US00880.8992B2

(12) United States Patent (10) Patent No.: US 8,808,992 B2 Gelb et al. (45) Date of Patent: Aug. 19, 2014

(54) SHOC2 MUTATIONS CAUSING FOREIGN PATENT DOCUMENTS NOONAN-LIKE SYNDROME WITH LOOSE f WO WOO3O29422 4, 2003 ANAGENHAIR WO WO2007 1064O7 9, 2007 WO WO2O08022335 2, 2008 (75) Inventors: Bruce D. Gelb, Dobbs Ferry, NY (US); WO WO2O08061239 5, 2008 Marco Tartaglia, Rome (IT): Len OTHER PUBLICATIONS Pennacchio, Berkeley, CA (US); Ravi Iyengar, Mohegan Lake, NY (US); Avi The nucleic acid sequence search report, AC AEL87058 searched s s s Jan. 14, 2013.* Ma'ayan, New York, NY (US) International Search Report PCT/US/2010/033924 dated Jul. 14, 2010. (73) Assignees: Icahn School of Medicine at Mount Schubbert, S., et al., Hyperactive Ras in developmental disorders and Sinai, New York, NY (US): The Regents cancer. Nature Reviews Cancer, vol. 7, pp. 295-308 (2007). s s (US); g Tartaglia, M., et I Molecular h of Noonan syndrome. In: th risis of California, Zenker M. (ed.), Noonan Syndrome and Related Disorders. Mono and, (US) graphs in Human Genetics, Basel, Karger, vol. 17, pp. 1-20 (2008). Tosti, A., et al., Loose anagen hair in a child with Noonan's Syn (*) Notice: Subject to any disclaimer, the term of this drome. Dermatologica, vol. 182, pp. 247-249 (1991). patent is extended or adjusted under 35 Tartaglia, M., et al., Gain-of-function SOS1 mutations cause a dis U.S.C. 154(b) by 736 days tinctive form of Noonan syndrome. Nature Genetics, vol. 39, pp. M YW- y yS. 75-79 (2007). Cordeddu, V., et al., Mutation of SHOC2 promotes aberrant protein (21) Appl. No.: 12/775,396 N-myristoylation and causes Noonan-like syndrome with loose anagen hair. Nature Genetics, vol. 41 (9), pp. 1022-1026 (2009). 1-1. MaZZanti, L., et al., Noonan-like syndrome with loose anagen hair: a (22) Filed: May 6, 2010 new syndrome'? American Journal of Medical Genetics, vol. 118A (3), pp. 279-286, (2003). (65) Prior Publication Data EMBL Online database accession No. CD743751 (Jun. 29, 2004), IRB1 04 B04 IRB1 04 030 Infected Rat Blood-fed (IRB) US 2011 FOO59851A1 Mar. 10, 2011 Angam.30hr Abdomen Libary Anopheles gambiae cDNA5, mRNA Sequence. U.S. Appl. No. 60/662,410, filed Mar. 16, 2005, Johnson et al. O O U.S. Appl. No. 60/773,847, filed Feb. 16, 2006, Johnson et al. Related U.S. Application Data U.S. Appl. No. 60/855,308, filed Oct. 31, 2006, Chicoine et al. (60) Provisional application No. 61/215.568, filed on May U.S. Appl. No. 60/940,567, filed May 29, 2007, Chicoine et al. 6, 2009 Bibliographic data of Chilean Patent No. 200600559, dated Mar. 9. s 2007. Bibliographic data of Chilean Patent No. 200703064, dated May 16, (51) Int. Cl. 2008. CI2O I/68 (2006.01) Office action issued Sep. 5, 2012, in Chilean Patent Application No. C07K5/00 (2006.01) 3369-2008. (52) U.S. Cl. k . USPC ...... 435/6.12:530/300: 530/350 cited by examiner (58) Field of Classification Search Primary Examiner — Kenneth R. Horlick USPC ...... 530/300,350, 435/6.12 Assistant Examiner — Joyce Tung See application file for complete search history. (74) Attorney, Agent, or Firm — Fish & Richardson P.C. (57) ABSTRACT (56) References Cited The present invention is directed to methods of diagnosing Noonan-like syndrome with loose anagen hair comprising U.S. PATENT DOCUMENTS detecting a mutation in SHOC2 gene. One specific diagnostic 6.045.996 A 4/2000 Croninet al. mutation disclosed is an A-to-G transition at position 4 result 6,506,889 B1 1/2003 Han et al. ing in a mutation at position 2 of SHOC2 amino acid sequence 7,335,469 B2 2/2008 Gelb et al. from serine to glycine. The invention also provides related 7,928,296 B2 4/2011 Chicoine et al. sequences and kits. 2006/0246470 A1* 1 1/2006 Fuqua et al...... 435/6 C 2007/0134655 A1 6, 2007 Bentwich 21 Claims, 11 Drawing Sheets U.S. Patent US 8,808,992 B2

s

×××××××××××********

^^^****

U.S. Patent Aug. 19, 2014 Sheet 2 of 11 US 8,808,992 B2

U.S. Patent Aug. 19, 2014 Sheet 3 of 11 US 8,808,992 B2

?eolae ***** U.S. Patent Aug. 19, 2014 Sheet 4 of 11 US 8,808,992 B2

U.S. Patent Aug. 19, 2014 Sheet 5 of 11 US 8,808,992 B2

& &

: &

8

:

: : : U.S. Patent Aug. 19, 2014 Sheet 6 of 11 US 8,808,992 B2

whole lysates P. anti-Bye

... anti-viyo

wie lysates : anti-vs

8. 3.8

FG. 3B

X: 8::::::::::::::: U.S. Patent Aug. 19, 2014 Sheet 7 of 11 US 8,808,992 B2

? U.S. Patent Aug. 19, 2014 Sheet 8 of 11 US 8,808,992 B2

F.G. 5 U.S. Patent Aug. 19, 2014 Sheet 9 of 11 US 8,808,992 B2

&

&

:

8 U.S. Patent Aug. 19, 2014 Sheet 10 of 11 US 8,808,992 B2

& U.S. Patent Aug. 19, 2014 Sheet 11 of 11 US 8,808,992 B2

US 8,808,992 B2 1. 2 SHOC2 MUTATIONS CAUSING Noonan-like syndrome with loose anagen hair refers to NOONAN-LIKE SYNDROME WITH LOOSE disorders described under Online Mendelian Inheritance in ANAGENHAIR Man database of John Hopkins University Accession No. OMIM 607721. Commonly, Noonan-like syndrome with This application claims priority from U.S. Provisional loose anagen hair is characterized by one or more of the Application No. 61/215.568, filed May 6, 2009, which is following phenotypic features: short stature, certain facial hereby incorporated by reference in its entirety. phenotype including high forehead, hypertelorism, palpebral ptosis and low-set and posteriorly rotated ears, macrocephaly, GOVERNMENT SPONSORED RESEARCHOR enlarged cerebral spinal fluid spaces, short neck with redun DEVELOPMENT 10 dant skin, severe growth hormone (GH) deficiency, mild psy chomotor delay with attention deficit/hyperactivity disorder This invention was made with government Support under (ADHD), mild dilatation of the pulmonary root, ectodermal grants 5R01 HL71207, HD01294 and HL074728 awarded by abnormalities such as ichthyosis, darkly pigmented and hair the National Institutes of Health. The government has certain less skin, and the unusual aspect of the hair, defined as loose rights in the invention. 15 anagen hair syndrome. Reviewed in MaZZanti et al., Am J Med Genet A. 2003, 118A:279-286. SEQUENCE LISTING The clinical diagnosis of NS and related disorders such as Noonan-like syndrome with loose anagen hair depends on The instant application contains a Sequence Listing which recognition of the symptoms by a knowledgeable doctor. has been submitted via EFS-Web and is hereby incorporated Nevertheless, Substantial phenotypic variations, including by reference in its entirety. Said ASCII copy, created on Nov. mild or subtle cases, make the diagnosis difficult. Further 2, 2010, is named 27527-0064001.txt, and is 18,828 bytes in more, the facial characteristics become less apparent with size. progressing age, so the condition will sometimes remain undiagnosed. No genetic test is currently available for diag TECHNICAL FIELD OF THE INVENTION 25 nosing Noonan-like syndrome with loose anagen hair. Fur thermore, currently available genetic tests for diagnosing NS The present invention is directed to methods of diagnosing (detecting mutations in PTPN11 and KRAS) account for only Noonan-like syndrome with loose anagen hair comprising 50% of patients suspected of having NS. Therefore, there detecting a mutation in SHOC2 gene. One specific diagnostic remains a great need for more specific (e.g., genetic) diag mutation disclosed is an A-to-G transition at position 4 result 30 nostics of Noonan-like syndrome with loose anagen hair and ing in a mutation at position 2 of SHOC2amino acid sequence other NS-related diseases. from serine to glycine. The invention also provides related sequences and kits. SUMMARY OF THE INVENTION

