelial cells must be controlled because this virulence attribute is directly associated with gut colonisation in poultry (Bohez et al.,

2008). Invasion genes are located on Salmonella Pathogenicity Islands 1 (SPI-1) and promotes the activity of invasion however, several other SPI’s are also required for advancement of pathogenesis. hilA, the environmentally regulated gene is the most important regulatory gene of SPI-1 (Van Immerseel et al., 2006). Organic acids such as propionic acid and butyric acid have been shown to differentially regulate hilA expression. S. Enteritidis and S. Typhimurium when pre-incubated with propionic and butyric acids, were less invasive in human and porcine intestinal cell lines and chicken caecal epithelial cells in vitro however, the invasion potential was more when pre-incubated with acetic acid supplemented medium. The invasion was found to be associated with effects of hilA expression (Durant et al., 1999; Lawhon et al., 2002; Van

Immerseel et al., 2004a; Van Immerseel et al., 2004b). The effect of organic acids in feed and water to reduce Salmonella colonisation has been studied extensively in broilers however, such studies in layers are lacking.

1.5.3 Studies on efficacy of organic acids in poultry

Commercial organic acid formulations are widely used in the poultry industry as feed and water additives to combat specific pathogens, including Salmonella. Every commercial organic acid 51 product is not tested for their inhibitory and bactericidal properties against Salmonella serovars isolated from layer farm environment. However, some data on efficacy of organic acids that are potentially used as feed and water additives to control Salmonella contamination is available in poultry.

Organic acids are used in feed, drinking water and other matrices to prevent Salmonella colonisation in animal tissue and further transmission through the food chain (Van Immerseel et al., 2006). Contaminated poultry feed is considered to be a major source of Salmonella in layer farm environments (Williams, 1981). It is believed that incorporating organic acids in feed would decontaminate feed and reduce the uptake of Salmonella by chickens. A commercial brand of formic acid significantly reduced the number of Salmonella positive breeder feed samples from 4.1% to 1.1% after the treatment of feed with 0.5% formic acid (Humphrey &

Lanning, 1988).

In a large-scale study (three years), incidence of Salmonella infection in newly hatched chicks was reduced when breeder hens were fed with formic acid treated feed (Humphrey & Lanning,

1988). Breeder hens that received feed treated with formic acid had fewer numbers of

Salmonella in the litter (4.3% vs 1.4%), hatchery waste (15.3% vs 1.2%) and insert papers

(4.6% vs 1.4%). These decreases were evident from the moment breeder hens received formic acid treated feed and illustrate the effects of formic acid on vertical transmission of Salmonella

(Humphrey & Lanning, 1988).

Researchers have developed new range of products in which SCFA are encapsulated in mineral carriers resulting in slow release during the transport of these acid products through the intestinal tract. Previous study has examined the efficacy of acetic acid (0.24%), formic acid

(0.22%) or propionic acid (0.27%) as film coated microcapsules on colonisation of S. Enteritidis in the caeca, liver, and spleen. The results showed significant increase in caecal colonisation of

S. Enteritidis when acetic acid was added, but a significant decrease in caecal colonisation was

52 observed when butyric acid was added to the feed. Internal organ colonisation was increased when acetic or formic acid was added to the feed (Van Immerseel et al., 2004c). The effect of powder and coated butyric acid were compared for their ability to control Salmonella colonisation of caeca and internal organs after infection of young chickens with S. Enteritidis.

Coated butyric acid was superior to uncoated butyric acid in reducing S. Enteritidis colonisation of the caeca and internal organs of specific pathogen free layer chickens (Van Immerseel et al.,

2005).

Drinking water is one source of Salmonella contamination, thus maintaining water free of

Salmonella is critical. Water acidification is also one of the methods for controlling Salmonella infections and or contamination on farm. SCFA are commonly used in water as sanitizers (Van

Immerseel et al., 2006). Commercial organic acids with blends of acids or salts are commonly marketed in the poultry industry. These products differ in their composition, ability to reduce pH and appear to have highly variable antibacterial activity from product to product in water and feed (Wales et al., 2010). A recent study examined the effects of 13 commercial organic acid products (water and feed products) on S. Enteritidis and S. Typhimurium. All products tested against both Salmonella strains revealed little variations between strains with respect to inhibitory and bactericidal activity of each product. However, significant variations were observed between products. The water source had a strong influence on the organic acid activity in this study. The ability of organic acid products to reduce Salmonella contamination was higher in tap water in comparison with mineral or river water (Wales et al., 2013). The antibacterial activity of organic acids against Salmonella is studied extensively in different matrices however, the efficacy of commercial formulations against Salmonella biofilms is not widely studied.

1.5.4 Use of organic acids against biofilms

Although several studies have demonstrated the effect of organic acid against Salmonella contamination in poultry, there are few studies that examined the effect of organic acid against 53

Salmonella biofilms. Phenolic products or polyphenols are one of the most ubiquitous groups of phytochemicals. Ferulic and gallic acids are examples of phenolic acids of plant origin and their activity against biofilms formed by E. coli, Pseudomonas aeruginosa, Staphylococcus aureus and Listeria monocytogenes was evaluated in a recent study (Borges et al., 2012).

Experiments conducted using microtiter plate assay revealed that both ferulic acid and gallic acid (0.1%) had preventive action on biofilm formation and showed higher potential to reduce biofilm mass formed by Gram-negative bacteria (Borges et al., 2012). The efficiency of organic acid treatment can be influenced by cell contact surface. It has been shown that 2% lactic and acetic acid significantly reduced E. coli biofilms on polystyrene surface however, the same acids did not reduce E. coli biofilms formed on stainless steel surfaces (Park & Chen, 2015).

The effects of citric, malic and gallic acids on prevention and removal of Bacillus subtilis biofilms on microtiter plates and stainless steel surfaces were evaluated (Akbas & Cag, 2016).

The results of this study showed that citric acid was the most effective in preventing and removing biofilms from both surfaces. The anti-biofilm effect of malic acid was higher than gallic acid but less than citric acid. The prevention and control of biofilms by these acids was significantly higher on microtiter plates compared to stainless steel, and this effect was dependent on concentration and exposure time of acids on both surfaces (Akbas & Cag, 2016).

The effects of malic acid, ozone alone or combination of both were examined for inhibition of biofilm formation by S. Typhimurium on different food surfaces (Singla et al., 2014). The results showed that malic acid alone was not able to inhibit biofilm formation however, malic acid and ozone combination significantly reduced biofilm formation on the food surfaces. These findings suggest that malic acid and ozone could be effective disinfectants against biofilms formed on food contact surfaces (Singla et al., 2014). Cantaloupe rind samples were electrostatically spread with malic and lactic acid solutions alone or in combination to examine reduction in S. Typhimurium attachment (Almasoud et al., 2015). The results of this study showed that a combined treatment of 2% malic and lactic acid had 3.6-log reduction of S.

Typhimurium SD10. This study also revealed that lactic acid was more effective than malic 54 acid in reducing attachment of S. Typhimurium (Almasoud et al., 2015). The studies described above suggest that organic acids are able to reduce biofilm formation however, complete elimination of biofilms is not possible. In addition, organic acids could be used as a potent anti- biofilm agent in the food industry to avoid toxic hazards of commonly used chemical disinfectants (Akbas & Cag, 2016). However, their prudent use is important to avoid development of acid resistant Salmonella strains (Mani-López et al., 2012).

1.5.5 Salmonella acid tolerance response (ATR)

The antibacterial effects of organic acid depends on concentration, pH and dissociation constant of each acid (Mani-López et al., 2012). Exposure of Salmonella to sub optimal/ sub lethal organic acid concentrations can induce development of adaptive response in the organism.

Several studies have reported acid tolerance response (ATR) in S. Typhimurium (Alvarez-

Ordonez et al., 2009; Foster & Hall, 1990; Greenacre et al., 2003). This feature of S.

Typhimurium represents a serious food safety concern for the meat and poultry industry since during meat product processing, bacteria experience number of mildly acidic conditions, which may induce ATR in Salmonella. The development of ATR could increase the ability of

Salmonella to survive in other lethal stresses including low pH in gut and intracellular environment (Mani-López et al., 2012). In order to reduce development of ATR, it is important to inactivate bacteria with an appropriate decontamination method. Appropriate doses, acid type, temperature, and hygienic practices are vital to reduce the risk of the development of ATR in Salmonella (Mani-López et al., 2012).

1.6 Objectives of thesis

Based on research gaps identified within the literature, the objectives of this thesis were:

1. To examine antimicrobial resistance of S. enterica isolates from egg farm environment.

2. To study faecal shedding, reproductive organ colonisation and egg contamination after oral

infection of laying hens with S. Typhimurium.

3. To study the ability of S. enterica isolates to form biofilm on eggshell surfaces.

4. To evaluate anti-bacterial and anti-biofilm activity of commercial organic acid products

against S. enterica isolates recovered from egg farm environment.

1.7 References

Aarestrup, F. M., Hasman, H., Olsen, I., & Sørensen, G. (2004). International spread of

blaCMY-2-mediated cephalosporin resistance in a multiresistant Salmonella enterica

serovar Heidelberg isolate stemming from the importation of a boar by Denmark from

Canada. Antimicrobial Agents and Chemotherapy, 48(5), 1916-1917.

Akbas, M. Y., & Cag, S. (2016). Use of organic acids for prevention and removal of Bacillus

subtilis biofilms on food contact surfaces. Food Science and Technology International,

1-11.

Almasoud, A., Hettiarachchy, N., Rayaprolu, S., Horax, R., & Eswaranandam, S. (2015).

Electrostatic spraying of organic acids on biofilms formed by E. coli O157:H7 and

Salmonella Typhimurium on fresh produce. Food Research International, 78, 27-33.

Alvarez-Ordonez, A., Fernandez, A., Bernardo, A., & Lopez, M. (2009). Comparison of acids

on the induction of an Acid Tolerance Response in Salmonella Typhimurium,

consequences for food safety. Meat Science, 81(1), 65-70.

Amavisit, P., Lightfoot, D., Browning, G. F., & Markham, P. F. (2003). Variation between

Pathogenic Serovars within Salmonella Pathogenicity Islands. Journal of Bacteriology,

185(12), 3624-3635.

Anjum, M. F., Choudhary, S., Morrison, V., Snow, L. C., Mafura, M., Slickers, P., et al. (2011).

Identifying antimicrobial resistance genes of human clinical relevance within

Salmonella isolated from food animals in Great Britain. Journal of Antimicrobial

Chemotherapy, 66(3), 550-559.

Anwar, H., & Costerton, J. W. (1990). Enhanced activity of combination of tobramycin and

piperacillin for eradication of sessile biofilm cells of Pseudomonas aeruginosa.

Antimicrobial Agents and Chemotherapy, 34(9), 1666-1671.

Arnold, J. W., & Yates, I. E. (2009). Interventions for control of Salmonella: Clearance of

microbial growth from rubber picker fingers. Poultry Science, 88(6), 1292-1298.

Asai, T., Esaki, H., Kojima, A., Ishihara, K., Tamura, Y., & Takahashi, T. (2006). Antimicrobial

resistance in Salmonella isolates from apparently healthy food-producing animal from

2000 to 2003: the first stage of Japanese veterinary antimicrobial resistance monitoring

(JVARM). Journal of Veterinary Medical Science, 68(8), 881-884.

Australian Egg Corporation Limited. (2015). Annual report (pp. 1-61).

Australian Salmonella Reference Centre. (2009). Annual report (pp. 4-6). Adelaide, South

Australia: Institute of Medical and Veterinary Science.

Australian Veterinary Association. (2014). Veterinary use of antibiotics critical to human

health. Retrieved July 21, 2016, from

http://www.ava.com.au/sites/default/files/AVA_website/pdfs/Veterinary%20use%20o

f%20antibiotics%20critical%20to%20human%20health.pdf

Baker, R. C., Goff, J. P., & Mulnix, E. J. (1980). Salmonellae recovery following oral and

intravenous inoculation of laying hens. Poultry Science, 59(5), 1067-1072.

Barton, M. D., Pratt, R., & Hart, W. S. (2003). Antibiotic resistance in animals. Communicable

Diseases Intelligence Quarterly Report, 27 Suppl, S121-S126.

Barton, M. D., & Wilkins, J. (2001). Antibiotic resistance in bacteria isolated from poultry : A

report for the Rural Industries Research and Development Corporation Barton, ACT:

Rural Industries Research and Development Corporation.

Baskerville, A., Humphrey, T. J., Fitzgeorge, R. B., Cook, R. W., Chart, H., Rowe, B., et al.

(1992). Airborne infection of laying hens with Salmonella enteritidis phage type 4.

Veterinary Record, 130(18), 395-398.

Bebear, C. M., Renaudin, H., Charron, A., Clerc, M., Pereyre, S., & Bebear, C. (2003). DNA

gyrase and topoisomerase IV mutations in clinical isolates of Ureaplasma spp. and

Mycoplasma hominis resistant to fluoroquinolones. Antimicrobial Agents &

Chemotherapy, 47(10), 3323-3325.

Board, R. G., & Tranter, H. S. (1995). Egg science and technology. In W. J. Stadelman & O. J.

Cotterill (Eds.), The Microbiology of Eggs (4th ed., pp. 81-103). New York: Food

Products Press.

Boddicker, J. D., Ledeboer, N. A., Jagnow, J., Jones, B. D., & Clegg, S. (2002). Differential

binding to and biofilm formation on, HEp-2 cells by Salmonella enterica serovar

Typhimurium is dependent upon allelic variation in the fimH gene of the fim gene

cluster. Molecular Microbiology, 45(5), 1255-1265.

Bohez, L., Gantois, I., Ducatelle, R., Pasmans, F., Dewulf, J., Haesebrouck, F., et al. (2008).

The Salmonella Pathogenicity Island 2 regulator ssrA promotes reproductive tract but

not intestinal colonization in chickens. Veterinary Microbiology, 126(1-3), 216-224.

Borges, A., Saavedra, M. J., & Simoes, M. (2012). The activity of ferulic and gallic acids in

biofilm prevention and control of pathogenic bacteria. Biofouling, 28(7), 755-767.

Bounar-Kechih, S., Hamdi, T. M., Mezali, L., Assaous, F., & Rahal, K. (2012). Antimicrobial

resistance of 100 Salmonella strains isolated from Gallus gallus in 4 wilayas of Algeria.

Poultry Science, 91(5), 1179-1185.

Bridier, A., Briandet, R., Thomas, V., & Dubois-Brissonnet, F. (2011). Resistance of bacterial

biofilms to disinfectants: a review. Biofouling, 27(9), 1017-1032.

Bridier, A., Sanchez-Vizuete, P., Guilbaud, M., Piard, J. C., Naïtali, M., & Briandet, R. (2015).

Biofilm-associated persistence of food-borne pathogens. Food Microbiology, 45, Part

B, 167-178.

Brown, D. D., & Brand, T. F. (1978). Experimental infection of point-of-lay and in-lay pullets

with Salmonella typhimurium. British Veterinary Journal, 134(2), 92-100.

Butaye, P., Cloeckaert, A., & Schwarz, S. (2003). Mobile genes coding for efflux-mediated

antimicrobial resistance in Gram-positive and Gram-negative bacteria. International

Journal of Antimicrobial Agents, 22(3), 205-210.

Castelijn, G. A., van der Veen, S., Zwietering, M. H., Moezelaar, R., & Abee, T. (2012).

Diversity in biofilm formation and production of curli fimbriae and cellulose of 59

Salmonella Typhimurium strains of different origin in high and low nutrient medium.

Biofouling, 28(1), 51-63.

Chen, S., Zhao, S., White, D. G., Schroeder, C. M., Lu, R., Yang, H., et al. (2004).

Characterization of multiple-antimicrobial-resistant Salmonella serovars isolated from

retail meats. Applied and Environmental Microbiology, 70(1), 1-7.

Cheng, A. C., Turnidge, J., Collignon, P., Looke, D., Barton, M., & Gottlieb, T. (2012). Control

of fluoroquinolone resistance through successful regulation, Australia. Emerging

Infectious Diseases, 18(9), 1453-1460.

Cherrington, C. A., Hinton, M., & Chopra, I. (1990). Effect of short-chain organic acids on

macromolecular synthesis in Escherichia coli. Journal of Applied Bacteriology, 68(1),

69-74.

Chopra, I., & Roberts, M. (2001). Tetracycline antibiotics: mode of action, applications,

molecular biology, and epidemiology of bacterial resistance. Microbiology and

Molecular Biology Reviews, 65(2), 232-260.

Chousalkar, K. K., Sexton, M., McWhorter, A., Hewson, K., Martin, G., Shadbolt, C., et al.

(2015). Salmonella Typhimurium in the Australian egg industry: Multidisciplinary

approach to addressing the public health challenge and future directions. Critical

Reviews in Food Science and Nutrition, [Epub ahead of print].

Corcoran, M., Morris, D., De Lappe, N., O'Connor, J., Lalor, P., Dockery, P., et al. (2014).

Commonly used disinfectants fail to eradicate Salmonella enterica biofilm from food

contact surface materials. Applied and Environmental Microbiology, 80(4), 1507-1514.

Costerton, J. W., Stewart, P. S., & Greenberg, E. P. (1999). Bacterial biofilms: a common cause

of persistent infections. Science, 284(5418), 1318-1322.

Cox, J. M., & Pavic, A. (2010). Advances in enteropathogen control in poultry production.

Journal of Applied Microbiology, 108(3), 745-755.

Cox, J. M., Woolcock, J. B., & Sartor, A. L. (2002). The significance of Salmonella, particularly

S. Infantis, to the Australian egg industry : a report for the Rural Industries Research 60

and Development Corporation. Barton, ACT: Rural Industries Research &

Development Corporation.

Cox, N. A., Davis, B. H., Watts, A. B., & Colmer, A. R. (1973). Salmonella in the laying hen.

1. Salmonella recovery from viscera, feces and eggs following oral inoculation. Poultry

Science, 52(2), 661-666.

Davies, J. (1994). Inactivation of antibiotics and the dissemination of resistance genes. Science,

264(5157), 375-382.

Davies, J., & Davies, D. (2010). Origins and evolution of antibiotic resistance. Microbiology

and Molecular Biology Reviews, 74(3), 417-433.

Davies, R., & Breslin, M. (2003a). Observations on Salmonella contamination of commercial

laying farms before and after cleaning and disinfection. Veterinary Record, 152(10),

283-287.

Davies, R. H., & Breslin, M. (2003b). Investigation of Salmonella contamination and

disinfection in farm egg-packing plants. Journal of Applied Microbiology, 94(2), 191-

196.

Davies, R. H., & Breslin, M. (2003c). Persistence of Salmonella enteritidis phage type 4 in the

environment and arthropod vectors on an empty free-range chicken farm.

Environmental Microbiology, 5(2), 79-84.

De Buck, J., Van Immerseel, F., Haesebrouck, F., & Ducatelle, R. (2004). Colonization of the

chicken reproductive tract and egg contamination by Salmonella. Journal of Applied

Microbiology, 97(2), 233-245.

De Oliveira, D. C., Fernandes Junior, A., Kaneno, R., Silva, M. G., Araujo Junior, J. P., Silva,

N. C., et al. (2014). Ability of Salmonella spp. to produce biofilm is dependent on

temperature and surface material. Foodborne Pathogens and Disease, 11(6), 478-483.

De Reu, K., Grijspeerdt, K., Messens, W., Heyndrickx, M., Uyttendaele, M., Debevere, J., et

al. (2006). Eggshell factors influencing eggshell penetration and whole egg

contamination by different bacteria, including Salmonella enteritidis. International

Journal of Food Microbiology, 112(3), 253-260.

Donlan, R. M., & Costerton, J. W. (2002). Biofilms: survival mechanisms of cinically relevant

microorganisms. Clinical Microbiology Reviews, 15(2), 167-193.

Doorduyn, Y., Van Den Brandhof, W. E., Van Duynhoven, Y. T., Wannet, W. J., & Van Pelt,

W. (2006). Risk factors for Salmonella Enteritidis and Typhimurium (DT104 and non-

DT104) infections in The Netherlands: predominant roles for raw eggs in Enteritidis

and sandboxes in Typhimurium infections. Epidemiology and Infection, 134(3), 617-

626.

Doublet, B., Lailler, R., Meunier, D., Brisabois, A., Boyd, D., Mulvey, M. R., et al. (2003).

Variant Salmonella genomic island 1 antibiotic resistance gene cluster in Salmonella

enterica serovar Albany. Emerging Infectious Diseases, 9(5), 585-591.

Dunkley, K. D., Callaway, T. R., Chalova, V. I., McReynolds, J. L., Hume, M. E., Dunkley, C.

S., et al. (2009). Foodborne Salmonella ecology in the avian gastrointestinal tract.

Anaerobe, 15(1–2), 26-35.

Durant, J. A., Lowry, V. K., Nisbet, D. J., Stanker, L. H., Corrier, D. E., & Ricke, S. C. (1999).

Short-chain fatty acids affect cell-association and invasion of HEp-2 cells by Salmonella

typhimurium. Journal of Environmental Science and Health. Part B: Pesticides, Food

Contaminants, and Agricultural Wastes, 34(6), 1083-1099.

Dutta, S., Kawamura, Y., Ezaki, T., Nair, G. B., Iida, K., & Yoshida, S. (2005). Alteration in

the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in

Quinolone-resistant Shigella dysenteriae serotype 1 clinical isolates from Kolkata,

India. Antimicrobial Agents & Chemotherapy, 49(4), 1660-1661.

Dyda, A., Hundy, R., Moffatt, C. R., & Cameron, S. (2009). Outbreak of Salmonella

Typhimurium 44 related to egg consumption. Communicable Diseases Intelligence

Quarterly Report, 33(4), 414-418.

El-Lethey, H., Huber-Eicher, B., & Jungi, T. W. (2003). Exploration of stress-induced

immunosuppression in chickens reveals both stress-resistant and stress-susceptible

antigen responses. Veterinary Immunology and Immunopathology, 95(3–4), 91-101.

Eliopoulos, G. M., & Huovinen, P. (2001). Resistance to trimethoprim-sulfamethoxazole.

Clinical Infectious Diseases, 32(11), 1608-1614.

Finch, R. G., Greenwood, D., Norrby, S. R., & Whitley, R. J. (Eds.). (2003). Antibiotic and

Chemotherapy: Anti-infective Agents and Their Use in Therapy (8th ed.). Edinburgh:

Churchill Livingstone.

Foley, S. L., Johnson, T. J., Ricke, S. C., Nayak, R., & Danzeisen, J. (2013). Salmonella

pathogenicity and host adaptation in chicken-associated serovars. Microbiology and

Molecular Biology Reviews, 77(4), 582-607.

Foley, S. L., & Lynne, A. M. (2008). Food animal-associated Salmonella challenges:

Pathogenicity and antimicrobial resistance. Journal of Animal Science, 86(14 suppl),

E173-E187.

Foley, S. L., Lynne, A. M., & Nayak, R. (2008). Salmonella challenges: Prevalence in swine

and poultry and potential pathogenicity of such isolates. Journal of Animal Science,

86(14 suppl), E149-E162.

Foley, S. L., Nayak, R., Hanning, I. B., Johnson, T. J., Han, J., & Ricke, S. C. (2011). Population

dynamics of Salmonella enterica serotypes in commercial egg and poultry production.

Applied and Environmental Microbiology, 77(13), 4273-4279.

Foster, J. W., & Hall, H. K. (1990). Adaptive acidification tolerance response of Salmonella

typhimurium. Journal of Bacteriology, 172(2), 771-778.

Fraud, S., Maillard, J. Y., Kaminski, M. A., & Hanlon, G. W. (2005). Activity of amine oxide

against biofilms of Streptococcus mutans: a potential biocide for oral care formulations.

Journal of Antimicrobial Chemotherapy, 56(4), 672-677.

Frye, J. G., & Jackson, C. R. (2013). Genetic mechanisms of antimicrobial resistance identified

in Salmonella enterica, Escherichia coli, and Enteroccocus spp. isolated from U.S. food

animals. Frontiers in Microbiology, 4, 135.

Galiş, A. M., Marcq, C., Marlier, D., Portetelle, D., Van, I., Beckers, Y., et al. (2013). Control

of Salmonella contamination of shell eggs-preharvest and postharvest methods: A

review. Comprehensive Reviews in Food Science and Food Safety, 12(2), 155-182.

Gantois, I., Ducatelle, R., Pasmans, F., Haesebrouck, F., Gast, R., Humphrey, T. J., et al. (2009).

Mechanisms of egg contamination by Salmonella Enteritidis. FEMS Microbiology

Reviews, 33(4), 718-738.

Gantois, I., Eeckhaut, V., Pasmans, F., Haesebrouck, F., Ducatelle, R., & Van Immerseel, F.

(2008). A comparative study on the pathogenesis of egg contamination by different

serotypes of Salmonella. Avian Pathology, 37(4), 399-406.

Gerstel, U., & Römling, U. (2003). The csgD promoter, a control unit for biofilm formation in

Salmonella typhimurium. Research in Microbiology, 154(10), 659-667.

Giaouris, E., Heir, E., Desvaux, M., Hebraud, M., Moretro, T., Langsrud, S., et al. (2015). Intra-

and inter-species interactions within biofilms of important foodborne bacterial

pathogens. Frontiers in Microbiology, 6, 841.

Giaouris, E., & Nesse, L. L. (2015). Attachment of Salmonella spp. to food contact and product

surfaces and biofilm formation on them as stress adaptation and survival strategies. In

H. C.B. (Ed.), Salmonella: prevalence, risk factors and treatment options (pp. 111-136).

New York, USA: Nova Science Publishers, Inc.

Gilbert, P., Das, J. R., Jones, M. V., & Allison, D. G. (2001). Assessment of resistance towards

biocides following the attachment of micro-organisms to, and growth on, surfaces.

Journal of Applied Microbiology, 91(2), 248-254.

Gillespie, I. A., O'Brien, S. J., Adak, G. K., Ward, L. R., & Smith, H. R. (2005). Foodborne

general outbreaks of Salmonella Enteritidis phage type 4 infection, England and Wales,

1992-2002: where are the risks? Epidemiology and Infection, 133(5), 795-801. 64

Gole, V. C., Caraguel, C. G., Sexton, M., Fowler, C., & Chousalkar, K. K. (2014a). Shedding

of Salmonella in single age caged commercial layer flock at an early stage of lay.

International Journal of Food Microbiology, 189, 61-66.

Gole, V. C., Torok, V., Sexton, M., Caraguel, C. G., & Chousalkar, K. K. (2014b). Association

between the indoor environmental contamination of Salmonella with egg contamination

on layer farms. Journal of Clinical Microbiology, 52(9), 3250-3258.

Gole, V. C., Chousalkar, K. K., Roberts, J. R., Sexton, M., May, D., Tan, J., et al. (2014c).

Effect of egg washing and correlation between eggshell characteristics and egg

penetration by various Salmonella Typhimurium strains. PloS One, 9(3), e90987.

Grant, A. Q., Hashem, F., & Parveen, S. (2016). Salmonella and Campylobacter: Antimicrobial

resistance and bacteriophage control in poultry. Food Microbiology, 53, Part B, 104-

109.

Grantcharova, N., Peters, V., Monteiro, C., Zakikhany, K., & Romling, U. (2010). Bistable

expression of CsgD in biofilm development of Salmonella enterica serovar

Typhimurium. Journal of Bacteriology, 192(2), 456-466.

Greenacre, E. J., Brocklehurst, T. F., Waspe, C. R., Wilson, D. R., & Wilson, P. D. (2003).

Salmonella enterica serovar Typhimurium and Listeria monocytogenes acid tolerance

response induced by organic acids at 20 degrees C: optimization and modeling. Applied

and Environmental Microbiology, 69(7), 3945-3951.

Grimont, P. A. D., & Weill, F.-X. (2007). Antigenic formulae of the Salmonella serovars (9th

ed.). Paris, France: WHO Collaborating Centre for Reference and Research on

Salmonella, Institut Pasteur.

Guibourdenche, M., Roggentin, P., Mikoleit, M., Fields, P. I., Bockemühl, J., Grimont, P. A.

D., et al. (2010). Supplement 2003–2007 (No. 47) to the White-Kauffmann-Le Minor

scheme. Research in Microbiology, 161(1), 26-29.

Gyles, C. L. (2008). Antimicrobial resistance in selected bacteria from poultry. Animal Health

Research Reviews, 9(2), 149-158. 65

Hendriksen, R. S., Vieira, A. R., Karlsmose, S., Lo Fo Wong, D. M., Jensen, A. B., Wegener,

H. C., et al. (2011). Global monitoring of Salmonella serovar distribution from the

World Health Organization Global Foodborne Infections Network Country Data Bank:

results of quality assured laboratories from 2001 to 2007. Foodborne Pathogens and

Disease, 8(8), 887-900.

Hood, S. K., & Zottola, E. A. (1997). Adherence to stainless steel by foodborne microorganisms

during growth in model food systems. International Journal of Food Microbiology,

37(2–3), 145-153.

Hooper, D. C. (1999). Mechanisms of fluoroquinolone resistance. Drug Resistance Updates,

2(1), 38-55.

Howard, Z. R., O'Bryan, C. A., Crandall, P. G., & Ricke, S. C. (2012). Salmonella Enteritidis

in shell eggs: Current issues and prospects for control. Food Research International,

45(2), 755-764.

Hsiao, C. P., & Siebert, K. J. (1999). Modeling the inhibitory effects of organic acids on

bacteria. International Journal of Food Microbiology, 47(3), 189-201.

Humphrey, T. J., & Lanning, D. G. (1988). The vertical transmission of salmonellas and formic

acid treatment of chicken feed. A possible strategy for control. Epidemiology and

Infection, 100(1), 43-49.

Hundy, R., Stafford, R., Kirk, M., Ashbolt, R., McKay, I., Millard, G., et al. (2002). Enhancing

foodborne disease surveillance across Australia in 2001: the OzFoodNet Working

Group. Communicable Diseases Intelligence Quarterly Report, 3(26), 375-406.

Huovinen, P., Sundström, L., Swedberg, G., & Sköld, O. (1995). Trimethoprim and

sulfonamide resistance. Antimicrobial Agents and Chemotherapy, 39(2), 279-289.

Hur, J., Jawale, C., & Lee, J. H. (2012). Antimicrobial resistance of Salmonella isolated from

food animals: A review. Food Research International, 45(2), 819-830.

Hutchison, M. L., Gittins, J., Sparks, A. W., Humphrey, T. J., Burton, C., & Moore, A. (2004).

An assessment of the microbiological risks involved with egg washing under

commercial conditions. Journal of Food Protection, 67(1), 4-11.

Jardine, A., Ressler, K. A., Botham, S., Irwin, M. J., Shadbolt, C., Vally, H., et al. (2011). An

outbreak of Salmonella typhimurium 108/170 at a privately catered barbeque at a

Sydney sports club. Foodborne Pathogens and Disease, 8(11), 1215-1219.

Jonas, K., Tomenius, H., Kader, A., Normark, S., Römling, U., Belova, L., et al. (2007). Roles

of curli, cellulose and BapA in Salmonella biofilm morphology studied by atomic force

microscopy. BMC Microbiology, 7(1), 1-9.

Joseph, B., Otta, S. K., Karunasagar, I., & Karunasagar, I. (2001). Biofilm formation by

Salmonella spp. on food contact surfaces and their sensitivity to sanitizers. International

Journal of Food Microbiology, 64(3), 367-372.

Keller, L. H., Schifferli, D. M., Benson, C. E., Aslam, S., & Eckroade, R. J. (1997). Invasion

of chicken reproductive tissues and forming eggs is not unique to Salmonella enteritidis.

Avian Diseases, 41(3), 535-539.

Kim, H., Ryu, J. H., & Beuchat, L. R. (2007). Effectiveness of disinfectants in killing

Enterobacter sakazakii in suspension, dried on the surface of stainless steel, and in a

biofilm. Applied and Environmental Microbiology, 73(4), 1256-1265.

Latasa, C., Roux, A., Toledo-Arana, A., Ghigo, J.-M., Gamazo, C., Penadés, J. R., et al. (2005).

BapA, a large secreted protein required for biofilm formation and host colonization of

Salmonella enterica serovar Enteritidis. Molecular Microbiology, 58(5), 1322-1339.

Lawhon, S. D., Maurer, R., Suyemoto, M., & Altier, C. (2002). Intestinal short-chain fatty acids

alter Salmonella typhimurium invasion gene expression and virulence through

BarA/SirA. Molecular Microbiology, 46(5), 1451-1464.

Leach, S. A., Williams, A., Davies, A. C., Wilson, J., Marsh, P. D., & Humphrey, T. J. (1999).

Aerosol route enhances the contamination of intact eggs and muscle of experimentally

infected laying hens by Salmonella typhimurium DT104. FEMS Microbiology Letters,

171(2), 203-207.

Li, H., Wang, H., D'Aoust, J., & Maurer, J. (2013). Salmonella Species. In M. Doyle & R.

Buchanan (Eds.), Food Microbiology : Fundamentals and Frontiers. Washington, US:

ASM Press.

