Gene Stat2 Murine/Human T Cells Expressing a Chimeric +CD4

IL-12, but Not IFN-α, Promotes STAT4 Activation and Th1 Development in Murine CD4+ T Cells Expressing a Chimeric Murine/Human Stat2 Gene This information is current as of October 3, 2021. Meredith E. Persky, Kenneth M. Murphy and J. David Farrar J Immunol 2005; 174:294-301; ; doi: 10.4049/jimmunol.174.1.294 http://www.jimmunol.org/content/174/1/294 Downloaded from

References This article cites 45 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/174/1/294.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on October 3, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

IL-12, but Not IFN-␣, Promotes STAT4 Activation and Th1 Development in Murine CD4؉ T Cells Expressing a Chimeric Murine/Human Stat2 Gene1

Meredith E. Persky,* Kenneth M. Murphy,†‡ and J. David Farrar2*

Humans and mice have evolved distinct pathways for Th1 cell development. Although IL-12 promotes CD4؉ Th1 development in both murine and human T cells, IFN-␣␤ drives Th1 development only in human cells. This IFN-␣␤-dependent pathway is not conserved in the mouse species due in part to a specific mutation within murine Stat2. Restoration of this pathway in murine T cells would provide the opportunity to more closely model specific human disease states that rely on CD4؉ T cell responses to IFN-␣␤. To this end, the C terminus of murine Stat2, harboring the mutation, was replaced with the corresponding human Stat2 sequence by a knockin targeting strategy within murine embryonic stem cells. Chimeric m/h Stat2 knockin mice were healthy, bred normally, and exhibited a normal lymphoid compartment. Furthermore, the murine/human STAT2 protein was expressed in Downloaded from murine CD4؉ T cells and was activated by murine IFN-␣ signaling. However, the murine/human STAT2 protein was insufficient to restore full IFN-␣-driven Th1 development as defined by IFN-␥ expression. Furthermore, IL-12, but not IFN-␣, promoted acute IFN-␥ secretion in collaboration with IL-18 stimulation in both CD4؉ and CD8؉ T cells. The inability of T cells to commit to Th1 development correlated with the lack of STAT4 phosphorylation in response to IFN-␣. This finding suggests that, although the C terminus of human STAT2 is required for STAT4 recruitment and activation by the human type I IFNAR (IFN-␣␤R), it is not sufficient to restore this process through the murine IFNAR complex. The Journal of Immunology, 2005, 174: 294–301. http://www.jimmunol.org/

defining hallmark of an adaptive immune response is through STAT4 (10–12) and promote IFN-␥ secretion in CD4ϩ T the orchestrated development of naive CD4ϩ T cells into cells (12–15). Furthermore, this pathway is not conserved and/or is A effector populations that secrete distinct subsets of cy- not efficient in murine CD4ϩ T cells (11, 12). Although recent tokines (1). These developmental cues are directed by innate cy- studies have called this observation into question (16–18), clearly tokines secreted by professional APCs responding to pathogens (2, the murine (m)3 IFN-␣␤R (IFNAR) is inefficient at promoting Th1 3). For example, macrophages and dendritic cells responding to development and requires extremely high concentrations of IFN-␣ Gram-negative bacteria secrete high levels of IL-12 and IL-18 (in- to detect this effect in murine T cells. The lack of an experimen- nate cytokines) and present Ag to naive CD4ϩ T cells (4). IL-12 tally tractable mouse model of IFN-␣-driven Th1 development is by guest on October 3, 2021 directs T cell development to the Th1 phenotype (5) through the a major barrier to understanding human immune responses to activation of a key second messenger, STAT4 (6, 7). The Th1 pathogens that promote IFN-␣␤ secretion, such as viruses. phenotype is characterized by secretion of high concentrations of Our previous studies have provided a molecular explanation for IFN-␥ at sites of inflammation. Furthermore, IFN-␥ secreted by the lack of IFN-␣␤-dependent Th1 development in mouse CD4ϩ Th1 cells mediates the elimination of both intracellular and extra- T cells (11, 19, 20). Unlike the IL-12R, our studies of the human cellular bacterial pathogens through the activation of granulocytes (h)IFNAR demonstrated that recruitment and activation of STAT4 and phagocytic cells. by the hIFNAR is mediated by STAT2 (11). STAT2 is recruited to The importance of Th1 cells in the immune response to patho- the hIFNAR by an Src homology 2 (SH2)-dependent interaction gens is highlighted by the fact that this developmental pathway is with phosphorylated Y466 within the hIFNAR1 subunit (21, 22). conserved in mammalian species. For CD4ϩ T cells, IL-12 sig- In contrast, although STAT4 requires an intact SH2 domain for naling and STAT4 activation is a conserved pathway that regulates efficient activation by the hIFNAR (19), it does not interact di- the first steps of commitment to IFN-␥ expression (6–9). However, rectly with any phosphorylated tyrosine residues within either the in humans, in addition to IL-12, type I IFNs (IFN-␣␤) also signal hIFNAR1 or R2 subunit (11). Rather, STAT4 recruitment occurs in a STAT2-dependent manner, possibly by an either direct or indirect interaction with Y833 and Y841 within the C terminus of *Center for Immunology and Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390; †Department of Pathology and Cen- human STAT2 (19). This interaction does not occur in mouse due ter for Immunology, and ‡Howard Hughes Medical Institute, Washington University to a significant mutation and insertion of a repetitive minisatellite School of Medicine, St. Louis, MO 63110 sequence within the C terminus of murine STAT2. As such, murine Received for publication April 16, 2004. Accepted for publication October 26, 2004. STAT2 fails to mediate STAT4 activation by the hIFNAR. Impor- The costs of publication of this article were defrayed in part by the payment of page tantly, expression of a chimeric m/h STAT2 molecule, whereby the C charges. This article must therefore be hereby marked advertisement in accordance terminus of the murine sequence has been replaced with the human with 18 U.S.C. Section 1734 solely to indicate this fact. counterpart, restores IFN-␣␤-dependent STAT4 phosphorylation in 1 This work was supported by grants from Howard Hughes Medical Institute and the National Institutes of Health awarded to K.M.M., and by a grant from the Leukemia STAT2-deficient human fibroblasts (19). and Lymphoma Society and start-up funds from Howard Hughes Medical Institute awarded to J.D.F. 2 Address correspondence and reprint requests to Dr. J. David Farrar, Center for Immu- 3 Abbreviations used in this paper: m, murine; h, human; KI, knockin; IFNAR, IFN- nology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, ␣␤R; SH2, Src homology 2; ES cell, embryonic stem cell; ISGF3, IFN-sensitive gene Dallas, TX 75390-9093. E-mail address: [email protected] factor-3.