BACKGROUND OF THE INVENTION 35 AS specified above, there remains a great need for more specific (e.g., genetic) diagnostics of Noonan-like syndrome Dysregulation of the RAS-MAPK signalling pathway has with loose anagen hair and other NS-related diseases. recently been recognized as the molecular cause underlying a The present invention addresses these and other needs by group of clinically related developmental disorders with fea providing a novel method for diagnosing Noonan-like Syn tures including reduced postnatal growth, facial dysmor 40 drome with loose anagen hair in a human Subject, comprising phism, cardiac defects, ectodermal anomalies, variable cog detecting a mutation in a SHOC2 nucleic acid molecule from nitive deficits and susceptibility to certain malignancies. the subject, wherein the mutation results in a SHOC2 protein These Mendelian traits, including Noonan, LEOPARD, car comprising a glycine (Gly) Substitution at position 2 of the diofaciocutaneous and Costello syndromes, neurofibromato SHOC2 amino acid sequence, and wherein the presence of sis type 1 and related phenotypes, are caused by mutations in 45 said mutation in said SHOC2 nucleic acid molecule is diag genes encoding RAS proteins (KRAS and HRAS), down nostic of Noonan-like syndrome with loose anagen hair in stream transducers (RAF1, BRAF, MEK1 and MEK2), or said human Subject. pathway regulators (PTPN11, SOS1, NF1 and SPRED1). For According to the method of the invention, such diagnostic Noonan syndrome (NS), the most common of these disorders mutation in a SHOC2 nucleic acid molecule can be detected (1:2500 live births), mutations are observed in several of these 50 by any method. In one embodiment, the mutation is detected RAS-MAPK signalling pathway genes, constituting approxi by a method selected from the group consisting of hybridiza mately 70% of cases. tion (including solution and Solid-phase hybridization meth Noonan syndrome (NS) is an autosomal dominant, pleio ods), PCR amplification of a single specified genomic region, morphic disorder characterized by short stature, facial dys microarray-based sequencing, HPLC (including denaturing morphia, congenital heart defects (e.g., most commonly pull 55 HPLC (DHPLC)), Denaturing Gradient Gel Electrophoresis monic Stenosis and hypertrophic cardiomyopathy) and (DGGE). Single Strand Conformation Polymorphism skeletal anomalies (Noonan, Am. J. Dis. Child. 116:373-80. (SSCP), HOT cleavage, direct capture-based methods, next 1968: Allanson, J. Med. Genet. 24:9-13, 1987). Other fre generation sequencing, exome sequencing, and whole quently associated disorders include a webbed neck, chest genome sequencing. deformities, cryptorchidism, mental retardation, and bleed 60 In a preferred embodiment, the diagnostic mutation in a ing diatheses. NS is a relatively common syndrome with an SHOC2 nucleic acid molecule associated with Noonan-like estimated incidence of 1:1000 to 1:2500 live births. The dis syndrome with loose anagen hair is an A to G transition at order is genetically heterogeneous and previously identified position 4 of the SHOC2 coding sequence. In one embodi genes account for approximately only 65% of cases. In addi ment, the sequence of the wild-type human SHOC2 nucleic tion, there are some closely related disorders, such as 65 acid is SEQID NO: 1, which corresponds to GenBank Acces Noonan-like syndrome with loose anagen hair, that are diffi sion No. NM 007373, wherein the coding sequence for cult to discern, particularly in infants and young children. SHOC2 protein begins at position 350, and the mutant human US 8,808,992 B2 3 4 SHOC2 nucleic acid sequence associated with Noonan-like targeted to the cell membrane basally (lower left) and after syndrome with loose anagen hair (SEQID NO: 2) has the G stimulation (lower right). Confocal laser microscopy visual Substitution at position 4 of the coding sequence of ized SHOC2 (anti-V5 monoclonal antibody, then Alexa NM 007373 (i.e., position 353). In one embodiment, the Fluor-594 goat anti-mouse antibody; red), actin cytoskeleton wild-type human SHOC2 protein sequence is SEQID NO: 3, 5 (Alexa Fluor 488-phalloidin; green) and nuclei (DAPI; blue). which corresponds to GenBank Accession No. NP 031399, Images are single optical sections representative of>50 trans and the mutant human SHOC2 protein sequence associated fected cells for each experiment. Bars indicate 20um. (c) Cell with Noonan-like syndrome with loose anagen hair (SEQID fractioning assay documenting preferential membrane target NO: 4) has the serine (Ser)->glycine (Gly) (Ser2Gly or S2G) ing of SHOC2’’. Transiently transfected cells were serum substitution at position 2 of NP 031399. 10 starved or stimulated with EGF, and lysates were fractionated The present invention is also directed to kits for diagnosing to separate membrane-associated proteins. ERBB2 is shown Noonan-like syndrome with loose anagen hair, comprising to demonstrate equivalent fractionation efficiency, while anti one or more oligonucleotides that specifically hybridize to (or V5 blot from cell lysates show equivalent transfection effi hybridize adjacent to) a site of mutation of a SHOC2 nucleic ciency. acid molecule, wherein the mutation results in an amino acid 15 FIG. 3. Functional characterization of the disease-causing substitution in a SHOC2 polypeptide encoded by the SHOC2 4A->G change in SHOC2. (a) Subcellular localization of co nucleic acid molecule; and instructions for use, wherein the expressed SHOC2" (green) and SHOC2'' (red) document amino acid substitution in the SHOC2 polypeptide is at posi ing that SHOC2’ does not impair EGF-stimulated tion 2 of the SHOC2 amino acid sequence. In one embodi SHOC2' translocation to the nucleus. Imaging of V5-tagged ment, the amino acid Substitution is glycine for serine. In a (anti-V5 monoclonal antibody, then Alexa Fluor-594 goat further embodiment, the site of mutation comprises nucle anti-mouse antibody) and Myc-tagged (anti-Myc antibody, otide 4 of the SHOC2 coding sequence. In a further embodi then Alex Fluor 488 goat anti-rabbit antibody) SHOC2 pro ment, the mutation at nucleotide 4 of the SHOC2 coding teins and nuclei (DAPI, blue). Panels above show Myc sequence is an A to G transition. tagged SHOC2" and V5-tagged SHOC2 and below show In one specific embodiment, the kit of the invention com 25 V5-tagged SHOC2" and Myc-tagged SHOC2’’. Cells prises tWO oligonucleotides 5'-GTGTAG were imaged basally (left) and following EGF stimulation GATCTTTGTCTCTTC-3' (SEQ ID NO. 5) and 5'-CCT (right). Bars indicate 20 Lum. (b) Lysates of Cos-1 cells co TCTTTCCATCTTTGGCAT-3' (SEQ ID NO: 6). expressing Myc-tagged SHOC2" and V5-tagged SHOC2 The present invention is also directed to an isolated were immunoprecipitated using anti-Myc (above panel) or SHOC2 polypeptide variant comprising a serine (Ser)->gly 30 anti-V5 (below panel) antibody, and immunoprecipitated cine (Gly) (Ser2Cly or S2G) substitution at position 2 of the proteins were visualized by western blotting. These results SHOC2 amino acid sequence. In one embodiment, such iso indicate that SHOC2 proteins do not form heterodimers. (c) lated SHOC2 polypeptide variant has SEQ ID NO: 4. The ERK phosphorylation in V5-tagged SHOC2" or SHOC2 instant invention is also directed to isolated nucleic acid mol transiently expressed Neuro2A cells basally or following ecules encoding such a SHOC2 variant. In one embodiment, 35 EGF stimulation. such nucleic acid molecule has SEQID NO: 2. FIG. 4. Consequences of SHOC2 expression in C. elegans Vulva development. Nomarski images of Vulvas of BRIEF DESCRIPTION OF THE FIGURES adult animals (a-d). A normal vulva is observed in animals expressing SHOC2" (a), while in worms expressing FIG.1. The germline 4A-G mutation in the SHOC2 gene 40 SHOC2 (band c) or myr:SHOC2" (d) a protrusion of the underlies a distinctive phenotype of the neuro-cardio-facial vulva is visible. Subcellular localization of V5-tagged cutaneous syndrome family. (a) DHPLC profiles showing the SHOC2 proteins in excretory canal cells (e-g) and intestinal de novo origin of the 4A-G nucleotide change in two affected cells (h-j). In both cell types, SHOC2" protein is present Subjects (left), and electropherograms documenting the het throughout the cytoplasm (eandh), while both SHOC2'' (f erozygous condition for this mutation at codon 2 in peripheral 45 and i) and myr:SHOC2" (g and j) are enriched in or leukocytes, skin fibroblasts, buccal epithelial cells and/or hair restricted to the plasma membrane. Confocal analysis was bulb cells from these individuals. (b) Representative pheno performed by immunofluorescence staining using an Anti-V5 typic features of affected subjects carrying the SHOC2 muta antibody (red). In intestinal cells, nuclei express GFP due to tion. (c) SHOC2 genomic organization and protein structure. pelt-2:GFP plasmid used as a marker for transformation. The coding exons are shown at the top as numbered filled 50 Nomarski images of VPCs at L3 stage (k-n). In animals boxes. Intronic regions are reported as dotted lines. SHOC2 expressing SHOC2" only P6.p descendant invaginate (k), motifs comprise an N-terminal lysine-rich region (grey while in SHOC2 (1 and m)and myr:SHOC2" (n) express coloured; Prosite motif score—8.8, http://www.expasy.ch/ ing animals also P5.p (1 to n) and P7.p descendants (mand n) tools/scanprosite?) followed by 19 leucine-rich repeats (Pfam detach from the cuticle. Anterior is to the left and dorsal is up hits with an E-value:0.5 are black coloured, while those with 55 in all images. an E-value 1 are represented in white, http://pfamjan FIG. 5. Mammalian protein-protein interaction network elia.org/). Numbers above the domain structure indicate the analysis identifies SHOC2 as the best disease gene candidate amino acid boundaries of those domains. for Noonan syndrome or a clinically related phenotype. The FIG. 2. The disease-causing 4A-G change in SHOC2 pro network was constructed by connecting proteins known to be motes protein myristoylation and cell membrane targeting. 60 mutated in Noonan syndrome (cyan) through two nodes/three (a) Himyristic acid incorporation (middle) occurs in links using the human interactome. SHOC2, the best candi SHOC2 but not in SHOC2" or SHOC2''. Equivalent date, is shown in magenta. Connections indicate protein levels of SHOC2 proteins in immunoprecipitates (left) and protein interactions. Leading candidates and Z scores are Hmyristic acid incorporation in cells (right) are shown. (b) reported in Supplementary Table 1. SHOC2" is uniformly spread in the cytoplasm and nucleus in 65 FIG. 6. Subcellular localization of the Myc-tagged starved Cos-1 cells (upper left) and is restricted to the nucleus SHOC2" and SHOC2’ proteins expressed in Cos-1 cells, following EGF stimulation (upper right), while SHOC2 is basally and following EGF stimulation. SHOC2" is uni US 8,808,992 B2 5 6 formly spread in the cytoplasm and nucleus in starved cells ling. These results provide the first example of an acquired (upper left), and is restricted to the nucleus following stimu co-translational modification leading to gain of function and lation (upper right), while the SHOC2''' is targeted to the causing human disease. cell membrane in both basal (lower left) and stimulated In one embodiment, the sequence of the wild-type human (lower right) conditions. Confocal laser Scanning microscopy 5 SHOC2 nucleic acid is SEQID NO: 1, which corresponds to was performed using anti-Myc monoclonal antibody, fol GenBank Accession No. NM 007373, wherein the coding lowed by Alexa Fluor-594 goat anti-mouse antibody (red), sequence for SHOC2 protein begins at position 350, and the while actin cytoskeleton was detected by Alexa Fluor 488 mutant human SHOC2 nucleic acid sequence associated with phalloidin (green). Nuclei are visualized by DAPI staining Noonan-like syndrome with loose anagen hair (SEQID NO: (blue). Co-localization areas were detected in yellow. Images 10 2) has the G substitution at position 4 of the coding sequence represent single optical sections representative of >50 trans of NM 007373 (i.e., position 353). In one embodiment, the wild-type human SHOC2 protein sequence is SEQID NO: 3, fected cells observed in each experiment. Bars indicate 20 which corresponds to GenBank Accession No. NP 031399, lm. and the mutant human SHOC2 protein sequence associated FIG. 7. Subcellular localization of the V5-tagged 15 with Noonan-like syndrome with loose anagen hair (SEQID SHOC2" and SHOC2’ proteins expressed in Neuro2A NO: 4) has the serine (Ser)->glycine (Gly) (Ser2Gly or S2G) cells, basally and following EGF stimulation. SHOC2" is substitution at position 2 of NP 031399. uniformly spread in the cytoplasm and nucleus in starved The Subject to whom the diagnostic applications of this cells (upper left), and is restricted to the nucleus following disclosure are directed may be any mammal. In a preferred stimulation (upper right), while the SHOC2’ is targeted to embodiment, the subject is a human. The subject may be of the cell membrane in both basal (lower left) and stimulated any age (e.g., an adult, a child, an infant), which includes (lower right) conditions. Confocal laser Scanning microscopy prenatal diagnostics. was performed using anti-V5 monoclonal antibody, followed In accordance with the present disclosure there may be by Alexa Fluor-594 goat anti-mouse antibody (red), while employed conventional molecular biology, microbiology, actin cytoskeleton was detected by Alexa Fluor 488-phalloi 25 and recombinant DNA techniques within the skill of the art. din (green). Nuclei are visualized by DAPI staining (blue). Such techniques are explained fully in the literature. See, e.g., Co-localization areas were detected in yellow. Images repre Sambrook, Fritsch & Maniatis, Molecular Cloning: A Labo sent single optical sections representative of >50 transfected ratory Manual, Second Edition (1989) Cold Spring Harbor cells observed in each experiment. Bars indicate 8 um. Laboratory Press, Cold Spring Harbor, N.Y. (herein “Sam FIG.8. Myristoylation is required for membrane targeting 30 brook et al., 1989''); DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glovered. 1985): Oligonucleotide of the SHOC2’ mutant. V5-tagged SHOC2''' is mem Synthesis (M. J. Gaited. 1984); Nucleic Acid Hybridization brane-targeted in untreated CoS-1 cells (top), while mem (B. D. Hames & S.J. Higgins eds. (1985)); Transcription And brane targeting is progressively lost in cells treated with an Translation (B. D. Hames & S. J. Higgins, eds. (1984)); NMT inhibitor (200uM, middle: 300 uM, bottom). Confocal 35 Animal Cell Culture (R. I. Freshney, ed. (1986)): Immobi laser Scanning microscopy was performed using anti-V5 lized Cells And Enzymes (IRL Press, (1986)); B. Perbal, A monoclonal antibody, followed by Alexa Fluor-594 goat anti Practical Guide To Molecular Cloning (1984); F. M. Ausubel mouse antibody (red), while actin cytoskeleton was detected et al. (eds.), Current Protocols in Molecular Biology, John by Alexa Fluor 488-phalloidin (green). Nuclei are visualized Wiley & Sons, Inc. (1994). by DAPI staining (blue). Co-localization areas were detected 40 in yellow. Images represent single optical sections represen DEFINITIONS tative of >50 transfected cells observed in each experiment. Bars indicate 20 Lum. As used herein, the term “Noonan-like syndrome with loose anagen hair refers to disorders described under Online DETAILED DESCRIPTION OF THE INVENTION 45 Mendelian Inheritance in Man database of John Hopkins University Accession No. OMIM 607721. Commonly, The present invention is based on an unexpected discovery Noonan-like syndrome with loose anagen hair is character that aberrantly acquired N-myristoylation of SHOC2, a cyto ized by one or more of the following phenotypic features: plasmic leucine-rich repeat-containing protein that positively short stature, certain facial phenotype including high fore modulates RAS-mitogen activated protein kinase (MAPK) 50 head, hypertelorism, palpebral ptosis and low-set and poste signal flow, underlies a clinically distinctive condition of riorly rotated ears, macrocephaly, enlarged cerebral spinal the neuro-cardio-facial-cutaneous disorders family. As dem fluid spaces, short neck with redundant skin, severe growth onstrated in the Examples section, below, twenty-five sub hormone (GH) deficiency, mild psychomotor delay with jects with a relatively consistent phenotype termed Noonan attention deficit/hyperactivity disorder (ADHD), mild dilata like syndrome with loose anagen hair OMIM (Online 55 tion of the pulmonary root, a unique combination of ectoder Mendelian Inheritance in Man database of John Hopkins mal abnormalities including ichthyosis, darkly pigmented University) 6077217 shared an A-to-G transition at position and hairless skin, and the unusual aspect of the hair, defined as 4 in SHOC2 coding sequence that leads to serine (Ser)->gly loose anagenhair syndrome. Reviewed in MaZZantietal. Am cine (Gly) substitution at position 2 of SHOC2 protein J Med Genet A. 2003, 118A:279-286. (Ser2Gly or S2G) and introduces an N-myristoylation site, 60 As used herein, the term “Noonan syndrome' or “NS” resulting in aberrant targeting of SHOC2 protein to the refers to disorders and diseases described under Accession plasma membrane and impaired translocation to the nucleus No. OMIM 16395O. upon growth factor Stimulation. Expression of mutant “N-myristoylation' is a common form of protein fatty acy SHOC2 protein in vitro enhanced MAPK activation in a cell lation resulting from the attachment of myristate to a required type-specific fashion. Induction of mutant SHOC2 in Cae 65 N-terminal glycine residue. norhabditis elegans engendered protruding Vulva, a neomor The term “SHOC2 nucleic acid molecule” refers to a phic phenotype previously associated with aberrant signal nucleic acid molecule comprising a nucleotide sequence US 8,808,992 B2 7 8 encoding a SHOC2 protein. The terms "SHOC2 coding No. 6,287,822 or 6,024.878, are separation methods that can nucleic acid sequence' or “SHOC2 coding sequence” refer to also be useful in connection with the present disclosure. a portion of a SHOC2 nucleic acid molecule which encodes a Denaturing Gradient Gel Electrophoresis (DGGE) is a SHOC2 protein. method for resolving two DNA fragments of identical length The terms “mutant” and “mutation” mean any detectable on the basis of sequence differences as Small as a single base change in genetic material or any product, process, mecha pair change, using electrophoresis through a gel containing nism, or result of Such a change. When compared to a control varying concentrations of denaturant (Guldberg et al., Nuc. material. Such change may be also referred to as a “variant' or Acids Res. 1994, 22:880). an "abnormality”. This includes gene mutations, in which the Single Strand Conformation Polymorphism (SSCP) is a structure of a gene is altered, arising from any mutation pro 10 method for detecting sequence differences between two cess, and the structure and/or amount of any expression prod DNAs, comprising hybridization of the two species with sub uct (e.g., RNA and/or protein) expressed by Such a modified sequent mismatch detection by gel electrophoresis (Ravnik gene is also altered. Glavac et al., Hum. Mol. Genet. 