Li, X., Payne, J. B., Santos, F. B., Levine, J. F., Anderson, K. E., & Sheldon, B. W. (2007).

Salmonella populations and prevalence in layer feces from commercial high-rise houses

and characterization of the Salmonella isolates by serotyping, antibiotic resistance

analysis, and pulsed field gel electrophoresis. Poultry Science, 86(3), 591-597.

Lianou, A., & Koutsoumanis, K. P. (2012). Strain variability of the biofilm-forming ability of

Salmonella enterica under various environmental conditions. International Journal of

Food Microbiology, 160(2), 171-178.

Liebana, E., Garcia-Migura, L., Clouting, C., Clifton-Hadley, F. A., Breslin, M., & Davies, R.

H. (2003). Molecular fingerprinting evidence of the contribution of wildlife vectors in

the maintenance of Salmonella Enteritidis infection in layer farms. Journal of Applied

Microbiology, 94(6), 1024-1029.

Liu, Z., Niu, H., Wu, S., & Huang, R. (2014). CsgD regulatory network in a bacterial trait-

altering biofilm formation. Emerging Microbes & Infections, 3(1), e1.

Mah, T. F., & O'Toole, G. A. (2001). Mechanisms of biofilm resistance to antimicrobial agents.

Trends in Microbiology, 9(1), 34-39.

Majowicz, S. E., Musto, J., Scallan, E., Angulo, F. J., Kirk, M., O'Brien, S. J., et al. (2010). The

global burden of nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases,

50(6), 882-889.

Mani-López, E., García, H. S., & López-Malo, A. (2012). Organic acids as antimicrobials to

control Salmonella in meat and poultry products. Food Research International, 45(2),

713-721.

Marcus, R., Varma, J. K., Medus, C., Boothe, E. J., Anderson, B. J., Crume, T., et al. (2007).

Re-assessment of risk factors for sporadic Salmonella serotype Enteritidis infections: a

case-control study in five FoodNet Sites, 2002-2003. Epidemiology and Infection,

135(1), 84-92.

Marcus, S. L., Brumell, J. H., Pfeifer, C. G., & Finlay, B. B. (2000). Salmonella pathogenicity

islands: big virulence in small packages. Microbes and Infection, 2(2), 145-156.

Marshall, B. M., & Levy, S. B. (2011). Food animals and antimicrobials: impacts on human

health. Clinical Microbiology Reviews, 24(4), 718-733.

McManus, M. (1997). Mechanisms of bacterial resistance to antimicrobial agents. American

Journal of Health-System Pharmacy, 54(12), 1420-1433.

Mead, G. C., & Barrow, P. A. (1990). Salmonella control in poultry by ‘competitive exclusion’

or immunization. Letters in Applied Microbiology, 10(6), 221-227.

Moffatt, C. R., & Musto, J. (2013). Salmonella and egg-related outbreaks. Microbiology

Australia, 34(2), 94-98.

Moffatt, C. R., Musto, J., Pingault, N., Miller, M., Stafford, R., Gregory, J., et al. (2016).

Salmonella Typhimurium and outbreaks of egg-associated disease in Australia, 2001 to

2011. Foodborne Pathogens and Disease, 13(7), 379-385.

Molbak, K., & Neimann, J. (2002). Risk factors for sporadic infection with Salmonella

enteritidis, Denmark, 1997-1999. American Journal of Epidemiology, 156(7), 654-661.

Murray, I. A., & Shaw, W. V. (1997). O-Acetyltransferases for chloramphenicol and other

natural products. Antimicrobial Agents and Chemotherapy, 41(1), 1-6.

Musgrove, M. T., Jones, D. R., Northcutt, J. K., Cox, N. A., Harrison, M. A., Fedorka-Cray, P.

J., et al. (2006). Antimicrobial resistance in Salmonella and Escherichia coli isolated

from commercial shell eggs. Poultry Science, 85(9), 1665-1669.

Ndi, O., & Barton, M. (2011). Antibiotic resistance in animals : The Australian perspective. In

P. L. Keen & M. H. M. M. Montforts (Eds.), Antimicrobial resistance in the

environment (pp. 265-290). Hoboken, NJ: John Wiley & Sons, Inc. 69

Nguyen, H. D. N., Yang, Y. S., & Yuk, H. G. (2014). Biofilm formation of Salmonella

Typhimurium on stainless steel and acrylic surfaces as affected by temperature and pH

level. LWT - Food Science and Technology, 55(1), 383-388.

Nguyen, H. D. N., & Yuk, H.-G. (2013). Changes in resistance of Salmonella Typhimurium

biofilms formed under various conditions to industrial sanitizers. Food Control, 29(1),

236-240.

Nogrady, N., Gado, I., Fekete, P. Z., & Paszti, J. (2005). Chloramphenicol resistance genes in

Salmonella enterica subsp. enterica serovar Typhimurium isolated from human and

animal sources in Hungary. Veterinarni Medicina - UZPI, 50, 164-170.

O'Leary, D., Cabe, E. M. M., McCusker, M. P., Martins, M., Fanning, S., & Duffy, G. (2013).

Microbiological study of biofilm formation in isolates of Salmonella enterica

Typhimurium DT104 and DT104b cultured from the modern pork chain. International

Journal of Food Microbiology, 161(1), 36-43.

O'Leary, D., McCabe, E. M., McCusker, M. P., Martins, M., Fanning, S., & Duffy, G. (2015).

Acid environments affect biofilm formation and gene expression in isolates of

Salmonella enterica Typhimurium DT104. International Journal of Food

Microbiology, 206(0), 7-16.

Obeng, A. S., Rickard, H., Ndi, O., Sexton, M., & Barton, M. (2012). Antibiotic resistance,

phylogenetic grouping and virulence potential of Escherichia coli isolated from the

faeces of intensively farmed and free range poultry. Veterinary Microbiology, 154(3–

4), 305-315.

Okamura, M., Kamijima, Y., Miyamoto, T., Tani, H., Sasai, K., & Baba, E. (2001a).

Differences among six Salmonella serovars in abilities to colonize reproductive organs

and to contaminate eggs in laying hens. Avian Diseases, 45(1), 61-69.

Okamura, M., Miyamoto, T., Kamijima, Y., Tani, H., Sasai, K., & Baba, E. (2001b).

Differences in abilities to colonize reproductive organs and to contaminate eggs in

intravaginally inoculated hens and in vitro adherences to vaginal explants between

Salmonella enteritidis and other Salmonella serovars. Avian Diseases, 45(4), 962-971.

Okamura, M., Sonobe, M., Obara, S., Kubo, T., Nagai, T., Noguchi, M., et al. (2010). Potential

egg contamination by Salmonella enterica serovar Typhimurium definitive type 104

following experimental infection of pullets at the onset of lay. Poultry Science, 89(8),

1629-1634.

Olsen, S. J., Bishop, R., Brenner, F. W., Roels, T. H., Bean, N., Tauxe, R. V., et al. (2001). The

changing epidemiology of Salmonella: trends in serotypes isolated from humans in the

United States, 1987-1997. Journal of Infectious Diseases, 183(5), 753-761.

Olson, M. E., Ceri, H., Morck, D. W., Buret, A. G., & Read, R. R. (2002). Biofilm bacteria:

formation and comparative susceptibility to antibiotics. Canadian Journal of Veterinary

Research, 66(2), 86-92.

OzFoodNet Working Group. (2009). Monitoring the incidence and causes of diseases

potentially transmitted by food in Australia: annual report of the OzFoodNet Network,

2008. Communicable Diseases Intelligence Quarterly Report, 33(4), 389-413.

OzFoodNet Working Group. (2010a). OzFoodNet quarterly report, 1 January to 31 March

2010. Communicable Diseases Intelligence Quarterly Report, 34(2), 127-136.

OzFoodNetWorkingGroup. (2010b). OzFoodNet quarterly report, 1 April to 30 June 2010.

Communicable Diseases Intelligence Quaterly Report, 34(3), 345-354.

OzFoodNet Working Group. (2010c). OzFoodNet quarterly report, 1 July to 30 September

2010. Communicable Diseases Intelligence Quarterly Report, 34(4), 450-458.

OzFoodNet Working Group. (2011a). OzFoodNet quarterly report, 1 April to 30 June 2011.

Communicable Diseases Intelligence Quarterly Report, 35(4), 312-320.

OzFoodNet Working Group. (2011b). OzFoodNet quarterly report, 1 October to 31 December

2010. Communicable Diseases Intelligence Quarterly Report, 35(1), 29-37.

OzFoodNet Working Group. (2012a). Monitoring the incidence and causes of diseases

potentially transmitted by food in Australia: annual report of the OzFoodNet network,

2010. Communicable Diseases Intelligence Quarterly Report, 36(3), E213-241.

OzFoodNet Working Group. (2012b). OzFoodNet quarterly report, 1 January to 31 March

2012. Communicable Diseases Intelligence Quarterly Report, 36(4), E353-360.

OzFoodNet Working Group. (2012c). OzFoodNet quarterly report, 1 July to 30 September

2011. Communicable Diseases Intelligence Quarterly Report, 36(2), E188-195.

OzFoodNet Working Group. (2012d). OzFoodNet quarterly report, 1 October to 31 December

2011. Communicable Diseases Intelligence Quarterly Report, 36(3), E294-300.

OzFoodNet Working Group. (2013a). OzFoodNet quarterly report, 1 April to 30 June 2012.

Communicable Diseases Intelligence Quarterly Report, 37(1), E73-78.

OzFoodNet Working Group. (2013b). OzFoodNet quarterly report, 1 July to 30 September

2012. Communicable Diseases Intelligence Quarterly Report, 37(3), E260-266.

OzFoodNet Working Group. (2013c). OzFoodNet quarterly report, 1 October to 31 December

2012. Communicable Diseases Intelligence Quarterly Report, 37(4), E418-426.

OzFoodNet Working Group. (2014a). OzFoodNet enhanced foodborne disease surveillance, 1

January to 31 March 2013. Communicable Diseases Intelligence Quarterly Report,

38(1), E70-77.

OzFoodNet Working Group. (2014b). OzFoodNet quarterly report, 1 April to 30 June 2013.

Communicable Diseases Intelligence Quarterly Report, 38(4), E376-382.

OzFoodNet Working Group. (2015a). Monitoring the incidence and causes of diseases

potentially transmitted by food in Australia: Annual report of the OzFoodNet network,

2011. Communicable Diseases Intelligence Quarterly Report, 39(2), E236-264.

OzFoodNet Working Group. (2015b). OzFoodNet quarterly report, 1 January to 31 March

2014. Communicable Diseases Intelligence Quarterly Report, 39(4), E612-618.

OzFoodNet Working Group. (2015c). OzFoodNet quarterly report, 1 July to 30 September

2013. Communicable Diseases Intelligence Quarterly Report, 39(2), E280-284. 72

OzFoodNet Working Group. (2015d). OzFoodNet quarterly report, 1 October to 31 December

2013. Communicable Diseases Intelligence Quarterly Report, 39(3), E479-485.

Park, Y. J., & Chen, J. (2015). Control of the biofilms formed by curli- and cellulose-expressing

shiga toxin-producing Escherichia coli using treatments with organic acids and

commercial sanitizers. Journal of Food Protection, 78(5), 990-995.

Parry, C. M., & Threlfall, E. (2008). Antimicrobial resistance in typhoidal and nontyphoidal

salmonellae. Current Opinion in Infectious Diseases, 21(5), 531-538

Parsons, B. N., Crayford, G., Humphrey, T. J., & Wigley, P. (2013). Infection of chickens with

antimicrobial-resistant Salmonella enterica Typhimurium DT193 and monophasic

Salmonella Typhimurium-like variants: an emerging risk to the poultry industry? Avian

Pathology, 42(5), 443-446.

Périchon, B., & Courvalin, P. (2009). Antibiotic resistance. In M. Schaechter (Ed.),

Encyclopedia of Microbiology (3rd ed., pp. 193-204). Oxford: Academic Press.

Poole, K. (2005). Aminoglycoside resistance in Pseudomonas aeruginosa. Antimicrobial

Agents and Chemotherapy, 49(2), 479-487.

Prouty, A. M., & Gunn, J. S. (2003). Comparative analysis of Salmonella enterica serovar

Typhimurium biofilm formation on gallstones and on glass. Infection and Immunity,

71(12), 7154-7158.

Randall, L. P., Cooles, S. W., Osborn, M. K., Piddock, L. J. V., & Woodward, M. J. (2004).

Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five

serotypes of Salmonella enterica isolated from humans and animals in the UK. Journal

of Antimicrobial Chemotherapy, 53(2), 208-216.

Reiber, M. A., Conner, D. E., & Bilgili, S. F. (1995). Salmonella colonization and shedding

patterns of hens inoculated via semen. Avian Diseases, 39(2), 317-322.

Revathi, G., Shannon, K. P., Stapleton, P. D., Jain, B. K., & French, G. L. (1998). An outbreak

of extended-spectrum, beta-lactamase producing Salmonella senftenberg in a burns

ward. Journal of Hospital Infection, 40(4), 295-302. 73

Revolledo, L., Ferreira, A., & Mead, G. (2006). Prospects in Salmonella control: competitive

exclusion, probiotics, and enhancement of avian intestinal immunity. The Journal of

Applied Poultry Research, 15(2), 341-351.

Reynolds, A., Moffatt, C. R., Dyda, A., Hundy, R. L., Kaye, A. L., Krsteski, R., et al. (2010).

An outbreak of gastroenteritis due to Salmonella Typhimurium phage type 170

associated with consumption of a dessert containing raw egg. Communicable Diseases

Intelligence Quarterly Report, 34(3), 329-333.

Ricke, S. C. (2003). Perspectives on the use of organic acids and short chain fatty acids as

antimicrobials. Poultry Science, 82(4), 632-639.

Ricke, S. C. (2014). Application of molecular approaches for understanding foodborne

Salmonella establishment in poultry production. Advances in Biology, 2014.

Ricke, S. C., Calo, J. R., & Kaldhone, P. (2015). Salmonella control in food production: current

issues and perspectives in the United States. In S. C. Ricke, J. R. Donaldson, & C. A.

Phillips (Eds.), Food Safety (pp. 107-133). San Diego: Academic Press.

Ricke, S. C., Dunkley, C. S., & Durant, J. A. (2013a). A review on development of novel

strategies for controlling Salmonella Enteritidis colonization in laying hens: fiber-based

molt diets. Poultry Science, 92(2), 502-525.

Ricke, S. C., Ok-Kyung, K., Foley, S., & Nayak, R. (2013b). Salmonella. In R. G. Labbé & S.

García (Eds.), Guide to Foodborne Pathogens (2nd ed., pp. 112-137): John Wiley &

Sons, Oxford.

Romling, U., Sierralta, W. D., Eriksson, K., & Normark, S. (1998). Multicellular and

aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in

the agfD promoter. Molecular Microbiology, 28(2), 249-264.

Russell, J. (1992). Another explanation for the toxicity of fermentation acids at low pH: anion

accumulation versus uncoupling. Journal of Applied Bacteriology, 73(5), 363-370.

Sadekuzzaman, M., Yang, S., Mizan, M. F. R., & Ha, S. D. (2015). Current and recent advanced

strategies for combating biofilms. Comprehensive Reviews in Food Science and Food

Safety, 14(4), 491-509.

Schonewille, E., Nesse, L. L., Hauck, R., Windhorst, D., Hafez, H. M., & Vestby, L. K. (2012).

Biofilm building capacity of Salmonella enterica strains from the poultry farm

environment. FEMS Immunology and Medical Microbiology, 65(2), 360-365.

Sefton, A. M. (2002). Mechanisms of antimicrobial resistance: their clinical relevance in the

new millennium. Drugs, 62(4), 557-566.

Seixas, R., Machado, J., Bernardo, F., Vilela, C., & Oliveira, M. (2014). Biofilm formation by

Salmonella enterica serovar 1,4,[5],12:i:- Portuguese isolates: a phenotypic, genotypic,

and socio-geographic analysis. Current Microbiology, 68(5), 670-677.

Shen, Y., Stojicic, S., & Haapasalo, M. (2011). Antimicrobial efficacy of chlorhexidine against

bacteria in biofilms at different stages of development. Journal of Endodontics, 37(5),

657-661.

Shi, X., & Zhu, X. (2009). Biofilm formation and food safety in food industries. Trends in Food

Science & Technology, 20(9), 407-413.

Simm, R., Ahmad, I., Rhen, M., Le Guyon, S., & Romling, U. (2014). Regulation of biofilm

formation in Salmonella enterica serovar Typhimurium. Future Microbiology, 9(11),

1261-1282.

Simões, M., Simões, L. C., & Vieira, M. J. (2010). A review of current and emergent biofilm

control strategies. LWT - Food Science and Technology, 43(4), 573-583.

Singla, R., Goel, H., & Ganguli, A. (2014). Novel synergistic approach to exploit the

bactericidal efficacy of commercial disinfectants on the biofilms of Salmonella enterica

serovar Typhimurium. Journal of Bioscience and Bioengineering, 118(1), 34-40.

Smith, C. A., & Baker, E. N. (2002). Aminoglycoside antibiotic resistance by enzymatic

deactivation. Current Drug Targets: Infectious Disorders, 2(2), 143-160.

Snow, L. C., Davies, R. H., Christiansen, K. H., Carrique-Mas, J. J., Wales, A. D., O'Connor,

J. L., et al. (2007). Survey of the prevalence of Salmonella species on commercial laying

farms in the United Kingdom. Veterinary Record, 161(14), 471-476.

Solano, C., García, B., Valle, J., Berasain, C., Ghigo, J.-M., Gamazo, C., et al. (2002). Genetic

analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Molecular

Microbiology, 43(3), 793-808.

Speer, B. S., Shoemaker, N. B., & Salyers, A. A. (1992). Bacterial resistance to tetracycline:

mechanisms, transfer, and clinical significance. Clinical Microbiology Reviews, 5(4),

387-399.

Srey, S., Jahid, I. K., & Ha, S.-D. (2013). Biofilm formation in food industries: A food safety

concern. Food Control, 31(2), 572-585.

Steenackers, H., Hermans, K., Vanderleyden, J., & De Keersmaecker, S. C. J. (2012).

Salmonella biofilms: An overview on occurrence, structure, regulation and eradication.

Food Research International, 45(2), 502-531.

Stephens, N., Sault, C., Firestone, S. M., Lightfoot, D., & Bell, C. (2007). Large outbreaks of

Salmonella Typhimurium phage type 135 infections associated with the consumption

of products containing raw egg in Tasmania. Communicable Diseases Intelligence

Quarterly Report, 31(1), 118-124.

Swann, M. M., Baxter, K. L., & Field, H. I. (1969). Report of The Joint Committee on The Use

of Antibiotics in Animal Husbandry and Veterinary Medicine. London: Her Majesty’s

Stationary Office.

Tenover, F. C. (2006). Mechanisms of antimicrobial resistance in bacteria. American Journal

of Infection Control, 34(5), S3-S10.

Thormar, H., Hilmarsson, H., & Bergsson, G. (2006). Stable concentrated emulsions of the 1-

monoglyceride of capric acid (monocaprin) with microbicidal activities against the

food-borne bacteria Campylobacter jejuni, Salmonella spp., and Escherichia coli.

Applied and Environmental Microbiology, 72(1), 522-526. 76 van Asten, A. J. A. M., & van Dijk, J. E. (2005). Distribution of “classic” virulence factors

among Salmonella spp. FEMS Immunology and Medical Microbiology, 44(3), 251-259.

Van Immerseel, F., & Atterbury, R. J. (2013). Other approaches to infection control. In P. A.

Barrow & U. Methner (Eds.), Salmonella in domestic animals. (2nd ed., pp. 518).

Wallingford: CABI.

Van Immerseel, F., Boyen, F., Gantois, I., Timbermont, L., Bohez, L., Pasmans, F., et al.

(2005). Supplementation of coated butyric acid in the feed reduces colonization and

shedding of Salmonella in poultry. Poultry Science, 84(12), 1851-1856.

Van Immerseel, F., De Buck, J., Boyen, F., Bohez, L., Pasmans, F., Volf, J., et al. (2004a).

Medium-chain fatty acids decrease colonization and invasion through hilA suppression

shortly after infection of chickens with Salmonella enterica serovar Enteritidis. Applied

and Environmental Microbiology, 70(6), 3582-3587.

Van Immerseel, F., De Buck, J., De Smet, I., Pasmans, F., Haesebrouck, F., & Ducatelle, R.

(2004b). Interactions of butyric acid- and acetic acid-treated Salmonella with chicken

primary cecal epithelial cells in vitro. Avian Diseases, 48(2), 384-391.

Van Immerseel, F., De Buck, J., Pasmans, F., Velge, P., Bottreau, E., Fievez, V., et al. (2003).

Invasion of Salmonella enteritidis in avian intestinal epithelial cells in vitro is influenced

by short-chain fatty acids. International Journal of Food Microbiology, 85(3), 237-248.

Van Immerseel, F., Fievez, V., de Buck, J., Pasmans, F., Martel, A., Haesebrouck, F., et al.

(2004c). Microencapsulated short-chain fatty acids in feed modify colonization and

invasion early after infection with Salmonella enteritidis in young chickens. Poultry

Science, 83(1), 69-74.

Van Immerseel, F., Russell, J. B., Flythe, M. D., Gantois, I., Timbermont, L., Pasmans, F., et

al. (2006). The use of organic acids to combat Salmonella in poultry: a mechanistic

explanation of the efficacy. Avian Pathology, 35(3), 182-188.

Verraes, C., Van Boxstael, S., Van Meervenne, E., Van Coillie, E., Butaye, P., Catry, B., et al.

(2013). Antimicrobial resistance in the food chain: A review. International Journal of

Environmental Research and Public Health, 10(7), 2643-2669.

Vestby, L. K., Moretro, T., Langsrud, S., Heir, E., & Nesse, L. L. (2009). Biofilm forming

abilities of Salmonella are correlated with persistence in fish meal- and feed factories.

BMC Veterinary Research, 5, 20.

Wales, A., Breslin, M., Carter, B., Sayers, R., & Davies, R. (2007). A longitudinal study of

environmental Salmonella contamination in caged and free-range layer flocks. Avian

Pathology, 36(3), 187-197.

Wales, A., McLaren, I., Rabie, A., Gosling, R. J., Martelli, F., Sayers, R., et al. (2013).

Assessment of the anti-Salmonella activity of commercial formulations of organic acid

products. Avian Pathology, 42(3), 268-275.

Wales, A. D., Allen, V. M., & Davies, R. H. (2010). Chemical treatment of animal feed and

water for the control of Salmonella. Foodborne Pathogens and Disease, 7(1), 3-15.

Wales, A. D., & Davies, R. H. (2011). A critical review of Salmonella Typhimurium infection

in laying hens. Avian Pathology, 40(5), 429-436.

Wang, H., Dong, Y., Wang, G., Xu, X., & Zhou, G. (2016). Effect of growth media on gene

expression levels in Salmonella Typhimurium biofilm formed on stainless steel surface.

Food Control, 59, 546-552.

Welch, T. J., Fricke, W. F., McDermott, P. F., White, D. G., Rosso, M. L., Rasko, D. A., et al.

(2007). Multiple antimicrobial resistance in plague: an emerging public health risk. PloS

One, 2(3), e309.

Whiley, H., & Ross, K. (2015). Salmonella and eggs: from production to plate. International

Journal of Environmental Research and Public Health, 12(3), 2543-2556.

White, A. P., Gibson, D. L., Grassl, G. A., Kay, W. W., Finlay, B. B., Vallance, B. A., et al.

(2008). Aggregation via the red, dry, and rough morphotype is not a virulence adaptation

in Salmonella enterica serovar Typhimurium. Infection and Immunity, 76(3), 1048-

1058.

White, A. P., Gibson, D. L., Kim, W., Kay, W. W., & Surette, M. G. (2006). Thin aggregative

fimbriae and cellulose enhance long-term survival and persistence of Salmonella.

Journal of Bacteriology, 188(9), 3219-3227.

Williams, A., Davies, A. C., Wilson, J., Marsh, P. D., Leach, S., & Humphrey, T. J. (1998).

Contamination of the contents of intact eggs by Salmonella typhimurium DT104.

Veterinary Record, 143(20), 562-563.

Williams, J. E. (1981). Salmonellas in poultry feeds- a worldwide review. World's Poultry

Science Journal, 37(01), 6-25.

Wilson, M., Patel, H., & Fletcher, J. (1996). Susceptibility of biofilms of Streptococcus sanguis

to chlorhexidine gluconate and cetylpyridinium chloride. Oral Microbiology and

Immunology, 11(3), 188-192.

Wilson, T. (2012). Antibiotics and parasiticides in egg layers: What can be used and how.

Paper presented at the The Australasian Veterinary Poultry Association (AVPA)

Conference, Gold Coast.

Winter, S. E., Thiennimitr, P., Winter, M. G., Butler, B. P., Huseby, D. L., Crawford, R. W., et

al. (2010). Gut inflammation provides a respiratory electron acceptor for Salmonella.

Nature, 467(7314), 426-429.

Wong, H. S., Townsend, K. M., Fenwick, S. G., Trengove, R. D., & O’Handley, R. M. (2010a).

Comparative susceptibility of planktonic and 3-day-old Salmonella Typhimurium

biofilms to disinfectants. Journal of Applied Microbiology, 108(6), 2222-2228.

Wong, H. S., Townsend, K. M., Fenwick, S. G., Maker, G., Trengove, R. D., & O'Handley, R.

M. (2010b). Comparative susceptibility of Salmonella Typhimurium biofilms of

different ages to disinfectants. Biofouling, 26(7), 859-864.

Ziyate, N., Karraouan, B., Kadiri, A., Darkaoui, S., Soulaymani, A., & Bouchrif, B. (2016).

Prevalence and antimicrobial resistance of Salmonella isolates in Moroccan laying hens

farms. The Journal of Applied Poultry Research.

Zogaj, X., Nimtz, M., Rohde, M., Bokranz, W., & Romling, U. (2001). The multicellular

morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the

second component of the extracellular matrix. Molecular Microbiology, 39(6), 1452-

1463.

CHAPTER 2 ANTIMICROBIAL RESISTANCE OF NON- TYPHOIDAL SALMONELLA ISOLATES FROM EGG LAYER FLOCKS AND EGG SHELLS

82 International Journal of Food Microbiology 203 (2015) 23–26

Contents lists available at ScienceDirect

International Journal of Food Microbiology

journal homepage: www.elsevier.com/locate/ijfoodmicro

Short communication Antimicrobial resistance of non-typhoidal Salmonella isolates from egg layer ﬂocks and egg shells

Vivek V. Pande, Vaibhav C. Gole, Andrea R. McWhorter, Sam Abraham, Kapil K. Chousalkar ⁎

School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy, SA 5371, Australia article info abstract

Article history: This study was conducted to examine the antimicrobial resistance (AMR) of Salmonella spp. isolated from Received 21 November 2014 commercial caged layer ﬂocks in New South Wales and South Australia. All Salmonella isolates (n = 145) were Received in revised form 15 February 2015 subjected to phenotypic and genotypic characterisation of AMR and carriage of integrons. The majority of Accepted 20 February 2015 Salmonella isolates (91.72%) were susceptible to all antimicrobials tested in this study. Limited resistance was ob- Available online 28 February 2015 served to amoxicillin and ampicillin (5.51%), tetracycline (4.13%), cephalothin (2.06%) and trimethoprim (0.68%). ﬂ Keywords: None of the isolates were resistant to cefotaxime, ceftiofur, cipro oxacin, chloramphenicol, gentamycin, neomy- Eggs cin or streptomycin. A low frequency of Salmonella isolates (4.83%) harboured antimicrobial resistance genes and Layer a class 1 integron. The most commonly detected AMR genes among the Salmonella isolates were blaTEM (2.07%), Antimicrobial resistance tet A (1.38%) and dhfrV (0.69%). Overall, Salmonella enterica isolates exhibited a low frequency of AMR and Salmonella represent a minimal public health risk associated with the emergence of multidrug resistant Salmonella spp. from the Australian layer industry. Crown Copyright © 2015 Published by Elsevier B.V. All rights reserved.

1. Introduction global concern for both animal and public health. Moreover, the transfer of multidrug resistant Salmonella spp. to humans through food produc- Salmonella spp. is a major cause of foodborne illness worldwide. ing animals can compromise the treatment options (Hur et al., 2012). Consumption of contaminated food products such as pork, meat, egg Compared with many other countries, Australia currently has a very and egg related products are among the most common sources of conservative approach for antibiotic usage in commercial egg layer Salmonella infection (Hur et al., 2012). In Australia, outbreaks of flocks. Antimicrobials, such as fluoroquinolones, are prohibited and human salmonellosis are associated with the consumption of contami- ceftiofur is not approved for mass administration in food producing nated food products containing chicken meat or egg products animals (Cheng et al., 2012; Obeng et al., 2012). To date, there is little in- (OzFoodNet Working Group, 2012). In Australia, a total of 11,992 formation available characterising antimicrobial resistance (AMR) in Salmonella cases were reported in 2010, representing 53.7 cases per Salmonella isolated from commercial Australian egg layer flocks. In 100,000 people which is higher compared to the previous 5 years this study, the phenotypic and genotypic AMR was characterised for with an average infection rate of 41.8 cases per 100,000 people multiple Salmonella isolates recovered from layer flocks and egg shells. (OzFoodNet Working Group, 2012). Typically, infection with Salmonella is self-limiting producing mild gastroenteritis, however, severe infection occurs common in elderly 2. Materials and methods and immunocompromised individuals (Parry and Threlfall, 2008). Se- vere, systemic salmonellosis may require treatment with antimicrobials 2.1. Bacterial strains and serotyping such as fluoroquinolones and extended-spectrum cephalosporins (Parry and Threlfall, 2008). The use of antimicrobial agents in the A total 145 Salmonella isolates were used in this study. Samples were prevention and treatment of many infectious diseases and as a growth isolated from 33 commercial caged layer flocks sourced from a total of promoter is well known both in veterinary and human medicine (Hur 13 farms from New South Wales (10 farms) and South Australia (3 et al., 2012). Indiscriminate use of antibiotics in both animal and farms). All Salmonella isolates used in this study were previously human populations has, however, led to an emergence of multidrug isolated in our laboratory during epidemiological studies (Chousalkar resistant Salmonella strains (Anjum et al., 2011). The emergence and and Roberts, 2012; Gole et al., 2014a, 2014b). Details of Salmonella iso- dissemination of antibiotic resistance to Salmonella is of significant lates, sources and their distribution are presented in Table 1. All isolates were serotyped by the Salmonella Reference Laboratory, Institute of ⁎ Corresponding author. Tel.: +61 8 8313 1502; fax: +61 8 8303 7356. Medical and Veterinary Science, SA Pathology (Adelaide, South E-mail address: [email protected] (K.K. Chousalkar). Australia).