Based on these results and the lack of IFN-␣␤-dependent Th1 T cell cultures ϩ responses observed in murine CD4 T cells (12, 23), we proposed Spleen and mesenteric lymph node cells from wild-type and m/h Stat2 that mice and humans might respond differently to pathogens such KI ϫ DO11.10 mice were cultured in IMDM supplemented with 10% FBS, as viruses that primarily evoke IFN-␣␤ secretion, as opposed to L-glutamine (200 ␮M), nonessential amino acids (10 ␮M each), sodium pyruvate (100 ␮M), 2-ME (50 ␮M), and penicillin/streptomycin (100 U/ml IL-12, from innate cells (20). A definitive test of this hypothesis ϩ involves reconstructing the IFN-␣␤ pathway to activate STAT4 in each) (HyClone). CD4 T cells were activated with OVA peptide (0.3 mM) and IL-2 (50 U/ml) under Th1 (anti-IL-4 (11B11; 10 ␮g/ml) and murine T cells. As a first step, we report here the development of rmIL-12 (10 U/ml; R&D Systems)), Th2 (anti-IL-12 (Tosh; 10 ␮g/ml) and a chimeric m/h Stat2 knockin (KI) mouse. The exon encoding the rmIL-4 (100 U/ml)), or under neutralizing conditions (anti-IL-4 plus anti- murine STAT2 C terminus, exon 23, was replaced with the cor- IL-12) in the absence or presence of IFN-␣ (typically 1000 U/ml; R&D responding human sequence by a targeted mutation of murine em- Systems). Cells were activated for 3 days and split 1:8 into medium containing additional IL-2 (50 U/ml) and cultured for an additional 4 days. bryonic stem (ES) cells. Surprisingly, and in contrast to recent ϩ ϩ For CD8 T cell cultures, splenocytes and lymph node cells were iso- reports, we found that murine CD4 T cells from m/h Stat2 KI lated from m/h Stat2 KI mice (129/SvJ background), and CD8ϩ T cells mice were not able to activate STAT4 or commit to IFN-␥ expres- were purified by flow-cytometric sorting. Purified CD8 T cells were acti- sion in response to mIFN-␣, even at extremely high concentrations vated with Con A in the presence of irradiated BALB/c splenocytes and of the cytokine. These results would suggest that an additional IL-2 (100 U/ml) in complete IMDM for 3 days. Cells were diluted 1/10 on species-specific component is required for the efficient recruitment day 3 in medium containing additional IL-2 (100 U/ml) and rested to day 7. of STAT4 to the mIFNAR. Intracellular cytokine staining and flow-cytometric analysis

Resting T cell cultures were restimulated in medium containing PMA (50 Downloaded from Materials and Methods ng/ml) and ionomycin (1 ␮M) for 4 h. In some cases, cells were restim- Mice ulated with recombinant cytokines rmIL-12 (10 U/ml), rmIL-18 (50 ng/ ␣ ␮ IL-12p40Ϫ/Ϫ (24) were purchased from The Jackson Laboratory and back- ml), and rmIFN- (1000 U/ml). Brefeldin A (1 g/ml; Sigma-Aldrich) was crossed five generations onto the DO11.10 TCR transgenic (BALB/c back- added during the last2hofstimulation. Activated cells were collected, fixed ground) (25). in 4% formalin, permeabilized with 0.05% saponin, and stained with fluoro- chrome-conjugated anti-IL-4 (11B11) and anti-IFN-␥ (R46A2) mAbs

