Genetics: Early Online, published on July 25, 2019 as 10.1534/genetics.119.302499

1 2 3 4 5 6 7 8 9 10 11 12 Histone H2B ubiquitylation regulates histone expression by suppressing 13 antisense transcription in fission yeast 14 15 16 Viviane Pagé1, Jennifer J. Chen1, Mickael Durand-Dubief2, David Grabowski1, Eriko 17 Oya2, Miriam Sanso3, Ryan D. Martin1, Terence E. Hébert1, Robert P. Fisher3, Karl 18 Ekwall2, and Jason C. Tanny1* 19 20 21 22 23 1Department of Pharmacology and Therapeutics, McGill University, Montreal, 24 Quebec, Canada 25 2Department of Biosciences and Nutrition, Karolinska Institute, Stockholm, 26 Sweden 27 3Department of Oncological Sciences, Icahn School of Medicine at Mount 28 Sinai, Mount Sinai School of Medicine, New York, NY, USA 29 30 *Corresponding author: [email protected] 31

Copyright 2019. 1 Abstract 2 3 Histone H2B monoubiquitylation (H2Bub1) is tightly linked to RNA polymerase II 4 transcription elongation, and is also directly implicated in DNA replication and 5 repair. Loss of H2Bub1 is associated with defects in cell cycle progression, but how 6 these are related to its various functions, and the underlying mechanisms involved, 7 is not understood. Here we describe a role for H2Bub1 in the regulation of 8 replication-dependent histone in the fission yeast Schizosaccharomyces 9 pombe. H2Bub1 activates histone genes indirectly by suppressing antisense 10 transcription of ams2+, a gene encoding a GATA-type that 11 activates histone genes and is required for assembly of centromeric chromatin. 12 Mutants lacking the ubiquitylation site in H2B or the H2B-specific E3 ubiquitin 13 ligase Brl2 had elevated levels of ams2+ antisense transcripts and reduced Ams2 14 levels. These defects were reversed upon inhibition of Cdk9, ortholog of the 15 kinase component of positive transcription elongation factor b (P-TEFb), indicating 16 that they likely resulted from aberrant transcription elongation. Reduced Cdk9 17 activity also partially rescued segregation phenotypes of H2Bub1 18 mutants. In a genome-wide analysis, loss of H2Bub1 led to increased antisense 19 transcripts at over 500 protein-coding genes in H2Bub1 mutants; for a subset of 20 these, including several genes involved in chromosome segregation and chromatin 21 assembly, antisense de-repression was Cdk9-dependent. Our results highlight 22 antisense suppression as a key feature of cell cycle-dependent gene regulation by 23 H2Bub1 and suggest that aberrant transcription elongation may underlie the effects 24 of H2Bub1 loss on cell cycle progression. 25

2 1 Introduction 2 3 Histone H2B monoubiquitylation (H2Bub1) is a conserved and multifunctional 4 histone mark with direct roles in RNA polymerase II transcription elongation, DNA

5 replication, and DNA repair (MOYAL et al. 2011; NAKAMURA et al. 2011; TRUJILLO AND

6 OSLEY 2012; FUCHS et al. 2014). H2Bub1 is catalyzed by the E2 ubiquitin-conjugating

7 enzyme Rad6 and E3 ubiquitin ligases related to budding yeast Bre1 (FUCHS AND

8 OREN 2014). During transcription, activity of these enzymes requires Cdk9, the

9 kinase component of positive transcription elongation factor b (P-TEFb) (TANNY 10 2014). Ubiquitylation by these factors occurs on a conserved lysine on the 11 nucleosome surface (K120 in ; K119 in fission yeast), which promotes the 12 methylation of specific sites on histone H3 by Dot1 and COMPASS-related complexes

13 (KIM et al. 2013; ANDERSON et al. 2019; WORDEN et al. 2019). H2Bub1 also acts 14 independently of downstream histone methylation by influencing activity of a 15 number of additional factors, including histone chaperones and chromatin-

16 remodeling factors (SANSO et al. 2012; FUCHS AND OREN 2014). How these functions 17 are coordinated to regulate transcription, replication, or DNA repair is not well 18 understood. 19 H2Bub1 is required for normal cell cycle progression in yeast and in 20 mammalian cells. H2Bub1 has direct roles in a variety of cell cycle events, such as 21 DNA replication fork progression, operation of the S phase checkpoint, DNA double- 22 strand break repair, sister chromatid cohesion, and assembly of centromeric

23 chromatin (TRUJILLO AND OSLEY 2012; SADEGHI et al. 2014; HUNG et al. 2017; ZHANG et 24 al. 2017). Several studies have also implicated H2Bub1 in the regulation of cell

25 cycle-dependent genes (SHEMA et al. 2008; ZIMMERMANN et al. 2011; JAASKELAINEN et

26 al. 2012; FUCHS AND OREN 2014). Thus, H2Bub1 function during the cell cycle likely 27 requires coordination among multiple different mechanisms. In the fission yeast 28 Schizosaccharomyces pombe, loss of H2Bub1 causes defective cell separation and 29 increased cell size, but the origin of these effects is unclear. These phenotypes are 30 largely reversed upon reduction in the activity of Cdk9, suggesting that they result

31 from aberrant transcription that is Cdk9-dependent (SANSO et al. 2012). To gain

3 1 insight into the roles of H2Bub1 in cell cycle progression we have examined its 2 function in cell cycle-regulated gene expression in the model eukaryote S. pombe, 3 and we identify a specific role for this modification in regulating expression of 4 replication-dependent histone genes. We provide evidence that this arises from a 5 role of H2Bub1 in suppressing Cdk9-dependent antisense transcripts. These results 6 offer new insight into gene regulatory mechanisms of H2Bub1 and its role in cell- 7 cycle progression. 8 9 10 Experimental Procedures 11 12 Yeast strains and media. S. pombe strains used in this study are listed in Table 1. S. 13 pombe strains were cultured in YE (0.5% yeast extract, 3% dextrose) or in EMM

14 (Edinburgh minimal media; (MORENO et al. 1991)) supplemented with adenine, 15 leucine, uracil, and histidine (0.25g/L each). Strains harboring plasmids expressing

16 ams2+ (TAKAYAMA et al. 2016) were cultured in supplemented EMM lacking leucine 17 and thiamine. Transformation of plasmids was carried out using a lithium acetate

18 method (BAHLER et al. 1998). Thiabendazole (TBZ; Sigma) was added to plates at a 19 concentration of 15 µg/mL. 3-MB-PP1 was synthesized by Zamboni Chemical 20 Solutions (Bellini Life Sciences Complex, McGill University) and used at a final 21 concentration of 20 µM. Cycloheximide (Sigma) was added to supplemented YE 22 media at a final concentration of 100 µM. Standard genetic crosses and tetrad

23 dissection were used to create double mutant strains (MORENO et al. 1991). 24

25 Synchronization in S phase with hydroxyurea. Cells were grown to OD600 of 0.2 26 in 300 mL EMM at 30oC and hydroxyurea (HU) was added to 12 mM; incubation 27 continued for 4 hours. Cultures were harvested by centrifugation at 25oC, washed 28 once with pre-warmed EMM, resuspended in 300 mL pre-warmed EMM, and 29 returned to growth. Samples were collected upon return to growth and at 20-minute 30 intervals thereafter. For fluorescence-activated cell sorting (FACS) analysis, 1 mL of 31 culture was pelleted in a microfuge, resuspended in ice-cold 70% ethanol, and

4 1 stored at 4oC. For RNA analyses 10 mL of culture was pelleted, washed with 1 mL

o 2 sterile dH2O and stored at -80 C. 3 4 RNA analyses. Total RNA was extracted from frozen cell pellets using a hot phenol