83 24 V.V. Pande et al. / International Journal of Food Microbiology 203 (2015) 23–26

Table 1 reaction, both negative and positive controls were included. A set of Distribution and sources of Salmonella isolates. five positive control Salmonella strains known to contain the targeted an- Salmonella (S.) serovar Source Total timicrobial resistance genes were selected from isolates included in an earlier study (Abraham et al., 2014). PCR reactions for multiplex pool Dust Egg belt Faeces Shell wash were performed in total volume of 25 μL containing 5 ng of DNA tem- S. Agona 4 2 0 0 6 plate and final concentrations of 10 μM of each dNTP (Bioline, S. Anatum 2 4 0 0 6 S. Infantis 0 2 3 11 16 Australia), 4 mM MgCl2,25pM each primer pool and 1 U of Hotstart S. Mbandaka 7 11 12 0 30 Taq polymerase (Qiagen, Australia). Uniplex PCR reactions were also per- S. Oranienburg 8 8 8 6 30 formed in a total reaction volume of 25 μL including 2 μLDNAtemplate. S. Typhimurium 14 5 6 1 26 Each uniplex PCR reaction mixture consisted of final concentration of S. Worthington 7 8 14 2 31 1.5 mM MgCl ,2.5μM of each dNTP (Bioline, Australia), 25 pM of each Total 42 40 43 20 145 2 primer, and 1 U of Taq polymerase (Bioline, Australia). DNA amplification was carried out in T100 thermal cycler (Bio-Rad, Australia) using the fol- 2.2. Antimicrobial susceptibility testing lowing conditions: 15 min initial denaturation at 95 °C, following 30 cycles of denaturation at 94 °C for 30 s, annealing at various temper- Antimicrobial susceptibility testing of each Salmonella isolate to 12 atures for 30 s (Table S1) and extension at 72 °C for 60 s and final ampli- antibiotics (Table 2) was determined using the broth microdilution fication cycle at 72 °C for 10 min. PCR products were electrophoresed at method and the results were interpreted according to the established 80 V for 2.5 h on 2% agarose gel. The size of PCR products was determined Clinical and Laboratory Standards Institute (CLSI), guidelines (CLSI, by comparing with standard 100 bp ladders (Thermo Fisher, Australia). 2013). In cases where CLSI breakpoints were absent, results were eval- The details of antimicrobial resistance genes, integrons and primer uated according to the National Antimicrobial Resistance Monitoring sequences are described in Supplementary Table S1. guidelines (National Antimicrobial Resistance Monitoring System, 2012) or Swedish Veterinary Antimicrobial Resistance Monitoring 3. Results guidelines (Swedish Veterinary Antimicrobial Resistance Monitoring, 2012). All tests were performed using Escherichia coli ATCC 25922 as 3.1. Antimicrobial susceptibility screening of Salmonella isolates control strain. Salmonella isolates showing resistance to more than three classes of antimicrobial agents were classified as multi-drug The Salmonella isolates selected for this study displayed a low but resistant (MDR). wide spectrum of antibiotic resistance (Table 2). A total of 91.72% (133/145) of the Salmonella isolates were susceptible to all tested antimicrobials. Overall, resistance was observed to amoxicillin and ampicil- 2.3. DNA extraction lin (5.51%), tetracycline (4.13%), cephalothin (2.06%) and trimethoprim (0.68%) (Table 2). Resistance to cefotaxime, ceftiofur, ciprofloxacin, DNA extraction from all Salmonella isolates was performed using 6% chloramphenicol, gentamycin, neomycin, or streptomycin was not ob- Chelex® (Bio-Rad, Sydney, NSW, Australia) prepared in TE (10 mM Tris served for any isolate. S. Mbandaka, S. Typhimurium and S. Worthington and 1 mM EDTA). Briefly, single colonies of fresh Salmonella isolates showed resistance to amoxicillin, ampicillin and tetracycline whereas were grown in LB broth at 37 °C for approximately 16 h with shaking. S. Agona, S. Anatum, S.InfantisandS. Oranienburg were susceptible to 100 μL of overnight bacterial culture was mixed to 1 ml of sterile all tested antimicrobials. water and centrifuged at 14,000 g for 2 min. The supernatant in the No multidrug resistant phenotypes were identified from any tube was decanted and bacterial pellet was re-suspended in 200 μLof Salmonella isolate included in this study. Results of resistance patterns 6% Chelex solution. The tubes were incubated at 56 °C for 20 min. Fol- of all Salmonella isolates are described in Table 3. lowing vortexing, tubes were incubated at 100 °C for 8 min. Samples were kept on ice for 5 min and centrifuged for centrifuged at 14,000 g 3.2. Detection of resistance genes and integrons for 10 min. Supernatants were recovered from each isolate and used as DNA template for polymerase chain reactions (PCR). All 145 Salmonella isolates belonging to seven different serovars recovered from layer flocks were investigated for antimicrobial resistance 2.4. Analysis of antimicrobial resistance genes (ARG) and integrons genes and integrons by multiplex and uniplex PCR. A total of 4.83% (7/145) Salmonella isolates harboured antimicrobial resistance All 145 Salmonella isolates were screened for total of 20 antimicrobial genes and class 1 integron (Table 4). The resistance genes most com- resistance genes (ARG) by either multiplex or uniplex PCR (Van et al., monly detected were blaTEM (2.07%), tet A (1.38%), dhfrVandclass1 2008). Presence of class 1, 2 and 3 integrons in Salmonella isolates were integron (0.69%). One isolate, S. Mbandaka was positive for class 1 investigated by multiplex PCR assay (Dillon et al., 2005). For each PCR integron and contained the dhfrV gene conferring resistance to

Table 2 Percentage (%) of antimicrobial resistance among different serovars of Salmonella (n).

Antimicrobials

Serovar No. of isolates tested AMC AMP CTX CEF CPL CIP CHL GEN NEO STR TET TRM

S. Agona 6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 S. Anatum 6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 S. Infantis 16 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 S. Mbandaka 30 6.66 (2) 6.66 (2) 0.0 0.0 3.33 (1) 0.0 0.0 0.0 0.0 0.0 16.66 (5) 3.33 (1) S. Oranienburg 30 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 S. Typhimurium 26 3.84 (1) 3.84 (1) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 3.84 (1) 0.0 S. Worthington 31 16.12 (5) 16.12 (5) 0.0 0.0 6.45 (2) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total 145 5.51 (8/145) 5.51 (8/145) 0.0 0.0 2.06 (3/145) 0.0 0.0 0.0 0.0 0.0 4.13 (6/145) 0.68 (1/145)

Abbreviations: AMC — Amoxycillin; AMP — Ampicillin; CTX — Cefotaxime; CEF — Ceftiofur; CPL — Cephalothin; CIP — Ciproﬂoxacin; CHL — Chloramphenicol; GEN — Gentamycin; NEO — Neomycin; STR — Streptomycin; TET — Tetracyline; TRM — Trimethorpim.

84 V.V. Pande et al. / International Journal of Food Microbiology 203 (2015) 23–26 25

Table 3 showing high rates of resistance to antimicrobials in Salmonella iso- Drug resistance pattern among various Salmonella serovars recovered from Egg farms. lates from retail chicken meat samples, food animals or food prod- Serovar (no. of Resistance Resistance pattern Number of ucts (Musgrove et al., 2006; Chen et al., 2004; Louden et al., 2012). isolates) to number of isolates Globally, resistance to fluoroquinolones or extended spectrum antibiotics cephalosporins among Salmonella spp. isolated from food animals is S. Agona (6) 0 0 0 prevalent (Hur et al., 2012). The results obtained in this study demon- S. Anatum (6) 0 0 0 strating the absence antimicrobial resistance in Salmonella spp. isolated S. Infantis (16) 0 0 0 from Australian caged layer farms is an important finding for public S. Mbandaka (30) 1 Tet 4 fl S. Mbandaka (30) 3 AMP + AMC + TRM 1 health. The lack of uoroquinolone resistance in this study could be S. Mbandaka (30) 4 AMP + AMC + CPL + TET 1 attributed to a ban on the use of fluoroquinolones in Australian food an- S. Oranienburg (30) 0 0 0 imals. As a result, resistance to fluoroquinolones has not been detected S. Typhimurium (26) 3 AMC + AMP + TET 1 in many bacterial strains including Salmonella (Cheng et al., 2012). S. Worthington (31) 2 AMC + AMP 3 Australia has strict regulations and controlled usage for antibiotic in S. Worthington (31) 3 AMP + AMC + CPL 2 food producing animals in contrast with other countries where fewer — — — — Abbreviations: AMC Amoxycillin; AMP Ampicillin; CPL Cephalothin; TET regulations are imposed on usage of critical antimicrobials (Obeng Tetracyline; TRM — Trimethorpim. et al., 2012). Antibiotics used in human medicine are generally not used to treat commercial egg layers. This strategy has helped minimise trimethoprim. Several antimicrobial resistance genes and integrons the amount of antibiotic residues in eggs or egg products and transfer of were not detected in some Salmonella isolates including, cat1, floR, antibiotic resistance and resistance genes from animals to humans aadA, blaOXA,cmlA,blaCMY-2, dhfrI, aphA1, blaDHA, blaMIR-1, blaACT-1, through the food chain (Barton et al., 2003). As a result of these restric- aac(3)-IV, blaFOX1–5, blaSHV, tetB, tetC, tetD, tetG,integronclass2and tions, a recent Australian study reported very low levels of antimicrobial integron class 3. The association of phenotypic resistance and the resistance in Salmonella isolates from confirmed cases of salmonellosis presence of antimicrobial resistance genes were variable among in livestock (Abraham et al., 2014). The current study has extended Salmonella serovars. For example, phenotypic resistance to one or these earlier studies and has demonstrated a lower prevalence of anti- more antimicrobials was observed for both S. Mbandaka (n = 5) microbial resistance in Salmonella serovars recovered from Australian and S. Worthington (n = 5), however, the corresponding resistance layer flocks. genes were not detected by PCR. One S.Typhimuriumisolatetested In this study, antimicrobial resistance was associated with specific positive for the presence of the blaTEM gene but did not show resis- Salmonella serovars, S. Mbandaka, S. Typhimurium and S.Worthington. tance by broth microdilution method. Serovar specific differences for resistance have been described in previous studies (Musgrove et al., 2006; Aslam et al., 2012). The serovar 4. Discussion specific differences in resistance could be the result of selective transfer of mobile genetic elements or Salmonella serovars may possess the The widespread use of antibiotics both in both human and veter- genetic determinants of antimicrobial resistance (Aslam et al., 2012). inary medicine is well known, but their imprudent use may give rise Further studies designed to characterise the genetic mechanisms of to multidrug resistant strains of Salmonella (Anjum et al., 2011). This serovar specific resistance are essential. is the first Australian-based descriptive study characterising the The discordance between phenotypic resistance and the presence of occurrence of phenotypic and genotypic antimicrobial resistance of antimicrobial resistance genes among S. Mbandaka and S. Worthington Salmonella isolates recovered from commercial layer flocks. It is isolates was consistent with (Abraham et al., 2014) but differed noteworthy that the majority of Salmonella isolates (91.72%) in this from (Anjum et al., 2011). In the present study, one S. Typhimurium study were susceptible to all antimicrobials tested and no resistance isolate found to be PCR positive for the blaTEM gene was susceptible was observed to fluoroquinolones or extended spectrum cephalo- to all antimicrobials (Anjum et al., 2011). Such a phenomenon sporins which are commonly used for the treatment of human sal- could occur due to the presence of silent, non-expressing genes or monellosis (Cheng et al., 2012).Thoughthedegreeandprevalence existence of non-integrated gene cassettes as described for qnrS, of antimicrobial resistance in Salmonella isolates was low, the most blaCMY, tetBandstrA-strB genes in Salmonella isolates (Anjum common resistance was to amoxicillin, ampicillin, cephalothin, tet- et al., 2011). racycline and trimethoprim. A large scale study in the UK reported Consistent with previous work, blaTEM was the most commonly de- that 76% Salmonella isolates from laying flocks were susceptible to tected β-lactamase gene in Salmonella isolates which were resistant to antimicrobials tested, with the frequency of resistance being highest ampicillin and amoxicillin (Aslam et al., 2012). Tetracycline resistance to ampicillin (15.3%), tetracycline (13.6%), chloramphenicol (6.8%) in Salmonella is encoded most frequently by class tet A, B, C, D, and G and streptomycin (10.7%) (Snow et al., 2007). The findings present- genes and these genes were screened in all Salmonella isolates in this edhereareincontrastwithpreviousreportsfromtheUSAandChina study. Two of our isolates (1.38%) contained only tetA gene and none of the other tet genes were observed in Salmonella isolates. Resistance to trimethoprim is primarily mediated by expression of dhfr genes Table 4 encoding drug-resistant dihydrofolate reductase (DHFR) (Huovinen Antimicrobial resistance gene and class 1 integron distribution pattern in Salmonella et al., 1995). The dhfrV gene was identified in a trimethoprim resistant isolates (n = 145) tested during this study. S. Mbandaka isolate and is consistent with other reports (Abraham Resistance Total number of isolates Salmonella isolates (n) et al., 2014). A class 1 integron was also detected in a single S. Mbandaka genes associated with resistance isolate which carried dhfrV gene conferring resistance to trimethoprim, genes (%) a finding which has also been reported earlier in Salmonella spp. isolated None 138 (95.17) Agona (6), Anatum (6), Infantis (16), from livestock (Abraham et al., 2014). Mbandaka (26), Oranienburg (30), The work described here highlights the low rates of antimicrobial Typhimurium (23), fl Worthington (31) resistance in Salmonella isolated from Australian layer ocks. Regular

blaTEM 3 (2.07) Typhimurium (2), Mbandaka (1) surveillance over a larger geographical area and comprehensive nation- dhfrV 1 (0.69) Mbandaka (1) wide sampling is, however, needed to identify any changes in antimi- int1 1 (0.69) Mbandaka (1) crobial resistance patterns in Salmonella isolates in the egg industry. TetA 2 (1.38) Typhimurium (1), Mbandaka (1) Collective efforts to ensure the appropriate use of antimicrobials in

85 26 V.V. Pande et al. / International Journal of Food Microbiology 203 (2015) 23–26 food animals remain a high priority to minimise the risk of spread and Cheng, A.C., Turnidge, J., Collignon, P., Looke, D., Barton, M., Gottlieb, T., 2012. Control of fluoroquinolone resistance through successful regulation, Australia. Emerg. Infect. development of antimicrobial resistance. Dis. 18, 1453–1460. Chousalkar, K.K., Roberts, J.R., 2012. Recovery of Salmonella from eggshell wash, eggshell Competing interests crush, and egg internal contents of unwashed commercial shell eggs in Australia. Poult. Sci. 91, 1739–1741. CLSI, 2013. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third All authors declare no competing interest. Informational Supplement. CLSI document M100-S23. Clinical Laboratory Standards Institute, Wayne, PA. Acknowledgements Dillon, B., Thomas, L., Mohmand, G., Zelynski, A., Iredell, J., 2005. Multiplex PCR for screening of integrons in bacterial lysates. J. Microbiol. Methods 62, 221–232. Gole, V.C., Torok, V., Sexton, M., Caraguel, C.G., Chousalkar, K.K., 2014a. Association This research was conducted within the Poultry CRC (Grant no between the indoor environmental contamination of Salmonella with egg contamina- – 3.3.2), established and supported under the Australian Government's tion on layer farms. J. Clin. Microbiol. 52, 3250 3258. Gole, V.C., Caraguel, C.G., Sexton, M., Fowler, C., Chousalkar, K.K., 2014b. Shedding of Cooperative Research Centres Program. Mr. Vivek Pande is an Interna- Salmonella in single age caged commercial layer flock at an early stage of lay. Int. tional Postgraduate Research Scholarship recipient at University of J. Food Microbiol. 189, 61–66. Adelaide. We would like to acknowledge Nikita Nevrekar for technical Huovinen, P., Sundström, L., Swedberg, G., Sköld, O., 1995. Trimethoprim and sulfonamide resistance. Antimicrob. Agents Chemother. 39, 279–289. help during this research work. We would also like to thank all egg pro- Hur, J., Jawale, C., Lee, J.H., 2012. Antimicrobial resistance of Salmonella isolated from food ducers who participated in this study. animals: a review. Food Res. Int. 45, 819–830. Louden, B.C., Haarmann, D., Han, J., Foley, S.L., Lynne, A.M., 2012. Characterization of antimicrobial resistance in Salmonella enterica serovar Typhimurium isolates from food Appendix A. Supplementary data animals in the U.S. Food Res. Int. 45, 968–972. Musgrove, M.T., Jones, D.R., Northcutt, J.K., Cox, N.A., Harrison, M.A., Fedorka-Cray, P.J., Supplementary data to this article can be found online at http://dx. Ladely, S.R., 2006. Antimicrobial resistance in Salmonella and Escherichia coli isolated – doi.org/10.1016/j.ijfoodmicro.2015.02.025. from commercial shell eggs. Poult. Sci. 85, 1665 1669. National Antimicrobial Resistance Monitoring System — Enteric Bacteria (NARMS), 2012. 2010 Executive Report. Department of Health and Human Services, Food and Drug References Administration, Rockville, MD: U.S. Obeng, A.S., Rickard, H., Ndi, O., Sexton, M., Barton, M., 2012. Antibiotic resistance, Abraham, S., Groves, M.D., Trott, D.J., Chapman, T.A., Turner, B., Hornitzky, M., Jordan, D., phylogenetic grouping and virulence potential of Escherichia coli isolated from the 2014. Salmonella enterica isolated from infections in Australian livestock remain faeces of intensively farmed and free range poultry. Vet. Microbiol. 154, 305–315. susceptible to critical antimicrobials. Int. J. Antimicrob. Agents 43, 126–130. OzFoodNet Working Group, 2012. Monitoring the incidence and causes of diseases poten- Anjum, M.F., Choudhary, S., Morrison, V., Snow, L.C., Mafura, M., Slickers, P., Ehricht, R., tially transmitted by food in Australia: annual report of the OzFoodNet network, Woodward, M.J., 2011. Identifying antimicrobial resistance genes of human clinical 2010. Communicable Diseases Intelligence Quaterly Report 36, pp. E213–E241. relevance within Salmonella isolated from food animals in Great Britain. Parry, C.M., Threlfall, E., 2008. Antimicrobial resistance in typhoidal and nontyphoidal J. Antimicrob. Chemother. 66, 550–559. salmonellae. Curr. Opin. Infect. Dis. 21, 531–538. Aslam, M., Checkley, S., Avery, B., Chalmers, G., Bohaychuk, V., Gensler, G., Reid-Smith, R., Snow, L.C., Davies, R.H., Christiansen, K.H., Carrique-Mas, J.J., Wales, A.D., O'Connor, J.L., Boerlin, P., 2012. Phenotypic and genetic characterization of antimicrobial resistance Cook, A.J.C., Evans, S.J., 2007. Survey of the prevalence of Salmonella species on in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiol. commercial laying farms in the United Kingdom. Vet. Rec. 161, 471–476. 32, 110–117. Swedish Veterinary Antimicrobial Resistance Monitoring (SVARM, 2011). 2012b. The Barton, M.D., Pratt, R., Hart, W.S., 2003. Antibiotic resistance in animals. Commun. Dis. National Veterinary Institute (SVA), Uppsala, Sweden. Intell. 27, S121–S126. Van, T.T.H., Chin, J., Chapman, T., Tran, L.T., Coloe, P.J., 2008. Safety of raw meat and Chen, S., Zhao, S., White, D.G., Schroeder, C.M., Lu, R., Yang, H., McDermott, P.F., Ayers, S., shellfish in Vietnam: an analysis of Escherichia coli isolations for antibiotic resistance Meng, J., 2004. Characterization of multiple-antimicrobial-resistant Salmonella and virulence genes. Int. J. Food Microbiol. 124, 217–223. serovars isolated from retail meats. Appl. Environ. Microbiol. 70, 1–7.

86 Table S1 Details of primers used in PCR for antimicrobial resistance genes.

PCR pool set/ Gene Gene description Primer DNA sequence (5’3’) Amplicon Reference annealing size (bp) temperature 1/640C cat1 Chloramphenicol CATI-F AGTTGCTCAATGTACCTATAACC 547 (Maynard et al., 2003) CATI-R TTGTAATTCATTAAGCATTCTGCC dhfrV Trimethoprim dhfrV-F CTGCAAAAGCGAAAAACGG 432 (Maynard et al., 2003) dhfrV-R AGCAATAGTTAATGTTTGAGCTAAAG floR Florfenicol floR-F TATCTCCCTGTCGTTCCAG 399 (Maynard et al., 2003) floR-R AGAACTCGCCGATCAATG aadA Aminoglycosides aadA-F TGATTTGCTGGTTACGGTGAC 284 (Maynard et al., 2003) aadA-R CGCTATGTTCTCTTGCTTTTG

blaOXA Beta-lactam blaOXA- GCAGCGCCAGTGCATCAAC 198 (Maynard et al., F 2003) blaOXA- CCGCATCAAATGCCATAAGTG R 0 2/64 C blaTEM Beta-lactam blaTEM- GAGTATTCAACATTTTCGT 857 (Maynard et al., F 2003) blaTEM- ACCAATGCTTAATCAGTGA R

cmlA Chloramphenicol cmlA-F CCGCCACGGTGTTGTTGTTATC 698 (Maynard et al., 2003) cmlA-R CACCTTGCCTGCCCATCATTAG

CIT (blaLAT or AmpC’s CITM-F TGGCCAGAACTGACAGGCAAA 462 (Pérez and blaCMY-2) Hanson, 2002) CITM-R TTTCTCCTGAACGTGGCTGGC dhfrI Trimethoprim dhfrI-F AAGAATGGAGTTATCGGGAATG 391 (Maynard et al., 2003) dhfrI-R GGGTAAAAACTGGCCTAAAATTG 3/630C aphA1 Aminoglycosides aphA-1-F ATGGGCTCGCGATAATGTC 634 (Maynard et al., 2003) aphA-1-R CTCACCGAGGCAGTTCCAT

blaDHA AmpC’s DHAM-F AACTTTCACAGGTGTGCTGGGT 405 (Pérez and Hanson, 2002) DHAM-R CCGTACGCATACTGGCTTTGC

EBC (blaMIR-1 AmpC’s EBCM-F TCGGTAAAGCCGATGTTGCGG 302 (Pérez and or blaACT-1) Hanson, 2002) EBCM-R CTTCCACTGCGGCTGCCAGTT aac(3)-IV Aminoglycosides aac(3)- CTTCAGGATGGCAAGTTGGT 286 (Sáenz et al., IV-F 2004) aac(3)- TCATCTCGTTCTCCGCTCAT IV-R

blaFOX1–5 FOXM FOXM-F AACATGGGGTATCAGGGAGATG 190 (Pérez and Hanson, 2002) 88

FOXM-R CAAAGCGCGTAACCGGATTGG 4/640C Intergron I Int1F CAGTGGACATAAGCCTGTTC 160 (Koeleman et al., 2001) Int1R CCCGAGGCATAGACTGTA Integron 2 Int2 F CACGGATATGCGACAAAAAGGT 788 (Mazel et al., 2000) Int2 R GTAGCAAACGAGTGACGAAATG Integron 3 Int3 F GCCTCCGGCAGCGACTTTCAG 979 (Mazel et al., 2000) Int3 R ACGGATCTGCCAAACCTGACT 0 Uniplex/62 C blaSHV Beta-lactam blaSHV-F TCGCCTGTGTATTATCTCCC 768 (Maynard et al., 2003) blaSHV- CGCAGATAAATCACCACAATG R Uniplex/600C tetA Tetracycline tet(A)-F GTGAAACCCAACATACCCC 887 (Maynard et al., 2003) tet(A)-R GAAGGCAAGCAGGATGTAG Uniplex/630C tetB Tetracycline tet(B)-F CCTTATCATGCCAGTCTTGC 773 (Maynard et al., 2003) tet(B)-R ACTGCCGTTTTTTCGCC Uniplex/630C tetC Tetracycline tet(C)-F ACTTGGAGCCACTATCGAC 880 (Maynard et al., 2003) tet(C)-R CTACAATCCATGCCAACCC

Uniplex/630C tetD Tetracycline tet(D)-F TGGGCAGATGGTCAGATAAG 827 (Maynard et al., 2003) tet(D)-R CAGCACACCCTGTAGTTTTC Uniplex/630C tetG Tetracycline tet(G)-F GCTCGGTGGTATCTCTGCTC 550 (Ma et al., 2007) tet(G)-R CAAAGCCCCTTGCTTGTTAC

References

Koeleman, J.G.M., Stoof, J., Van Der Bijl, M.W., Vandenbroucke-Grauls, C.M.J.E., Savelkoul,

P.H.M., 2001. Identification of Epidemic Strains of Acinetobacter baumannii by Integrase

Gene PCR. Journal of Clinical Microbiology 39, 8-13.

Ma, M., Wang, H., Yu, Y., Zhang, D., Liu, S., 2007. Detection of antimicrobial resistance genes of pathogenic Salmonella from swine with DNA microarray. Journal of Veterinary Diagnostic

Investigation 19, 161-167.

Maynard, C., Fairbrother, J.M., Bekal, S., Sanschagrin, F., Levesque, R.C., Brousseau, R.,

Masson, L., Lariviere, S., Harel, J., 2003. Antimicrobial resistance genes in enterotoxigenic

Escherichia coli O149: K91 isolates obtained over a 23-year period from pigs. Antimicrobial

Agents and Chemotherapy 47, 3214-3221.

Mazel, D., Dychinco, B., Webb, V.A., Davies, J., 2000. Antibiotic Resistance in the ECOR

Collection: Integrons and Identification of a Novel aad Gene. Antimicrobial Agents and

Chemotherapy 44, 1568-1574.

Pérez-Pérez, F.J., Hanson, N.D., 2002. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. Journal of Clinical Microbiology 40, 2153-

2162.

Sáenz, Y., Briñas, L., Domínguez, E., Ruiz, J., Zarazaga, M., Vila, J., Torres, C., 2004.

Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrobial Agents and Chemotherapy 48, 3996-4001.

CHAPTER 3 STUDY OF SALMONELLA TYPHIMURIUM INFECTION IN LAYING HENS

ORIGINAL RESEARCH published: 25 February 2016 doi: 10.3389/fmicb.2016.00203

Study of Salmonella Typhimurium Infection in Laying Hens

Vivek V. Pande, Rebecca L. Devon, Pardeep Sharma, Andrea R. McWhorter and Kapil K. Chousalkar*

School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy, SA, Australia

Members of Salmonella enterica are frequently involved in egg and egg product related human food poisoning outbreaks worldwide. In Australia, Salmonella Typhimurium is frequently involved in egg and egg product related foodborne illness and Salmonella Mbandaka has also been found to be a contaminant of the layer farm environment. The ability possessed by Salmonella Enteritidis to colonize reproductive organs and contaminate developing eggs has been well-described. However, there are few studies investigating this ability for Salmonella Typhimurium. The hypothesis of this study was that the Salmonella Typhimurium can colonize the gut for a prolonged period of time and that Edited by: horizontal infection through feces is the main route of egg contamination. At 14 weeks Jean-Christophe Augustin, of age hens were orally infected with either S. Typhimurium PT 9 or S. Typhimurium PT Ecole Nationale Vétérinaire d’Alfort, France 9 and Salmonella Mbandaka. Salmonella shedding in feces and eggs was monitored for Reviewed by: 15 weeks post-infection. Egg shell surface and internal contents of eggs laid by infected Brian Brunelle, hens were cultured independently for detection of Salmonella spp. The mean Salmonella National Animal Disease Center, USA Avelino Alvarez-Ordóñez, load in feces ranged from 1.54 to 63.35 and 0.31 to 98.38 most probable number/g Teagasc Food Research Centre, (MPN/g) in the S. Typhimurium and S. Typhimurium + S. Mbandaka group, respectively. Ireland No correlation was found between mean fecal Salmonella load and frequency of egg shell *Correspondence: contamination. Egg shell contamination was higher in S. Typhimurium + S. Mbandaka Kapil K. Chousalkar [email protected] infected group (7.2% S. Typhimurium, 14.1% S. Mbandaka) compared to birds infected with S. Typhimurium (5.66%) however, co-infection had no signiﬁcant impact on egg Specialty section: contamination by S. Typhimurium. Throughout the study Salmonella was not recovered This article was submitted to Food Microbiology, from internal contents of eggs laid by hens. Salmonella was isolated from different a section of the journal segments of oviduct of hens from both the groups, however pathology was not observed Frontiers in Microbiology on microscopic examination. This study investigated Salmonella shedding for up to 15 Received: 25 November 2015 weeks p.i which is a longer period of time compared to previously published studies. Accepted: 08 February 2016 Published: 25 February 2016 The ﬁndings of current study demonstrated intermittent but persistent fecal shedding of Citation: Salmonella after oral infection for up to 15 weeks p.i. Further, egg shell contamination, Pande VV, Devon RL, Sharma P, with lack of internal egg content contamination and the low frequency of reproductive McWhorter AR and Chousalkar KK (2016) Study of Salmonella organ infection suggested that horizontal infection through contaminated feces is the Typhimurium Infection in Laying Hens. main route of egg contamination with S. Typhimurium in laying hens. Front. Microbiol. 7:203. doi: 10.3389/fmicb.2016.00203 Keywords: Salmonella Typhimurium, laying hens, oviduct, egg contamination

Frontiers in Microbiology | www.frontiersin.org 1 February 2016 | Volume 7 | Article 203

94 Pande et al. Salmonella Typhimurium oral Infection

INTRODUCTION most frequently recovered serovar along with S.Typhimurium (11.54%, 15/130) (Gole et al., 2014a,c). S. Mbandaka has also Foodborne gastric infections due to Salmonella enterica are of been isolated from egg shell, animals, feed, and sporadic cases of major concern worldwide. Typically contaminated eggs and egg human salmonellosis (Hoszowski and Wasyl, 2001; Little et al., related products are primary vehicles for human salmonellosis. 2007; Im et al., 2015). Given the diversity of poultry associated Globally, S. Enteritidis represents a dominant serotype in Salmonella serovars, there are few reports on how the presence commercial poultry isolated from eggs and is frequently involved of commonly isolated serovars from layer farm environments in egg related food poisoning in humans (Foley et al., 2011). (such as S. Mbandaka) might influence the shedding patterns of S. Enteritidis, however, is not endemic in Australian poultry S. Typhimurium. In addition, how two Salmonella serovars have flocks (OzFoodNet Working Group, 2009). This niche has been an effect upon organ invasion and egg contamination in vivo is filled by S. Typhimurium, which is a leading cause of foodborne still unclear. outbreakslinkedtocontaminatedeggandeggrelatedproducts Given the potential public health threat by S.Typhimurium (OzFoodNet Working Group, 2009). In 2010, S. Typhimurium associated with consumption of contaminated egg and egg was the most commonly notified Salmonella serotype accounting products, this study sought to investigate the dynamics of egg for 5241 (44%) cases of all Salmonella notified infections in contamination over an extended time course. In this study the Australia (OzFoodNet Working Group, 2012). duration of fecal shedding, its relation to frequency of egg The external and internal egg contamination by Salmonella contamination and reproductive organ colonization after oral during poultry production is a complex issue, influenced by infection with S. Typhimurium alone and in combination with many variables. As a result, implementation of appropriate S. Mbandaka was investigated in commercial layer hens. To our control measures is extremely difficult (Whiley and Ross, knowledge, this is a first report of a Salmonella oral challenge 2015). Egg contamination can occur by two routes, vertical model conducted in controlled environment employing strict or horizontal. Vertical transmission is a result of reproductive biosecurity measures for up to 30 weeks of age. organ colonization (ovary and oviduct) before shell formation, whereas horizontal transmission occurs due to external egg shell MATERIALS AND METHODS contamination (De Reu et al., 2006). Oral challenge of both S. Enteritidis and S. Typhimurium Experimental Animals has the potential to invade the reproductive organs. However, Fertile eggs were obtained from a commercial layer parent flock. only S. Enteritidis has been recovered from egg contents (Keller Eggs were fumigated using formaldehyde as previously described et al., 1997; Okamura et al., 2001a; Gast et al., 2004, 2007, 2013; (Samberg and Meroz, 1995) and incubated for 21 days at 37.7◦C. Gantois et al., 2008). The intrinsic properties and resistance to Relative humidity was maintained at 45–55% until day 18 and antibacterial compounds enabling S. Enteritidis to colonize the increased to 55–65% up to hatching. A total of 32 birds were oviduct and contaminate egg internal contents are well-known hatched, raised in pens until week 10 and then shifted in cages (Gantois et al., 2009). There is, however, limited information on contained within positive pressure rooms at Roseworthy Campus the long term shedding, colonization of reproductive organs and of The University of Adelaide, until the end of experiment egg contamination by S. Typhimurium. (week 30). Previous studies have examined reproductive organ Sample size for this study was calculated using Openepi- colonization and egg contamination by S. Typhimurium in Tool (Dean et al., 2011). This tool along with the sample size laying hens. Results from these experiments, however, are determines the power of the experimental trial. For sample size inconsistent due to variation in experimental design, route calculation, assumed percent with outcome in S.Typhimurium of inoculation, inoculum dose as well as the strain of S. and S.Typhimurium+S. Mbandaka infected group was 20% and Typhimurium selected (Baker et al., 1980; Williams et al., 1998; 70% respectively with the confidence interval of 95%. This gave Leach et al., 1999; Okamura et al., 2001a,b, 2010). Moreover, an 80% chance of detecting differences between treatment groups the majority of these previous studies examined the capability with normal approximation. of S. Typhimurium to colonize reproductive organs and/or egg Prior to experiments all animal rooms and equipment were contamination frequency up to 3 weeks post-infection, which fumigated with formaldehyde and cleaned with commercial could fail to unveil the ability of S. Typhimurium to cause egg disinfectants (Chemtel, Australia). Throughout the experiment, contamination over a prolonged period (Wales and Davies, feed was sterilized by fumigation (Samberg and Meroz, 1995) 2011). Altogether, there is a lack of published data arising from and water purification tablets (Aquatabs, Ireland) were added long term experiments aimed at fecal shedding, reproductive to drinking water. Feed and water was provided ad libitum. organ colonization and egg contamination by S.Typhimurium The recommended lighting program specified in the commercial in laying hens. management guide of Hy-Line Australia Pty Ltd was followed On commercial layer farms environmental contamination in this study. Feces, feed, and water samples were tested at with multiple Salmonella serovars is common and represents fortnightly intervals for detection of Salmonella spp. by the a serious concern for poultry industries world-wide (Gole culture method as described previously (Gole et al., 2014a). All et al., 2014c; Im et al., 2015). A recent epidemiological survey experiments were conducted according to the protocol approved examining the prevalence of Salmonella spp. on layer farms by the institutional animal ethics committee of The University demonstrated that S. Mbandaka (54.40%, 68/125) was the of Adelaide (Protocol No. S-2014-008) and in compliance with

Frontiers in Microbiology | www.frontiersin.org 2 February 2016 | Volume 7 | Article 203