(Caltag). Relative fluorescence was measured by flow-cytometric analysis us- http://www.jimmunol.org/ Generation of m/h Stat2 KI mice ing a FACSCalibur instrument (BD Biosciences) with emission compensation detection. A 129/SvJ bacterial artificial chromosome clone harboring the murine Stat2 gene was obtained by screening a bacterial artificial chromosome library with a probe generated from the 5Ј end of the murine Stat2 cDNA IFN-␥ ELISA (Genome Systems). A 20-kb fragment of the 3Ј region of murine Stat2 was subcloned into pBluescript (Stratagene) and extensively characterized by Detection of IFN-␥ by ELISA has been described previously (27). Briefly, restriction mapping and sequencing. The 5Ј region of the targeting con- Immulon 1B microtiter plates (ThermoLabsystems) were coated with pu- struct was assembled with three segments that included the replacement of rified mAb R46A2 (2 ␮g/ml; Caltag), and IFN-␥ protein was detected with exon 23 sequence with the corresponding human Stat2 C terminus sequence. a biotin-conjugated secondary mAb XMG1.2 (0.5 mg/ml; Caltag). Com- A 4-kb HindIII/AflII genomic fragment was cloned upstream of a 450-bp plexes were detected by incubation with streptavidin-HRP followed by by guest on October 3, 2021 AflII/BamHI-digested human Stat2 PCR fragment that was amplified with detection with 3,3Ј,5,5Ј-tetramethylbenzidine substrate. primers 5Ј-GCTGCAGCAGCCTCTGGAGCTTAAGCAGGATTCAGA and 3Ј-ACTGTCGGGATCCGGTTCCTAGAAGTCAGAAGGCATCAAG GGTCC. The fusion of these two fragments at the AflII site maintained the EMSA correct reading frame of exon 23. A 150-bp BglII-digested PCR fragment from the exon/intron junction of exon 23 was amplified with primers Nuclear extracts were prepared from T cells activated for 30 min with 5Ј-GCCTGAGATCTTGCAGCAGATTAGCGTGGAGG and 3Ј-GAT either medium alone, IL-12 (10 U/ml), or rmIFN-␣ (A) (1000 U/ml) as GAAGGAGATCTTTGGGGCTCACGTTTTGGC. This exon/intron joint previously described (11). To detect STAT2-containing IFN-sensitive gene fragment was cloned at the 3Ј BamHI site at the end of the human Stat2 factor-3 (ISGF3) complexes, 3 ␮g of nuclear extracts were incubated in 20 sequence described above, and this final 4.7-kb fragment was cloned into ␮l of binding reaction (10 mM Tris-Cl (pH 7.5), 50 mM NaCl, 1 mM DTT, the XhoI site of the pLNTK targeting vector. Together, these three com- 1 mM EDTA, 5% (v/v) glycerol, and 3 ␮g of poly(dI:dC) containing 1 ϫ ponents created the 5Ј region of homologous recombination and effectively 105 cpm 32P-labeled double-stranded IFN-stimulated regulatory element replaced the murine Stat2 C terminus with the human counterpart that oligonucleotide (GGGGGAAAGGGAAACCGAAACTGAACCCC). Re- included a stop codon at the end of this sequence. The remaining segment actions were incubated at room temperature for 30 min followed by the of exon 23 was preserved within this altered exon to ensure proper splicing addition of a supershifting Ab to some reactions. Complexes were resolved to exon 24, which encodes the natural polyadenylation sequence. The 3Ј on nondenaturing 4.5% acrylamide gels and visualized by autoradiography, end of homologous recombination consisted of a 4-kb XhoI fragment that as previously described. included the remaining segment of intron 23 through to the end of the last exon 24. This fragment was cloned into the SalI site within pLNTK. Transfected RW-4 ES cells (26) were placed in selection with G418. Immunoprecipitation and Western blotting Correctly targeted clones were identified by Southern blotting with probes derived from genomic sequence outside the regions of homologous recom- Resting T cell cultures (day 7, described above) were restimulated with bination. The PGK-neor cassette was removed by transient infection of ES either medium alone, or with medium containing rmIL-12 (10 U/ml) or clones with adenovirus vector expressing Cre recombinase. ES cells were rmIFN-␣ (A) (1000 U/ml) for 30 min at 37°C. Cells were harvested, injected into C57BL/6 blastocysts and implanted into pseudopregnant washed once in cold PBS, and lysed with 1 ml of lysis buffer (0.15 M NaCl, Swiss Black females. Chimeric male offspring were mated to C57BL/6 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris-Cl (pH females to determine germline transmission. Founders that were determined to 8.0)). Cell lysates were immunoprecipitated sequentially with anti-STAT4 transmit the chimeric allele were then mated to DO11.10 (BALB/c back- (5 ␮g/ml; SC-486; Santa Cruz) and anti-STAT1 (5 ␮g/ml; SC-346) poly- ground) for five generations. In addition, a second line was maintained on the clonal Abs in the presence of protein A-Sepharose (Amersham Bio- 129 background by first crossing founders to 129/SvJ followed by intercross sciences). Immunoprecipitates were resolved by SDS-PAGE and immuno- breedings to maintain this colony. Experimental groups were generated from blotted with a peroxidase-conjugated anti-phosphotyrosine Ab (RC20; crosses of heterozygous KI parents to generate both homozygous KI and Upstate Biotechnology). Immunoreactive complexes were detected by wild-type littermate controls. The m/h Stat2 KI allele was routinely detected by chemiluminescence. To detect equivalent STAT precipitation, blots were genomic PCR with primers 5Ј-GTGGACGAGCTGCAGCAG, 3Ј-ATAC stripped and incubated again with polyclonal Abs anti-STAT4 (SC-486) or CATGCATAGTGTG, and 3Ј-CTAGTCCTCAGAAGGTATCAAGAGTC anti-STAT1 (SC-346) and with a peroxidase-conjugated goat anti-rabbit Ig CATCCCAAGAG. secondary Ab. 296 EFFECT OF A CHIMERIC STAT2 MOLECULE ON Th1 DEVELOPMENT

Results the middle of intron 23. Following in vitro Cre-mediated deletion, Generation of m/h Stat2 KI mice only a single 12-nt loxP site was left within intron 23 and did not interfere with proper splicing of the message to exon 24, encoding We previously demonstrated that a chimeric m/h STAT2 molecule the natural polyadenylation signal. Homologous recombination could restore IFN-␣␤-dependent STAT4 activation when expressed in STAT2-deficient human fibroblasts (U6A cells) (19). To within ES cells was detected by Southern blotting with a genomic ϩ Ј reconstruct this pathway in murine CD4 T cells, we wished to DNA probe from the 3 end of the Stat2 gene outside the region of express the same molecule from the endogenous murine Stat2 lo- recombination (Fig. 1C). Generation of chimeric m/h Stat2 KI cus as that expressed in our in vitro studies (Fig. 1A). The diver- mice was performed by injection of targeted ES cells into gence of sequence similarity between murine and human Stat2 C57BL/6 blastocysts and implantation into pseudopregnant fe- begins within the first 50 nt of exon 23. The targeting construct males. Germline transmission was confirmed for three highly chi- was designed such that the region of sequence divergence within meric founders. Offspring were routinely monitored for the pres- exon 23 was replaced with the cDNA sequence encoding the hu- ence of the KI allele by genomic PCR analysis (Fig. 1D). man STAT2 C terminus, including a stop codon (Fig. 1, A and B). Both heterozygous and homozygous m/h Stat2 KI mice were The PGK-neor cassette was flanked by loxP sites and placed within fertile, produced normal-sized litters, and were of normal size and Downloaded from http://www.jimmunol.org/ by guest on October 3, 2021