3:801, 1994). As used herein, the term "oligonucleotide' refers to a “HOT cleavage' is a method for detecting sequence differ nucleic acid, generally of at least 10 nucleotides, preferably 15 ences between two DNAs, comprising hybridization of the of at least 15 nucleotides, preferably no more than 100 nucle two species with Subsequent mismatch detection by chemical otides, that is hybridizable to a genomic DNA molecule, a cleavage (Cotton, et al., Proc. Natl. Acad. Sci. USA 85.4397, cDNA molecule, or an mRNA molecule. Oligonucleotides 1988). can be labeled, e.g., with 'P-nucleotides or biotin. In one The above methods are preferably followed by direct embodiment, an oligonucleotide can be used as a probe to sequencing. detect the presence of a mutant nucleic acid. A library of More recently developed techniques using microarrays, oligonucleotides arranged on a solid Support, Such as a silicon preferably microarray techniques allowing for high-through wafer or chip, can be used to detect various mutations of put screening, can also be advantageously implemented for interest. Generally, oligonucleotides are prepared syntheti detecting mutations. Microarrays may be designed so that the cally, preferably on a nucleic acid synthesizer. Accordingly, 25 same set of identical oligonucleotides is attached to at least oligonucleotides can be prepared with non-naturally occur two selected discrete regions of the array, so that one can ring phosphoester analog bonds, such as thioester bonds, etc. easily compare a normal sample, contacted with one of the selected regions of the array, against a test sample, contacted Diagnostic Methods of the Invention with another of the selected regions. These arrays avoid the 30 mixture of normal sample and test sample, using microfluidic The present invention is directed to methods for diagnosing conduits. Useful microarray techniques include those devel Noonan-like syndrome with loose anagen hair in a human oped by Nanogen, Inc (San Diego, Calif.) and those devel Subject, comprising detecting a mutation in a SHOC2 nucleic oped by Affymetrix. However, all types of microarrays, also acid molecule from the subject, wherein the mutation results called “gene chips' or “DNA chips, may be adapted for the in an SHOC2 polypeptide comprising a glycine Substitution 35 identification of mutations. Such microarrays are well known at position 2 of the SHOC2 amino acid sequence, and wherein in the art (see, for example, the following: U.S. Pat. Nos. the presence of said mutation in said SHOC2 nucleic acid 6,045,996; 6,040,138; 6,027,880; 6,020,135; 5,968,740: molecule is diagnostic of Noonan-like syndrome with loose 5,959,098; 5,945,334; 5,885,837; 5,874,219; 5,861,242: anagen hair in said human Subject. In a preferred embodi 5,843,655; 5,837,832; 5,677, 195 and 5,593,839). In princi ment, the mutation in the SHOC2 nucleic acid molecule is an 40 pal, any type of array, for example, dot blots on a nylon A to G transition at position 4 of the SHOC2 nucleic acid hybridization membrane (see Sambrook et al., Molecular Sequence. Cloning A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold The above mutation can be detected by any acceptable Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989) method. Cost-efficient fast methods suitable for high could be used, although, as will be recognized by those of throughput use are particularly preferred. Non-limiting 45 skill in the art, very small arrays will be preferred because examples of Such methods include, e.g., Solution or Solid hybridization volumes will be smaller. For these assays phase hybridization methods, PCR amplification of a single nucleic acid hybridization and wash conditions are chosen So specified genomic region, microarray-based sequencing, that the attached oligonucleotides “specifically bind’ or “spe HPLC (e.g., denaturing HPLC (DHPLC)), Denaturing Gra cifically hybridize' to at least a portion of a SHOC2 nucleic dient Gel Electrophoresis (DGGE). Single Strand Conforma 50 acid molecule present in a target sample, i.e., the probe tion Polymorphism (SSCP), HOT cleavage, direct capture hybridizes, duplexes or binds to the SHOC2 locus with a based methods, next generation sequencing, exome complementary nucleic acid sequence but does not hybridize sequencing, and whole genome sequencing. to a site with a non-complementary nucleic acid sequence. As Denaturing HPLC (DHPLC) can separate heteroduplexes used herein, one polynucleotide sequence is considered that differ by as little as one base pair. Thus, the use of 55 complementary to another when, if the shorter of the poly DHPLC can be applied to point mutation detection (Underhill nucleotides is less than or equal to 25 bases, there are no et al., Genome Research 7: 996, 1997: Liu et al., Nucleic Acid mismatches using standard base-pairing rules. It can easily be Res. 26; 1396, 1998). DHPLC analyses are carried out at a demonstrated that specific hybridization conditions result in partially denaturing temperature, i.e., a temperature Sufficient specific hybridization by carrying out a hybridization assay to denature a heteroduplex at the site of base pair mismatch, 60 including negative controls (see, e.g., Shalon et al., Supra, and homoduplexes can be separated from heteroduplexes having Chee et al., Science 274:610-4, 1996). the same base pair length (Hayward-Lester et al., Genome A variety of methods are available for detection and analy Research 5:494, 1995: Underhill et al., Proc. Natl. Acad. Sci. sis of a hybridization event. Depending on the reporter group USA 93:193, 1996; Doris et al., DHPLC Workshop, 1997, (fluorophore, enzyme, radioisotope, etc.) used to label a Stanford University). “Matched Ion Polynucleotide Chroma 65 probe (e.g., oligonucleotide), detection and analysis are car tography” (MIPC), or Denaturing “Matched Ion Polynucle ried out fluorimetrically, calorimetrically or by autoradiogra otide Chromatography” (DMIPC) as described in U.S. Pat. phy. By observing and measuring emitted radiation, such as US 8,808,992 B2 10 fluorescent radiation or a particle emission, information may TABLE 1-continued be obtained about hybridization events. When fluorescently labeled probes are used, the fluorescence emissions at each Top Noonan syndrome disease candidates predicted by mammalian site of array can, preferably be detected by Scanning confocal protein-protein interaction network analysis. laser microscopy. In one embodiment, a separate Scan, using Protein Links for Total links in Links Total links in the appropriate excitation line, is carried out for each of the l8le the node background to seed Subnetwork Z-score two fluorophores used. Alternatively, a laser can be used that NSR 41 84 2 22 6.76514 allows simultaneous specimen illumination at wavelengths AK2 60 84 2 22 548344 specific to the two fluorophores and emissions from the two BCL2 68 84 2 22 5.10772 10 PRKCA 91 84 2 22 4.3O827 fluorophores can be analyzed simultaneously (see Shalon et EGFR 106 84 2 22 392713 al., Genome Res. 6:639-695, 1996). Two nodes. Three links subnetwork For description of direct capture-based methods, next gen SHOC2 4 84 2 223 6.86825 eration sequencing, exome sequencing (targeted sequencing RASSF2 2 84 1 223 4.85658 of all protein-coding regions), and whole genome sequencing 15 SPRY1 3 84 1 223 3.883O3 FRS2 11 84 2 223 3.84O67 see, e.g., Olson, Nat Methods 2007, 4:891-892; Turner et al., SLAMF6 4 84 1 223 3.29149 Nat Methods 2009, 6:315-316; Okou et al., Nat Methods APBB1P 4 84 1 223 3.29149 2007, 4:907-909; Albert et al., Nat Methods 2007, 4:903-905; GRAP 5 84 1 223 2.88O21 Hodges et al., Nat Genet. 2007, 39:1522-1527; Nget al., Nat. HRAS 5 84 1 223 2.88O21 RIT2 7 84 1 223 2.32640 Genet., 2010, 42:30; Nget al., Nature, 2009, 461:272: Choi et NRAS 25 84 2 223 2.14823 al., PNAS, 2009, 106:19096; Drmanac et al., Science, 2010, RRAS 8 84 1 223 2.12572 327:78 The present invention is also directed to kits for diagnosing Noonan-like syndrome with looseanagenhair, comprising an The top candidates were curated to exclude genes previ oligonucleotide that specifically hybridizes to (or hybridizes 25 ously screened or those with inappropriate expression pat adjacent to) a site of mutation of a SHOC2 nucleic acid terns. Resequencing of coding exons for the best candidate, molecule, wherein the mutation results in an amino acid SHOC2, in a NS cohort including 96 individuals who were substitution in a SHOC2 polypeptide encoded by the SHOC2 negative for mutations in previously identified disease genes nucleic acid molecule; and instructions for use, wherein the and opportunely selected to represent the wide phenotypic amino acid substitution in the SHOC2 polypeptide is at posi 30 spectrum characterizing this disorder revealed an A-to-G tion 2 of the SHOC2 amino acid sequence. In one embodi transition at position 4 of the gene, predicting the Ser2Gly ment, the amino acid substitution is glycine for serine. In a amino acid substitution (S2G), in four unrelated individuals further embodiment, the site of mutation comprises nucle (FIG.1a). This nucleotide change had not been reported in a otide 4 of the SHOC2 nucleic acid molecule. In a further public SNP database, and Ser in SHOC2 is conserved among embodiment, the mutation at site 4 is an A to G transition. 35 Vertebrate orthologues. All cases were sporadic, and genotyp In one specific embodiment, the kit of the invention com ing of parental DNAs available for three of the four subjects prises tWO oligonucleotides 5'-GTGTAG documented the absence of the sequence variant in the parents GATCTTTGTCTCTTC-3' (SEQ ID NO. 5) and 5'-CCT and confirmed paternity in each family, providing evidence TCTTTCCATCTTTGGCAT-3' (SEQ ID NO: 6). that the change was a de novo mutation associated with the 40 disease. For these subjects, DNAs from several tissues were Example 1 available and all harboured the S2G mutation, providing evi To rationalize further candidate gene approaches to NS dence that the defect was inherited through the germline gene discovery, a systems biology approach was used based (FIG.1a). SHOC2 in a cohort of 410 mutation-negative sub on in silico protein network analysis. By applying a graph jects with NS or a related phenotype was then analyzed. 21 45 with the 4A-G missense change were observed and proved theory algorithm on a filtered consolidated human interac that mutations were de novo in twelve families from which tome, a Subnetwork of proteins generated from an integrated parental DNAs were available. No additional disease-associ network of mammalian protein interaction databases and ated SHOC2 sequence variant was identified in the analyzed cell-signalling network datasets was derived by seeding with cohort, strongly suggesting a specific pathogenetic role for the known RAS/MAPK mutant proteins (FIG. 5). 50 the S2Gamino acid substitution. To identify potential NS disease genes, Zscores were com Review of the features of the SHOC2 mutation-positive puted using a binomial proportions test, ranking the signifi individuals revealed a relatively consistent phenotype, previ cance of the intermediate nodes based on their connections to ously termed Noonan-like syndrome with loose anagen hair' the seed proteins' (Table 1). (FIG. 1b). Their features were at first view reminiscent of 55 Noonan syndrome. Phenotype analysis of these subjects, TABLE 1. however, was notable for the observation that they exhibited Top Noonan syndrome disease candidates predicted by mammalian reduced growth associated with proven growth hormone protein-protein interaction network analysis. (GH) deficiency, cognitive deficits, distinctive hyperactive behaviour, and hair anomalies including easily pluckable, Protein Links for Total links in Links Total links in 60 sparse, thin, slow growing hair. In six Subjects, a diagnosis of l8le the node background to seed subnetwork Z-score loose anagen hair (LAH) was confirmed by microscopic One node. Two links subnetwork examination of pulled hairs, many of which were in the SHOC2 4 11184 2 22 22.48O34 anagen phase but lacked an inner and outer root sheath. Most NRAS 25 11184 2 22 8.80S67 of them also exhibited hairless and darkly pigmented skin CRKL 34 11184 2 22 7.48228 65 with eczema or ichthyosis. Voice was characteristically JAK1 39 11184 2 22 6.95066 hypernasal. Cardiac anomalies were observed in the majority of the cases, with dysplasia of the mitral valve and septal US 8,808,992 B2 11 12 defects significantly overrepresented compared with the gen tion of tagged SHOC2 proteins was analyzed in Cos-1 cells eral NS population. Overall, these subjects appeared to share (FIG. 2b and FIG. 6). Confocal laser microscopy analysis a consistent phenotype that was characterized by an unusual documented that SHOC2" was uniformly distributed in the combination of features observed in disorders of the neuro cytoplasm and nucleus in starved cells but was restricted to cardio-facial-cutaneous disorders family. Mazzanti et al.' the nucleus following EGF stimulation, implying an unex reported the new syndrome Noonan-like syndrome with pected role for this protein in signal transduction. In contrast, loose anagen hair by detailing three children with short stat SHOC2 was specifically targeted to the cell membrane in ure, the same facial phenotype, macrocephaly, enlarged spi both states. This aberrant localization of SHOC2''' was con nal fluid space, short neck with redundant skin, severe GH firmed using 293T and Neuro2A cell lines (FIG.7) and by cell deficiency, mild psychomotor delay with attention deficit/ 10 fractionation (FIG. 2C). Treatment with 2-hydroxymyristic hyperactivity disorder, mild dilation of the pulmonary root in acid, an NMT inhibitor, at varying doses reduced or abolished two of them and a unique combination of ectodermal abnor SHOC2's membrane localization (FIG. 8), confirming a malities. dependency upon myristoylation. In addition, even in the SHOC2 is a widely expressed protein composed almost absence of efficient myristoylation, the mutant did not trans entirely by leucine-rich repeats (LRR) and has a lysine-rich 15 locate to the nucleus upon EGF stimulation, indicating pos sequence at the N-terminus (FIG. 1c). In C. elegans, where sible loss of function. To exclude the possibility that Shoc2/sur8 was discovered, the protein acts as a positive SHOC2’ might play a dominant negative effect by seques modulator of the signal transduction elicited by eg 1-15 and tering the wild-type protein to the cell membrane, impairing let-23, and mediated by let-60, homologues of vertebrate its EGF-dependent translocation to the nucleus, heterodimer FGFR, EGFR and RAS family members, respectively. ization of the wild type and SHOC2’ proteins was assayed Since LRRs can provide a structural framework for protein by confocal microscopy and co-immunoprecipitation assays protein interactions, SHOC2 is believed to function as a scaf in COS-1 cells transiently co-transfected with V5- and Myc fold linking RAS to downstream signal transducers. Based tagged proteins (FIG.3a, b). These experiments demonstrated on the N-terminal position of the S2G substitution, the that the wild-type and mutant proteins do not heterodimerize, present inventors hypothesized that co-translational process 25 ruling out that possibility. Next, it was explored whether ing might be perturbed in the mutant protein, making it a SHOC2 altered intracellular signalling through MAPK. substrate for the N-myristoyltransferase (NMT). N-terminal Wild-type and mutant SHOC2 were expressed in Cos-1,293T myristoylation is an irreversible modification occurring co and Neuro2A cells. While no significant change in ERK translationally in which myristate, a 14-carbon Saturated fatty activation in Cos-1 and 293T cells was observed, SHOC2’’’ acid, is covalently added to an N-terminal glycine residues 30 expression promoted enhanced EGF-dependent ERK phos after excision of the initiator methionine residue by methio phorylation compared to wildtype SHOC2, in neuroblastoma nylaminopeptidase'. Glycine at codon 2 is absolutely Neuro2A cells (FIG. 3c). required, Small uncharged residues at positions 3 and 6 are To explore further the functional effects of the SHOC2 generally needed, and basic residues at positions 8 and 9 are mutant, C. elegans was used as an experimental model. In C. preferred'. Save the presence of Ser at position 2, the N-ter 35 elegans, reduced Shoc2/Sur-8 (Sur8) causes no phenotype minal sequence of the SHOC2 satisfied those consensus rules, but can suppress the gain-of-function Ras (let-60°)-induced and in silico analysis predicted myristoylation of the multivulva phenotype (Muv). It was tested whether expres SHOC2 mutant with high confidence. To verify this, the sion of SHOC2 proteins could rescue the suppressed Muv myristoylation status of wild type and mutant SHOC2 pro phenotype in the sur-8' let-60° genetic background. While teins transiently expressed in Cos-1 cells was evaluated (FIG. 40 wild type SHOC2 was able to replace Sur-8 functionally, 2a). SHOC2''' incorporated H-myristic acid, while the SHOC2’ failed to do so (STable 2). Expression of the wild type protein and the disease-unrelated SHOC2' did mutant in let-60° worms did not suppress the MuV pheno not. type (Table 2), excluding dominant negative effects for N-myristoylation facilitates anchoring of proteins to intra SHOC2. In a wild-type genetic background, expression of cellular membranes. To explore whether it conferred mem 45 SHOC2 at embryonic and early larval stages of develop brane targeting to mutant SHOC2, the subcellular localiza ment caused no visible phenotype. TABLE 2