5 method (TANNY et al. 2007). For RT-qPCR, 1 μg RNA was reverse transcribed to 6 cDNA (AMBG Easyscript) with oligo-dT primers, which was then amplified with the 7 primers listed in Table 2 and a SYBR Green qPCR master mix (Bio-Rad) in a Bio-Rad 8 CFX96 qPCR instrument. Levels of histone mRNAs were expressed relative to act1+. 9 Strand-specific RT-qPCR was carried out similarly using gene-specific primers 10 (Table 2). 11 12 FACS analysis. Samples fixed in 70% ethanol were washed once with 1 mL 50 mM 13 sodium citrate and then resuspended in 0.5 mL 50 mM sodium citrate containing 0.1 14 μg/mL RNase A. After a 4-hour incubation at 37oC 0.5 mL 50 mM sodium citrate 15 containing 4 μg/mL propidium iodide was added. Samples were sonicated briefly 16 and analyzed on a FACSCalibur-I instrument (BD Biosciences). Data were processed

17 using FloJo software as described (KNUTSEN et al. 2011), and were imported into R 18 for visualization. 19 20 Immunoblotting. Whole-cell extracts were prepared with trichloroacetic acid

21 (TCA) as described (SANSO et al. 2012). SDS-PAGE and immunoblotting were carried

22 out as described (SANSO et al. 2012). Antibodies used were monoclonal anti-Myc 23 (clone 9E10; Millipore 05-419) and TAT1 monoclonal antibody against tubulin (a 24 gift from K. Gull). Band intensities were quantified using ImageJ software. 25 26 Microscopy. Chromosome segregation defects were scored by DAPI staining and

27 tubulin immunofluorescence as described (SADEGHI et al. 2014). At least 50 anaphase 28 cells were scored for each strain in each experiment. Septation defects were scored

29 by staining with DAPI and calcofluor as described (SANSO et al. 2012; MBOGNING et al. 30 2013); >100 cells were scored for each strain in each experiment. 31

5 1 Chromatin Immunoprecipitation (ChIP). ChIP for methylated histone H3 lysine 9 2 was carried out as described (16). 3 4 Data availability. Strains and plasmids are available upon request. The authors 5 affirm that all data necessary for confirming the conclusions of the article are 6 present within the article, figures, and tables. Supplemental figures available at 7 FigShare. RNA-seq data are available at NCBI BioProject (PRJNA382240). 8 9 10 Results 11 12 H2Bub1 regulates histone gene expression 13 14 To examine the role of H2Bub1 in cell-cycle regulated gene expression in fission 15 yeast we synchronized wild-type or htb1-K119R mutant cells in early S phase using 16 hydroxyurea (HU) and monitored cell cycle progression over time after release into 17 fresh media. The htb1-K119R mutant encodes histone H2B lacking the conserved

18 ubiquitylation site (TANNY et al. 2007). FACS analysis showed both wild-type and 19 htb1-K119R cells arrested with a G1 DNA content after HU treatment and 20 progressed through S phase with similar kinetics after release (completing 21 replication after 60 minutes)(Figure 1A). A small shoulder peak in the arrested htb1- 22 K119R population (t=0) likely represents septated cells with two G1 nuclei, which

23 are observed with increased frequency in this mutant (TANNY et al. 2007). We 24 examined expression of cell-cycle-regulated genes by RT-qPCR; the constitutive 25 act1+ gene was used as a control. In wild-type cells, expression of the G1/S markers 26 cdc18+, cdc22+, and mik1+ were high in HU (relative to act1+), decreased upon 27 release as cells entered S phase, and began to rise again at 80 minutes post-release. 28 Entry into mitosis and the subsequent G1 phase began at 80 minutes as indicated by 29 strong induction of the mitotic gene ace2+ (Figure 1B). The htb1-K119R mutation 30 did not affect expression of G1/S marker genes after release and through the 31 completion of S phase. We observed a pronounced reduction in expression of ace2+

6 1 (as well as a smaller decrease for cdc22+) at later time points. This is likely a result 2 of delayed and defective entry into mitosis, consistent with previously described

3 phenotypes in this mutant (Figure 1B)(TANNY et al. 2007; SANSO et al. 2012). 4 We previously found synthetic lethal interactions between the htb1-K119R 5 mutation and deletion of hip1+ or slm9+, genes that encode chromatin assembly 6 factors that comprise the HIRA complex and that regulate expression of histone

7 genes (BLACKWELL et al. 2004; TANNY et al. 2007; KURAT et al. 2014). We thus 8 examined whether htb1-K119R was also involved in histone gene regulation. 9 Histones H3 and H4 are each expressed from three nearly identical genes in S. 10 pombe (hht1+/hhf1+, hht2+/hhf2+, and hht3+/hhf3+), whereas histone H2A is 11 expressed from two genes (hta1+ and hta2+), and a single gene encodes histone H2B 12 (htb1+). These genes show similar cell-cycle dependent expression profiles with 13 peaks coincident with DNA replication, with the exception of hht2+ and hhf2+ (which

14 show no cell-cycle oscillation) (TAKAYAMA AND TAKAHASHI 2007). We performed RT- 15 qPCR with primer pairs that amplify the coding regions of each of the four core 16 histone genes and thus detect all gene copies for each. In wild-type cells, histone 17 gene expression peaked as cells progressed through S phase and begin to rise again 18 20 minutes following the increase in G1/S markers. In the htb1-K119R cells histone 19 H2B and H4 mRNA levels were decreased by ~2-fold in S phase cells, whereas 20 histone H2A and H3 mRNA levels were not significantly changed (Figure 1B). 21 Consistent with defective mitotic entry, transcripts for hta, hht, and hhf failed to rise 22 in htb1-K119R cells after completion of S phase. Decreases in mRNA levels for 23 histones H2B, H3, and H4 were also observed in htb1-K119R and brl2 (lacking an 24 E3 ligase essential for H2Bub1) cells grown asynchronously, indicating that these 25 effects are not artifacts of HU treatment (Figure S1). Thus, H2Bub1 is a positive 26 regulator of histone gene expression during S phase in fission yeast. 27 Since the hht2+ and hhf2+ genes are not cell cycle-regulated, we tested 28 whether H2Bub1 differentially affects individual histone gene copies. We performed 29 RT-qPCR using primer pairs that amplify the 3’-untranslated regions, which allowed 30 us to distinguish between hht1+ and hht2+. Expression of hht1+ in wild-type cells

7 1 peaked in S phase as expected in the HU time course, whereas hht2+ expression 2 levels did not vary (Figure 2). The htb1-K119R mutation caused diminished 3 expression of hht1+ throughout the cell cycle, but had no effect on hht2+. This 4 indicates that H2Bub1 specifically activates cell cycle-dependent histone gene 5 expression. 6 7 H2Bub1 regulates the levels of the histone gene activator Ams2 8 9 The most well-characterized activator of histone gene expression in fission 10 yeast is Ams2, a GATA-type transcription factor that is also required for 11 incorporation of the centromere-specific histone variant CENP-A into centromeric

12 nucleosomes (CHEN et al. 2003; TAKAYAMA AND TAKAHASHI 2007; TAKAYAMA et al. 13 2010). Since loss of H2Bub1 is associated with a reduction in histone gene 14 expression (Figure 1) as well as impaired centromeric chromatin assembly and

15 increased lagging in anaphase (SADEGHI et al. 2014), we surmised that 16 H2Bub1 may promote the function of Ams2. The specific effect of htb1-K119R on 17 expression of the cell cycle-regulated hht1+ transcript is also consistent with the

18 known function of Ams2 in histone gene regulation (TAKAYAMA AND TAKAHASHI 2007). 19 Indeed, we found that levels of myc-tagged Ams2 protein were reduced by ~2-fold

20 in htb1-K119R and brl2 strains grown asynchronously (Figures 3A and 3B)(TANNY

21 et al. 2007; ZOFALL AND GREWAL 2007).