FIGURE 1. Generation of m/h Stat2 KI mice. A, A chimeric m/h Stat2 molecule spliced just past the SH2 domain restores IFN-␣␤-dependent STAT4 activation in human cells (19) and is the basis for the KI targeting construct. B, The divergence between the murine and human sequences begins within exon 23. The targeting construct replaces this sequence with the human counterpart that contains the natural stop codon. The intron/exon structure is maintained following Cre-mediated deletion of the neor cassette that is flanked by loxP sites. C, Genomic DNAs from progeny (lanes 3–5) were probed with a segment of exon 24 resulting in a 14-kb band for the wild-type (WT) allele and a 4.5-kb band for the KI allele. D, Genomic DNAs from progeny (lanes 7–14) were amplified with one sense primer and two antisense primers resulting in a 850-bp band corresponding to the wild-type allele (lane 4) and 250- and 900-bp bands corresponding to the KI allele (lanes 5–6; see B). The Journal of Immunology 297 weight. Lymphocyte analysis of thymus, mesenteric lymph nodes, and spleen revealed a normal complement of CD4ϩ and CD8ϩ cells, indicating that T cell development was unaltered by the Stat2 modification (data not shown). Additionally, we found that splenic B cells (B220ϩ) and monocytes (CD11bϩ) were also normal in m/h Stat2 KI mice (data not shown). The chimeric m/h STAT2 molecule is expressed and functional in murine CD4ϩ T cells Our previous studies demonstrated that both the full-length murine STAT2 and the m/h STAT2 chimeric molecules could be recruited and activated by the hIFNAR (19). However, it is possible that activation of murine STAT2 by the mIFNAR requires specific sequences within the murine STAT2 molecule that would be abol- ished by the expression of the chimeric m/h STAT2. Thus, two criteria must be met before IFN-␣␤-dependent STAT4 activation can be assessed: the m/h STAT2 molecule must be 1) expressed in CD4ϩ T cells and 2) activated by the mIFNAR. Northern blot analysis of RNA isolated from purified CD4ϩ T cells demonstrated a gene-dose-dependent expression of murine Stat2 in the Downloaded from wild-type and m/h Stat2 heterozygous backgrounds that hybridized with a probe specific for the murine Stat2 C terminus (Fig. 2A, upper panel). This probe contained a 20-nt overlap of sequence within the C terminus that is not divergent between mouse and human, and explains the low degree of hybridization seen in the homozygous KI (Fig. 2A, upper panel, lane 3). Furthermore, a http://www.jimmunol.org/ probe from the C terminus of human Stat2 hybridized to a band corresponding to the m/h Stat2 mRNA in both heterozygous and homozygous KI T cells (Fig. 2A, middle panel). The m/h Stat2 mRNA was translated into a protein of the correct molecular mass and was recognized by an anti-STAT2 Ab specific for the C terminus of human STAT2 (Fig. 2, B and C). In addition, this Ab was also capable of specifically immunoprecipitating the chimeric m/h STAT2 molecule from CD4ϩ T cell lysates. A pre- FIGURE 2. Expression and activation of the m/h STAT2 chimeric mol- by guest on October 3, 2021 vious report of the STAT2 knockout demonstrated that ablation of ecule. A, Total RNA isolated from wild-type, m/h Stat2 heterozygous, and STAT2 dramatically decreased the expression of other STAT mol- homozygous splenocytes, and human Hut78 cells were probed with cDNA ecules, including STAT1. However, the m/h STAT2 molecule de- corresponding to the murine STAT2 C terminus (top panel), the human scribed in this study did not alter expression of STAT1 in murine STAT2 C terminus (middle panel), and GAPDH (bottom panel). B, Whole- T cells (Fig. 2B). cell lysates from wild-type, and m/h Stat2 KI homozygous splenocytes IFN-␣␤-mediated STAT2 phosphorylation is accompanied by were probed with an anti-STAT2 Ab specific for the C terminus of human STAT2 and an anti-STAT1 polyclonal Ab. C, Whole-cell lysates from concomitant phosphorylation of STAT1 and the assembly of the wild-type and m/h Stat2 heterozygous splenocytes were immunoprecipi- ISGF3 complex containing a heterotrimer of STAT1, STAT2, and tated with an anti-STAT2 Ab specific for the C terminus of human STAT2. IFN regulatory factor 9 (28). We detected the formation of this The resulting blot was probed with the same anti-STAT2 Ab. D, Enriched complex in murine T cells by EMSA. ISGF3 was induced by mu- CD4ϩ T cells from wild-type, heterozygous and homozygous m/h Stat2 KI rine IFN-␣ (A) in both wild-type and m/h Stat2 KI T cells (Fig. mice were activated for 30 min with rmIFN-␣ (A) (1000 U/ml). Nuclear 2D). Furthermore, a supershift complex was identified in heterozy- extracts from activated cells were incubated with a 32P-labeled IFN-stim- gous and homozygous KI T cells by incubation of nuclear extracts ulated regulatory element probe in the presence or absence of an anti- with an anti-STAT2 Ab specific for the human STAT2 C terminus. STAT2 Ab specific for the human C terminus. Collectively, these data demonstrate that the chimeric m/h Stat2 gene is expressed and translated into protein in murine T cells. Furthermore, the chimeric m/h STAT2 molecule is functionally sess developmental commitment to the Th1 phenotype, lymph activated by the mIFNAR and capable of binding DNA. node and splenic T cells were activated with OVA peptide and IL-2 in the absence or presence of specific cytokines and/or anti- Expression of m/h STAT2 is not sufficient to restore cytokine Abs for 3 days. Cells were split into new medium con- ␣␤ IFN- -dependent Th1 development taining IL-2 for an additional 4 days before restimulation and cy- Commitment of CD4ϩ T cells to high levels of IFN-␥ secretion tokine measurements. As expected, primary activation of cells occurs, in part, by a STAT4-dependent process (29). As a first step under typical Th1-inducing conditions (␣-IL-4 plus IL-12) led to in measuring the reconstitution of IFN-␣␤-dependent signaling for robust IFN-␥ secretion upon secondary activation of cells with Th1 development, we crossed the m/h Stat2 KI to the DO11.10 either PMA/ionomycin (Fig. 3A, condition no. 2), or with plate- TCR (TCR) transgenic on the BALB/c background (25). In these bound anti-CD3 (B). Activation with rmIFN-␣ (A) (Fig. 3, A and mice, the majority of T cells are selected by I-Ad and respond to B, condition no. 3) induced a 2- to 4-fold increase in the percentage a single peptide derived from the chicken OVA protein. Thus, in of cells capable of producing IFN-␥ when compared with cells vitro T cell cultures from these mice can be activated by a single developing under neutralizing conditions (Fig. 3, A and B, condi- Ag (OVA peptide) under well-defined cytokine conditions. To as- tion no. 1). Although rmIFN-␣ (A) (specific activation of murine 298 EFFECT OF A CHIMERIC STAT2 MOLECULE ON Th1 DEVELOPMENT