Vulval precursor cell induction in C. elegans strains expressing the wild-type or mutant SHOC2 protein.

Induction of vulval fate VPC

Genotype Transgene N Muv' N P3.p P4p P5.p P6.p P7.p P8.p Average

let-608 Ole 135 68.1 39 30.8 41.O 100 100 100 30.8 4.0 let-60sof: Ole 3O2 7.9 85 2.4 5.9 100 100 100 14.1 3.2 sur-87 let-60sof: SHOC2' 271 19.6° 45 4.4 35.6° 100 100 100 37.8 3.8 sur-87 let-60sof: SHOC2S26 104 10.6 29 34 3.4 100 1 OO 100 3.4 3.1d sur-87 wild type Ole >100 O let-6082f Ole 135 68.1 US 8,808,992 B2 13 14 TABLE 2-continued Vulval precursor cell induction in C. elegans strains expressing the wild-type or mutant SHOC2 protein. Induction of vulval fate

Genotype Transgene N My N P3.p P4p P5.p P6.p P7.p P8.p Average let-608 SHOC2' 72 61.1 let-608 SHOC2S2G 132 65.9 Strains: let-603 indicates let-60(n1046), sur-8 indicates sur-8(ku167). SHOC2 indicates hsp16.2:SHOC2:V5, SHOC2 indicates hsp16.2:SHOC2:V5. N indicates the number of animals scored, VPC indicates vulval precursor cell. Animals were heat-shocked at early L3 stage. Induction of vulval fate is expressed as the percent of individualVPCs (P3.p to P8,p) dividing more than one time. Average refers to the average number of VPCs induced per animal. P values were calculated using t-Student test for average VPC induction and z statistics for all other proportions. Muv is expressed as the percent of animals with ectopic pseudovulvae. Significantly different from the let-603; sur-8'? strain (P<0.001). Significantly different from the let-60°, sur-8 strain (P<0.005). Significantly different from the let-609; sur-8'? strain expressing the SHOC2' transgene (P<0.001).

