Clemson University TigerPrints
All Dissertations Dissertations
8-2007 FUNCTIONAL CHARACTERIZATION OF ECTODYSPLASIN-1 AND IDENTIFICATION OF NOVEL CANDIDATE GENES FOR ECTODERMAL DYSPLASIAS AND ASSOCIATED CLINICAL FEATURES Bradley Griggs Clemson University, [email protected]
Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Genetics Commons
Recommended Citation Griggs, Bradley, "FUNCTIONAL CHARACTERIZATION OF ECTODYSPLASIN-1 AND IDENTIFICATION OF NOVEL CANDIDATE GENES FOR ECTODERMAL DYSPLASIAS AND ASSOCIATED CLINICAL FEATURES" (2007). All Dissertations. 122. https://tigerprints.clemson.edu/all_dissertations/122
This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact [email protected]. FUNCTIONAL CHARACTERIZATION OF ECTODYSPLASIN-1 AND IDENTIFICATION OF NOVEL CANDIDATE GENES FOR ECTODERMAL DYSPLASIAS AND ASSOCIATED CLINICAL FEATURES
A Dissertation Presented to the Graduate School of Clemson University
In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Genetics
by Bradley Lee Griggs August 2007
Accepted by: Dr. Anand K. Srivastava, Committee Chair Dr. Albert Abbott Dr. William Marcotte Dr. Lesly Temesvari
ABSTRACT
Ectodermal dysplasias (ED) are a group of developmental disorders in which ectodermally derived structures are abnormally formed or absent entirely. The molecular signaling pathway controlling the differentiation of ectodermal appendages has been well documented in recent years. However, questions remain concerning the key signaling molecule of this pathway, ectodysplasin-1 (EDA), the identity of the EDA signaling pathway’s target genes, and the presence of additional phenotypes observed in some patients.
Despite the intensive study of EDA in recent years, the functional significance of the
N-terminal intracellular domain of ectodysplasin-1 (N-EDA) has remained elusive. The yeast two-hybrid system was employed to further the understanding of this domain in the
EDA protein. RBM39 has been identified as a potential interacting protein with N-EDA.
Fluorescence microscopy has also demonstrated that these proteins co-localize to the nucleus, a novel finding for N-EDA.
In an attempt to identify additional genes involved in the EDA pathway that may be responsible for ED phenotypes, the translocation breakpoint regions of a patient with a chromosomal translocation t(1;6) and clinical features of ED with mild mental retardation
(MR) have been partially mapped. Candidate genes have been identified near both translocation breakpoint regions.
Finally, an additional clinical feature found in some ED patients is MR of varying severity. To help understand the etiology of MR in one ED patient with a 9p subtelomeric aberration, positional cloning was used to identify DOCK8 as the potential causative gene for
iii the MR phenotype. These results were supported by the identification of a second patient
with MR in which a 9p subtelomeric deletion also disrupts DOCK8. The findings of this study indicate that haploinsufficiency of DOCK8 is likely responsible for the MR in these two patients and suggest a putative role for DOCK8 in brain development and function.
The differentiation of ectodermal appendages is a complex process in which mutations in genes at any step of EDA signaling can result in ED phenotypes. These studies contribute to the understanding of how ectodermally derived structures form, both through the discovery of novel functions for N-EDA and the identification of a new candidate target gene involved in the EDA signaling pathway. Finally, these results also provide possible causative genes for MR observed in one patient with ED.
iv DEDICATION
Through all of my education my parents have been a tremendous source of strength and support. I am grateful to both of them for all of their help. This body of work is dedicated to them in honor of the sacrifices they have made throughout my education.
v vi ACKNOWLEDGMENTS
I would like to thank my advisor, Dr. Anand Srivastava, for all of his help, patience, and guidance through my graduate education. The members of my graduate committee,
Drs. Bert Abbott, Bill Marcotte, and Lesly Temesvari, have been most helpful in contributing their advice and critiques throughout this work.
I am indebted to many of the faculty and staff of the Greenwood Genetic Center for their help and support. I would like to specifically thank Dr. Barabara DuPont and the
Cytogenetics laboratory staff for their help with the FISH experiments. Drs. Fatima Abdi and Karl Franek have been an invaluable source of advice. I would like to acknowledge all of the technologists and graduate students in the research lab of GGC for their help, but I need to specifically mention Traci Pawlowski, Melanie May, Joy Norris, Tonya Moss,
Raewyn Lowe, and Dana Schultz.
I want to especially acknowledge our patients and their families. Their willingness to participate in these and other studies have and will continue to add to our understanding of human genetics.
Finally, to my wife Rachel; you have been a great source of strength and inspiration through the last several years. Your sacrifices while I have completed this degree have not gone unnoticed. You have helped me immensely.
Thank you, again, to all who have helped through the years.
vii viii TABLE OF CONTENTS
Page
TITLE PAGE ...... i
ABSTRACT...... iii
DEDICATION ...... v
ACKNOWLEDGEMENTS ...... vii
LIST OF TABLES ...... xi
LIST OF FIGURES...... xii
PREFACE...... 1
FUNCTIONAL ANALYSIS OF THE N-TERMINAL INTRACELLULAR FRAGMENT OF ECTODYSPLASIN-1...... 15
Introduction ...... 15 Methodology ...... 17 Results ...... 28 Discussion ...... 38
IDENTIFICATION OF CANDIDATE GENES FOR ECTODERMAL DYSPLASIA AND AUTOSOMAL MR IN A PATIENT WITH A t(1;6)(p22.1;p22.2) TRANSLOCATION ...... 41
Introduction ...... 41 Methodology ...... 42 Results ...... 46 Discussion ...... 54
DEDICATOR OF CYTOKINESIS 8 (DOCK8) IS DISRUPTED IN A PATIENT WITH ECTODERMAL DYSPLASIA, MENTAL RETARDATION, AND A SUBTELOMERIC 9p REARRANGEMENT...... 59
Introduction ...... 59 Methodology ...... 61 Results ...... 68 Discussion ...... 78
ix CONCLUSIONS...... 83
APPENDIXES ...... 85
Investigation into the interaction between the EGFR and EDA ...... 87 Human Molecular Genetics Copyright License Agreement ...... 99 Cell Cycle Copyright License Agreement ...... 101 Abbreviations...... 103
REFERENCES CITED...... 105
x LIST OF TABLES
Table Page
P.1 Tissue specific expression of EDA isoforms...... 6
1.1 Primer List...... 25
3.1 Mutation Screen Primers...... 66
3.2 Chromosome 9p BAC/PAC FISH and subtelomeric results...... 70
3.3 Sequence variants detected in the DOCK8 gene...... 77
A.1 Primer list...... 88
xi LIST OF FIGURES
Figure Page
P.1 Exon and protein structure of Ectodysplasin-A ...... 5
P.2 EDA signaling pathway...... 7
1.1 Yeast two-hybrid positive clone, vector swap clone, and false positive controls ...... 30
1.2 RBM39 genomic and protein alignments...... 32
1.3 Co-immunoprecipitation of N-EDA and RBM39 clone 4-18...... 35
1.4 Cellular localization of N-EDA and RBM39 ...... 37
2.1 Delineation of translocation breakpoint critical regions and candidate genes...... 47
2.2 FISH analysis of chromosomes 1 and 6 ...... 49
2.3 Normalized relative expression for ABCD3 and ZNF184 ...... 53
2.4 ABCD3 Northern analysis in patient CMS8770...... 54
3.1 Mapping of the subtelomeric 9p chromosomal rearrangements...... 69
3.2 FISH analysis of chromosome 9p aberrations...... 71
3.3 Characterization and fine mapping of DOCK8...... 72
3.4 Tissue expression profile of human DOCK8 variants...... 76
3.5 Actin structure of fibroblast cell lines CMS11195 and CMS1485...... 80
A.1 EGFR expression determined by Real-Time PCR and western analysis...... 93
A.2 Cellular localization of EDA-A1...... 94
xii PREFACE
Ectodermal dysplasias (ED) are a group of genetically diverse developmental abnormalities which involve structures that originally derive from the ectodermal germ layer.
There are over 150 clinically distinct ectodermal dysplasias variably affecting teeth, hair, fingernails, sweat gland, and the sebaceous gland (Pinheiro and Freire-Maia, 1994; Mikkola and Thesleff, 2003).
Hypohidrotic ectodermal dysplasia (HED) is one of the most common forms of this disorder. HED is characterized by the absence or deficient function of at least two derivatives of the ectoderm: hair, teeth, sweat glands, or nails. The varied phenotype includes sparse scalp and body hair, anodontia or oligodontia with conical shaped teeth, and a lack of eccrine sweat glands. Additionally, there can be a distinctive facies with prominent forehead and lips, depressed nasal bridge, and darker pigmentation around the eyes (Clarke,
1987). HED potentially can be life threatening because of the lack or reduced number of functional eccrine sweat glands. This abnormality leads to difficulty in maintaining body temperature and places the patient at risk for hyperthermia. A mortality rate quoted at up to
30% is reported if affected individuals are not diagnosed in the first two years of life
(Mikkola and Thesleff, 2003).
Historically, HEDs have been described in the scientific literature for over 150 years.
In 1848, Thurman described two cases where the skin, hair and teeth were not properly developed (Clarke, 1987). Charles Darwin described HED with the toothless men of Sind in
1875 in his book, “The Variations of Animals and Plants Under Domestication” and documented precisely the ED phenotypes and male specific inheritance pattern (Kere et al.,
1 1996). The 1938 Works Progress Administration guide on Mississippi described a large
family of former slaves with HED (Srivastava et al., 2001). Although HED has been
described in the literature for some time, the molecular basis for the disorder has only
recently been thoroughly understood.
For some time, there were several hypotheses as to the mode of inheritance of HED.
Historically, most of the families displayed an X-linked inheritance pattern and, ultimately,
the disease locus was linked to the long arm of the X chromosome at q12-13 (Kolvraa et al.,
1986). The first evidence supporting autosomal recessive inheritance was demonstrated with
a report of five families who presented with severely affected female members and negative
gene testing of the X chromosome locus (Munoz et al., 1997). Subsequently, autosomal
recessive and autosomal dominant inheritance patterns were linked to chromosome 2q11-
q13 (Ho et al., 1998; Baala et al., 1999). Additional autosomal loci have been identified
including sites at 1q and 11p. We now know that approximately 90% of HEDs are
diagnosed as X-linked (Cui and Schlessinger, 2006).
Kere, Srivastava, and co-workers first identified the gene responsible for X-linked
HED in 1996. The authors used positional cloning to identify a predicted 135 residue
transmembrane protein, coded for by the gene ectodysplasin-A (EDA). The gene was
physically disrupted in two patients with X; autosome translocations and four patients with
submicroscopic deletions (Kere et al., 1996). Additionally, point mutations within EDA were identified in nine other HED patients. Fluorescence microscopy and biochemical fractionation demonstrated that EDA localizes to the cell membrane (Ezer et al., 1997; Ezer et al., 1999; Mikkola et al., 1999). COS-7 and MCF-7 cell lines show a tendency to round up and detach when transfected with EDA, suggesting the EDA protein may have a functional
2 role in cell dynamics (Ezer et al., 1997). Interestingly, this protein is involved in epidermal
differentiation and was found to share a high degree of similarity with the tumor necrosis
family (TNF) of soluble ligands (Ezer et al., 1999).
The results of Ezer and co-workers are supported by work in BHK cells, which
shows that antibodies raised against the N-terminal fragment of EDA only stain
permeabilized cells where the protein is visualized around the nucleus and throughout the
endoplasmic reticulum (ER) and Golgi body. Antibodies raised against the C-terminus stain
heavily around the membrane in either permeabilized or non-permeabilized cells (Mikkola et
al., 1999). These results confirm the predicted data that EDA is a type II membrane protein
meaning that the amino terminus is intracellular and the carboxy terminus is extracellular.
The mutant mouse tabby (Ta) has an X-linked phenotype similar to HED in
humans, with involvement of the hair, teeth, and sweat glands. The causative gene for the
tabby phenotype, named tabby (ta) for the mouse model, was identified in 1997 and found to
be the homologue of EDA (Srivastava et al., 1997). Ta shares a high degree of structural
similarity to EDA, as well as common temporal and spatial expression patterns (Ferguson et
al., 1997; Srivastava et al., 1997). Ta and EDA share a 94.6% sequence identity at the cDNA level (Bayes et al., 1998).
Like the tabby mouse, the downless (dl) and crinkled (cr) mouse mutants also have a phenotype similar to HED, with involvement of hair, teeth, and sweat glands. The gene affected in the dl mouse was found to be a TNF-like receptor whose human homologue,
EDAR, was mutated in some families with autosomal dominant HED (Headon and
Overbeek, 1999; Monreal et al., 1999). The cr gene, an adapter signaling molecule for dl/EDAR, was identified as being responsible for the cr mouse mutant (Headon et al., 2001;
3 Yan et al., 2002). The human homologue of cr is the EDAR Associated Death Domain
(EDARADD) and is mutated in some families with autosomal recessive ED (Headon et al.,
2001).
Evidence of a role for EDA in epidermal appendage formation has been found in many species other than human and mouse. A large genomic deletion including exon 3 of the EDA homologue in cattle was found in a German Holstein family with three maternal half-siblings affected with HED (Drogemuller et al., 2001). A point mutation affecting the splicing of exon 9 in the canine homologue of EDA has been reported in a breeding line of
dogs with HED (Casal et al., 2005). The EDA signaling pathway has also been linked to the
development of feather tracts in birds (Houghton et al., 2005). In fish, alternate alleles of
EDA have been identified as the cause of natural variants in the armor plating in
sticklebacks from different environments (Colosimo et al., 2005).
EDA has several splice variants, as shown in Figure P.1. The two longest isoforms,
EDA-A1 and EDA-A2, differ by only 2 amino acids (Bayes et al., 1998). These isoforms consist of a short intracellular domain, a transmembrane domain, a furin cleavage site, a collagenous binding domain, and a TNF homology domain (Fig. P.1). The various shorter isoforms lack many of the domains found near the carboxy terminal portion of the protein.
However, all of the EDA splice variants maintain the intracellular domain and the transmembrane domain. All of the isoforms, with the exception of EDA-C, localize to the cell membrane (Ezer et al., 1997; Bayes et al., 1998; Mikkola et al., 1999). Fluorescence microscopy has shown that EDA-C appears to accumulate around the nucleus, most likely in the endoplasmic reticulum. It is thought that this isoform is an unstable variant (Ezer et al.,
1999).
4 A X Chromosome
1 1a 1b 1c 1d 2345678Exon EDA -A1 391 a.a . EDA -A2 389 a.a . EDA -B 178 a.a . EDA -C 147 a.a . EDA -D 142 a.a . EDA -E 148 a.a . EDA -F 147 a.a . EDA -O 135 a.a .
B 1 2 3 4 5 6 7 8 Collagen Binding Intracellular Domain (1 -40) Domain (180 -235)
NH 2 COOH
Transmembrane Furin site TNF Homology Domain Domain (41 -63) (150 -159) (250 -391)
Figure P.1 Exon and Protein Structure of Ectodysplasin-A. (a) Exon composition of each EDA isoform is indicated, as well as EDA genomic localization. (b) Diagram indicating major functional domains of EDA. The exon responsible for coding for each domain is indicated by brackets above the diagram. Grey bar beneath schematic indicates portion of protein common to all isoforms.
EDA isoforms are expressed in different tissue specific patterns (Table P.1) (Kere et al., 1996; Bayes et al., 1998). Northern analysis of adult and fetal tissues shows a 6 kb band that corresponds to the full length EDA-A isoforms in all tissues tested, suggesting EDA-A may be involved in maintenance, as well as differentiation of, ectodermal appendages (Kere et al., 1996; Bayes et al., 1998). EDA-A and EDA-C are expressed widely and have been identified in brain, heart, kidney, lung, liver, pancreas, placenta, and skeletal muscle. EDA-B was reported to be absent in skeletal muscle and EDA-O was not detected in the brain
5 (Bayes et al., 1998). No expression of EDA-D was noted in brain, kidney, lung and pancreas. EDA-E was expressed only in lung, liver, and pancreas (Bayes et al., 1998).
Table P.1 Tissue specific expression of EDA isoforms
EDA-A1 EDA-B EDA-C EDA-D EDA-E EDA-F EDA-O Brain + + + - - - - Heart + + + + - - + Kidney + + + - - - + Lung + + + + + - + Liver + + + - + - + Pancreas + + + - + - + Placenta + + + + - - + Sk Muscle + - + + - - + Skin + * * * * * *
Adapted from: Human Molecular Genetics 7 (1998) 1661-1669 * Not Determined
Experimental evidence suggests that EDA-A1 is the primary isoform responsible for triggering secondary differentiation of ectodermally derived structures (Yan et al., 2000;
Schneider et al., 2001; Srivastava et al., 2001). EDA-A2 is thought to function in epidermal organogenesis and may have a secondary or supporting role to that of EDA-A1 (Yan et al.,
2000; Srivastava et al., 2001). In addition, EDA-A2 has also been implicated in skeletal muscle homeostasis (Newton et al., 2004).
The final processing of EDA-A1 into a soluble ligand and its subsequent signaling through downstream targets has been previously reviewed and is summarized in Figure P.2
(Srivastava et al., 2001; Wisniewski et al., 2002; Mikkola and Thesleff, 2003; Botchkarev and
Fessing, 2005; Cui and Schlessinger, 2006). Briefly, EDA-A1 is synthesized in the ER and is moved to the Golgi body, where it is translocated to the cell membrane. Once on the cell
6 membrane, some currently unidentified signal triggers trimer formation. Once the trimer has formed, EDA-A1 can then be cleaved at the furin-like serine protease site, releasing the soluble ligand portion of the protein containing the TNF homology domain into the extracellular matrix. The trimeric molecule then binds to a receptor, EDAR. Binding to the receptor triggers an intracellular signaling cascade which ultimately activates NF-kB. The active NF-kB, in turn, triggers expression of target genes.
1 2 IKK1 6 K B
F NEMO A A A T T IKK2 R
LEF1 T D
D IkB α / )
EDAR A r R c
(dl) (
A NF -kBs
EDA D (ta ) EDA E RelA/p50
Wnt Dkk4/ Dkk1
Shh/Ptc/Gli , BMP/Sostdc1, LT β, Madcam1, etc.
Figure P.2 EDA signaling pathway. EDA-A1 expression is regulated by Wnt. Once translated, EDA-A1 localizes to the cell membrane where it forms a self trimer, is cleaved by a furin protease, binds EDAR, and triggers a signalling cascade through EDARADD, TAB2, TRAF6, and TAK1 to activate NF-kB. Once activated, NF-kB proceeds to the nucleus where it regulates transcription of EDA-A1’s target genes. Adapted from: Cell Cycle 5: 2477-83 (2006).
7 The process resulting in trimerization of EDA-A1 has not been fully elucidated. The collagenous domain, which consists of a Gly – X – Y repeat, is known to be required for trimerization (Ezer et al., 1999; Schneider et al., 2001). In addition, a conserved sequence between amino acids 61-76 is also likely to have a role in trimer formation (Snellman et al.,
2000). This region (a.a. 61-76) extends from the last two amino acids of the transmembrane domain into the extracellular domain. Missense mutations within this conserved domain have been identified in four HED patients (Schneider et al., 2001; Tao et al., 2006).
Missense mutations reported within the collagenous domain, can disrupt trimer formation while in-frame deletions within the collagenous domain appear to have no effect in trimer formation (Schneider et al., 2001).
Mutations have been reported in other functional domains of EDA as well. Six missense mutations have been reported in the furin cleavage domain. When tested experimentally, a reduction or loss of EDA-A1 proteolytic cleavage was found to result from these missense mutations, which account for approximately 23% of HED (Schneider et al.,
2001).
All of the missense alterations reported within the TNF homology domain appear to impede binding with EDAR (Schneider et al., 2001). EDAR, a TNF receptor, is a 448 amino acid type-1 transmembrane protein (Monreal et al., 1999; Koppinen et al., 2001). Like
EDA, EDAR has been found to be conserved through mammals, birds, and fish (Monreal et al., 1999; Kondo et al., 2001; Houghton et al., 2005). Mutations in EDAR represent the autosomal ED locus located on chromosome 2q (OMIM 604095). This locus accounts for one-quarter of all non-EDA-induced ED (Chassaing et al., 2006).
8 EDAR intracellularly binds to EDARADD, an adapter molecule for EDAR.
EDARADD transmits the signal from the receptor to the downstream signaling proteins.
Mutations in EDARADD on chromosome 1q have been reported in patients with autosomal ED (OMIM 606603). EDARADD is thought to function by recruiting a protein complex that includes TAB2, TAK1, and TRAF6 (located at 11p; OMIM 602355) which, when mutated in mice, results in ED (Naito et al., 2002; Morlon et al., 2005). TAK1 then phosphorylates and activates IKK, which subsequently triggers the degradation of the IkB regulatory subunit releasing active NF-kB, which then enters the nucleus to regulate expression of EDA-A1’s target genes (Doffinger et al., 2001; Kumar et al., 2001).
The targets genes of the EDA pathway have only recently started to be identified.
So far, four pathways in particular appear to be targets of EDA. EDA signaling has been shown to be the trigger for Sonic hedgehog (Shh) and cyclin D1 expression, which is critical for continued hair follicle development after hair placode growth initiation (Schmidt-Ullrich et al., 2006). Nishioka and co-workers identified that the structural proteins mucosal addressin cell adhesion molecule 1 (MAdCAM-1) and intercellular adhesion molecule 1
(ICAM-1) play a role in the development of mouse guard hairs as targets of the EDA signaling pathway (Nishioka et al., 2002). Lymphotoxin-β (LTβ) was identified through microarray experiments comparing the expression profiles of normal and Tabby mice. LTβ was previously known to only participate in lymphoid organogenesis, but has since been shown to be critical for proper hair formation in mice (Cui et al., 2006). The Wnt agonists
Dkk1 and Dkk4 also appear to be targets of EDA signaling. Wnt up-regulates EDA expression, subsequently up-regulating Dkk1 and Dkk4, which act as negative feedbacks to
9 Wnt resulting in reduced EDA expression (Figure P.2) (Andl et al., 2002; Durmowicz et al.,
2002; Cui et al., 2006; Cui and Schlessinger, 2006).
There are many clinical phenotypes that have been associated with ED. Since several of the EDA signaling pathway proteins have roles in other signaling pathways, mutations in these pathway members can lead to complex phenotypes in addition to ED.