22 As part of a project to profile gene expression in the absence of H2Bub1 or 23 Cdk9 activity (MS, VP, JCT, and RPF; manuscript submitted and available as a pre-

24 print (SANSÔ 2017)), we performed strand-specific RNA-seq analysis on 25 asynchronously growing wild-type and htb1-K119R cells (raw data available from 26 NCBI BioProject PRJNA382240). The htb1-K119R mutation caused 2-fold changes 27 in the levels of 179 protein-coding transcripts (80 down, 99 up) and 2-fold 28 increases in 538 antisense transcripts, indicating a major effect of H2Bub1 on 29 antisense suppression (MS, VP, JCT, and RPF; manuscript submitted). The ams2+ 30 gene was among those with increased antisense transcript levels in the htb1-K119R

8 1 strain. Increased antisense signal was detected across the entire ams2+ transcription 2 unit in htb1-K119R cells, including a region spanning the transcription start site, 3 whereas sense signals were similar in wild-type and mutant cells (Figure S2). To 4 determine whether increased antisense correlated with reduced levels in Ams2 5 protein, we quantified ams2+ transcripts by strand-specific RT-qPCR in strains 6 harboring ams2-myc (Figure 3C; see also Figure S3). Consistent with the RNA-seq 7 data, htb1-K119R and brl2 mutations enhanced ams2+ antisense transcripts in this 8 background. We did not observe a difference in sense transcript levels between 9 wild-type and strains lacking H2Bub1 (Figure 3C). Thus, the absence of H2Bub1 10 leads to a concomitant increase in transcripts antisense to ams2+ and decrease in 11 Ams2 protein expression.

12 The loss of H2Bub1 was found to increase ams2+ antisense levels in the 13 presence of the C-terminal myc tag, which is inserted along with a kanMX6 marker

14 gene 3’ of ams2+ (KIM et al. 2016). This argues that sequences in the ams2+ 3’UTR are 15 not necessary for antisense production, and that the transcripts originate from 16 within the ams2+ coding region. 17 To investigate whether interplay between sense and antisense transcription 18 might be a feature of ams2+ regulation in wild-type cells, we performed strand- 19 specific RT-qPCR on samples derived from cells synchronized with HU. Previous 20 gene expression analyses (performed without strand-specificity) indicated that 21 ams2+ expression is cell-cycle regulated, peaking in G1/S prior to histone gene

22 activation (TAKAYAMA AND TAKAHASHI 2007). Consistent with these results, we found 23 that ams2+ sense transcripts peaked in G1/S in both wild-type and htb1-K119R and 24 diminished as cells completed DNA replication. Sense ams2+ transcripts were 25 decreased ~2-fold in htb1-K119R relative to wild-type in S phase and in the 26 subsequent mitosis (Figure 3D). In contrast, antisense ams2+ transcripts were found 27 at constitutively low levels in wild-type cells, and were elevated 5-10-fold in the 28 htb1-K119R mutant throughout the cell cycle (Figure 3D). Thus, antisense 29 transcription does not regulate ams2+ during the cell cycle in wild-type cells, and the

9 1 effects of H2Bub1 loss on ams2+ antisense levels are not specific to a particular cell 2 cycle stage. 3 4 Interplay between H2Bub1 and Cdk9 regulates ams2+ antisense and Ams2 protein 5 levels 6 7 To determine the functional significance of H2Bub1-mediated suppression of 8 the ams2+ antisense transcript, we examined its relationship to the previously 9 described opposition between H2Bub1 and Cdk9, in which lowering activity of Cdk9

10 suppressed the mitotic defects caused by htb1-K119R and brl2 (SANSO et al. 2012). 11 It remains unclear how this opposition operates at the level of expression of 12 individual genes. We asked whether the effects of htb1-K119R on ams2+ and histone 13 genes might be opposed by Cdk9 activity. We used an analog-sensitive allele of cdk9+ 14 (cdk9as), which allowed us to specifically inhibit Cdk9 activity using the bulky ATP-

15 analog 3-MB-PP1 (VILADEVALL et al. 2009; MBOGNING et al. 2013). Treatment of the 16 cdk9as strain (grown asynchronously) with 3-MB-PP1 had little effect on either the 17 sense or antisense ams2+ transcripts relative to DMSO controls. As expected, ams2+ 18 antisense transcripts were elevated by ~5-fold in the DMSO-treated cdk9as htb1- 19 K119R strain compared to cdk9as, but 3-MB-PP1 treatment reversed this increase 20 with little effect on the levels of the sense transcript (Figure 4A). To determine if this 21 effect correlated with the levels of Ams2 protein, we performed a time course of 22 Cdk9 inhibition in the ams2-myc strain background and monitored protein levels by 23 immunoblot. Upon 3-MB-PP1 treatment of the cdk9as htb1-K119R strain, we 24 observed a time-dependent increase in Ams2 protein levels relative to the tubulin 25 loading control (Figures 4B and 4C). Ams2 protein levels were not affected in the 26 DMSO-treated control. In addition, Ams2 levels were not significantly affected by 3- 27 MB-PP1 treatment in the cdk9as strain. This suggests that H2Bub1 regulates Ams2 28 levels through suppression of the ams2+ antisense transcript, and that elevated 29 ams2+ antisense upon H2Bub1 loss depends upon Cdk9 activity.

10 1 Transcriptional and post-transcriptional mechanisms ensure that Ams2 2 protein levels are restricted to the S phase of the cell cycle. In addition to cell cycle- 3 regulated transcription of ams2+, Ams2 protein is a substrate for ubiquitylation by 4 both the SCF and APC ubiquitin ligase complexes, leading to its proteolysis in G1 and

5 G2/M (TAKAYAMA et al. 2010; TRICKEY et al. 2013). It is thus possible that cell cycle 6 perturbations caused by htb1-K119R or Cdk9 inhibition could result in altered Ams2 7 protein stability that could account for the differences in protein levels that we 8 observe. To test this possibility, we treated cdk9as ams2-myc or cdk9as htb1-K119R 9 ams2-myc cells with either DMSO or 3-MB-PP1 for two hours, and then blocked 10 protein synthesis with cycloheximide. Samples were removed at various times after 11 cycloheximide addition and analyzed by immunoblotting to assess Ams2 protein 12 levels (Figure S4A). Ams2 levels declined at similar rates under all of the conditions 13 examined, arguing that neither H2Bub1 nor Cdk9 activity affect Ams2 protein 14 stability (Figure S4B). 15 We further asked if removal of ams2+ antisense expression through 16 inhibition of Cdk9 could increase histone gene expression in the htb1-K119R strain. 17 We assessed expression of histone genes by RT-qPCR (without strand specificity) in 18 cdk9as and cdk9as htb1-K119R strains. Treatment of cdk9as with 3-MB-PP1 had no 19 effect or caused a slight decrease in histone gene expression relative to the DMSO 20 control. In contrast, similar treatment of the cdk9as htb1-K119R strain caused 21 increased expression of histone genes, consistent with increased Ams2 levels caused 22 by reduction of the ams2+ antisense transcript (Figure 4D). 23 In addition to activating expression of histone genes, Ams2 promotes 24 incorporation of the centromere-specific histone variant CENP-A into centromeric

25 chromatin to allow accurate mitotic chromosome segregation (CHEN et al. 2003). 26 Mutants lacking H2Bub1 also show mitotic chromosome segregation defects 27 thought to be caused by a decrement in transcription-coupled CENP-A incorporation 28 and an increase in repressive heterochromatin within the core of the centromere

29 (SADEGHI et al. 2014). To test if the decreased levels of Ams2 may contribute to these 30 defects we assayed htb1-K119R and cdk9-T212A htb1-K119R double mutants for 31 growth in the presence of thiabendazole (TBZ), a spindle poison to which mutants