In contrast, its expression at early L3 stage caused abnor TABLE 4 mal vulval development, resulting in protruding Vulva (Pv1), decreased egg laying efficiency (Eg1) and accumulation of Phenotypes observed in C. elegans let-23 mutants after larvae inside the mother with the formation of bag-of-worms expression of the wild-type or mutant SHOC2 transgene. adults (Bag phenotype) (Table 3 and FIG. 4a-c). These neo 25 Genotype Transgene N Bag morphic phenotypes were absent in animals expressing wild type Ole 24 O SHOC2" but were also observed whenSHOC2" tagged with let-23'f Ole 93 84.9 an N-myristoylation sequence (myr:SHOC2") was let-23'f SHOC2 92 85.9 expressed (Table 3 and FIG. 4d). let-23 SHOC2S2G 93 95.7 30 let-23cates hsp16.2:SHOC2:V5. indicates let-23SylSHOC2" indicates hsp162:SHOC2":V5, SHOC2S2 indi TABLE 3 Worms were heat-shocked at early L3 stage. N indicates the number of animals scored, Bag is the percent of animals that become a Phenotypes resulting from expression of the “bag-of-worm” 4 days post-fertilization. SHOC2", SHOC2* or myr:SHOC" transgene. Significantly different from the let-23 strain and the let-23 strain expressing SHOC2 (P < 0.05 in both comparisons). 35 Genotype Transgene N Pyl N Egl N Bag It is discovered herein that a SHOC2 mutation promoting Wild type Ole 56 1.8 25 19.2 2O S.O N-myristoylation of its protein product causes Noonan-like Wild type SHOC2 44 O 25 16.2 2O S.O Wild type SHOC2S2G 96 17.7° 25 26.3° 20 55.0° syndrome with loose anagen hair. Acquired co-translational Wild type myr:SHOC" 49 36.7' 25 25.5° 20' 45.0° processing, a unique finding for inherited human disease, 40

results in constitutive membrane targeting, leading to Animals were heat-shocked at early L3 stage. SHOC2' indicates hsp16.2::SHOC2'::V5, SHOC2 indicates hsp16.2::SHOC2:V5, myr:SHOC2 indicates hsp16.2::myr: increased MAPK activation in a cell context-specific manner. SHOC2V5. Cell-specific RAS pathway activation has also been observed N indicates the number of animals scored. Pwl is the percent of animals with a protruding wulva. with NS-associated SHP-2 mutants.'" While not well Eglis the average number of eggs per worm contained in the uterus, Bag is the percent of a bag-of-worms animals 6 days post fertilization, understood, this phenomenon explains why, despite the ubiq Significantly different from SHOC2 (P<0.01; P<0.0001; P - 0.05; P - 0.005; P 45 uitousness of RAS signalling, development is perturbed in < 0.02). certain tissues in these disorders. The SHOC2 and myr:SHOC2" proteins were targeted In C. elegans, N-myristoylated SHOC2 expression altered to the cell membrane in various C. elegans cell types, while morphogenesis during Vulval development, a process for SHOC2" was observed diffusely throughout the cytoplasm which the involvement of Ras signalling is well established. and nucleus (FIG. 4e-i). The defects in Vulva formation were 50 Specification of VPCs was not altered, contrasting with what not due to increased induction of the Vulva cell fate in Vulval is noted with many other Ras pathway mutants. Rather, per precursor cells (VPC) as expression of SHOC2’ did not turbation of the morphogenetic movements of the VPC reduce the vulvaless phenotype of a let-237 hypomorph descendant cells was observed. While numerous mutants mutant (Table 4), nor increase the penetrance of the MuV altering Vulval specification and morphogenesis have been phenotype of let-60 animals (Table 2). At the late L3/early 55 identified, far less is known about processes affecting only L4 stage, Vulva morphogenesis normally begins with the morphogenesis.'" It is possible that SHOC2 alters Ras descendants of vulval precursor cell (VPC) P6.p detaching signalling in steps downstream of the induction of the Vulval from the cuticle and forming a symmetric invagination. Ani fate. Alternatively, SHOC2'-induced vulva defects might mals in which the expression of SHOC2" had been induced arise through perturbation of signalling pathways other than at early L3 maintained this pattern. In contrast, in larvae 60 Ras-MAPK, such as signalling mediated by the Rho GTPase, expressing SHOC2 (17/48) or myr:SHOC2" (10/22), Rac, which is critical for vulval morphogenesis'7. descendants of VPCs P5. p and/or P7.p also detached from the A unique feature of the SHOC2 mutation is its association cuticle, resulting in larger and asymmetric invaginations with loose anagen hair. This phenotype occurs in isolation or (FIG. 4k-n). This morphogenesis defect was the earliest with NS and has been without molecular cause. Hair shafts detectable neomorphic effect of the SHOC2’ mutation on 65 from affected individuals show features of the anagen stage of vulval development and likely underlies the abnormalities hair follicle development, during which epithelial stem cells seen in the adult Vulva. proliferate in the hair bulb; later stage (telogen) hairs are US 8,808,992 B2 15 16 absent". Hair bulbs lack internal and external root sheaths in Algorithm: this condition. Taken together, these findings suggest pertur 1. Combine available mammalian protein-protein interac bation in the proliferation, survival or differentiation of epi tion networks using the method described above. 2. Filter the merged network to prune out interactions from thelial stem cell-derived cells residing in hair follicles. Our publications reporting high-throughput interaction data as results implicate SHOC2-mediated signal transduction in this described in Berger et al.' aspect of stem cell biology, which must await the availability 3. Find all shortest paths of length k between all pairs of of a suitable animal model for precise delineation. vertices in the merged seed list SUS" of all known NS disease Lastly, as disclosed herein, the human interactome and a genes. network-based statistical method were successfully used to 10 4. Find all edges between intermediate vertices identified predict a novel gene for human disease. The leading candi in 3. Intermediate vertices, I, are vertices that fall on shortest date, SHOC2, was a relatively obscure gene that caused no paths between pairs between all pairs in SUS" such that ICG phenotype when mutated in worms, evidence of the strength and IC/{SUS". of this approach. For other projects, one can anticipate that 5. Combine all nodes and links found in 3 and 4 to create successful candidates will not be deemed this favourably, 15 the subnetwork G'. necessitating resequencing of many low-probability candi 6. Rank intermediates base on their links in background date genes. Emerging interactome datasets and improved network vs. links in Subnetwork using a Binomial proportions analytic methods are likely to enhance the predictive power of test as described in Berger et al.'. systems biology. Subjects and Mutation Analysis. Genomic DNAs from a cohort of 96 subjects with NS or a Materials and Methods phenotype suggestive of this disorder without mutation in previously identified disease genes (PTPN11, SOS1, KRAS, Constructing a Mammalian Protein-Protein HRAS, RAF1, BRAF MEK1 and MEK2) were screened for Interaction Network from Available Resources the entire SHOC2 coding region using high-throughput rese 25 quencing as previously described. All sequence variants The protein-protein and signalling networks chosen are all identified were verified by manual inspection of the chro literature-based “legacy” direct biochemical mammalian matograms and putative causative mutations were verified interactions from low-throughput functional experiments using another independent sequencing reaction. SHOC2 was extracted manually by expert biologists (literature-curated). then analyzed in a panel of 410 mutation-negative individuals Interactions from high-throughput methods, orthologous 30 with NS or a clinically related phenotype with denaturing interactions from lower organisms, or interactions predicted high-performance liquid chromatography and direct using in silico methods were not included. Only direct bio sequencing. DNA from skin fibroblasts, hair bulbs and/or physical binding or enzymatic interactions were considered, epithelial cells from the oral mucosa was extracted using while interactions based on functional association were standard protocols. Samples were collected under Institu 35 tional Review Board-approved protocols, with informed con excluded. The following available protein-protein interaction sent. Permission was obtained to publish the photographs of datasets were used: DIP' (http://dip.doe-mbi.ucla.edu/, May subjects shown in FIG. 1. When available, parental DNAS 30, 2006); IntAct (ftp://ftp.ebi.ac.uk/pub/databases/intact/ were sequenced to establish whether identified changes were current, Jun. 12, 2006); MINT' (http://mint.bio.uniroma2.it/ de novo. Paternity was confirmed using the Ampf/STRIden mint-old/release/main.php, May 21, 2006); Ma'ayan et al.’ 40 tifier PCR Amplification Kit (Applied Biosystems). (http://www.mssm.edu/labs/iyenear/resources, May 21, Functional Analyses. 2006); BIND' (http://www.bind.ca/, Jan. 24, 2006): PDZ In Silico analysis of protein N-myristoylation was per Base' (http://icb.med.cornell.edu/services/pdz/start, Sep. formed using Myristoylator (http://www.expasy.org/tools/ 25, 2006). These datasets were chosen, because components myristoylator?), TermiNator (http://www.isv.cnrs-giffr/ter in those networks were annotated with accession codes that 45 minator3/index.html) and NMT (http://mendel.imp.ac.at/sat/ permit data consolidation and those datasets were provided myristate/index.html) software. The nucleotide substitutions freely for analysis and reuse. All interactions from these of interest were introduced in V5- and Myc-tagged human databases claimed to be direct biochemical interactions deter SHOC2 cl DNA expression constructs by site-directed mined experimentally, and include the PubMed reference of mutagenesis (QuikChange Site-Directed Mutagenesis Kit, the research article that describes the experiments used to 50 Stratagene). COS-1, 293-T and Neuro2A cells were main identify the interactions. Consolidating interactions from the tained in DMEM (GIBCO) supplemented with 10% heat different network databases was accomplished by combining inactivated FCS (Eueoclone) and antibiotics, and transfected human/mouse/rat gene symbols using the Xml version of at 60-70% confluency, using Fugene6 (Roche) or Lipo Swiss Prot (http://www.piruniprot.org/database?, on Jun. 21, fectamine 2000 (Invitrogen). N-myristoylation was evaluated 2006). The consolidated interactions were stored in a flat file 55 by Himyristic acid (30 uCi/ml) incorporation as described format (http://www.mssm.edu/labs/iyengar/resources/ elsewhere. Proteins immunoprecipitated with an anti-V5 datasets/sig format.shtml). antibody from cell lysates were separated by SDS-PAGE. Algorithm Used to Generate a List of Novel Ns Candidate Gels were fixed, soaked in AmplifyTM (Perkin Elmer) for 30 Genes. min, dried under a GelAir drying frame (BioRad), and 60 exposed to X-ray film (Kodak) for two months. Cellular frac Problem: tionation and ERK phosphorylation assays were performed Given a graph G in which a small subset of vertices S, on Cos-1 cells transiently expressing the V5 tagged SHOC2" SCG, are identified as seed nodes in this case known disease or SHOC2 using 1 standard protocols’’’. Cells were genes that cause NS, find a close to minimum connected serum starved (16 h) and then stimulated with EGF (30 to 100 subgraph G' that includes the seed nodes in S while pruning 65 ng/ml) for the indicated intervals. In all experiments, a human out intermediate nodes and links that are not statistically NMT1 c)NA expression construct (Origene) was co-trans significant for interacting with the seed list. fected. US 8,808,992 B2 17 18 Confocal Laser Scanning Microscopy. vulval induction at the L4 stage and for Pv1 phenotype at the 3x10 cells were seeded on glass coverslips, transiently adult stage. Microscopy observations were performed with a transfected, serum starved (16 h) and stimulated with EGF Zeiss Axioskop equipped with epifluorescence and Differen (30 ng/ml, 15 min). Cells were fixed with 3% paraformalde tial Interference Contrast on live animals anesthetized and hyde (30 min, 4°C.), permeabilized with 0.5% Triton X-100 mounted on 2% agarose pads containing 10 mM Na-AZide. (10 min, room temperature), and stained as described in the Images were collected with an Axiocam digital camera. Con figure legends. Imaging was performed on a Leica TCS SP2 focal analyses were performed using a Leica TCS SP2 con AOBS apparatus, utilizing excitation spectral laser lines at focal microscope. For immunocytochemistry analyses, trans 405, 488 and 594 nm, tuned with an acousto-optical tunable genic worms were heat shocked, and after 2 h were fixed with filter. Image acquisition and processing were conducted by 10 using the Leica Confocal Software (Leica Lasertechnik 2% PFA (R.T. 5 min, 1 h on ice). They were processed as GmbH). Signals from different fluorescent probes were taken reported, and then incubated overnight in a dilution of anti in sequential Scanning mode. V5 monoclonal antibody (1:200). After repeated washing (24 Generation of C. elegans Strains and Phenotypic Analysis. h), animals were incubated overnight with Texas-Red conju Culture, maintenance and genetic crosses for nematodes 15 gated anti-mouse secondary antibody (1:100) (Invitrogen), were as described. Nematode strains were provided by the washed and mounted for observation on microscope slides. Caenorhabditis Genetics Center (University of Minnesota, The present invention is also described and demonstrated Minneapolis, Minn.). V5-tagged SHOC2" and SHOC2’’’ by way of the above examples. However, the use of these and cDNA were subcloned into the heat shock inducible other examples anywhere in the specification is illustrative pPD49.83 vector (a gift of Andrew Fire, Stanford University only and in no way limits the scope and meaning of the School of Medicine, Stanford, Calif.). A chimeric SHOC2 invention or of any exemplified term. Likewise, the invention protein, myr:SHOC2", in which the first seven amino acid is not limited to any particular preferred embodiments residues were substituted by the N-terminal myristoylation described here. Indeed, many modifications and variations of signal (MGSCIGK) of Src-2 was obtained via PCR amplifi the invention may be apparent to those skilled in the art upon cation and cloned into the pPD49.83 vector. Germline trans 25 reading this specification, and Such variations can be made formation was performed as described’.elt-2:GFP (p.JM67, without departing from the invention inspirit or in Scope. The a gift from James D. McGhee, University of Calgary, Calgary, invention is therefore to be limited only by the terms of the Canada), which drives GFP expression in intestinal cells, was appended claims along with the full scope of equivalents to used as co-injection marker. At least three independent lines which those claims are entitled. for each construct were tested for the Pv1 phenotype after 30 heat shock. All the lines expressing SHOC2' or myr: All patents, applications, publications, test methods, litera SHOC2" upon heat shock exhibited a Pv1 phenotype. Only ture, and other materials cited herein are hereby incorporated the lines carrying the following transgenes were scored quan by reference in their entirety as if physically present in this titatively at the compound microscope and used for further specification. analyses and crosses: gbEx240 hsp16.2::SHOC2'::V5: 35 pelt-2:GFP), gbEx208ahsp16.2::SHOC2:V5; pelt-2: REFERENCES GFP and gbEx209 hsp16.2::myr:SHOC2":V5; pelt-2: GFP. Genetic crosses were performed according to standard 1. Resh, M.D. Trafficking and signaling by fatty-acylated and methods. For sur-8(ku167), let-60(n1046), gbEx240 and sur prenylated proteins. Nat Chem Biol 2, 584-90 (2006). 8(ku167), let-60(n1046), gbEx208a double mutants and let 40 2. Farazi, T.A., Waksman, G. & Gordon, J. I. The biology and 23(sy1); gbEx240 and let-23(sy1); gbEx208a single mutants enzymology of protein N-myristoylation. J Biol Chem 276, the presence of sur-8(ku167), let-60(n1046) and let-23(sy1) 39501-4 (2001). mutations was confirmed by sequencing the appropriate 3. Selfors, L. M., Schutzman, J. L., Borland, C. Z. & Stern, M. region of genomic DNA from each transgenic strain. After J. Soc-2 encodes a leucine-rich repeat protein implicated in each cross, isogenic worms that had lost the transgene were 45 fibroblast growth factor receptor signaling. Proc Natl Acad cloned separately and used as controls. N2 and derivative Sci USA 95,6903-8 (1998). strains were maintained and grown at 20°C. unless otherwise 4. Sieburth, D. S., Sun, Q. & Han, M. SUR-8, a conserved specified. The following mutant alleles were used: sur-8'. Ras-binding protein with leucine-rich repeats, positively sur-8(ku167) IV; let-603°/; let-60(n1046) IV; let-23': let-23 regulates Ras-mediated signaling in C. elegans. Cell 94, (sy1) II. Animals were scored blindly at the dissecting micro 50 119-30 (1998). Scope to count the number of eggs in utero after cutting the 5. Li, W., Han, M & Guan, K. L. The leucine-rich repeat mother (Egl), animals that had become bags of worms (Bag) protein SUR-8 enhances MAP kinase activation and forms and to check for the presence of multiple ectopic pseudoVul a complex with Ras and Raf. Genes Dev 14, 895-900 vae (Muv). A subset of worms was also scored blindly at the (2000). compound microscope for Vulva morphology and VPC 55 6. Rodriguez-Viciana, P., Oses-Prieto, J., Burlingame, A., induction phenotypes. Fried, M. & McCormick, F. A phosphatase holoenzyme C. elegans Heat Shock Experiments, Microscopy and Immu comprised of Shoc2/Sur8 and the catalytic subunit of PP1 nocytochemistry. functions as an M-Ras effector to modulate Raf activity. At different developmental stages, worms carrying the Mol Cell 22, 217-30 (2006). transgenes were subjected to heat shock at 33°C. for 30 min 60 7. Mazzanti, L. et al. Noonan-like syndrome with loose and then kept at 30°C. for 1 h. Synchronized embryos were anagen hair: a new syndrome'? Am J Med Genet A 118A, heat shocked to study the effects of transgene expression on 279-86 (2003). embryonic and early larval development, while synchronized 8. Schubbert, S., Shannon, K, & Bollag, G. Hyperactive Ras L1/L2 larvae were heat shocked to study the effects on later in developmental disorders and cancer. Nat Rev Cancer 7, larval development, movement and fertility. To study VPC 65 295-308 (2007). induction and Vulva morphogenesis, hermaphrodites were 9. Tartaglia, M. & Gelb, B. D. Molecular genetics of Noonan heat shocked at early L3 stages and animals were scored for syndrome. In Monographs in Human Genetics. Noonan US 8,808,992 B2 19 20 syndrome and related disorders. A matter of deregulated 21. Chatraryamontri, A. et al. MINT: the Molecular INTerac RAS signalling (ed. Zenker, M.) 17, 20-39 (Karger Press, tion database. Nucl Acids Res 35, D572-4 (2007). Basel, Switzerland, 2009). 22. Ma'ayan, A. etal. Formation of regulatory patterns during 10. Berger, S. I. Posner, J. M. & Ma'ayan, A. signal propagation in a Mammalian cellular network. Sci Genes2Networks: connecting lists of gene symbols using ence 309, 1078-83 (2005). mammalian protein interactions databases. BMC Bioinfor 23. Bader, G. D., Betel, D. & Hogue, C. W. V. BIND: the matics 8,372 (2007). Biomolecular Interaction Network Database. Nucl Acids 11. Boutin, J. A. Myristoylation. Cell Signal 9, 15-35 (1997). Res 31, 248-50 (2003). 12. Tartaglia, M. et al. Somatic mutations in PTPN11 in 24. Beuming, T., Skrabanek, L., Niv, M.Y., Mukherjee, P. & juvenile myelomonocytic leukemia, myelodysplastic Syn- 10 Weinstein, H. PDZBase: a protein-protein interaction data dromes and acute myeloid leukemia. Nat Genet. 34, 148- base for PDZ-domains. Bioinformatics 21, 827-8 (2005). 50 (2003). 25. Tartaglia, M. et al. Gain-of-function SOS1 mutations 13. Araki, T. et al. Mouse model of Noonan syndrome reveals cause a distinctive form of Noonan syndrome. Nat Genet. cell type- and gene dosage-dependent effects of Ptpnl 1 39, 75-9 (2007). mutation. Nat Med 10,849-57 (2004). 15 26. Utsumi, T. et al. Amino acid residue penultimate to the 14. Loh, M. L. et al. Mutations in PTPN11 implicate the amino-terminal Gly residue strongly affects two cotrans SHP-2 phosphatase in leukemogenesis. Blood 103, 2325- lational protein modifications, N-myristoylation and 31 (2004). N-acetylation. J Biol Chem 276, 10505-13 (2001). 15. Sternberg, P. W. Vulval development. In Wormbook (ed. 27. Vachon, L., Costa, T. & Hertz, A. GTPase and adenylate The C. elegans Research Community) WormBook, doi/ 20 cyclase desensitize at different rates in NG108-15 cells. 10.1895/wormbook.1.6.1, http://www.wormbook.org Mol Pharmacol 31, 159-68 (1987). (2005). 28. Sulston, J. E. & Hodgkin, J. Methods. In The Nematode 16. Eisenmann, D.M. & Kim, S. K. Protruding vulva mutants Caenorhabditis elegans (ed. Wood W. B. and the Commu identify novel loci and Wnt signaling factors that function nity of C. elegans Researchers) 587-606 (Cold Spring Har during Caenorhabditis elegans vulva development. Genet- 25 bor Laboratory Press, Cold Spring Harbor, N.Y., 1988). ics 156, 1097-116 (2000). 29. Mello, C. C., Kramer, J.M., Stinchcomb, D. & Ambros, V. 17. Kishore, R. S. & Sundaram, M.V. ced-10 Rac and mig-2 Efficient gene transfer in C. elegans after microinjection of function redundantly and act with unc-73 trio to control the DNA into germline cytoplasm: extrachromosomal mainte orientation of Vulval cell divisions and migrations in Cae- nance and intergration of transforming sequences. EMBOJ norhabditis elegans. Dev Biol 241, 339-48 (2002). 30 10,3959-70 (1991). 18. Tosti, A. et al. Loose anagen hair in a child with Noonan's 30. Duerr, J. S. Immunohistochemistry. In Worm Book (ed. syndrome. Dermatologica 182, 247-9 (1991). The C. elegans Research Community.) WormBook, doi/ 19. Xenarios, I. et al. The Database of Interacting Proteins: 10.1895/wormbook. 1.105.1, http://www.wormbook.org 2001 update. Nucl Acids Res 29, 239-41 (2001). (2006). 20. Kerrien, S. et al. IntAct-open source resource for molecu- 35 31. Dijkstra, E. W. A note on two problems in connexion with larinteraction data. NuclAcids Res 35, D561-D565 (2007). graphs. Numerische Mathematik 1, 269-271 (1959).