For example, mutations in inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
(IKBKG) at Xq28, which codes for NEMO (OMIM 300248), a regulator of NF-kB activity, result in ED with immune deficiency (Doffinger et al., 2001; Smahi et al., 2002). More frequently, however, ED and these associated clinical findings are linked to mutations in genes whose role in ectodermal differentiation is unknown. Mutations in the tumor protein p63, located at 3q27, result in split-hand/split-foot malformation, ectodermal dysplasia, and facial clefts (OMIM 603273). Mutations in cadherin-3, located at 16q22.1, have been identified in patients with ectodermal dysplasia, ectrodactyly associated with syndactyly or cleft hand or both, and macular dystrophy (OMIM 225280). Missense mutations in the
GJB6 gene, which is located at 13q12 and encodes connexin-30, have been linked both to
ED and to autosomal dominant nonsyndromic sensorineural deafness 3 (Grifa et al., 1999;
Lamartine et al., 2000; Smith et al., 2002).
Another gene which has been linked to the ED phenotype but whose molecular role in ectodermal development remains unclear is epidermal growth factor (EGF). Treatment of wildtype mice with EGF results in premature eyelid opening and incisor eruption (Cohen,
1962; Kapalanga and Blecher, 1990). One portion of the tabby phenotype includes delayed eyelid opening and incisor eruption (Kapalanga and Blecher, 1990). Prenatal injection of
EGF into tabby mice results in the correction of eyelid opening and incisor eruption timing
10 (Kapalanga and Blecher, 1990; Kapalanga and Blecher, 1991). Treatment of skin cell culture systems with EGF results in inhibition of hair follicle formation (Kashiwagi et al., 1997). In vivo experiments in the marsupial Isoodon macrourus have also shown treatment with exogenous EGF results in the inhibition of development of hair follicles, sweat glands, sebaceous glands, and dermal papillae (Adelson et al., 1997). Furthermore, fibroblasts from tabby mice and HED patients have been reported to have reduced levels of EGF’s receptor,
EGFR, both at the messenger RNA and protein level (Vargas et al., 1996; Cui et al., 2002).
The restoration of ta signaling through the transfection of tabby mice with an EDA-A1 transgene resulted in normal EGFR expression levels as compared to wildtype mice (Cui et al., 2002). However, ectopic treatment of tabby mice with EGF did not correct the molar cusp formation abnormalities, a portion of the tabby phenotype (Pispa et al., 1999).
Neurological clinical findings in the form of mental retardation (MR), can be associated with the ED phenotype (OMIM 225060, 203550, 256710, 600644). The affected gene or genes in these case reports are often not known. Linkage data likewise is not available for most of these reports. These rare cases of ED and neurological findings led many authors in the past to incorrectly surmise a link between HED and MR. This assumption was supported by the fact that the original patients whose chromosomal abnormalities were used to map the HED X locus were affected with MR in addition to their ectodermal defects. It is now understood that the cognitive involvement seen in some of these patients were likely due to other genes disrupted by chromosomal breakpoints.
Mental retardation is a significant developmental disorder affecting an estimated 2-
3% of the world’s population. It can result from both environmental and genetic causes.
One South Carolina study cited genetic causes of MR at 23% of all cases and 63% of those
11 for which the cause could be identified (Stevenson et al., 2003). The study found single gene causes of MR could be identified in 8% of the patient cohort.
The most progress in identifying genes associated with MR has been made on the X chromosome. The identification of X-linked families by pedigree followed by linkage studies to identify X-linked mental retardation loci has proven to be an efficient method to identify single gene causes of MR. More than eighty MR genes have been identified
(Stevenson, 2005).
It has been comparatively more difficult to identify single genes involved in autosomal MR. If an X-linked inheritance pattern can be identified, linkage analysis needs only to be done on the X chromosome. In the absence of an X-linked inheritance pattern, the expense involved in performing linkage on the entire genome is restrictive. In addition, finding families large enough to provide the statistical power necessary to do linkage analysis is rare. Given these restrictions, the use of cytogenetically visible abnormalities to mark regions on a particular chromosome where the causative gene resides, termed positional cloning, is one method employed to identify autosomal MR genes. EDA was initially identified also using positional cloning. In part because of these difficulties, only three autosomal MR genes have been identified compared to the numerous XLMR genes
(Raymond and Tarpey, 2006).
This dissertation has attempted to investigate three areas related to ectodermal dysplasia. First, the extracellular domains of EDA have been well documented; however, there remain questions concerning the functional role of the intracellular N-terminal domain
(N-EDA). The inability to identify causatives mutations in all ED patients suggests additional genes remain whose function in ectodermal differentiation has yet to be identified.
12 Although many members of the EDA signaling pathway have been identified in recent years, there remain chromosomal loci linked to ED but without causative genes identified.
Finally, MR is often a clinical phenotype associated with ED but is not directly linked to genes in the EDA signaling pathway. This work attempts to identify the cause of the MR seen in two patients with ED.
The first chapter of this work presents a functional characterization of EDA-1. We have used a yeast 2-hybrid screen with N-EDA to identify the nuclear protein RBM39 as a novel protein interactor. Fluorescence microscopy demonstrated N-EDA accumulates in the cell nucleus at significantly higher levels than other cellular structures.
The second chapter presents work aimed at identifying novel candidate genes either in the EDA signaling pathway or targets of it. A patient with a t(1;6)(p22.2;p22.2) translocation presented with mild HED. We hypothesized that the translocation disrupted a gene resulting in the HED. Physically mapped bacterial artificial chromosome (BAC) clones which span both breakpoints have been identified and the minimal critical regions likely to harbor candidate genes have been determined.
The final chapter presents work attempting to identify the cause of an associated clinical feature in one patient with HED. This patient’s clinical features included HED and
MR. Her karyotype revealed a t(X;9)(q13;p24.3) translocation. The X breakpoint disrupts the EDA gene resulting in HED. We hypothesized the chromosome 9 breakpoint affects a gene resulting in the MR. Furthermore, an unrelated patient was also identified with a 9p subtelomeric chromosome abnormality. We mapped those aberrations and identified and characterized a gene, DOCK8, physically disrupted in both patients.
13 In summary, this work presents the identification of a protein found to interact with the intracellular domain of EDA, providing the first evidence of a functional role for the intracellular domain. Additionally, two translocation breakpoint loci were partially mapped, identifying novel candidate genes for both ED and MR. Finally, DOCK8 was identified as the gene disrupted as a result of chromosomal aberrations in two patients, one with HED and MR and the second with only MR, suggesting that DOCK8 could play a role in normal brain development or function. These results add to the understanding of how ectodermally derived structures form and explain the presence of the additional clinical phenotype MR seen in many ED patients.
14 FUNCTIONAL ANALYSIS OF THE N-TERMINAL INTRACELLULAR
FRAGMENT OF ECTODYSPLASIN-1
Introduction
Ectodermal dysplasia (ED) is a developmental disorder affecting ectodermally derived structures such as hair, teeth, nails, and sweat glands. Mutations in either ectodysplasin-A (EDA) or its downstream receptors can cause EDs (Kere et al., 1996;
Headon and Overbeek, 1999; Monreal et al., 1999). Identified in 1996, EDA is a type II transmembrane protein whose expression is modulated by WNT and Lef1 (Kere et al., 1996;
Laurikkala et al., 2001; Laurikkala et al., 2002). Multiple isoforms of the protein have been identified, some with varying expression patterns, suggesting possible roles for EDA in areas other than ectodermal appendage development. Although varying in size and exon composition, all of the isoforms share the N-terminal intracellular domain and the transmembrane domain (Fig. P.1) (Kere et al., 1996; Bayes et al., 1998). The EDA-A1 isoform is required to initiate secondary differentiation of ectodermally derived structures.
The signaling cascade triggered by EDA-A1 has been previously reviewed (Fig. P.2) (Cui and
Schlessinger, 2006). On the cell membrane, EDA-A1 forms a homotrimer which is subsequently cleaved by a serine-like furin protease allowing the C-terminal TNF homology domain to become a soluble ligand (Ezer et al., 1999; Chen et al., 2001; Elomaa et al., 2001).
Upon binding to the EDA receptor (EDAR), a signaling cascade is initiated which results in the activation of NF-kB leading to target gene expression (Elomaa et al., 2001; Laurikkala et al., 2001). This signaling pathway has been extensively studied over the last decade; however, there still remain several unanswered questions.
15 One of the most obvious questions that remain is what function does the N-terminal intracellular portion of EDA (N-EDA) have? Could this portion of the protein be involved in trimer formation, thus allowing EDA to be cleaved? Alternately, this may have a role in the remaining portion of the protein after cleavage of the extracellular portion. Since it is present in all isoforms of the EDA protein, the identification of potential protein interactors could shed light on additional, yet unknown, intracellular signaling in which EDA participates. N-EDA has been previously studied by Mikkola and coworkers (1999), who screened 3.2 x 106 clones with the intracellular domain (aa1-39) with a human keratinocyte library using a LexA-based yeast 2-hybrid system, but only identified false positive clones.
These results suggest that either the N-EDA does not bind other proteins or that the potential protein interactors were not present in the keratinocyte library. Binding partners could be specific to a particular function of the protein and subsequently have a limited temporal or spatial expression pattern. The possibility also exists that the N-EDA is utilized by splice variants not involved in epidermal development.
This study has attempted to clarify the role of the N-terminal portion of the EDA protein. Using a GAL4-based yeast 2-hybrid approach; RBM39 was identified in a human fetal brain cDNA library using the N-terminal portion of EDA as bait. Transfection of a V5 epitope tagged N-Terminal EDA construct into COS-7 cells reveals an accumulation of N-
EDA in the nucleus, an observation previously not reported. The tagged N-EDA molecule was also found to localize to the nucleus with RBM39. Together, these results suggest that
N-EDA interacts with RBM39 for an, as yet to be described, function.
16 Materials and methods
Vectors
The vectors used in the yeast two-hybrid screen were obtained from Clontech
(Mountain View, CA) as a part of the Matchmaker™ two-hybrid system 3 kit. The bait vector, pGBKT7, includes a kanamycin resistance gene for bacterial selection and a tryptophan pathway (Trp) gene for selection in yeast. In addition, there is a c-myc epitope in frame with the insert. pGBKT7 creates a fusion protein of the GAL4 DNA binding domain
(BD) and the inserted protein sequence. The pAS2.1 primer pair flanks the vector multi- cloning site (MCS) - pAS2.1 Forward 5’-tcatcggaagagagtagtaac -3’, Reverse 5’- cgttttaaaacctaagagtcac-3’ (product size: 230 bp plus insert; annealing temperature 61oC). The prey vector, pGADT7, includes an ampicillin resistance gene for bacterial selection and a leucine pathway (Leu) gene for selection in yeast. There is an HA epitope in frame with the insert. pGADT7 creates a fusion protein between the GAL4 activation domain (AD) and the inserted protein sequence. The pACT2 primer pair flanks the vector MCS - pACT2
Forward 5’-ctattcgatgatgaagataccccacc -3’, Reverse 5’- gtgaacttgcggggtttttcagtatc-3’ (product size: 210 bp plus insert; annealing temperature 64oC).
Mammalian expression vectors used in the co-localization studies were obtained from Invitrogen (Carlsbad, CA). N-EDA was inserted into pcDNA3.1D/V5-His-TOPO®.
The PC / BGH primer pair flanked the vector MCS – PC Forward 5’-gggagacccaagctggctagt
-3’, BGH Reverse 5’-tagaaggcacagtcgag -3’ (product size: 250 bp plus insert; annealing temperature 60oC). RBM39 (clone 4.18) was inserted into pcDNA3.1/NT-GFP-TOPO®.
The GFP forward primer was used with the BGH reverse primer to flank the vector MCS –
17 GFP Forward 5’-cacaatctgccctttcgaaa -3’ (product size: 271 bp plus insert; annealing
temperature 60oC). Both vectors utilize ampicillin resistance for selection in bacteria.
N-EDA Construct
The intracellular portion of EDA (N-EDA) had previously been cloned into the
pAS2.1 yeast two-hybrid bait vector (Hartung and Srivastava, unpublished). This construct
was used as the template for creating the pGBKT7+ N-EDA construct used in the library
screen. Restriction endonuclease recognition sites that would allow for excision of the N-
EDA insert followed by subsequent ligation of the insert in the correct reading frame into
the pGBKT7 vector were identified in pAS2.1+N-EDA. Eight µg of pAS2.1+N-EDA and three µg of pGBKT7 were digested with BamHI and NcoI (New England Biolabs, Ipswich,
MA) in NEB buffer 3 at 37°C for 12 hours. Digests were resolved on a 1% TAE agarose gel, extracted from the gel, and purified with the QIAquick Gel Extraction Kit (QIAGEN,
Valencia, CA) following the manufacturer’s protocols. Ligation reactions were then set up at a 3:1 (insert/vector) 0.002 pmole ratio using T4 ligase and buffer (Invitrogen). Ligation reactions were incubated overnight at 14°C. Ligation products were transformed into One
Shot® Top10 chemically competent bacteria (Invitrogen). Transformants were screened through colony PCR to identify positive clones. The bacterial colonies were suspended in 50
µl sterile distilled H2O. Two µl from each colony was then added to a gridded LB/Kan agar
plate for later isolation. An additional two µl of the suspended bacteria were then used as
template in a colony PCR. Plasmid preparations were made of the positive clones and then
sequenced to verify insert integrity and reading frame.
18 Yeast strains
The AH109 yeast strain (Clontech) was used for the library screen and subsequent
yeast mating experiments. AH109 provides four reporter genes to test for protein-protein
interactions: ADE2, HIS3, lacZ, and MEL1. The Y187 yeast strain (Clontech) was used in
the yeast mating experiments. Y187 provides three reporter genes to test for protein-protein
interactions: ADE2, HIS3, and lacZ.
Bacterial Culture and Plasmid Preparations
Bacterial clones were grown on LB agar plates with appropriate antibiotic selection at
37°C for 16-18 hours, except where noted. Bacterial clones were grown in liquid culture at
37°C shaking at 250 rpm for 16-18 hours.
Plasmid isolations were performed using one of three methods. Standard preparations were isolated with the QIAprep Spin Miniprep kit (QIAGEN). Preparations used in COS-7 transfections were prepared using the PureYield™ plasmid midiprep system
(Promega). Library scale isolations were performed using the QIAGEN Plasmid Giga Kit
(QIAGEN).
Bacterial Transformations
One Shot® Top10 chemically competent bacteria cells (Invitrogen) were thawed on ice for 5 minutes. DNA (<25 ng) was added to the bacteria, followed by a 30 minute incubation on ice. The bacteria cells were then heat shocked at 42°C for 35 seconds and returned to ice. 250 µl of SOC media (Invitrogen) was added to the heat shocked cells,
19 followed by an one hour incubation at 37°C. The bacteria cells were then plated on
LB/Kanamycin (50 µg/ml) agar plates.
Yeast Culture and Plasmid Preparations
Protocols for yeast strain maintenance and media composition were obtained from the Yeast Protocols Handbook (Clontech). Yeast strains were maintained on yeast extract,
BactoPeptone, dextrose, and adenine media (YPDA). Components for nutritional selective medias were purchased from Contech. Selective media was made by adding to the yeast nitrogen base media mix the appropriate amino acid dropout combination. –Trp media contained all amino acids except tryptophan and was used when selecting only for the pGBKT7 vector. –Leu dropout media contained all amino acids except leucine and was used when selecting only for the pGADT7 vector. –Leu,Trp selective media was used for yeast transformed with both the pGBKT7 and pGADT7 vectors. Adenine (Ade) and histidine (His) were the two nutritional reporter genes in both yeast strains. -Ade,His,
Leu,Trp media provided selection pressure for both vectors in addition to selecting for those transformants who were positive for a bait protein and prey protein interaction. In addition to the nutritional selection, α-gal (Clontech) could be applied to –Ade,His,Leu,Trp plates.
An active MEL1 reporter gene transcribes α-galactosidase which breaks the α-gal down resulting in blue colonies.
Yeast were grown on agar plates at 30°C for 3-5 days, or until colonies 0.2 mm in diameter appeared. Yeast were grown in liquid culture at 30°C shaking at 250 rpm for 16-18 hours or as specified.
20 Plasmids were isolated from fresh overnight cultures using the Zymoprep II™ Yeast
Plasmid Minipreparation Kit (Zymo Research).
Yeast Transformations
Yeast strains were transformed using the Polyethylene glycol (PEG)/ Lithium acetate
(LiAc) method outlined in the Yeast Protocols Handbook (Clontech). A single yeast colony
(either AH109 or Y187) was inoculated in 50 ml of YPDA or appropriate selective media and grown 18 hours at 30°C with shaking. Approximately 30 ml (or enough to produce a
final O.D.600=0.2-0.3) was then added to 300 ml of YPDA. The yeast were incubated at
30°C with shaking for 3 hours or until the O.D.600 was approximately equal to 0.5. The yeast
were collected, washed with sdH2O, and resuspended in 1.5 ml of 1xTE/LiAc (10x TE: 0.1
M Tris-HCl, 10 mM EDTA, pH 7.5; 10x LiAc: 1 M lithium acetate, pH 7.5).
Transformations were performed in a 1.5 ml tube by combining DNA (0.1 µg in single
transformation, 5 µg in library transformations), 0.1 mg Herring testes carrier DNA
(Clontech), 0.1 ml competent yeast, and 0.6 ml PEG/LiAc (40% PEG 4000, 1x TE, 1x
LiAc). The yeast were incubated at 30°C for 30 minutes followed by the addition of 70 µl
DMSO. Next, the yeast were heat shocked at 30°C for 15 minutes and returned to ice.
Finally, the yeast were collected from the transformation cocktail by centrifugation and
resuspended in YPDA and were allowed to recover in YPDA for 1 hour at 30°C followed by
plating on appropriate selective plates.
21 Yeast Plasmid Preparations
Fresh yeast colonies were grown overnight in 5 ml of appropriate media. Plasmids were isolated using the Zymoprep II™ Yeast Plasmid Minipreparation Kit (Zymo Research,
Orange, CA).
Yeast Mating
Yeast mating was performed by first transforming a bait and prey vector into AH109 and Y187 respectively. A single transformed colony was then suspended in 100 µl YPDA.
A bait and prey clone were then mixed together and incubated at 30°C for 18 hours. Yeast were collected by centrifugation, washed with 1xTE, and plated onto –Leu,Trp or –Ade,His,
Leu,Trp plates.
Sequencing
PCR amplicons were generated using the pAS2.1 vector primers. The PCR products were purified with GFX™ PCR Purification Kit (GE Healthcare) using manufacturer’s protocols. A dideoxy terminator sequencing reaction was set up using fifty nanograms of the purified PCR product and the DYEnamic™ ET dye terminator kit (GE Healthcare,
Piscataway, NJ ) following manufacturer’s guidelines. Sequencing was performed on a
MegaBACE 1000 (GE Healthcare). Sequences were analyzed using the Lasergene software package (DNASTAR, Inc., Madison, WI)
22 Autoactivation Assay
All yeast constructs were interacted against empty vectors and a non-specific protein
to ensure the construct was not capable of activating the reporter genes in the absence of a
true interacting protein. Constructs were transformed into AH109 with the appropriate
control and plated on –Leu,Trp and –Ade,His,Leu,Trp plates. Growth on the –Ade,His,
Leu,Trp plates identified that clone as a false positive.
Library Amplification
The Human Fetal Brain Matchmacker™ cDNA Library (Clontech) was used for the
yeast two-hybrid screen. The cDNA library was originally created from mRNA obtained
from nine pooled 20-25 week human fetuses. The library vector was pAS2.1, the prey
vector from the Clontech Matchmaker™ two-hybrid system 2.
The library was amplified to provide three-fold coverage to the 3.5x106 independent library clones present. Amplification of the library was performed following the manufacturer’s protocol. The clones were plated on LB/amp plates at a concentration of
40,000 clones per 115 mm plate. The plates were incubated at 30°C for 36-40 hours. The clones were collected in 5 ml LB by scraping. Plasmid preparations were prepared using the
QIAGEN Plasmid Giga Kit following manufacturer’s protocols.
Yeast 2-Hybrid Screen
AH109 yeast were transformed with the pGBKT7+N-EDA construct using the
LiCl/PEG method. Transformants were selected on –T plates. Transformed clones were isolated and used for plasmid DNA preparations. Plasmids were transformed into One
23 Shot® cells (Invitrogen) and grown on the appropriate antibiotic selection LB plate.
Plasmid preparations were made from the transformed bacteria and sequenced.
pGBKT7+N-EDA containing yeast clones were then transformed with the Human Fetal
Brain cDNA library (Clontech) as described previously. Transformants were plated on high
stringency -Ade,His,Leu,Trp selective plates. A portion of the transformation was plated on
-Leu,Trp plates to calculate transformation efficiency. Clones that grew in the initial plating
of the library transformants onto -Ade,His,Leu,Trp plates were selected and re-plated on -
Ade,His,Leu,Trp to further select for true positives. Positive clones were grown overnight
in a 5ml culture followed by plasmid preparations. Isolated plasmids were transformed into
One Shot™ cells (Invitrogen). Bacterial plasmid preps were then sequenced to identify clones. Sequence information was submitted to a BLAST search to identify the insert.
Clone inserts that were not coding for known genes or representing non-coding or untranslated regions of known genes were eliminated. All clones coding for known proteins were then tested for autoactivation by interacting them with empty bait plasmids and the false positive pLAM5’ bait plasmids. Clones that showed no autoactivation were again interacted using yeast mating with the AH109 and Y187 yeast strains. The clones were transformed into the Y187 cell line and mated to AH109 yeast previously transformed with the pGBKT7+N-EDA construct.
Vector Swap
The N-EDA insert in pGBKT7 and the RBM39 clone 4-18 were amplified using adapter primers (Table 1.1). The PCR products were subcloned in the pCR2.1 vector
(Invitrogen) and sequenced. Bacterial preps of these vectors were then digested with NdeI
24 and EcoRI (N-EDA) or SmaI and SalI (RBM39), followed by gel isolation and ligation into
either pGBKT7 (RBM39) or pGADT7 (N-EDA). These constructs were again sequenced
to ensure proper reading frame and transformed into AH109 as previously described.