95 Pande et al. Salmonella Typhimurium oral Infection the Australian code for the care and use of animals for scientific scientific, Australia) followed by the addition of 90 ml Buffered purposes. peptone water (BPW, (Oxoid, Australia) (1:10); bags were then homogenized for 1 min. From this bag 10 ml of homogenate was Bacterial Strains, Culture, and Inoculum placed into three different sterile tubes (100 dilution). Then 1 ml Preparation of homogenate sample was transferred to three different tubes Salmonella isolates used for oral infection in this study were containing 9 ml of BPW, and then serially diluted in triplicate ◦ recovered previously from layer hen fecal samples (Gole tubes of BPW. The tubes were incubated overnight at 37 C. et al., 2014a,c). S. Typhimurium PT 9 has been frequently After incubation, 10 μl of BPW from each MPN tube was plated implicated in egg product related human Salmonellosis in on modified semisolid Rappaport–Vassiliadis (MSRV, Oxoid, ◦ Australia (OzFoodNet Working Group, 2009, 2012). Hence, Australia) agar plates and incubated at 42 C for 24 h. A loopful this strain was selected. The antimicrobial resistance profile of media from the leading edge of white zones from MRSV plate of Salmonella isolates was characterized earlier (Pande et al., was streaked onto XLD and or Salmonella Brilliance agar plates 2015). S. Typhimurium PT 9 isolate used in this study was (Oxoid, Australia) for confirmation of Salmonella. resistant to amoxicillin, ampicillin, and tetracycline. This isolate was susceptible to trimethoprim, cefotaxime, cephalothin, Bacteriological Analysis of Egg Shell and chloramphenicol, gentamycin, neomycin, and streptomycin. On Internal Contents other hand, S. Mbandaka isolate used in this study was resistant Eggs from both control and Salmonella infected hens were to amoxicillin, ampicillin, and trimethoprim and susceptible collected aseptically in individual Whirl-Pack plastic bags. Each to cefotaxime, cephalothin, chloramphenicol, gentamycin, egg was processed for the presence of Salmonella on the egg neomycin, streptomycin, and tetracycline (Pande et al., 2015). shell and in the internal contents. Briefly, an individual egg For oral inoculation, stocks of bacterial strains were cultured ◦ was immersed in 10 ml of BPW in Whirl- Pack plastic bag, overnight at 37 C on nutrient agar. Twenty-four hours prior to massaged for 2 min and then removed. The egg shell rinse was infection, a single colony of each Salmonella strain was added then processed for Salmonella isolation as previously described to a separate tube containing 5 ml of Luria Bertani (LB) broth (Gole et al., 2014a). Each egg was dipped in 70% ethanol (Oxoid, Australia) and incubated 6 h with shaking (110 rpm). for 2 min to prevent internal content contamination from the From this LB culture, 10 μl was transferred to 5 ml of LB and ◦ egg shell surface. Each egg was then broken aseptically and grown overnight at 37 C with shaking. Bacterial suspensions contents emptied into a Whirl-Pack plastic bag. The egg contents 9 were diluted to 10 bacteria per ml for oral inoculation. Bacterial were homogenized thoroughly. Five ml of internal egg contents cell counts (CFU) were determined by plating 10-fold serial were mixed with 45 ml of BPW (1:10) and incubated at 37◦C dilutions of the inoculum on nutrient agar to confirm dose. overnight. Salmonella enrichment and isolation from egg shell Experimental Design and internal content samples was carried out as described previously (Gole et al., 2014a). Salmonella positive egg shell wash At week 10 after hatch, birds were divided in three treatment enriched in Rappaport-Vassiliadis (RVS) broth was stored in 20% groups and housed in separate rooms in individual cages. At glycerol at −80◦C for further PCR testing. the age of 14 weeks, birds were orally challenged with either 9 = 9 10 CFU of S.TyphimuriumPT9(Tgroup,n 14) or 10 Bacteriological Analysis of Reproductive CFU of S.TyphimuriumPT9andS. Mbandaka (TM group, n = 14). Control birds (C group, n = 4) received only Organs sterile LB broth. Following infection, all experimental birds were Samples (0.1–0.2 g) of the ovary, infundibulum, magnum, monitored twice a day for clinical signs of infection. All hens were isthmus, uterus (shell gland), and vagina were collected in sterile humanely euthanized at the age of week 30. Ovary and segments tubes. The tissue samples were homogenized using a Bullet R of the oviduct (infundibulum, magnum, isthmus, uterus (shell Blender (Next Advance Inc. USA) at full speed for 2 min and gland) and vagina) were removed aseptically and processed for serial 10-fold dilutions were prepared in phosphate buffer saline μ bacteriological and histopathological analysis. Throughout the (PBS). From each dilution 100 l was spread directly onto = XLD agar plates (Oxoid, Australia) and incubated overnight at study, all eggs laid (n 1004) during 5, 7, 9, 11, 13, 15 weeks ◦ post-infection (p.i.) were tested for presence of Salmonella spp. 37 C. After 24 h the number of colonies was enumerated and concentration of Salmonella in tissues was expressed as mean Enumeration and Isolation of Salmonella log10 CFU/g of tissue. from Feces Fecal samples were aseptically collected from individual hens in DNA Extractions from Fecal Samples, Egg Whirl- Pack plastic bags (Thermo Fisher Scientific, Australia) on Shell Wash, and Reproductive Organs days 0, 1, 3, 6, 9, and 12 followed by weeks 3, 5, 7, 9, 11, 13, and DNA was extracted from all fecal samples of control, T and TM 15 p.i. groups using QIAamp DNA Stool Mini Kit (Qiagen, Australia) Fecal samples were processed for enumeration of Salmonella according to manufacturer instructions. DNA extraction from all by three tube most probable number (MPN) method (Santos Salmonella isolates recovered from egg shell washes of T and TM et al., 2005; Pavic et al., 2010). Briefly, 10 g of fecal sample hens was performed as previously described (Pande et al., 2015). were weighed in sterile Whirl-Pack plastic bag (Thermo Briefly, the frozen stock of RVS broth was thawed and 50 μlof

Frontiers in Microbiology | www.frontiersin.org 3 February 2016 | Volume 7 | Article 203

96 Pande et al. Salmonella Typhimurium oral Infection broth was mixed with 450 μl of LB broth and incubated overnight In order to investigate the detection limit of S.Typhimurium at 37◦C. One hundred microliter of overnight bacterial culture by multiplex PCR, Salmonella negative fecal samples were spiked was mixed to 1 ml of sterile water and centrifuged at 14,000 g with S. Typhimurium or S.Typhimurium+ S.Mbandaka for 2 min. After decanting the supernatant, the bacterial pellet at doses ranging from 101 to 109 CFU/ml. Following DNA was re-suspended in 200 μl of 6% ChelexR (Bio-Rad, Sydney, extractions from spiked samples using QIAamp DNA Stool NSW, Australia) prepared in TE (10 mM Tris and 1 mM EDTA). Mini Kit (Qiagen, Australia), multiplex PCR was performed as Tubes were incubated at 56◦C for 20 min, vortexed and further described above. incubated at 100◦C for 8 min. Samples were placed on ice for 5 min and centrifuged at 14,000 g for 10 min. Supernatants were Histopathology of Reproductive Organs recovered from each sample and used as a DNA template for Infundibulum, magnum, isthmus, uterus, and vagina were PCR. collected individually to evaluate histomorphological alterations DNA was extracted from reproductive organs using DNeasy in response to Salmonella infection. Tissue samples of Blood & Tissue Kit (Qiagen, Australia) as per manufacturer reproductive organs were fixed in 10% neutral buffered instructions. formalin, embedded in paraffin wax and 5 μm sections were stained with Haematoxylin and Eosin stain (H &E). PCR Detection of S. Typhimurium and Statistical Analysis S. Mbandaka Significant differences between groups in the isolation rate of Salmonella positive egg shell wash samples from T and TM Salmonella from feces and eggs were determined by Fisher’s exact group, all fecal samples and culture positive reproductive organs probability test. MPN data was analyzed by two way analysis from T and TM groups were screened for Salmonella specific of variance. The relationship between recovery of Salmonella invAgeneandS. Typhimurium serovar specific genomic region (MPN/g) from feces and isolation of Salmonella from egg shell 2 TSR3 (Akiba et al., 2011) by multiplex PCR to detect S. was determined by Pearson correlation test (R -value). All data Typhimurium PT9. TSR3 gene was not amplified in S. Mbandaka generated in this study was analyzed statistically either using R R isolates (Akiba et al., 2011). Further, to differentiate S. Mbandaka GraphPad Prism version 6 software or IBM SPSS Statistics from S. Typhimurium PT 9 in the TM group, DNA extracted version 21. P < 0.05 were considered statistically significant. from feces, egg shell wash and reproductive organs were tested for dhfrV gene that confers resistance to trimethoprim (Pande RESULTS et al., 2015). Samples from T infected group were also tested for dhfrV gene. S. Typhimurium PT9 used in this study was Clinical Symptoms and Mortality sensitive to trimethoprim and negative for dhfrVgene(Pande During the first week p.i., mucoid and blood tinged feces were et al., 2015). PCR reactions for invA and TSR3 gene were observed in two birds from each treatment group. No mortality performed in a total reaction volume of 20 μl including 2 μlDNA was recorded in any of the treatment groups throughout this template. PCR reaction mixture consisted of final concentration study. μ of 1.5 mM MgCl2, 2.5 M of each dNTP (Bioline, Australia), Salmonella 0.5 μM each forward and reverse primer and 2.5 U of Taq Fecal Shedding of at Different polymerase (Bioline, Australia). DNA amplification was carried p.i. Intervals out in T100 thermal cycler (Bio-Rad, Australia) using the All fecal, water and feed samples collected from experimental following protocol: 2 min initial denaturation at 94◦C, following birds before oral challenge were negative for Salmonella spp. 30 cycles of denaturation at 95◦C for 30 s, annealing at 60◦C for The number of Salmonella positive fecal samples for both T (S. 30 s, extension at 68◦C for 30 s and a final extension at 72◦C for Typhimurium) and TM (S. Typhimurium and S. Mbandaka) 5min. groups over the course of the experiment is presented in Table 1. PCR reactions for dhfrV gene were performed in a total No significant difference (p = 0.848) was observed in number reaction volume of 25 μl including 2 μl DNA templates. Each of fecal samples positive for Salmonella between T (152/168, PCR reaction mixture consisted of final concentration of 90.47%) and TM groups (154/168, 91.66%). There were more 1.5 mM MgCl2, 2.5 μM of each dNTP (Bioline, Australia), fecal positive samples until week 5 p.i. 0.28 μM of each primer and 2.5U of Taq polymerase (Bioline, An overall decline after week 5 in the number of birds Australia) using the following PCR cycle conditions: 2 min initial shedding Salmonella in feces was observed in both groups. denaturation at 95◦C, following 30 cycles of denaturation at 94◦C Overall, persistent Salmonella shedding in feces was observed for 30 s, annealing at 64◦C for 30 s, extension at 72◦C for 30 s, and in both groups throughout the experimental period after oral a final extension at 72◦C for 5 min. infection. Salmonella spp. was not isolated from any bird in the PCR products were electrophoresed at 60 V for 1.5 h on 1.5% control group (data not shown). agarose gel in 0.5X Tris borate EDTA buffer and stained with Salmonella GelRed™ nucleic acid gel stain (Biotium, USA). The size of Enumeration of from Feces by PCR products was determined by comparing with standard 100 MPN Method bp ladders (Thermo Fisher, Australia). Negative and positive The viable counts of Salmonella (MPN/g) in feces over the course controls were used in each PCR reaction for all the samples. of the experiment are presented in Figure 1. Throughout the

Frontiers in Microbiology | www.frontiersin.org 4 February 2016 | Volume 7 | Article 203

97 Pande et al. Salmonella Typhimurium oral Infection

TABLE 1 | Detection of Salmonella from fecal samples by culture and PCR.

Days p.i. T group TM group

Salmonella detection S. Typhimurium Salmonella detection S. Typhimurium S. Mbandaka by culture method detection by PCR by culture method detection by PCR detection by PCR

Day 1 14/14a (100%) 14/14b (100%) 14/14a (100%) 12/14b (85.71%) 11/14b (78.57%) Day 3 13/14 (93%) 14/14 (100%) 14/14 (100%) 14/14 (100%) 14/14 (100%) Day 6 14/14 (100%) 14/14 (100%) 14/14 (100%) 14/14 (100%) 14/14 (100%) Day 9 14/14 (100%) 14/14 (100%) 14/14 (100%) 13/14 (92.85%) 13/14 (92.85%) Day 12 14/14 (100%) 13/14 (92.85%) 14/14 (100%) 14/14 (100%) 14/14 (100%) Week 3 14/14 (100%) 12/14 (85.71%) 14/14 (100%) 10/14 (71.42%) 12/14 (85.71%) Week 5 14/14 (100%) 11/14 (78.57%) 13/14 (93%) 11/14 (78.57%) 9/14 (64.28%) Week 7 10/14 (71%) 13/14 (92.85%) 12/14 (86%) 9/14 (64.28%) 9/14 (64.28%) Week 9 9/14 (64%) 12/14 (85.71%) 11/14 (79%) 9/14 (64.28%) 7/14 (50%) Week 11 11/14 (79%) 12/14 (85.71%) 10/14 (71%) 9/14 (64.28%) 8/14 (57.14%) Week 13 11/14 (79%) 12/14 (85.71%) 12/14 (86%) 8/14 (57.14%) 6/14 (42.85%) Week 15 14/14 (100%) 14/14 (100%) 12/14 (86%) 10/14 (71.42%) 4/14 (28.57%)

Total 152/168 (90.47%) 155/168 (92.26%) 154/168 (91.66%) 133/168 (79.16%) 121/168 (72.02%) aNumber of fecal samples positive/total numbers of fecal samples tested by culture method. bNumber of fecal samples positive/total numbers of fecal samples tested by PCR.

Analysis of Salmonella from Egg Shell All eggs tested (n = 136) from control hens were negative for Salmonella. The frequency of egg shell contamination after oral infection ranged from 0 to 16.67 and 16.67 to 21.11% in T and TM group, respectively. Overall the frequency of egg shell contamination was significantly higher (p = 0.001) in the TM group (18.69%, 83/444) as compared to the T group (5.66%, 24/424) (Table 2). In order to determine the effect of co-infection (TM group) ontherecoveryrateofS. Typhimurium on egg shell surface, multiplex PCR that specifically differentiates S.Typhimurium from S. Mbandaka was carried out. Overall the frequency of recovery of S. Typhimurium from egg shells of TM group (7.20%, 32/444) did not differ significantly from T group (5.66%, 24/424). PCR results indicated that overall, 14.1% (63/444) egg shell samples were positive for S. Mbandaka (Table 2). Correlation between Salmonella shedding in feces (MPN/g) and subsequent FIGURE 1 | Enumeration of Salmonella (MPN/g) from feces of birds orally infected with 109 CFU of S. Typhimurium (T group) or S. egg shell contamination was analyzed using a Pearson correlation Typhimurium + S. Mbandaka (TM group). Values are Mean ± SEM. test. No correlation was evident between mean fecal Salmonella Comparison between group marked with an asterisk (*) is significantly different load and observed frequency of contaminated eggs laid by orally at p < 0.05 based on ANOVA. infected birds of T and TM group (p = 0.624, R2 = 0.002 T group; p = 0.177, R2 = 0.022 TM group). Fecal Shedding and egg contamination data per bird/egg over time is presented experimental period viable counts of Salmonella were detected in Supplementary Table 1. In TM group, Salmonella shedding in the feces with a mean frequency ranging from 1.54 to 63.35 in feces and eggs was variable in individual birds across 15 and 0.31 to 98.38 MPN/g in T and TM groups, respectively. The weeks p.i. mean Salmonella load peaked at week 5 p.i. and thereafter, a decline in the viable Salmonella load was observed in both groups (Figure 1). Mean Salmonella counts were variable between days Comparison between Culture and PCR p.i. and group over the course of the experiment. Mean load of Based Detection of S. Typhimurium Salmonella was significantly higher (p = 0.0001) in the TM group The sensitivity of multiplex PCR for invA and TSR3 gene to compared to the T group at day 12 p.i. Variables such as group detect S. Typhimurium was determined by spiking fecal samples and days p.i. revealed significant differences in viable Salmonella with various doses of S. Typhimurium or S.Typhimurium+ count recovered from feces of orally infected birds (p = 0.0004). S. Mbandaka. The PCR detection limit for S.Typhimurium

Frontiers in Microbiology | www.frontiersin.org 5 February 2016 | Volume 7 | Article 203

98 Pande et al. Salmonella Typhimurium oral Infection

TABLE 2 | Detection of Salmonella from egg shell samples by culture and PCR.

Days p.i. T group TM group

Salmonella detection S. Typhimurium Salmonella detection S. Typhimurium S. Mbandaka by culture method detection by PCR by culture method detection by PCR detection by PCR

Week 5 4/24a (16.67%)# 4/24 (16.67%) 8/41 (19.51%) 3/41 (7.31%)* 5/41 (12.91%)* Week 7 0/46 (0%) 0/46 (0%) 9/51 (17.65%) 7/51 (13.72%) 7/51 (13.72%) Week 9 6/98 (6.12%) 6/98 (6.12%) 19/90 (21.11%) 7/90 (7.77%) 17/90 (18.88%) Week 11 5/87 (5.75%) 5/87 (5.75%) 15/90 (16.67%) 5/90 (5.55%) 12/90 (13.33%) Week 13 6/87 (6.90%) 6/87 (6.90%) 18/91 (19.78%) 7/91 (7.69%) 10/91 (10.98%) Week 15 3/82 (3.66%) 3/82 (3.66%) 14/81 (17.28%) 3/81 (3.70%) 12/81 (14.81%)

Total 24/424 (5.66%) 24/424 (5.66%) 83/444 (18.69%) 32/444 (7.20%) 63/444 (14.18%) aNumber of positive eggs/total number of eggs tested. *Results conﬁrmed by PCR, a Number of positive eggs/total number of eggs tested. #Values in %. was 102 CFU/reaction whereas it was 104 CFU/reaction when TABLE 3 | Recovery and enumeration of Salmonella from reproductive fecal samples were spiked with both S. Typhimurium and organs after oral infection. S. Mbandaka. The PCR detection limit for dhfrV gene to detect S.Mbandakawas104 CFU/reaction, when fecal samples were Groups spiked with both S. Typhimurium and S. Mbandaka. The details T group TM group of fecal and egg shell samples positive and negative for Salmonella a b a b at diﬀerent days p.i. by culture and PCR method are described in Reproductive organs n Mean log10 CFU/g n Mean log10 CFU/g Tables 1, 2. Fecal samples from T infected group tested negative Ovary 1/14 1.85 ± 0.00 (n = 1)0/140.00± 0.00 (n = 0) for dhfrV gene. Overall, S. Typhimurium was detected in 133/168 Infundibulum 2/14 3.44 ± 1.13 (n = 2)1/142.17± 0.00 (n = 1) (79.16%) fecal samples and 32/444 (7.20%) egg shell samples Magnum 2/14 2.37 ± 0.48 (n = 2)0/140.00± 0.00 (n = 0) in TM group. Similarly, S. Mbandaka was detected in 121/168 Isthmus 3/14 2.47 ± 0.40 (n = 3)0/140.00± 0.00 (n = 0) (72.02%) fecal samples and 63/444 (14.18%) egg shell samples in Uterus 3/14 2.37 ± 0.37 (n = 3)2/143.00± 0.45 (n = 2) TM group. Vagina 3/14 3.54 ± 0.64 (n = 3)1/142.40± 0.00 (n = 1)

Analysis of Salmonella from Internal Egg aNumber of positive tissues after direct plating/total number of tissues examined. b Mean log10 Salmonella concentration per gram of tissue ± standard error for positive Contents tissues after direct plating. Overthecourseoftheexperiment,Salmonella was not isolated from the internal content of eggs (n = 1004) laid by either Detection of S. Typhimurium in control or infected hens. Reproductive Tissues by PCR Bacteriological and Histopathological The reproductive organs from the T and TM groups found Analysis of Reproductive Organs positive for Salmonella by culture method were analyzed by multiplex PCR to detect S. Typhimurium. Only one reproductive The recovery rate of Salmonella from reproductive organs tissue (uterus) from T group was found positive for S. is summarized in Table 3. Colonization of Salmonella in Typhimurium by multiplex PCR assay (data not shown). All reproductive organs of laying hens after oral infection was other samples from T group tested negative by PCR for observed in both groups. In the T group birds Salmonella Salmonella spp. was recovered from diﬀerent segments of oviduct: ovary (1/14), infundibulum (2/14), magnum (2/14), isthmus (3/14), uterus (3/14), and vagina (3/14) collected after 15 weeks p.i. DISCUSSION However, in the TM group Salmonella was only recovered from infundibulum (1/14), uterus (2/14), and vagina (1/14) The present experiment was designed to study the long term (Table 3). Mean concentration of Salmonella (mean log10 CFU/g) shedding, egg contamination and colonization of oviduct by S. was highest in vagina (3.54 ± 0.64) and uterus (3.00 ± Typhimurium. It is considered that adult birds are more resistant 0.45) of the T and TM group birds, respectively (Table 3). to salmonellae than young chicks due to the developed gut Colonization of reproductive organs was not frequent and microﬂora (Gast, 2008). Continued harboring of the organism only 0–3 hens of the 14 hens for each of the groups showed and intermittent fecal shedding has also been noted for up to 1 Salmonella in the bacteriological analysis of their reproductive year following infection of day old chicks (Gast, 2008) however, organs, and no histopathological lesions were detected in in our study older birds (14 wk) were infected with Salmonella. any case. Previous studies reported low colonization of S.Typhimurium

Frontiers in Microbiology | www.frontiersin.org 6 February 2016 | Volume 7 | Article 203

99 Pande et al. Salmonella Typhimurium oral Infection in adult birds (Groves, 2011), however, the results of the current The multiplex PCR was validated to detect S.Typhimurium study demonstrate that S. Typhimurium can colonize the gut and positive samples in T and TM groups. In experimentally shed bacteria up to 15 weeks p.i. spiked fecal samples, the multiplex PCR demonstrated a good In this study, intermittent but prolonged fecal shedding of sensitivity and was able to detect 102 CFU/reaction of S. bacteria was observed in both infected groups. A significant Typhimurium. On the other hand, PCR assay was able to detect difference between the T and TM group at day 12 p.i. could be 104 CFU/reaction of S. Typhimurium and S.Mbandakainthe due to the intermittent Salmonella shedding. The magnitude of fecal samples spiked with S.Typhimurium+ S. Mbandaka. The Salmonella shedding was higher up to 5 week p.i. Thereafter, the poor detection limit observed in the feces experimentally spiked level of Salmonella in feces dropped but persisted for 15 weeks with S.Typhimurium+ S. Mbandaka may under-represent p.i. The increased Salmonella shedding in feces observed up to 5 the positive samples detected in the TM group using the PCR week p.i. in this study could be attributed to the stress associated assay. The poor PCR sensitivity compared with the standard with the onset of lay. In layer birds, the stress occurring as a culture method to detect S. Typhimurium in fecal samples is result of lay could negatively impact their immunity (El-Lethey similar to previous studies and could be attributed to the gradual et al., 2003; Humphrey, 2006) consequently resulting in higher reduction in Salmonella in feces, presence of PCR inhibitors and shedding of Salmonella. Higher rate of fecal Salmonella shedding other abundant microflora DNA interfering with the PCR assays at the early onset of lay has also been reported previously (Gole (Wilson, 1997; Gole et al., 2014a,c). et al., 2014a).ThedecreaseinSalmonella load in feces after 5 This study has examined egg shell contamination following weeks p.i. in both treatment groups could be the result of recovery oral infection with Salmonella for a prolonged period (15 weeks from laying stress or development of effective humoral response. p.i.) compared to previous short term experimental infection In addition, previous studies have reported that gastrointestinal studies (up to 3 weeks) and our results demonstrated that microflora of older birds was responsible for protection against egg shell contamination by Salmonella occurred for longer p.i. food poisoning Salmonella serovars (Barrow et al., 1988; Gast, intervals. Egg shell contamination following oral infection of 2008). S. Typhimurium observed in this study has also been reported Fecal Salmonella counts from this study could not be previously (Cox et al., 1973). In the current study, the overall rate compared with previous reports because the majority of of egg shell contamination by Salmonella was significantly higher these studies have examined post-infection fecal shedding of in the co-infected group (TM group) compared to the T group. Salmonella for a shorter duration. A field survey investigating However, the effect of co-infection on egg shell contamination theprevalenceofSalmonella shedding on commercial layer analyzed by PCR demonstrated no significant difference in farms found significant variability in Salmonella prevalence at number of S. Typhimurium positive egg shells between T various stages of lay (Gole et al., 2014a). On farm, shedding of (S. Typhimurium) and TM groups (S.Typhimurium+ S. S. Typhimurium from the known positive laying hens can be Mbandaka). There is a little literature indicating the effect of intermittent and remain undetected for several weeks (Gole et al., mixed Salmonella infection on egg contamination after oral 2014c). Such results suggest that Salmonella spp. can remain in infection. The high experimental infection doses used in our the caeca for long periods of time and persistently infected hens study does not mimic field situations and had non-significant could transmit the infection to unexposed and susceptible birds effectsontherecoveryrateofS. Typhimurium from the egg shell thereby maintaining the Salmonella infection cycle in the flock in the coinfected group. To compare these results with the field (Lister and Barrow, 2008). Hence, it is essential to frequently scenario further experiments using different routes and doses of monitor the Salmonella free status of the birds used for the multiple Salmonella serotypes are needed. infection trials. In the present study internal egg contents laid down by birds No correlation between fecal Salmonella counts and the infected with S. Typhimurium alone or in combination with recovery of bacteria from egg shell surface in experimentally S. Mbandaka were negative for Salmonella up to week 15 p.i. infected birds was observed in this study. A recent longitudinal The results of this study are also in agreement with the field survey on two commercial layer farms found a significant surveys in Australia (Daughtry et al., 2005; Gole et al., 2013, relationship between Salmonella fecal contamination and egg 2014c) and previous reports in which oral or crop infection with shells testing positive for Salmonella (odds ratio 91.8; p < S. Typhimurium was not associated with the contamination of 0.001) (Gole et al., 2014c). In contrast, egg shells were found egg contents (Cox et al., 1973; Baker et al., 1980; Keller et al., negative for S. Typhimurium in experimental infections although 1997; Okamura et al., 2010). On the other hand, contamination of the bacterium was excreted in the feces (Baker et al., 1980; egg internal contents with S. Typhimurium has been documented Okamura et al., 2001a,b). In the present study, though the after experimental infection of hens at the onset of lay via oral egg shell contamination failed to positively relate with fecal and aerosol routes (Williams et al., 1998; Leach et al., 1999; shedding of Salmonella, fecal carriage of Salmonella was observed Okamura et al., 2010). Altogether, the possibility of egg content throughout the experimental period. The egg shell surface contamination with S. Typhimurium seems to be a rare event. contamination observed in this study stresses the importance of However, in those studies where experimental infection has proper egg handling and hygienic practices in food preparation caused internal contamination, sexual maturity, or the onset and processing premises to avoid cross contamination of other of lay was found to be an important factor for internal egg food products. contamination.

Frontiers in Microbiology | www.frontiersin.org 7 February 2016 | Volume 7 | Article 203

100 Pande et al. Salmonella Typhimurium oral Infection

It is well-known that colonization of reproductive organs with in this study. Salmonella pathogenicity islands (SPIs) are the S. Enteritidis results in the deposition of bacteria within the egg gene clusters that encode virulence factors present in Salmonella contents of developing eggs in experimentally infected laying genome (Foley et al., 2013). It has been observed that SPI-1 and hens (Thiagarajan et al., 1994; Keller et al., 1995). However, SPI-2 contribute to the colonization of caecum, liver, and spleen the frequency of S. Typhimurium isolation from reproductive in chickens (Dieye et al., 2009; Rychlik et al., 2009). A recent organs and corresponding frequency of internal egg content study also demonstrated that poultry body temperature may contamination is unclear. The present study determined that regulate systemic colonization (Troxell et al., 2015). However, colonization of reproductive organs of S. Typhimurium infected the role of these pathogenicity islands in reproductive organ (T group) hens and coinfected (TM group) hens varied after colonization in laying hens is less understood and needs further oral infection. The magnitude of S. Typhimurium recovery research. In addition, the possible role of several factors such from each section of oviduct except for uterus was higher in as immunoglobulins, iron sequestering, and proteins inhibiting the T group than TM group where Salmonella was localized bacterial protease and antibacterial enzymes present in the egg to certain parts of the oviduct. To assess the effect of mixed yolk and albumin have been identified to inhibit the growth of infection, reproductive tissues from T and TM groups found Salmonella before shell formation is complete and eggs are laid positive for Salmonella by culture method were also analyzed (Keller et al., 1995; Gantois et al., 2009; Bedrani et al., 2013). by multiplex PCR to detect S. Typhimurium. In spite of In order to determine the course of reproductive organ positive culture results, S. Typhimurium was recovered from invasion after oral Salmonella infection, histopathology of only one reproductive tissue (uterus) by multiplex PCR assay. reproductive tissues was carried out in this experiment. The This finding suggests that culture methods are more sensitive regions of reproductive tract which were found positive after than multiplex PCR in detecting S. Typhimurium. The lack of cultural analysis did not show lesions suggestive of bacterial additional stand-alone S. Mbandaka group and sacrifice of birds infection. As there is lack of published information on at regular intervals are some of the limitations of this study. histopathological alterations in oviduct tissue after prolonged However, it is interesting to note that despite the low Salmonella infection interval, these findings could not be compared to colonization in the oviduct of hens from TM group, frequency previous studies. In addition, examination of infected birds at of egg shell contamination was significantly higher in the TM periodic intervals was not a part of this study but may have group (particularly for S. Mbandaka) as compared to the T identified a time window for establishment of oviduct lesions group. as a result of bacterial infection. The possible explanation for The results of prolonged Salmonella fecal shedding observed the absence of inflammatory lesions after a long p.i. interval in this study indicated that colonization was present somewhere in response to oral Salmonella infection in this study could within the animal after several weeks p.i. However, though the be related to either the low level of tissue colonization or persistence of Salmonella in the reproductive tissues of very few development of strong immune response to clear the infection. infected birds was evident after a long p.i. interval, the internal Further, research examining the localization of Salmonella at egg contents were negative throughout the experimental period different time intervals, cellular involvement and why Salmonella in both T and TM groups. Moreover, this study demonstrates clearance from reproductive tissues does not take place is that the mere presence of S. Typhimurium in reproductive tissues warranted. would not give rise to the production of internally contaminated In summary, intermittent but persistent fecal shedding of eggs. Salmonella after oral infection was observed up to 15 weeks The observations of the present study also support the p.i. Further, egg shell contamination together with lack of previous findings which concluded that S.Typhimuriumhas internal egg contents contamination and the low frequency the potential to colonize both the reproductive organs and of reproductive organ infection suggested that horizontal developing eggs prior to oviposition but cannot be recovered infection through contaminated feces is the main route of egg from internal egg contents after oviposition (Keller et al., contamination with S. Typhimurium during lay. Previously, it 1997; Okamura et al., 2001a; Gantois et al., 2008). Overall, the has been hypothesized that effective and more immune response results of the present and previous studies demonstrate that S. generated by S. Typhimurium compared to S. Enteritidis is Typhimurium was found to colonize the reproductive organs of likely to limit the disease progression and quickly clears the laying hens. However, why S. Typhimurium is not associated with S. Typhimurium infection from birds (Wales and Davies, contamination of laid eggs is still unclear. 2011). The egg shell contamination observed in this study also S. Typhimurium is able to penetrate and survive in the egg stresses the importance of proper egg handling and hygienic albumin and the yolk at 20 or 25◦C(Gantois et al., 2008; Gole practices in food preparation and processing premises to et al., 2014b). In addition, the S. Typhimurium genome possesses avoid cross contamination of other food products. Considering virulence associated genes involved in cellular adhesion, invasion the productive life span of commercial laying hens (75–80 and survival of S.Typhimurium(McWhorter et al., 2015). weeks) further studies are required to study the shedding of Therefore, it could be possible that S. Typhimurium is unable to S. Typhimurium beyond 15 weeks p.i. survive and proliferate in egg contents during egg formation at host body temperature (42◦C) or there could be down regulation AUTHOR CONTRIBUTIONS of genes critical to colonization of S. Typhimurium. This could partly explain why S. Typhimurium despite their colonization Conception and designed the experiments: KC, AM, and VP. in reproductive organs was never isolated from egg contents Performed the experiments: VP, RD, PS, KC, and AM. Data

Frontiers in Microbiology | www.frontiersin.org 8 February 2016 | Volume 7 | Article 203

101 Pande et al. Salmonella Typhimurium oral Infection acquisition and analysis: VP, KC, and AM. Drafting of article and thank Dr Vaibhav Gole and Dr Rebecca Forder for technical help revisions: VP, AM, and KC. in this study.

