BRD7, a Subunit of SWI/SNF Complexes, Binds Directly to BRCA1 and Regulates BRCA1-Dependent Transcription

Published OnlineFirst March 9, 2010; DOI: 10.1158/0008-5472.CAN-09-2089

Tumor and Stem Cell Biology Cancer Research BRD7, a Subunit of SWI/SNF Complexes, Binds Directly to BRCA1 and Regulates BRCA1-Dependent Transcription

Mary T. Harte, Garrett J. O'Brien, Niamh M. Ryan, Julia J. Gorski, Kienan I. Savage, Nyree T. Crawford, Paul B. Mullan, and D. Paul Harkin

Abstract We carried out a yeast two-hybrid screen using a BRCA1 bait composed of amino acids 1 to 1142 and identified BRD7 as a novel binding partner of BRCA1. This interaction was confirmed by coimmunoprecipitation of endogenous BRCA1 and BRD7 in T47D and HEK-293 cells. BRD7 is a bromodomain containing protein, which is a subunit of PBAF-specific Swi/Snf chromatin remodeling complexes. To determine the functional consequences of the BRCA1-BRD7 interaction, we investigated the role of BRD7 in BRCA1-dependent transcription using microarray-based expression profiling. We found that a variety of targets were coordinately regulated by BRCA1 and BRD7, such as estrogen receptor α (ERα). Depletion of BRD7 or BRCA1 in either T47D or MCF7 cells resulted in loss of expression of ERα at both the mRNA and protein level, and this loss of ERα was reflected in resistance to the antiestrogen drug fulvestrant. We show that BRD7 is present, along with BRCA1 and Oct-1, on the ESR1 promoter (the gene which encodes ERα). Depletion of BRD7 prevented the recruitment of BRCA1 and Oct-1 to the ESR1 promoter; however, it had no effect on the recruitment of the other Swi/Snf subunits BRG1, BAF155, and BAF57 or on RNA polymerase II recruitment. These results support a model whereby the regulation of ERα transcription by BRD7 is mediated by its recruitment of BRCA1 and Oct-1 to the ESR1 promoter. Cancer Res; 70(6); 2538–47. ©2010 AACR.

Introduction providing one possible mechanism for the ERα-negative sta- tus of BRCA1 tumors (6). Transcription is a complex multi- Germ line mutations within BRCA1 confer a genetic pre- step process, and BRCA1 seems to work at several levels, as disposition to breast and ovarian cancer. BRCA1 has been determined by its interaction with proteins, which act at dif- implicated in diverse functions, in particular DNA damage ferent stages. BRCA1 has been shown to associate, via RNA repair, cell cycle checkpoint control, ubiquitination, and tran- helicase, with RNA polymerase II (Pol II), a component of scriptional regulation (1). BRCA1 has been shown to associ- the core transcriptional complex. It also associates with a ate with a variety proteins, and work to date supports a variety of sequence-specific DNA-binding transcription fac- model whereby BRCA1 acts as a scaffolding protein mediat- tors, such as p53, Myc, signal transducers and activators of ing the assembly of signaling complexes crucial for these as- transcription 1 (STAT1), and Oct-1 (7). To facilitate tran- sorted functions. scription the structure of chromatin must be altered so as A role for BRCA1 in transcriptional regulation is now well to allow access of the transcriptional machinery to the DNA. established, with a variety of activated and repressed tran- This is achieved both by modification of the tail of histones, scriptional targets having been identified. These include as well as by chromatin remodeling, via multisubunit en- proteins involved in DNA repair, such as DDB2 and XPC zyme complexes, such as the Swi/Snf complex, which hydro- (2); cell cycle regulators, such as p21 and GADD45 (3); lyses ATP to alter the interactions between histones and and regulators of growth, such as 2,5 oligoadenylate synthe- DNA. BRCA1 has been shown to associate with the histone tase (4) and psoriasen (5). Approximately 90% of BRCA1- acetyltransferases p300/CBP and hGCN5/TRRAP, as well as linked tumors are estrogen receptor α (ERα) negative. We the histone deacetyases HDAC1 and HDAC2 (7). In addition recently showed that BRCA1, along with the transcription BRCA1 was shown to interact directly with BRG1, the factor Oct-1, could activate the transcription of ERα, thus ATPase subunit of the Swi/Snf complex (8). Swi/Snf chromatin remodeling complexes are evolution- Authors' Affiliation: CentreforCancerResearchandCellBiology, arily conserved from yeast to humans and have been shown Queens University Belfast, Belfast, Northern Ireland, United Kingdom to both positively and negatively regulate transcription. Hu- Corresponding Authors: Mary Harte or D. Paul Harkin, Centre for Can- man cells contain two major classes of the Swi/Snf complex, cer Research and Cell Biology, Queens University Belfast, Lisburn Road, Belfast, Northern Ireland, BT9 7BL, United Kingdom. Phone: BAF (BRG1 or hBRM-associated factor) and PBAF (polybro- 44-28-90972641; Fax: 44-28-90972776; E-mail: [email protected] mo-associated BAF). Each subgroup contains one of two and [email protected]. highly homologous ATPases, BRG1 or BRM, and a variable doi: 10.1158/0008-5472.CAN-09-2089 number of associated subunits termed BRG1-associated fac- ©2010 American Association for Cancer Research. tors (BAF). BAF complexes can contain either BRG1 or BRM,

2538 Cancer Res; 70(6) March 15, 2010

BRD7 Regulates BRCA1-Dependent Transcription

whereas PBAF complexes contain only BRG1. The core sub- Short interfering RNA transfection. Short interfering units shared by most Swi/Snf complexes include the BAFs RNA (siRNA) transfection of T47D or MCF cells was car- 170, 155, 60, 57, 53, 47, and actin (9). The subclasses are de- ried out as previously described (6). The siRNA sequences fined by the presence of specific signature subunits. BAF used were the same except for the following: BRCA1 num- complexes are specified by the ARID1 (BAF250) subunit, ber-1, ACCATACAGCTTCATAAATAA; BRD7 number-1, whereas the signature subunits of PBAF complexes are ARID2, GUGCCAAGAUUAUCCGUAUUU; BRD7 number-2, CGCU- polybromo (BAF180), and BRD7, a bromodomain containing GAAAGCAGUAACAAATT; Scrambled siRNA, AGCAGCAC- protein (10). GACTTCTTCAAG. In this study we identify BRD7 as a novel binding partner Gene expression profiling and microarray data analysis. of BRCA1 and functionally characterize their interaction. RNA was harvested from T47D cells transfected in triplicate independent transfections with BRD7 siRNA number-2, BRCA1 siRNA (6), or SCR sequence. This was prepared and Materials and Methods hybridized to a Breast Cancer DSA microarray (6). The criteria used to detect differential gene expression between Yeast two-hybrid screen. Yeast two-hybrid screening was BRCA1- or BRD7-depleted and SCR-treated cells was a 1.3- carried out with the Clontech Matchmaker two-hybrid sys- fold difference in gene expression at a statistical signific- tem (Takara Bio Europe) using an ovarian cDNA library ance defined by a P value of ≤0.01 using the Student's un- cloned in frame with the GAL4 activation domain in the paired t test. pACT2 vector. A bait construct composed of 1 to 3426 bp Western blotting. Nuclear extract (60 μg) was resolved by (amino acids 1–1142) of BRCA1, was subcloned in frame with SDS-PAGE and Western blotted for BRD7 (ProteinTech), ERα the GAL4 DNA-binding domain in pGBKT7 to generate (HC-20), BRCA1 (D9), Oct-1 (C-21), BAF155 (F-2), BAF57 (C- pGBKT7BRCA 1 to 1142. Two further constructs were gener- 20), c-Myc (9E10; all six are from Santa Cruz Biotechnology), ated in pGBKT7 composed of 1 to 2781 bp (amino acids 1– and BRG1 (Millipore). Membranes were reprobed for actin 927) and 907 to 2781 bp (amino acids 303–927) of BRCA1. For (Sigma, AC-74) to show equal loading. the screen the pGBKT7BRCA 1 to 1142 was transformed into Real-time PCR. Total RNA was isolated from cells using the AH109 yeast strain and mated for 24 h at 30°C with Y187 RNA STAT60 reagent (Tel-Test, Inc.). RNA was generated yeast transformed with pACT-ovarian library. Interacting from three independent transfections, using two different clones were selected by their ability to activate the His3 re- siRNA sequences for BRCA1 and BRD7. RNA (2 μg) was reporter as indicated by growth on histidine/leucine/trypto- verse transcribed using random primers and Moloney mu- phan (HLT)–negative media. Autoactivation of the His3 rine leukemia virus reverse transcriptase (Invitrogen) reporter by the pGBKT7BRCA 1 to 1142 construct was according to the manufacturer's instructions. The cDNA prevented by the addition of 4 mmol/L 3-amino-triazole was subjected to quantitative real-time reverse transcrip- (Sigma). Primary clones, which activated the His3 reporter, tion–PCR (qRT-PCR) using Roche Lightcycler 480 SYBR were further tested for their ability to activate the ADE2 Green 1 master mix, according to the manufacturer's instruc- and lacZ reporters, as shown by growth on histidine/ tions, on a Roche Lightcycler 480 machine. Real-time primers adenine/leucine/tryptophan–negative media or conversion were designed using the Roche Universal Probe library,1 and of 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Sigma) the primer sequences are listed in Supplementary Materials to a blue product, respectively. and Methods. The levels of mRNA for each gene were nor- Cell lines. All cell lines used were obtained from the Amer- malized relative to actin mRNA. Statistical significance was ican Type Culture Collection and have been passaged for <6 determined using the Student's unpaired two-tailed t test. mo since receipt. Gene transfection. Constructs encoding either BRD7 or Coimmunoprecipitation and Western blotting. Coimmu- ΔBRD7 deleted in residues encoding the bromodomain noprecipitations of BRCA1, BRD7, and Myc were carried out of BRD7 (amino acids 129–237) were obtained from Dr J. from nuclear extracts of HEK-293 and T47D breast cells. For Kzhyshkowska (11). These were transfected into T47D cells coimmunoprecipitation 500 μg of nuclear extract were made using GeneJuice (Novagen) according to the manufacturer's up to 250 μL with immunoprecipitation buffer (100 mmol/L instructions. Cells were harvested for chromatin immuno- KCl, 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 20 mmol/L HEPES, precipitation (ChIP) assay, or protein extracts 48 hrs after 10% glycerol, 1 mmol/L DTT, 0.1% NP40, protease inhibitor transfection. mix). For immunoprecipitation, 3 μg of the following antibo- ChIP assay. ChIP assays were performed as previously de- dies were used: BRCA1, Ab-1, and Ab-4 (Calbiochem); anti- scribed (6). The antibodies used for immunoprecipitation BRD7 (ProteinTech Group); c-Myc, C-19, or C-8 (Santa Cruz were anti-Pol II (CTD4H8, Millipore); anti-BRCA1, Ab-1, or Biotechnology); and isotype-matched controls, IgG1, IgG2A, D9; anti-BRD7 (AbCam); anti-acetylhistone H3 and anti- and rabbit IgG (DAKO). The samples were incubated over- BRG1 (Millipore); anti-Oct1, anti-BAF57, anti-BAF155 (all night at 4°C, then 50 μL of 50% protein A/G sepharose beads three from Santa Cruz Biotechnology); and rabbit IgG (Sigma) in immunoprecipitation buffer were added, and in- and IgG1 (DAKO). The ESR1 promoter was amplified by cubation continued for another 2 h. The pellet was washed 4× in immunoprecipitation buffer. The samples were West- ern blotted for BRCA1, BRD7, or c-Myc. 1 www.roche.com

www.aacrjournals.org Cancer Res; 70(6) March 15, 2010 2539

Harte et al.

PCR using primers previously described (6) or with ESR1 con- nal antibodies Ab-1 and Ab-4, again BRD7 was clearly present trol primers located ∼3 kb upstream of the promoter that am- (Fig. 1C, right, lanes and 3 and 4). The same immunoprecipi- plified a 146-bp product [5′CACTGCAATACTGGGGGTCT tations carried out in T47D cells again clearly showed an (forward) and 5′CCCTGGGACACTATGCAGTT (reverse)]. association of BRCA1 and BRD7 when immunoprecipitated Antiestrogen sensitivity studies. T47D, MCF7, or BT-474 in either direction (Fig. 1D). cells were transfected with either BRCA1, BRD7, ERα,or BRCA1 and BRD7 cooperate in transcriptional regula- SCR siRNA at a concentration of 200 nmol/L for two consec- tion. BRD7 is a bromodomain containing protein, which utive days using oligofectamine according to the manufac- has been identified as a PBAF-specific Swi/Snf subunit (10). turer's instructions. On day 3, the cells were plated onto To determine the functional consequences of the BRCA1- 96-well plates at a density of 5,000 cells per well. At 24 h later, BRD7 interaction, we investigated the role of BRD7 in the cells were treated with fulvestrant (ICI 182,780; Tocris BRCA1-dependent transcription using microarray-based ex- − − Bioscience) at concentrations varying from 10 4 to 10 12 pression profiling. The gene expression profile of either mol/L. After 72 h the number of viable cells was quantitated BRCA1 or BRD7 depleted cells was compared with that of using the MTT assay. The concentration of drug that inhib- SCR-transfected cells (Fig. 2B). A total of 1,928 genes exhibited 40% of the growth of the cells (IC40) was calculated with ited BRCA1-dependent changes in expression relative to con- prism software. trol; of these 1,172 were positively regulated and 756 were negatively regulated. A total of 5,248 genes exhibited BRD7- dependent expression changes compared with control; of Results these 2,236 were positively regulated and 3,012 were negatively regulated by BRD7. The list of genes displaying Identification of BRD7 as a BRCA1-interacting protein. BRCA1-dependent changes in gene expression were com- Given that the biology of BRCA1 seems to be in large part pared with those showing BRD7-dependent regulation. From dictated by its interactions with other proteins, we carried this analysis 583 genes were determined to be jointly regu- out a yeast two-hybrid screen using the NH2 terminal 1142 lated by BRCA1 and BRD7, revealing that 30% of all BRCA1- amino acids of BRCA1 to identify novel interactors. A hu- regulated genes were also jointly regulated by BRD7 and 11% man ovarian cDNA library was screened, and 154 clones of BRD7-regulated genes were also regulated by BRCA1. Of were isolated, using activation of the HIS3 reporter gene the 583 genes, 331 (57%) were positively regulated by BRCA1 as a read out of interaction. These clones were subjected and BRD7, and 252 (43%) were negatively regulated by both. to further screening, which examined their ability to acti- This agrees with previous studies, which show that BRCA1 vate two additional reporter genes, LacZ and ADE2. Subse- and the Swi/Snf complex are able to both positively and neg- quent to this second round of screening, seven library atively regulate transcription. clones were identified as encoding BRCA1 interacting pro- We further validated the expression of four of these tar- teins. Of these seven clones, two encoded the known gets, ERα, Rad51, versican, and CYP1A1, using qRT-PCR. BRCA1 interacting proteins BARD1 and cMyc. A third The expression of ERα, Rad51, and versican was decreased clone contained sequence encoding amino acids 277 to to a similar degree in both BRCA1- and BRD7-depleted 652 of BRD7, a bromodomain containing protein. T47D or MCF7 cells, indicating that both BRCA1 and BRD7 To further elucidate the site of interaction of BRD7 with mediate the transcriptional activation of these three targets BRCA1, Y187 yeast expressing the BRD7 clone was mated (Fig. 3). We have previously shown that ERα is a BRCA1-reg- with AH109 yeast expressing either the BRCA1 bait 1 to ulated target (6). The expression of CYP1A1 was substantially 1142 or two further constructs encoding amino acids 1 to upregulated in both MCF7 and T47D cells in the absence of 927 of BRCA1 or 303 to 927 of BRCA1 (Fig. 1A). The BRD7 either BRCA1 or BRD7, indicating that it is normally re- clone was unable to interact with 303 to 927 BRCA1 but pressed by both. was still able to interact with 1 to 927BRCA1, as shown by BRD7 recruits BRCA1 and Oct-1 to the ESR1 promoter. growth on HLT− media (Fig. 1B). The 303 to 927 BRCA1 con- We have previously shown that BRCA1 and Oct-1 are present struct expressed a functional protein as shown by its ability on the ESR1 promoter (6). ChIP analysis showed that along to interact with the cMyc clone (data not shown). This indi- with BRCA1 (Fig. 4A, top, lanes 4 and 6) and Oct1 (lane 10), cates that the first 300 amino acids of BRCA1 are important BRD7 was clearly present on the ESR1 promoter (lane 8). The in mediating the interaction with BRD7. association of BRD7 with the ESR1 promoter correlated with BRCA1 and BRD7 interact in vivo. To determine whether the levels of acetylated histone H3 (lane 9). In addition as ex- BRCA1 and BRD7 interact in vivo, coimmunoprecipitation pected for an actively transcribed gene RNA Pol II was also experiments were carried out in HEK-293 and T47D breast present on the promoter (lane 3). cells. The previously characterized interaction of BRCA1 with We next examined if recruitment of either BRCA1 or BRD7 c-Myc was used as a positive control. BRCA1 was clearly pres- to the promoter was affected by the presence of their partner ent in the BRD7 immunoprecipitate (Fig. 1C, left, lane 4) to an protein. Depletion of BRD7 clearly inhibited the recruitment even greater degree than that associating with c-Myc (lane 3), of BRCA1 to the ESR1 promoter; however, the reciprocal de- indicating an association between endogenous BRCA1 and pletion of BRCA1 had no effect on the recruitment of BRD7 BRD7. When the reciprocal BRCA1 immunoprecipitation to the promoter (Fig. 4B, left). Depletion of BRD7 also pre- was carried out using two different BRCA1-specific monoclo- vented the recruitment of the transcription factor Oct-1 to

2540 Cancer Res; 70(6) March 15, 2010 Cancer Research

BRD7 Regulates BRCA1-Dependent Transcription

Figure 1. BRCA1 associates with BRD7. A, schematic diagram of BRCA1 indicating the position of the Ring domain, the nuclear localization motif (NLS), and the BRCT domains, along with the BRCA1 constructs 1 to 1142, 1 to 927, and 303 to 927 used in the yeast two-hybrid analysis. B, Y187 yeast cells expressing either pGBKT7 1 to 1142, 1 to 927, or 303 to 927 BRCA1 constructs or pGBKT7 alone were crossed with AH109 yeast expressing the pACT-BRD7 clone. The resulting diploid yeast was plated onto either leucine/tryptophan negative media (LT−), which selects for the presence of both plasmids, or on HLT− media (+ 3AT). Growth of the diploid yeast on HLT− media (+3AT) indicates activation of the HIS3 reporter gene, which occurs upon protein interaction. C, nuclear extracts were prepared from HEK-293 cells and immunoprecipitated for either BRD7, c-Myc (C-19), or rabbit IgG (left); or BRCA1 (Ab-1 and Ab-4) or c-Myc (C8; right). The IgG1 is the isotype control antibody for Ab-1 and Ab-4, and IgG2A is the isotype control antibody for the c-Myc C8 antibody. D, nuclear extracts were prepared from T47D cells and immunoprecipitated for BRCA1 (Ab-1) or BRD7. IgG1 and rabbit IgG are isotype-matched controls. The immunoprecipitates were Western blotted for BRD7, BRCA1 (D9), or c-Myc (9E10). Ten percent of the amount of lysate used in the immunoprecipitation were loaded directly on all the blots (10% input).

the ESR1 promoter. Depletion of BRD7 had no effect on the of the Swi/Snf complex, we examined the recruitment of recruitment of Pol II to the promoter. We also examined the BRG1, as well as the core subunits BAF 57 and BAF 155 to effect of Oct-1 depletion on recruitment of BRD7 to the ESR1 the ESR1 promoter. All three Swi/Snf subunits were recruited promoter (Fig. 4B, right). Oct-1 depletion prevented the re- to the ESR1 promoter irrespective of the presence of BRD7 cruitment of BRCA1 to the promoter, as we had shown pre- (Fig.4C,lanes7,8,and9),indicatingthattheassembly viously. However Oct-1 depletion had no effect on the and recruitment of the complex was unaffected by the ab- recruitment of BRD7 to the ESR1 promoter. In summary sence of BRD7. In addition this result shows that despite these ChIP assays reveal that BRD7 is responsible for the re- thepresenceofBRG1ontheESR1promoter,itisunable cruitment of both BRCA1 and Oct-1 to the ESR1 promoter; to recruit BRCA1. however, the recruitment of Pol II is unaffected. To determine if the bromodomain of BRD7 was important Brd7 is a subunit of PBAF Swi/Snf complexes, which are for enabling the recruitment of BRD7 to the ESR1 promoter, multisubunit complexes composed of three signature subu- either full-length BRD7 or ΔBRD7 deleted in amino acids 129 nits, a number of core BAF subunits, and the ATPase BRG1. to 236, which encode the bromodomain (11), were expressed Brd7 is one of the signature subunits of PBAF complexes. in T47D cells (Fig. 4D). ChIP analysis of T47D cells expressing BRCA1 has previously been shown to bind to BRG1 (8). To either construct revealed that there was a reduced level of ensure that BRD7 depletion was not affecting the assembly recruitment of ΔBRD7 to the promoter compared with

www.aacrjournals.org Cancer Res; 70(6) March 15, 2010 2541

Harte et al.

full-length BRD7 (Fig. 4D, compare lanes and 7 and 8). This Discussion reduced recruitment of ΔBRD7 clearly correlated with reduced levels of recruitment of BRCA1 to the ESR1 promoter In this study we have identified BRD7, a subunit of PBAF- (compare lanes 5 and 6); however, the recruitment of Pol II specific Swi/Snf complexes, as a novel binding partner of was unaffected. BRCA1. We further show that BRD7 is responsible for the Association between BRD7 and response to antiestrogen recruitment of BRCA1 and Oct-1 onto the ESR1 promoter. treatment. We have shown that the transcription of ERα is Finally we highlight the functional significance of the obser- coordinately regulated by BRD7 and BRCA1; thus we wanted vation by showing that depletion of BRCA1 or BRD7 resulted to confirm that this regulation was reflected in the level of in loss of ERα expression and resistance to fulvestrant. ERα protein expression. Depletion of either BRCA1 or We show by microarray-based expression profiling that BRD7 led to a reduction in the level of ERα protein in either BRD7, like BRCA1, can both repress and activate gene ex- T47D, MCF7, or BT474 cells (Fig. 5). We had previously pression. Our results suggest that BRD7 may be involved in shown that this reduction in ERα protein levels, produced the regulation of up to 30% of BRCA1 regulated genes. In by depletion of BRCA1, was able to mediate resistance to contrast BRCA1 was shown to coregulate only 11% of the antiproliferative effects of the antiestrogen fulvestrant BRD7 transcriptional targets as defined by microarray (6). We examined whether the reduction in ERα levels pro- analysis. This is not surprising as BRD7 is a member of duced by depletion of BRD7 produced a similar resistance to the PBAF Swi/Snf complex and likely to play a much wider fulvestrant. Depletion of ERα with siRNA was used as a pos- role than BRCA1 in transcriptional regulation. BAF and itive control. In comparison to scrambled control-treated PBAF Swi/Snf complexes have been shown to regulate ex- cells, depletion of either BRCA1 or BRD7 led to a significant pression of distinct genes (12). As the PBAF and BAF com- resistance to the antiproliferative effects of fulvestrant in all plexes share a set of core subunits, it is likely that the three cell types, similar to that produced by depletion of ERα. functional specificity of the two subclasses is dictated by

Figure 2. Microarray analysis of genes regulated by BRCA1 or BRD7. T47D cells were treated with siRNA to BRCA1, BRD7, or a SCR sequence in triplicate independent experiments. At 72 h posttransfection, either RNA or nuclear extracts were prepared. A, 10 μg of nuclear extract was Western blotted for BRCA1 or BRD7 to confirm depletion of both. The membrane was reprobed for actin to confirm equal loading. B, heat maps comparing gene expression from either BRCA1- or BRD7-depleted cells versus that of SCR-treated cells.

2542 Cancer Res; 70(6) March 15, 2010 Cancer Research

BRD7 Regulates BRCA1-Dependent Transcription

Figure 3. BRCA1 and BRD7 coregulate the transcription of ERα, Rad51, versican, and CYP1A1. qRT-PCR analysis of BRCA1, BRD7, ERα, Rad51, versican, and CYP1A1 mRNA levels was carried out in T47D or MCF7 cells transfected with siRNA to BRCA1, BRD7, or a Scr sequence. Mean mRNA levels are shown with SEM, normalized with respect to actin mRNA. The statistical significance of the data was analyzed using the Student's t test; *, P < 0.05; **, P < 0.01; ***, P < 0.001.

their repertoire of unique subunits, one of which is BRD7 that BRD7 could also bind the transcription factor IRF2 in the case of PBAF. We have shown that, in addition to (13). It is possible that the role of BRD7 within the Swi/ BRCA1, BRD7 is also able to recruit the transcription fac- Snf complex is to provide specificity by selectively recruit- tor Oct-1 to the ESR1 promoter. A previous study showed ing specific transcription factors. Other Swi/Snf subunits

www.aacrjournals.org Cancer Res; 70(6) March 15, 2010 2543

Harte et al.

Figure 4. BRD7 is on the ERα promoter and recruits both BRCA1 and Oct-1 to the promoter. A, a ChIP assay was carried out in MCF7 cells to assess the recruitment to the ESR1 promoter of Pol II, BRCA1 (Ab1 and D9), BRD7, acetyl-histone H3 (AcH3), and Oct1. The immunoprecipitation was compared with that of the appropriate isotype-matched controls: IgG1 for Pol II and Ab1, IgG2A for D9, and rabbit IgG for BRD7, AcH3, and Oct1. Total input DNA (5 ng) was used as a positive control for the PCR. The resulting complex was amplified using primers specific to the ESR1 promoter (top) or with ESR1 control primers, which amplify a sequence ∼3 kb from the transcription start site (bottom). B, MCF7 cells were treated with siRNA specific to BRCA1, BRD7, or SCR control (left) or BRD7, Oct-1, or SCR control (right). At 72 h posttransfection either chromatin or nuclear extracts were prepared. The chromatin was immunoprecipitated with antibodies to Pol II, BRCA1, Oct-1, BRD7, and the relevant controls IgG1 and rabbit IgG. Total input DNA (5 ng) was used as a positive control for PCR. The resulting complex was amplified using ESR1 promoter-specific primers. Nuclear lysate (10 μg) was Western blotted for BRCA1, BRD7, or Oct-1. The membranes were reprobed for actin to show equal protein loading. C, MCF7 cells were treated with siRNA specific to BRD7 or SCR control. The chromatin was immunoprecipitated with antibodies to Pol II, BRCA1, BRD7, BRG1, BAF155, or BAF57 and relevant controls IgG1 or rabbit IgG. The resulting complex was amplified using primers specific to the ESR1 promoter (top two panels) or with ESR1 control primers (bottom). Nuclear lysate (10 μg) was Western blotted for BRD7, BRG1, BAF155, or BAF57. The membranes were reprobed for actin to show equal protein loading. D, T47D cells were transfected with constructs encoding either BRD7 or ΔBRD7 (Δ, deleted in the bromo-domain), and at 48 h posttransfection, either chromatin or nuclear extracts were prepared. The chromatin was immunoprecipitated with antibodies to Pol II, BRCA1, BRD7, and the relevant controls IgG1 or rabbit IgG. The resulting complex was amplified using ESR1 promoter-specific primers. Nuclear lysate (10 μg) was Western blotted for BRD7. The membranes were reprobed for actin to show equal protein loading.

2544 Cancer Res; 70(6) March 15, 2010 Cancer Research

BRD7 Regulates BRCA1-Dependent Transcription

Figure 5. Depletion of either BRCA1 or BRD7 mediates resistance to the antiestrogen fulvestrant. T47D (A), MCF7 (B), or BT474 cells (C) were transfected with siRNA to BRCA1, BRD7, ERα, or a SCR sequence. At 24 h posttransfection, cells were plated onto 96-well plates. At 24 h later, the cells were treated with a range of concentrations of fulvestrant for a further 72 h, and cell number was quantitated using the MTT assay. Sigmoidal growth inhibition curves were generated, and growth is shown relative to untreated cells for each transfection. Nuclear extracts were prepared at 72 h posttransfection. Nuclear extract (10 μg) was Western blotted for BRCA1, BRD7, or ERα. The membranes were reprobed for actin to show equal protein loading. have been shown to bind specific transcription factors, for Snf complexes. A glutathione S-transferase fusion protein example, BAF60 binds directly to p53 (14). composed of amino acids 260 to 553 of BRCA1 was able BRCA1 has previously been shown to bind directly to to associate with BRG1. We found that BRD7 was unable BRG1 (8), which is one of the two ATPases present in to bind in yeast to a BRCA1 construct composed of amino Swi/Snf complexes. BRG1 is present in both BAF and PBAF acids 303 to 927, which retains the BRG1 binding site. Thus Swi/Snf complexes. The interaction of BRCA1 with BRD7 it is likely that BRD7 and BRG1 interact independently and would suggest that BRCA1 may be specific to PBAF Swi/ directly with BRCA1.

www.aacrjournals.org Cancer Res; 70(6) March 15, 2010 2545

Harte et al.

The direct binding of BRCA1 to two components of the promoters, whereas for BRG1, its chromatin remodeling ac- Swi/Snf complex suggests that each may have a specific func- tivity is likely to be important. tion. The initial observation of BRCA1 interaction with BRG1 As yet the only cancer in which the expression of BRD7 has showed that an ATPase dead form of BRG1 was able to in- been studied is in nasopharyngeal tumors, wherein its ex- hibit the BRCA1-mediated activation of p21 transcription by pression is downregulated relative to normal nasopharyngeal p53, suggesting that the chromatin remodeling activity of epithelial tissue (19). Overexpression of BRD7 has been BRG1 is important in mediating its effects on BRCA1 tran- shown to inhibit the growth of nasopharyngeal carcinoma scription (8). We have shown that BRD7 is required for the cells and arrest the cells in the G0-G1 phase of the cell cycle recruitment of BRCA1 to the ESR1 promoter. BRG1 is clearly (20). Other subunits of the Swi/Snf family have been implicat- not sufficient to recruit BRCA1 to the ESR1 promoter, as ed in particular cancers, for example, immunohistochemical shown by the loss of BRCA1 recruitment in the absence of staining of tissue microarray samples has revealed that BRG1 BRD7, despite the fact that BRG1 is still retained on the pro- or BRM are lost in 10% to 20% of a range of tumor types, moter. Although the role of BRCA1 in transcriptional regula- including breast and ovarian tumors. One Swi/Snf subunit, tion is well established, BRCA1 cannot directly bind to DNA BAF47, has been classified as a tumor suppressor, as one al- itself. BRD7 possesses a bromodomain and has been shown lele is consistently lost and the other allele is either mutated to colocalise with acetylated histone H3 and also to bind to a or silenced by methylation in pediatric rhabdoid tumors (21). H3-derived peptide acetylated at Lys14 (15, 16). We have Our microarray data suggest that BRD7 may be important for shown that the association of BRD7 with the ESR1 promoter the regulation of up to 30% of BRCA1 targets. It would there- correlates with the acetylation of histone H3. In addition de- fore be interesting in the future to determine if, like BRG1, letion of the bromodomain of BRD7 leads to a reduction in BRD7 may also be lost or inactivated in a subset of breast association of BRD7 with the ESR1 promoter. BRCA1 binds cancers and if this loss results in the development of tumors to BRD7 between amino acids 277 to 652, which is outside of that display a BRCA1-like phenotype. the bromodomain (amino acids 129–236). Thus it would be possible for BRD7 to simultaneously bind its acetylated his- Disclosure of Potential Conflicts of Interest tone target via its bromodomain and BRCA1 via its COOH terminal domain. Acetylation of histone H3 may play a role No potential conflicts of interest were disclosed. in recruiting BRD7 to the promoter, and BRD7 would then be able to recruit BRCA1 and Oct-1 and drive the transcription Acknowledgments of ERα. Alternatively BRD7 may itself be recruited through interaction with other Swi/Snf subunits. BAF57 has been We thank Dr. Julia Kzhyshkowska and Selen Systems GmbH for the BRD7 shown to bind directly to both ERα and the androgen recep- and ΔBRD7 expression constructs. tor and is recruited to both estrogen- and androgen-responsive promoters in a ligand-dependent manner (17, 18). On Grant Support this basis it has been proposed that BAF57 is important in α targeting of the Swi/Snf complex to both ER and androgen Medical Research Council (M.T. Harte and D.P. Harkin), Cancer Research receptor–responsive promoters. Interestingly we have also UK (G.J. O'Brien, K.I. Savage, and D.P. Harkin), Breast Cancer Campaign (N.T. shown that BRG1, BAF155, and BAF57 are all retained on Crawford, P.B. Mullan, and D.P. Harkin), R&D Office NI (J.J. Gorski, P.B. Mullan, and D.P. Harkin), and Queens University Belfast (N.M. Ryan). the ESR1 promoter irrespective of the presence of BRD7, The costs of publication of this article were defrayed in part by the payment and thus BAF57 or one of the other subunits may target of page charges. This article must therefore be hereby marked advertisement in BRD7 to the ESR1 promoter. In summary our results support accordance with 18 U.S.C. Section 1734 solely to indicate this fact. a model whereby, in the context of BRCA1-mediated tran- Received 06/10/2009; revised 12/11/2009; accepted 01/04/2010; published scription, the role of BRD7 is to recruit BRCA1 to specific OnlineFirst 03/09/2010.

References 1. Narod SA, Foulkes WD. BRCA1 and BRCA2: 1994 and beyond. Nat receptor α deficiency in BRCA1-linked breast cancer. J Natl Cancer Rev Cancer 2004;4:665–76. Inst 2007;99:1683–94. 2. Hartman AR, Ford JM. BRCA1 induces DNA damage recognition 7. Mullan PB, Quinn JE, Harkin DP. The role of BRCA1 in transcriptional factors and enhances nucleotide excision repair. Nat Genet 2002; regulation and cell cycle control. Oncogene 2006;25:5854–63. 32:180–4. 8. Bochar DA, Wang L, Beniya H, et al. BRCA1 is associated with a 3. Harkin DP, Bean JM, Miklos D, et al. Induction of GADD45 and JNK/ human SWI/SNF-related complex: linking chromatin remodeling to SAPK-dependent apoptosis following inducible expression of breast cancer. Cell 2000;102:257–65. BRCA1. Cell 1999;97:575–86. 9. Mohrmann L, Verrijzer CP. Composition and functional specificity of 4. Mullan PB, Hosey AM, Buckley NE, et al. The 2,5 oligoadenylate SWI2/SNF2 class chromatin remodeling complexes. Biochim synthetase/RNaseL pathway is a novel effector of BRCA1- and Biophys Acta 2005;1681:59–73. interferon-γ-mediated apoptosis. Oncogene 2005;24:5492–501. 10. Kaeser MD, Aslanian A, Dong MQ, Yates JR III, Emerson BM. BRD7, 5. Kennedy RD, Gorski JJ, Quinn JE, et al. BRCA1 and c-Myc associate a novel PBAF-specific SWI/SNF subunit, is required for target gene to transcriptionally repress psoriasin, a DNA damage-inducible gene. activation and repression in embryonic stem cells. J Biol Chem 2008; Cancer Res 2005;65:10265–72. 283:32254–63. 6. Hosey AM, Gorski JJ, Murray MM, et al. Molecular basis for estrogen 11. Kzhyshkowska J, Rusch A, Wolf H, Dobner T. Regulation of

2546 Cancer Res; 70(6) March 15, 2010 Cancer Research

BRD7 Regulates BRCA1-Dependent Transcription

transcription by the heterogeneous nuclear ribonucleoprotein E1B- main and its interaction with acetylated peptides from histone H3 AP5 is mediated by complex formation with the novel bromodo- and H4. Biochem Biophys Res Commun 2007;358:435–41. main-containing protein BRD7. Biochem J 2003;371:385–93. 17. Belandia B, Orford RL, Hurst HC, Parker MG. Targeting of SWI/SNF 12. Yan Z, Cui K, Murray DM, et al. PBAF chromatin-remodeling chromatin remodelling complexes to estrogen-responsive genes. complex requires a novel specificity subunit, BAF200, to regulate EMBO J 2002;21:4094–103. expression of selective interferon-responsive genes. Genes Dev 18. Link KA, Burd CJ, Williams E, et al. BAF57 governs androgen recep- 2005;19:1662–7. tor action and androgen-dependent proliferation through SWI/SNF. 13. Staal A, Enserink JM, Stein JL, Stein GS, van Wijnen AJ. Molecular Mol Cell Biol 2005;25:2200–15. characterization of celtix-1, a bromodomain protein interacting with 19. Peng C, Liu HY, Zhou M, et al. BRD7 suppresses the growth of Na- the transcription factor interferon regulatory factor 2. J Cell Physiol sopharyngeal Carcinoma cells (HNE1) through negatively regulating 2000;185:269–79. β-catenin and ERK pathways. Mol Cell Biochem 2007;303:141–9. 14. Oh J, Sohn DH, Ko M, et al. BAF60a interacts with p53 to recruit the 20. Zhou J, Ma J, Zhang BC, et al. BRD7, a novel bromodomain gene, SWI/SNF complex. J Biol Chem 2008;283:11924–34. inhibits G1-S progression by transcriptionally regulating some 15. Peng C, Zhou J, Liu HY, et al. The transcriptional regulation role of important molecules involved in ras/MEK/ERK and Rb/E2F path- BRD7 by binding to acetylated histone through bromodomain. J Cell ways. J Cell Physiol 2004;200:89–98. Biochem 2006;97:882–92. 21. Reisman D, Glaros S, Thompson EA. The SWI/SNF complex and 16. Sun H, Liu J, Zhang J, et al. Solution structure of BRD7 bromodo- cancer. Oncogene 2009;28:1653–68.

www.aacrjournals.org Cancer Res; 70(6) March 15, 2010 2547

BRD7, a Subunit of SWI/SNF Complexes, Binds Directly to BRCA1 and Regulates BRCA1-Dependent Transcription

Mary T. Harte, Garrett J. O'Brien, Niamh M. Ryan, et al.

Cancer Res 2010;70:2538-2547. Published OnlineFirst March 9, 2010.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-09-2089

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/03/19/0008-5472.CAN-09-2089.DC1

Cited articles This article cites 21 articles, 6 of which you can access for free at: http://cancerres.aacrjournals.org/content/70/6/2538.full#ref-list-1

Citing articles This article has been cited by 11 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/70/6/2538.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/70/6/2538. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.