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 6

<21 Os SEQ ID NO 1 &211s LENGTH: 3962 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens <4 OOs SEQUENCE: 1 gagtggggga giggcgggcg ggggg.cggcg gttgggcagc gttcgcttctt aggaggagga 60 ggalagaggag galaggagggc gagcgaggag gatggcggag toggggctcc tacggaact 12O

ctaatgaatc attgattgac cagdactatt ttaccagttg gaatgaatga to agaaatgg 18O

gcatagtgct tittagat coa acatgitaaca gatggatgtt actic catgct gattacttct 24 O

tdaagccagt acttittittga ttgttgtagga totttgttctic tt catctittgaattcaatta 3 OO Ctggaaaata aaaggagttc atgtagttitt ttcCaggct tagt cacca tagtag tag 360

tittaggaaaa gaaaaagact ctaaagaaaa agat cocaaa gtaccatcag ccaaggaaag 42O agaaaaggag gCaaaagcct ctggaggttt toggaaagag agcaaagaala aagaacctaa 48O

gaccalaaggg aaagatgcca aagatggaaa galaggactic C agtgctgcc C aaccaggggit 54 O

ggcatttitca gttgacaat a catcaaacg gccaaac cca gCacctggga ct agaaaaaa 6 OO

atc.ca.gcaat gcagaggtga ttaaagagct caacaaatgc cgggaagaga attcaatgcg 660

tttgg actta to caa.gagat ctatacacat attgc.catca totaatcaaag agttgactica 72O US 8,808,992 B2 21 22 - Continued attalacagaa ctittattitat acagtaacaa attgcagtcc ctic ccagcag aggtgggatg 78O tittagtaaat ct catgacac toggctictaag tdaaaattica cittaccagtt togcctgactic 84 O tcttgataac ttgaagaa.gc tigcggatgct tatttacgg cataataaac tagagaaat 9 OO t cct tcagtg gtgtataggc tiggattct ct caccact citt tacct tcgct ttaatcgitat 96.O aact actgtg gaaaaggaca totaaaaactt gtcaaaactic agcatgctta gcatt cq aga O2O gaacaaaatt aaacaactac ctdctgaaat tdgtgaatta totaacctica ttacgctgga O8O tgtagct cac aat caacttgaac acct tcc aaaggagatt ggaaactgta cacagataac 14 O caac cittgac ttgcagdaca atgaactgct agacctic cca gatactatag gaalacctgtc 2OO cagtttaagt cqt cittgg to tdagatataa cagactgtca gcaat accca gat cattagc 26 O aaaatgcagt gcacttgaag aattaaattt agagaacaat aacatttcta citttaccaga 32O gagt cittitta t caagt cittg togaaactgaa tagtttgacc ttagctagaa attgct tcca 38O gttgttatcca gtgggtgg to catct cagtt ttctaccatc tatt coct ca acatggalaca 44 O caatcgaatc aacaaaattic catttggaat titt ct coaga gcaaaagtat taagtaagct SOO gaatatgaag gacaat cagt taacat cact tcc cttggat tittggaactt ggaccagtat 560 ggtagaattgaatttagc.ca ctaat cagct cacaaagat C cct gaggatgttctggtct 62O cgtttct citt gaggttctta t cittatcaaa caatc.ttcta aagaa.gcttic cc catggtct 68O tgga aacctt aggaagittaa gagagttgga tictagaa.gag aacaa attgg aatcCttgcc 74 O aaatgaaatt gcatat citta aggatttaca gaaattagtic ttgacaaaca accagttgac 8OO cact ct tccc agaggcattg gttcaccittac taatctoaca catctgggcc ttggagagaa 86 O cc tact tact cacct tcc td aagaaattgg tacactggag aacct agaag aactg tattt 92 O gaatgacaac cccaacct gc at agcct tcc ctittgagctg gcactctgca gcaa.gctitt c 98 O aatcatgagt attgagaact gtc. cacticag ticacct tcca cct Cagattg ttgctggggg 2O4. O gcct tcttitc at catt cagt tottaaagat gcagggit coa tat cqtgcca toggtotgata 21OO taaatctgct ggit cocacac actgttcaaa aatagactgc cattaatgtt tottatctat 216 O atctgtat ct atttatgtag at attggitat atggcagatt tataaaaatt gcattatgtg 222 O tittctgctaa tagaggaatc atago cattt agaattittitt ttaaattctg tacaaaaggc 228O ttatataagt titt ctittgct gaatttgatg gatgtttittctgttgttgtaa totgatatgc 234 O cagtttgctt aaaacatttg cca acacatt atgaagittat taaatttaag gigacagaggit 24 OO agtatagitta gatatactitt ct cittaggaa aaataatggg caaaaattitt tdttgcaact 246 O titt catatat attitt.cccct taccalattgt tittatcc tta tag tattgta gg.ccctgaaa 252O gtagaattitt totttalactt attittgagat ttgagattta aattittatgt attgtttaca 2580 gtcagagtaa at cactggat ttctitttgtt tdttittgatt togctctgttt tatt cagtica 264 O aatctagagt ttgaatcc to tdctaaagaa tittgcatcca citggtgtaaa cagtgaaagg 27 OO tatttgcttgttgaaaaaaa aaactggcaa agtgaaaaga tacagtcaaa aatctagaat 276 O ttctittaatt ttgcttct ct gacgagttgt gaa.gcaaaat acctgaagtg agt ctittggg 282O taggggaagg gtattgagac Cttittctagt atgaatattt tittaagtttgggggaagaga 288O aacttgcagt gaaaaggagt tttitt cattc ctdaaagttg cagat coaca aaactaa.ca.g 294 O gataattggg caaataaatt acatataaac acacacaatic tatatatgta tatacaatgc 3 OOO tatatagata totatttatt at at catalaa ctacagtagg taactittaag gatttct tcc 3 O 6 O