ACKNOWLEDGMENTS SUPPLEMENTARY MATERIAL

This research work was supported by Australian Egg Corporation The Supplementary Material for this article can be found Limited (AECL) Australia. Mr. VP is a recipient of post-graduate online at: http://journal.frontiersin.org/article/10.3389/fmicb. research scholarship of The University of Adelaide Australia. We 2016.00203

REFERENCES Gast, R. K. (2008). “Paratyphoid infections,” in Diseases of Poultry,eds.Y.M.Saif, A. M. Fadly, J. R. Glisson, L. R. McDougald, L. K. Nolan, and D. E. Swayne Akiba, M., Kusumoto, M., and Iwata, T. (2011). Rapid identification of Salmonella (Ames: Iowa State University Press; Blackwell Publishing), 636–655. enterica serovars, Typhimurium, Choleraesuis, Infantis, Hadar, Enteritidis, Gast, R. K., Guard-Bouldin, J., and Holt, P. S. (2004). Colonization of reproductive Dublin and Gallinarum, by multiplex PCR. J. Microbiol. Methods 85, 9–15. doi: organs and internal contamination of eggs after experimental infection of 10.1016/j.mimet.2011.02.002 laying hens with Salmonella heidelberg and Salmonella Enteritidis. Avian Dis. Baker, R. C., Goff, J. P., and Mulnix, E. J. (1980). Salmonellae recovery following 48, 863–869. doi: 10.1637/7204-05050R oral and intravenous inoculation of laying hens. Poult. Sci. 59, 1067–1072. doi: Gast, R. K., Guraya, R., Guard-Bouldin, J., Holt, P. S., and Moore, R. W. (2007). 10.3382/ps.0591067 Colonization of specific regions of the reproductive tract and deposition Barrow, P. A., Simpson, J. M., and Lovell, M. A. (1988). Intestinal colonisation at different locations inside eggs laid by hens infected with Salmonella in the chicken by food-poisoning Salmonella serotypes; microbial Enteritidis or Salmonella heidelberg. Avian Dis. 51, 40–44. doi: 10.1637/0005- characteristics associated with faecal excretion. Avian Pathol. 17, 571–588. doi: 2086(2007)051[0040:COSROT]2.0.CO;2 10.1080/03079458808436478 Gast, R. K., Guraya, R., and Guard, J. (2013). Salmonella Enteritidis deposition in Bedrani, L., Helloin, E., Guyot, N., Réhault-Godbert, S., and Nys, Y. (2013). Passive eggs after experimental infection of laying hens with different oral doses. J. Food maternal exposure to environmental microbes selectively modulates the innate Prot. 76, 108–113. doi: 10.4315/0362-028X.JFP-12-268 defences of chicken egg white by increasing some of its antibacterial activities. Gole, V. C., Caraguel, C. G., Sexton, M., Fowler, C., and Chousalkar, K. BMC Microbiol. 13:128. doi: 10.1186/1471-2180-13-128 K. (2014a). Shedding of Salmonella in single age caged commercial layer Cox, N. A., Davis, B. H., Watts, A. B., and Colmer, A. R. (1973). Salmonella in the flock at an early stage of lay. Int. J. Food Microbiol. 189, 61–66. doi: laying hen. 1. Salmonella recovery from viscera, feces and eggs following oral 10.1016/j.ijfoodmicro.2014.07.030 inoculation. Poult Sci. 52, 661–666. doi: 10.3382/ps.0520661 Gole, V. C., Chousalkar, K. K., and Roberts, J. R. (2013). Survey Daughtry, B. J., Sumner, J., Hooper, G., Thomas, C. J., Grimes, T., Horn, R., et al. of Enterobacteriaceae contamination of table eggs collected from (2005). National Food Safety Risk Profile of Eggs and Egg Products. Sydney: layer flocks in Australia. Int. J. Food Microbiol. 164, 161–165. doi: Australian Egg Corporation Limited. 10.1016/j.ijfoodmicro.2013.04.002 Dean, A., Sullivan, K., and Soe, M. (2011). OpenEpi: Open Source Epidemiologic Gole,V.C.,Chousalkar,K.K.,Roberts,J.R.,Sexton,M.,May,D.,Tan,J.,etal. Statistics for Public Health, Version 2.3.1. Available online at: http://www. (2014b). Effect of egg washing and correlation between eggshell characteristics openepi.com/Menu/OE_Menu.htm and egg penetration by various Salmonella Typhimurium strains. PLoS ONE De Reu, K., Grijspeerdt, K., Messens, W., Heyndrickx, M., Uyttendaele, 9:e90987. doi: 10.1371/journal.pone.0090987 M., Debevere, J., et al. (2006). Eggshell factors influencing eggshell Gole, V. C., Torok, V., Sexton, M., Caraguel, C. G., and Chousalkar, K. K. (2014c). penetration and whole egg contamination by different bacteria, including Association between the indoor environmental contamination of Salmonella Salmonella Enteritidis. Int. J. Food Microbiol. 112, 253–260. doi: with egg contamination on layer farms. J. Clin. Microbiol. 52, 3250–3258. doi: 10.1016/j.ijfoodmicro.2006.04.011 10.1128/JCM.00816-14 Dieye, Y., Ameiss, K., Mellata, M., and Curtiss, R. III. (2009). The Salmonella Groves, P. (2011). Salmonella Control in Layer Chickens. A Report for Pathogenicity Island (SPI) 1 contributes more than SPI2 to the colonization the Australian Egg Corporation Limited. Sydney, NSW: Poultry Research of the chicken by Salmonella enterica serovar Typhimurium. BMC Microbiol. Foundation, The University of Sydney. 9:3. doi: 10.1186/1471-2180-9-3 Hoszowski, A., and Wasyl, D. (2001). Typing of Salmonella enterica subsp. enterica El-Lethey, H., Huber-Eicher, B., and Jungi, T. W. (2003). Exploration of stress- serovar Mbandaka isolates.Vet.Microbiol.80, 139–148. doi: 10.1016/S0378- induced immunosuppression in chickens reveals both stress-resistant and 1135(00)00382-5 stress-susceptible antigen responses. Vet. Immunol. Immunopathol. 95, 91–101. Humphrey, T. (2006). Are happy chickens safer chickens? Poultry doi: 10.1016/S0165-2427(02)00308-2 welfare and disease susceptibility. Br. Poult Sci. 47, 379–391. doi: Foley, S. L., Johnson, T. J., Ricke, S. C., Nayak, R., and Danzeisen, J. (2013). 10.1080/00071660600829084 Salmonella pathogenicity and host adaptation in chicken-associated serovars. Im, M. C., Jeong, S. J., Kwon, Y. K., Jeong, O. M., Kang, M. S., and Lee, Y. J. (2015). Microbiol. Mol. Biol. Rev. 77, 582–607. doi: 10.1128/MMBR.00015-13 Prevalence and characteristics of Salmonella spp. isolated from commercial Foley, S. L., Nayak, R., Hanning, I. B., Johnson, T. J., Han, J., and Ricke, S. C. layer farms in Korea. Poult Sci. 94, 1691–1698. doi: 10.3382/ps/pev137 (2011). Population dynamics of Salmonella enterica serotypes in commercial Keller, L. H., Benson, C. E., Krotec, K., and Eckroade, R. J. (1995). Salmonella egg and poultry production. Appl. Environ. Microbiol. 77, 4273–4279. doi: Enteritidis colonization of the reproductive tract and forming and freshly laid 10.1128/AEM.00598-11 eggs of chickens. Infect. Immun. 63, 2443–2449. Gantois, I., Ducatelle, R., Pasmans, F., Haesebrouck, F., Gast, R., Humphrey, Keller, L. H., Schifferli, D. M., Benson, C. E., Aslam, S., and Eckroade, R. J. (1997). T. J., et al. (2009). Mechanisms of egg contamination by Salmonella Invasion of chicken reproductive tissues and forming eggs is not unique to Enteritidis. FEMS Microbiol. Rev. 33, 718–738. doi: 10.1111/j.1574-6976.2008. Salmonella Enteritidis. Avian Dis. 41, 535–539. doi: 10.2307/1592142 00161.x Leach, S. A., Williams, A., Davies, A. C., Wilson, J., Marsh, P. D., and Humphrey, Gantois, I., Eeckhaut, V., Pasmans, F., Haesebrouck, F., Ducatelle, R., and T. J. (1999). Aerosol route enhances the contamination of intact eggs and van Immerseel, F. (2008). A comparative study on the pathogenesis of egg muscle of experimentally infected laying hens by Salmonella typhimurium contamination by different serotypes of Salmonella. Avian Pathol. 37, 399–406. DT104. FEMS Microbiol. Lett. 171, 203–207. doi: 10.1111/j.1574-6968.1999.tb doi: 10.1080/03079450802216611 13433.x

Frontiers in Microbiology | www.frontiersin.org 9 February 2016 | Volume 7 | Article 203

102 Pande et al. Salmonella Typhimurium oral Infection

Lister, S. A., and Barrow, P. (2008). “Enterobacteriaceae,” i n Poultry Diseases, 6th Rychlik, I., Karasova, D., Sebkova, A., Volf, J., Sisak, F., Havlickova, H., et al. Edn, eds M. Pattison, P. F. McMullin, J. M. Bradbury, and D. J. Alexander (2009). Virulence potential of five major pathogenicity islands (SPI-1 to SPI-5) (Edinburgh: W.B.Saunders), 111–125. of Salmonella enterica serovar Enteritidis for chickens. BMC Microbiol. 9:268. Little, C. L., Walsh, S., Hucklesby, L., Surman-Lee, S., Pathak, K., Gatty, Y., et al. doi: 10.1186/1471-2180-9-268 (2007). Survey of Salmonella contamination of non–United Kingdom produced Samberg, Y., and Meroz, M. (1995). Application of disinfectants in poultry raw shell eggs on retail sale in the northwest of England and London, 2005 to hatcheries. Rev. Sci. Tech. 14, 365–380. 2006. J. Food Prot. 70, 2259–2265. Santos, F., Li, X., Payne, J., and Sheldon, B. (2005). Estimation of most probable McWhorter, A. R., Davos, D., and Chousalkar, K. K. (2015). Pathogenicity of number Salmonella populations on commercial North Carolina turkey farms. Salmonella strains isolated from egg shells and the layer farm environment J. Appl. Poult. Res. 14, 700–708. doi: 10.1093/japr/14.4.700 in Australia. Appl. Environ. Microbiol. 81, 405–414. doi: 10.1128/AEM.02 Thiagarajan, D., Saeed, A. M., and Asem, E. K. (1994). Mechanism of transovarian 931-14 transmission of Salmonella Enteritidis in laying hens. Poult. Sci. 73, 89–98. doi: Okamura, M., Kamijima, Y., Miyamoto, T., Tani, H., Sasai, K., and Baba, E. (2001a). 10.3382/ps.0730089 Differences among six Salmonella serovars in abilities to colonize reproductive Troxell, B., Petri, N., Daron, C., Pereira, R., Mendoza, M., Hassan, H. M., et al. organs and to contaminate eggs in laying hens. Avian Dis. 45, 61–69. doi: (2015). Poultry body temperature contributes to invasion control through 10.2307/1593012 reduced expression of Salmonella pathogenicity island 1 genes in Salmonella Okamura, M., Miyamoto, T., Kamijima, Y., Tani, H., Sasai, K., and Baba, enterica Serovars Typhimurium and Enteritidis. Appl. Environ. Microbiol. 81, E. (2001b). Differences in abilities to colonize reproductive organs and to 8192–8201. doi: 10.1128/AEM.02622-15 contaminate eggs in intravaginally inoculated hens and in vitro adherences to Wales, A. D., and Davies, R. H. (2011). A critical review of Salmonella vaginal explants between Salmonella Enteritidis and other Salmonella serovars. Typhimurium infection in laying hens. Avian Pathol. 40, 429–436. doi: Avian Dis. 45, 962–971. doi: 10.2307/1592875 10.1080/03079457.2011.606799 Okamura, M., Sonobe, M., Obara, S., Kubo, T., Nagai, T., Noguchi, M., et al. (2010). Whiley, H., and Ross, K. (2015). Salmonella and Eggs: from production to plate. Potential egg contamination by Salmonella enterica serovar Typhimurium Int. J. Environ. Res. Public Health 12, 2543–2556. doi: 10.3390/ijerph120302543 definitive type 104 following experimental infection of pullets at the onset of Williams, A., Davies, A. C., Wilson, J., Marsh, P. D., Leach, S., and Humphrey, lay. Poult. Sci. 89, 1629–1634. doi: 10.3382/ps.2010-00774 T. J. (1998). Contamination of the contents of intact eggs by Salmonella OzFoodNet Working Group (2009). Monitoring the incidence and causes Typhimurium DT104. Vet. Rec. 143, 562–563. doi: 10.1136/vr.143.20.562 of diseases potentially transmitted by food in Australia: annual report Wilson, I. G. (1997). Inhibition and facilitation of nucleic acid amplification. Appl. of the OzFoodNet Network, 2008. Commun. Dis. Intell. Q. Rep. 33, Environ. Microbiol. 63, 3741–3751. 389–413. OzFoodNet Working Group (2012). Monitoring the incidence and causes of Conflict of Interest Statement: The authors declare that the research was diseases potentially transmitted by food in Australia: annual report of the conducted in the absence of any commercial or financial relationships that could OzFoodNet network, 2010. Commun. Dis. Intell. Q. Rep. 36, E213–E241. be construed as a potential conflict of interest. Pande, V. V., Gole, V. C., McWhorter, A. R., Abraham, S., and Chousalkar, K. K. (2015). Antimicrobial resistance of non-typhoidal Salmonella isolates Copyright © 2016 Pande, Devon, Sharma, McWhorter and Chousalkar. This is an from egg layer flocks and egg shells. Int. J. Food Microbiol. 203, 23–26. doi: open-access article distributed under the terms of the Creative Commons Attribution 10.1016/j.ijfoodmicro.2015.02.025 License (CC BY). The use, distribution or reproduction in other forums is permitted, Pavic, A., Groves, P. J., Bailey, G., and Cox, J. M. (2010). A validated miniaturized provided the original author(s) or licensor are credited and that the original MPN method, based on ISO 6579:2002, for the enumeration of Salmonella publication in this journal is cited, in accordance with accepted academic practice. from poultry matrices. J. Appl. Microbiol. 109, 25–34. doi: 10.1111/j.1365- No use, distribution or reproduction is permitted which does not comply with these 2672.2009.04649.x terms.

Frontiers in Microbiology | www.frontiersin.org 10 February 2016 | Volume 7 | Article 203

103 Supplementary Table 1. PCR detection of S. Typhimurium and S. Mbandaka in fecal and eggshell wash samples of individual bird (TM group) over 30 wk.

Days/weeks 1 3 6 9 12 3 5 7 9 11 13 15 p.i. Bird Feces Feces Feces Feces Feces Feces Feces Eggs Feces Eggs Feces Eggs Feces Eggs Feces Eggs Feces Eggs Number 1 2a 3a 2 2 1 2 3 4 1 1 2 2 1 3 5 2 2 2 2 3 6 2 1 1 1 1 7 1 1 1 2 1 3 2 2 3 8 3 1 2 9 1 2 1 10 2 1 11 2 1 2 1 12 1 1 13 1 1 3 2 2 5 1 14 1 3 1 1 Total 3 5 7 7 7 17 5 12 7 10 3 12 a Number of Salmonella positive eggs by individual bird, = Positive for S. Typhimurium, = Positive for S. Mbandaka

104

CHAPTER 4 SALMONELLA ENTERICA ISOLATES FROM LAYER FARM ENVIRONMENTS ARE ABLE TO FORM BIOFILM ON EGGSHELL SURFACES

This chapter is published in Biofouling journal. The permission (DE/GBIF/P8236) has been granted by Tylor & Francis to reproduce this chapter in the printed thesis and to post in the repository of The University of Adelaide.

105

106

!"#$ %&! "'"#( & ) %%)**+++,% ,* * -

% % . / %- %-

0/10,$ 23 ,45%67) 7,8 1

%%% !"#$% & ' (' )( ' ' *('*(' ++ ( ,( +-!./$00/#"123.#" #"4"5"40!/"#6 !"#$ ##0#"$4

1%%% .557 +5#" #"4"5"40!/"#6 !"#$ ##0#"$4

8 ' )'

* ."49 !"#$

&*') :

8 .0/

8 '

;<' ( *( .55888 ( '5 5: 3 (' =: >+*(!" 107 BIOFOULING, 2016 VOL. 32, NO. 7, 699710 http://dx.doi.org/10.1080/08927014.2016.1191068

Salmonella enterica isolates from layer farm environments are able to form biofilm on eggshell surfaces

Vivek V. Pande, Andrea R. McWhorter and Kapil K. Chousalkar

School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy, Australia

ABSTRACT ARTICLE HISTORY This study examined the eggshell biofilm forming ability of Salmonella enterica isolates recovered Received 24 February 2016 from egg farms. Multicellular behaviour and biofilm production were examined at 22 and 37°C by Accepted 11 May 2016 Congo red morphology and the crystal violet staining assay. The results indicated that the biofilm KEYWORDS forming behaviour of Salmonella isolates was dependent on temperature and associated with Bioﬁlm; eggshell; Salmonella serovars. Significantly greater biofilm production was observed at 22°C compared with 37°C. The number of viable biofilm cells attached to eggshells after incubation for 48 h at 22°C was significantly influenced by serovar. Scanning electron microscopic examination revealed firm attachment of bacterial cells to the eggshell surface. The relative expression of csgD and adrA gene was significantly higher in eggshell biofilm cells of S. Mbandaka and S. Oranienburg. These findings demonstrate that Salmonella isolates are capable of forming biofilm on the eggshell surface and that this behaviour is influenced by temperature and serovar.

Introduction Salmonella within a biofilm displays higher resistance to Members of the bacterial species Salmonella enterica are environmental stressors, antibiotics and disinfectants com- common causes of human gastroenteritis, a disease char- pared to planktonic counterparts, thus making the eradi- acterised by gut inflammation and diarrhoea (Winter cation of this bacterium extremely difficult from surfaces et al. 2010). It is estimated that gastroenteritis caused commonly used in food and the poultry industry (Joseph by Salmonella spp. accounts for 93.8 million cases and et al. 2001; Steenackers et al. 2012). 155,000 deaths worldwide each year (Majowicz et al. 2010). Biofilm formation is a complex process and regulated In Australia, contaminated food products of animal origin, by several sets of genes involved in extracellular matrix particularly egg and egg products, are frequently associ- production and adhesion. csgD, a transcriptional regulator ated with outbreaks of human salmonellosis (OzFoodNet of the LuxR superfamily, positively regulates the expression Working Group 2015, 2012). of Salmonella biofilm associated extracellular matrix com- The formation of a biofilm is one of the mechanisms ponents, including curli, fimbriae and cellulose (Gerstel & Salmonella spp. utilise for survival in harsh physical and Römling 2003; White et al. 2008; Grantcharova et al. 2010). chemical environments (Costerton et al. 1999). A biofilm csgD stimulates curli production through transcriptional is a community of interacting bacterial cells attached to activation of the csgBAC operon, which encodes the major biotic or abiotic surfaces, embedded in a self-produced curli subunit CsgA as well as the nucleator protein CsgB. extracellular polymeric matrix (Costerton et al. 1999). The csgD also indirectly regulates cellulose synthesis by activat- extracellular matrix of a biofilm is predominantly coming transcription of adrA. Being a member of the GGDEF prised of curli, fimbriae and cellulose, which promote link- protein family, AdrA synthesises c-di-GMP as diguanylate age and interaction between bacterial cells (Steenackers cyclase, and its transcription is regulated by csgD (Liu et al. et al. 2012). Differential multicellular behaviour contrib- 2014). BapA, a large surface protein involved in biofilm for- utes to the formation of distinct colony morphotypes on mation and the expression of bapA, is coordinated with that Congo red agar plates supplemented with Coomassie of genes encoding curli, fimbriae and cellulose, through the brilliant blue (Romling et al. 2003; Seixas et al. 2014). action of csgD (Latasa et al. 2005; Wang et al. 2016).

CONTACT Kapil K. Chousalkar [email protected] The supplemental material for this paper is available online at http://dx.doi.org/10.1080/08927014.2016.1191068. © 2016 Informa UK Limited, trading as Taylor & Francis Group

108 700 V. V. PANDE ET AL.

Biofilm formation is influenced by several factors Biofilm formation assay including environmental conditions, eg the type of cul- Phenotypic characterisation by Congo red ture medium and the surface material, as well as strain morphology origin and serovar (Vestby et al. 2009; Castelijn et al. The colony morphology ofSalmonella isolates (n=145) was 2012; Lianou & Koutsoumanis 2012; Schonewille et al. determined on Congo red agar plates for curli, fimbriae 2012; De Oliveira et al. 2014). The ability ofSalmonella and cellulose production, as described previously (Castelijn to attach and form a biofilm represents a significant et al. 2012) with some modifications. Briefly, stock public health risk for many industries, including those Salmonella cultures were grown on nutrient agar plates involved in food production and processing. Biofilm on at 37°C overnight. Single colonies of Salmonella were food preparation surfaces and equipment could serve as grown in 5 ml of Luria-Bertani (LB) broth (10 g bacto a persistent source of cross contamination, compromis- tryptone) (Oxoid, Adelaide, Australia), 5 g yeast extract ing the safety of food products and human health (Shi (Oxoid), 10 g sodium chloride (Fischer Chemicals, & Zhu 2009). Melbourne, Australia) with shaking (110 rpm) at 37°C Salmonella spp. are able to form biofilm on a large for 6 h. Each Salmonella isolate was plated (3 μl) onto LB number of abiotic surfaces including stainless steel, plas- agar without sodium chloride, supplemented with Congo tics, cement, rubber and glass (Steenackers et al. 2012). red (40 μg ml−1, Sigma Aldrich, St Louis, MO, USA) and Biofilm formation on the surfaces of eggshells, however, Coomassie brilliant blue (20 μg ml−1, Sigma Aldrich). The has to date not been documented for any bacterial species. inoculated plates were incubated at 22 and 37°C for 96 h Worldwide egg and eggshell contamination by Salmonella and colonies were visualised macroscopically. Salmonella is a major concern for poultry industries. For its survival enterica subsp. enterica serovar Typhimurium ATCC 14028 and growth on the outer surface of an egg Salmonella must was used as a positive control strain during this study. overcome low nutrient availability and temperature stress (Gantois et al. 2009). Over the past decade, the number of Quantitation of biofilm formation by crystal violet foodborne salmonellosis cases traced to egg or egg prod- staining assay ucts has substantially increased (OzFoodNet Working Salmonella isolates (n=145) were grown on LB agar plates Group 2012). This suggests thatSalmonella spp. are able overnight at 37°C. Single bacterial colonies were inocu- to attach and or form biofilm on the eggshell surface, and lated in 10 ml of LB broth without sodium chloride and remain viable, resulting in the cross contamination of a incubated at 37°C overnight. Twenty μl of overnight grown variety of food products. Food safety and public health bacterial culture were mixed with 180 μl of LB broth with- impacts associated with biofilm forming foodborne out sodium chloride in polystyrene round bottom 96 well pathogens emphasises the importance of understanding plates (Sarstedt, Adelaide, Australia). Negative control wells eggshell biofilm formation by Salmonella spp. The main contained 200 μl of LB broth only. Inoculated plates were objective of the present study was to determine the biofilm incubated statically at either 22 or 37°C for 96 h. After incu- forming ability of egg farm related Salmonella serovars on bation, the plate contents were decanted and wells were the eggshell surface. In addition, the impact of tempera- washed gently three times with sterile distilled water to ture and serovar variation on biofilm formation was also remove loosely bound bacteria. Plates were air dried and investigated. stained with 200 μl of 0.1% (w/v) crystal violet for 30 min at room temperature. Following staining, wells were gently Materials and methods washed three times with sterile distilled water and air dried. Bound crystal violet stain in the wells was resuspended Bacterial strains and serotyping with ethanol-acetone (70:30) for 10 min at room tempera- One hundred and forty-fiveSalmonella isolates of seven ture. The absorbance of each well was measured at 590 nm different serovars: S. Agona (n=6), S. Anatum (n=6), S. (A590) using a microplate spectrophotometer (Benchmark Infantis (n=16), S. Mbandaka (n=30), S. Oranienburg plus, Biorad, Hercules, CA, USA). The mean absorbance (n=30), S. Typhimurium (n=26), and S. Worthington of negative controls was subtracted from the absorbance (n=31) were used to study biofilm formation. All values obtained from experimental wells. All experiments Salmonella isolates used in this study were previously were conducted in duplicate and repeated twice. isolated in the authors’ laboratory from 33 caged layer flocks across 13 different egg farms during epidemiologi- Studies on biofilm formation on eggshell cal studies (Chousalkar & Roberts 2012; Gole et al. 2014a, 2014b) and were serotyped at the Australian Salmonella Salmonella isolates and egg source Reference Centre, Microbiology and Infectious Diseases, Four Salmonella isolates from each Salmonella ser- SA Pathology, Adelaide, South Australia. ovar: S. Agona, S. Anatum, S. Infantis, S. Mbandaka, 109 BIOFOULING 701

−2 S. Oranienburg, S. Typhimurium and S. Worthington, were expressed as log10 CFU cm . In this study, three bio- isolated from layer farms, were used to investigate their logical replicates of each Salmonella isolate were used to biofilm forming ability on the eggshell. All isolates were ensure reproducibility of the results and the experiments examined for their potential to survive and form biofilm were conducted in duplicate. on eggshell surfaces at 22°C for 48 h. Based on the results of biofilm formation at 22°C, ambient temperature was RNA extraction and quantitative real time PCR (RT- selected to study eggshell biofilm formation. In this study, PCR) fresh unwashed eggs were obtained from the cage front The biofilm cells on the eggshell surface were removed as of a 39-week-old caged layer flock housed at Roseworthy described above, cotton swabs were suspended in 1 ml of campus, The University of Adelaide. RNAlater® Stabilisation Solution (Ambion™, Austin, TX, USA) and cells were harvested by centrifugation at 5,000 g Biofilm formation on eggshell for 10 min. RNA was extracted from triplicate independ- To ensure that a defined surface area was covered by bac- ent cultures of each Salmonella isolate from each serovar terial culture, an individual egg was marked with a pencil using a RNeasy mini kit (Qiagen, Melbourne, Australia) (1.2 cm2 area) and disinfected with formaldehyde fumi- according to the manufacturer’s guidelines. The concentra- gation (Samberg & Meroz 1995). Eggshell surfaces were tion of RNA was analysed using a NanoDrop™ 1000 spec- further sanitised by immersing the eggs in 70% ethanol for trophotometer (Thermo Fischer Scientific, Wilmington, 2 min, allowing them to dry in a class II biosafety cabinet, DE, USA) and samples were stored at –80°C. and then immediately used for experimentation. Biofilm Quantitative PCR was performed using Rotor gene 600 formation on the eggshell was assessed at 22°C on indi- real time thermal cycler (Corbett Research, Qiagen) with vidual eggs in triplicate for each isolate of representative QuantiFast SYBR® Green RT-PCR Kit (Qiagen) as per the serovar. All experiments were performed in duplicate. manufacturer’s recommended protocol. PCRs were per- Stock Salmonella cultures were grown on nutrient agar formed in a total reaction volume of 20 μl and contained plates at 37°C overnight. Single colonies of Salmonella 10 μl of 2× QuantiFast SYBR Green RT-PCR master mix, were grown in 20 ml of LB broth with overnight incuba- 2 μl (1 μM) each of the forward and reverse primers, 0.2 μl tion at 3°C. Eggs were placed horizontally in Whirlpack of QuantiFast RT Mix, 2.8 μl of RNase-free water and 5 ng bags (Fischer Scientific, Melbourne, Australia) containing of template RNA. Real time PCR was performed using the 5 ml of overnight grown bacterial culture and 45 ml of LB following cycling conditions: 10 min reverse transcription broth without sodium chloride (10 g bacto tryptone and at 50°C, 5 min initial PCR activation step at 95°C followed 5 g yeast extract, Oxoid) (1:10), ensuring the marked sur- by 40 cycles of denaturation at 95°C for 10 s and com- face area was covered with bacterial suspension. The bags bined annealing and extension at 60°C for 30 s. Each RNA were then incubated statically at 22°C for 48 h. Negative sample was analysed in duplicate and each PCR reaction control bags contained LB broth only. The cell concentra- included a non-template control. Primer sets synthesised tion (CFU) in working bacterial suspensions was calcu- by Geneworks (Adelaide, Australia) were used to amplify lated by plating 10-fold serial dilutions on nutrient agar. adrA bapA, csgB and csgD genes (Supplementary material The number of bacterial cells contained within the Table S1). To generate a standard curve, the serially diluted eggshell biofilm was enumerated by the plate count RNA standard (1,000 ng to 0.001 ng) was quantified in method, as described earlier (Castelijn et al. 2012) with each quantitative RT-PCR run. The slopes of the standard some modification. Following incubation at 22°C for 48 h, curves were used to measure the amplification efficiency eggs were aseptically removed from the Whirlpack bags for each of these primers. Quantitative RT-PCR results using sterile forceps and kept in Petri plates. The eggshell were analysed by comparative threshold cycle (Ct) method (1.2 cm2 area) was rinsed thrice with sterile 0.85% nor- and an internal calibrator was used to normalise the tran- mal saline solution to remove unbound cells. Attached scription levels (Livak & Schmittgen 2001). The relative cells were collected with a sterile cotton swab to remove gene expression was calculated by the 2ΔCt formula, where ΔCt biofilm-associated bacteria. The cotton swab was placed is equivalent to the Ct of the internal calibrator sub- into a microcentrifuge tube containing 0.85% normal tracted from the Ct of the target gene. saline and vortexed with acid washed glass beads (710– 1180 μm, Sigma-Aldrich) at full speed for 1 min. Serial Scanning electron microscopy (SEM) dilutions were prepared in 0.85% normal saline and plated SEM was performed to examine the attachment of bacon xylose lysine deoxycholate (XLD) agar plates (Thermo terial cells and cell density on the eggshell during biofilm Scientific, Adelaide, Australia). Plates were incubated at formation. For SEM, following incubation at 22°C for 37°C overnight and colonies were counted to determine 48 h, eggs were aseptically removed from Whirlpack bags the number of colony forming units (CFU). The results and the eggshell (1.2 cm2 area) was rinsed three times with

110 702 V. V. PANDE ET AL.

Table 1. Congo red agar morphotypes from various Salmonella serovars after incubation for 96 h at 22 and 37°C.

Salmonella isolates Morpho- types(Temper- S. Agona S. Anatum S. Infantis S. Mbanda- S. Oranien- S. Typhimuri- S. Worthing- ature) (n=6) (n=6) (n=16) ka(n=30) burg(n=30) um(n=26) ton (n=31) Total (n=145) rdar (22°C) 6 (100%) 6 (100%) 16 (100%) 30 (100%) 29 (96.66%) 26 (100%) 19 (61.29%) 132 (91.03%) saw (22°C) 0 0 0 0 1 (3.33%) 0 12 (38.71%) 13 (8.96%) rdar (37°C) 0 0 0 0 0 0 0 0 saw (37°C) 6 (100%) 6 (100%) 16 (100%) 30 (100%) 30 (100%) 26 (100%) 31 (100%) 145 (100%)

Abbreviations: rdar – red, dry and rough; saw – smooth and white. sterile 0.85% normal saline solution to remove unbound and saw morphotypes were displayed by 91.03% (132/145) cells. Eggshell samples were removed carefully and fixed and 8.96% (13/145) Salmonella isolates respectively in a solution containing 1.25% glutaraldehyde, 4% par- (Table 1). In contrast, 100% of the Salmonella isolates aformaldehyde, and 4% sucrose in phosphate buffered (145/145) displayed saw morphology on Congo red agar saline (PBS) (pH 7.2). Samples were rinsed once in wash plates at 37°C (Table 1). buffer containing 4% sucrose in PBS, post fixed in 2% osmium tetroxide (OsO ) for 30 min and dehydrated in 4 Crystal violet staining assay ascending grades of ethanol. Samples were immersed in a 1:1 mixture of 100% ethanol and hexamethyldisilizane, To quantify biofilm production formed by Salmonella iso- (ProSciTech, Townsville City, QLD, Australia), then in lates at 22 and 37°C after incubation for 96 h, the crystal two changes of 100% hexamethyldisilizane before drying violet staining assay was used. Overall, the amount of bio- in a fume hood. Samples were mounted on aluminium film formation was significantly influenced by tempera- stubs and coated with platinum for observation under a ture (Figure 2A) and representative isolates of Salmonella scanning electron microscope (Philips XL30 FEGSEM) at serovar (Figure 2B and C). Biofilm formation was sig-

Adelaide Microscopy, the University of Adelaide. nificantly higher (p < 0.05) at 22°C (OD590=2.24 ± 0.02) compared with 37°C (OD590=0.21 ± 0.01). Among the seven serovars, isolates of S. Anatum (OD =2.71 ± 0.05) Statistical analysis 590 produced significantly more (p < 0.05) biofilm at 22°C

For all experiments, the data are presented as mean ± the compared to S. Agona (OD590=2.27 ± 0.04); S. Infantis standard errors of the mean. To determine the signifi- (OD590=2.03 ± 0.05); S. Mbandaka (OD590=1.98 ± 0.03); cant mean differences between Salmonella serovar, data of S. Oranienburg (OD590=2.21 ± 0.03); S. Typhimurium biofilm formation and attachment of viable biofilm cells (OD590=2.41 ± 0.06) and S. Worthington isolates to the eggshell was analysed by one-way analysis of var- (OD590=2.43 ± 0.04) (Figure 2B). At 37°C, biofilm for- iance (ANOVA) followed by Turkey’s post hoc multiple mation was weak and increased variability was observed comparison test. between serovars when compared with 22°C (Figure 2C).

Significant differences in the expression levels of genes At 37°C, only S. Oranienburg (OD590=0.72 ± 0.05) and between Salmonella serovars were analysed statistically S. Typhimurium (OD590=0.21 ± 0.02) formed significantly using the Kruskal–Wallis test. All statistical analyses were more (p < 0.05) biofilm compared with the isolates of performed using GraphPad Prism 6 software (GraphPad other serovars: S. Agona (OD590 = -0.05 ± 0.01); S. Anatum Software, Inc. La Jolla, CA, USA). In all cases, a p-value (OD590 = -0.01 ± 0.01); S. Infantis (OD590=0.02 ± 0.01); of < 0.05 was considered statistically significant. S. Mbandaka (OD590=0.06 ± 0.01) and S. Worthington (OD590=0.04 ± 0.01) (Figure 2C).

Results Enumeration of Salmonella biofilm cells on eggshell Colony morphology on Congo red agar plates To determine whether Salmonella isolates are able to In order to determine curli, fimbriae and cellulose produc- attach and form biofilm on eggshell, the bacterial cells tion, the multicellular behaviour of all Salmonella isolates were removed by swabbing and enumerated by plate was examined on Congo red agar plates after incubation count and the results are shown in Figure 3. Control for 96 h at 22 and 37°C. Two major colony morphotypes eggs cultured for Salmonella were negative. The num- were observed in this study: (1) red, dry and rough (rdar), bers of viable biofilm cells attached to the eggshell indicative of curli, fimbriae and cellulose production, and varied significantly between representative isolates (2) smooth and white (saw), indicating a lack of both curli, of Salmonella serovars. The number of viable cells fimbriae and cellulose production (Figure1 ). At 22°C, rdar recovered from eggshells inoculated with S. Anatum 111 BIOFOULING 703

Figure 1. Colony morphology on Congo red agar plates. Three μl of overnight grown culture in LB broth, without sodium chloride, were plated on Congo red agar plates, incubated at either 22 or 37°C and visualised after 96 h. Diﬀerences in colony morphotypes were evident between the two temperatures. The red, dry and rough (rdar) morphotype was observed at 22°C for both experimental isolates (A) and the control strain S. Typhimurium ATCC 14028 (B). Smooth and white (saw) colonies on Congo red agar plates at 37°C were observed for all experimental isolates (C) as well as S. Typhimurium ATCC 14028 (D). Images in this ﬁgure are representative samples of the rdar and saw morphotypes observed at 22 or 37°C.

−2 (6.65 ± 0.12 log10 CFU cm ) were significantly (p < 0.05) Scanning electron microscopy greater than S. Agona (5.95 ± 0.15 log CFU cm−2), S. 10 To obtain detailed information on the architecture of bio- Infantis (5.58 ± 0.09 log CFU cm−2), S. Mbandaka 10 film formation following incubation for 48 h at 22°C by (5.69 ± 0.11 log CFU cm−2), S. Oranienburg (5.88 ± 0.08 10 representative isolates of Salmonella serovars, the eggshells log CFU cm−2) and S. Typhimurium isolates (5.72 ± 0.21 10 were visualised by SEM. SEM revealed that the bacterial log CFU cm−2). Eggs inoculated with S. Worthington 10 cells were firmly adhered to the eggshell surface and had (6.27 ± 0.13 log CFU cm−2) had significantly more 10 formed a dense multilayer. A characteristic extracellular (p < 0.05) viable biofilm cells than eggs treated with −2 matrix was observed after incubation for 48 h, indicating S. Infantis isolates (5.58 ± 0.09 log10 CFU cm ). 112 704 V. V. PANDE ET AL.

study produced a dense layer of cells encapsulated by an abundant extracellular matrix over the observed eggshell surface area.

Expression of biofilm forming genes by quantitative RT-PCR Genes associated with curli, fimbriae and cellulose production can be used as a measurement of biofilm formation. Quantitative RT-PCR was used to measure the relative transcription levels of csgD, csgB, adrA and bapA genes in eggshell biofilm cells ofS . Anatum, S. Agona, S. Infantis, S. Mbandaka, S. Oranienburg, S. Typhimurium and S. Worthington isolates after incubation for 48 h at 22°C. The relative gene expression levels ofcsg D in eggshell biofilm cells of S. Mbandaka (1.517 ± 0.387) were significantly higher than the expression observed for S. Typhimurium isolates (0.287 ± 0.142, P = 0.028, Figure 5A). S. Oranienburg (0.303 ± 0.100) exhibited higher expression levels of adrA compared with S. Agona isolates (0.082 ± 0.031, p = 0.010, Figure 5C). No significant differences in the relative gene expression levels of either csgB or bapA genes in eggshell biofilm cells were observed between representative isolates of different Salmonella serovars (Figure 5B and D).

Discussion This study investigated the ability of egg farm associated Salmonella serovars to form biofilm and the results demonstrate that biofilm formation was significantly influenced by both temperature and serovar. All the isolates tested during this study were found to possess the ability to form biofilm on the eggshell surface at 22°C. The ability to form a biofilm represents a significant risk not only to contamination of food items prepared with eggs but also in the kitchen environment. At 22°C, the majority (91.03%) of isolates exhibited the rdar (red, dry and rough) morphotype that has been Figure 2. Biofilm production at 22 and 37°C after incubation for linked with curli, fimbriae and cellulose production. In 96 h determined by crystal violet staining assay. (A) Comparative contrast, all Salmonella isolates (100%) displayed the biofilm formation by Salmonella isolates at 22 and 37°C. Salmonella isolates produced significantly greater amounts saw (smooth and white) morphotype at 37°C indicating of biofilm at 22°C compared with 37°C. (B) Biofilm formation the absence of curli, fimbriae and cellulose production. by different Salmonella serovars at 22°C. Significant variations Similar morphotypes have been reported previously for between serovars in biofilm formation were noticed. (C) Very weak different isolates of S. Typhimurium and S. Enteritidis and variable biofilm formation by different Salmonella serovars (Romling et al. 1998, 2003; Castelijn et al. 2012; O’Leary at 37°C. Each bar represents mean OD values ± SEM measured et al. 2013). It has been proposed that bacteria expressing at 590 nm. Bars marked with different lowercase letters indicate significant differences (p < 0.05, ANOVA) in biofilm formation the rdar morphotype form tight attachments on abiotic between temperature or serovar. surfaces and as a consequence are able to persist long- term in the environment (Romling et al. 1998; Vestby et al. 2009). that a mature biofilm had formed (Figure 4B–H). All rep- Findings of the crystal violet assay indicated that resentative isolates of Salmonella serovars included in this although there were significant differences between

113 BIOFOULING 705

In Australia, Salmonella foodborne outbreaks are often associated with eggshell contamination and not due to bacterial colonisation of the egg internal contents (McAuley et al. 2015). There are no published data reporting the ability of Salmonella spp. to produce biofilm on an eggshell surface. Based on the data obtained from colony morphology and the crystal violet staining assay, further experiments were conducted to examine biofilm formation by Salmonella isolates on eggshell at 22°C. The attachment of Salmonella to the eggshell is the primary step in egg contamination and the biofilm formation process. The findings of this study demonstrated that all Salmonella serovars were able to attach to the eggshell surface but significant differences between representative isolates of various Salmonella serovars were observed. Figure 3. Enumeration of Salmonella biofilm cells from the The survival of S. Typhimurium PT 135, an egg product eggshell after incubation for 48 h at 22°C. Data are expressed as −2± related outbreak strain, was assessed on eggshells and the mean log10 CFU cm SEM from two independent experiments. Bars marked with different lowercase letters indicate significant results indicated the persistence of this strain on the egg differences (p < 0.05, ANOVA). shell up to four weeks (McAuley et al. 2015). Previous findings from the authors’ laboratory showed that Salmonella serovars in biofilm formation, the Salmonella S. Typhimurium strains were able to survive on an eggshell isolates exhibited dense biofilm production at 22°C com- for up to 21 days (Gole et al. 2014c). While the formation pared with 37°C. The results presented here are consistent of biofilm was not assessed in either study, this could be with the findings of a previous study that examined the one of the likely mechanisms that bacteria use to persist biofilm formation capacity of 78 different isolates of eight on eggshell. Previous studies on Salmonella Typhimurium Salmonella serovars and showed that biofilm formation is isolates from poultry and pork production chains exam- strongly dependent on serovar and that the greatest bio- ined their ability to attach to stainless steel surfaces at 20 film formation was observed at 20°C (Schonewille et al. or 25°C for up to seven or 14 days. The results of these 2012). studies revealed long term survival of viable cells attached In Salmonellae, csgD (previously agfD) promoter is to the surface of stainless steel coupons. However, survival the key target for expression of multicellular behaviour was influenced by different serovars (Castelijn et al.2013 ), (the rdar morphotype) and is regulated by environmen- the condition of the medium and the incubation period tal conditions. Expression of csgD positively regulates the (O’Leary et al. 2013; Wang et al. 2016). production of polymers, thin aggregative fimbriae and Bacterial attachment to a surface is a complex process cellulose that form the extracellular matrix of biofilm and influenced by several factors including temperature. (Romling et al. 2000; Gerstel & Romling 2001; Liu et al. The temperature of 22°C used in the present study to 2014). Previously it has been observed that the rdar mor- examine bacterial attachment makes it difficult to define photype and expression of thin aggregative fimbriae were the precise temperature range suitable for the attachment restricted to low temperatures (below 37°C) (Römling of Salmonella to the eggshell. Therefore, further studies et al. 1998; Grantcharova et al. 2010; Castelijn et al. 2013). at refrigeration temperature analysing the mechanism of Moreover, in the stationary phase of bacterial cell growth, survival and/or attachment of Salmonella to the eggshell nitrogen and phosphate depletion were found to induce are needed. The results of biofilm formation on the egg- csgD promoters that enhanced the rdar morphotype shell suggest that cleaning and disinfection in the food (Gerstel & Romling 2001). This could partially explain processing environment is necessary, as the persistence of the higher biofilm formation at 22°C in this study. Faster biofilm cells could cross-contaminate other food products depletion of nutrient availability and changes in oxygen and increase the risk of food-borne outbreaks associated tension and pH are among some of the factors responsible with eggs and egg related products. for causing weak biofilm production at 37°C (Gerstel & The architecture of Salmonella attachment and bio- Romling 2001; Stepanović et al. 2003). Altogether, the data film development by representative isolates of different obtained from Congo red agar morphology and the crystal Salmonella serovars was visualised by SEM and the images violet staining assay suggest that biofilm composition and showed a dense layer of closely attached cells encapsulated regulation is dependent on temperature and vary between within an extracellular matrix. Such encapsulation of egg- Salmonella serovars. shell biofilm cells suggest that curli, fimbriae and cellulose

114 706 V. V. PANDE ET AL.

Figure 4. SEM images showing biofilm formation by Salmonella serovars on eggshells after incubation for 48 h at 22°C. A dense layer of Salmonella cells surrounded by extracellular matrix components was observed on inoculated eggshells. Representative images of biofilm formation on the eggshell surface by the different Salmonella serovars used in this study. (A) Control; (B) S. Agona; (C) S. Anatum; (D) S. Infantis; (E) S. Oranienburg; (F) S. Mbandaka; (G) S. Typhimurium; (H) S. Worthington.

115 BIOFOULING 707

Figure 5. Quantitative RT-PCR analysis showing the relative gene expression values of (A) csgD; (B) csgB; (C) adrA; and (D) bapA genes in eggshell biofilm cells. Data are presented as means ± SEM. Bars marked with different lowercase letters indicate significant differences (p < 0.05, Kruskal–Wallis test) in the relative gene expression levels between Salmonella serovars. have a role, as most of the biofilm formation by repre- levels of only csgD and adrA genes were observed between sentative isolates of Salmonella serovar exhibited the rdar different isolates of Salmonella serovars. These data sug- morphotype on Congo red agar plates at 22°C. Similar gest the role of curli, fimbriae and cellulose in eggshell microscopic observation has been described previously biofilm formation in a low nutrient medium at an ambient for Salmonella biofilm formed on stainless steel surfaces temperature of 22°C. (Castelijn et al. 2012). The microscopic appearance of csgD, a transcriptional regulator of the LuxR super- Salmonella biofilm formed on the food processing surfaces family, positively regulates the expression of Salmonella changes over time. Morphologically more adherent and biofilm associated extracellular matrix components, dense biofilm was observed by SEM at 168 h compared including curli and cellulose (Gerstel & Römling 2003; with 48 h on surfaces in food processing environments Fabrega et al. 2014). csgD also indirectly regulates cellulose (Corcoran et al. 2014). The SEM images in the present synthesis by activating transcription of adrA (Romling study provided evidence that isolates of Salmonella ser- et al. 2000; Gerstel & Römling 2003; Castelijn et al. 2012). ovars recovered from layer farm environments are capable In this study, the relative gene expression of csgD was sig- of attaching and forming biofilms on the eggshell surface. nificantly higher in eggshell biofilm cells ofS . Mbandaka Subsequent, quantitative RT-PCR analysis showed that isolates when compared with S. Typhimurium isolates. the relative expression of selected genes (csgD, csgB, adrA Interestingly, the higher expression of csgD and adrA and bapA) involved in the production of curli, fimbriae genes observed in S. Mbandaka and S. Oranienburg iso- and cellulose was induced in the eggshell biofilm cells at lates, respectively, was not associated with their enhanced 22°C. However, significant differences in the expression eggshell biofilm formation. It is interesting to note that a

116 708 V. V. PANDE ET AL. parallel difference in terms ofcsg D gene expression and Complete elimination of Salmonella from the poultry eggshell biofilm formation betweenS . Mbandaka and and food industry environment is challenging. Overall S. Typhimurium isolates was not observed. Similarly, food safety improvement is possible through adequate the expression of adrA was significantly higher in hygienic measures, along with antimicrobial interven- S. Oranienburg compared with S. Agona isolates. adrA is tion strategies at all levels of the food production chain. an important gene required for cellulose production and To reduce eggshell contamination, egg washing with its expression in S. Typhimurium biofilm cells has been sanitisers is a common method worldwide, including in found to be influenced by the type of growth medium Australia (Chousalkar et al. 2015). Given the variation in (Wang et al. 2016). The increased expression levels of egg washing protocols, it is unclear whether the current csgD and adrA genes observed in S. Mbandaka and sanitisers, their concentration, and exposure time are able S. Oranienburg isolates, respectively, could be the result to prevent or completely remove biofilm cells on the egg- of early development of mature biofilm in these ser- shell. Further research examining the anti-biofilm effects ovars, whereas the low expression levels of these genes in of egg washing agents is required. The ability ofSalmonella S. Typhimurium and S. Agona isolates could be the result serovars to form eggshell biofilm observed in this study of a developing phase in biofilm formation. Although is of particular interest to the poultry and food industry, differences in the gene expression pattern between rep- as survival and biofilm formation on eggshells at ambi- resentative isolates of serovars were observed, interest- ent temperature may increase the risk of food contami- ingly only S. Typhimurium has frequently been reported nation and human Salmonella infections. The findings of from egg product related human food poisoning out- this study have improved knowledge of eggshell biofilm breaks in Australia (OzFoodNet Working Group 2015). formation by Salmonella serovars and the information It is also important to note that other serovars such as should be useful in implementing anti-biofilm strategies S. Oranienburg, S. Mbandaka and S. Agona were detected against foodborne infections associated with Salmonella in eggs or egg products but they were not reported fre- contamination. quently in human outbreaks in Australia (Taylor et al. In conclusion, this study has demonstrated that 1998; Food Standards Australia New Zealand 2009). Salmonella isolates recovered from a layer farm envi- The understanding of differential gene regulation dur- ronment are able to form biofilm on eggshells. The ing Salmonella biofilm formation is well defined and pre- behaviour of biofilm formation was affected by temper- vious studies have examined this feature on various abiotic ature and representative isolates of various Salmonella surfaces. However, to the authors’ knowledge this is the serovars. In addition, it has been demonstrated that at first study which examined the expression of the key genes ambient temperature, Salmonella isolates are able to involved during Salmonella biofilm formation on the egg- attach and form biofilm on eggshells and genes asso- shell. Thus, the results of this study cannot be compared ciated with curli, fimbriae and cellulose production with the earlier investigations. Previously, significant contribute to biofilm formation. However, differences variations between time and the expression levels of bio- between representative isolates of Salmonella serovars film-associated genes were observed in S. Typhimurium were evident in eggshell biofilm formation. Further, bio- biofilm formed on stainless steel coupons using trypticase film formation on the eggshell observed in this study soy broth (Wang et al. 2016); and Castelijn et al. (2012) could be a food safety and public health concern, as showed that the expression levels of csgD and adrA were the persistence of such biofilm producingSalmonella significantly increased in Salmonella biofilm cells in a low strains would make their eradication more difficult, and nutrient medium at 25°C compared with 37°C. enable them to develop resistance to antimicrobials and Although biofilm formation on eggshells at 22°C common disinfectants. appears to be serovar related in this study, comparison between serovars using four representative isolates may Acknowledgements not be adequate to define the serovar specific differences in biofilm formation on eggshell. Hence, further studies The authors thank Nikita Nevrekar for technical help during this research work. They would also like to thank Lyn screening a larger number of Salmonella isolates of various Waterhouse for technical help during the scanning electron serovars are required. Moreover, the expression levels of microscope work at Adelaide microscopy of the University of biofilm genes were analysed at a single temperature and Adelaide. time point. Future studies at different temperatures and time intervals investigating the kinetics of gene expression Disclosure statement and biofilm formation on eggshell by different Salmonella serovars are required. All authors declare no conflict of interest.

117 BIOFOULING 709

References Microbiol. 189:61–66. doi:http://dx.doi.org/10.1016/j. ijfoodmicro.2014.07.030 Castelijn GA, van der Veen S, Zwietering MH, Moezelaar R, Gole VC, Torok V, Sexton M, Caraguel CG, Chousalkar KK. Abee T. 2012. Diversity in biofilm formation and production 2014b. Association between the indoor environmental of curli fimbriae and cellulose ofSalmonella Typhimurium contamination of Salmonella with egg contamination on strains of different origin in high and low nutrient medium. layer farms. J Clin Microbiol. 52:3250–3258. doi:http:// Biofouling. 28:51–63. doi:http://dx.doi.org/10.1080/089270 dx.doi.org/10.1128/JCM.00816-14 14.2011.648927 Gole VC, Chousalkar KK, Roberts JR, Sexton M, May D, Tan Castelijn GA, Parabirsing JA, Zwietering MH, Moezelaar R, J, Kiermeier A. 2014c. Effect of egg washing and correlation Abee T. 2013. Surface behaviour of S. Typhimurium, S. Derby, between eggshell characteristics and egg penetration by S. Brandenburg and S. Infantis. Vet Microbiol. 161:305–314. various Salmonella Typhimurium strains. PloS one. 9:e90987. doi:http://dx.doi.org/10.1016/j.vetmic.2012.07.047 doi:http://dx.doi.org/10.1371/journal.pone.0090987 Chousalkar KK, Roberts JR. 2012. Recovery of Salmonella from Grantcharova N, Peters V, Monteiro C, Zakikhany K, Romling eggshell wash, eggshell crush, and egg internal contents of U. 2010. Bistable expression of CsgD in biofilm development unwashed commercial shell eggs in Australia. Poult Sci. of Salmonella enterica serovar Typhimurium. J Bacteriol. 91:1739–1741. doi:http://dx.doi.org/10.3382/ps.2012-02144 192:456–466. doi:http://dx.doi.org/10.1128/JB.01826-08 Chousalkar KK, Sexton M, McWhorter A, Hewson K, Martin Joseph B, Otta SK, Karunasagar I, Karunasagar I. 2001. Biofilm G, Shadbolt C, Goldsmith P. 2015. Salmonella Typhimurium formation by Salmonella spp. on food contact surfaces and in the Australian egg industry: multidisciplinary approach to their sensitivity to sanitizers. Int J Food Microbiol. 64:367– addressing the public health challenge and future directions. 372. doi:http://dx.doi.org/10.1016/S0168-1605(00)00466-9 Crit Rev Food Sci Nutr. doi:http://dx.doi.org/10.1080/1040 Latasa C, Roux A, Toledo-Arana A, Ghigo JM, Gamazo C, 8398.2015.1113928 Penadés JR, Lasa I. 2005. BapA, a large secreted protein Corcoran M, Morris D, De Lappe N, O’Connor J, Lalor P, required for biofilm formation and host colonization of Dockery P, Cormican M. 2014. Commonly used disinfectants Salmonella enterica serovar Enteritidis. Mol Microbiol. fail to eradicate Salmonella enterica biofilm from food 58:1322–1339. doi:http://dx.doi.org/10.1111/j.1365- contact surface materials. Appl Environ Microbiol. 80:1507– 2958.2005.04907.x 1514. doi:http://dx.doi.org/10.1128/AEM.03109-13 Lianou A, Koutsoumanis KP. 2012. Strain variability Costerton JW, Stewart PS, Greenberg EP. 1999. Bacterial of the biofilm forming ability of Salmonella enterica biofilms: a common cause of persistent infections. under various environmental conditions. Int J Food Science. 284:1318–1322. doi:http://dx.doi.org/10.1126/ Microbiol. 160:171–178. doi:http://dx.doi.org/10.1016/j. science.284.5418.1318 ijfoodmicro.2012.10.002 De Oliveira DC, Fernandes Junior A, Kaneno R, Silva Liu Z, Niu H, Wu S, Huang R. 2014. CsgD regulatory network in MG, Araujo Junior JP, Silva NC, Rall VL. 2014. Ability a bacterial trait-altering biofilm formation. Emerg Microbes of Salmonella spp. to produce biofilm is dependent on Infect. 3(1):e1. doi:http://dx.doi.org/10.1038/emi.2014.1 temperature and surface material. Foodborne Pathog Dis. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene 11:478–483. doi:http://dx.doi.org/10.1089/fpd.2013.1710 expression data using real-time quantitative PCR and the 2− Fabrega A, Soto SM, Balleste-Delpierre C, Fernandez-Orth ΔΔCT method. Methods. 25:402–408. D, Jimenez de Anta MT, Vila J. 2014. Impact of quinolone- resistance acquisition on biofilm production and fitness in Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’Brien Salmonella enterica. J Antimicrob Chemother. 69:1815– SJ, Jones TF, Fazil A, Hoekstra RM. 2010. The global burden 1824. doi:http://dx.doi.org/10.1093/jac/dku078 of nontyphoidal Salmonella gastroenteritis. Clin Infect Dis. Food Standards Australia New Zealand. 2009. Risk assessment 50:882–889. doi:http://dx.doi.org/10.1086/649513 of eggs and egg products. 1–192. Available from: https:// McAuley CM, Duffy LL, Subasinghe N, Hogg G, Coventry J, www.foodstandards.gov.au/code/proposals/documents/ Fegan N. 2015. Salmonella Typhimurium and Salmonella P301%20Eggs%20PPPS%20DAR%20SD1%20Risk%20 Sofia: growth in and persistence on eggs under production Assessment.pdf. and retail conditions. BioMed Res Int. Article ID 914987: Gantois I, Ducatelle R, Pasmans F, Haesebrouck F, Gast R, 1–8. foi:http://dx.doi.org/10.1155/2015/914987 Humphrey TJ, Van Immerseel F. 2009. Mechanisms of egg O’Leary D, Cabe EMM, McCusker MP, Martins M, Fanning S, contamination by Salmonella Enteritidis. FEMS Microbiol Duffy G. 2013. Microbiological study of biofilm formation Rev. 33:718–738. doi:http://dx.doi.org/10.1111/j.1574- in isolates of Salmonella enterica Typhimurium DT104 6976.2008.00161.x and DT104b cultured from the modern pork chain. Int J Gerstel U, Romling U. 2001. Oxygen tension and nutrient Food Microbiol. 161:36–43. doi:http://dx.doi.org/10.1016/j. starvation are major signals that regulate agfD promoter ijfoodmicro.2012.11.021 activity and expression of the multicellular morphotype in OzFoodNet Working Group. 2012. Monitoring the incidence Salmonella typhimurium. Environ Microbiol. 3:638–648. and causes of diseases potentially transmitted by food in doi:http://dx.doi.org/10.1046/j.1462-2920.2001.00235.x Australia: annual report of the OzFoodNet network, 2010. Gerstel U, Römling U. 2003. Thecsg D promoter, a control Commun Dis Intell Q Rep. 36:E213–241. Available from: unit for biofilm formation in Salmonella typhimurium. Res http://www.health.gov.au/internet/main/publishing.nsf/ Microbiol. 154:659–667. doi:http://dx.doi.org/10.1016/j. Content/cda-cdi3603a.htm resmic.2003.08.005 OzFoodNet Working Group. 2015. OzFoodNet quarterly Gole VC, Caraguel CG, Sexton M, Fowler C, Chousalkar report, 1 January to 31 March 2014. Commun Dis Intell Q KK. 2014a. Shedding of Salmonella in single age caged Rep. 39:E612–618. Available from: http://www.health.gov. commercial layer flock at an early stage of lay. Int J Food au/internet/main/publishing.nsf/Content/cda-cdi3904i.htm

118 710 V. V. PANDE ET AL.

Romling U, Bokranz W, Rabsch W, Zogaj X, Nimtz M, Tschape Steenackers H, Hermans K, Vanderleyden J, De Keersmaecker H. 2003. Occurrence and regulation of the multicellular SC. 2012. Salmonella biofilms: an overview on occurrence, morphotype in Salmonella serovars important in human structure, regulation and eradication. Food Res Int. 45: disease. Int J Med Microbiol. 293:273–285. doi:http://dx.doi. 502–531. doi:http://dx.doi.org/10.1016/j.foodres.2011.01.038 org/10.1078/1438-4221-00268 Stepanović S, Ćirković I, Mijač V, Švabić-Vlahović M. 2003. Römling U, Bian Z, Hammar M, Sierralta WD, Normark S. Influence of the incubation temperature, atmosphere and 1998. Curli fibers are highly conserved betweenSalmonella dynamic conditions on biofilm formation by Salmonella spp. typhimurium and Escherichia coli with respect to operon Food Microbiol. 20:339–343. doi:http://dx.doi.org/10.1016/ structure and regulation. J Bacteriol. 180:722–731. Available S0740-0020(02)00123-5 from: http://jb.asm.org/content/180/3/722.full Taylor JP, Barnett BJ, del Rosario L, Williams K, Barth SS. 1998. Romling U, Rohde M, Olsen A, Normark S, Reinkoster J. Prospective investigation of cryptic outbreaks of Salmonella 2000. AgfD, the checkpoint of multicellular and aggregative agona salmonellosis. J Clin Microbiol. 36:2861–2864. behaviour in Salmonella typhimurium regulates at least two Available from: http://jcm.asm.org/content/36/10/2861.full independent pathways. Mol Microbiol. 36:10–23. doi:http:// Vestby LK, Møretrø T, Ballance S, Langsrud S, Nesse LL. 2009. dx.doi.org/10.1046/j.1365-2958.2000.01822.x Survival potential of wild type cellulose deficient Salmonella Romling U, Sierralta WD, Eriksson K, Normark S. 1998. from the feed industry. BMC Vet Res. 5:43. doi:http://dx.doi. Multicellular and aggregative behaviour of Salmonella org/10.1186/1746-6148-5-43 typhimurium strains is controlled by mutations in the agfD Wang H, Dong Y, Wang G, Xu X, Zhou G. 2016. Effect of promoter. Mol Microbiol. 28:249–264. doi:http://dx.doi. growth media on gene expression levels in Salmonella org/10.1046/j.1365-2958.1998.00791.x Typhimurium biofilm formed on stainless steel surface. Samberg Y, Meroz M. 1995. Application of disinfectants in Food Control. 59:546–552. doi:http://dx.doi.org/10.1016/j. poultry hatcheries. Rev Sci Tech. 14:365–380. Available foodcont.2015.06.026 from: http://europepmc.org/abstract/med/7579636 White AP, Gibson DL, Grassl GA, Kay WW, Finlay Schonewille E, Nesse LL, Hauck R, Windhorst D, Hafez HM, BB, Vallance BA, Surette MG. 2008. Aggregation via Vestby LK. 2012. Biofilm building capacity of Salmonella the red, dry, and rough morphotype is not a virulence enterica strains from the poultry farm environment. FEMS adaptation in Salmonella enterica serovar Typhimurium. Immunol Med Microbiol. 65:360–365. doi:http://dx.doi. Infect Immun. 76:1048–1058. doi:http://dx.doi.org/10.1128/ org/10.1111/j.1574-695X.2012.00966.x IAI.01383-07 Seixas R, Machado J, Bernardo F, Vilela C, Oliveira M. Winter SE, Thiennimitr P, Winter MG, Butler BP, Huseby DL, 2014. Biofilm formation by Salmonella enterica serovar Crawford RW, Russell JM, Bevins CL, Adams LG, Tsolis 1,4,[5],12:i:- Portuguese isolates: a phenotypic, genotypic, RM. 2010. Gut inflammation provides a respiratory electron and socio-geographic analysis. Curr Microbiol. 68:670–677. acceptor for Salmonella. Nature. 467:426–429. doi:http:// doi:http://dx.doi.org/10.1007/s00284-014-0523-x dx.doi.org/10.1038/nature09415 Shi X, Zhu X. 2009. Biofilm formation and food safety in food industries. Trends Food Sci Tech. 20:407–413. doi:http:// dx.doi.org/10.1016/j.tifs.2009.01.054

119 Table S1. List of primers used in this study.

Name of Function of gene Reverse primer Forward primer Reference gene

Nucleator and minor subunit of curli  (1) csgB TTTGCGATATACTGGCATCGTT TCGACCAGGCAGGGAATTAT

fibres

csgD Master regulator of biofilm CGACCTCGCGATTTCATTATTAGA AACACGTGGTCAGCGGATTACAG (1)

Post transcriptional activator of adrA CGCCATATCCGCAGACTTTAGC GGAACGCCGGCAGACAGC (1) cellulose biosynthesis

bapA Large surface adhesins CGTCAGCGGCGGCGTAGTA TTCCCGCCGACAATAGCAGTAG (1)

Reference

1. Fabrega A, Soto SM, Balleste-Delpierre C, Fernandez-Orth D, Jimenez de Anta MT, Vila J. 2014. Impact of quinolone-resistance acquisition on

biofilm production and fitness in Salmonella enterica. J Antimicrob Chemother 69:1815-1824.

120

CHAPTER 5 ANTI-BACTERIAL AND ANTI-BIOFILM ACTIVITY OF COMMERCIAL ORGANIC ACID PRODUCTS AGAINST S. ENTERICA ISOLATES RECOVERED FROM LAYER FARM ENVIRONMENT

121

122

Anti-bacterial and anti-biofilm activity of commercial organic acid products against

Salmonella enterica isolates recovered from layer farm environment

a a a,* Vivek Pande , Andrea R. McWhorter , Kapil K. Chousalkar

a School of Animal and Veterinary Sciences, The University of Adelaide, Roseworthy, SA,

5173, Australia.

Running headline: Organic acid Salmonella biofilms

* Corresponding Author:

Dr Kapil. K. Chousalkar School of Animal and Veterinary Science The University of Adelaide Roseworthy, 5371, SA, Australia Telephone: +61 8 8313 1502 Facsimile: + 61 8 8303 7356 Email: [email protected]

123

5.1. Abstract

Aims: This study aimed to evaluate the antibacterial activity of commercial organic acid products against S. enterica isolates. The second aim of this study was to examine the susceptibility of 3 and 5 day old Salmonella Typhimurium biofilms to organic acid products.

Methods and Results: Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of organic acid products were evaluated for Salmonella isolates (n=4) of representative serovars. Biofilms were formed at 22 ± 2°C using MBEC™ assay system and exposed for 30 and 90 minutes at 0.2 and 0.4% of commercial organic acid products.

No significant differences were observed between isolates of representative Salmonella serovars in respect of inhibitory and bactericidal concentrations of each product. However, between the products wide variations in these tests were evident. Two out of three commercial organic acid products tested in this study significantly reduced viable cells from all ages of biofilms in a dose and time dependent manner. Increased age of biofilm did not enhance resistance towards organic acid treatments. None of the tested products completely eliminated biofilm cells at any concentrations and exposure times.

Conclusions: Product composition, exposure time, and concentration of organic acid products were important factors in reducing viable biofilm cells. Incomplete elimination of biofilm from surfaces commonly used in food supply chain may cause further contamination and lead to recurrent infections.

Significance and Impact of the Study: This study has expanded our understanding about the susceptibility of Salmonella biofilms to commercial organic acid products. These findings have implications in the usage, development, and optimization of organic acid products and their ability to eliminate/reduce biofilms.

124

5.2. Introduction

Non-typhoidal Salmonella (NTS) infections are one of the main causes of foodborne illness worldwide (Kirk et al. 2015). Globally, an estimated 93.8 million cases of gastroenteritis and

155,000 deaths are caused by Salmonella spp annually (Majowicz et al. 2010). In Australia, consumption of contaminated food products of animal origin, particularly egg and egg products, are frequently associated with outbreaks of human salmonellosis (OzFoodNet Working Group

2012; 2015).

There are more than 2,500 serovars of Salmonella enterica spp however, Salmonella Enteritidis and Salmonella Typhimurium are the most common causes of human salmonellosis in most parts of the world (Hendriksen et al. 2011). Globally, S. Enteritidis is most commonly isolated from eggshell and egg contents and is frequently involved in egg and egg product associated foodborne outbreaks (Wales 2011). S. Enteritidis, however, is not endemic in Australian layer flocks and infection in humans with this serovar occurs primarily as a result of overseas travel.

In Australia, S. Typhimurium has filled this niche and is frequently implicated in foodborne outbreaks linked to the consumption of contaminated egg and egg related products (OzFoodNet

Working Group 2009; 2012; 2015). Between 2001 and 2010, S. Typhimurium was identified as the causative agent for 150 (90%) of the 166 egg associated outbreaks in Australia (Moffatt et al. 2016).

In order to reduce the risk of Salmonella contamination, several intervention strategies have been developed at multiple points both on farm and in the commercial kitchen. In poultry industry cleaning, disinfection, biosecurity, vaccination, prebiotics, probiotics, acidification of feed and water (organic acids) as well as egg washing are the most common practises used at farm level (Cox and Pavic 2010; Ricke 2014; Chousalkar et al. 2015). In the commercial kitchen environment, routine cleaning and disinfection are efficient and cost effective methods to reduce the risk of Salmonella contamination. The common classes of chemical disinfectants in food industry include alcohols, aldehydes, halogens, phenicols, oxidising agents, biguanides, 125 and quaternary ammonium compounds (McDonnell and Russell 1999; Møretrø et al. 2012).

Although the application of these strategies has reduced the Salmonella contamination level, complete elimination of this pathogen is yet to be achieved.

Organic acids are commonly used to prevent microbial contamination and dissemination of foodborne pathogens in pre-harvest and post-harvest food production and processing (Ricke

2003). Organic acids are generally referred to as volatile fatty acids, fatty acids, weak, or carboxylic acids (Cherrington et al 1991, Ricke 2003). Organic acids, such as acetate, propionate, and butyrate are produced in smaller quantities in the gut environment of food animals and humans (Ricke 2003). Organic acids are relatively stable and usually metabolised by food animals or are excreted unabsorbed therefore, chemical residues are not a food safety risk (Wales et al. 2010). Commercial organic acid products are widely used in the poultry industry. Acid blends and buffered blends including acid salts are favoured for maximum antimicrobial effect (Wales et al. 2010). These products are commonly used in feed and water to reduce shedding of specific foodborne pathogens including Salmonella (Van Immerseel et al. 2006; Wales et al. 2013). Previous in vivo poultry studies have shown that the addition of organic acids in feed (Hinton and Linton 1988; Iba and Berchieri 1995; Thompson and Hinton

1997) and water (Parker et al. 2007; Menconi et al. 2013) significantly reduced the shedding and caecal colonisation of Salmonella. It has also been demonstrated in vitro that organic acid products are able to reduce total Salmonella counts in different feed types (Koyuncu et al. 2013) and water sources (Wales et al. 2013).

Contaminated drinking water is one source of Salmonella infection and re-infection in poultry flocks. Salmonella can survive in drinking water for prolonged periods of time, therefore it is important to keep drinking water free of Salmonella (Van Immerseel et al. 2006). Despite acidification of drinking water, complete elimination of Salmonella is difficult. Bacterial biofilms that form in water tanks and lines are protected, making the eradication of Salmonella challenging (Watkins 2006). 126

A biofilm is a community of bacteria irreversibly attached to biotic or abiotic surfaces and enclosed in self-produced extracellular matrix material (Donlan and Costerton 2002).

Salmonella is able to attach and form biofilm on different surfaces such as stainless steel, glass, plastic, cement, and rubber, which are commonly used in industry and domestic environments

(Steenackers et al. 2012). The extracellular matrix in which biofilm cells are embedded acts as both chemical and mechanical barriers against antimicrobial agents and environmental stressors

(Suci et al. 1994; Chen and Stewart 1996; Steenackers et al. 2012).

Minimum inhibitory concentrations and minimum bactericidal concentration testing are traditionally used to evaluate the efficacy of antimicrobial agents. These testings are performed using planktonic phenotypes to measure required concentration of antimicrobial agent for its bacteriostatic or bactericidal activity (Prescott and Baggot 1985). However, the concentration of antimicrobial agent to kill bacteria in biofilm may be thousand times greater than that required to kill planktonic bacteria of exactly same strain (Nickel et al. 1985; Costerton et al.

1995). It has also been demonstrated that cells in a biofilm are more resistant to commonly used disinfectants compared to their planktonic counterparts (Joseph et al. 2001; Wong et al.

2010a). Thus, biofilm formation contributes to the persistence of Salmonella in environments and detachment of bacteria from biofilm could be a source of recurrent bacterial contamination in food processing chains, reducing food quality (Møretrø et al. 2012). Previous studies have documented increased resistance to antimicrobials with increasing age of biofilm (Anwar and

Costerton 1990; Fraud et al. 2005; Shen et al. 2011; Nguyen and Yuk 2013; Corcoran et al.

2014). In contrast, age of biofilm was not associated with increased resistance to antimicrobials

(Wilson et al. 1996; Gilbert et al. 2001; Kim et al. 2007; Wong et al. 2010b). Previous research in our laboratory demonstrated that Salmonella enterica isolates from egg farm environment are able to form biofilm on the eggshell surface (Pande et al. 2016).

Although much is known about anti-Salmonella efficacy of organic acids in feed and water, studies examining the efficacy of commercial organic acid products against the S. Typhimurium 127 biofilm are lacking. Biofilm formation is a serious food safety concern, therefore prevention of biofilm in food chains is critical.

In Australia, organic acid products are commonly used by egg producers in feed and water as additives to combat foodborne pathogen including Salmonella. Persistent exposure to organic acids could increase their inhibitory and bactericidal concentration. Therefore, the susceptibility of Salmonella isolates to organic acid product may differ. In line with this assumption, large variations were observed in the minimum inhibitory concentrations of the different bacterial species (Aarestrup and Hasman 2004) and Salmonella serotypes (Long et al. 2016) to the commonly used disinfectants. However, there is limited data available examining the inhibitory and bactericidal concentration of commercial organic acid products against isolates of

Salmonella serotypes recovered from layer farm environment.

In this study, we investigated the differences between isolates of representative Salmonella serovars in minimum inhibitory concentration (MIC) or minimum bactericidal concentration

(MBC) of three commercial organic acid products. The efficacy of commercial organic acid products against S. Typhimurium biofilms was also evaluated for different aged biofilms, and exposure time and organic acid product concentration. From amongst isolates of representative

Salmonella serovars, S. Typhimurium was selected in this study because of its frequent involvement in human disease outbreaks in Australia (OzFoodNet Working Group 2012).

5.3. Materials and Methods

Bacterial strains

Four isolates of each Salmonella enterica spp enterica : S. Agona; S. Anatum; S. Infantis; S.

Mbandaka; S. Oranienburg; S. Typhimurium (phage type 9) and S. Worthington previously isolated during epidemiological studies were used in this study (Chousalkar and Roberts 2012;

Gole et al. 2014). All isolates were serotyped at the Australian Salmonella Reference Centre,

Microbiology and Infectious Diseases, SA Pathology, Adelaide, South Australia. 128

Organic acid products

Commercial organic acid products commonly used in the Australian poultry industry were selected to examine their efficacy against Salmonella isolates. The details of commercial organic acid products tested are mentioned in Table 1.

Determination of MIC and MBC of organic acid products against Salmonella serovars

MIC

Each Salmonella isolate from seven representative serovars was screened to determine the MIC of organic acid products as described earlier with some modifications (Wales et al. 2013).

Briefly, each organic acid product (2%) was prepared in nutrient broth (Oxoid, Australia) and diluted serially in 96 well plates (Sarstedt, Australia). The range of concentration used to determine the MIC of each organic acid product was 0.003 - 2%. All isolates were tested in duplicate with one negative control well in each row containing nutrient broth only. Organic acid was omitted from positive control well of each row. Each test strain of Salmonella was grown overnight at 37°C on nutrient agar. Bacterial suspension of each Salmonella isolate was prepared by suspending bacteria in saline to 0.5 McFarland standard and diluted (1:20) in normal saline. For each challenge and positive control well, 10 µL of bacterial suspension was added. Plates were incubated for 18 h at 37 °C and observed for visible growth. The highest concentration of organic acid products without visible growth was recorded as MIC.

MBC

To determine minimum bactericidal concentration (MBC), 10-µl aliquot from each well of a 96 well plate showing no visible growth was spotted onto nutrient agar plates. Following overnight incubation of plates at 37 °C, the dilution showing no growth was documented as MBC. The

MIC and MBC were determined for all Salmonella isolates in duplicate and the experiments were performed twice on different days.

129

Salmonella isolates, culture conditions, and inoculum preparation for biofilm study

Four isolates of S. Typhimurium (phage type 9) were used to study biofilm formation. All isolates were cultured onto xylose lysine deoxycholate (XLD) agar plates (Thermo Fisher

Scientific, Australia) and maintained in Luria Bertani (LB) broth (Oxoid, Australia) with 20% glycerol at -80 °C. The biofilm inoculum was prepared by culturing the stocks of each bacterial isolate overnight at 37 °C onto XLD agar (Thermo Fisher Scientific, Australia). Briefly, a single colony of each Salmonella isolate was added to a separate tube containing 10 ml of LB broth and incubated overnight with shaking (110 rpm). The overnight grown culture was diluted

1:100 in LB with no salt to reach a final concentration of 107 bacteria per ml for biofilm formation. Colony forming unit (CFU) were determined by plating 10 fold serial dilutions of the inoculum on LB agar to confirm dose.

Biofilm formation

S. Typhimurium biofilm formation was carried out using MBEC™ Assay system (Innovotech

Inc. Edmonton, Canada). The top plate of MBEC™ biofilm inoculator consists of 96 pegs and a corresponding base containing 96 individual wells. The design of this plate allows the growth of multiple isolates and testing of multiple biocides at different concentrations. Biofilm formation was established by adding 200 µl of bacterial inoculum in each well of MBEC plate and plates were incubated at 22 ± 2 °C for 3 or 5 days on a rocking platform shaker (ROCKit,

Select Bio-Products, NJ, USA).

Activity of organic acid products against S. Typhimurium biofilms

The activity of three commercial organic products listed in Table 1 were examined against S.

Typhimurium biofilm as previously described with some modifications (Wong et al. 2010a).

Due to confidential reasons, the details of the organic acid products and company cannot be revealed in the public domain. Before each experiment, fresh dilutions of organic acids were made from stock solution and used immediately. Two concentrations of each organic acid 130 product (0.2 and 0.4%) were used to examine their activity against biofilm for 30 or 90 min.

Following biofilm establishment, peg lids were aseptically removed at day 3 or 5 of biofilm growth and rinsed with 0.9% normal saline solution for 1 min in individual wells of 96 well flat bottom microtiter plates (Nunc™, Thermo Scientific, Australia). For each organic acid studied, the peg lids were placed in organic acid plate and exposed for 30 or 90 min. Tap water was filtered using Nalgene™ rapid -flow™ sterile filter with PES membrane ( Thermo Fischer

Scientific, Australia ) and used as a negative control in the organic acid challenge plate. After specified exposure time, the peg lids were rinsed twice (1 min each rinse) in normal saline solution, immersed in the neutralising broth (Difco™ Neutralizing Broth) for one min then aseptically transferred to 96 well plate containing 200 µl of LB broth. The plates were sonicated at high speed for 5 min (Model 160TD, Soniclean Pty Ltd, Australia), serially diluted in 0.9% normal saline solution, and plated onto LB agar plates (Thermo Scientific, Australia).

Following overnight incubation at 37 °C, the colonies were counted to determine colony forming units (CFU). The testing of each organic acid product was performed in triplicate and repeated twice. The detailed instructions for this assay are provided by the manufacturer in the procedural manual version 1.1 (Innovotech Inc. Edmonton, Canada).

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 6 for windows (GraphPad

Software, Inc. CA, USA). One-way analysis of variance (ANOVA) was used to detect differences in the MIC and MBC between Salmonella isolates of each serotype for individual organic acid products. The mean cell count recovered from control and organic acid treated group at different days, exposure times and concentrations were analysed by two way ANOVA followed by Tukey’s multiple comparisons test and data were expressed as Mean log10 CFU ±

SEM. P values <0.05 were considered statistically significant.

131

5.4. Results

MIC and MBC for Salmonella isolates

The mean MIC and MBC values of the three different organic acid products against isolates of

Salmonella serovars are presented in Table 2. MIC and MBC values for each product did not differ significantly between Salmonella isolates of representative serovars. Two products (A and C) were most potent for both MIC and MBC. However, one product (B) was less effective in inhibiting and abolishing the growth of Salmonella in both tests.

Efficacy of organic acid product A against S. Typhimurium biofilms

In Australia, S. Typhimurium is frequently implicated in egg and egg related food poisoning cases in humans, hence S. Typhimurium isolates were selected for biofilm formation and their susceptibility to organic acid treatment was evaluated in this study. The mean log10 CFU reduction in viable biofilm cells after organic acid exposure was calculated by subtracting the mean log10 CFU of cells from the control group. In comparison with control, significant differences (P <0.05) in the recovery rate of viable cells from 3 and 5 day old biofilms were observed after treatment with organic acid product A and this effect was exposure and/ or concentration dependent (Fig. 1).

Product A, at 0.2 % for 30 min exposure reduced 1 and 1.22 log10 CFU cells from day 3 and 5 biofilms respectively. At the same concentration, exposure time of 90 min reduced 2.62 and

1.89 log10 CFU cells at day 3 and 5 of biofilm formation. At 0.4% concentration for 30 min exposure there was 2.52 and 3.26 log10 CFU reduction in viable cells of day 3 and 5 biofilms respectively. After 90 min exposure at 0.4%, reduction of 4.90 and 2.52 log10 CFU cells was observed from day 3 and day 5 biofilms. None of the exposure times and concentrations of organic acid product A were able to eliminate day 3 and day 5 viable biofilm cells.

132

Efficacy of organic acid product B against S. Typhimurium biofilms

S. Typhimurium biofilms were grown for 3 and 5 days and then exposed for 30 or 90 min at

0.2% or 0.4% concentration of product B. In comparison with control, treatment with organic acid product B for 30 or 90 min at both 0.2% and 0.4% concentration had no significant effect

(P> 0.05) on the recovery rate of viable cells from any biofilms (Fig. 2). There was less than 1 log10 CFU reduction in viable cells from 3 and 5 day old biofilms exposed for 30 or 90 min at both concentrations of organic acids (Fig. 2).

Efficacy of organic acid product C against S. Typhimurium biofilms

S. Typhimurium biofilms were grown for 3 and 5 days and then exposed for 30 or 90 min at different concentrations of organic acid product C. Significant reduction (P<0.05) in viable cells was observed in comparison to control from all ages of biofilm and this effect was related to exposure time and/or concentration of organic acid treatment (Fig. 3).

Product C, at 0.2 % with 30 min exposure reduced only 0.55 and 1.02 log10 CFU cells from day

3 and 5 biofilms respectively. However, 90 min exposure resulted in higher reduction of the number of viable cells with, 1.37 and 2.78 log10 CFU cells from day 3 and 5 biofilms respectively. At 0.4% concentration for 30 min exposure there was 1.11 and 2.19 log10 CFU reduction in viable cells of day 3 and 5 biofilms, respectively. After 90 min exposure at 0.4%, reduction of 2.98 and 3.76 log10 CFU cells was observed from day 3 and day 5 biofilms.

5.5. Discussion

Salmonella enterica subsp. enterica are the major cause of food-borne illnesses and a serious public health concern (Hendriksen et al. 2011). The majority of human disease outbreaks are associated with consumption of contaminated food particularly egg and egg related products

(Moffatt et al. 2016). Reducing Salmonella contamination at farm level is a logical step to reduce human infection and ensuring public health and safety. In the poultry industry,

133 commercial organic acid products are extensively used in feed and water as one of the control measures to reduce the risk of Salmonella contamination (Cox and Pavic 2010; Wales et al.

2010). It is now recognised that part of the ecological success of Salmonella enterica spp enabling it to survive extreme environmental conditions is due to its ability to form biofilms which is a major food safety issue worldwide (Steenackers et al. 2012). This study has examined inhibitory and bactericidal activity of commercial organic acid formulations against isolates of

Salmonella serovars. Our results demonstrated that inhibitory and bactericidal concentrations of organic acids did not differ between isolates of representative Salmonella serovars and some organic acid products were able to reduce biofilm formation at all ages however, none of the products was able to completely eliminate S. Typhimurium biofilms.

Screening of 28 Salmonella isolates from seven representative serovars for inhibition and bactericidal activity by three commercial organic acid products showed no significant variation between isolates. However, variations in these tests were observed amongst products. Similarly, significant differences amongst the four commercial organic acid products for MIC and MBC values against Salmonella spp have been documented in an earlier study (Wales et al. 2013).

These findings suggests that the exposure time could increase the inhibitory and bactericidal activity to the biocide therefore, bacterial isolates may develop different susceptibility patterns to a particular product.

In this study, the efficacy of three organic acid products against Salmonella biofilms was evaluated using MBEC assay system. The MBEC system or Calgary biofilm device is a high throughput-screening assay designed to evaluate the efficiency of antimicrobials against biofilms of a variety of pathogens. Previously the MBEC system has been used to determine the efficacy of commonly used disinfectants and antibiotics against biofilms of pathogenic bacteria including Salmonella (Ceri et al. 1999; Wong et al. 2010a; Wong et al. 2010b).

134

The results of this study showed that biofilm age was not associated with increased resistance to organic acid treatments. Exposure time, concentration, and organic acid type were responsible for the reduction of viable biofilms cells. There is a paucity of literature on the efficacy of commercial organic acid products against S. Typhimurium biofilms, therefore the result of present study could not be compared with previous work. Nevertheless, the findings of present study could be partially compared with previous reports that showed 3 and 5 day old

S. Typhimurium biofilms were not associated with the increased resistance towards commonly used disinfectants (Wong et al. 2010b). In contrast, other studies reported that age of biofilm was significantly related to increased resistance to commonly used disinfectants or antimicrobials (Shen et al. 2011; Nguyen and Yuk 2013; Corcoran et al. 2014). The discrepancies in results could be attributed to the diverse experimental conditions, such as product, growth, strains of bacteria, temperature, and device used.

The extracellular matrix (ECM) is an important constituent of biofilm that provides protection to biofilm cells against the harsh effects of many biocides and other environmental factors by acting either as a barrier or by reducing the diffusion of active products (Suci et al. 1994; Chen and Stewart 1996; Steenackers et al. 2012). ECM development by S. Typhimurium on day 3 and 5 day old biofilms may have provided protection against action of organic acids. As a result, complete biofilm elimination was not achieved in this study.

This study indicated that the efficacy of three commercial organic acid products varied greatly against Salmonella biofilm under the conditions of this study using MBEC assay system. Of the organic acid products tested, two products (A and B) were able to reduce viable cells in the biofilm of all ages and this effect was associated with exposure time and concentration. No significant difference (P< 0.05) was observed in the effectiveness of product B when used on biofilms cells of all ages at different exposure time and concentration. Even at twice the recommended user concentration, complete elimination of biofilm cells was not achieved by any of the products tested under the conditions of this study. These findings could be compared 135 with earlier study, which reported that gallic, and ferullic acids were not able to completely remove biofilms formed by E. coli, Listeria monocytogenes, Pseudomonas aeruginosa, and

Staphylococcus aureus (Borges et al. 2012). The anti-microbial mechanism of organic acids is derived from their ability to cross bacterial cell membrane and once internalised into the cell cytoplasm, organic acid dissociate into anions and protons and interfere with the pH homeostasis of the cell. In addition to alterations in cellular pH gradient, other toxicity effects of organic anions that attribute to the membrane structure, osmolality and macromolecule synthesis have also been proposed (Cherrington et al. 1990; Russell 1992; Ricke 2003; Van

Immerseel et al. 2006; Wales et al. 2010). The differences in the activity of organic acid products against biofilms may relate to product composition, concentration of active ingredients, mechanism of action and pH of the solutions. Therefore, due to these differences and proprietary issues the comparison of three organic acid products A, B, and C is not suitable.

Organic acid products (A and C) contain buffering components and blends of organic acids.

These two products resulted in a significant reduction of viable bacterial cells within a biofilm.

Product B contains multiple organic acids but no buffering components and was not associated with significant reduction in biofilm cells under test conditions. This suggests that rather than only blends of acids, buffering capacity of the product may maintain and stabilise the pH required to limit the growth of pathogenic bacteria. Significant reduction in biofilm formation with decreasing pH values has been observed in earlier studies (Nguyen et al. 2014; Wang et al. 2016). The product A and C were associated with higher reductions in viable biofilms cells and had lowest MIC and MBC values than product B. In contrast, product B found to be least effective in reducing viable cells in biofilms and showed higher MIC and MBC values than products A and C. Therefore, the variations in biofilm activity by these products are not surprising.

All of the products tested in this study are marketed in poultry industry for use in drinking water. Previous study reported that the activity of commercial organic acid products against 136

Salmonella was enhanced in tap water in comparison with mineral or river water (Wales et al.

2013). In this study, organic acid products were tested in tap water hence further studies examining anti-biofilm effects of organic acid products in different water sources are needed.

Such studies would have relevance to field conditions where organic and inorganic matter in water from different sources could influence the effect of organic acid products against pathogenic bacteria.

In this study only S. Typhimurium was used during biofilm experiments however, in commercial settings contamination of farm environment with multiple serovars is common and a serious concern worldwide (Gole et al. 2014; Im et al. 2015). Biofilm formation by mixed species is the most likely phenomenon under the conditions of harsh environment in food processing industry. Microbial communities can be formed by several species of microorganisms, such mixed species biofilm may have different susceptibility and resistance pattern towards organic acid treatment. Thus, further studies examining the activity of organic acid product against biofilm formed by consortium of microorganism are needed.

An important risk associated with incomplete removal of biofilm cells after organic acid treatment is the development of enhanced acid tolerance response in foodborne pathogens such as Salmonella. It has been shown that acid adapted S. Typhimurium were more resistant to extremely acidic conditions as compared to non-adopted populations (Berk et al. 2005; Alvarez-

Ordonez et al. 2009; Álvarez-Ordóñez et al. 2012). Development of acid tolerance in the surviving biofilm cells in the food production environment may favour their survival, growth and may also serve as a source of cross contamination or even resist subsequently applied decontamination treatments (Álvarez-Ordóñez et al. 2012). Persistence of such biofilm cells in food processing facility may compromise food safety and is a serious public health concern. In the literature there are no findings documented with regard to acid tolerance response in

Salmonella isolates that has been exposed to lethal or sub lethal concentrations of organic acids

137 on the poultry farm. Further comparative research, monitoring organic acid resistance level in

Salmonella enterica strains with or without organic acid exposure is essential.

In conclusion, our data demonstrated that there are no significant differences between isolates of Salmonella serovars in respect of inhibitory (MIC) and bactericidal (MBC) concentrations of each commercial organic acid products. Age of biofilm was not associated with increased resistance to organic acids tested in this study. Although organic acid treatment was effective in reducing viable biofilm cells, none of the organic acid product eliminated 3 or 5 day old biofilms. However, the product type, concentration, and exposure time were important factors for reduction in the number of viable biofilm cells. These findings may have future implications for use of organic acids against biofilm control in poultry industry.

Acknowledgements

Mr. Vivek Pande is a recipient of postgraduate research scholarship of The University of

Adelaide Australia.

138

5.6. References

Aarestrup, F.M. and Hasman, H. (2004) Susceptibility of different bacterial species isolated from food animals to copper sulphate, zinc chloride and antimicrobial substances used for disinfection. Vet Microbiol 100, 83-89.

Alvarez-Ordonez, A., Fernandez, A., Bernardo, A. and Lopez, M. (2009) Comparison of acids on the induction of an Acid Tolerance Response in Salmonella Typhimurium, consequences for food safety. Meat Sci 81, 65-70.

Álvarez-Ordóñez, A., Prieto, M., Bernardo, A., Hill, C. and López, M. (2012) The Acid

Tolerance Response of Salmonella spp.: An adaptive strategy to survive in stressful environments prevailing in foods and the host. Food Res Int 45, 482-492.

Anwar, H. and Costerton, J.W. (1990) Enhanced activity of combination of tobramycin and piperacillin for eradication of sessile biofilm cells of Pseudomonas aeruginosa. Antimicrob

Agents Chemother 34, 1666-1671.

Berk, P.A., Jonge, R., Zwietering, M.H., Abee, T. and Kieboom, J. (2005) Acid resistance variability among isolates of Salmonella enterica serovar Typhimurium DT104. J Appl

Microbiol 99, 859-866.

Borges, A., Saavedra, M.J. and Simoes, M. (2012) The activity of ferulic and gallic acids in biofilm prevention and control of pathogenic bacteria. Biofouling 28, 755-767.

Ceri, H., Olson, M.E., Stremick, C., Read, R.R., Morck, D. and Buret, A. (1999) The Calgary

Biofilm Device: new technology for rapid determination of antibiotic susceptibilities of bacterial biofilms. J Clin Microbiol 37, 1771-1776.

Chen, X. and Stewart, P.S. (1996) Chlorine penetration into artificial biofilm is limited by a reaction−diffusion interaction. Environ Sci Technol 30, 2078-2083.

Cherrington, C.A., Hinton, M. and Chopra, I. (1990) Effect of short-chain organic acids on macromolecular synthesis in Escherichia coli. J Appl Bacteriol 68, 69-74. 139

Chousalkar, K.K. and Roberts, J.R. (2012) Recovery of Salmonella from eggshell wash, eggshell crush, and egg internal contents of unwashed commercial shell eggs in Australia. Poult

Sci 91, 1739-1741.

Chousalkar, K.K., Sexton, M., McWhorter, A., Hewson, K., Martin, G., Shadbolt, C. and

Goldsmith, P. (2015) Salmonella Typhimurium in the Australian egg industry:

Multidisciplinary approach to addressing the public health challenge and future directions. Crit

Rev Food Sci Nutr [Epub ahead of print].

Corcoran, M., Morris, D., De Lappe, N., O'Connor, J., Lalor, P., Dockery, P. and Cormican, M.

(2014) Commonly used disinfectants fail to eradicate Salmonella enterica biofilm from food contact surface materials. Appl Environ Microbiol 80, 1507-1514.

Costerton, J.W., Lewandowski, Z., Caldwell, D.E., Korber, D.R. and Lappin-Scott, H.M.

(1995) Microbial biofilms. Annu Rev Microbiol 49, 711-745.

Cox, J.M. and Pavic, A. (2010) Advances in enteropathogen control in poultry production. J

Appl Microbiol 108, 745-755.

Donlan, R.M. and Costerton, J.W. (2002) Biofilms: survival mechanisms of cinically relevant microorganisms. Clin Microbiol Rev 15, 167-193.

Fraud, S., Maillard, J.Y., Kaminski, M.A. and Hanlon, G.W. (2005) Activity of amine oxide against biofilms of Streptococcus mutans: a potential biocide for oral care formulations. J

Antimicrob Chemother 56, 672-677.

Gilbert, P., Das, J.R., Jones, M.V. and Allison, D.G. (2001) Assessment of resistance towards biocides following the attachment of micro-organisms to, and growth on, surfaces. J Appl

Microbiol 91, 248-254.

Gole, V.C., Torok, V., Sexton, M., Caraguel, C.G. and Chousalkar, K.K. (2014) Association between the indoor environmental contamination of Salmonella with egg contamination on layer farms. J Clin Microbiol 52, 3250-3258.

140

Hendriksen, R.S., Vieira, A.R., Karlsmose, S., Lo Fo Wong, D.M., Jensen, A.B., Wegener,

H.C. and Aarestrup, F.M. (2011) Global monitoring of Salmonella serovar distribution from the World Health Organization Global Foodborne Infections Network Country Data Bank: results of quality assured laboratories from 2001 to 2007. Foodborne Pathog Dis 8, 887-900.

Hinton, M. and Linton, A.H. (1988) Control of Salmonella infections in broiler chickens by the acid treatment of their feed. Vet Rec 123, 416-421.

Iba, A.M. and Berchieri, A., Jr. (1995) Studies on the use of a formic acid-propionic acid mixture (Bio-add) to control experimental Salmonella infection in broiler chickens. Avian

Pathol 24, 303-311.

Im, M.C., Jeong, S.J., Kwon, Y.K., Jeong, O.M., Kang, M.S. and Lee, Y.J. (2015) Prevalence and characteristics of Salmonella spp. isolated from commercial layer farms in Korea. Poult Sci

94, 1691-1698.

Joseph, B., Otta, S.K., Karunasagar, I. and Karunasagar, I. (2001) Biofilm formation by

Salmonella spp. on food contact surfaces and their sensitivity to sanitizers. Int J Food Microbiol

64, 367-372.

Kim, H., Ryu, J.H. and Beuchat, L.R. (2007) Effectiveness of disinfectants in killing

Enterobacter sakazakii in suspension, dried on the surface of stainless steel, and in a biofilm.

Appl Environ Microbiol 73, 1256-1265.

Kirk, M.D., Pires, S.M., Black, R.E., Caipo, M., Crump, J.A., Devleesschauwer, B., Dopfer,

D., Fazil, A., Fischer-Walker, C.L., Hald, T., Hall, A.J., Keddy, K.H., Lake, R.J., Lanata, C.F.,

Torgerson, P.R., Havelaar, A.H. and Angulo, F.J. (2015) World Health Organization Estimates of the Global and Regional Disease Burden of 22 Foodborne Bacterial, Protozoal, and Viral

Diseases, 2010: A Data Synthesis. PLoS Med 12, e1001921.

141

Koyuncu, S., Andersson, M.G., Lofstrom, C., Skandamis, P.N., Gounadaki, A., Zentek, J. and

Haggblom, P. (2013) Organic acids for control of Salmonella in different feed materials. BMC

Vet Res 9, 81.

Long, M., Lai, H., Deng, W., Zhou, K., Li, B., Liu, S., Fan, L., Wang, H. and Zou, L. (2016)

Disinfectant susceptibility of different Salmonella serotypes isolated from chicken and egg production chains. J Appl Microbiol [Epub ahead of print].

Majowicz, S.E., Musto, J., Scallan, E., Angulo, F.J., Kirk, M., O'Brien, S.J., Jones, T.F., Fazil,

A. and Hoekstra, R.M. (2010) The global burden of nontyphoidal Salmonella gastroenteritis.

Clinl Inf Dis 50, 882-889.

McDonnell, G. and Russell, A.D. (1999) Antiseptics and disinfectants: activity, action, and resistance. Clin Microbiol Rev 12, 147-179.

Menconi, A., Reginatto, A., Londero, A., Pumford, N., Morgan, M., Hargis, B. and Tellez, G.

(2013) Effect of organic acids on Salmonella typhimurium infection in broiler chickens. Int J

Poult Sci 12, 72.

Moffatt, C.R., Musto, J., Pingault, N., Miller, M., Stafford, R., Gregory, J., Polkinghorne, B.G. and Kirk, M.D. (2016) Salmonella Typhimurium and Outbreaks of Egg-Associated Disease in

Australia, 2001 to 2011. Foodborne Pathog Dis 13, 379-385.

Møretrø, T., Heir, E., Nesse, L.L., Vestby, L.K. and Langsrud, S. (2012) Control of Salmonella in food related environments by chemical disinfection. Food Res Int 45, 532-544.

Nguyen, H.D.N., Yang, Y.S. and Yuk, H.G. (2014) Biofilm formation of Salmonella

Typhimurium on stainless steel and acrylic surfaces as affected by temperature and pH level.

Food Sci Tech 55, 383-388.

Nguyen, H.D.N. and Yuk, H.-G. (2013) Changes in resistance of Salmonella Typhimurium biofilms formed under various conditions to industrial sanitizers. Food Control 29, 236-240.

142

Nickel, J.C., Ruseska, I., Wright, J.B. and Costerton, J.W. (1985) Tobramycin resistance of

Pseudomonas aeruginosa cells growing as a biofilm on urinary catheter material. Antimicrob

Agents Chemother 27, 619-624.

OzFoodNet Working Group (2009) Monitoring the incidence and causes of diseases potentially transmitted by food in Australia: annual report of the OzFoodNet Network, 2008. Commun Dis

Intell Q Rep 33, 389-413.

OzFoodNet Working Group (2012) Monitoring the incidence and causes of diseases potentially transmitted by food in Australia: annual report of the OzFoodNet network, 2010. Commun Dis

Intell Q Rep 36, E213-241.