11 1 with chromosome segregation defects are particularly sensitive. The cdk9-T212A 2 mutation eliminates the site in the T-loop and reduces Cdk9

3 activity roughly 10-fold (PEI et al. 2006; SANSO et al. 2012). As was the case with 4 cdk9as, this allele increased expression of histone genes in htb1-K119R cells (Figure 5 S1). Whereas the htb1-K119R mutation alone caused sensitivity to TBZ, consistent 6 with published results, this phenotype was rescued in the cdk9-T212A htb1-K119R 7 double mutant, consistent with improved centromere function (Figure 5A). To 8 assess centromere function more directly, we determined the frequency of lagging 9 chromosomes in anaphase cells using fluorescence microscopy. The htb1-K119R 10 mutation caused increased frequency of lagging chromosomes in both wild-type and 11 cdk9-T212A backgrounds, although the increase was smaller in cdk9-T212A cells 12 (Figure 5B). This suggests partial suppression of the centromere defect caused by 13 htb1-K119R. The lagging chromosome phenotype of htb1-K119R cells also correlates 14 with an increase in histone H3 lysine 9 methylation (H3K9me, a mark of

15 heterochromatin) within the central core of the centromere (SADEGHI et al. 2014). To 16 determine if this effect could be modulated by Cdk9, we performed chromatin 17 immunoprecipitation (ChIP) analysis. The htb1-K119R and cdk9-T212A single 18 mutations, as well as both mutations combined, caused increased H3K9me at the 19 central core, indicating that loss of H2Bub1 can also alter centromere function 20 independently of Cdk9 (Figure S5). 21 To determine whether reduced levels of Ams2 is important for other mitotic 22 defects caused by H2Bub1 loss, we introduced plasmids expressing HA-tagged Ams2 23 from the nmt1+ promoter (which drives constitutive expression in media lacking

24 thiamine) into either wild-type or htb1-K119R cells (TAKAYAMA et al. 2016). 25 Immunoblotting confirmed expression of HA-Ams2 in both strains, although we 26 consistently observed lower levels of expression in htb1-K119R cells (Figure S6A). In 27 control cells harboring empty vector, RT-qPCR analysis revealed the expected 28 decreases in expression of htb1+, hhf, and hht1+ transcripts associated with the htb1- 29 K119R mutation. These defects were fully rescued in Ams2-overexpressing cells 30 (Figure S6B). Consistent with the HA immunoblots, less histone gene expression 31 was observed in the Ams2-overexpressing htb1-K119R cells than in the wild-type.

12 1 We scored septation phenotypes by fluorescence microscopy after staining with 2 DAPI and calcofluor (to stain the division septum) and found that Ams2 3 overexpression did not ameliorate the abnormal septation observed in htb1-K119R 4 cells, despite the normalized expression of histone genes (Figure S6C). Thus, effects 5 on Ams2 levels are not sufficient to account for phenotypes caused by loss of 6 H2Bub1 or their reversal by Cdk9 inhibition. 7 8 Subset of H2Bub1-regulated antisense transcripts are Cdk9-dependent 9 10 The strand-specific RNA-seq analysis showed that the vast majority of 11 antisense transcripts derepressed in the htb1-K119R mutant were in fact further

12 derepressed by Cdk9 inhibition (MS, VP, JCT, RPF, manuscript submitted; (SANSÔ 13 2017)). However, prompted by our findings with ams2+, we analyzed the RNA-seq 14 data to identify other examples of antisense transcripts that were increased by the 15 htb1-K119R mutation relative to wild-type, but for which this effect was partially or 16 completely negated by simultaneous inhibition of Cdk9. These were selected based 17 on two criteria: antisense transcripts increased (by >2 fold over wild-type) in htb1- 18 K119R but not in 3-MB-PP1-treated cdk9as htb1-K119R cells, or those similarly 19 increased in DMSO-treated cdk9as htb1-K119R cells but not in 3-MB-PP1-treated 20 cdk9as htb1-K119R cells. We identified transcripts antisense to 37 protein-coding 21 genes meeting these criteria. We did not identify any significant enrichment of Gene 22 Ontology (GO) terms in this list. However, among this small group are ams2+, mis14+ 23 (encoding an essential kinetochore protein), pcf3+ (encoding a subunit of the CAF-I 24 chromatin assembly complex), and genes encoding histones H2B and H4, suggesting 25 that improper regulation of sense:antisense balance at these genes could contribute 26 to the cell cycle defects in htb1-K119R mutants (Table 3).

27 Comparison to published NET-seq data (WERY et al. 2018) indicates that this 28 subset of genes experiences exceptionally high levels of overlapping antisense 29 transcription in wild-type cells, with 9/37 having 80-100% overlap and 30/37 30 having an overlap of at least 40% (Figure 6). The distribution of these genes among 31 gene groups with high levels of overlapping antisense transcription is significantly

13 1 different from that of protein-coding genes in general (P<0.0001; Chi squared test). 2 A second notable property of this group of genes is the fact that 32/37 are oriented 3 convergently with respect to a neighboring gene, suggesting that the high levels of 4 overlapping antisense transcription at these locations is due to transcriptional 5 readthrough. Only two of the genes exhibit a corresponding decrease in sense 6 transcript levels in the htb1-K119R mutant as measured by RNA-seq (MS, VP, JCT, 7 and RPF; manuscript submitted). Thus, our analyses point to aberrant 8 transcriptional events, sensitive to Cdk9 inhibition, that mediate a subset of gene 9 expression defects in the absence of H2Bub1. 10 11 Discussion 12 13 We have shown that H2Bub1 regulates histone genes indirectly through an 14 antisense-based mechanism in fission yeast. A role for H2Bub1 in antisense 15 suppression is consistent with its close connection to transcription elongation and 16 with previous studies demonstrating its role in transcription-coupled chromatin

17 assembly (BATTA et al. 2011). H2Bub1 is thought to influence the chromatin 18 assembly function of the FACT complex, although the details of this mechanism and

19 how it operates at individual genes have not been elucidated (NUNE et al. 2019). 20 Here we demonstrate the impact of faulty antisense suppression at a specific gene 21 that partially accounts for the cell cycle-related gene expression defects in H2Bub1 22 mutants. 23 Previous studies in the budding yeast S. cerevisiae pointed to a direct role for 24 Rad6/Bre1-dependent H2Bub1 as a co-activator for the SBF transcription factor

25 that drives the G1/S transition (ZIMMERMANN et al. 2011). A co-activator role is also 26 supported by findings in cells, in which the Bre1 ortholog RNF20 has been

27 shown to enhance transactivation by p53 and the androgen receptor (KIM et al.

28 2005; JAASKELAINEN et al. 2012). Interestingly, there is evidence that H2Bub1 29 regulates mammalian histone gene expression post-transcriptionally through non-

30 canonical mRNA 3’-end processing (PIRNGRUBER et al. 2009). The data presented

14 1 here argue that antisense suppression is another important, albeit indirect, 2 mechanism employed by H2Bub1 to regulate gene expression during the cell cycle. 3 The ams2+ antisense transcripts induced upon loss of H2Bub1 may affect 4 ams2+ transcription or post-transcriptional steps in Ams2 expression. In 5 asynchronous cells, H2Bub1 loss had no effect on levels of ams2+ sense transcripts, 6 whereas htb1-K119R cells released from a HU block showed decreased ams2+ sense 7 transcript levels. This discrepancy may be due to an effect of the htb1-K119R 8 mutation on recovery from the HU block, or may reflect differences in ams2+ 9 transcript stability between the growth conditions in these experiments. In either 10 case, determining the mechanism for the effects of ams2+ antisense at this locus will 11 require direct, strand-specific measurement of transcription. The fact that the 12 antisense transcript is Cdk9-dependent suggests that aberrant RNAPII elongation is 13 involved in mediating the effect on ams2+ expression. Our observation that the 14 H2Bub1-suppressed, Cdk9-dependent antisense transcripts identified by RNA-seq 15 also experience high levels of overlapping antisense transcription (as determined by 16 NET-seq) also supports this model. Global analyses of nascent transcription indicate 17 that sense and antisense transcription at a given locus are generally anti-correlated, 18 thus increased elongation in the antisense direction would be predicted to have a