US 8,808,992 B2 25 26 - Continued cagtttaagt cqt cittgg to tdagatataa cagactgtca gcaat accca gat cattagc 26 O aaaatgcagt gcacttgaag aattaaattt agagaacaat aacatttcta citttaccaga 32O gagt cittitta t caagt cittg togaaactgaa tagtttgacc ttagctagaa attgct tcca 38O gttgttatcca gtgggtgg to catct cagtt ttctaccatc tatt coct ca acatggalaca 44 O caatcgaatc aacaaaattic catttggaat titt ct coaga gcaaaagtat taagtaagct SOO gaatatgaag gacaat cagt taacat cact tcc cttggat tittggaactt ggaccagtat 560 ggtagaattgaatttagc.ca ctaat cagct cacaaagat C cct gaggatgttctggtct 62O cgtttct citt gaggttctta t cittatcaaa caatc.ttcta aagaa.gcttic cc catggtct 68O tgga aacctt aggaagittaa gagagttgga tictagaa.gag aacaa attgg aatcCttgcc 74 O aaatgaaatt gcatat citta aggatttaca gaaattagtic ttgacaaaca accagttgac 8OO cact ct tccc agaggcattg gttcaccittac taatctoaca catctgggcc ttggagagaa 86 O cc tact tact cacct tcc td aagaaattgg tacactggag aacct agaag aactg tattt 92 O gaatgacaac cccaacct gc at agcct tcc ctittgagctg gcactctgca gcaa.gctitt c 98 O aatcatgagt attgagaact gtc. cacticag ticacct tcca cct Cagattg ttgctggggg 2O4. O gcct tcttitc at catt cagt tottaaagat gcagggit coa tat cqtgcca toggtotgata 21OO taaatctgct ggit cocacac actgttcaaa aatagactgc cattaatgtt tottatctat 216 O atctgtat ct atttatgtag at attggitat atggcagatt tataaaaatt gcattatgtg 222 O tittctgctaa tagaggaatc atago cattt agaattittitt ttaaattctg tacaaaaggc 228O ttatataagt titt ctittgct gaatttgatg gatgtttittctgttgttgtaa totgatatgc 234 O cagtttgctt aaaacatttg cca acacatt atgaagittat taaatttaag gigacagaggit 24 OO agtatagitta gatatactitt ct cittaggaa aaataatggg caaaaattitt tdttgcaact 246 O titt catatat attitt.cccct taccalattgt tittatcc tta tag tattgta gg.ccctgaaa 252O gtagaattitt totttalactt attittgagat ttgagattta aattittatgt attgtttaca 2580 gtcagagtaa at cactggat ttctitttgtt tdttittgatt togctctgttt tatt cagtica 264 O aatctagagt ttgaatcc to tdctaaagaa tittgcatcca citggtgtaaa cagtgaaagg 27 OO tatttgcttgttgaaaaaaa aaactggcaa agtgaaaaga tacagtcaaa aatctagaat 276 O ttctittaatt ttgcttct ct gacgagttgt gaa.gcaaaat acctgaagtg agt ctittggg 282O taggggaagg gtattgagac Cttittctagt atgaatattt tittaagtttgggggaagaga 288O aacttgcagt gaaaaggagt tttitt cattc ctdaaagttg cagat coaca aaactaa.ca.g 294 O gataattggg caaataaatt acatataaac acacacaatic tatatatgta tatacaatgc 3 OOO tatatagata totatttatt at at catalaa ctacagtagg taactittaag gatttct tcc 3 O 6 O tatic cttgta caatgacatgaatgtc.tttc tittgaaaact gcaatgitatg tatgtttcaa 312 O ggittatttaa cagtgtacta toggttittata t cittgacttig ccttgtacat ctittcaattic 318O tggaatat ct gtgtctaagc acaatat citt cacactgtgc tigt attgct g c tdaactaaa 324 O tgcacttitt c cccacatatggggcactggc titcaaacaat t cagttcagt at cattactt 33 OO ttaatctgat ctitt cottt c ttgg tagttgttaatacagt tatggaaaag aggcacattg 3360

Catagaagcc attggggagt t cagtggaag ttctgtaaga tigtgcatgta Ctatttgatg 342O cgttitt ctitt gctt cactgc titttaatact tag cagtatt gttggtctaa gtcaatttga 3480 ttattgagga gtct cagagc aaggtgcgtt citagatgtca toctaaaaaa cactt catat 354 O US 8,808,992 B2 27 28 - Continued ataattaatc. act attttgt ataattacat attgctgctt gtgttgtttitt tttittttitcc 36OO atttagttgg gcgttgttgtt ttacacaaaa. c catttittga attaaggcta tgat attaag 366 O atagaaattit ggactgttgt totgctttitc ctggcactica aatt catgac tagttittgag 372 O gtcaaaccta tgttcgtaat gagagattitt ataaggat.ca actaagaaat ggalaggdagg 378 O tgaagatata aaacco taga atgcttaaat gtgctgtaaa act attgtag atgtcactgg 384 O attittaccala gtaatat cot ttct ttttitt titt cococca cittitt cagtt 3900 aaaattttgt ttataaaagg aatttgttta ttacagotct acctagaaaa aaaaaaaaaa. 396 O a.a. 3962

<210s, SEQ ID NO 3 &211s LENGTH: 582 212. TYPE : PRT &213s ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 3 Met Ser Ser Ser Lieu. Gly Lys Glu Lys Asp Ser Glu Asp Pro 1. 1O 15

Lys Wall Pro Ser Ala Lys Glu Arg Glu Lys Glu Ala Ser Gly

Gly Phe Gly Lys Glu Ser Lys Glu Lys Glu Pro Thir Gly Lys 35 4 O 45

Asp Ala Asp Gly Llys Lys Asp Ser Ser Ala Ala Glin Pro Gly Val SO 55 6 O

Ala Phe Ser Val Asp ASn Thr Ile Lys Arg Pro Asn Pro Ala Pro Gly 65 70 7s 8O

Thir Arg Llys Ser Ser Asn Ala Glu Wall Ile Glu Luell Asn Lys 85 90 95

Arg Glu Glu Asn. Ser Met Arg Lieu. Asp Lieu. Ser Arg Ser Ile 105 11 O

His Ile Luell Pro Ser Ser Ile Llys Glu Lieu. Thir Glin Lell Thir Glu Lieu. 115 12 O 125

Luell Ser Asn Llys Lieu. Glin Ser Lieu. Pro Ala Glu Wall Gly Cys 13 O 135 14 O

Lell Wall Asn Lieu Met Thir Lieu Ala Lieu. Ser Glu Asn Ser Luell Thir Ser 145 150 155 160

Lell Pro Asp Ser Lieu. Asp Asn Lieu Llys Llys Lieu. Arg Met Luell Asp Lieu. 1.65 17O 17s

Arg His Asn Llys Lieu. Arg Glu Ile Pro Ser Wall Wall Arg Lieu. Asp 18O 185 19 O

Ser Luell Thir Thir Lieu. Tyr Lieu. Arg Phe Asn Arg Ile Thir Thir Wall Glu 195 2O5

Asp Ile Lys Asn Lieu. Ser Lys Luell Ser Met Lell Ser Ile Arg Glu 21 O 215

Asn Ile Lys Glin Lieu Pro Ala Glu Ile Gly Glu Lell Asn Luell 225 23 O 235 24 O

Ile Thir Luell Asp Val Ala His Asn Gln Lieu. Glu His Lell Pro Lys Glu 245 250 255

Ile Gly Asn Cys Thr Glin Ile Thr Asn Lieu. Asp Lell Glin His Asn. Glu 26 O 265 27 O

Lell Luell Asp Leu Pro Asp Thr Ile Gly Asn Lieu. Ser Ser Luell Ser Arg 285

Lell Gly Luell Arg Tyr Asn Arg Lieu. Ser Ala Ile Pro Arg Ser Lieu Ala US 8,808,992 B2 29 30 - Continued

29 O 295 3 OO Lys Cys Ser Ala Lieu. Glu Glu Lieu. Asn Lieu. Glu Asn. Asn. Asn. Ile Ser 3. OS 310 315 32O Thir Lieu Pro Glu Ser Lieu Lleu Ser Ser Lieu Val Llys Lieu. Asn. Ser Lieu. 3.25 330 335 Thr Lieu Ala Arg Asn Cys Phe Gln Leu Tyr Pro Val Gly Gly Pro Ser 34 O 345 35. O Glin Phe Ser Thr Ile Tyr Ser Lieu. Asn Met Glu. His Asn Arg Ile Asn 355 360 365 Lys Ile Pro Phe Gly Ile Phe Ser Arg Ala Lys Val Lieu. Ser Lys Lieu. 37 O 375 38O Asn Met Lys Asp Asn Gln Lieu. Thir Ser Lieu Pro Lieu. Asp Phe Gly Thr 385 390 395 4 OO Trp. Thir Ser Met Val Glu Lieu. Asn Lieu Ala Thr Asn Gln Lieu. Thir Lys 4 OS 41O 415 Ile Pro Glu Asp Wal Ser Gly Lieu Val Ser Lieu. Glu Val Lieu. Ile Lieu. 42O 425 43 O Ser Asn. Asn Lieu Lleu Lys Llys Lieu Pro His Gly Lieu. Gly Asn Lieu. Arg 435 44 O 445 Llys Lieu. Arg Glu Lieu. Asp Lieu. Glu Glu Asn Llys Lieu. Glu Ser Lieu Pro 450 45.5 460 Asn Glu Ile Ala Tyr Lieu Lys Asp Lieu. Glin Llys Lieu Val Lieu. Thir Asn 465 470 47s 48O Asn Glin Lieu. Thir Thr Lieu Pro Arg Gly Ile Gly His Lieu. Thir Asn Lieu 485 490 495 Thir His Lieu. Gly Lieu. Gly Glu Asn Lieu. Lieu. Thir His Lieu Pro Glu Glu SOO 505 51O Ile Gly. Thir Lieu. Glu Asn Lieu. Glu Glu Lieu. Tyr Lieu. Asn Asp Asin Pro 515 52O 525 Asn Lieu. His Ser Lieu Pro Phe Glu Lieu Ala Lieu. Cys Ser Lys Lieu. Ser 53 O 535 54 O Ile Met Ser Ile Glu Asn Cys Pro Leu Ser His Leu Pro Pro Glin Ile 5.45 550 555 560 Val Ala Gly Gly Pro Ser Phe Ile Ile Glin Phe Leu Lys Met Glin Gly 565 st O sts Pro Tyr Arg Ala Met Val 58O