OzFoodNet Working Group (2015) OzFoodNet quarterly report, 1 January to 31 March 2014.

Commun Dis Intell Q Rep 39, E612-618.

Pande, V.V., McWhorter, A.R. and Chousalkar, K.K. (2016) Salmonella enterica isolates from layer farm environments are able to form biofilm on eggshell surfaces. Biofouling 32, 699-710.

Parker, D., Hofacre, C., Mathis, G., Quiroz, M., Knight, C. and Dibner, J. (2007) Organic acid water treatment effective in decreasing Salmonella colonization and horizontal transmission in broiler chickens. In Proceedings of the 16th European Symposium on Poultry Nutrition

Strasbourg, France, August. pp.26-30.

Prescott, J.F. and Baggot, J.D. (1985) Antimicrobial susceptibility testing and antimicrobial drug dosage. J Am Vet Med Assoc 187, 363-368.

Ricke, S. (2003) Perspectives on the use of organic acids and short chain fatty acids as antimicrobials. Poult Sci 82, 632-639.

Ricke, S.C. (2014) Application of molecular approaches for understanding foodborne

Salmonella establishment in poultry production. Adv Biol 2014.

Russell, J. (1992) Another explanation for the toxicity of fermentation acids at low pH: anion accumulation versus uncoupling. J Appl Bacteriol 73, 363-370. 143

Shen, Y., Stojicic, S. and Haapasalo, M. (2011) Antimicrobial efficacy of chlorhexidine against bacteria in biofilms at different stages of development. J Endod 37, 657-661.

Steenackers, H., Hermans, K., Vanderleyden, J. and De Keersmaecker, S.C.J. (2012)

Salmonella biofilms: An overview on occurrence, structure, regulation and eradication. Food

Res Int 45, 502-531.

Suci, P.A., Mittelman, M.W., Yu, F.P. and Geesey, G.G. (1994) Investigation of ciprofloxacin penetration into Pseudomonas aeruginosa biofilms. Antimicrob Agents Chemother 38, 2125-

2133.

Thompson, J.L. and Hinton, M. (1997) Antibacterial activity of formic and propionic acids in the diet of hens on Salmonellas in the crop. Br Poult Sci 38, 59-65.

Van Immerseel, F., Russell, J.B., Flythe, M.D., Gantois, I., Timbermont, L., Pasmans, F.,

Haesebrouck, F. and Ducatelle, R. (2006) The use of organic acids to combat Salmonella in poultry: a mechanistic explanation of the efficacy. Avian Pathol 35, 182-188.

Wales, A., McLaren, I., Rabie, A., Gosling, R.J., Martelli, F., Sayers, R. and Davies, R. (2013)

Assessment of the anti-Salmonella activity of commercial formulations of organic acid products. Avian Pathol 42, 268-275.

Wales, A.D., & Davies, R. H. (2011) A critical review of Salmonella Typhimurium infection in laying hens. Avian Pathol 40, 429-436.

Wales, A.D., Allen, V.M. and Davies, R.H. (2010) Chemical treatment of animal feed and water for the control of Salmonella. Foodborne Pathog Dis 7, 3-15.

Wang, H., Wu, N., Jiang, Y., Ye, K., Xu, X. and Zhou, G. (2016) Response of long-term acid stress to biofilm formation of meat-related Salmonella Enteritidis. Food Control 69, 214-220.

Watkins, S. (2006) Clean water lines for flock health. Avian Advice 8, 3-5.

Wilson, M., Patel, H. and Fletcher, J. (1996) Susceptibility of biofilms of Streptococcus sanguis to chlorhexidine gluconate and cetylpyridinium chloride. Oral Microbiol Immunol 11, 188-192. 144

Wong, H.S., Townsend, K.M., Fenwick, S.G., Maker, G., Trengove, R.D. and O'Handley, R.M.

(2010b) Comparative susceptibility of Salmonella Typhimurium biofilms of different ages to disinfectants. Biofouling 26, 859-864.

Wong, H.S., Townsend, K.M., Fenwick, S.G., Trengove, R.D. and O’Handley, R.M. (2010a)

Comparative susceptibility of planktonic and 3-day-old Salmonella Typhimurium biofilms to disinfectants. J Appl Microbiol 108, 2222-2228.

145

Table and Figure legends

Table 1. Details of commercial organic acid products used in the study.

Product Name Composition (As per the information Intended use and dose

available with the product leaflet)

A Synergistic combination of acidity- Drinking water; 0.2%

regulating salts

B Propionic acid, formic acid, ammonium Drinking water; 0.2%

propionate and ammonium formate

C Synergistic blend of free and Drinking water; 0.2%

buffered organic acids

146

Table 2. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of three commercial organic acid products against

Salmonella isolates (n=4) of representative serovars.

MIC MBC

A B C A B C Salmonella serovars producta producta producta producta producta producta

S. Agona 0.062±0.00 0.0125±0.00 0.062±0.00 0.062±0.00 0.250±0.00 0.125±0.00

S. Anatum 0.062±0.00 0.0125±0.00 0.062±0.00 0.077±0.01 0.250±0.00 0.125±0.00

S. Infantis 0.062±0.00 0.0125±0.00 0.062±0.00 0.093±0.01 0.250±0.00 0.125±0.00

S. Mbandaka 0.062±0.00 0.0125±0.00 0.062±0.00 0.077±0.01 0.250±0.00 0.125±0.00

S. Oranienburg 0.062±0.00 0.0125±0.00 0.062±0.00 0.062±0.00 0.250±0.00 0.125±0.00

S. Typhimurium 0.062±0.00 0.0125±0.00 0.062±0.00 0.062±0.00 0.250±0.00 0.125±0.00

S. Worthington 0.062±0.00 0.0125±0.00 0.062±0.00 0.093±0.01 0.250±0.00 0.125±0.00 a MIC or MBC values for each organic acid product in the respective column do not differ significantly between the isolates of Salmonella serovars. Values of MIC and MBC are the concentrations of organic acid product associated with inhibition or elimination of Salmonella growth and are expressed as Mean±SEM (n=4 Salmonella isolates of each serovar).

147

Figure 1. Recovery of viable biofilm cells at day 3 and day 5 after exposure to organic acid product A. 3 and 5 day old S. Typhimurium biofilms exposed for 30 or 90 min to 0.2 or 0.4% concentration of organic acid and cells were enumerated. A significant reduction in viable biofilm cells from 5 day old biofilms was observed after 30 min exposure to product A at 0.2% concentration whereas 90 minute exposure has significantly reduced the viable biofilm cells from 3 and 5 day old biofilms. Product A at 0.4% concentration significantly reduced viable cells from 3 and 5 day biofilms at all exposure times. Data are presented as Mean log10 CFU peg-1 ± SEM from two independent experiments with three replicates for each Salmonella isolate (n=4). Asterisks (*) indicate statistically significant differences (P<0.05, ANOVA) in comparison with control biofilms of corresponding day.

Figure 2. Recovery of viable biofilm cells at day 3 and day 5 after exposure to organic acid product B. 3 and 5 day old S. Typhimurium biofilms exposed for 30 or 90 min at 0.2 or 0.4% concentration of organic acid and cells were enumerated. No significant differences in the recovery of viable biofilm cells were observed from 3 and 5 day old biofilms at all exposure

-1 times and concentrations of product B. Data are presented as Mean log10 CFU peg ± SEM from two independent experiments with three replicates for each Salmonella isolate (n=4).

Figure 3. Recovery of viable biofilm cells at day 3 and day 5 after exposure to organic acid product C. 3 and 5 day old S. Typhimurium biofilms exposed for 30 or 90 min to 0.2 or 0.4% concentration of organic acid and cells were enumerated. No significant reduction in viable biofilm cells was observed from 3 and 5 day old biofilms after 30 min exposure at 0.2% concentration of product C whereas 90 minute exposure has significantly reduced the viable biofilm cells from 5 day old biofilm only. Product C at 0.4% concentration significantly reduced viable cells from 5 day biofilm only at 30 min exposure however, 90 min exposure has significantly reduced viable cells from 3 and 5 day old biofilms. Data are presented as Mean

-1 log10 CFU peg ± SEM from two independent experiments with three replicates for each 148

Salmonella isolate (n=4). Asterisks (*) indicate statistically significant differences (P<0.05,

ANOVA) in comparison with control biofilms of corresponding day.

149

Figure 1.

150

Figure 2.

151

Figure 3.

152

CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS

153

Foodborne disease can have a variety of etiological agents, including bacteria, viruses, parasites, prions, as well as chemicals or natural toxins. Amongst bacteria, Bacillus,

Campylobacter, Clostridium, Escherichia, Salmonella, and Staphylococcus are some of the common bacterial foodborne pathogens and are responsible for a significant proportion of gastrointestinal infections in humans. In Australia, Salmonella enterica infections are the second most prevalent cause of foodborne illness after Campylobacter. It is estimated that gastric illness caused by non-typhoidal Salmonella spp accounts for 93.8 million cases and

155,000 deaths worldwide each year (Majowicz et al., 2010). Infection with Salmonella is a public health and financial burden for both industrialised and non-industrialised countries.

Humans acquire non-typhoidal Salmonella through consumption of contaminated food items such as pork, meat, milk, fruits, vegetables, as well as egg, and egg products (Hur et al., 2012).

In Australia, the majority of human disease outbreaks of non-typhoidal salmonellosis are associated with consumption of contaminated raw or undercooked egg or egg-based products.

Salmonella Typhimurium (S. Typhimurium) is the most frequently isolated organism during outbreak investigations (OzFoodNet Working Group, 2012, 2015) and has been identified as the causative agent for 150 (90%) of the 166 egg associated outbreaks reported between 2001 and 2011(Moffatt et al., 2016).

On farm intervention strategies including biosecurity, vaccination, organic acids, egg washing, as well as cleaning and disinfection, have been implemented worldwide to reduce the risk of

Salmonella within the food supply chain. The emergence of antimicrobial resistant Salmonella strains and the decreased susceptibility of Salmonella biofilms to antimicrobials remain major obstacles in controlling these bacteria. In this thesis, the antibacterial sensitivity of S. enterica spp recovered from Australian egg farm environments, the reproductive organ colonisation and egg contamination by Salmonella after oral infection in layers, the role of biofilms in transmission of Salmonella infection and in-vitro susceptibility of biofilms to commercial organic acid products were investigated. 154

Rate of antimicrobial resistance (AMR) in Australian layer farm isolates

Antimicrobial resistance in Salmonella and its adverse effects on public health is a major focus of scientific research at both national and international levels. Indiscriminate use of antimicrobial agents in human and veterinary medicine favours the emergence of antimicrobial resistant strains of Salmonella. In Australia, antimicrobial resistance surveillance data in

Salmonella isolates from broilers is available (Page, 2009), however, such data from layer farm related isolates is very limited.

One of the first Australian studies characterising phenotypic and genotypic AMR of S. enterica isolates recovered from commercial cage-egg farm environments is described in Chapter 2.

Results of this study showed low prevalence of AMR and the majority of Salmonella isolates

(91.72%) were susceptible to antimicrobials. The low prevalence of AMR in Salmonella isolates is an encouraging finding from the perspective of the egg industry and public health.

These data are consistent with previous work, which demonstrated low levels of AMR among clinical Salmonella isolates isolated from Australian food animals (Abraham et al., 2014). A finding of significant importance is the absence of isolates resistant to fluoroquinolones and extended-spectrum cephalosporins, which are commonly used drugs for severe and systemic human salmonellosis. The low rate of antimicrobial resistance observed in this study is an outcome of a conservative approach to registration of new antimicrobial agents, high-quality poultry production standards and prudent selection of use of antimicrobial agents in the industry

(Page, 2009). In comparison to other countries, Australia has strict regulations on antibiotic usage in food animals. The use of fluoroquinolones is not permitted in layer birds or other food- producing animals. As a result, no resistance to fluoroquinolones has been previously detected in Salmonella isolates from Australian food animals (Abraham et al., 2014; Barton, 2010).

Other factors such as Australia’s geographical location, quarantine regulations and the minimum level of human contact or exposure to food animals, significantly contributes to restricting the emergence of antimicrobial resistance in Salmonella strains.

155

Antibiotic resistance genes are ubiquitous in nature and confer resistance to antibiotics.

Bacteria can acquire antibiotic resistance genes through either spontaneous mutations or exchange of genetic material between bacteria. In this study, 4.83 % (7/145) S. enterica isolates harboured antimicrobial resistance genes and class 1 integron. The presence of resistant genes with integron indicates that some genes are carried on transferable mobile gene cassettes placed either on chromosomal DNA or on plasmids (Carattoli, 2003; Carattoli et al., 2005; Levings et al., 2005). Although the distribution of antimicrobial resistance genes and integron 1 amongst

Salmonella isolates was low, this could be a serious concern. These mobile genetic elements have the potential to transfer or acquire resistance determinant into the genome of other bacterial populations, if antibiotic selection pressure is further intensified.

This study was limited in part due to the inclusion of Salmonella isolates from egg farms located within two Australian states. In order to address the issue of antimicrobial resistance, a national screening of Salmonella isolates from multiple egg farms is required. Continuous AMR surveillance monitoring is also essential for tracking the distribution of antimicrobial resistance in the Australian egg industry. Although antimicrobial resistance in Salmonella spp isolated from egg farms is low, public health authorities, the egg industry, and the general community often express concerns about the risk of egg contamination and egg related disease outbreaks.

Reproductive organ colonisation and egg contamination by S. Typhimurium after oral infection in laying hens

The ability of S. Typhimurium to colonise reproductive organs and contaminate eggs have been examined previously, however, the results from these studies are inconsistent. In addition, there is limited data on the long term faecal shedding of S. Typhimurium. Given the increase in a number of egg-associated outbreaks in Australia (OzFoodNet Working Group, 2012; Moffatt et al., 2016), there is no conclusive information on the precise mode of egg contamination by

S. Typhimurium. In this study, S. Typhimurium phage type 9 (PT9) with multi locus variable tandem repeat analysis (MLVA) profile 03-24-11-11-523 was chosen based on its frequent 156 involvement in human food poisoning outbreaks. In South Australia during 2011, S.

Typhimurium PT9 with MLVA profile 03-24-11-11-523 was most frequently been associated with food poisoning cases associated with egg or egg related products.

Experimental Salmonella infection of commercial laying hens in a controlled environment is an effective method to study the reproductive organ invasion and subsequent egg contamination. Such studies are however, expensive, and labour intensive. Furthermore, it is difficult to maintain Salmonella free birds over prolonged period of time. In experiment 2

(outlined in chapter 3), layer hens were orally challenged with S. Typhimurium PT9 to investigate long-term bacterial shedding in the faeces, oviduct colonisation, and egg contamination. Shedding in faeces was high up to 5 weeks post infection (p.i.), but persisted up to 15 weeks p.i. The increased Salmonella shedding in faeces observed up to 5-week p.i. was attributed to stress associated with the onset of lay. The results of previous field (Gole et al.,

2014a) and experimental infection studies (Okamura et al., 2010) indicated that sexual maturity or onset of lay was associated with increased Salmonella shedding and egg contamination.

The present study examined Salmonella shedding and egg contamination for 15-week p.i.

Commercial laying hens, however, have an extended productive cycle (up to 70-80 weeks) and may experience many physical or environmental conditions that could induce stress such as, onset of lay/ sexual maturity, transportation, farm management, induced moulting, extreme environmental variations, or concurrent infections (Gole et al., 2014b; Humphrey, 2004). Stress caused by these conditions could increase colonisation of Salmonella in the gut, and favour the translocation of Salmonella to the reproductive tract, where contamination of eggs could occur during formation (Burkholder et al., 2008). Therefore, extending the research beyond 15 weeks would give more information about S. Typhimurium shedding and egg contamination in response to various stress events in laying hens during their productive lifespan. It is also important to note that such long-term studies are expensive and laborious. Previous studies have shown that stress caused by induced molt or feed restriction markedly increases the level 157 of corticosteroids hormones (Freeman et al., 1981; Harvey & Klandorf, 1983) and decreases the cell-mediated immunity, resulting in decrease in the number of CD4 T lymphocytes (Holt,

1992a, 1992b). The mechanism of stress was not investigated during this study, hence further research should be directed to study the level of stress hormones, immune response, its influence on Salmonella shedding and subsequent egg contamination in laying hens.

S. Typhimurium PT9 colonised the reproductive organs and caused eggshell contamination over the course of the experiment, however, no bacteria were isolated from the egg internal contents (albumen and yolk). These findings imply that horizontal transmission/ external soiling of shell eggs with faeces, or contamination from the layer farm environment, is the likely route of egg contamination for the S. Typhimurium PT 9 isolate used in this study. Other factors such as poor egg handling and hygienic measures, undercooking and cross- contamination of other food products during food preparation could increase the likelihood of foodborne outbreaks in humans. The eggshell contamination observed in this study indicates that intensive efforts to minimise Salmonella contamination pressure at the primary production level are required to mitigate the high number of egg-associated disease outbreaks. The results of this study will help educate regulators and commercial food providers to recognise the risk of eggshell contamination and strictly adhere to the food safety standard associated with egg handling in a food-processing environment.

The colonisation of reproductive organs can lead to internal egg contamination prior to oviposition (Gantois et al., 2009). In this study, although S. Typhimurium was able to persist in the reproductive organs, it remains unclear why it was unable to contaminate the internal egg contents. The egg itself possesses several antibacterial properties. Antibacterial compounds within egg albumen such as lysozyme, ovotransferin, ovomucoid, ovoinhibitors, cystatin, ovostain, β-defensins, and immunoglobulins have shown to inhibit the growth of Salmonella spp (Gantois et al., 2009). The results of an in vitro egg penetration study revealed that S.

Typhimurium at 20°C was able to penetrate the eggshell and survive in egg internal contents 158 after 21 days of infection (Gole et al., 2014c). The successful survival of S. Typhimurium in egg albumen in that study may be due to deterioration of egg albumen's antimicrobial activity during storage period of 21 days. Hence, it could be concluded that the S. Typhimurium PT9 isolate used in this study was not able to survive in the fresh albumen in vivo.

Another possible explanation for the failure of S. Typhimurium to contaminate egg internal content (even after colonisation of oviduct) could be lack of the Regions of difference (ROD) in S. Typhimurium genome. Previously it has been demonstrated that ROD 9, 21, and 40 plays an important role in chicken reproductive tract colonization (Raspoet et al., 2014). These ROD's are present in S. Enteritidis but not in S. Typhimurium (Thomson et al., 2008). It could be hypothesised that the inability of S. Typhimurium to survive in fresh egg albumen resulted from the lack of ROD’s. However, further, microarray based experiments are essential to confirm this hypothesis.

There are several genes that are important for persistence of Salmonella in the chicken reproductive tract. Previous studies have identified the genes using in vivo expression technology (Gantois et al., 2008) and genome wide microarray based transposon library

(Raspoet et al., 2014). The results of these studies demonstrated virulence genes within

Salmonella Pathogenicity Islands (SPI)-1, 2, and 3, involved in amino acid synthesis, nucleic acid metabolism, motility, cell wall integrity, virulence plasmid and stress responses were induced during oviduct colonisation and egg contamination with S. Enteritidis (Gantois et al.,

2008; Raspoet et al., 2014). Further mechanistic research is required to unveil the role of these genes during oviduct colonisation and egg contamination by S. Typhimurium. Such information could improve our understanding of the underlying molecular mechanism behind S.

Typhimurium colonisation in the oviduct of laying hens.

159

Role of Salmonella biofilms in food safety

Despite pre- and post-production control measures, including biosecurity, sanitation, vaccination, organic acids, and egg washing, residual Salmonella contamination of the layer farm environment remains a major challenge for the poultry industry. The formation of biofilm is a mechanism utilised by the Salmonella spp for survival in harsh physical and chemical environments. Biofilm formation is influenced by several factors such as Salmonella serovar, bacterial strain, as well as environmental conditions. Bacterial cells in a biofilm are resistant to commonly used antimicrobials, hence their eradication from food preparation surfaces from domestic and industrial settings is difficult. Eggshell biofilm formation by Salmonella poses a significant risk of cross-contamination of other food items prepared in a kitchen environment and biofilm cells may become a source of human infections.

In Chapter 4, Salmonella isolates (n=145) from seven representative serovars, S. Agona, S.

Anatum, S. Infantis, S. Mbandaka, S. Oranienburg, S. Typhimurium and S. Worthington were examined for their ability to form biofilms at two different temperatures (22 and 37°C), using crystal violet and Congo red assay. These serovars were isolated from a commercial layer farm environment and some of them have been associated with egg related outbreaks of food poisoning (Glass et al., 2016; Gole et al., 2014a; Gole et al., 2014b). This study showed that biofilm-forming behaviour was significantly influenced by temperature and Salmonella strains.

Biofilm formation was higher at 22°C compared to 37°C. Furthermore, curli fimbriae and cellulose, major components of biofilm matrix, contribute to biofilm formation at ambient temperature (22°C). The ability of Salmonella serovars to form biofilm at ambient temperature

(22°C) is of particular interest to the poultry industry because commercial layer sheds are usually maintained at similar temperature. Survival and biofilm formation by Salmonella at ambient temperature may increase the risk of food contamination and human Salmonella infections.

160

It was further hypothesized that Salmonella spp possesses the ability to attach, remain viable, and form biofilms on eggshell surface. Representative isolates of Salmonella serovars (S.

Agona, S. Anatum, S. Infantis, S. Mbandaka, S. Oranienburg, S. Typhimurium, and S.

Worthington) were examined for their ability to attach and form biofilms on eggshell at ambient temperature (22°C). The results demonstrated that Salmonella spp are able to attach and form biofilm, however, this behaviour was significantly influenced by Salmonella strains. The molecular mechanism underlying biofilm formation revealed that the key genes (adrA, bapA, csgA and csgD) involved in the production of curli fimbriae and cellulose were induced during eggshell biofilm formation. Scanning electron microscopy examination of the eggshell revealed a dense layer of biofilm cells encapsulated in an extracellular matrix. These results suggest that biofilm is one of the likely mechanisms Salmonella utilises to persist on eggshell. In this study, limited isolates of Salmonella serovars were examined for their ability to form biofilms on eggshell, making it difficult to ascertain serovar-specific differences. Future investigation including large number of isolates of representative serovars is required. Although the results of the current study indicate that S. enterica isolates are able to form biofilms at 22 °C, this study did not examine such behaviour at refrigeration temperature, which is commonly used to store eggs in supermarkets and consumer households. To our knowledge, this is the first report describing biofilm formation on eggshells.

Anti-bacterial and anti-biofilm activity of organic acids against S. enterica spp

Complete eradication of Salmonella on farm and through the food supply chain is unlikely.

Improved food safety practises, hygiene, and antimicrobial strategies will, however, help to reduce the risk of Salmonella contamination. Several intervention strategies have been employed to reduce Salmonella contamination at farm level and during food supply chain. In

Australia, organic acids are commonly used in feed and water to prevent Salmonella contamination. Given the differences in composition and the active ingredients of commercial

161 organic products, their inhibitory and bactericidal activity may differ between products.

Moreover, the activity of commercial organic acid products against Salmonella biofilm is unclear.

The experiments described in Chapter 5 sought to identify inhibitory and bactericidal concentrations of three commercial organic acid products against representative isolates of

Salmonella serovars. In addition, susceptibility of S. Typhimurium biofilms to organic acid products was characterised using high throughput MBEC™ assay. The results of this experiment showed no significant differences between isolates of representative Salmonella serovars with respect to inhibitory and bactericidal dilutions of each product. However, wide variations in inhibitory and bactericidal effects between products were evident. Of the organic acid products evaluated in this study, two products were able to reduce viable cells in the biofilm of all ages in a dose and time- dependent manner. In general, higher concentration and increased contact time with organic acid were critical to prevent the growth of biofilm- associated cells. There is a general consensus that older biofilms are more resistant to antimicrobials than younger biofilms. In contrast to earlier research, this study demonstrated that older biofilms (Day 5) were not more resistant than younger biofilms (Day 3) to organic acid treatments. The product type, concentration, and exposure time were identified as important parameters in the successful reduction of viable biofilm cells. Organic acid products, however, even at twice the recommended user concentration were unable to completely eradicate biofilm cells. The incomplete removal of biofilms may favour the bacterial persistence and as a result, their eradication becomes more difficult from both domestic and commercial settings.

The repeated exposure of Salmonella biofilms cells to lethal or sub-lethal concentrations of organic acid during routine sanitation process may give rise to increased organic acid tolerance or development of acid tolerance response. The emergence and dissemination of acid resistant

Salmonella strains could compromise the control of Salmonella and pose a significant public health risk. The extracellular matrix is an important constituent of biofilm, as it acts as a 162 chemical and mechanical barrier and prevents the diffusion of active products. Although this study did not elucidate the mechanism of increased resistance of S. Typhimurium biofilm to organic acid treatments, the scanning electron microscopic examination of eggshell biofilm support the hypothesis that extracellular matrix of the biofilm could protect the cells against the action of organic acids.

Organic acid products marketed in the poultry industry for use in drinking water were evaluated in this study. However, the activity of organic acid products known to differ considerably depending on the type of water source. The previous study has shown substantial anti-

Salmonella activity of commercial organic acid products in tap water in comparison with river or mineral water (Wales 2013). In this study, organic acid products were diluted in tap water and screened against the biofilm activity however, further studies on the anti-biofilm activity of organic acid products in different water sources are needed. Such studies will be relevant to field conditions where organic and inorganic matter in the water from different sources could vary and influence the effect of organic acids against pathogenic bacteria.

In both domestic and commercial settings, multiple species of zoonotic bacteria can attach, survive, and form biofilms on abiotic surfaces. However, it has not yet been determined whether interactions between members of bacterial community in the biofilm influence the virulence, susceptibility, and resistance towards antimicrobial agents. Further studies on the activities of organic acid against biofilm formed by the consortium of microorganism are needed.

Conclusions

The major conclusions of this thesis are that S. enterica isolates recovered from layer farm environments exhibited low frequency of antimicrobial resistance and presents a low public health risk associated with the emergence of multidrug resistant Salmonella spp isolated from

Australian egg industry. Although S. Typhimurium PT9 was able to colonise the reproductive organs and contaminate eggshell, throughout the study, S. Typhimurium was not isolated from 163 the egg internal contents. This data indicate that horizontal transmission is the main route of egg contamination with S. Typhimurium PT9 in laying hens. S. enterica isolates were able to attach and form biofilm on eggshell surface at 22°C however, biofilm-forming behaviour was significantly influenced by temperature and Salmonella strains. The inhibitory and bactericidal dilutions of each commercial organic acid products did not differ between representative isolates of Salmonella serovars. Organic acid treatment was effective in reducing viable biofilm cells, but none of the product eradicated the viable cells from 3 or 5 day old biofilms. The age of biofilms was not associated with resistance towards organic acid treatments. However, organic acid products, exposure time, and concentration were critical factors for the reduction in the number of viable biofilm cells. The results of these studies may assist in highlighting the risks of Salmonella contamination and developing policies to mitigate the risk. Intervention strategies to control Salmonella is not limited to farm level, but the collaborative efforts from public, food industry and regulatory authorities are essential for the control of Salmonella throughout the food supply chain.

164

References

Abraham, S., Groves, M. D., Trott, D. J., Chapman, T. A., Turner, B., Hornitzky, M., et al.

(2014). Salmonella enterica isolated from infections in Australian livestock remain

susceptible to critical antimicrobials. International Journal of Antimicrobial Agents,

43(2), 126-130.

Barton, M. D. (2010). Antibiotic resistance in Australian animals in 2010–what lies ahead?

Paper presented at the APVMA Science Fellows Symposium.

Burkholder, K. M., Thompson, K. L., Einstein, M. E., Applegate, T. J., & Patterson, J. A.

(2008). Influence of stressors on normal intestinal microbiota, intestinal morphology,

and susceptibility to Salmonella enteritidis colonization in broilers. Poultry Science,

87(9), 1734-1741.

Carattoli, A. (2003). Plasmid-mediated antimicrobial resistance in Salmonella enterica. Current

Issues in Molecular Biology, 5(4), 113-122.

Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K. L., & Threlfall, E. J. (2005).

Identification of plasmids by PCR-based replicon typing. Journal of Microbiological

Methods, 63(3), 219-228.

Freeman, B. M., Manning, C. C., & Flack, I. H. (1981). The effects of restricted feeding on

adrenal cortical activity in the immature domestic fowl. British Poultry Science, 22(3),

295-303.

Gantois, I., Ducatelle, R., Pasmans, F., Haesebrouck, F., Gast, R., Humphrey, T. J., et al. (2009).

Mechanisms of egg contamination by Salmonella Enteritidis. FEMS Microbiology

Reviews, 33(4), 718-738.

Gantois, I., Ducatelle, R., Pasmans, F., Haesebrouck, F., & Van Immerseel, F. (2008).

Salmonella enterica serovar Enteritidis genes induced during oviduct colonization and

egg contamination in laying hens. Applied and Environmental Microbiology, 74(21),

6616-6622.

165

Glass, K., Fearnley, E., Hocking, H., Raupach, J., Veitch, M., Ford, L., et al. (2016). Bayesian

source attribution of salmonellosis in South Australia. Risk Analysis, 36(3), 561-570.

Gole, V. C., Caraguel, C. G., Sexton, M., Fowler, C., & Chousalkar, K. K. (2014a). Shedding

of Salmonella in single age caged commercial layer flock at an early stage of lay.

International Journal of Food Microbiology, 189, 61-66.

Gole, V. C., Torok, V., Sexton, M., Caraguel, C. G., & Chousalkar, K. K. (2014b). Association

between the indoor environmental contamination of Salmonella with egg contamination

on layer farms. Journal of Clinical Microbiology, 52(9), 3250-3258.

Gole, V. C., Chousalkar, K. K., Roberts, J. R., Sexton, M., May, D., Tan, J., et al. (2014c).

Effect of egg washing and correlation between eggshell characteristics and egg

penetration by various Salmonella Typhimurium strains. PloS One, 9(3), e90987.

Harvey, S., & Klandorf, H. (1983). Reduced adrenocortical function and increased thyroid

function in fasted and refed chickens. Journal of Endocrinology, 98(1), 129-135.

Holt, P. S. (1992a). Effect of induced molting on B cell and CT4 and CT8 T cell numbers in

spleens and peripheral blood of White Leghorn hens. Poultry Science, 71(12), 2027-

2034.

Holt, P. S. (1992b). Effects of induced moulting on immune responses of hens. British Poultry

Science, 33(1), 165-175.

Humphrey, T. (2004). Salmonella, stress responses and food safety. Nature Reviews:

Microbiology, 2(6), 504-509.

Hur, J., Jawale, C., & Lee, J. H. (2012). Antimicrobial resistance of Salmonella isolated from

food animals: A review. Food Research International, 45(2), 819-830.

Levings, R. S., Lightfoot, D., Partridge, S. R., Hall, R. M., & Djordjevic, S. P. (2005). The

genomic island SGI1, containing the multiple antibiotic resistance region of Salmonella

enterica serovar Typhimurium DT104 or variants of it, is widely distributed in other S.

enterica serovars. Journal of Bacteriology, 187(13), 4401-4409.

166

Majowicz, S. E., Musto, J., Scallan, E., Angulo, F. J., Kirk, M., O'Brien, S. J., et al. (2010). The

global burden of nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases,

50(6), 882-889.

Moffatt, C. R., Musto, J., Pingault, N., Miller, M., Stafford, R., Gregory, J., et al. (2016).

Salmonella Typhimurium and outbreaks of egg-associated disease in Australia, 2001 to

2011. Foodborne Pathogens and Disease, 13(7), 379-385.

Okamura, M., Sonobe, M., Obara, S., Kubo, T., Nagai, T., Noguchi, M., et al. (2010). Potential

egg contamination by Salmonella enterica serovar Typhimurium definitive type 104

following experimental infection of pullets at the onset of lay. Poultry Science, 89(8),

1629-1634.

OzFoodNet Working Group. (2012). Monitoring the incidence and causes of diseases

potentially transmitted by food in Australia: annual report of the OzFoodNet network,

2010. Communicable Diseases Intelligence Quarterly Report, 36(3), E213-241.

OzFoodNet Working Group. (2015). OzFoodNet quarterly report, 1 January to 31 March 2014.

Communicable Diseases Intelligence Quarterly Report, 39(4), E612-618.

Page, S. (2009). Antimicrobial resistance in Australian broilers: Summary. Berry NSW:

Australian Chicken Meat Federation.

Raspoet, R., Appia-Ayme, C., Shearer, N., Martel, A., Pasmans, F., Haesebrouck, F., et al.

(2014). Microarray-based detection of Salmonella enterica serovar Enteritidis genes

involved in chicken reproductive tract colonization. Applied and Environmental

Microbiology, 80(24), 7710-7716.

Thomson, N. R., Clayton, D. J., Windhorst, D., Vernikos, G., Davidson, S., Churcher, C., et al.

(2008). Comparative genome analysis of Salmonella Enteritidis PT4 and Salmonella

Gallinarum 287/91 provides insights into evolutionary and host adaptation pathways.

Genome Research, 18(10), 1624-1637.

167