cells) was more active than rhIFN-␣ (A/D) (active on both murine and human cells) at promoting some cells to commit to IFN-␥ secretion, the induction of Th1 development relative to the effects of IL-12 was very low. However, similar levels of IFN-␥ secretion were observed in wild-type and m/h Stat2 KI T cells regardless of primary stimulation conditions. Recent studies have suggested that murine T cells have the capacity to respond to IFN-␣␤ for IFN-␥ production (16–18). How- ever, in some cases, those experiments were performed with relatively high concentrations of IFN-␣ (50,000–100,000 U/ml) compared with the levels normally used to assess human T cell differentiation (500–1,000 U/ml). Based on these observations, wild-type and m/h Stat2 KI T cells were tested for their ability to commit to Th1 development in response to increasing concentrations of IFN-␣. In this study, T cell cultures were activated in the presence of anti-IL-12 (Tosh) (30) and increasing concentrations of rmIFN-␣ (A) ranging from 100 to 100,000 U/ml (see Fig. 5, C and D). In contrast to previous studies, we found no difference in the levels of IFN-␥ secreted upon secondary activation when comparing cells activated under neutralizing conditions (anti-IL-12) Downloaded from and cells activated with IFN-␣ at any concentration. In addition, there were no significant differences in the percentage of cells capable of secreting IFN-␥ between wild-type and m/h Stat2 KI T cells. The overall quantity of IFN-␥ secreted by cells polarized in the presence of increasing concentrations of rmIFN-␣ (A) was confirmed by ELISAs (Fig. 3D) and further demonstrated that http://www.jimmunol.org/ IFN-␣ failed to promote Th1 polarization in m/h Stat2 KI T cells. In addition to the developmental effects exerted by STAT4 activation, an additional STAT4-dependent pathway regulates acute induction of IFN-␥ gene transcription within fully differentiated Th1 cells. Combinatorial treatment of Th1 cells with IL-12 plus IL-18 induces sustained levels of IFN-␥ secretion in the absence of TCR activation (31, 32). This dual signaling pathway is dependent upon STAT4 activation and is conserved between murine and hu- by guest on October 3, 2021 man Th1 cells (14, 33). In human Th1 cells, IFN-␣ plus IL-18 also induce acute IFN-␥ secretion, in part, due to the activation of STAT4 (33). Although the m/h STAT2 molecule failed to mediate IFN-␣␤-dependent Th1 development, it was possible that the acute pathway for IFN-␥ gene expression in fully differentiated Th1 cells was restored by this genetic modification. This hypothesis was tested by activating DO11.10ϩ T cells from wild-type and m/h Stat2 KI mice in the presence of IL-12 for 7 days to promote Th1 development. These cells were then restimulated in the presence of either IL-12 plus IL-18 or with rmIFN-␣ (A) plus IL-18 for 24 h (Fig. 4). Consistent with our prior results, we found that dual stimulation with IFN-␣ plus IL-18 did not promote IFN-␥ secretion from either wild-type or m/h Stat2 KI T cells. The C terminus of human STAT2 is not sufficient to mediate IFN-␣␤-dependent STAT4 activation FIGURE 3. IFN-␣ does not induce Th1 development in m/h Stat2 KI In human cells, species-specific determinants within the human CD4ϩ T cells. DO11.10ϩ splenocytes and lymph nodes from wild-type, STAT2 C terminus were necessary for recruiting STAT4 to the heterozygous and homozygous m/h Stat2 KI mice were stimulated with hIFNAR (19). To test the sufficiency of this domain in recruiting OVA peptide and the indicated anti-cytokine Abs or cytokines. A and B, STAT4 to the mIFNAR, we assessed STAT4 phosphorylation in Cells were restimulated with PMA/ionomycin (A) or plate-bound anti-CD3 wild-type and m/h Stat2 KI T cells. DO11.10ϩ T cells were acti- (B) and analyzed for IFN-␥ expression by intracellular staining and flow ϩ ϩ vated with OVA peptide and IL-12 for 7 days to generate cells that cytometry. Live cells were gated on CD4 T cells. C and D, DO11.10 splenocytes and lymph nodes from wild-type, homozygous m/h Stat2 KI, could respond to subsequent activation with IL-12 as a positive and IL-12p40Ϫ/Ϫ mice were stimulated with OVA peptide in the presence control. Resting Th1 cells were restimulated with either medium of anti-IL-12 (Control), IL-12 (10 U/ml), or with anti-IL-12 and increasing alone, IL-12, or with rmIFN-␣ (A). STAT4 and STAT1 tyrosine concentrations of rmIFN-␣ (A) as indicated in the figure. Cells were re- phosphorylation was determined by immunoblotting (Fig. 5). stimulated for4h(C)or24h(D) on day 7, and IFN-␥ expression was IL-12 was active in both wild-type and KI Th1 cells to promote measured on by intracellular cytokine staining (C) and ELISA (D). Each STAT4 phosphorylation; however, rmIFN-␣ did not exhibit such experimental point was performed in triplicate, and the data are represen- activity. The failure of IFN-␣ to activate STAT4 was not due to a tative of three independent experiments. general lack of IFNAR activation, because STAT1 was robustly The Journal of Immunology 299

FIGURE 4. IFN-␣ does not synergize with IL-18 to induce IFN-␥ secretion in m/h Stat2 KI CD4ϩ T cells. DO11.10ϩ splenocytes and lymph node cells from wild-type, heterozygous and homozygous m/h Stat2 KI FIGURE 5. The C terminus of hSTAT2 is not sufficient to restore IFN- mice were stimulated with OVA peptide under Th1-inducing conditions ␣ ϩ -dependent STAT4 tyrosine phosphorylation in murine CD4 T cells. Downloaded from ␥ ϩ (IL-12 plus IFN- plus anti-IL-4) for 3 days and rested in medium con- DO11.10 lymph node and spleen cells from wild-type (lanes 1–3) and taining IL-2 until day 7. Cells were restimulated as indicated in the figure m/h Stat2 KI (lanes 4–6) mice were stimulated with OVA peptide in and analyzed for IFN-␥ secretion by intracellular staining and flow cytom- ␥ ϩ Th1-inducing conditions (anti-IL-4, IFN- , and IL-12) for 3 days and split etry. Live cells were gated on CD4 T cells. 1:8 in medium containing IL-2. On day 7, cells were washed and restimulated for 30 min at 37°C with either medium alone (lanes 1 and 4), or with medium containing IL-12 (10 ng/ml; lanes 2 and 5) or with rmIFN-␣ (A) phosphorylated in both wild-type and KI T cells (Fig. 5, lower (1000 U/ml; lanes 3 and 6). Cell lysates were prepared and immunopre- http://www.jimmunol.org/ panel). Furthermore, previous studies with both human and murine cipitated with anti-STAT4 (SC-486) and anti-STAT1 (SC-346; Santa Cruz) STAT2-deficient cells demonstrated that STAT1 activation is de- polyclonal Abs. Immunoprecipitates were immunoblotted for both phosphotyrosine (P-Y; RC20) and for STAT4 and STAT1 as indicated in the pendent upon the presence of a functional STAT2 molecule (22, figure. 34, 35). Thus, we conclude that the chimeric m/h STAT2 molecule is functional to recruit and activate STAT1, but not STAT4, in murine T cells. Taken together, this study demonstrates that, al- secreting cells (Fig. 6A, c and i), and this effect was enhanced by though sequences within the C terminus of STAT2 are required in combined stimulation with IL-12 (A, e and k) but not with IFN-␣ human cells, this domain is not sufficient to promote STAT4 re- ( f and l). However, only IL-12 plus IL-18 activation led to a sig- by guest on October 3, 2021 cruitment and activation by the mIFNAR. nificant accumulation of IFN-␥ in the culture supernatants during a 24-h stimulation (Fig. 6B), indicating that the percentage of cells ␣ ␥ ϩ IFN- fails to promote IFN- secretion in murine CD8 T cells capable of expressing IFN-␥ in response to IL-18 or IL-18 plus A recent report has suggested that IFN-␣␤ can promote STAT4 IFN-␣ was transient and not sustained. Furthermore, the levels of phosphorylation and IFN-␥ secretion from murine T cells in a IFN-␥ secreted in response to IL-18 were not significantly different murine model of lymphocytic choriomeningitis virus infection from the levels observed in response to combined stimulation with (16). However, their system relied primarily on the secretion of IL-18 plus IFN-␣. These data demonstrate that, unlike IL-12, IFN-␥ by CD8ϩ T cells. Thus, it was possible that IFN-␣ signaling IFN-␣ stimulation has no direct effect on acute induction of IFN-␥ ϩ for IFN-␥ secretion was more efficient in murine CD8ϩ than in gene expression in CD8 T cells. Furthermore, we found no sig- CD4ϩ T cells. Based on those results, we wished to determine nificant difference in either the percentage of cells capable of ex- whether IFN-␣-driven IFN-␥ secretion was more efficient in mu- pressing IFN-␥ or the accumulation of IFN-␥ within the culture ϩ rine CD8ϩ cells that expressed the m/h STAT2 chimeric molecule. supernatants of wild-type vs m/h Stat2 KI CD8 cells responding Unlike CD4ϩ T cells, murine CD8ϩ T cells do not require STAT4 to IFN-␣ stimulation. signaling to become competent to secrete high levels of IFN-␥ upon restimulation through the TCR (29). However, acute IL-12/ Discussion IL-18-mediated IFN-␥ secretion from CD8ϩ T cells remains de- A central role for STAT4 in promoting Th1 development and pendent upon STAT4 activation. Thus, for these experiments, type I responses in vivo has been demonstrated directly in Stat4- CD8ϩ T cells were purified from wild-type and m/h Stat2 KI mice deficient mice (6, 7) as well as in other genetic backgrounds that (on 129/SvJ background) by flow-cytometric sorting. Cells were influence STAT4 activation such as IL-12R knockouts (36, 37). activated with irradiated allogeneic BALB/c splenocytes in the Early evidence of species-specific IFN-␣␤-induced STAT4 acti- presence of Con A for 3 days followed by dilution in medium vation (11, 12, 23, 38) correlated well with the known biological containing additional IL-2 and rested to day 7. CD8ϩ T cells were responses when comparing mouse and human T cells. Collec- then washed extensively, restimulated with recombinant cytokines, tively, these correlations predict that any receptor, including the and analyzed for IFN-␥ secretion by both intracellular cytokine IFNAR, that can activate STAT4 within CD4ϩ T cells would have staining (Fig. 6A) and ELISA (B). the capacity to drive IFN-␥ gene expression in both mouse and Stimulation of CD8ϩ cells with either IL-12 or IFN-␣ alone did human T cells. STAT4 activation by the hIFNAR involves the not lead to significant increases in either the percentage of cells presence of activated STAT2 (11), and this interaction maps to a capable of expressing IFN-␥ (Fig. 6A, b, d, h, and j) or accumu- nonconserved region within the STAT2 C terminus (19). In this lation of IFN-␥ in the culture supernatants (B), as expected. IL-18 study, we demonstrated that, although this sequence within STAT2 stimulation led to a marked increase in the percentage of IFN-␥- is required to recruit and activate STAT4 within human cells, it is 300 EFFECT OF A CHIMERIC STAT2 MOLECULE ON Th1 DEVELOPMENT

Indeed, neither the IFNAR1 nor -R2 subunits are well conserved between mouse and human. However, we demonstrated that STAT4 did not interact with any potential phosphotyrosine residues within either the hIFNAR1 or -R2 subunit by a phosphopep- tide competition EMSA assay (11). Recently, several studies have demonstrated a unique requirement for STAT N-terminal domains that regulate receptor-proximal activation. For example, in human cells, the STAT2 N-domain mediates a direct interaction with the IFNAR2 cytoplasmic domain, and this interaction is formed before cytokine activation (39). This preassociated complex facilitates cytokine-mediated phosphorylation of STAT2. An analogous mechanism might be operative for STAT4. First, several reports have demonstrated that the STAT4 N-domain is required for efﬁcient phosphorylation in response to both IL-12 and IFN-␣ (40–42). Indeed, transgenic expression of STAT4 lack- ing the N-domain fails to reconstitute IL-12-driven STAT4 phosphorylation or Th1 development when crossed to the STAT4-de- ﬁcient background (42). Crystallographic data have demonstrated

that the STAT4 N-domain exists as a latent dimer through homo- Downloaded from typic interaction (43). Although this structure has been re-evalu- ated (41, 44), the existence and purpose of this latent STAT4 dimer in cytokine-driven phosphorylation has been recently examined. In this study, instead of completely removing the N-domain from the primary STAT4 sequence, speciﬁc residues that mediate N-domain

dimer formation were mutated and expressed within both human http://www.jimmunol.org/ fibroblasts and murine Stat4-deficient T cells (41). These experiments revealed that mutation of these critical N-domain residues abrogated STAT4 phosphorylation in response to both IFN-␣ (in human fibroblasts) and IL-12 (in murine T cells), suggesting a common mechanism for recruitment of STAT4 to both the IL-12R and the hIFNAR. Whether STAT4, like STAT2, preassociates with either the IL-12R or the hIFNAR has not been reported yet. How- ever, due to the significant sequence divergence within both the IFNAR1 and -R2 subunits between mouse and human, it is ex- by guest on October 3, 2021 pected that the conserved STAT4 N-domain would interact in a species-specific manner with the cytoplasmic domain of the hIF- NAR. If this is the case, then the hIFNAR cytoplasmic domain would represent a second species-specific component necessary for the recruitment and activation of STAT4. Furthermore, this possibility would also explain why the modification of STAT2 described here was not sufficient to activate STAT4 by the mIF- NAR in murine CD4ϩ T cells. In contrast to our initial characterization of the species-specific link between IFN-␣␤ signaling and STAT4 activation, recent reports have suggested that IFN-␣␤ can activate STAT4 and promote IFN-␥ expression in murine T cells (16, 17). These studies used relatively high concentrations of IFN-␣ to detect this effect. Based on this observation, we considered the possibility that, al- FIGURE 6. IFN-␣ does not synergize with IL-18 to induce IFN-␥ se- though the mIFNAR was inefficient at activating STAT4, this ef- cretion in m/h Stat2 KI CD8ϩ T cells. CD8ϩ T cells were purified by fect could be overcome by titrating IFN-␣ to very high concen- flow-cytometric sorting from lymph nodes of wild-type and m/h Stat2 KI trations. However, we found that wild-type, m/h Stat2 KI, and mice (on 129/SvJ background). Cells were stimulated with Con A (5 ␮g/ IL-12p40-deficient CD4ϩ T cells did not secrete significant levels ml) in the presence of irradiated BALB/c splenocytes for 3 days and rested of IFN-␥ when activated in the presence of rmIFN-␣ (A) at any in medium containing IL-2 until day 7. Cells were restimulated with re- concentration (up to 100,000 U/ml; Fig. 3, C and D). It has been combinant cytokines as indicated in the figure for4h(A)or24h(B), and ␣ IFN-␥ expression was determined by intracellular cytokine staining (A) and suggested that the use of different IFN- subtypes could account by ELISA (B). for this discrepancy. However, Berenson et al. (45) recently demonstrated that, although mIFN-␣ (A) was more active than rhIFN-␣ (A/D) at promoting weak STAT4 phosphorylation (as not sufficient to promote STAT4 phosphorylation or Th1 commit- observed by Nguyen et al. (16)), neither of these IFN-␣ subtypes ment within murine CD4ϩ T cells. was able to induce Th1 commitment within CD4ϩ T cells, and the In our initial studies of the hIFNAR, we considered the possi- present study confirms this observation. In addition, Nguyen et al. bility that STAT4 was recruited directly to the IFNAR via inter- (16) reported elevated STAT4 phosphorylation in response to actions with the cytoplasmic domain of the receptor subunits (11). IFN-␣␤ in murine CD8ϩ cells compared with enriched CD4ϩ T The Journal of Immunology 301 cells. Although a STAT4-dependent, IL-12-independent mecha- 18. Wang, J., N. Pham-Mitchell, C. Schindler, and I. L. Campbell. 2003. Dysregu- ␥ ϩ lated Sonic hedgehog signaling and medulloblastoma consequent to IFN-␣-stim- nism for commitment to IFN- secretion exists for CD8 T cells ␥ ϩ ulated STAT2-independent production of IFN- in the brain. J. Clin. Invest. (29), we found no evidence that CD8 T cells could secrete IFN-␥ 112:535. in response to acute stimulation with IFN-␣ in either the absence 19. Farrar, J. D., J. D. Smith, T. L. Murphy, S. Leung, G. R. Stark, and K. M. Murphy. 2000. Selective loss of type I interferon-induced STAT4 activa- or presence of IL-18. Thus, based on our present findings, we tion caused by a minisatellite insertion in mouse Stat2. Nat. Immunol. 1:65. conclude that IFN-␣ does not promote efficient STAT4 phosphor- 20. Farrar, J. D., and K. M. Murphy. 2000. Type I interferons and T helper devel- ylation or IFN-␥ expression in murine T cells even in the presence opment. Immunol. Today 21:484. 21. Yan, H., K. Krishnan, A. C. Greenlund, S. Gupta, J. T. Lim, R. D. Schreiber, of a humanized STAT2 molecule. A direct comparison of IFN- C. W. Schindler, and J. J. Krolewski. 1996. Phosphorylated interferon-␣ receptor ␣␤-dependent STAT4 phosphorylation (11, 12) and Th1 develop- 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa ment (12) between mouse and human CD4ϩ T cells has been de- STAT2 protein. EMBO J. 15:1064. 22. Qureshi, S. A., S. Leung, I. M. Kerr, G. R. Stark, and J. E. Darnell, Jr. 1996. scribed in detail, and forms the basis of the present study. Function of Stat2 protein in transcriptional activation by ␣-interferon. Mol. Cell. However, given the recent controversy using different in vivo and Biol. 16:288. 23. Wenner, C. A., M. L. Guler, S. E. Macatonia, A. O’Garra, and K. M. Murphy. in vitro model systems, this issue clearly warrants further study. 1996. Roles of IFN-␥ and IFN-␣ in IL-12-induced T helper cell-1 development. J. Immunol. 156:1442. Acknowledgments 24. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, and M. K. Gately. 1996. We thank Erik Geissal and Loderick Matthews for excellent technical as- IL-12-deficient mice are defective in IFN-␥ production and type 1 cytokine resistance, Alec Cheng and Barry Sleckman for help with ES cell targeting, sponses. Immunity 4:471. Michael White for blastocyst injections, and Angela Mobley for assistance 25. Murphy, K. M., A. B. Heimberger, and D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4ϩCD8ϩTCRlo thymocytes in vivo. Science with flow cytometry. We thank Theresa Murphy, Douglas Tyler, Ann 250:1720. Davis, and Nishant Sahni for helpful discussions, and Christoph Wu¨lfing 26. Hug, B. A., R. L. Wesselschmidt, S. Fiering, M. A. Bender, E. Epner, Downloaded from and Lora Hooper for critically reading the manuscript. M. Groudine, and T. J. Ley. 1996. Analysis of mice containing a targeted deletion of ␤-globin locus control region 5Ј hypersensitive site 3. Mol. Cell. Biol. 16:2906. 27. Hsieh, C. S., A. B. Heimberger, J. S. Gold, A. O’Garra, and K. M. Murphy. 1992. References Differential regulation of T helper phenotype development by interleukins 4 and 1. Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, 10 in an ␣␤ T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA M. Afkarian, and T. L. Murphy. 2000. Signaling and transcription in T helper 89:6065. development. Annu. Rev. Immunol. 18:451. 28. Qureshi, S. A., M. Salditt-Georgieff, and J. E. Darnell, Jr. 1995. Tyrosine-phos-

2. Moser, M., and K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 phorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA in forming http://www.jimmunol.org/ development. Nat. Immunol. 1:199. interferon-stimulated-gene factor 3. Proc. Natl. Acad. Sci. USA 92:3829. 3. Szabo, S. J., B. M. Sullivan, S. L. Peng, and L. H. Glimcher. 2003. Molecular 29. Carter, L. L., and K. M. Murphy. 1999. Lineage-speciﬁc requirement for signal mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21:713. transducer and activator of transcription (Stat)4 in interferon ␥ production from 4. Reis e Sousa, C., A. Sher, and P. Kaye. 1999. The role of dendritic cells in the CD4ϩ versus CD8ϩ T cells. J. Exp. Med. 189:1355. induction and regulation of immunity to microbial infection. Curr. Opin. Immu- 30. Tripp, C. S., M. K. Gately, J. Hakimi, P. Ling, and E. R. Unanue. 1994. Neu- nol. 11:392. tralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: 5. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, and reversal by IFN-␥. J. Immunol. 152:1883. K. M. Murphy. 1993. Development of TH1 CD4ϩ T cells through IL-12 pro- 31. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, duced by Listeria-induced macrophages. Science 260:547. S. Menon, R. Kastelein, F. Bazan, and A. O’Garra. 1997. IGIF does not drive Th1 6. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, development but synergizes with IL-12 for interferon-␥ production and activates R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, and IRAK and NF␬B. Immunity 7:571.

J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of 32. Yang, J., T. L. Murphy, W. Ouyang, and K. M. Murphy. 1999. Induction of by guest on October 3, 2021 natural killer and T cells. Nature 382:171. interferon-␥ production in Th1 CD4ϩ T cells: evidence for two distinct pathways 7. Kaplan, M. H., Y. L. Sun, T. Hoey, and M. J. Grusby. 1996. Impaired IL-12 for promoter activation. Eur. J. Immunol. 29:548. responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 33. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, 382:174. I. Julkunen, and T. Sareneva. 2001. IFN-␣ and IL-18 synergistically enhance 8. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, IFN-␥ production in human NK cells: differential regulation of Stat4 activation J. E. Darnell, Jr., and K. M. Murphy. 1995. Interleukin 12 signaling in T helper and IFN-␥ gene expression by IFN-␣ and IL-12. Eur. J. Immunol. 31:2236. type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and 34. Park, C., S. Li, E. Cha, and C. Schindler. 2000. Immune response in Stat2 knock- activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755. out mice. Immunity 13:795. 9. Bacon, C. M., E. F. Petricoin III, J. R. Ortaldo, R. C. Rees, A. C. Larner, 35. Leung, S., S. A. Qureshi, I. M. Kerr, J. E. Darnell, Jr., and G. R. Stark. 1995. Role J. A. Johnston, and J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphor- of STAT2 in the ␣ interferon signaling pathway. Mol. Cell. Biol. 15:1312. ylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. 36. Wu, C., J. Ferrante, M. K. Gately, and J. Magram. 1997. Characterization of USA 92:7307. IL-12 receptor ␤1 chain (IL-12R␤1)-deficient mice: IL-12R␤1 is an essential 10. Cho, S. S., C. M. Bacon, C. Sudarshan, R. C. Rees, D. Finbloom, R. Pine, and J. J. component of the functional mouse IL-12 receptor. J. Immunol. 159:1658. O’Shea. 1996. Activation of STAT4 by IL-12 and IFN-␣: evidence for the in- 37. Wu, C., X. Wang, M. Gadina, J. J. O’Shea, D. H. Presky, and J. Magram. 2000. volvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. IL-12 receptor ␤2 (IL-12R␤2)-deficient mice are defective in IL-12-mediated 157:4781. signaling despite the presence of high affinity IL-12 binding sites. J. Immunol. 11. Farrar, J. D., J. D. Smith, T. L. Murphy, and K. M. Murphy. 2000. Recruitment 165:6221. of Stat4 to the human interferon-␣/␤ receptor requires activated Stat2. J. Biol. 38. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, and Chem. 275:2693. F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component 12. Rogge, L., D. D’Ambrosio, M. Biffi, G. Penna, L. J. Minetti, D. H. Presky, by human T helper 1 cells. J. Exp. Med. 185:825. L. Adorini, and F. Sinigaglia. 1998. The role of Stat4 in species-specific regu- 39. Li, X., S. Leung, I. M. Kerr, and G. R. Stark. 1997. Functional subdomains of lation of Th cell development by type I IFNs. J. Immunol. 161:6567. STAT2 required for preassociation with the ␣ interferon receptor and for signal- 13. Parronchi, P., M. De Carli, R. Manetti, C. Simonelli, S. Sampognaro, ing. Mol. Cell. Biol. 17:2048. M. P. Piccinni, D. Macchia, E. Maggi, G. Del Prete, and S. Romagnani. 1992. 40. Murphy, T. L., E. D. Geissal, J. D. Farrar, and K. M. Murphy. 2000. Role of the IL-4 and IFN (␣ and ␥) exert opposite regulatory effects on the development of Stat4 N domain in receptor proximal tyrosine phosphorylation. Mol. Cell. Biol. cytolytic potential by Th1 or Th2 human T cell clones. J. Immunol. 149:2977. 20:7121. 14. Sareneva, T., S. Matikainen, M. Kurimoto, and I. Julkunen. 1998. Influenza A 41. Ota, N., T. J. Brett, T. L. Murphy, D. H. Fremont, and K. M. Murphy. 2004. virus-induced IFN-␣/␤ and IL-18 synergistically enhance IFN-␥ gene expression N-domain-dependent nonphosphorylated STAT4 dimers required for cytokine- in human T cells. J. Immunol. 160:6032. driven activation. Nat. Immunol. 5:208. 15. Brinkmann, V., T. Geiger, S. Alkan, and C. H. Heusser. 1993. Interferon-␣ in- 42. Chang, H. C., S. Zhang, I. Oldham, L. Naeger, T. Hoey, and M. H. Kaplan. 2003. creases the frequency of interferon-␥-producing human CD4ϩ T cells. J. Exp. STAT4 requires the N-terminal domain for efficient phosphorylation. J. Biol. Med. 178:1655. Chem. 278:32471. 16. Nguyen, K. B., W. T. Watford, R. Salomon, S. R. Hofmann, G. C. Pien, 43. Vinkemeier, U., I. Moarefi, J. E. Darnell, Jr., and J. Kuriyan. 1998. Structure of A. Morinobu, M. Gadina, J. J. O’Shea, and C. A. Biron. 2002. Critical role for the amino-terminal protein interaction domain of STAT-4. Science 279:1048. STAT4 activation by type 1 interferons in the interferon-␥ response to viral 44. Chen, X., R. Bhandari, U. Vinkemeier, F. Van Den Akker, J. E. Darnell, Jr., and infection. Science 297:2063. J. Kuriyan. 2003. A reinterpretation of the dimerization interface of the N-ter- 17. Freudenberg, M. A., T. Merlin, C. Kalis, Y. Chvatchko, H. Stubig, and minal domains of STATs. Protein Sci. 12:361. C. Galanos. 2002. Cutting edge: a murine, IL-12-independent pathway of IFN-␥ 45. Berenson, L. S., J. D. Farrar, T. L. Murphy, and K. M. Murphy. 2004. Frontline: induction by Gram-negative bacteria based on STAT4 activation by type I IFN absence of functional STAT4 activation despite detectable tyrosine phosphory- and IL-18 signaling. J. Immunol. 169:1665. lation induced by murine IFN-␣. Eur. J. Immunol. 34:2365.