Table 1.1 Primer List
Annealing Amplicon Primer Name Sequence (5’-3’) Used For Temperature Size (bp) (°C) N-EDA VS catatgatgggctacccggaggtg Vector Swap 68 129 F/R gaattcgctgttcccttcgcccgc RBM39 VS2 cccggggaatggatttgaactagca Vector Swap 60 673 F/R gtcgactcatcgtctacttggaac aaaattgtaatacgactcactatagggcgagcc- Addition of T7 pACT2 T7 co- gccaccatgtacccatacgatgttccagattacgct promoter to pACT2 72 varies ip F/R acttggggggtttttcagtatctacg vector N-EDA caccatgggctacccggaggtggag Co-localization ORF+Kozak 55 121 gctgttcccttcgcccgcccgggc construct F/R RBM39cnst2N aatggatttgaactagcaggaaga Co-localization 72 663 F/R tcatcgtctacttggaaccagtag construct
In vitro Co-Immunoprecipitation
Protein-protein interactions were verified using the Matchmaker™ Co-IP kit
(Clontech). Primers were created to add a T7 promoter site to the RBM39 clone 4-18
plasmid (Table 1.1). The resulting PCR product was used as template for an in vitro
transcription/translation (Promega, Madison, WI) reaction to incorporate 35S-methionine
into the product. Control and bait plasmids already contained the T7 promoter and were
used directly in the in vitro transcription/translation. 10 ul of each in vitro transcription/translation product was mixed at room temperature for 1 hour. The HA
25 epitope antibody was added and incubated for 1 hour at room temperature. Protein A beads were pretreated in Phosphate buffered saline (PBS) with 2.5% BSA. The protein A beads were then used to pull the HA antibody bound proteins out of solution. Washes were performed using solutions from the Matchmaker Co-IP kit. The resulting protein was resolved on a 15% SDS/PAGE gel, transferred to a nitrocellulose membrane with a BioRad
Trans-blot® Semi-Dry Transfer Cell, and exposed to BioMax film (Kodak, Rochester, NY ).
Fluorescence Microscopy Constructs
To determine cellular localization, N-EDA and RBM39 (clone 4-18) were cloned into pCR3.1 TOPO family expression vectors (Invitrogen) following manufacture’s protocols. The vectors utilized a topoisomerase mitigated ligation for the incorporation of insert sequences. Primers were designed to amplify the inserts of interest (Table 1.1). The pGBKT7+N-EDA and the RBM39 (4-18) constructs were used as templates for these reactions. N-EDA was cloned into pCR3.1 TOPO v5/His. The portion of RBM39 represented by clone 4-18 was ligated into pCR3.1 NGFP. These constructs were sequenced to ensure proper reading frame.
Mammalian Cell Culture
COS-7 cell line was cultured using standard protocols. In brief, the cells were grown in Dulbecco's Modified Eagle Media (DMEM) with 4 mM L-glutamine adjusted to contain
1.5 g/L sodium bicarbonate and 4.5 g/L glucose (Sigma, St. Louis, MO). The media was completed by the addition of fetal bovine serum to 10%. The cells were grown at 37°C with
10% CO2.
26 The cells were passaged when they approached 90% confluence. The growth media
was removed and the cells were washed 2 times with PBS. Trypsin+EDTA (Sigma) was
added briefly to the cells and removed. The cells were incubated at 37°C for 10 minutes,
followed by collection with complete DMEM.
Mammalian Cell Transfections
Sub-confluent COS-7 cells were seeded at a density of 50,000 cells in plating media
(DMEM with 1% FBS) onto Poly-lysine (Sigma) treated glass cover slips in 12-well cell
culture dishes (Falcon, Branchburg, NJ). Cells were transfected with 0.8 µg of the appropriate vector with the Lipofectamine 2000 (Invitrogen) transfection reagents at a ratio of 1:2 (DNA: Lipofectamine). The transfection mix was applied to the cells for 5 hours, after which the cells were washed in (PBS) and grown for 48 hours in normal growth media.
Fluorescence Microscopy
Transfected COS-7 cells were stained with anti-V5 mouse monoclonal antibody
(Invitrogen) to visualize N-EDA or EDA-A1. The anti-Lamin B goat polyclonal antibody
(Santa Cruz, Santa Cruz, CA) was used to stain the nuclear membrane. To facilitate its detection, RBM39 was expressed as a fusion with green fluorescence protein (GFP) at its N- terminus.
The Anti-V5 mouse monoclonal antibody was visualized though conjugation with
Alexa Flour® 594 goat anti-mouse (Invitrogen). The Anti-Lamin B goat polyclonal antibody was detected by using Alexa Fluor® 647 chicken anti-goat. The cells transfected with only
N-EDA or RBM39 were also stained with Alexa Fluor® 488 phalloidin green (N-EDA) or
27 Alexa Fluor® 594 phalloidin red (RBM39) to visualize the actin cytoskeleton. Cells were washed two times with PBS and fixed with 4% para-formaldehyde for 5 minutes. Cells were then permeabilized with 0.1% Triton X-100 in PBS for 5 minutes, and washed twice with
PBS. The cells were then incubated with a quenching solution (1.02 g sodium acetate in 50 ml PBS) twice for 8 minutes each to decrease fluorescence background of para- formaldehyde. Cells were then incubated for 30 minutes in a blocking solution (2% horse sera, 0.4% BSA in PBS). Primary antibodies were diluted 1:400 in the blocking solution and applied to the cells for 1 hour at room temperature. Cells were rinsed three times (5 minutes per wash) with Blocking solution followed by a final rinse in TS (10 mM Tris-HCl pH 7.5,
15 mM NaCl). Secondary antibodies diluted 1:2000 in Blocking solution were then added to the cells. The cells were then rinsed four times with PBS and coverslips were mounted onto microscope slides using Anit-Fade Gold (Invitrogen). Fluorescence microscopy was performed using a Zeiss LSM510 fitted with image analysis software.
Results
Identification of N-EDA Protein Interactors
The intracellular domain of EDA is encoded by amino acids 1-39. The pGBKT7+N-EDA plasmid expressing a fusion protein comprised of the GAL4 DNA binding domain and EDA intracellular domain was interacted against the pACT2 human fetal brain library to identify novel protein interactors. Approximately 936,000 clones were screened. A positive interacting clone was expected to grow on -Ade,His,Leu,Trp plates due to the presence of a bait plasmid containing a Trp nutrient marker and a prey plasmid that contains a Leu nutrient marker. Additionally, a protein – protein interaction between the
28 bait and prey constructs results in the activation of the Ade and His nutrient marker reporter
genes and the α-galactosidase color reporter gene. Seventy-two clones grew on -
Ade,His,Leu,Trp selective plates, suggesting an interaction between the GAL4-N-EDA
protein and the proteins encoded by those individual clones of the cDNA library. The
activation of a third reporter gene in the AH109 yeast strain, MEL1, was then tested through
α-galactosidase activity. The yeast clones were plated on -Ade,His,Leu,Trp + α-gal [20 ng/ml] plates. Of the 72 original positive clones, 60 clones were found to have positive α- galactosidase activity demonstrated by the colony turning blue, indicating a likely interaction between N-EDA and the protein coded for by the gene present in the fetal brain library.
The prey vectors containing the cDNA library inserts were then isolated and sequenced.
After identifying duplicate clones based on sequence, 37 unique clones remained. Of these, only 21 were found to code for proteins. The remaining clones inserts were found to either represent untranslated regions of genes or non-genic sequences. The 21 remaining clones were individually co-transformed into AH109 with pGBKT7 or pLAM5’-1, coding for the 5’ portion of the lamin C gene as a putative negative control. The reporter genes were activated in all but two of these transformants, eliminating 19 as false positives.
One of the positive clones was C17ORF32 (MGC45714). When transformed with pGBKT7 or pLAM5’-1, several slow growing light blue colonies resulted suggesting a weak interaction between the C17ORF32 clone and the negative control plasmids. C17ORF32
was not dismissed as a false positive because, when transformed with pGBKT7+N-EDA,
the resulting clones were robust, both in growth and color selection. This suggests the N-
EDA – C17ORF32 interaction was stronger than the background level seen in the negative
controls. This clone subsequently failed to produce a product in in vitro transcription/
29 translation reactions and may yet be a false positive. Characterization of this clone is on
going.
1 1 8 8 2 2
7 7 3 3
6 6 4 4 5 5 -AHLT -LT Figure 1.1 Yeast 2-hybrid positive clone, vector swap clone, and false positive controls. (1) Positive control (2) N-EDA + RBM39 vector swap (3) N-EDA + Clone 4-18 (4) pGBKT7- 53 + 4.18 (5) pGBKT7 + 4.18 (6) N-EDA + pGADT7-T (7) N-EDA + pGADT7 (8) Negative control. pGBKT7 + N-EDA interacted with pAS2.1 + 4-18 and the vector swap with pGBKT7 + 4-18 interacted with pGADT7 + N-EDA both show protein-protein interaction through activation of the reporter genes. Reduced growth and lighter blue colonies in 2 and 3 as compared to the positive control in 1 suggests that the N-EDA + RBM39 interaction is weak as compared to the strong interaction seen in the positive control. Absence of growth on selective media for the N-EDA and the RBM39 negative controls suggest the activation of the reporter genes in 2 and 3 is the result of an interaction between N-EDA and RBM39 and not the result of a non-specific interaction. Growth of all clones on the -Leu,Trp plates show each yeast transformant was viable.
The other gene identified in the two-hybrid screen was RBM39 (Fig. 1.1 and 1.2).
Two different library transformants, 4-18 and 4-38, were found to code for this protein.
Specifically, both clones 4-18 and 4-38 were found to code for RBM39 isoform a. Clone 4-
18 coded for RBM39 isoform a amino acids 312-530 (Fig. 1.2a). Clone 4-38 coded for
30 RBM39 isoform a amino acids 96-530, overlapping and completely including the coding
region present in clone 4-18 (Fig. 1.2a). RBM39 isoform b lacks 6 amino acids (a.a 392-397)
coded for in RBM39 isoform a and by clones 4-18 and 4-38. RBM39 isoforms c, d, and e
have also been identified but are nonsense-mediated mRNA decay (NMD) candidates
(GenBank NM_184241.1, NM_184244.1, and NM_184237.1). Additionally, isoforms c, d,
and e code for 78 bp in the 5’ region of RBM39 not present in isoforms a and b or clones 4-
18 and 4-38.
31 a Chromosme 20
13 12.1 11.21 11.22 12 13.2 pter qter
NT_028392.5 (40kb) 12 3 4 56 78 9 10 11 12 13 14 15 16 17 Exons RBM39 -A 530 a.a RBM39 -B 524 a.a
Clone 4 -38 437 a.a Clone 4 -18 214 a.a
b 13, 14, 2, 3 4 5, 6, 7 8 9 10 11 12 15 16 17
Serine RNA RNA RNA Rich Recognition Recognition Recognition Domain Motif 1 Motif 2 Motif 3 Clone 4 -38
Clone 4 -18
Figure 1.2 RBM39 genomic and protein alignments. (a) The genomic structure of RBM39 is indicated. The gene codes for five splice variants, three of which are targets of nonsense mediated decay. The two splice variants which code for proteins are shown. The portions of RBM39 coded for by clones 4-18 and 4-38 are indicated. (b) The RBM39 protein consists of 3 RNA recognition motifs (RRM) and a serine rich (SR) region, and the exons coding for these domains are indicated. The portion RBM39 coded for by clones 4-38 and 4-18 is indicated by blue bars.
32 Clone 4-18 was further tested to verify that the activation of the reporter genes was
the result of a specific interaction between N-EDA and RBM39. The first step was to
perform a yeast mating assay to serve as an independent verification of the results seen in the
co-transformation experiments. The pGBKT7+N-EDA construct was transformed into the
AH109 yeast strain and clone 4-18 was transformed into the Y187 yeast strain. The yeast
were allowed to mate overnight and subsequently plated onto –AHLT selective plates.
pGBKT7+N-EDA and clone 4-18 mated yeast grew on selective plates whereas yeast
transformed with controls to check for nonspecific activation of the reporter genes did not
grow on selective plates.
A final in vivo experiment was performed to support the protein interaction between
N-EDA and RBM39. To ensure that the positive interaction was not the result of the specific fusion proteins GAL4 BD + N-EDA and GAL4 AD +4-18, a vector swap assay was performed. The N-EDA construct was moved to the prey vector pGADT7, resulting in a GAL4 AD + N-EDA fusion protein, and the RBM39 4-18 construct was cloned into the pGBKT7 vector, resulting in a GAL4BD + RBM39 4-18 fusion protein. Co- transformation of these constructs into AH109 yeast resulted in the activation of both the A
and H nutritional selection genes and the MEL color selection gene. As seen in Figure 1.1,
the vector swap yeast grew in a similar manner to that of the original N-EDA/4-18
transformant. The in vivo results seen in the yeast strongly support a protein-protein interaction between N-EDA and RBM39. The interaction between N-EDA and RBM39 is a weak interaction based on the growth and the intensity of blue colony color seen in these transformants as compared to the positive control yeast colonies (Fig. 1.1).
33 RBM39 is a nuclear protein which binds several types of transcription factors
including c-Jun and ERα and ERβ and is a transcriptional co-activator of estrogen receptors
(Lee et al., 1999; Jung et al., 2002). RBM39 has three RNA recognition motifs (RRM) and a
serine rich region (Figure 1.2b). Clone 4-38 spans all of the RRMs while clone 4-18 spans
only the RRM nearest the carboxyl terminus of the protein (Fig.1.2b).
Verification of N-EDA and RBM39 Interaction Through Co-immunoprecipitation
In vitro transcription/translation products incorporating 35S-methionine were generated in order to determine if N-EDA and RBM39 would co-immunoprecipitate. If positive, this in vitro analysis would further support the N-EDA – RBM39 interaction. As seen in Figure 1.3 lane 1, N-EDA precipitated with RBM39 using the c-Myc monoclonal antibody. N-EDA could not be visualized in complementary pull-down assays using the HA epitope tagged to RBM39 (Fig. 1.3, lane 2). The N-EDA protein is small (39 amino acids) and only incorporates two 35S-methionines. Therefore, the lack of signal seen when
precipitating EDA with RBM39 and anti-HA is likely the combined results of a weak
protein-protein interaction between N-EDA and RBM39 as seen in the in vivo results
(Fig.1.1) and the relatively low signal strength of only two 35S-methionines incorporated into
the N-EDA protein. Controls verified neither the N-EDA nor RBM39 bound non-
specifically to the wrong antibody (Fig. 1.3, lanes 3 and 4). Attempts to precipitate non-
specific proteins (SV40 large T-antigen with N-EDA and Murine p53 with RBM39) were
also unsuccessful; suggesting the interaction seen between N-EDA and RBM39 is specific
(Fig. 1.3, lanes 5 and 6).
34 In vitro transcription/ translation product 123456 - - - - + - pGADT7 -T 3 - - - - - + pGBKT7 -53 -5 -T 7 7 9 T T RBM39 A 3 K D + + + - - + D B A E M - B G G + + - + + - N-EDA N R p p
65 kD 50 kD 37 kD 35 kD 25 kD 27 kD
20 kD
15 kD
7 kD
+ - + - + - c-Myc antibody - + - + - + HA antibody
Figure 1.3 Co-immunoprecipitation of N-EDA and RBM39 clone 4-18. In vitro transcription / translation products and Co-IP reactions were resolved through SDS-PAGE. (Lane 1) N-EDA and the c-Myc antibody pulled-down RBM39. (Lane 2) N-EDA could not be visualized after pull-downs with RBM39 and the HA antibody. (Lane 3) RBM39 did not precipitate with the c-Myc antibody. (Lane 4) N-EDA did not precipitate with the HA antibody. (Lane 5) SV40 large T-antigen coded for by pGADT7-T did not precipitate with N-EDA and the c-Myc antibody. (Lane 6) Murine p53 coded for by pGBKT7-53 did not precipitate with RBM39 and the HA antibody.
35 Cellular Localization of N-EDA and RBM39
RBM39 is a nuclear protein and EDA is a transmembrane protein (Ezer et al., 1997;
Lee et al., 1999). Previous studies have noted that the smaller EDA gene isoforms, in particular EDA-O, appear to be perinuclear, but no study has demonstrated any EDA isoform localizing to the nucleus (Ezer et al., 1999). Since RBM39 is primarily nuclear, this raised the question as to whether or not the N-EDA+RBM39 interaction discovered through the yeast two-hybrid system was biologically relevant or not. To help address this question, expression constructs were made which tagged N-EDA with the V5 epitope and
RBM39 with a GFP fusion protein. Transfection into COS-7 cells revealed the N-EDA construct actively localized to the nucleus (Figure 1.4a). Additionally, the RBM39 construct was also found in the nucleus (Figure 1.4b), as has been previously reported (Imai et al.,
1993). In the present study, there was a significant amount of RBM39 found in the cytoplasm (Fig. 1.4b and c). This is not surprising given the construct used only codes for the 4-18 clone representing the C-terminal portion of the RBM39 protein. The lack of a nuclear localization signal within N-EDA suggests that it is actively transported to the nucleus. It remains to be determined if RBM39 is the facilitator of N-EDA’s nuclear localization.
Co-transfection with both N-EDA and RBM39 expression constructs support the single transfection findings that both proteins localize to the nucleus. Interestingly, there was one region within the nucleus where RBM39 was excluded and N-EDA was concentrated (Figure 1.4c). The identity of this region will be the focus of future studies.
36 Merge N-EDA Lamin B Actin a
Merge RBM39 Lamin B Actin b
Merge N-EDA Lamin B RBM39 c
Figure 1.4 Cellular localization of N-EDA and RBM39. (a) N-EDA (red) localizes to the nucleus (blue) of Cos-7 cells. The cellular outline is depicted by phalloidin staining of actin (green). (b) RBM39 (green) localizes primarily to the nucleus, but is also found in the cytoplasm. (c) Co-localization of N-EDA and RBM39. N-EDA is shown in red in pane 1 and white in pane 2. Lamin B is shown in blue in pane 1 and white in pane 3. RBM39 is shown in green in pane 1 and white in pane 4.
37 Discussion
This work presents the findings that the N-terminal domain of EDA selected the
nuclear protein RBM39 in a yeast two-hybrid screen. Both in vivo and in vitro control
experiments support this interaction. N-EDA and RBM39 were found to both localize to
the nucleus.
RBM39 maps to 20q11.22. No ED locus has been mapped to this autosomal region.
This would mean that, either ED mutations in this gene have not been documented, or
interaction between RBM39 and N-EDA may represent a novel function of the EDA gene.
RBM39 was originally isolated through its interaction with other transcriptional activators in
the c-Jun pathway (Jung et al, 2002). Transcriptional activation in RBM39 appears to be
coupled to pre-mRNA splicing (Dowhan et al., 2005). RBM39 has been shown to interact
with core proteins in the spliceosome.
The identification of RBM39 as a possible interacting protein with the N-terminal
portion of EDA is a novel and unexpected finding. The interaction with N-EDA could
suggest a mechanism whereby the intracellular domain could be cleaved off, translocates to
the nucleus, and, finally affect gene expression of EDA-1 or other genes. A similar mechanism exists with portions of the intracellular region of amyloid precursor protein
(APP). After cleavage by a γ-secretase, the APP cytoplasmic fraction is rapidly degraded, but translates to the nucleus, where it is thought to have signaling functions with Notch and
SREBP (Cupers et. al., 2001). A similar process could exist with the N-terminal portion of the EDA protein.
Clones 4-18 and 4-38 code for portions of RBM39 which encompass RRMs, otherwise known as a ribonucleoprotein domain. The RRM domain was first identified
38 through its ability to bind mRNA precursors, however, it has since been shown to bind a wide variety of proteins, as well (Shamoo et.al., 1995; Maris et. al., 2005). The RRM located closest to the carboxyl terminus of RBM39 has been shown to interact with and activate estrogen receptor (ER) transcription factors (Jung et. al., 2002). If the interaction between
N-EDA and RBM39 holds true, then N-EDA will be linked through RBM39 to ERs, which are expressed in skin and have been shown to impact hair growth (Thornton, 2002).
It should be noted that the interaction found through the yeast two-hybrid screen may not be biologically significant. Interaction between RBM39 and N-EDA is weak in vivo and was difficult to resolve in co-immunoprecipitation assays. Also, there are no known isoforms of EDA that consist only of the intracellular domain or that localize to the nucleus.
There is also no evidence that the intracellular domain is cleaved or internalized. Future experiments including in vivo co-immunoprecipitation assays from COS-7 cells should help resolve this question. The observation clearly shows that N-EDA accumulates in the nucleus and in the surrounding cellular compartments.
In conclusion, this study has identified, through a yeast two-hybrid screen, a novel interaction between the intracellular domain of EDA and RBM39. N-EDA appears to be actively transported to the nucleus, where it co-localizes with RBM39 in some areas, it was also found to concentrate in a region where RBM39 was excluded. Future experiments should help determine if this is a biologically significant interaction.
39 40 IDENTIFICATION OF CANDIDATE GENES FOR ECTODERMAL DYSPLASIA
AND AUTOSOMAL MR IN A PATIENT WITH A t(1;6)(p22.1;p22.2)
TRANSLOCATION
Introduction
Ectodermal dysplasia (ED) is a heterogeneous developmental disorder affecting the secondary differentiation of ectodermally derived structures. The disease results in thin hair, missing or abnormally shaped teeth, and a reduction in number of sweat glands. The symptoms of the disease can be managed through orthodontics to correct misshapen teeth and the limiting of physical activity to compensate for a reduced ability to shed excess heat from the body through sweating. However, if ED is not diagnosed early, there is a significant increase in mortality resulting from hyperthermia and respiratory tract infections
(Mikkola and Thesleff, 2003).
The molecule that initiates secondary differentiation of ectodermally derived structures has been identified as the ectodysplasin-1 (EDA) gene (Kere et al., 1996). This soluble tumor necrosis factor (TNF) ligand binds to the EDA receptor, triggering a signaling cascade through NF-kB to activate target gene expression (Fig. P.2) (Ezer et al., 1999;
Headon and Overbeek, 1999; Doffinger et al., 2001). The EDA signaling pathway has been well established, but work is now just beginning to identify genes that are the targets of this pathway. EDA signaling has been shown to be the trigger for Sonic hedgehog (Shh) and cyclin D1 expression, which is critical for continued hair follicle development after hair placode growth initiation(Schmidt-Ullrich et al., 2006). The structural proteins mucosal addressin cell adhesion molecule 1 (MAdCAM-1) and intercellular adhesion molecule 1
41 (ICAM-1) play a role in the development of mouse guard hairs as a targets of the EDA signaling pathway (Nishioka et al., 2002). Lymphotoxin-β (LTβ) is critical for proper hair formation in mice (Cui et al., 2006). The Wnt agonists Dkk1 and Dkk4 also appear to be targets of EDA signaling. Wnt up-regulates EDA expression, subsequently up-regulating
Dkk1 and Dkk4, which then act as negative feedbacks to Wnt, resulting in reduced EDA expression (Figure P.2) (Andl et al., 2002; Durmowicz et al., 2002; Cui et al., 2006; Cui and
Schlessinger, 2006).
The genes responsible for a large number of EDs and associated disorders are yet to be identified. One way to identify these genes is to use a mapping approach utilizing cytogenetically visible chromosomal aberrations in patients with ectodermal defects.
A patient has recently been reported with a mild HED phenotype and cytogenetic findings of a t(1;6)(p22.1;p22.2) translocation (Asamoah et al., 2003). There are no known
HED genes located at either translocation locus. In this study, the chromosomal breakpoints at 1p22.1 and 6p22.2 have been partially mapped and the candidate genes from these regions have been identified. Expression levels of candidate genes expressed in the lymphoblastoid cell lines available were analyzed. It is speculated that one of the genes identified in this study may be affected by the translocation resulting in the patient’s clinical features.
Materials and methods
Case report
CMS8770 has previously been described (Asamoah et al., 2003). In brief, this female patient was born at 37 weeks to non-consanguineous parents after an uncomplicated
42 pregnancy. The newborn period was also uncomplicated. Most early milestones were met; however, she did not speak any words at 24 months of age. IQ results at 6.5 years of age revealed she was borderline mild MR with a Full Scale IQ of 73. Dental evaluation during this time revealed the absence of several permanent teeth. Subsequent evaluation revealed poor hair and nail, growth as well as decreased sweating. The patients karyotype was determined to be 46,XX,t(1;6)(p22.1;p22.2) de novo. Family history was only significant for learning problems in two paternal uncles, one paternal aunt, and several paternal cousins.
Molecular cytogenetics
Genomic contigs, clones, markers, mapping and sequence information were obtained from the NCBI (http://www.ncbi.nlm.nih.gov/genome/guide/human) databases. BAC and
PAC clones were obtained from commercial resources. DNA was isolated using Qiagen
Mini-Prep columns and was labeled by incorporation of digoxigenin-11-dUTP or biotin-16- dUTP (Boehringer Mannheim) by nick translation using DNA polymerase (Life
Technologies). Labeled products were combined with a 50x human Cot-1 DNA (Gibco-
BRL) and the chromosome-specific labeled centromeric alphoid probe to a final concentration of 20 ng/µl in Hybrisol VII. Probes were denatured at 76oC for 10 minutes and preassociated at 37 oC for 15-20 minutes before hybridization.
For in situ hybridization, the metaphase chromosome spreads were obtained from lymphoblastoid cells using conventional methods. Slides were incubated in 2x SSC at 37oC for 30 minutes, serially dehydrated in 70%, 80%, and 95% ethanol at room temperature, denatured in 70% formamide/2 x SSC at 72oC for two minutes, then serially dehydrated in
70%, 80%, and 95% ethanol. In situ hybridization and washing procedures were performed
43 as previously described (Ross et al., 1997; Vervoort et al., 2002). Replication banding was performed simultaneously with FISH. Commercially available chromosome-specific labeled centromeric alphoid probes were used to identify specific chromosomes. The labeled probes were visualized with rhodamine-labeled anti-digoxigenin, and chromosomes were counterstained with DAPI. Images were examined at 100x magnification under a Zeiss
Axiphot fluorescence microscope equipped with FITC, DAPI and triple band pass filter sets.
Digital images were captured by computer using Applied Imaging Probevision software
(Pittsburgh), and photographs were printed on a Kodak XL 7700 color image printer.
RNA Isolation
Total RNA was extracted from lymphoblastoid cell lines using the GenElute™
Mammalian Total RNA Purification Kit (Sigma) according to the manufacturer’s protocols.
Samples were treated with TURBO™ DNase (Ambion, Inc.) using 2 units / 50 µg RNA at
37°C for 30 minutes. RNA was subsequently purified using the RNeasy Mini Kit (Qiagen) following the manufacturer’s protocols.
Quantitative Real-Time PCR
Quantitative Real-Time PCR was performed using the iScript™ One-Step RT-PCR
Kit with SYBR® Green (BioRad) on an iCycler iQ™ Real-Time PCR detection System
(BioRad). The experimental primer pairs sequences were: ABCD3ex5-6 Forward – 5’- agtggtatcattggtcgtagcag -3’, Reverse – 5’-gagccttactcggaagcacag -3’(140 bp product);
ZNF184ex3-4 Forward – 5’-ccaagggggacataatctactctc -3’, Reverse – 5’-atggctctgtcccttgctctaa
-3’(224 bp product). For the reference gene, a primer pair amplifying a portion of the
44 coding region of the RPII gene was used. The primer sequences were: Forward – 5’- gcaccacgtccaatgacat -3’, Reverse – 5-gtgcggctgcttccataa -3’ (267 bp product). The cycling conditions used an initial 10 minute first strand synthesis step at 50°C followed by a 5 minute denaturation step at 95°C. Two-step amplification was performed by cycling between 95°C for 10 seconds and annealing/extension at 56°C (ABCD3), 57°C (ZNF184), or 60°C (RPII) for 30 seconds 45 times. Data was analyzed using the iCycler iQ™ software to generate a standard curve for each gene and calculate the fluorescence generated from the experimental primer pairs relative to RPII using the comparative Ct method.
Northern Analysis
Northern analysis was performed as described previously (Sambrook and Russell,
2001). Twenty µg total RNA was resolved on a 1.5% denaturing agarose gel and transferred to Hybond+ (GE Healthcare) filter overnight using the downward capillary transfer method
(Chomczynski, 1992). The filter was hybridized with a cDNA probe spanning exons 1-3 of
ABCD3 (208 bp). The probes were labeled with [32P]-dCTP using the RadPrime DNA
Labeling System (Invitrogen) and hybridization was performed following the ExpressHyb
(BD Biosciences) protocol. The filter was washed at high stringency according to the manufacturer’s recommendations. The filter was exposed to X-ray Biomax film (Kodak) at
-80°C for 4 days.
45 Results
Delineation of translocation breakpoint critical regions
The patients karyotype was previously determined to be t(1:6)(p22.1;p22.2)
(Asamoah et al., 2003). Physically mapped genomic clones from the Genomic contigs
NT_032977.8 (chromosome 1) and NT_007592.14 (Chromosome 6) were identified and used systematically in FISH analysis to map the translocation breakpoint critical regions.
(Figure 2.1 a,b ).
46 a Chromosome 1 35 31 22 21 21 25 32 42 pter qter qter
1p22 1p21
RP11 -148B18 RP11 -86H7 RP11 -57H12 RP11 -146P11 RP11 -122C9
RP11 -366L18 RP11 -465K1 RP11 -6J23
ABCA4 ARHGAP29 ABCD3 F3 LOC400763 SLC44A3
Chromosome 6 b 25 23 22 21.3 12 14 21 22 25 pter qter
6p22.2 6p22.1
RP3 -425P112 RP1 -45P21 RP1 -153G14 RP1 -97D16 RP1 -29K1 RP11 -150A6 RP11 -999A17
RP11 -106D17
ZNF184 LOC645950 ZNF204
Figure 2.1 Delineation of translocation breakpoint critical regions and candidate genes. Physically mapped BAC clones used in FISH analysis on chromosome 1 (a) and chromosome 6 (b) are indicated. Clones distal to the breakpoint are shown in orange. Clones spanning the breakpoint are shown in purple. Clones distal to the breakpoint are shown in green. Candidate genes from the region flanking the breakpoint critical regions are noted with arrows showing direction of transcription. Translocation critical region is shown by double purple lines.
47 The boundaries of the chromosome 1 breakpoint region were initially established with the probe RP11-148B18, which was distal to the breakpoint giving signals on the normal chromosome 1 and the derivative chromosome 6, and probe RP11-122C9, which was proximal to the breakpoint giving signals on both the normal and derivative chromosome 1 (Fig. 2.1a). Subsequent analysis found the probes RP11-86H7, RP11-465K1,
RP11-57H12, and RP11-146P11 all to be proximal to the translocation breakpoint giving signals on both the normal and derivative chromosome 1 (Fig. 2.1a). Probe RP11-366L18 spans the distance between RP11-148B18 and RP11-86H7. RP11-366L18 showed a split signal between the derivative chromosome 1 and the derivative chromosome 6, in addition to the normal chromosome 1, suggesting it spans the translocation breakpoint (Fig. 2.1a,
2.2b). To narrow the chromosome 1p22.1 breakpoint region within the 96 kb clone RP11-
366L18, a second clone, RP11-6J23, which spanned a large portion of both clones RP11-
148B18 and RP11-366L18 was used. RP11-6J23 was also found to show a split signal between the derivative chromosome 1 and the derivative chromosome 6, in addition to the normal chromosome 1 (Fig. 2.1a, 2.2a). This result showed that RP11-6J23 also spans the translocation breakpoint and narrows the translocation breakpoint critical region to the distal end of RP11-366L18 (Fig. 2.1a).
The distal boundary to the chromosome 6 translocation critical region was initially narrowed by the probes RP3-425P112 and RP1-45P21, both of which mapped distal to the breakpoint showing signals on the normal chromosome 6 and derivative chromosome 1
(Fig. 2.1b). Subsequent analysis with clone RP1-153G14 also resulted in a distal signal present on the normal chromosome 6 and derivative chromosome 1 (Fig. 2.1b). The proximal boundary was identified through the probes RP1-29K1, RP11-150A6, and RP1-
48 97D16, all of which mapped proximal to the breakpoint with signals on both the normal and derivative chromosome 6 (Fig. 2.1b). Probe RP11-999A17 lies between the distal boundary identified through RP1-153G14 and the proximal boundary identified by RP1-97D16.
RP11-999A17 was also found to be proximal to the breakpoint (Fig. 2.1b). RP11-106D17 partially overlaps both RP1-97D16 and RP11-999A17. RP11-106D17 was found to span the translocation breakpoint with signal present on the derivative chromosome 6, the derivative chromosome 1, and the normal chromosome 6 (Fig. 2.1b, 2.2c).
a b c der(6) der(1)
1 der(1) der(6) 1 der(6)
6 der(1)
Figure 2.2 FISH analysis of Chromosome 1 and 6. (a) FISH analysis of the spanning probe RP11-6J23 (green). Chromosome 1 centromeric control probes are shown in red. (b) FISH analysis of the spanning probe RP11-366L18 (green). Chromosome 1 centromeric control probes are shown in red. (c) FISH analysis of the spanning probe RP11-106D17 (green). Chromosome 6 centromeric control probes are shown in red.
Identification of ED Candidate Genes
Sequence information corresponding to the translocation critical regions was obtained from the NCBI database. End sequences of BAC/PAC clones from the critical
49 region were analyzed further and the physical map of the overlapping genomic clones was determined. On chromosome 1, four probes in particular were informative in identifying the translocation critical regions. The ends of clones RP11-148B18 (distal), RP11-366L18
(spans breakpoint), and RP11-86H7 (proximal) overlap (Fig 2.1a). The clone RP11-6J23 is almost bisected by the overlap between RP11-148B18 and RP11-366L18 (Fig. 2.1a). The fact that clones RP11-6J23 and RP11-366L18 both show a signals in FISH analysis which span the breakpoint means that the translocation must lie within the approximately 60 kb of overlap between RP11-6J23 and RP11-366L18 (Fig.2.1a).
Since no overlap between the clone ends exists between RP11-106D17 and the proximal and distal clones RP11-999A17 and RP1-153G14, the critical region cannot be narrowed significantly beyond the 170 kb size of the RP11-106D17 using FISH analysis.
Since resolution in FISH is somewhat limited and probe intensity was strong, albeit not equal, on each of the derivative chromosomes, it is safe to assume the translocation breakpoint does not lie in the 15 kb ends of this clone. Based on this evidence, the translocation breakpoint critical region on chromosome 6 has been narrowed to approximately 140 kb within the clone RP11-106D17 (Fig. 2.1b).
In silico analysis of the gene content of the 1p22.1 and 6p22.2 regions and the flanking regions showed the presence of known and putative genes (Fig. 2.1a,b).
Chromosome 1 was found to have five known genes and one predicted gene with in 500 kb of translocation breakpoint critical region (Fig 2.1a). Two genes, F3 and SLC44A3, are located on the centromeric side of the critical region (Fig. 2.1a). F3 (GenBank accession no.
BC011029) codes for coagulation factor III, a cell surface glycoprotein. F3 is known to be an integral member of the clotting pathway and is considered a poor candidate gene.
50 SLC44A3 (GenBank accession no. BC033858) is largely uncharacterized. Sequence analysis
predicts it to be an integral membrane protein. The telomeric side of the translocation
breakpoint on chromosome 1 also has two known genes, ABCA4 and ARHGAP29.
ABCA4 (GenBank accession no. U88667) is an interesting candidate gene that is associated
with retinal abnormalities (Maugeri et al., 2000). Recent reports have shown that restoration
of the Ta allele in Tabby mice improves eye health (Cui et al., 2005). But this is probably due
to restoration of proper tear gland function and not linked to retina development.
ARHGAP29 (GenBank RefSeq no. NM_004815) is also an interesting candidate gene. It
has been shown to in interact with Rho and cause mutant Rho-like changes in fibroblast
cytoskeleton when ARHGAP29 is suppressed. Rho proteins have recently been implicated
in MR, suggesting this gene could be the cause of the neurological findings in this patient if
it is indeed affected by the translocation (Benarroch, 2007). The 5’ portion of ABCD3
overlaps with the telomeric side of the chromosome 1 critical region. ABCD3 (GenBank
accession no. M81182) is a membrane protein that is thought to be involved in peroxisome
biogenesis; however its exact function is still in question (OMIM 170995). It was originally
linked to the biochemical disorder Zellweger syndrome, but this association has
subsequently been questioned (Paton et al., 1997).
The chromosome 6 critical region is in a relatively gene poor region. There are
two known Zinc finger genes, ZNF184 (GenBank accession no. U66561 ) and ZNF204
(GenBank accession no. AF033199), near the critical regions, as well as the hypothetical gene
LOC645950. The Zinc finger genes belong to a large family of proteins, some of which are transcription factors, that can bind DNA, RNA, and even proteins (Gamsjaeger et al., 2007).
51 LOC645950 is a hypothetical gene. Attempts to amplify this gene through primers designed
from the EST databases were unsuccessful.
Candidate ED Gene Expression Analysis
Candidate gene expression was measured by real-time RT-PCR. Four candidate
genes could not be checked by this method because of absent (ABCA4, ARHGAP34, and
ZNF204) or limited (SLC44A3) expression in lymphoblastoid cell lines (UniGene Hs.8198,
UniGene Hs.416707, UniGene Hs.483238, and UniGene Hs.483423). The two genes that could be check through real-time RT-PCR were ZNF184, the closest candidate gene to the chromosome 6 critical region, and ABCD3, which partially overlaps with the chromosome 1 critical region. Real-time RT-PCR results for these genes are shown in Figure 2.3. Neither gene appears to have an altered transcript level in the patient as compared to controls.
ABCD3 Northern Analysis
Because the 5’ portion of ABCD3 is located in the chromosome 1 translocation breakpoint critical region, a chimeric transcript could be produced and result in the phenotype. If a chimeric transcript is formed, it would likely be of a different size than the normal ABCD3 mRNA. To test for the presence of a chimeric transcript, we performed
Northern analysis on the patients RNA using a probe spanning exon 1-3 on ABCD3. The
northern blot showed only the expected 4 kb band size of a normal ABCD3 transcript (Fig.
2.4).
52 ABCD3 ex 5 -6 Normalized Relative expression 1.4 n
o 1.2 i s s e r
p 1 x e e
v 0.8 i t a l e 0.6 R d e z i
l 0.4 a m r
o 0.2 N 0 CMS4633 CMS6265 CMS5865 CMS5863 CMS8770
Controls Patient
ZNF184 ex 3 -4 Normalized Relative expression 2.5 n o i
s 2 s e r p x e
e 1.5 v i t a l e
R 1 d e z i l a
m 0.5 r o N 0 CMS4633 CMS6265 CMS5865 CMS5863 CMS8770
Controls Patient
Figure 2.3 Normalized relative expression for ABCD3 and ZNF184. No significant difference in expression was seen between the patient, CMS8770, and four control individuals (CMS4633, CMS6265, CMS5865, and CMS5863) for either gene tested. Real- time RT-PCR was performed in triplicate.
53 Patient Controls Patient Controls
0 5 3 5 0 5 3 5 7 6 3 6 7 6 3 6 7 2 6 8 7 2 6 8 8 6 4 5 8 6 4 5 S S S S S S S S a M M M M b M M M M C C C C C C C C
5 kb 28S
3 kb
Figure 2.4 ABCD3 Northern analysis in patient CMS8870. (a) Northern analysis using a cDNA probe spanning exons 1-3 of ABCD3 yielded an approximately 4 kb band in the patient (CMS8770) and normal controls (CMS6265, CMS4633, CMS5865) indicated by the double headed black arrow. No evidence of a chimeric transcript of a differing size from the normal transcript was present. (b) Ethidium bromide stained gel picture shows the lane abnormality visible directly above the ABCD3 band is the 28S ribosomal RNA band.
Discussion
This study has identified the translocation breakpoint critical regions in a patient with
ED, mild MR, and a karyotype of 46,XX,t(1;6)(p22.1;p22.2) . The closest gene to the
chromosome 1 breakpoint critical region is ABCD3. Real-time RT-PCR did not indicate
changes in expression of this gene in lymphoblastoid cells from the patient and Northern
analysis failed to show the presence of a chimeric transcript resulting from the translocation.
Taken together, these results suggest ABCD3 is not physically disrupted by the translocation.
There is no known gene present in the chromosome 6 translocation critical region.
This suggest that any deleterious affect of the translocation would likely be the result of a disruption in a distant transcriptional control sites for genes flanking the translocation breakpoint critical region. There are several examples in the literature of the long range
54 effects translocations can have on flanking gene expression (Crisponi et al., 2001). In such cases, the translocation often separates the target gene from a cis regulatory element. As a result, expression of the target gene can be either up-regulated or down-regulated.
On chromosome 1, we have narrowed the breakpoint critical region to a maximum of 60 kb. This implicates as candidate genes ABCA4, ARHGAP29, ABCD3, and
SLC44A3. The critical region on chromosome 6 has been narrowed to 140 kb. Two zinc finger genes, ZNF204 and ZNF184, are located near this critical region. There is no known
ED gene located in either breakpoint critical region.
Initial screening of the candidate genes in this region has been hampered because several are either not expressed in blood or expressed at extremely low levels. No other cell line from this patient is currently available for study. The two candidate genes that could be screened using mRNA derived from lymphoblastoid cell lines, ZNF184 and ABCD3, showed no change in expression compared to controls. Northern analysis using probes for the 5’ portion of ABCD3 did not detect any altered transcripts. These genes remain good candidate genes for the phenotype.
ABCD3 and ABCA4 are both members of the ABC gene family. The ABC gene family codes for a large group of transmembrane proteins involved in the active transport of target molecules across cell membranes or , in a small subgroup, the regulation of ion channels (Gottesman and Ambudkar, 2001). The ABC family of transporters have been linked to such human diseases as retinopathies, cystic fibrosis, and cardiomyopathies
(Schuierer and Langmann, 2005). Recently, ABCA2 and ABCA3 were shown to play an important role in neural stem cell proliferation, differentiation, and regulation (Lin et al.,
2006). Changes in expression patterns of ABC transporters have been linked to a significant
55 number of drug resistant cancers (Schuierer and Langmann, 2005). Given the large number of cellular processes affected by this group, it would be completely plausible that either candidate gene identified here could be the cause of the MR or ED seen in the patient.
ABCD3 is a peroxisomal membrane protein involved in the biogenesis of peroxisomes and the transfer of long chain acyl-CoA across peroxisomal membranes
(Imanaka et al., 1999). ABCD3 was once linked to the biochemical disorder Zellweger syndrome, but this association has subsequently been questioned (Paton et al., 1997). It also has been shown that SOD1 mutant mice, a model for amyotrophic lateral sclerosis, have decreased ABCD3 levels, which might be the cause of the decrease in peroxisomal function and increase in oxidative stress resulting in neuronal loss. (Ilieva et al., 2003). It remains to be seen as to whether ABCD3 plays a role in either phenotype in our patient.
Mutations in ABCA4 have a wide phenotypic spectrum (Valverde et al., 2007).
ABCA4 mutations are linked to Stargardt disease, the most common juvenile macular dystrophy, autosomal recessive cone-rod dystrophy, and retinitis pigmentosa (Riveiro-
Alvarez et al., 2007; Valverde et al., 2007). The eye is derived from the ectodermal germ layer, so there could be a link between a gene involved in retinal development and that of other ectodermally derived structures. However, of the large number of patients tested in recent ABCA4 mutation studies, none were reported to have either epidermal defects or MR
(Riveiro-Alvarez et al., 2007; Valverde et al., 2007).
Of all of the candidate genes identified in this study, ARHGAP29 is possibly the best candidate gene for the MR seen in the patient. ARHGAP29 is a GTPase which has been shown to regulate Rho activity (Saras et al., 1997). Rho proteins act as directors of cytoskeleton organization in dendrites, dentritic spines, and axons controling the growth and
56 development of these structures (Benarroch, 2007). With a role integral as this to the proper
connection and maintenance of synapses, it is understandable why Rho proteins and their
effectors are being implicated in MR. If ARHGAP29 is linked to the ED phenotype seen in
the patient, it would be the first such association between Rho signaling and ectodermal
development.
Little is known about the other three candidate genes, ZNF184, ZNF204, and
SLC44A3. A role in MR or HED could be imagined for ZNF184 or ZNF204 if either are found to have altered expression, given the Zinc finger family’s frequent role as transcription factors. Initial studies on ZNF184 expression show no difference in the patient and control, suggesting it is not affected by the translocation. SLC44A3 is a membrane protein that is predicted to act as a solute carrier and expressed at low levels in both skin and brain
(UniGene Hs.483423).
There is a question of whether one gene is responsible for both the MR and HED phenotype seen in the patient or if two different genes are affected by the translocation. If, in fact, there is one gene resulting in both phenotypes, this would be the first instance of an
HED gene mutation affecting neural function. It is more likely that two separate genes have been affected by the translocation. To answer this question completely, expression data must be obtained for the remaining candidate genes bordering the translocation breakpoint critical regions.
There remains the possibility that the MR seen in the patient is not the result of the translocation and is, in fact, the result of a separate cause. This hypothesis is supported by the patient’s family history. For this to be the case, the MR causing mutation would have to exhibit incomplete penetrance as the patient’s father is apparently normal. Alternately, the
57 patients MR could be the result of a compound heterozygous mutation with one allele coming from her mother and another coming from her father. This being stated, it is more likely that the patient’s MR is the result of a gene or genes affected by the translocation.
Other causes cannot be ruled out at this juncture.
Future studies will help identify the cause of the phenotype seen in this patient.
Further narrowing of the breakpoints may give insights into why the translocation occurred.
Addition patient samples, particularly from a different tissue type such as a skin punch yielding fibroblasts, will help finish the screening of the candidate genes in the region.
58 DEDICATOR OF CYTOKINESIS 8 (DOCK8) IS DISRUPTED IN A PATIENT WITH
ECTODERMAL DYSPLASIA, MENTAL RETARDATION, AND A
SUBTELOMERIC 9p REARRANGEMENT
Introduction
Ectodermal dysplasia (ED) is a developmental disorder in which secondarily derived ectodermal structures such as hair, teeth, and sweat glands do not form correctly.
Ectodysplasin-1 (EDA), has been shown to be the gene responsible for the X-linked hypohydrotic ectodermal dysplasia (HED), the most common form of ED (Ezer et al., 1999;
Mikkola et al., 1999).
There was long a proposed association in the literature of cognitive involvement in the ED phenotype in the form of mental retardation (MR). Tanner criticized these exaggerated claims made by some authors that upwards of 50% of ED patients had cognitive involvement (Tanner, 1985). Although some patients, even those used in the initial mapping of the EDA gene such as AnLy, do have MR, this is known to be a rare occurrence. Larger studies have shown that MR is in fact rarely seen in HED patients
(Clarke, 1987). The current understanding of the EDA signaling pathway (see Figure P.2) supports this. There are no known EDA signaling pathway proteins whose mutation also results in MR (Cui and Schlessinger, 2006). It is now generally accepted that MR seen in ED patients such as AnLy is the result of genes either disrupted by translocation breakpoints or due to a defect in a MR gene located elsewhere in the genome.
MR is the most common developmental disability, affecting intellectual and adaptive functions in approximately 1-3% of the population. Yet, the underlying cause of MR is
59 established in less than half the cases (Stevenson, 2005; Ropers, 2006). Genetic factors in
MR likely include mutations in genes distributed throughout the genome and are already well established for the genes on the X chromosome (Stevenson, 2005; Ropers, 2006). The finding of MR among almost all patients with autosomal microdeletions and the association of MR with submicroscopic alterations in the subtelomeric region of the autosomes further indicates the ubiquitous distribution of autosomal genes that influence intelligence (Brewer et al., 1998; Colleaux et al., 2001; Anderlid et al., 2002).
Chromosomal abnormalities have been found in a significant number (4-34%) of individuals with MR and developmental disabilities (reviewed by Xu and Chen 2003). About
5% of idiopathic MR can be explained by deletions or rearrangements of the subtelomeric regions of the autosomes (Knight et al., 1999; de Vries et al., 2000; Rossi et al., 2001;
Anderlid et al., 2002; De Vries et al., 2003; Xu and Chen, 2003). A large number of subtelomeric deletions have been observed in patients with MR and suggests that these deletions are likely to harbor gene(s) responsible for the observed phenotypes in these patients. Furthermore, analysis of patients with submicroscopic deletions has facilitated identification of small regions of overlap linked to specific phenotypic characteristics and subsequent isolation of the causative genes. Recently, disruption of the Eu-HMTase1 gene has been shown to be associated with the 9q34 subtelomeric deletion syndrome (Kleefstra et al., 2005; Kleefstra et al., 2006).
In this study, the 9p24 chromosomal breakpoints in one patient with HED and MR were characterized at the DNA level. Additionally, a new patient who also has a 9p rearrangement including the region affected in patient 1 was also studied. The DOCK8 gene, which lies with in the 9p24 critical region, was characterized. DOCK8 was shown to be
60 expressed in fetal and adult human brains and the longest isoform of the gene is physically disrupted in both patients.
Material and methods
Case report
Case 1 (CMS1485, alias “ANLY”) has been previously described (MacDermot and
Hulten, 1990; Thomas et al., 1993; Kere et al., 1996; Srivastava et al., 1996). This female patient was diagnosed with ectodermal dysplasia (HED), mental retardation, and had a de novo balanced translocation t(X;9)(q13.1;p24). The patient was reported to have delayed speech and psychomotor development. At age 7, she reportedly had education in a special school and a psychological assessment showed her functioning at the lower end of the moderate MR range (MacDermot and Hulten, 1990).
Case 2 (CMS6482) is a 47 year old white male with profound mental retardation (IQ
2). He was born at term to a 19 year old mother who had an appendectomy at 4 months gestation. He was reported to weigh 14 pounds. He walked at age 11 months. At one year of age, he was found to have a seizure disorder, unusual posturing and no speech. As an adult, he developed cataract with presbyopia and a cholesteatoma of the right ear. Physical examination at age 47 revealed his height to be 166.5 cm, weight 61 kg and head circumference 55 cm. He had no speech. He had significant balding, prominent supraorbital ridges, recessed eyes, midface hypoplasia, and a square chin. His ears measured 7.7 cm bilaterally with the left having a more simple architecture. His finger tips were somewhat squared at the tip with prominent pads. The distal phalanx of the left third finger was missing from an accidental amputation. He walked with a stooped over posture. Normal
61 laboratory studies included routine chromosome analysis, FMR1 gene analysis, urine creatine, urine organic acids, and plasma amino acids. Subtelomeric FISH analysis revealed the 9p deletion (ish 9ptel(30557x1)).
Cell culture
Fibroblast cell lines corresponding to patient CMS1485 (GM00705A) and a control sample CMS11195 (GM03652F) were obtained from NIGMS human genetic mutant cell repository, Coriell Institute for Medical Research (Camden, NJ). Peripheral blood lymphocytes of case 2 (CMS6482) were immortalized by Epstein-Barr virus transformation to establish a lymphoblastoid cell line. These cell lines were used for FISH experiments,
RNA preparations, and genomic DNA preparations.
Molecular cytogenetics
Genomic contigs, clones, markers, mapping and sequence information were obtained from the NCBI (http://www.ncbi.nlm.nih.gov/genome/guide/human) databases. BAC and
PAC probe preparation, hybridization, staining, and visualization has previously been descried in the methods section of the previous chapter (pg. 39). The metaphase chromosome spreads were obtained from lymphoblastoid cells (CMS6482) or from fibroblast cell (CMS1485) using conventional methods.
Pulsed-field gel electrophoresis (PFGE)
High molecular weight DNA was isolated from patient fibroblasts in agarose plugs
(Sambrook and Russell, 2001). The plugs were digested with 80U of Sal1 for 16 hours in
62 appropriate endonuclease buffer. Digested fragments were separated by electrophoresis on a
1% Seakem® Gold agarose gel (Cambrex) at 6 V/cm for 22 hours, at 12ºC in 0.5X TBE running buffer, using a 45 sec pulse time on a CHEF-DR® III apparatus (Bio-Rad). After electrophoresis, samples were transferred to a Hybond-N+ membrane (GE Healthcare) using an alkaline downward transfer procedure (Chomczynski, 1992). The filters were pre- hybridized at 65°C for 2-3 hours in aqueous hybridization solution before adding the denatured probe.
A 938 bp cDNA amplicon spanning from DOCK8 exon 41 to a portion of 47 was amplified using primers D8ex41.47 Forward – 5’- TCACATAGACTAGAGGCATTTTA -
3’, Reverse – 5’- GATCAGGGAGTGTACAGTCAGTC -3’. The cDNA hybridization probe was labeled with [32P]-dCTP using the RadPrime DNA Labeling System (Invitrogen).
Quantitative Real-Time PCR
Genomic Quantitative PCR was performed using iQ™ SYBR® Green Supermix (Bio-
Rad) on an iCycler iQ™ Real-Time PCR detection System (Bio-Rad). The experimental primer pairs sequences were: IVS13/F26IVS7 Forward – 5’-
TTTTTGTCTTTGCCCCTCTGTA -3’, Reverse – 5’-TGTCTGGCCACCTCGCTGTAA -
3’(333 bp product); Exon18/D8ex18 Forward – 5’-TTGCTTGTTAGTAATCAGAAAAG -
3’, Reverse – 5’-GTCCCCACAAAGAACTAAAG -3’(294 bp product); IVS23/D8IVS23a
Forward – 5’-TCTCGCAGTGACATCCTC -3’, Reverse – 5’-
ATTTGTGCTTTCTTCTCAGTG -3’(151 bp product); Exon29/D8ex29 Forward – 5’-
TGGGGAAATGTCATGTTTGA -3’, Reverse – 5’-CAGACACATGTGCACCAACA -
3’(214 bp product); Exon34/D8ex34 Forward – 5’-CTGAGCTAATTGTCAGGAAC -3’,
63 Reverse – 5’-GAAGCTAGATGAGAATCTTACTC -3’(272 bp product). For the reference
gene, a primer pair amplifying exon 16 of the NEPH2 gene was used. The primer sequences were: Forward – 5’-GGGCCATCAGAGCTAAAGACC -3’, Reverse – 5-
CTTGGGGGAAGTGGAGGTTTA -3’ (210 bp product). The cycling conditions used an initial 5 minute denaturation step at 95°C followed by the two-step amplification cycles at
95°C for 10 seconds and 58°C for 30 seconds repeated 40 times. Data was analyzed using the iCycler iQ™ software to generate a standard curve for each gene and calculate the fluorescence generated from the experimental primer pairs relative to NEPH2 using the
comparative Ct method.
Expression Studies
Northern blots (Multiple Tissue Blots, BD Biosciences and Origene) containing poly
A+ RNAs from different human adult and fetal tissues and poly A+ RNAs from different
human brain sections (from individuals of ages 16-75 years) were hybridized with a 867 bp
DOCK8 cDNA probe spanning exons 2-9 or with a 457 bp DOCK8 cDNA probe spanning
exons 22-25. The probes were labeled with [32P]-dCTP using the RadPrime DNA Labeling
System (Invitrogen) and hybridization was performed following the ExpressHyb (BD
Biosciences) protocol. Filters were washed at high stringency according to the
manufacturer’s recommendations.
Expression of DOCK8 in fetal tissues was also measured by RT-PCR using a human
fetal multiple tissue cDNA panel (BD Bioscience) and the D8ex41.47 primer pair. Isoform
specific primers were used to examine expression of the DOCK8 gene splice variants.
Variant 1, Dock8ex13-14 Forward 5’- AACGGCTCCTGTGTGTTCTT -3’, Reverse 5’-
64 TTGTAATGTTCCGGGCTGAT -3’ (155 bp product; annealing temperature 60oC);
Variant 2, Dock8ex13a-14 Forward 5’- GGGAAGACCATCTGCACCT -3’, Reverse 5’-
TCAGCCTCTGTGGGTAGACA -3’ (396 bp product; annealing temperature 60oC);
Variant 3, Dock8ex15-17 Forward 5’- CAGCGGGCCTGAATTTCT -3’, Reverse 5’-
TGGGAGACAGTAGGATCCAGTT -3’ (247 bp product; annealing temperature 60oC).
Mutation Screening
A patient cohort consisting of 180 females with MR was screened for mutations in
DOCK8. These patients were previously tested negative for the MR-causing FMR1 expansion. Amplicons corresponding to each exon (Table 3.1) were analyzed using
Incorporation PCR SSCP (IPS) or Denaturing High Performance Liquid Chromatography
(dHPLC) as previously described (Huber et al., 1993; Sossey-Alaoui et al., 1999). Primer pair details are listed in Table 3.1.
Both strands of PCR products from patients with abnormally migrating fragments and a normal control were amplified and sequenced using DYEnamic ET Dye Terminator
Cycle sequencing Kit (GE Healthcare) and an automated MegaBACE 1000 DNA Analysis system (GE Healthcare). Sequences were analyzed using the DNASTAR Lasergene program (DNASTAR).
65 Table 3.1 Mutation screen primers
Annealing Name Forward Primer (5’-3’) Reverse Primer (5’-3’) Length (bp) Temperature (°C) DOCK8 ex1 cagcacagcagcactcttgc cattaatgacgcaacacac 253 61 DOCK8 ex2 catctactattgcctttgtgc tcatgacaatcccaatcac 295 61 DOCK8 ex3 attcgtgtcatgttccttgc gtgtgtgatatggagtgg 322 54 DOCK8 ex4 accatgtctacacttaag ctttctatgcgtctatcg 326 56 DOCK8 ex5 gacatccaagattcttcgg tacaagtgagccctgacacc 403 60 DOCK8 ex6 ggttgggggttggaagagaa taaagcggtggcagtgtg 289 60 DOCK8 ex7 gtttatctatctaggtgttttcag ttatgtgccttagggatggat 188 61 DOCK8 ex8 aacaggtctaacttatatttcac atgggcaaatcagatcg 220 58 DOCK8 ex9 ttatggatgtaatttatgtgcc gcacattagggactaaagc 231 56 DOCK8 ex10 gtcagaggcagttgacttgg ccgctagtaagctgtggac 299 60 DOCK8 ex11 catattcagtgttcctgatcag accagacacactgtaatgtg 279 60 DOCK8 ex12 cgtttgtccccaacccaagag gtaagcagttttggcacagc 207 61 DOCK8 ex13 gattccctcataacatgacag ccccagcccgagcctgtg 273 60 DOCK8 ex14 caccccatgaatggaagtct cctgatttgaggcaaatgt 248 60 DOCK8 ex15 gaacatcctgttggcctgat tgaaaaaccaggagatgatg 217 60 DOCK8 ex16 gctgtggcgttttacaatca atcagcaggctggaaacaa 239 60 DOCK8 ex17 tgcatttgattattgcgagcta ggaaggtggtccaagacta 249 60 DOCK8 ex18 ttgcttgttagtaatcagaaaag gccccacaaagaactaaag 294 60 DOCK8 ex19 atgaggcctgccttctcc cagccctgcaggttcatac 281 60 DOCK8 ex20 cagctgtgggactacccatt cacactcagggcaactcta 224 60 DOCK8 ex21 tgacatgtctctgcctggtg cttccacggtttgacatct 228 60 DOCK8 ex22 cctttccatggttggttgac ggtgagggcatgaggaaat 211 60 DOCK8 ex23 catgcttcaggaacgaacaa cgatacaaacgcgcaagaa 238 60 DOCK8 ex24 agcaggtcaccaatctccat tttccaggtaaacaatttagaaaa 245 58 DOCK8 ex25 caaatccagagtgtcccaca catggcaacgaacatcacat 240 60 DOCK8 ex26 tgccaacctcaactccactt tggaaatacatgattaaactgagcta 300 60 DOCK8 ex27 ctggccatcgctattttcat tttggcttcatcttccatttt 243 60 DOCK8 ex28 tcctttcaccataacctcttga cccaacaatccaagaaaga 250 58 DOCK8 ex29 tggggaaatgtcatgtttga ccacacatgtgcaccaaca 214 60 DOCK8 ex30 acttcttccctggcctccat aagttgtgccactccagactt 248 60 DOCK8 ex31 acggagatctcaccaaagga acattcctccccacaaacag 244 60 DOCK8 ex32 ggtgctgaggcttctcagtt tagcagaaagttgccgagtg 212 60 DOCK8 ex33 caggtttgacatgcgcttta ttcatggccaacaaatcaga 182 60 DOCK8 ex34 ctgagctaattgtcaggaac gaagctagatgagaatcttactc 272 60 DOCK8 ex35 ctgccaagtgatgcctaatg ccaggtcactcagctggttt 223 60 DOCK8 ex36 gctttcagttatctactgctaagtgtg caaggtatgtgcttcggtgt 249 61 DOCK8 ex37 agtctctgctgccctctgat tgtcccttgagtgtgtcagg 250 60 DOCK8 ex38 tgtcctcaaaactacttctcactca aaaagctgcacacaccctac 250 60 DOCK8 ex39 ctagtctggtcgccctgttc atgccctctgggcactgac 211 62 DOCK8 ex40 gacaatgacctctggttgctc gccaccaggtaacaagacct 250 61 DOCK8 ex41 tggctcctcaggatgacata aggcgcacagaatcactttt 213 60 DOCK8 ex42 gaactctcaataatcagtgaac ggtagagaacgaagggatttag 274 60
66 Table 3.1 Continued
Annealing Name Forward Primer (5’-3’) Reverse Primer (5’-3’) Length (bp) Temperature (°C) DOCK8 ex43 ccattgcgtcagggatggcc gggtttgtgggtcctcctg 377 60 DOCK8 ex44 ctgtcatagctccaggcttgtc catggatcaaagtcctcatc 324 60 DOCK8 ex45 agggaccactggaagtagcc cactgctctactgaaattc 149 60 DOCK8 ex46 tctaagcacttcaaagtc cgctaggccccatgcgctg 286 60 DOCK8 ex47 acgctctctttccctctcct cagtccttctccagggttg 159 60 DOCK8 ex45 agggaccactggaagtagcc cactgctctactgaaattc 149 60
Fluorescence microscopy
The fibroblast cell lines CMS1485 and CMS11195 were seeded onto Nunc Lab-Tek
II CC2 chambered slides (Nalge Nunc International, Naperville, IL) at a density of 15,000 cells per well. Cells were grown overnight and then stained with Alexa Fluor® 488 phalloidin green and SYTOX® orange (Invitrogen). Briefly, cells were washed two times with PBS and fixed with 4% para-formaldehyde for 5 minutes. Cells were then permeabilized with 0.1%
Triton X-100 in PBS for 5 minutes followed by washing twice with PBS. The cells were then incubated with a quenching solution (1.02 g sodium acetate in 50 ml PBS) twice for 8 minutes each. Cells were then incubated for 30 minutes in a blocking solution (2% horse sera, 0.4% BSA in PBS) with 200 µg/ml RNaseA. Alexa Fluor® 488 phalloidin green diluted 1:200 in the blocking solution was applied to the cells for 1 hour at room temperature. Cells were rinsed in triplicate for 5 minute durations in blocking solution followed by a final rinse in TS (10mM Tris-HCl pH 7.5, 15 mM NaCl). SYTOX® orange was diluted to 2 µM in TS and added to cells for 7 minutes at room temperature. The cells were rinsed 4 times with PBS. Imaging was performed on an Axiovert 200 Laser Scanning
Microscope (Zeiss).
67 Results
Re-analysis of the de novo t(X;9)(q13;p24) translocation in a female patient with HED and MR
The Xq13 chromosome breakpoint in patient CMS1485 was previously mapped within intron 1 of the EDA gene (Xq13) and it was determined that the ectodermal defects in this female patient (CMS1485) were due to the disruption of the EDA gene (Kere et al.,
1996; Srivastava et al., 1996). Thus, the MR is presumably associated with the 9p24 breakpoint in this patient. To refine the 9p24 chromosomal breakpoint, FISH analysis was performed, using three clones spaced across chromosomal band 9p24. All three clones initially used (RP11-130C19, RP11-125K10, and RP11-376O21) mapped proximal to the 9p breakpoint and gave signals on both the normal chromosome 9 and the derivative chromosome 9 (Table 3.2). FISH analysis with additional clones narrowed the location of the 9p breakpoint to a position between the clones RP11-174M15 and RP11-165F24 (Fig
3.1). Clones RP11-143M1 and RP11-174M15 mapped distal to the breakpoint (Table 3.2).
Both probes gave FISH signals on the normal chromosome 9, but also gave a 9p-specific signal on the derivative X chromosome. Clone RP11-165F24 mapped proximal to the breakpoint and gave signals on both the normal and derivative chromosome 9 (Fig. 3.2a,
Table 3.2). Clone RP11-59O6 was found to map distal to the breakpoint (Table 3.2).
Genomic clone RP11-910H2 partially overlaps both RP11-59O6 and RP11-165F24 (Fig.
3.1). FISH analysis with RP11-910H2 revealed signals on the normal chromosome 9 and the derivative X chromosome (Fig. 3.2a, Table 3.2). These results suggest the chromosome 9 translocation breakpoint lies within the overlap of these two adjacent and partially overlapping clones (RP11-59O6 and RP11-165F24), further narrowing the translocation
68 breakpoint region (Fig. 3.1) and also suggested the possibility of a microdeletion at the
breakpoint.
Chromosome 9
24 21 13 12 21 22 32 34 pter qter
NT_008413 pter 0.1 mb 0.2 mb 0.3 mb 0.4 mb 0.5 mb
305J7 RP11 -910H2
Clones RP11 -143M1 RP11 -59O6
RP11 -174M15 RP11 -165F24
FOXD4 CBWD1 C9orf66 DOCK8 Genes
Deleted region in CMS6482 Translocation breakpoint critical region Figure 3.1 Mapping of the subtelomeric 9p chromosomal rearrangements. Ideogram of chromosome 9 with a partial physical map of the subtelomeric 9p24.3 region, BAC clones used in FISH analysis, and known genes in italics are shown. Black arrows indicate the direction of the transcription. FISH analyses determined a critical deletion region (red bar) in patient CMS6482 and a region (blue bar) harboring the 9p24 translocation breakpoint in CMS1495.
Molecular analysis of the subtelomeric deletion in a patient with MR/DD
Subtelomeric FISH analysis revealed deletion of a probe from the 9p subtelomeric
region (ish 9pter (305J7-T7 x1) in patient CMS6482 (Fig. 3.1 and 3.2b). This probe was
found to map within a genomic contig (NT_008413; NCBI) in 9p24.3 (Fig. 3.1). We
identified physically mapped genomic clones from the contig and used them systematically in
69 FISH analyses to determine the extent of the subtelomeric 9p deletions in this patient (Fig.
3.1 and Table 3.2). A part of the 9p subtelomeric region has previously been shown to share sequence homology with other regions of chromosome 9 (Martin et al., 2002). Consistent with that report, probes RP11-143M1 and RP11-174M15 gave three FISH signals on a normal chromosome 9: one at the 9p subtelomere and two others in 9p12 and 9q21.2 regions (Fig. 3.2b). However, the 9p subtelomere-specific FISH signal with clone RP11-
174M15 was absent in CMS6482, indicating a deletion of this region in the patient (Fig 3.2b,
Table 3.2). Probe RP11-59O6 gave a signal on the normal chromosome 9 but not on the derivative chromosome 9 (Table 3.2). Probe RP11-910H2 gave signals on the normal chromosome 9, as well as a reduced signal on the on the derivative chromosome 9 suggesting this probe is partially deleted (Fig. 3.2b). These results determined the deletion in patient CMS6482 to be between genomic clones RP11-143M15 (telomeric) and RP11-910H2
(centromeric) (Fig. 3.1).
Table 3.2 Chromosome 9p BAC/PAC FISH and subtelomeric results
FISH Probe CMS6482 - 9p24 del CMS1485 - t(X;9)
RP11-143M1 Normal Distal RP11-174M15 Deleted Distal #Subtelomeric probe 305J7T7 Deleted NC RP11-59O6 Deleted Distal RP11-910H2 Partially Deleted Distal RP11-165F24 Normal Proximal RP11-130C19 NC Proximal RP11-125K10 NC Proximal RP11-376O21 NC Proximal #Subtelomeric Probes from Vysis Inc.; NC, not checked
70 a RP11 -910H2 RP11 -165F24
9 9
der(9)
der(X )
der(9)
b 305J7 -T7 RP11 -174M15 RP11 -910H2
del(9p)
9
99
del(9) del(9)
del(9p) 9
Figure 3.2 FISH analysis of chromosome 9p aberrations. (a) Probe RP11-910H2 (green) is distal to the 9p24.3 translocation breakpoint in CMS1485. The probe is present on the normal chromosome 9, as well as the derivative chromosome X. Probe RP11-165F24 (green) is proximal to the 9p24 translocation breakpoint. The probe is present on both the normal and derivative chromosome 9s(red). (b) FISH analyses in CMS6482. 305J7-T7 (green) is deleted on one chromosome 9 but not the other, indicating a subtelomeric deletion in this patient. RP11-174M15 (green) gave a signal only on the normal chromosome 9 (red) and not on the derivative chromosome 9 (arrow) indicating deletion of this probe in CMS6482. Consistent with reports, this probe also gave signals at 9p12 and 9q21.1. Probe RP11-910H2 (green, arrowheads) is partially deleted on the derivative chromosome 9 and gave signals on both the normal and the derivative chromosome 9. The chromosome 9 centromeric probe is in light red color.
71 A N D c t s l la ro b t o n r h o e p C k r m a O a y 2 LOC389701 FLJ00026 M L H
800 bp LOC389701ex2F FLJ00026 ex3R
b 10 12 15 17 19 21 22 25 27 30 32 34 36 38 40 42 47 123467895 11 13 26 28 29 13b 14 16 18 20 21b 23 24 31 33 35 37 39 41 43 44 45 46 190 kb
1 2345678910 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 1 NM_2034471 (A)n Refseq
1 2345678910 11 12 13 14 15 16 17 18 19 20 BC045629.1 2 20a
13b 14a (A)n
14 15 17 18 19 20 21 22 23 24 25 3 BC030518.1 26a ORF
13c (A)n
l c o d ) tr ;9 n X o ( C t 1.2 1 y
t CMS1485 i t
d 0.8 n e
a CMS6482 z
250 Kb i u l 0.6 a Q CMS11195 m e r v 0.4 i o 188 Kb t
N CMS5865 a l
e 0.2
R CMS6265 0 Intron 13 Exon 18 Exon 23 Exon 29 Exon 34
Figure 3.3 Characterization and fine mapping of DOCK8. (a) RT-PCR linking putative genes LOC389701 and FLJ00026 as part of a single gene, DOCK8. Primer locations and within the putative genes are indicated by blue arrows. (b) Schematic diagrams (not to scale) showing the genomic structure of the DOCK8 gene (top) and 3 variants identified through EST alignments (bottom). (c) PFGE analysis with a probe located in the 3’ portion of DOCK8 reveals an abnormally migrating fragment in CMS1485 but not in the control sample. (d) Fine mapping of the 9p critical region with Quantitative genomic PCR in CMS1485, CMS6482, and in three controls (CMS11195, CMS5865 and CMS6265) reveals the 9p subtelomeric deletion in CMS6482 extends at least through exon 23 of the DOCK8 gene. CMS1485 has a deletion presumably associated with the translocation located between exon 23 and 34 with exon 29 deleted. Standard deviation of qPCR averaged 10% and did not exceed 20%.
72 Delineation of a putative critical MR region in subtelomeric 9p and identification of DOCK8 as a candidate MR gene
Sequence information corresponding to the translocation breakpoint region (Fig. 3.1)
was obtained from the NCBI database. The end sequences of BAC/PAC clones from the
critical region were analyzed further to determine the physical map of the overlapping
genomic clones. A minimal critical deletion region of approximately 230 kb in CMS6482
was determined.
In silico analysis of the gene content of the 9p24 breakpoint region and the flanking regions showed the presence of known and putative genes (Fig. 3.1). A known gene,
FOXD4 (GenBank accession no. AY344640), is located near the telomeric end of the deletion, and a gene CBWD1, encoding a COBW-like protein was also found in a homologous region on human chromosome 2p13 (Martin et al., 2002). Two putative genes,
LOC389701 and FLJ00026, mapped near the proximal end of the critical 9p micro-deletion region. EST alignments of cDNAs and rt-PCR have subsequently shown these two putative genes to be partial sequences of a singe gene, DOCK8 (Figs. 3.3a,b). DOCK8 has subsequently been characterized in detail (Ruusala and Aspenstrom, 2004; Takahashi et al.,
2006). The gene consists of 47 exons spanning approximately 190 kb of genomic DNA
(Fig. 3.3b).
Disruption of DOCK8 in both patients carrying 9p subtelomeric rearrangements
FISH analysis suggests that DOCK8 may be disrupted by both the translocation and the deletion. To support these results in our translocation patient, PFGE was performed. A
DOCK8 cDNA probe detected a normal fragment of approximately 180 kb and a novel
73 fragment of approximately 250 kb in patient CMS1485’s DNA digested with SalI (Fig. 3.3c).
We also performed quantitative genomic PCR and revealed a microdeletion of up to 37 kb located between exons 23 and 34 of DOCK8 in patient CMS1485 (Fig. 3.3d).
Quantitative genomic PCR was also employed to further narrow the centromeric boundary of the deletion in CMS6482. Five amplicons of the DOCK8 gene were analyzed and three amplicons representing intron 13, exon 18, and exon 23 were found to be deleted
(Fig 3.3d). The deletion extends through nearly half of the 5’ end of DOCK8. The centromeric end of the subtelomeric deletion overlaps with the microdeletion critical region discovered in the translocation patient CMS1485 (Fig. 3.1 and 3.3d).
Characterization of DOCK8 and its expression studies
The longest DOCK8 transcript of approximate 8 kb encodes a protein of 2031aa that contains a DOCK domain in the C-terminal region. The NCBI database analysis revealed multiple splice variants of the DOCK8 gene. Two DOCK8 variants lacked residues 859-890 or residues 959-972 of 2031aa variant. In addition, one variant had an additional 68aa residues at its N-terminal (NCBI, ; Takahashi et al., 2006). Analysis of the available EST sequences further revealed two smaller variants of the gene (Fig. 3.3b). Northern analysis of fetal and adult human tissue blots using the DOCK8 cDNA as a hybridization probe detected a transcript of about 8.0 kb in all human tissues analyzed (data not shown). To monitor the expression pattern in the human brain, we used Northern blots containing
RNAs from different regions of the adult human brain. A variable level of expression was detected in all brain regions (Fig.3.4a). Furthermore, a highly expressed 1.5 kb transcript in pancreas was identified using a 5’ cDNA probe (data not shown). Expression analysis in a
74 panel of fetal cDNAs revealed the presence of DOCK8 in most tissues, including fetal brain
(Fig. 3.4b).
The tissue distribution of the splicing variants was examined through rt-PCR (Fig.
3.4c,d). All three variants of the DOCK8 were expressed at variable levels in all tissues analyzed (Fig. 3.4d). A comparatively low level of expression or no expression was noted for variant 2 in brain, heart and skeletal muscle (Fig. 3.4d, middle panel).
75 a x te e e r l b o d o e lo m c r p b u l l l o l lo a n l a c a r e r la t l e l l i a o b b u a p t p m e i r e d n c n a r i o m t e e e p c r e u C C M S O F T P
9.5 kb 7.5 kb
4.4 kb
2.4 Kb
Clontech Human Brain MTN Blot II
r b e d e d l l a c t l s s C y u n u p t r b n r e r e e i g n m e m t n e a . l y 0 a v d a 0 r u i i e k p h 1 B L L K H S S T W
1.5 kb 1 kb 938 bp
500 bp
c d le c s s r y u n u e e t e k in g r n r M e m r a n e a l y bp a r u iv id e k p h M B L L K H S S T 200 Variant 1 13 14 15 16 17 155 bp (NM_2034471) 100
Variant 2 13a 14 14a 15 16 17 400 396 bp (BC045629) 300
300 Variant 3 13b 14 15 17 247 bp (BC030518) 200
Figure 3.4 Tissue expression profile of DOCK8. (a) Northern blot probed with a DOCK8 cDNA probe spanning exons 22-25 shows a primary transcript at about 8kb present in most brain structures identified by the black arrow. (b) cDNA expression panel shows DOCK8 is expressed in multiple tissues, including brain. (c) Schematic diagram of primer locations used in variant specific RT-PCR. (d) DOCK8 Variant 1 and 3 are expressed in all fetal tissues tested. Variant 2 expression could only be detected in fetal lung, liver, kidney, spleen and thymus.
76 DOCK8 Mutation screening
Primers were designed flanking all DOCK8 exons (Table 3.1). Using IPS and dHPLC, we detected alterations in patients with mental retardation (data not shown).
Subsequent sequencing of the corresponding PCR products identified six single nucleotide changes (Table 3.3). Most of the variations were too frequent in the MR cohort and were considered likely to be polymorphisms rather than MR causing mutations. One missense alteration, p.L1262, which appeared to be unique, was subsequently found in 2 of 145 controls tested (Table 3.3).
Table 3.3 Sequence variants detected in the DOCK8 gene
Nucleotide Location Amino acid change Allele frequency SNP ID change 10/145 MR IVS4+14A>G Intron 4 None * patients 44/145 MR IVS4+65G>A Intron 4 None * patients Observed in c.391C>T Exon 4 p.S97L * control 1/145 MR patients c.3885C>G Exon 30 p.L1262V * 2/160 controls 26/145 MR c.5129G>A Exon 44 p.P1876P rs10491684 patients 18/145 MR c.5805G>C Exon 44 p.A1902P * patients * New single nucleotide variation
77 Discussion
An important cause of MR has been shown to be chromosomal abnormalities that may result in segmental aneuploidy and alter the dosage of developmental genes. MR/DD- associated subtelomeric deletions in patients provide critical genomic intervals for the identification of the causative genes that yield the various associated clinical features. This study has defined the 9p subtelomeric region associated with MR/DD in two unrelated patients. The MR-associated critical region defined here mapped further telomeric to the previously defined 9p24.3 deletions associated with 46, XY gonadal dysgenesis and the
ANKRD15 MR locus (Ottolenghi et al., 2000; Shan et al., 2000; Lerer et al., 2005) and also appears to be unrelated to the more common 9p minus syndrome (OMIM).
There is some evidence that suggests some 9p subtelomeric deletions may be normal variants. Techakittiroj and coworkers reported a case of a patient with multiple congenital anomalies and a 9p deletion (2004). Three asymptomatic individuals in this family also were found to have a 9p subtelomeric deletion. It is unknown if the 9p deletion in this family extends into DOCK8 gene region, or if the symptomatic individual’s deletion has expanded as compared to the non-symptomatic family members. The finding of a genomic interval common to two patients with MR/DD in our study would suggest a likely role of a gene from the critical region that may influence cognitive function.
Several putative genes are located within the MR critical region. ESTs representing
CBWD1 have been found in various tissues including fetal brain, especially in the hippocampus. One candidate is FOXD4, a member of the forkhead family of transcription factors (Pierrou et al., 1994; Larsson et al., 1995). Many members of the forkhead family are known to be key regulators of embryogenesis (Kaufmann and Knochel, 1996). FOXD4 is
78 widely expressed, most prominently in heart and skeletal muscle (Pierrou et al., 1994).
Mutations in FOX genes have been implicated in several human disorders (OMIM), including the involvement of the FOXP2 gene at 7q31 in a severe speech and language disorder (Lai et al., 2001). C9orf66 was considered to be a less likely candidate, showed no similarity to known proteins, and ESTs representing this putative gene were isolated only from kidney, testis and prostate cDNA libraries (UniGene Hs.190877).
DOCK8 was found to be physically disrupted both by the 9p24 translocation breakpoint the 9p subtelomeric deletion, which suggests this to be a likely candidate for the
MR, a common clinical feature observed in both patients. DOCK8 is expressed in both fetal and adult brain. DOCK8 belongs to the dedicator of cytokinesis (DOCK) family of proteins.
These are potential guanine nucleotide exchange factors, which activate some GTPases.
Ruusala and Aspenström have shown through yeast two-hybrid experiments that DOCK8 interacts with CDC42, a small GTPase of the Rho-subfamily (2004). Additionally, they have shown through immunofluorescence staining has shown that DOCK8 is present at the cell edges in areas undergoing lamellipodia formation. This data suggests a potential role of
DOCK8 in the organization of filamentous actin.
In an attempt to examine a likely involvement of DOCK8 in organization of filamentous actin, fluorescence microscopy was performed with the actin stain phalloidin on the X;9 translocation cell line (CMS1485) and a control fibroblast cell line. No measurable difference in actin organization or cell size was observed between the control and patient cells (Fig. 3.5). A scratch wound heal assay was also performed in an attempt to assay cell motility. Again, no appreciable difference was observed between the control and patient cell lines (data not shown). The lack of any measurable differences could be explained by the
79 low level of expression of DOCK8 in the fibroblast cell lines. It is also likely that the haploinsufficiency of DOCK8 may not cause phenotypic changes visible at the microscopic level.
CMS11195 CMS1485
Figure 3.5 Actin structure of fibroblast cell lines CMS11195 (control) and CMS1485 (Patient). Filamentous actin was detected by Alexa Fluor® 488 phalloidin green and the cells were examined by immunofluorescence microscopy. The nucleus is visualized using SYTOX® orange.
The physiological and biological significance of the DOCK8 variants remain unknown. Recently, a homozygous deletion, including the DOCK8 locus at chromosome
9p24, has been found in a human lung cancer cell line (Takahashi et al., 2006). Furthermore, localization of DOCK8 protein in lamellipodia suggests that it might have a role in cell migration, morphology, adhesion and growth. Further functional analysis of the DOCK8 isoforms are needed to elucidate the biological and any pathogenic consequences of DOCK8
mutations.
80 Other members of the DOCK family of proteins play roles in neuronal development and function. A defect of the DOCK3 gene has been shown in a patient with an attention deficit hyperactivity disorder-like phenotype (de Silva et al., 2003). Furthermore, a Rac
GTPase activator protein, DOCK7, has been shown to have a role in axon formation and neuronal polarity (Watabe-Uchida et al., 2006). Several genes involved in Rho GTPase regulation and signaling have been linked to mental retardation (Govek et al., 2005). The interaction of DOCK8 with a CDC42 suggests a possible mechanism whereby the disruption of DOCK8 in our patients may results in their impaired cognitive ability. Further analysis of the DOCK8 gene mutations in patients with MR, as well as functional analysis in animal models, should clarify the possible involvement of DOCK8 in brain development and function.
81 82 CONCLUSIONS
The study of ectodermal dysplasia and its associated clinical features is an active area of research that has helped further the understanding of how ectodermal appendages change from undifferentiated ectodermal tissue into highly specialized and diverse structures. The work presented herein helps add to the functional understanding of EDA, has presented novel candidate genes involved in the pathway, and has identified novel candidate genes involved in neural development and or function.
The first chapter presented describes the functional analysis of the N-terminal portion of the EDA protein. Yeast two-hybrid screens with N-EDA have identified RBM39 as a possible protein interacting partner. Through co-localization experiments aimed at supporting this interaction, the N-terminal portion of EDA was found to localize specifically to the nucleus in COS-7 cells. This, combined with the identification of RBM39 as a candidate protein interactor, has opened new areas of research into the function of EDA and has suggested a link between N-EDA and estrogen receptors through RBM39.
The second chapter describes the identification of translocation critical regions located on chromosomes 1p21 and 6p22. The patient affected with this translocation presented with HED and mild developmental delay. Translocation breakpoints were narrowed to 52.7 kb on chromosome 1 and 150 kb on chromosome 6. Initial analysis of the candidate genes has revealed no changes in expression. Several candidate genes are not expressed in the tissue available for analysis. Future studies of the candidate genes identified here should help reveal if either translocation critical region is the cause of the HED or developmental delay seen in the patient.
83 The third chapter presents evidence that DOCK8 is physically disrupted in two patients with 9p subtelomeric aberrations. DOCK8 is characterized at the genomic level and three splice variants have been identified through EST database analysis and RT-PCR. The primary isoform is disrupted in both patients with MR. Expression of the primary isoform in the brain is also demonstrated. Since DOCK8 has been suggested to have a role in actin structure and function by regulated CDC42, actin function and gross organization was tested in a fibroblast cell line of one patient. No differences could be identified between fibroblast from the patient with the X;9 translocation disrupting DOCK8 and controls. In conclusion, the findings of this study indicate that haploinsufficiency of DOCK8 is likely responsible for the MR in these two patients and suggest a putative role for DOCK8 in brain development and function.
The studies presented herein have helped to further the understanding of ectodermal appendage differentiation through the discovery of previously unknown functions of N-
EDA and through the identification of new candidate genes involved in EDs. Finally, these studies have provided a possible explanation for the additional clinical feature of MR seen in two ED patients, and in doing so, have identified new genes associated with autosomal MR.
84 APPENDICES
85 86 Appendix A
Investigation into the interaction between the EGF and EDA
Introduction
The ectodermal dysplasia (ED) signaling pathway has been elucidated from the proteolytic release of the soluble TNF-like ligand through receptor binding and ultimate NF- kB activation resulting in changes to transcriptional levels of target genes (Fig. P.2) (Cui and
Schlessinger, 2006). Several lines of evidence also suggests a possible link between the EDA signaling and epidermal growth factor (EGF), specifically the epidermal growth factor receptor (EGFR).
The tabby (ta) mouse, a model for X-linked ED, has loss of functional eccrine sweat glands and delayed eyelid opening as two of the features of its ED phenotype. Treatment with high doses of exogenous EGF can restore functional eccrine sweat glands in tabby mice
(Blecher et al., 1990). Ta Mice treated with exogenous EGF show accelerated eyelid opening as compared to their untreated littermates effectively ameliorating the tabby phenotype
(Kapalanga and Blecher, 1991). Fibroblasts from tabby mice and HED patients, including
AnLy, have been shown to express EGFR at significantly lower levels than controls at both the mRNA and protein levels (Vargas et al., 1996; Cui et al., 2002). Furthermore, exogenous
EGF can block the formation of hair follicles, sweat glands, sebaceous glands, and dermal papillae, all structures under EDA control (Adelson et al., 1997). Restoration of EDA-A1 through a transgene has also been found to restore EGFR expression to wildtype levels (Cui et al., 2002).
87 However, others have reported that there is, in fact, no apparent link between EDA and EGFR. A431 cells transiently transfected with Ta-A1 show no difference in EGFR receptor expression levels (Mikkola et al., 1999). Additionally, the authors showed that Ta-
A1 was not present in EGFR endocytosed vacuoles providing no support for a physical interaction between EDA and EGFR. Unfortunately, the authors used a cell line that already had high levels of EGFR expression for these experiments. As a result, any effect caused by the introduction of EDA into the cell could have been muted. The absence of
EDA from EGFR endocytosed vacuoles would be expected if EGFR was a target of EDA through the signaling pathway as opposed to a direct interaction.
This study attempts to clarify the potential link between EDA and EGFR, specifically in human. An EDA-A1 expression construct was created and transiently transfected into the AnLy cell line in which EDA has been shown to be disrupted.
However, RT-PCR and western analysis of EGFR in the transiently transfected cells revealed no differences in expression.
Methods
Expression Constructs
EDA-A1 was amplified out of a fetal kidney cDNA library (Clontech) using the primers listed in Table A.1. The amplicon was cloned into the pcDNA3.1D/V5-His-
TOPO® vector as previously described. The sequence and reading frame were verified by sequencing. A plasmid preparation of the construct was prepared using the PureYield™ plasmid midiprep system (Promega).
88 Primary Human Fibroblast Cell Culture
Fibroblast cell lines corresponding to patient the CMS1485 (GM00705A) and a control sample CMS11195 (GM03652F) were obtained from NIGMS human genetic mutant cell repository, Coriell Institute for Medical Research (Camden, NJ). The cells were cultured in Eagle's Minimum Essential Medium with Earle’s BSS 2X concentration of essential and non-essential amino acids and vitamins (Sigma). The media was supplemented with 15%
FBS and 2 mM L-glutamine. Standard protocols already discussed were used in cell culture, as well as DNA, RNA, and protein isolations.
Table A.1 Primer List
Annealing Amplicon Primer Name Sequence (5’-3’) Used For Temperature Size (bp) (°C) EDA-A1 caccatgggctacccggaggtggag EDA-A1 transfection 55 1175 ORF+Kozak F/R gctgttcccttcgcccgcccgggc construct gcaccacgtccaatgacat RT-PCR control RPII F/R 60 267 gtgcggctgcttccataa primers EGFR cDNA ccaagggagtttgtggagaa EGFR RT-PCR 56 192 3F/R cttccagaccagggtgttgt primers
Primary Human Fibroblast Transfections
Patient fibroblasts (CMS1485; GM00705A) were seeded at a density of 250,000 cells in plating media (DMEM with 1% FBS) onto 60 mm cell culture dishes (Falcon). Cells were transfected with 4 µg of the appropriate vector using the Effectine (Qiagen) transfection kit with a ration of 1:10 (DNA:Effectine). The transfection mix was applied to the cells for 5
89 hours after which the cells were washed in PBS and grown for 48 hours in complete EMEM media.
Fluorescence Microscopy
The fibroblast cell line CMS1485 was seeded onto Nunc Lab-Tek II CC2 chambered slides (Nalge Nunc International) at a density of 15,000 cells per well. Anti-V5 mouse monoclonal antibody was visualized though conjugation with Alexa Flour® 594 goat anti- mouse (Invitrogen). Actin was visualized through staining with Alexa Fluor® 488 phalloidin green (N-EDA). Briefly, cells were washed two times with PBS and fixed with 4% para- formaldehyde for 5 minutes. The cells were then permeabilized with 0.1% Triton X-100 in
PBS for 5 minutes followed by washing twice with PBS. Next, the cells were incubated with a quenching solution (1.02 g sodium acetate in 50 ml PBS) twice for 8 minutes each. Cells were then incubated for 30 minutes in a blocking solution (2% horse serum, 0.4% BSA in
PBS) with 200 µg/ml RNaseA. Primary antibodies were diluted 1:400 in the blocking solution and applied to the cells for 1 hour at room temperature. Cells were rinsed 3 times 5 minutes each with blocking solution followed by a final rinse in TS (10mM Tris-HCl pH 7.5,
15 mM NaCl). Secondary antibodies diluted 1:2000 in blocking solution were then added to the cells. The cells were then rinsed four times with PBS. Imaging was performed on an
Axiovert 200 Laser Scanning Microscope (Zeiss, Oberkochen, Germany).
EDA staining in non-permeabilized cells was performed as above, with the exception that, after fixation, the V5 antibody staining was performed. The cells were subsequently washed 3 times with PBS and treated with TX-100 as above.
90 Real-Time RT-PCR
Real-time RT-PCR was performed using the iScript™ One-Step RT-PCR Kit with
SYBR® Green (BioRad, Hercules, CA) on an iCycler iQ™ Real-Time PCR detection System
(BioRad). Primer pair information for both the EGFR and RPII, the reference genes, are listed in Table A.1. The cycling conditions used an initial 10 minute first strand synthesis step at 50°C followed by a 5 minute denaturation step at 95°C. Two-step amplification was performed by cycling between 95°C for 10 seconds and 58°C for 30 seconds 45 times. Data was analyzed using the iCycler iQ™ software to generate a standard curve for each gene and calculate the fluorescence generated from the experimental primer pairs relative to RPII using the comparative Ct method.
Western Analysis of EGFR
Protein was isolated from COS-7 cells using NP-40 lysis buffer (0.1% NP-40 (Sigma) in PBS). The protein lysate was quantified through a Bradford Protein assay (Peirce,
Rockford, IL). The protein was loaded on an 8% SDS-PAGE gel at a concentration of 10
µg per well. The gel was run at 120 volts for 1 hour. The protein was transferred to a nitrocellulose filter using a BioRad semidry transfer apparatus. The resulting filter was blocked in Tris-buffered saline, 0.2% Tween-20, and 5% powdered milk overnight at 4°C.
EGFR polyclonal antibody was added epitope at a dilution of 1:400 for 1 hour at room temperature. Secondary antibody was added for 1 hour at room temperature.
SuperSignal®West Dura Extended Duration Substrate (Pierce) was used for chemiluminescent detection. Western blots were stripped with Restore™ Western Blot
Stripping Buffer (Pierce) and re-probed with anti β-actin antibodies as a control.
91 Results
Expression of EDA-A1 in CMS1485
The CMS1485 cell line has been previously shown to have ectodermal dysplasia as a result of a translocation disrupting EDA within intron 1 (MacDermot and Hulten, 1990;
Thomas et al., 1993; Kere et al., 1996; Srivastava et al., 1996). This cell line has also been shown to have reduced EGFR expression as compared to normal cell lines (Vargas et al.,
1996; Cui et al., 2002). In order to determine if restoration of EDA-A1 signaling in the
CMS1485 cell line would restore EGFR expression to wild-type levels, we inserted a functional copy of EDA-A1 into this cell line. Transfection conditions were initially optimized using a LacZ gene inserted into the pcDNA3.1D/V5-His-TOPO® vector.
Transfection efficiency as measured through beta galactosidase activity was determined to be approximately 60%. However, transfection efficiency with the pcDNA3.1D/V5-His-
TOPO® + EDA-A1 construct was found to be lower. Approximately 10% of the transfected cells showed robust expression of EDA-A1. Another 30-40% of the cells showed expression at levels closer to background.
Expression of EGFR in Presence of Transgenic EDA-A1in CMS1485
Expression of EGFR in cells transfected with the EDA-A1 construct, the empty pcDNA3.1D/V5-His-TOPO® vector, or the LacZ constructed was measured through both real-time RT-PCR and Western analysis. Cells transfected with EDA –A1 were not found to have EGFR expression profiles significantly different from those cells transfected with empty vector (Fig. A1). RT-PCR with an EGFR primer pair normalized to RPII found
EGFR expression in EDA-A1 transfected cells to be not significantly different from that
92 seen in controls (Fig. A.1a). Real-time RT-PCR also revealed EGFR expression in CMS1485 was comparable to that of normal fibroblast (Fig. A.1a). Western analysis showed similar results with protein expression (Fig. A.1b).
93 a EGFR Normalized Relative Expression
1.4 n o i 1.2 s s e r
p 1.0 b x E e
v 0.8 i t a l
e 0.6 R d e
z 0.4 i l a m
r 0.2 o N 0.0 CMS11195 CMS1485 CMS1485 CMS1485 CMS1485 EDA -A1 Empty Vector LacZ
b r to c e 1 V -A ty A p Z D m c E E la 100 kD EGFR 75 kD
β-actin
EGFR / β-actin 0.98 1.01 1.01
Figure A.1 Expression analysis of EGFR in transfected cells. (a) Real-time RT-PCR of EGFR in a normal fibroblast cell line (CMS11195), EDA deficient cell line (CMS1485), and an EDA deficient cell line transfected with either EDA-A1, empty vector, or a lacZ control. No difference in expression of EGFR was seen between any of the samples. A coding portion of RPII was used to normalize samples. (b) Western blot of transfected cells. No difference in EGFR concentration was detected between cells transfected with EDA-A1 and those transfected with controls.
94 a b
cd
Figure A.2 Cellular localization of EDA-A1. (A) Cell outlines visualized by staining with phalloidin green (green). EDA-A1intracellular location visualized through V5 epitope (red) and is present in a lattice like appearance throughout the cell as previously reported (Ezer et al., 1997). (C) EDA-A1 localized in non- permeabilized cells. Cell outlines visualized with phalloidin green. EDA-A1 localized through V5 epitope (red) and is present only on the cell membrane.
Cellular Localization of EDA-A1
Fluorescence microscopy of EDA-A1 transfected into COS-7 cells was performed to
determine if EDA-A1 was displaying cellular localization consistent with what has been
previously reported. The results show that EDA is found in the cytoplasm in a “lace-like”
pattern suggestive of ER-Golgi trafficking (Fig. A.2a,b). These micrographs were nearly
identical to those previously published (Ezer et al., 1997; Bayes et al., 1998; Mikkola et al.,
1999). EDA-A1 was found to be expressed on the cell membrane in a Type II orientation
(Fig A.2c,d). This is also consistent with previous reports (Ezer et al. 1997). These data
95 suggest that the EDA-A1construct is being transcribed and translated and is localizing to the
cell membrane, a point that would be required for proper signaling.
Discussion
This study investigated the connection between EDA-1 and EGFR that has been
previously reported in ta mice. No increase in EGFR expression was detected in a primary
human fibroblast cell line naturally deficient in EDA function but transiently transfected
with EDA-A1
The lack of change in EGFR expression when CMS1485 was transfected with EDA-
A1 could be accounted for by several explanations. The most probable reason is the low transfection efficiency. Because of the sensitive nature of this cell line to cell concentrations, stable cell lines could not be established. High transfection efficiencies could not be obtained again because of the sensitive nature of this cell line. As a result, only about 40% of the cells were transfected. Of those, only about 10% expressed the EDA-A1 transgene at high levels. Any change in EGFR expression that may have occurred as a result of the
EDA–A1 transgene was, therefore, muted out by the large number of cells either with no
EDA-A1 gene construct or expressing EDA-A1 at low levels.
Previous reports have shown EGFR expression at both the protein and mRNA level is significantly reduced in CMS1485 as compared to other HED patients, as well as control fibroblasts (Vargas et al., 1996). This study did not show a significant difference between
EGFR expression in the CMS1485 cell line and controls. This may be the result of one of three possibilities. First, our control cell line obtained from the Coriell cell repository may itself have some other mutation affecting EGFR expression that has not been previously
96 identified. Second, our construct may not have produced a biologically active form of EDA-
A1. Receptor binding and NF-kB signaling pathway activation was not tested; however,
EDA-A1 production was examined through fluorescence microscopy. EDA-A1 was found to be present in a type II orientation as a membrane protein. Intracellular distribution was similar to published results with a lattice like appearance due to the protein overloading the
ER and Golgi transport mechanisms as seen previously (Ezer et al., 1997; Mikkola et al.,
1999). Most likely, the reason lies with the CMS1485 cell line. This primary cell line has been maintained since the 1970s. As it is not an immortalized cell line, each passage brings the cells closer to a senescent state. Passage numbers in the low twenties were used to transfect, as well as isolate RNA and protein. It is likely that these high passage numbers have resulted in changes in gene expression as well as the difficulty in transfecting this cell line.
In conclusion, a direct link between EDA signaling and EGFR in human cultured cells could not be established through this study. This finding does not exclude the possibility that EDA-EGF/EGFR may affect the same signaling pathways through other convergent pathways.
97 98 Appendix B
Human Molecular Genetics Copyright License Agreement
OXFORD UNIVERSITY PRESS LICENSE TERMS AND CONDITIONS May 21, 2007
This is a License Agreement between Bradley L Griggs ("You") and Oxford University Press ("Oxford University Press"). The license consists of your order details, the terms and conditions provided by Oxford University Press, and the payment terms and conditions.
License Number 1713701113155 License date May 21, 2007 Licensed content title The anhidrotic ectodermal dysplasia gene (EDA) undergoes alternative splicing and encodes ectodysplasin-A with deletion mutations in collagenous repeats Licensed content author M Bayes, et. al. Licensed content publication Human Molecular Genetics Licensed content publisher Oxford University Press Licensed content date Oct 1, 1998 Type of Use Thesis / Dissertation Institution name Clemson University Title of your work Functional Characterization of Ectodysplasin-1 and Identification of Novel Candidate Genes for Ectodermal Dysplasias and Associated Clinical Phenotypes Publisher of your work Clemson University Expected publication date Aug 2007 Permissions cost $0.00 Value added tax $0.00 Total $0.00 Terms and Conditions STANDARD TERMS AND CONDITIONS FOR REPRODUCTION OF MATERIAL FROM AN OXFORD UNIVERSITY PRESS JOURNAL
1. Use of the material is restricted to your license details specified during the order process.
2. This permission covers the use of the material in the English language in the following territory: world. For permission to translate any material from an Oxford University Press journal into another language, please email [email protected]
99 3. This permission is limited to the particular use authorized in (1) above and does not allow you to sanction its use elsewhere in any other format other than specified above, nor does it apply to quotations, images, artistic works etc that have been reproduced from other sources which may be part of the material to be used.
4. No alteration, omission or addition is made to the material without our written consent. Permission must be re-cleared with Oxford University Press if/when you decide to reprint.
5. The following credit line appears wherever the material is used: author, title, journal, year, volume, issue number, pagination, by permission of Oxford University Press or the sponsoring society if the journal is a society journal. Where a journal is being published on behalf of a learned society, the details of that society must be included in the credit line.
6. For the reproduction of a full article from an Oxford University Press journal for whatever purpose, the corresponding author of the material concerned should be informed of the proposed use. Contact details for the corresponding authors of all Oxford University Press journal contact can be found alongside either the abstract or full text of the article concerned, accessible from www.oxfordjournals.org. Should there be a problem clearing these rights, please contact [email protected]
7. If the credit line or acknowledgement in our publication indicates that any of the figures, images or photos was reproduced, drawn or modified from an earlier source it will be necessary for you to clear this permission with the original publisher as well. If this permission has not been obtained, please note that this material cannot be included in your publication/photocopies.
8. While you may exercise the rights licensed immediately upon issuance of the license at the end of the licensing process for the transaction, provided that you have disclosed complete and accurate details of your proposed use, no license is finally effective unless and until full payment is received from you (either by Oxford University Press or by Copyright Clearance Center (CCC)) as provided in CCC's Billing and Payment terms and conditions. If full payment is not received on a timely basis, then any license preliminarily granted shall be deemed automatically revoked and shall be void as if never granted. Further, in the event that you breach any of these terms and conditions or any of CCC's Billing and Payment terms and conditions, the license is automatically revoked and shall be void as if never granted. Use of materials as described in a revoked license, as well as any use of the materials beyond the scope of an unrevoked license, may constitute copyright infringement and Oxford University Press reserves the right to take any and all action to protect its copyright in the materials.
9. This license is personal to you and may not be sublicensed, assigned or transferred by you to any other person without Oxford University Press's written permission.
10. Oxford University Press reserves all rights not specifically granted in the combination of (i) the license details provided by you and accepted in the course of this licensing transaction, (ii) these terms and conditions and (iii) CCC's Billing and Payment terms and conditions.
11. You hereby indemnify and agree to hold harmless Oxford University Press and CCC, and their respective officers, directors, employs and agents, from and against any and all claims arising our to your use of the licensed material other than as specifically authorized pursuant to this license. v1.1
100 Appendix C
Cell Cycle Copyright Licensee Agreement
Bradley L. Griggs Greenwood Genetic Center 113 Gregor Mendel Circle Greenwood, SC 29649
Dear Dr. Griggs:
Per your request for copyright release we are pleased to grant y ou the permission to use Figure 1 from the following article in your upcoming dissertation . Please remember to cite the article in the figure legend.
EDA Signaling and Skin Appendage Development Chang -Yi Cui and David Schlessinger Cell Cycle 2006; 5:2477 -83
Sincerely,
Kimberly Mitchell Journals Publication Director Landes Bioscience [email protected]
101 102 Appendix D
List of Abbreviations
Ade Adenine AD Activation Domain BAC Bacterial Artificial Chromosome BD Binding Domain Cr Crinkled Dl Downless DMEM Dulbecco's Modified Eagle Media ED Ectodermal Dysplasias EDA Ectodysplasin-1 EDARADD EDAR Associated Death Domain ER Estrogen Receptor EGF Ectodermal Growth Factor EGFR Ectodermal Growth Factor Receptor ER Estrogen Receptor GFP Green Fluorescent Protein His Histidene HED Hypohydrotic Ectodermal Dysplasia ICAM1 Intercellular Adhesion Molecule 1 inhibitor of kappa light polypeptide gene enhancer in IKBKG B-cells, kinase gamma Leu Leucine LB Luria-Bertani Medium LBβ Lymphotoxin-β LiAC Lithium Acetate MAdcam Mucosal Addressin Cell Adhesion Molecule MR Mental Retardation N-EDA Intracellular Domain of EDA PEG Polyethelene Gylcol PBS Phosphate Buffered Saline Shh Sonic Hedgehog Trp Tryptophan Ta Tabby TNF Tumor Necrosis Factor Yeast Extract, BactoPeptone, Dextrose, and YPDA Adenine Media
103 104 REFERENCES CITED
Adelson, D.L., Hollis, D.E., Merchant, J.C. and Kelley, B.A.: In vivo effects of epidermal growth factor on epidermal pattern formation and hair follicle initiation in the marsupial bandicoot Isoodon macrourus. Reprod Fertil Dev 9 (1997) 493-500.
Anderlid, B.M., Schoumans, J., Anneren, G., Sahlen, S., Kyllerman, M., Vujic, M., Hagberg, B., Blennow, E. and Nordenskjold, M.: Subtelomeric rearrangements detected in patients with idiopathic mental retardation. Am J Med Genet 107 (2002) 275-84.
Andl, T., Reddy, S.T., Gaddapara, T. and Millar, S.E.: WNT signals are required for the initiation of hair follicle development. Dev Cell 2 (2002) 643-53.
Asamoah, A., Decker, A.B., Wiktor, A. and Van Dyke, D.L.: Child with De Novo t(1;6)(p22.1;p22.1) translocation and features of ectodermal dysplasia with hypodontia and developmental delay. Am J Med Genet A 118 (2003) 82-5.
Baala, L., Hadj Rabia, S., Zlotogora, J., Kabbaj, K., Chhoul, H., Munnich, A., Lyonnet, S. and Sefiani, A.: Both recessive and dominant forms of anhidrotic/hypohidrotic ectodermal dysplasia map to chromosome 2q11-q13. Am J Hum Genet 64 (1999) 651-3.
Bayes, M., Hartung, A.J., Ezer, S., Pispa, J., Thesleff, I., Srivastava, A.K. and Kere, J.: The anhidrotic ectodermal dysplasia gene (EDA) undergoes alternative splicing and encodes ectodysplasin-A with deletion mutations in collagenous repeats. Hum Mol Genet 7 (1998) 1661-9.
Benarroch, E.E.: Rho GTPases: role in dendrite and axonal growth, mental retardation, and axonal regeneration. Neurology 68 (2007) 1315-8.
Blecher, S.R., Kapalanga, J. and Lalonde, D.: Induction of sweat glands by epidermal growth factor in murine X-linked anhidrotic ectodermal dysplasia. Nature 345 (1990) 542-4.
Botchkarev, V.A. and Fessing, M.Y.: Edar signaling in the control of hair follicle development. J Investig Dermatol Symp Proc 10 (2005) 247-51.
Brewer, C., Holloway, S., Zawalnyski, P., Schinzel, A. and FitzPatrick, D.: A chromosomal deletion map of human malformations. Am J Hum Genet 63 (1998) 1153-9.
Casal, M.L., Scheidt, J.L., Rhodes, J.L., Henthorn, P.S. and Werner, P.: Mutation identification in a canine model of X-linked ectodermal dysplasia. Mamm Genome 16 (2005) 524-31.
105 Chassaing, N., Bourthoumieu, S., Cossee, M., Calvas, P. and Vincent, M.C.: Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hum Mutat 27 (2006) 255-9.
Chen, Y., Molloy, S.S., Thomas, L., Gambee, J., Bachinger, H.P., Ferguson, B., Zonana, J., Thomas, G. and Morris, N.P.: Mutations within a furin consensus sequence block proteolytic release of ectodysplasin-A and cause X-linked hypohidrotic ectodermal dysplasia. Proc Natl Acad Sci U S A 98 (2001) 7218-23.
Chomczynski, P.: One-hour downward alkaline capillary transfer for blotting of DNA and RNA. Anal Biochem 201 (1992) 134-9.
Clarke, A.: Hypohidrotic ectodermal dysplasia. J Med Genet 24 (1987) 659-63.
Cohen, S.: Isolation of a mouse submaxillary gland protein accelerating incisor eruption and eyelid opening in the new-born animal. J Biol Chem 237 (1962) 1555-62.
Colleaux, L., Rio, M., Heuertz, S., Moindrault, S., Turleau, C., Ozilou, C., Gosset, P., Raoult, O., Lyonnet, S., Cormier-Daire, V., Amiel, J., Le Merrer, M., Picq, M., de Blois, M.C., Prieur, M., Romana, S., Cornelis, F., Vekemans, M. and Munnich, A.: A novel automated strategy for screening cryptic telomeric rearrangements in children with idiopathic mental retardation. Eur J Hum Genet 9 (2001) 319-27.
Colosimo, P.F., Hosemann, K.E., Balabhadra, S., Villarreal, G., Jr., Dickson, M., Grimwood, J., Schmutz, J., Myers, R.M., Schluter, D. and Kingsley, D.M.: Widespread parallel evolution in sticklebacks by repeated fixation of Ectodysplasin alleles. Science 307 (2005) 1928-33.
Crisponi, L., Deiana, M., Loi, A., Chiappe, F., Uda, M., Amati, P., Bisceglia, L., Zelante, L., Nagaraja, R., Porcu, S., Ristaldi, M.S., Marzella, R., Rocchi, M., Nicolino, M., Lienhardt-Roussie, A., Nivelon, A., Verloes, A., Schlessinger, D., Gasparini, P., Bonneau, D., Cao, A. and Pilia, G.: The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome. Nat Genet 27 (2001) 159-66.
Cui, C.Y., Durmowicz, M., Tanaka, T.S., Hartung, A.J., Tezuka, T., Hashimoto, K., Ko, M.S., Srivastava, A.K. and Schlessinger, D.: EDA targets revealed by skin gene expression profiles of wild-type, Tabby and Tabby EDA-A1 transgenic mice. Hum Mol Genet 11 (2002) 1763-73.
Cui, C.Y., Hashimoto, T., Grivennikov, S.I., Piao, Y., Nedospasov, S.A. and Schlessinger, D.: Ectodysplasin regulates the lymphotoxin-beta pathway for hair differentiation. Proc Natl Acad Sci U S A 103 (2006) 9142-7.
Cui, C.Y. and Schlessinger, D.: EDA Signaling and Skin Appendage Development. Cell Cycle 5 (2006) 2477-83.
106 Cui, C.Y., Smith, J.A., Schlessinger, D. and Chan, C.C.: X-linked anhidrotic ectodermal dysplasia disruption yields a mouse model for ocular surface disease and resultant blindness. Am J Pathol 167 (2005) 89-95. de Silva, M.G., Elliott, K., Dahl, H.H., Fitzpatrick, E., Wilcox, S., Delatycki, M., Williamson, R., Efron, D., Lynch, M. and Forrest, S.: Disruption of a novel member of a sodium/hydrogen exchanger family and DOCK3 is associated with an attention deficit hyperactivity disorder-like phenotype. J Med Genet 40 (2003) 733-40.
De Vries, B.B., Bitner-Glindzicz, M., Knight, S.J., Tyson, J., MacDermont, K.D., Flint, J., Malcolm, S. and Winter, R.M.: A boy with a submicroscopic 22qter deletion, general overgrowth and features suggestive of FG syndrome. Clin Genet 58 (2000) 483-7.
De Vries, B.B., Winter, R., Schinzel, A. and van Ravenswaaij-Arts, C.: Telomeres: a diagnosis at the end of the chromosomes. J Med Genet 40 (2003) 385-98.
Doffinger, R., Smahi, A., Bessia, C., Geissmann, F., Feinberg, J., Durandy, A., Bodemer, C., Kenwrick, S., Dupuis-Girod, S., Blanche, S., Wood, P., Rabia, S.H., Headon, D.J., Overbeek, P.A., Le Deist, F., Holland, S.M., Belani, K., Kumararatne, D.S., Fischer, A., Shapiro, R., Conley, M.E., Reimund, E., Kalhoff, H., Abinun, M., Munnich, A., Israel, A., Courtois, G. and Casanova, J.L.: X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling. Nat Genet 27 (2001) 277-85.
Drogemuller, C., Distl, O. and Leeb, T.: Partial deletion of the bovine ED1 gene causes anhidrotic ectodermal dysplasia in cattle. Genome Res 11 (2001) 1699-705.
Durmowicz, M.C., Cui, C.Y. and Schlessinger, D.: The EDA gene is a target of, but does not regulate Wnt signaling. Gene 285 (2002) 203-11.
Elomaa, O., Pulkkinen, K., Hannelius, U., Mikkola, M., Saarialho-Kere, U. and Kere, J.: Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet 10 (2001) 953-62.
Ezer, S., Bayes, M., Elomaa, O., Schlessinger, D. and Kere, J.: Ectodysplasin is a collagenous trimeric type II membrane protein with a tumor necrosis factor-like domain and co- localizes with cytoskeletal structures at lateral and apical surfaces of cells. Hum Mol Genet 8 (1999) 2079-86.
Ezer, S., Schlessinger, D., Srivastava, A. and Kere, J.: Anhidrotic ectodermal dysplasia (EDA) protein expressed in MCF-7 cells associates with cell membrane and induces rounding. Hum Mol Genet 6 (1997) 1581-7.
107 Ferguson, B.M., Brockdorff, N., Formstone, E., Ngyuen, T., Kronmiller, J.E. and Zonana, J.: Cloning of Tabby, the murine homolog of the human EDA gene: evidence for a membrane-associated protein with a short collagenous domain. Hum Mol Genet 6 (1997) 1589-94.
Gamsjaeger, R., Liew, C.K., Loughlin, F.E., Crossley, M. and Mackay, J.P.: Sticky fingers: zinc-fingers as protein-recognition motifs. Trends Biochem Sci 32 (2007) 63-70.
Gottesman, M.M. and Ambudkar, S.V.: Overview: ABC transporters and human disease. J Bioenerg Biomembr 33 (2001) 453-8.
Govek, E.E., Newey, S.E. and Van Aelst, L.: The role of the Rho GTPases in neuronal development. Genes Dev 19 (2005) 1-49.
Grifa, A., Wagner, C.A., D'Ambrosio, L., Melchionda, S., Bernardi, F., Lopez-Bigas, N., Rabionet, R., Arbones, M., Monica, M.D., Estivill, X., Zelante, L., Lang, F. and Gasparini, P.: Mutations in GJB6 cause nonsyndromic autosomal dominant deafness at DFNA3 locus. Nat Genet 23 (1999) 16-8.
Headon, D.J., Emmal, S.A., Ferguson, B.M., Tucker, A.S., Justice, M.J., Sharpe, P.T., Zonana, J. and Overbeek, P.A.: Gene defect in ectodermal dysplasia implicates a death domain adapter in development. Nature 414 (2001) 913-6.
Headon, D.J. and Overbeek, P.A.: Involvement of a novel Tnf receptor homologue in hair follicle induction. Nat Genet 22 (1999) 370-4.
Ho, L., Williams, M.S. and Spritz, R.A.: A gene for autosomal dominant hypohidrotic ectodermal dysplasia (EDA3) maps to chromosome 2q11-q13. Am J Hum Genet 62 (1998) 1102-6.
Houghton, L., Lindon, C. and Morgan, B.A.: The ectodysplasin pathway in feather tract development. Development 132 (2005) 863-72.
Huber, C.G., Oefner, P.J., Preuss, E. and Bonn, G.K.: High-resolution liquid chromatography of DNA fragments on non-porous poly(styrene-divinylbenzene) particles. Nucleic Acids Res 21 (1993) 1061-6.
Ilieva, H.S., Nagano, I., Murakami, T., Shiote, M., Manabe, Y. and Abe, K.: Age-related changes in peroxisomal membrane protein 70 and superoxide dismutase 1 in transgenic G93A mice. Neurol Res 25 (2003) 423-6.
Imanaka, T., Aihara, K., Takano, T., Yamashita, A., Sato, R., Suzuki, Y., Yokota, S. and Osumi, T.: Characterization of the 70-kDa peroxisomal membrane protein, an ATP binding cassette transporter. J Biol Chem 274 (1999) 11968-76.
108 Jung, D.J., Na, S.Y., Na, D.S. and Lee, J.W.: Molecular cloning and characterization of CAPER, a novel coactivator of activating protein-1 and estrogen receptors. J Biol Chem 277 (2002) 1229-34.
Kapalanga, J. and Blecher, S.R.: Effect of the X-linked gene Tabby (Ta) on eyelid opening and incisor eruption in neonatal mice is opposite to that of epidermal growth factor. Development 108 (1990) 349-55.
Kapalanga, J. and Blecher, S.R.: Histological studies on eyelid opening in normal male mice and hemizygotes for the mutant gene Tabby (Ta) with and without epidermal growth factor treatment. Exp Eye Res 52 (1991) 155-66.
Kashiwagi, M., Kuroki, T. and Huh, N.: Specific inhibition of hair follicle formation by epidermal growth factor in an organ culture of developing mouse skin. Dev Biol 189 (1997) 22-32.
Kaufmann, E. and Knochel, W.: Five years on the wings of fork head. Mech Dev 57 (1996) 3-20.
Kere, J., Srivastava, A.K., Montonen, O., Zonana, J., Thomas, N., Ferguson, B., Munoz, F., Morgan, D., Clarke, A., Baybayan, P., Chen, E.Y., Ezer, S., Saarialho-Kere, U., de la Chapelle, A. and Schlessinger, D.: X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat Genet 13 (1996) 409-16.
Kleefstra, T., Brunner, H.G., Amiel, J., Oudakker, A.R., Nillesen, W.M., Magee, A., Genevieve, D., Cormier-Daire, V., van Esch, H., Fryns, J.P., Hamel, B.C., Sistermans, E.A., de Vries, B.B. and van Bokhoven, H.: Loss-of-function mutations in euchromatin histone methyl transferase 1 (EHMT1) cause the 9q34 subtelomeric deletion syndrome. Am J Hum Genet 79 (2006) 370-7.
Kleefstra, T., Smidt, M., Banning, M.J., Oudakker, A.R., Van Esch, H., de Brouwer, A.P., Nillesen, W., Sistermans, E.A., Hamel, B.C., de Bruijn, D., Fryns, J.P., Yntema, H.G., Brunner, H.G., de Vries, B.B. and van Bokhoven, H.: Disruption of the gene Euchromatin Histone Methyl Transferase1 (Eu-HMTase1) is associated with the 9q34 subtelomeric deletion syndrome. J Med Genet 42 (2005) 299-306.
Knight, S.J., Regan, R., Nicod, A., Horsley, S.W., Kearney, L., Homfray, T., Winter, R.M., Bolton, P. and Flint, J.: Subtle chromosomal rearrangements in children with unexplained mental retardation. Lancet 354 (1999) 1676-81.
Kolvraa, S., Kruse, T.A., Jensen, P.K., Linde, K.H., Vestergaard, S.R. and Bolund, L.: Close linkage between X-linked ectodermal dysplasia and a cloned DNA sequence detecting a two allele restriction fragment length polymorphism in the region Xp11- q12. Hum Genet 74 (1986) 284-7.
109 Kondo, S., Kuwahara, Y., Kondo, M., Naruse, K., Mitani, H., Wakamatsu, Y., Ozato, K., Asakawa, S., Shimizu, N. and Shima, A.: The medaka rs-3 locus required for scale development encodes ectodysplasin-A receptor. Curr Biol 11 (2001) 1202-6.
Koppinen, P., Pispa, J., Laurikkala, J., Thesleff, I. and Mikkola, M.L.: Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res 269 (2001) 180-92.
Kumar, A., Eby, M.T., Sinha, S., Jasmin, A. and Chaudhary, P.M.: The ectodermal dysplasia receptor activates the nuclear factor-kappaB, JNK, and cell death pathways and binds to ectodysplasin A. J Biol Chem 276 (2001) 2668-77.
Lai, C.S., Fisher, S.E., Hurst, J.A., Vargha-Khadem, F. and Monaco, A.P.: A forkhead- domain gene is mutated in a severe speech and language disorder. Nature 413 (2001) 519-23.
Lamartine, J., Munhoz Essenfelder, G., Kibar, Z., Lanneluc, I., Callouet, E., Laoudj, D., Lemaitre, G., Hand, C., Hayflick, S.J., Zonana, J., Antonarakis, S., Radhakrishna, U., Kelsell, D.P., Christianson, A.L., Pitaval, A., Der Kaloustian, V., Fraser, C., Blanchet- Bardon, C., Rouleau, G.A. and Waksman, G.: Mutations in GJB6 cause hidrotic ectodermal dysplasia. Nat Genet 26 (2000) 142-4.
Larsson, C., Hellqvist, M., Pierrou, S., White, I., Enerback, S. and Carlsson, P.: Chromosomal localization of six human forkhead genes, freac-1 (FKHL5), -3 (FKHL7), -4 (FKHL8), -5 (FKHL9), -6 (FKHL10), and -8 (FKHL12). Genomics 30 (1995) 464-9.
Laurikkala, J., Mikkola, M., Mustonen, T., Aberg, T., Koppinen, P., Pispa, J., Nieminen, P., Galceran, J., Grosschedl, R. and Thesleff, I.: TNF signaling via the ligand-receptor pair ectodysplasin and edar controls the function of epithelial signaling centers and is regulated by Wnt and activin during tooth organogenesis. Dev Biol 229 (2001) 443- 55.
Laurikkala, J., Pispa, J., Jung, H.S., Nieminen, P., Mikkola, M., Wang, X., Saarialho-Kere, U., Galceran, J., Grosschedl, R. and Thesleff, I.: Regulation of hair follicle development by the TNF signal ectodysplasin and its receptor Edar. Development 129 (2002) 2541-53.
Lee, S.K., Anzick, S.L., Choi, J.E., Bubendorf, L., Guan, X.Y., Jung, Y.K., Kallioniemi, O.P., Kononen, J., Trent, J.M., Azorsa, D., Jhun, B.H., Cheong, J.H., Lee, Y.C., Meltzer, P.S. and Lee, J.W.: A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. J Biol Chem 274 (1999) 34283-93.
Lerer, I., Sagi, M., Meiner, V., Cohen, T., Zlotogora, J. and Abeliovich, D.: Deletion of the ANKRD15 gene at 9p24.3 causes parent-of-origin-dependent inheritance of familial cerebral palsy. Hum Mol Genet 14 (2005) 3911-20.
110 Lin, T., Islam, O. and Heese, K.: ABC transporters, neural stem cells and neurogenesis--a different perspective. Cell Res 16 (2006) 857-71.
MacDermot, K.D. and Hulten, M.: Female with hypohidrotic ectodermal dysplasia and de novo (X;9) translocation. Clinical documentation of the AnLy cell line case. Hum Genet 84 (1990) 577-9.
Martin, C.L., Wong, A., Gross, A., Chung, J., Fantes, J.A. and Ledbetter, D.H.: The evolutionary origin of human subtelomeric homologies--or where the ends begin. Am J Hum Genet 70 (2002) 972-84.
Maugeri, A., Klevering, B.J., Rohrschneider, K., Blankenagel, A., Brunner, H.G., Deutman, A.F., Hoyng, C.B. and Cremers, F.P.: Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy. Am J Hum Genet 67 (2000) 960-6.
Mikkola, M.L., Pispa, J., Pekkanen, M., Paulin, L., Nieminen, P., Kere, J. and Thesleff, I.: Ectodysplasin, a protein required for epithelial morphogenesis, is a novel TNF homologue and promotes cell-matrix adhesion. Mech Dev 88 (1999) 133-46.
Mikkola, M.L. and Thesleff, I.: Ectodysplasin signaling in development. Cytokine Growth Factor Rev 14 (2003) 211-24.
Monreal, A.W., Ferguson, B.M., Headon, D.J., Street, S.L., Overbeek, P.A. and Zonana, J.: Mutations in the human homologue of mouse dl cause autosomal recessive and dominant hypohidrotic ectodermal dysplasia. Nat Genet 22 (1999) 366-9.
Morlon, A., Munnich, A. and Smahi, A.: TAB2, TRAF6 and TAK1 are involved in NF- kappaB activation induced by the TNF-receptor, Edar and its adaptator Edaradd. Hum Mol Genet 14 (2005) 3751-7.
Munoz, F., Lestringant, G., Sybert, V., Frydman, M., Alswaini, A., Frossard, P.M., Jorgenson, R. and Zonana, J.: Definitive evidence for an autosomal recessive form of hypohidrotic ectodermal dysplasia clinically indistinguishable from the more common X-linked disorder. Am J Hum Genet 61 (1997) 94-100.
Naito, A., Yoshida, H., Nishioka, E., Satoh, M., Azuma, S., Yamamoto, T., Nishikawa, S. and Inoue, J.: TRAF6-deficient mice display hypohidrotic ectodermal dysplasia. Proc Natl Acad Sci U S A 99 (2002) 8766-71.
NCBI: National Center for Biotechnology Information. http://www.ncbi.nlm.nih.gov/.
Newton, K., French, D.M., Yan, M., Frantz, G.D. and Dixit, V.M.: Myodegeneration in EDA-A2 transgenic mice is prevented by XEDAR deficiency. Mol Cell Biol 24 (2004) 1608-13.
111 Nishioka, E., Tanaka, T., Yoshida, H., Matsumura, K., Nishikawa, S., Naito, A., Inoue, J., Funasaka, Y., Ichihashi, M., Miyasaka, M. and Nishikawa, S.: Mucosal addressin cell adhesion molecule 1 plays an unexpected role in the development of mouse guard hair. J Invest Dermatol 119 (2002) 632-8.
OMIM: Online Mendelian Inheritance in Man. http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM.
Ottolenghi, C., Veitia, R., Quintana-Murci, L., Torchard, D., Scapoli, L., Souleyreau- Therville, N., Beckmann, J., Fellous, M. and McElreavey, K.: The region on 9p associated with 46,XY sex reversal contains several transcripts expressed in the urogenital system and a novel doublesex-related domain. Genomics 64 (2000) 170-8.
Paton, B.C., Heron, S.E., Nelson, P.V., Morris, C.P. and Poulos, A.: Absence of mutations raises doubts about the role of the 70-kD peroxisomal membrane protein in Zellweger syndrome. Am J Hum Genet 60 (1997) 1535-9.
Pierrou, S., Hellqvist, M., Samuelsson, L., Enerback, S. and Carlsson, P.: Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. Embo J 13 (1994) 5002-12.
Pinheiro, M. and Freire-Maia, N.: Ectodermal dysplasias: a clinical classification and a causal review. Am J Med Genet 53 (1994) 153-62.
Pispa, J., Jung, H.S., Jernvall, J., Kettunen, P., Mustonen, T., Tabata, M.J., Kere, J. and Thesleff, I.: Cusp patterning defect in Tabby mouse teeth and its partial rescue by FGF. Dev Biol 216 (1999) 521-34.
Raymond, F.L. and Tarpey, P.: The genetics of mental retardation. Hum Mol Genet 15 Spec No 2 (2006) R110-6.
Riveiro-Alvarez, R., Valverde, D., Lorda-Sanchez, I., Trujillo-Tiebas, M.J., Cantalapiedra, D., Vallespin, E., Aguirre-Lamban, J., Ramos, C. and Ayuso, C.: Partial paternal uniparental disomy (UPD) of chromosome 1 in a patient with Stargardt disease. Mol Vis 13 (2007) 96-101.
Ropers, H.H.: X-linked mental retardation: many genes for a complex disorder. Curr Opin Genet Dev 16 (2006) 260-9.
Rossi, E., Piccini, F., Zollino, M., Neri, G., Caselli, D., Tenconi, R., Castellan, C., Carrozzo, R., Danesino, C., Zuffardi, O., Ragusa, A., Castiglia, L., Galesi, O., Greco, D., Romano, C., Pierluigi, M., Perfumo, C., Di Rocco, M., Faravelli, F., Dagna Bricarelli, F., Bonaglia, M., Bedeschi, M. and Borgatti, R.: Cryptic telomeric rearrangements in subjects with mental retardation associated with dysmorphism and congenital malformations. J Med Genet 38 (2001) 417-20.
112 Ruusala, A. and Aspenstrom, P.: Isolation and characterisation of DOCK8, a member of the DOCK180-related regulators of cell morphology. FEBS Lett 572 (2004) 159-66.
Sambrook, J. and Russell, D.: Molecular Cloning: A Laboratory Manual, 3 ed. Cold Springs Harbor Laboratory Press, WoodBury, NY, 2001.
Saras, J., Franzen, P., Aspenstrom, P., Hellman, U., Gonez, L.J. and Heldin, C.H.: A novel GTPase-activating protein for Rho interacts with a PDZ domain of the protein- tyrosine phosphatase PTPL1. J Biol Chem 272 (1997) 24333-8.
Schmidt-Ullrich, R., Tobin, D.J., Lenhard, D., Schneider, P., Paus, R. and Scheidereit, C.: NF-kappaB transmits Eda A1/EdaR signalling to activate Shh and cyclin D1 expression, and controls post-initiation hair placode down growth. Development 133 (2006) 1045-57.
Schneider, P., Street, S.L., Gaide, O., Hertig, S., Tardivel, A., Tschopp, J., Runkel, L., Alevizopoulos, K., Ferguson, B.M. and Zonana, J.: Mutations leading to X-linked hypohidrotic ectodermal dysplasia affect three major functional domains in the tumor necrosis factor family member ectodysplasin-A. J Biol Chem 276 (2001) 18819-27.
Schuierer, M.M. and Langmann, T.: Molecular diagnosis of ATP-binding cassette transporter-related diseases. Expert Rev Mol Diagn 5 (2005) 755-67.
Shan, Z., Zabel, B., Trautmann, U., Hillig, U., Ottolenghi, C., Wan, Y. and Haaf, T.: FISH mapping of the sex-reversal region on human chromosome 9p in two XY females and in primates. Eur J Hum Genet 8 (2000) 167-73.
Smahi, A., Courtois, G., Rabia, S.H., Doffinger, R., Bodemer, C., Munnich, A., Casanova, J.L. and Israel, A.: The NF-kappaB signalling pathway in human diseases: from incontinentia pigmenti to ectodermal dysplasias and immune-deficiency syndromes. Hum Mol Genet 11 (2002) 2371-5.
Smith, F.J., Morley, S.M. and McLean, W.H.: A novel connexin 30 mutation in Clouston syndrome. J Invest Dermatol 118 (2002) 530-2.
Snellman, A., Tu, H., Vaisanen, T., Kvist, A.P., Huhtala, P. and Pihlajaniemi, T.: A short sequence in the N-terminal region is required for the trimerization of type XIII collagen and is conserved in other collagenous transmembrane proteins. Embo J 19 (2000) 5051-9.
Sossey-Alaoui, K., Lyon, J.A., Jones, L., Abidi, F.E., Hartung, A.J., Hane, B., Schwartz, C.E., Stevenson, R.E. and Srivastava, A.K.: Molecular cloning and characterization of TRPC5 (HTRP5), the human homologue of a mouse brain receptor-activated capacitative Ca2+ entry channel. Genomics 60 (1999) 330-40.
113 Srivastava, A.K., Durmowicz, M.C., Hartung, A.J., Hudson, J., Ouzts, L.V., Donovan, D.M., Cui, C.Y. and Schlessinger, D.: Ectodysplasin-A1 is sufficient to rescue both hair growth and sweat glands in Tabby mice. Hum Mol Genet 10 (2001) 2973-81.
Srivastava, A.K., Montonen, O., Saarialho-Kere, U., Chen, E., Baybayan, P., Pispa, J., Limon, J., Schlessinger, D. and Kere, J.: Fine mapping of the EDA gene: a translocation breakpoint is associated with a CpG island that is transcribed. Am J Hum Genet 58 (1996) 126-32.
Srivastava, A.K., Pispa, J., Hartung, A.J., Du, Y., Ezer, S., Jenks, T., Shimada, T., Pekkanen, M., Mikkola, M.L., Ko, M.S., Thesleff, I., Kere, J. and Schlessinger, D.: The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains. Proc Natl Acad Sci U S A 94 (1997) 13069-74.
Stevenson, R.E.: Advances in X-linked mental retardation. Curr Opin Pediatr 17 (2005) 720- 4.
Stevenson, R.E., Procopio-Allen, A.M., Schroer, R.J. and Collins, J.S.: Genetic syndromes among individuals with mental retardation. Am J Med Genet A 123 (2003) 29-32.
Takahashi, K., Kohno, T., Ajima, R., Sasaki, H., Minna, J.D., Fujiwara, T., Tanaka, N. and Yokota, J.: Homozygous deletion and reduced expression of the DOCK8 gene in human lung cancer. Int J Oncol 28 (2006) 321-8.
Tanner, B.A.: Intellectual Functioning and Ectodermal Dysplasia. Pediatrics 75 (1985) 126.
Tao, R., Jin, B., Guo, S.Z., Qing, W., Feng, G.Y., Brooks, D.G., Liu, L., Xu, J., Li, T., Yan, Y. and He, L.: A novel missense mutation of the EDA gene in a Mongolian family with congenital hypodontia. J Hum Genet 51 (2006) 498-502.
Thomas, N.S., Chelly, J., Zonana, J., Davies, K.J., Morgan, S., Gault, J., Rack, K.A., Buckle, V.J., Brockdorff, N., Clarke, A. and et al.: Characterisation of molecular DNA rearrangements within the Xq12-q13.1 region, in three patients with X-linked hypohidrotic ectodermal dysplasia (EDA). Hum Mol Genet 2 (1993) 1679-85.
Tucker, A.S., Headon, D.J., Schneider, P., Ferguson, B.M., Overbeek, P., Tschopp, J. and Sharpe, P.T.: Edar/Eda interactions regulate enamel knot formation in tooth morphogenesis. Development 127 (2000) 4691-700.
Valverde, D., Riveiro-Alvarez, R., Aguirre-Lamban, J., Baiget, M., Carballo, M., Antinolo, G., Millan, J.M., Garcia Sandoval, B. and Ayuso, C.: Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients. Invest Ophthalmol Vis Sci 48 (2007) 985-90.
114 Vargas, G.A., Fantino, E., George-Nascimento, C., Gargus, J.J. and Haigler, H.T.: Reduced epidermal growth factor receptor expression in hypohidrotic ectodermal dysplasia and Tabby mice. J Clin Invest 97 (1996) 2426-32.
Watabe-Uchida, M., John, K.A., Janas, J.A., Newey, S.E. and Van Aelst, L.: The Rac activator DOCK7 regulates neuronal polarity through local phosphorylation of stathmin/Op18. Neuron 51 (2006) 727-39.
Wisniewski, S.A., Kobielak, A., Trzeciak, W.H. and Kobielak, K.: Recent advances in understanding of the molecular basis of anhidrotic ectodermal dysplasia: discovery of a ligand, ectodysplasin A and its two receptors. J Appl Genet 43 (2002) 97-107.
Xu, J. and Chen, Z.: Advances in molecular cytogenetics for the evaluation of mental retardation. Am J Med Genet C Semin Med Genet 117 (2003) 15-24.
Yan, M., Wang, L.C., Hymowitz, S.G., Schilbach, S., Lee, J., Goddard, A., de Vos, A.M., Gao, W.Q. and Dixit, V.M.: Two-amino acid molecular switch in an epithelial morphogen that regulates binding to two distinct receptors. Science 290 (2000) 523- 7.
Yan, M., Zhang, Z., Brady, J.R., Schilbach, S., Fairbrother, W.J. and Dixit, V.M.: Identification of a novel death domain-containing adaptor molecule for ectodysplasin-A receptor that is mutated in crinkled mice. Curr Biol 12 (2002) 409- 13.
115