19 corresponding negative effect on sense elongation (PELECHANO AND STEINMETZ 2013;

20 MAYER et al. 2015; MCDANIEL et al. 2017; WERY et al. 2018). This relationship is 21 particularly strong when the antisense transcription overlaps the sense promoter, a

22 condition that correlates with decreased protein expression (HUBER et al. 2016). 23 Such a correlation may explain the relationship between H2Bub1 and Ams2 24 expression we observe, as the RNA-seq data indicated increased antisense 25 overlapping the ams2+ transcription start site in htb1-K119R. 26 Cdk9 dependence of some of the H2Bub1-induced antisense transcripts is 27 consistent with the opposing phenotypic relationship between Cdk9 and H2Bub1 28 that we have previously described, and partially accounts for suppression of 29 H2Bub1 chromosome segregation phenotypes by Cdk9 loss of function. Our 30 previous results show that Cdk9 inhibition also suppresses cell separation defects in 31 htb1-K119R mutants, and normalizes an aberrant intragenic distribution of RNA

15 1 polymerase II observed in genome-wide chromatin immunoprecipitation

2 experiments (SANSO et al. 2012). The data we report here, along with prior results, 3 are consistent with a model based on the concept of aberrant, Cdk9-dependent 4 transcriptional events as drivers of phenotypic effects caused by loss of H2Bub1. 5 Reduction of Cdk9 activity would reduce the detrimental effects of these aberrant 6 events in the context of a global decrease in the rate of RNA polymerase II

7 elongation (PARUA et al. 2018). However, these phenotypes are unlikely to be fully 8 accounted for by the small group of H2Bub1-suppressed, Cdk9-dependent antisense 9 transcripts we identified here, and opposing effects are not apparent for the vast 10 majority of antisense transcripts increased by either loss of H2Bub1 or reduction in 11 Cdk9 activity (MS, VP, JCT, and RPF; manuscript submitted). It is possible that 12 additional opposing effects of H2Bub1 and Cdk9 on gene expression would be 13 revealed in global run-on or NET-seq experiments carried out at various stages of 14 the cell cycle. Alternatively, aberrant transcription caused by loss of H2Bub1 may 15 interfere with other cell cycle-regulated events that occur on chromatin, such as

16 binding of condensin and cohesin complexes (SCHMIDT et al. 2009; KIM et al. 2016). 17 Given that links between H2Bub1 and cell cycle regulation are highly 18 conserved in evolution, and are implicated in proliferation of a variety of , it 19 will be of interest to determine the extent to which aberrant transcription

20 contributes to the effects of H2Bub1 loss in mammalian cells (MARSH AND DICKSON 21 2019). Our results suggest that inhibition of CDK9, already under investigation as a

22 potential therapeutic strategy in (OLSON et al. 2018), could have particular 23 benefit in cancers that exhibit these defects. 24 25 Acknowledgements 26 27 We thank K. Noma for S. pombe strains, K. Gull for TAT1 monoclonal antibody, Y. 28 Takayama for ams2+-expressing plasmids, M. Wery for assistance with NET-seq 29 analyses, Zamboni Chemical Solutions for providing 3-MB-PP1, and members of the 30 Fisher, Ekwall, Hébert, and Tanny labs for helpful discussions. This work was 31 supported by the Canadian Institutes for Health Research (MOP-130362 to J.C.T. and

16 1 and PJT-159687 to T.E.H.), Natural Sciences and Engineering Research Council of 2 Canada (RGPIN 03661-15 to J.C.T.), Swedish Cancer Society (to K.E.), Swedish 3 Research Council (to K.E.), and National Institutes of Health (R35 GM127289 to 4 R.P.F.). J.C.T. is supported by the Fonds de recherche santé Quebec (chercheur 5 boursier 33115). 6 7

17 1 References 2 3 Anderson, C. J., M. R. Baird, A. Hsu, E. H. Barbour, Y. Koyama et al., 2019 Structural 4 Basis for Recognition of Ubiquitylated Nucleosome by Dot1L 5 Methyltransferase. Cell Rep 26: 1681-1690 e1685. 6 Bahler, J., J. Q. Wu, M. S. Longtine, N. G. Shah, A. McKenzie, 3rd et al., 1998 7 Heterologous modules for efficient and versatile PCR-based gene targeting in 8 Schizosaccharomyces pombe. Yeast 14: 943-951. 9 Batta, K., Z. Zhang, K. Yen, D. B. Goffman and B. F. Pugh, 2011 Genome-wide function 10 of H2B ubiquitylation in promoter and genic regions. Genes Dev 25: 2254- 11 2265. 12 Blackwell, C., K. A. Martin, A. Greenall, A. Pidoux, R. C. Allshire et al., 2004 The 13 Schizosaccharomyces pombe HIRA-like protein Hip1 is required for the 14 periodic expression of histone genes and contributes to the function of 15 complex centromeres. Mol Cell Biol 24: 4309-4320. 16 Chen, E. S., S. Saitoh, M. Yanagida and K. Takahashi, 2003 A cell cycle-regulated GATA 17 factor promotes centromeric localization of CENP-A in fission yeast. Mol Cell 18 11: 175-187. 19 Fuchs, G., D. Hollander, Y. Voichek, G. Ast and M. Oren, 2014 Cotranscriptional 20 histone H2B monoubiquitylation is tightly coupled with RNA polymerase II 21 elongation rate. Genome Res 24: 1572-1583. 22 Fuchs, G., and M. Oren, 2014 Writing and reading H2B monoubiquitylation. Biochim 23 Biophys Acta 1839: 694-701. 24 Huber, F., D. Bunina, I. Gupta, A. Khmelinskii, M. Meurer et al., 2016 Protein 25 Abundance Control by Non-coding Antisense Transcription. Cell Rep 15: 26 2625-2636. 27 Hung, S. H., R. P. Wong, H. D. Ulrich and C. F. Kao, 2017 Monoubiquitylation of 28 histone H2B contributes to the bypass of DNA damage during and after DNA 29 replication. Proc Natl Acad Sci U S A 114: E2205-E2214. 30 Jaaskelainen, T., H. Makkonen, T. Visakorpi, J. Kim, R. G. Roeder et al., 2012 Histone 31 H2B ubiquitin ligases RNF20 and RNF40 in androgen signaling and prostate 32 cancer cell growth. Mol Cell Endocrinol 350: 87-98. 33 Kim, J., S. B. Hake and R. G. Roeder, 2005 The human homolog of yeast BRE1 34 functions as a transcriptional coactivator through direct activator 35 interactions. Mol Cell 20: 759-770. 36 Kim, J., J. A. Kim, R. K. McGinty, U. T. Nguyen, T. W. Muir et al., 2013 The n-SET 37 domain of Set1 regulates H2B ubiquitylation-dependent H3K4 methylation. 38 Mol Cell 49: 1121-1133. 39 Kim, K. D., H. Tanizawa, O. Iwasaki and K. Noma, 2016 Transcription factors mediate 40 condensin recruitment and global chromosomal organization in fission yeast. 41 Nat Genet 48: 1242-1252. 42 Knutsen, J. H., I. D. Rein, C. Rothe, T. Stokke, B. Grallert et al., 2011 Cell-cycle analysis 43 of fission yeast cells by flow cytometry. PLoS One 6: e17175. 44 Kurat, C. F., J. Recht, E. Radovani, T. Durbic, B. Andrews et al., 2014 Regulation of 45 histone gene transcription in yeast. Cell Mol Life Sci 71: 599-613.

18 1 Marsh, D. J., and K. A. Dickson, 2019 Writing Histone Monoubiquitination in Human 2 Malignancy-The Role of RING Finger E3 Ubiquitin Ligases. Genes (Basel) 10. 3 Mayer, A., J. di Iulio, S. Maleri, U. Eser, J. Vierstra et al., 2015 Native elongating 4 transcript sequencing reveals human transcriptional activity at nucleotide 5 resolution. Cell 161: 541-554. 6 Mbogning, J., S. Nagy, V. Page, B. Schwer, S. Shuman et al., 2013 The PAF complex and 7 Prf1/Rtf1 delineate distinct Cdk9-dependent pathways regulating 8 transcription elongation in fission yeast. PLoS Genet 9: e1004029. 9 McDaniel, S. L., A. J. Hepperla, J. Huang, R. Dronamraju, A. T. Adams et al., 2017 10 H3K36 Methylation Regulates Nutrient Stress Response in Saccharomyces 11 cerevisiae by Enforcing Transcriptional Fidelity. Cell Rep 19: 2371-2382. 12 Moreno, S., A. Klar and P. Nurse, 1991 Molecular genetic analysis of fission yeast 13 Schizosaccharomyces pombe. Methods Enzymol 194: 795-823. 14 Moyal, L., Y. Lerenthal, M. Gana-Weisz, G. Mass, S. So et al., 2011 Requirement of 15 ATM-dependent monoubiquitylation of histone H2B for timely repair of DNA 16 double-strand breaks. Mol Cell 41: 529-542. 17 Nakamura, K., A. Kato, J. Kobayashi, H. Yanagihara, S. Sakamoto et al., 2011 18 Regulation of homologous recombination by RNF20-dependent H2B 19 ubiquitination. Mol Cell 41: 515-528. 20 Nune, M., M. T. Morgan, Z. Connell, L. McCullough, M. Jbara et al., 2019 FACT and 21 Ubp10 collaborate to modulate H2B deubiquitination and nucleosome 22 dynamics. Elife 8. 23 Olson, C. M., B. Jiang, M. A. Erb, Y. Liang, Z. M. Doctor et al., 2018 Pharmacological 24 perturbation of CDK9 using selective CDK9 inhibition or degradation. Nat 25 Chem Biol 14: 163-170. 26 Parua, P. K., G. T. Booth, M. Sanso, B. Benjamin, J. C. Tanny et al., 2018 A Cdk9-PP1 27 switch regulates the elongation-termination transition of RNA polymerase II. 28 Nature 558: 460-464. 29 Pei, Y., H. Du, J. Singer, C. St Amour, S. Granitto et al., 2006 Cyclin-dependent kinase 9 30 (Cdk9) of fission yeast is activated by the CDK-activating kinase Csk1, 31 overlaps functionally with the TFIIH-associated kinase Mcs6, and associates 32 with the mRNA cap methyltransferase Pcm1 in vivo. Mol Cell Biol 26: 777- 33 788. 34 Pelechano, V., and L. M. Steinmetz, 2013 Gene regulation by antisense transcription. 35 Nat Rev Genet 14: 880-893. 36 Pirngruber, J., A. Shchebet, L. Schreiber, E. Shema, N. Minsky et al., 2009 CDK9 37 directs H2B monoubiquitination and controls replication-dependent histone 38 mRNA 3'-end processing. EMBO Rep 10: 894-900. 39 Sadeghi, L., L. Siggens, J. P. Svensson and K. Ekwall, 2014 Centromeric histone H2B 40 monoubiquitination promotes noncoding transcription and chromatin 41 integrity. Nat Struct Mol Biol 21: 236-243. 42 Sansô, M., Daniel Pinto, Peter Svensson, Viviane Pagé, Pabitra K Parua, Danny A. 43 Bitton, Jean Mbogning, Patricia Garcia, Elena Hidalgo, François Robert, Jürg 44 Bahler, Jason Tanny, Robert P. Fisher, 2017 Cdk9, Spt5 and histone H2B 45 mono-ubiquitylation cooperate to ensure antisense suppression by the Clr6- 46 CII/Rpd3S HDAC complex. bioRxiv.

19 1 Sanso, M., K. M. Lee, L. Viladevall, P. E. Jacques, V. Page et al., 2012 A Positive 2 Feedback Loop Links Opposing Functions of P-TEFb/Cdk9 and Histone H2B 3 Ubiquitylation to Regulate Transcript Elongation in Fission Yeast. PLoS Genet 4 8: e1002822. 5 Schmidt, C. K., N. Brookes and F. Uhlmann, 2009 Conserved features of cohesin 6 binding along fission yeast chromosomes. Genome Biol 10: R52. 7 Shema, E., I. Tirosh, Y. Aylon, J. Huang, C. Ye et al., 2008 The histone H2B-specific 8 ubiquitin ligase RNF20/hBRE1 acts as a putative tumor suppressor through 9 selective regulation of gene expression. Genes Dev 22: 2664-2676. 10 Takayama, Y., Y. M. Mamnun, M. Trickey, S. Dhut, F. Masuda et al., 2010 Hsk1- and 11 SCF(Pof3)-dependent proteolysis of S. pombe Ams2 ensures histone 12 homeostasis and centromere function. Dev Cell 18: 385-396. 13 Takayama, Y., M. Shirai and F. Masuda, 2016 Characterisation of functional domains 14 in fission yeast Ams2 that are required for core histone gene transcription. 15 Sci Rep 6: 38111. 16 Takayama, Y., and K. Takahashi, 2007 Differential regulation of repeated histone 17 genes during the fission yeast cell cycle. Nucleic Acids Res 35: 3223-3237. 18 Tanny, J. C., 2014 Chromatin modification by the RNA Polymerase II elongation 19 complex. Transcription 5: e988093. 20 Tanny, J. C., H. Erdjument-Bromage, P. Tempst and C. D. Allis, 2007 Ubiquitylation of 21 histone H2B controls RNA polymerase II transcription elongation 22 independently of histone H3 methylation. Genes Dev 21: 835-847. 23 Trickey, M., K. Fujimitsu and H. Yamano, 2013 Anaphase-promoting 24 complex/cyclosome-mediated proteolysis of Ams2 in the G1 phase ensures 25 the coupling of histone gene expression to DNA replication in fission yeast. J 26 Biol Chem 288: 928-937. 27 Trujillo, K. M., and M. A. Osley, 2012 A role for H2B ubiquitylation in DNA 28 replication. Mol Cell 48: 734-746. 29 Viladevall, L., C. V. St Amour, A. Rosebrock, S. Schneider, C. Zhang et al., 2009 TFIIH 30 and P-TEFb coordinate transcription with capping enzyme recruitment at 31 specific genes in fission yeast. Mol Cell 33: 738-751. 32 Wery, M., C. Gautier, M. Descrimes, M. Yoda, H. Vennin-Rendos et al., 2018 Native 33 elongating transcript sequencing reveals global anti-correlation between 34 sense and antisense nascent transcription in fission yeast. RNA 24: 196-208. 35 Worden, E. J., N. A. Hoffmann, C. W. Hicks and C. Wolberger, 2019 Mechanism of 36 Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Cell. 37 Zhang, W., C. H. L. Yeung, L. Wu and K. W. Y. Yuen, 2017 E3 ubiquitin ligase Bre1 38 couples sister chromatid cohesion establishment to DNA replication in 39 Saccharomyces cerevisiae. Elife 6. 40 Zimmermann, C., P. Chymkowitch, V. Eldholm, C. D. Putnam, J. M. Lindvall et al., 2011 41 A chemical-genetic screen to unravel the genetic network of CDC28/CDK1 42 links ubiquitin and Rad6-Bre1 to cell cycle progression. Proc Natl Acad Sci U 43 S A 108: 18748-18753. 44 Zofall, M., and S. I. Grewal, 2007 HULC, a histone H2B ubiquitinating complex, 45 modulates heterochromatin independent of histone methylation in fission 46 yeast. J Biol Chem 282: 14065-14072.

20 1

21 1 Figure Legends 2 3 Figure 1. H2Bub1 promotes expression of histone genes in S. pombe cells 4 synchronized with hydroxyurea (HU). (A) Fluorescence-activated cell sorting 5 (FACS) analysis of wild-type (JTB204) and htb1-K119R (JTB86-3) cells blocked with 6 HU and released into fresh media. Samples were removed for analysis at the 7 indicated time points (right). Asynchronously growing cells (AS) mark the position 8 of G2 DNA content. Sorted cells were binned based on PI-A intensity and the percent 9 of total cells in each bin is plotted. (B) Steady-state RNA levels of the indicated genes 10 were quantified by RT-qPCR at the indicated times after release from HU block and 11 normalized to act1+ mRNA levels. For each gene the wild-type expression level at 12 t=0 was set to 1. Error bars denote standard deviations; asterisks indicate 13 significant differences from wild-type (n=3, unpaired t test, *p<0.05). 14 15 Figure 2. H2Bub1 preferentially activates the cell cycle-regulated copies of 16 genes encoding histone H3. Steady-state RNA levels of the indicated genes were 17 quantified by RT-qPCR at the indicated times after release from HU block and 18 normalized to act1+ mRNA levels. For each gene the wild-type expression level at 19 t=0 was set to 1. Asterisks indicate significant differences from wild-type (n=3, 20 unpaired t test, *p<0.05). 21 22 Figure 3. H2Bub1 promotes expression of the histone gene activator Ams2 and 23 suppresses its antisense transcript. (A) Immunoblotting of whole-cell extracts 24 from the indicated ams2-myc strains (JTB854, JTB913, JTB902-5, respectively) with 25 the indicated antibodies. Two isolates of JTB913 (htb1-K119R) are shown; isolate #1 26 was used in subsequent experiments. (B) Quantification of the experiment in (A) 27 using ImageJ software. Intensities for the myc immunoblot were normalized to 28 tubulin; wild-type values were set to 1. Error bars indicate standard deviations; 29 asterisks indicate significant differences from wild-type (n=3, unpaired t test, 30 *p<0.05). (C) Steady-state ams2-myc RNA levels (sense or antisense) were 31 quantified by strand-specific RT-qPCR in the indicated ams2-myc strains and

22 1 normalized to act1+ mRNA levels. Error bars indicate standard deviations; asterisks 2 indicate significant differences from wild-type (n=3, unpaired t test, *p<0.05). (D) 3 Steady-state ams2+ RNA levels (sense or antisense) were quantified by strand- 4 specific RT-qPCR at the indicated times after HU block and release and normalized 5 to act1+ mRNA levels. The wild-type expression level at t=0 was set to 1. Error bars 6 denote standard deviations; asterisks indicate significant differences from wild-type 7 (n=3, unpaired t test, *p<0.05). 8 9 Figure 4. Increase in ams2+ antisense in htb1-K119R cells is reversed by 10 inhibition of Cdk9. (A) Steady-state ams2+ RNA levels (sense or antisense) were 11 quantified by strand-specific RT-qPCR in the indicated strains (JTB425, JTB508, 12 respectively) after a 2-hour treatment with DMSO (-) or 3-MB-PP1 (+). Values were 13 normalized to act1+ mRNA levels. Error bars denote standard deviations; asterisks 14 indicate significant differences between DMSO and 3-MB-PP1-treated samples (n=3, 15 unpaired t test, *p<0.05). (B) Immunoblots on whole-cell extracts from the indicated 16 ams2-myc strains (JTB914, JTB916, respectively) grown in presence of 3-MB-PP1 17 (+) or DMSO (-) for the indicated times. Antibodies are indicated on the right. (C) 18 Quantification of the experiment in (B) using Image J software. Intensities for the 19 myc immunoblot were normalized to tubulin. Error bars indicate standard 20 deviations; asterisk indicates significant difference between 1 hr and 4 hr treatment 21 times (n=3, unpaired t test, *p<0.05). (D) Steady-state mRNA levels for the indicated 22 histone genes were quantified by RT-qPCR in the indicated strains (JTB425, JTB508, 23 respectively) after a 2-hour treatment with DMSO (-) or 3-MB-PP1 (+). Values were 24 normalized to act1+ and those for the cdk9as, DMSO condition were set to 1. Error 25 bars denote standard deviations; asterisks indicate significant differences between 26 DMSO and 3-MB-PP1-treated samples for each strain (n=3, unpaired t test, *p<0.05). 27 28 Figure 5. Partial suppression of htb1-K119R chromosome segregation 29 phenotypes by reduction in Cdk9 activity. (A) Five-fold serial dilutions of the 30 indicated strains (JTB362, JTB98, JTB321, JTB429, respectively) were spotted on the 31 indicated media and grown for 2-3 days at 30oC. (B) Frequency of anaphase

23 1 chromosome segregation defects was quantified by fluorescence microscopy in the 2 indicated strains (see Materials and Methods). Error bars denote standard deviation 3 (n=3). At least 50 anaphase cells were counted in each experiment. 4 5 Figure 6. High levels of overlapping sense:antisense transcription at genes 6 with H2Bub1-suppressed, Cdk9-dependent antisense transcripts. All 7 sense:antisense gene pairs (3455 in total) or the gene group in question (37 genes) 8 sorted according to level of overlapping transcription as assessed by NET-seq. 9 Distributions were found to differ significantly (P<0.0001; Chi-squared test). 10 11 12 13 14 15 16 17

24

Table 1. Strains used in this study. Strain Genotype Source number JTB204 Tanny et h- ade6-M216 al, 2007 JTB86-3 htb1-K119R::kanMX6 ade6-M216 h- Tanny et al, 2007 JTB331 h- brl2∆::hphMX4 ade6-M210 Tanny et al, 2007 JTB321 cdk9-T212A::kanMX6 leu1-32 ura4-D18 his3- Sanso et D1 ade6-M210 h+ al, 2012 JTB335 cdk9-T212A::kanMX6 brl2∆::hphMX4 leu1-32 Sanso et ura4-D18 his3? ade6 al, 2012 JTB429 cdk9-T212A::kanMX6 htb1-K119R::kanMX6 Sanso et leu1-32 ura4-D18 his3? ade6 al, 2012 JTB362 leu1-32 ura4-D18 his3-D1 ade6-M210 h+ Sanso et al, 2012 JTB98-1 htb1-K119R::kanMX6 ade6 leu1-32 ura4-D18 Tanny et h- al, 2007 JTB425 cdk9as::natMX6 leu1-32 ura4-D18 his3-D1 This ade6-M210 h+ study JTB508 cdk9as::natMX6 htb1-K119R::kanMX6 ade6 This leu1? ura4? h? study JTB854 ams2-13myc::kanMX6 ade6-M216 leu1-32 Kim et ura4-D18 his2 h- al, 2016 JTB913 ams2-13myc::kanMX6 htb1-K119R::hphMX6 This ade6 leu1? ura4-D18 his2? h? study JTB914 ams2-13myc::kanMX6 cdk9as::natMX6 ade6 This leu1-32 ura4-D18 his? h? study JTB902-5 ams2-13myc::kanMX6 brl2∆::hphMX4 ade6 This leu1? ura4? his2? h? study JTB916 ams2-13myc::kanMX6 cdk9as::natMX6 htb1- This K119R::hphMX6 ade6 leu1? ura4-D18 his? h? study

Table 2. Oligonucleotide primers used in this study. Name Sequence hht-FW TCGGCCAAGATTTCAAGACTG hht-RV CGCCACGGAGACGACGAG hhf-FW ATTCGCGATGCCGTCACCTA hhf-RV TAACCACCGAAACCATAAAT hta-FW CTTCGCCGCCGTTTTGGAATA hta-RV CGTTACGGATGGCGAGTTGAAGAT htb1-FW AGCCATGCGTATCTTGAACTCTTT htb1-RV GGTAACGGCGTGCTTGGCTAACT hht1-FW CTGTCACCCTTTGATATGTTG hht1-RV TAACACATATCCGTTCCCATC hht2-FW GCATTGATTGCCTAATATTTTATTTG hht2-RV AAATTAATATGCTAAACCCGAC cdc18-FW TCCCTCGTTTACGAACAAAG cdc18-RV CAGCATGCTGAGATACAAC cdc22-FW CAGGTAGAGGGTACATATG cdc22-RV TGAGATGTTGAAGCAGTAGGC mik1-FW GGGATTATTGCAGGTCATGG mik1-RV ATCAACCATCGAGGAGACCGG ace2-FW GAATTCCTCCGGAGACAATG ace2-RV AAGTCACAGCGATACGGACG ams2-FW GAGCCTTTATCCGAAATTGGG (antisense) ams2-RV GCAAACAGGCAGAGTTGGC (sense) act1ChIP5 CCACTATGTATCCCGGTATTGC act1ChIP6 CAATCTTGACCTTCATGGAGCT

Table 3. K119R UP, Cdk9-dependent antisense transcripts identified by strand- specific RNA-seq. Systematic ID Name Product description cell cycle regulated GATA-type transcription factor SPCC290.04 ams2 Ams2 SPCC338.08 ctp1 CtIP-related endonuclease SPAC7D4.09c dfg10 3-oxo-5-alpha-steroid 4-dehydrogenase (predicted) mitochondrial inheritance GTPase, tubulin-like SPAC30C2.06c dml1 (predicted) SPAC19B12.05c fcp1 CTD phosphatase Fcp1 SPAC140.02 gar2 nucleolar protein required for rRNA processing SPBC32F12.16 gem7 human GEMIN7 ortholog phosphatidylglycerol phosphate phosphatase Gep4 SPCC645.02 gep4 (predicted) SPAC144.07c gpn2 conserved GTPase Gpn2 (predicted) SPAC1834.03c hhf1 histone H4 h4.1 SPCC622.09 htb1 histone H2B Htb1 SPBC3D6.04c mad1 mitotic spindle checkpoint protein Mad1 SPAC31G5.12c maf1 repressor of RNA polymerase III Maf1 SPAC688.02c mis14 NMS complex subunit Mis14/Nsl1 arrestin family Schizosaccharomyces specific protein SPCP1E11.03 mug170 Mug170 SPBC32H8.06 mug93 TPR repeat protein, meiotically spliced SPAC25H1.06 pcf3 CAF assembly factor (CAF-1) complex subunit C, Pcf3 SPAC3C7.10 pex13 peroxin 13 (predicted) SPCC24B10.22 pog1 mitochondrial DNA polymerase gamma Pog1 SPAC4D7.03 pop2 F-box/WD repeat protein Pop2 SPAC31G5.15 psd3 phosphatidylserine decarboxylase Psd3 SPAC1782.08c rex3 exonuclease Rex3 (predicted) SPAC29A4.11 rga3 RhoGAP, GTPase activating protein Rga3 SPBP8B7.02 rng9 contractile ring myosin V regulator Rng9 SPAC1D4.09c rtf2 replication termination factor Rtf2 SPAC18G6.04c shm2 hydroxymethyltransferase Shm2 (predicted) SPBC2D10.09 snr1 3-hydroxyisobutyryl-CoA hydrolase snr1 SPBC1734.05c spf31 DNAJ protein, splicing factor Spf31 (predicted) mitochondrial DUF4536, human DMAC1 ortholog, possibly has a general role in mitochondrial complex SPAC1F7.14c tam6 assembly SPAC15A10.12c tca17 TRAPP complex subunit 2-like Tca17 (predicted) SPCC1442.09 trp3 anthranilate synthase component I Trp3 SSU-rRNA maturation protein Tsr4 homolog 2 Tsr402 SPAC13G6.09 trs402 (predicted) SPCC162.06c vps60 vacuolar sorting protein Vps60 (predicted) SPAC29A4.06c splicing protein, human NSRP1 ortholog SPAC977.17 MIP water channel (predicted) SPAC9G1.07 Schizosaccharomyces specific protein SPBC776.03 homoserine dehydrogenase (predicted)

Minutes after release htb1-K119R htb1-K119R -A PI

Wild-type A B htahta hhthht htb1htb1+ hhfhhf 2.0 2.0 1.5 1.5 WT * htb1-K119R 1.5 1.5 * * 1.0 * 1.0 *

1.0 * 1.0 0.5 * 0.5 * 0.5 0.5

0.0 0.0 0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120

cdc18 cdc22 mik1 ace2 cdc18+ cdc22+ mik1+ ace2+ 2.5 2.5 2.5 40

2.0 2.0 2.0 *

Relative expressionRelative * * 30 1.5 1.5 1.5

1.0 1.0 1.0 20

0.5 0.5 0.5 10 * 0.0 0.0 0.0

-0.5 -0.5 -0.5 0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120 0 20 40 60 80 100 120

Minutes after release hht1 + hht2hht2+ WT htb1-K119R 2.0 2.0

1.5 * 1.5 * 1.0 * * 1.0

0.5 0.5

0.0 0.0 0 20 40 60 80 100 120 0 20 40 60 80 100 120 Relative expressionRelative

Minutes after release C C A A

Normalized expression relative expression 0 2 4 6 WT ams2-myc ams2-myc

WT 1

ams2-myc * 2 myc tubulin *

3

sense antisense B B D D Normalized expression

0 2 4 6 Relative intensity 0.0 0.5 1.0 1.5 0 WT 20

* 40 * Sense Sense * 60 80 100 * Minutes Minutes after release 120 * 0 1 2 3 0 20 * 40 * Antisense Antisense 60 * 80 * 100 * 120 * htb1- WT

K119R KR antisense wt antisense

A B ams2ams2+ as as 3 cdk9 cdk9 htb1-K119R * sense

n 1 2 4 1 2 4 Time (hrs)

o antisense i

s - + - + - + 3-MB-PP1

s 2 - + - + - +

e r

p 150 kD myc

x

e

e v

i 1

t

a

l e r tubulin

Normalized expressionNormalized 0

O- +B -O +B 3-MB-PP1 S M S M M s 3as M 3 cdk9a D asR s D cdk9 a 9 R 9 k 9 1 9 d 1 1 k c 1 htb1-K119Rs K d a c s K a 9 9 k k d d c D c C 1.5 2.0 hta * 1 hr hta * 2 hr htb1htb1 + 1.5 4 hr 1.0 * hhthht * * 1.0 * * hhfhhf 0.5 0.5 Normalized intensityNormalized Relative expressionRelative 0.0 0.0 - + - + 3-MB-PP1 - + - + - + - + - + - + - + - + 3-MB-PP1 cdk9as cdk9as htb1-K119R A B YES+TBZ YES

25

s e

WT m

o 20

s o

m 15

htb1-K119R o

r

h c

10

g n

cdk9-T212A i g

g 5

a l

htb1-K119R %

cdk9-T212A chromosomes% lagging 0 T R A e 9 2 l WTW 1 1 b 1 2 u T o K 9 d k d c

s

r i

a 0.5 p

0-20%

e s

n 0.4 20-40%

e s

i % sense:antisense t 40-60%

n 0.3 a

: overlap

e 60-80% s n 0.2

e 80-100%

s

f o

0.1

n

o

i t

c 0.0

a r f All K119R-up; Cdk9-dependent