<210s, SEQ ID NO 4 &211s LENGTH: 42O 212. TYPE: PRT <213> ORGANISM: Home sapiens

<4 OOs, SEQUENCE: 4 Met Gly Ser Ser Lieu. Gly Lys Glu Lys Asp Ser Lys Glu Lys Asp Pro 1. 5 1O 15

Llys Val Pro Ser Ala Lys Glu Arg Glu Lys Glu Ala Lys Ala Ser Gly 2O 25 3O Gly Phe Gly Lys Glu Ser Lys Glu Lys Glu Pro Llys Thr Lys Gly Lys 35 4 O 45

Asp Ala Lys Asp Gly Llys Lys Asp Ser Ser Ala Ala Glin Pro Gly Val SO 55 6 O

Ala Phe Ser Val Asp Asn. Thir Ile Lys Arg Pro Asn Pro Ala Pro Gly 65 70 7s 8O US 8,808,992 B2 31 - Continued Thir Arg Llys Llys Ser Ser Asn Ala Glu Val Ile Lys Glu Lieu. Asn Lys 85 90 95 Cys Arg Glu Glu Asn. Ser Met Arg Lieu. Asp Lieu. Ser Lys Arg Ser Ile 1OO 105 11 O His Ile Leu Pro Ser Ser Ile Lys Glu Lieu. Thr Gln Lieu. Thr Glu Lieu. 115 12 O 125 Tyr Lieu. Tyr Ser Asn Llys Lieu. Glin Ser Lieu Pro Ala Glu Val Gly Cys 13 O 135 14 O

Lieu Wall Asn Lieu Met Thir Lieu Ala Lieu. Ser Glu Asn. Ser Lieu. Thir Ser 145 150 155 160

Lieu Pro Asp Ser Lieu. Asp Asn Lieu Lys Llys Lieu. Arg Met Lieu. Asp Lieu. 1.65 17O 17s Arg His Asn Llys Lieu. Arg Glu Ile Pro Ser Val Val Tyr Arg Lieu. Asp 18O 185 19 O Ser Lieu. Thir Thr Lieu. Tyr Lieu. Arg Phe Asin Arg Ile Thr Thr Val Glu 195 2OO 2O5 Lys Asp Ile Lys Asn Lieu. Ser Lys Lieu. Ser Met Lieu. Ser Ile Arg Glu 21 O 215 22O Asn Lys Ile Lys Glin Lieu Pro Ala Glu Ile Gly Glu Lieu. Cys Asn Lieu 225 23 O 235 24 O Ile Thr Lieu. Asp Wall Ala His Asn. Glin Lieu. Glu. His Lieu Pro Lys Glu 245 250 255 Ile Gly Asn. Cys Thr Glin Ile Thir Asn Lieu. Asp Lieu Gln His Asn. Glu 26 O 265 27 O Lieu Lieu. Asp Lieu Pro Asp Thir Ile Gly Asn Lieu Ser Ser Lieu Ser Arg 27s 28O 285 Lieu. Gly Lieu. Arg Tyr Asn Arg Lieu. Ser Ala Ile Pro Arg Ser Lieu Ala 29 O 295 3 OO Lys Cys Ser Ala Lieu. Glu Glu Lieu. Asn Lieu. Glu Asn. Asn. Asn. Ile Ser 3. OS 310 315 32O Thir Lieu Pro Glu Ser Lieu Lleu Ser Ser Lieu Val Llys Lieu. Asn. Ser Lieu. 3.25 330 335 Thr Lieu Ala Arg Asn Cys Phe Gln Leu Tyr Pro Val Gly Gly Pro Ser 34 O 345 35. O Glin Phe Ser Thr Ile Tyr Ser Lieu. Asn Met Glu. His Asn Arg Ile Asn 355 360 365 Lys Ile Pro Phe Gly Ile Phe Ser Arg Ala Lys Val Lieu. Ser Lys Lieu. 37 O 375 38O Asn Met Lys Asp Asn Gln Lieu. Thir Ser Lieu Pro Lieu. Asp Phe Gly Thr 385 390 395 4 OO Trp. Thir Ser Met Val Glu Lieu. Asn Lieu Ala Thr Asn Gln Lieu. Thir Lys 4 OS 41O 415 Ile Pro Glu Asp 42O

<210s, SEQ ID NO 5 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: PCR Primer

<4 OOs, SEQUENCE: 5 gtgtaggat.c tttgtc.tc.tt c US 8,808,992 B2 33 34 - Continued

<210s, SEQ ID NO 6 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: PCR Primer

<4 OOs, SEQUENCE: 6 ccttctitt co atctittggca t 21

What is claimed is: mitting hybridization of the primers to the wild-type 1. A method for detecting the presence of a SHOC2 muta and/or mutant SHOC2 genomic DNA or cDNA, wherein tion associated with Noonan-like syndrome with loose 15 the mutant SHOC2 genomic DNA or cDNA encodes a anagen hair in a human Subject, comprising: mutant SHOC2 protein comprising glycine (Gly) at position 2 of the SHOC2 protein sequence, and (a) determining the sequence of all or a portion of a SHOC2 (ii) performing the amplification reaction. nucleic acid in a biological sample collected from the 9. The method of claim 8, wherein the primer pair consists Subject, wherein the sequence of all or a portion of the of 5'-GTGTAGGATCTTTGTCTCTTC-3' (SEQ ID NO. 5) SHOC2 nucleic acid is determined by carrying out a and 5'-CCTTCTTTCCATCTTTGGCAT-3' (SEQID NO: 6). method selected from the group consisting of microar 10. The method of claim 1, wherein step (a) comprises ray-based sequencing, denaturing HPLC (DHPLC), carrying out microarray-based sequencing, wherein the Denaturing Gradient Gel Electrophoresis (DGGE), microarray-based sequencing comprises contacting DNA or Single Strand Conformation Polymorphism (SSCP), 25 RNA obtained from the biological sample collected from the HOT cleavage, direct capture-based method, next gen subject or cDNA produced from RNA obtained from the eration sequencing, exome sequencing, Solution or biological sample collected from the Subject with an oligo Solid-phase hybridization, whole genome sequencing, nucleotide that specifically hybridizes to a site of mutation of hybridization, and PCR amplification of a single speci a SHOC2 nucleic acid molecule, under conditions permitting fied genomic region; 30 hybridization of the oligonucleotide to the wild-type or (b) comparing the SHOC2 nucleic acid sequence in the mutant SHOC2 genomic DNA, RNA or cDNA, wherein the biological sample from the subject to a nucleic acid mutant SHOC2 genomic DNA, RNA or cDNA encodes a sequence encoding a wild-type human SHOC2 protein mutant SHOC2 protein comprising glycine (Gly) at position or comparing the protein sequence encoded by the 2 of the SHOC2 protein sequence. SHOC2 nucleic acid sequence in the biological sample 35 11. The method of claim 1, comprising, prior to step (a), from the subject to a wild-type human SHOC2 protein producing cDNA from RNA contained in the biological sequence; and sample from the Subject. (c) determining that a mutation associated with Noonan 12. The method of claim 1, comprising, prior to step (a), like syndrome with loose anagen hair is present in the collecting the biological sample comprising DNA or RNA subject, when the SHOC2 nucleic acid sequence in the 40 from the subject. biological sample from the Subject encodes a mutant 13. A method for diagnosing a subject as afflicted with or SHOC2 protein comprising glycine (Gly) at position 2 predisposed to Noonan-like syndrome with loose anagen of the SHOC2 protein sequence. hair, said method comprising: 2. The method of claim 1, wherein the mutation associated (a) determining the sequence of all or a portion of a SHOC2 with Noonan-like syndrome with loose anagen hair is an A to 45 nucleic acid in a biological sample collected from the G transition at position 4 of the SHOC2 coding sequence. Subject, wherein the sequence of all or a portion of the 3. The method of claim 1, wherein the mutant SHOC2 SHOC2 nucleic acid is determined by carrying out a protein has the sequence SEQID NO: 4. method selected from the group consisting of microar 4. The method of claim 1, wherein the mutant SHOC2 ray-based sequencing, DHPLC, DGGE, SSCP, HOT nucleic acid molecule has the sequence SEQID NO: 2. 50 cleavage, direct capture-based method, next generation 5. The method of claim 1, wherein the wild-type human sequencing, exome sequencing, Solution or Solid-phase SHOC2 protein has the sequence SEQID NO:3. hybridization, whole genome sequencing, hybridiza 6. The method of claim 1, wherein the nucleic acid tion, and PCR amplification of a single specified sequence encoding a wild-type human SHOC2 protein con genomic region; sists of SEQID NO: 1. 55 (b) comparing the SHOC2 nucleic acid sequence in the 7. The method of claim 1, wherein step (a) further com biological sample from the Subject to a nucleic acid prises direct sequencing of said all or a portion of the SHOC2 sequence encoding a wild-type human SHOC2 protein nucleic acid sequence. or comparing the protein sequence encoded by the 8. The method of claim 1, wherein step (a) comprises SHOC2 nucleic acid sequence in the biological sample carrying out PCR amplification of a single specified genomic 60 from the subject to a wild-type human SHOC2 protein region, wherein the PCR amplification comprises: sequence; and (i) contacting DNA obtained from the biological sample (c) diagnosing the Subject as being afflicted with or predis collected from the subject or cDNA produced from RNA posed to Noonan-like syndrome with loose anagen hair, obtained from the biological sample collected from the when the SHOC2 nucleic acid sequence in the biological Subject with a primer pair that allows for specific ampli 65 sample from the subject encodes a mutant SHOC2 pro fication of all or part of a wild-type and/or mutant tein comprising glycine (Gly) at position 2 of the SHOC2 genomic DNA or cDNA, under conditions per SHOC2 protein sequence. US 8,808,992 B2 35 36 14. The method of claim 13, wherein the mutation associ (a) obtaining nucleic acid from a biological sample col ated with Noonan-like syndrome with loose anagen hair is an lected from the subject; A to G transition at position 4 of the SHOC2 coding sequence. (b) analyzing, using an automatic computerized sequencer, 15. The method of claim 13, wherein the mutant SHOC2 protein has the sequence SEQID NO: 4. the nucleic acid to determine its nucleotide sequence; 16. The method of claim 13, wherein the mutant SHOC2 (c) comparing, with Software programmed to perform a nucleic acid molecule has the sequence SEQID NO: 2. base-by-base comparison, the nucleotide sequence of 17. The method of claim 13, wherein the wild-type human the nucleic acid to a nucleotide sequence encoding a SHOC2 protein has the sequence SEQID NO:3. wild-type human SHOC2 protein; 18. The method of claim 13, wherein the nucleic acid 10 (d) providing for display on a computer, the difference sequence encoding a wild-type human SHOC2 protein con between the nucleotide sequence of the nucleic acid and sists of SEQID NO: 1. the nucleotide sequence of the wild-type human SHOC2 19. The method of claim 13, comprising, prior to step (a), protein; and producing cDNA from RNA contained in the biological sample from the Subject. (e) determining that a mutation associated with Noonan 20. The method of claim 13, comprising, prior to step (a), 15 like syndrome with loose anagen hair is present in the collecting the biological sample comprising DNA or RNA Subject when the nucleic acid comprises a nucleotide from the subject. sequence that encodes a mutant SHOC2 protein com 21. A method for detecting the presence of a SHOC2 muta prising glycine (Gly) at position 2 of the SHOC2 protein tion associated with Noonan-like syndrome with loose Sequence. anagen hair in a human Subject, the method comprising: