Translesion Polymerase H Is Upregulated by Cancer Therapeutics and Confers Anticancer Drug Resistance

Published OnlineFirst August 14, 2014; DOI: 10.1158/0008-5472.CAN-14-0953

Cancer Therapeutics, Targets, and Chemical Biology Research

Translesion Polymerase h Is Upregulated by Cancer Therapeutics and Confers Anticancer Drug Resistance

Maja T. Tomicic, Dorthe Aasland, Steffen C. Naumann, Ruth Meise, Christina Barckhausen, Bernd Kaina, and Markus Christmann

Abstract DNA repair processes are a key determinant of the sensitivity of cancer cells to DNA-damaging chemother- apeutics, which may induce certain repair genes as a mechanism to promote resistance. Here, we report the results of a screen for repair genes induced in cancer cells treated with DNA crosslinking agents, which identified the translesion polymerase h (PolH) as a p53-regulated target acting as one defense against interstrand crosslink (ICL)-inducing agents. PolH was induced by fotemustine, mafosfamide, and lomustine in breast cancer, glioma, and melanoma cells in vitro and in vivo, with similar inductions observed in normal cells such as lymphocytes and diploid fibroblasts. PolH contributions to the protection against ICL-inducing agents were evaluated by its siRNA- mediated attenuation in cells, which elevated sensitivity to these drugs in all tumor cell models. Conversely, PolH overexpression protected cancer cells against these drugs. PolH attenuation reduced repair of ICL lesions as measured by host cell reactivation assays and enhanced persistence of gH2AX foci. Moreover, we observed a strong accumulation of PolH in the nucleus of drug-treated cells along with direct binding to damaged DNA. Taken together, our findings implicated PolH in ICL repair as a mechanism of cancer drug resistance and normal tissue protection. Cancer Res; 74(19); 5585–96. 2014 AACR.

Introduction agents are being used for the treatment of glioblastoma, Because of the high toxicity in replicating cells, genotoxic astrocytoma, and, albeit to a lesser extent, malignant mel- agents are being used as anticancer drugs. Most important anoma, gastrointestinal, and pancreatic cancer, Hodgkin are drugs that induce DNA interstrand crosslinks (ICL), and non-Hodgkin lymphoma (7). Fotemustine is approved which are potent killing lesions (1). The ICL-inducing drugs for the treatment of metastasizing melanoma and shows include derivatives of nitrogen mustards and chloroethyl improved response rates and an increased survival over nitrosoureas. One of the most often used nitrogen mustard dacarbazine in the treatment of disseminated cutaneous is cyclophosphamide, whose active metabolite alkylates the melanoma (8). Also, it showed promising results in com- N7 position of guanine yielding cytotoxic ICL (2). Chlor- bination with ipilimumab (9), bevacizumab (10), and temo- oethyl nitrosoureas used in cancer therapy are carmustine zolomide (11). (BCNU), lomustine (CCNU), nimustine (ACNU), and fote- Tumor cells are able of counteracting the killing effects of mustine (Muphoran). Upon formation of a nucleophilic these anticancer drugs, using various strategies including DNA chloroethylenium ion, the O6-position of guanine becomes repair (12, 13). Activation of DNA repair by anticancer drugs alkylated, leading to the formation of O6-chloroethylguanine occurs on various levels, which includes the transcriptional (O6-ClG; ref. 3). O6-ClG can be repaired by the DNA repair activation of repair genes (14). An important factor involved in protein O6-methylguanine-DNA methyltransferase (MGMT; transcriptional regulation of DNA repair genes is p53, which ref. 4). If not repaired, O6ClG undergoes intramolecular becomes activated via the ATM/ATR pathway by DNA-dam- rearrangement to form N1-O6-ethenoguanine and ﬁnally aging agents and ionizing radiation that cause DNA replication N1-guanine-N3-cytosine ICLs (5, 6). O6-chloroethylating arrest and DNA double-strand breaks (DSB; for review, see ref. 15). As a consequence, the cellular amount of p53, its nuclear translocation, and its DNA-binding activity are enhanced and target genes become transcriptionally activated Department of Toxicology, University Medical Center Mainz, Mainz, (16). Activation of p53 results in cell-cycle arrest, which occurs Germany. either in the G1 or G2–M phase (17) and upregulation of repair Note: Supplementary data for this article are available at Cancer Research genes (14), thereby causing resistance to anticancer drugs. Online (http://cancerres.aacrjournals.org/). In glioblastoma cells, p53 mediates resistance against the Corresponding Author: Markus Christmann, Department of Toxicology, – University Medical Center Mainz, Obere Zahlbacher Str. 67, D-55131 topoisomerase I inhibitors, topotecan and irinotecan (18 21) Mainz, Germany. Phone: 0049-6131-179066; Fax: 0049-6131-178499; and the chloroethylating agent ACNU (22). In case of ACNU, the E-mail: [email protected] protective effect was shown to be the result of p53-driven doi: 10.1158/0008-5472.CAN-14-0953 induction of the nucleotide excision repair genes xpc and ddb2 2014 American Association for Cancer Research. (22). Protection by p53 against chloroethylating agents was

www.aacrjournals.org 5585

Tomicic et al.

also observed in melanoma cells, where it was shown to trigger disintegrated using a tissue lyser (Retsch) and RNA or protein resistance against the anticancer drug fotemustine (23). In wasisolatedasstatedbelow. contrast, p53 sensitizes melanoma cells to cisplatin by activation of apoptosis (24). Preparation of cell extracts and Western blot analysis To identify p53 target genes involved in DNA repair that Whole-cell extracts and nuclear cell extracts were prepared contribute to protection of melanoma cells against chloroethy- as described (31). Antibodies used were: anti-PolH (ab17725, lating agents, qRT-PCR arrays were performed, analyzing the Abcam), anti-p53 (sc100, Santa Cruz Biotechnology), anti- expression of all known DNA repair genes upon fotemustine phospho-p53Ser15 (9284, Cell Signaling Technology), anti- treatment of D05 melanoma cells wild-type for p53. Besides the b-Actin (sc-47778, Santa Cruz Biotechnology), and anti-ERK2 well-characterized p53 targets ddb2 and xpc (25), a strong and (sc-154, Santa Cruz Biotechnology). robust induction of the translesion polymerase h (PolH) was observed. PolH plays an important role in tolerating replication Preparation of RNA, end point PCR, and qRT-PCR blocking DNA lesions by translesion synthesis (TLS; ref. 26) and Total RNA was isolated using the RNA II Isolation Kit is also involved in the replication at fragile sites in the absence (Machery and Nagel) and cDNA synthesis was performed using of exogenous stress (27, 28). Here, we show induction of PolH the Verso cDNA Kit (Thermo Scientific). Endpoint PCR was following treatment with ICL-inducing drugs, which occurs in performed using Red-Taq Ready Mix (Sigma-Aldrich) and p53 wt but not p53-mutated tumor cells. It was also observed in quantitative real-time PCR (qRT-PCR) using the SensiMix nontransformed cells and in a mouse xenograft model in vivo. SYBR Green & Fluorescein Kit (Bioline). The specific primers Furthermore, we show the induction contributes to resistance are depicted in Supplementary Table S1. against all tested ICL drugs: fotemustine, lomustine (CCNU), and the cyclophosphamide analogon mafosfamide. The pro- Chromatin immunoprecipitation assay tective effect results from involvement of PolH in the repair of Chromatin immunoprecipitation (ChIP) was performed as DNA damage induced by these drugs. The data provide an described (32). PCR was performed using specific primers example of acquired drug resistance by upregulation of a TLS flanking the p53-binding site of polH [hPolH-CHIP-up: polymerase. As upregulation of PolH was found in normal and GAGCTCGAGAAATCAAGGCT, hPolH-CHIP low: AAATCTG- cancer cells, the data have implications both for cancer cell GAACCATCACGCT; (33) and as negative control, b-actin– resistance and protection of the normal tissue. specific primers (hActin-up: TCCGCTGCCCTGAGGCACTC, hActin-low: GAGCCGCCGATCCACACGGA]. Materials and Methods Cell lines and anticancer drug treatment Overexpression and knockdown of PolH The cell lines used (A375, D03, D05, MCF7, TK6, U87, LN229, For transient transfection, 1 106 cells were seeded U138, T98G, LN18, LN308, LN319, VH10tert) were described per 10-cm dish. One day later, cells were transfected with previously (23, 25, 29, 30) and grown in RPMI or DMEM medium 2 mg of pcDNA3.1 or pcDNA3.1-polH vector, by use of containing 10% FBS, in 7% CO2 at 37 C. Fresh blood was Effectene reagent (Qiagen). Knockdown of PolH was per- obtained from healthy donors obtained from the blood bank of formed using the siRNA from Santa Cruz Biotechnology (sc- the University Medical Center Mainz (Mainz, Germany). Periph- 36289) and the Lipofectamine RNAiMAX Transfection Kit eral blood lymphocytes (PBLC) were isolated using density (Invitrogen). centrifugation and Lymphoprep (PROGEN Biotechnik GmbH) as described (29). For growth stimulation, lymphocytes were Determination of apoptosis incubated for 24 hours in 24-well tissue culture plates containing For monitoring drug-induced apoptosis, ethanol-fixed cells plastic-bound anti-CD3 (BD PharMingen) plus anti-CD28 anti- were stained with propidium iodide as described (34). The sub- fl bodies (BD PharMingen). If not differentially stated, cells were G1 fraction was determined by ow cytometry. Experiments pre-exposed to 10 mmol/L O6-benzylguanine (O6BG) and one were repeated at least three times, mean values SD are hour later exposed to fotemustine (diethyl1-[3-(2–chloroethyl)- shown, and data were statistically analyzed using Student t 3-nitrosoureido]ethylphosphate; Muphoran, Servier Research test. International), CCNU (Sigma Aldrich), or mafosfamide (ASTA Medica). The drugs remained in the medium until cell harvest. Immunofluorescence Cells were seeded on coverslips. Following genotoxin Xenograft experiments exposure, cells were washed with PBS and fixedwith4% A375 cells (8 106) were injected in the left and the right paraformaldehyde. After washing with PBS/0.2% Tween, a flank of immunodeficient mice (NOD.CB17-Prkdcscid/J). second fixation step was performed using 100% methanol, When tumors reached a suitable size, all animals were followed by additional washing steps with PBS/0.2% Tween. injected with O6BG (30 mg/kg i.p., dissolved in 1/3 PEG The antibodies used were anti-PolH (Abcam, ab 17725), anti- 400 and 2/3 PBS). Two hours later, vehicle or fotemustine gH2AX (#05-164, Upstate), and as secondary antibody Alexa (70 mg/kg i.p., dissolved in 1/4 ethanol and 3/4 PBS) was Fluor 488 F(ab0) fragment of goat anti-rabbit IgG (Invitrogen, administered. Forty hours later, the mice were sacrificed and A11070). Nuclear staining was performed using TO-PRO3 tumors were isolated, immediatelyfrozeninliquidnitrogen, iodide (Invitrogen). Slides were mounted in Vectashield andstoredat80 C. For expression analysis, the tissue was medium (Vector Laboratories Inc.) and analyzed using a

5586 Cancer Res; 74(19) October 1, 2014 Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

confocal laser scanning microscope (LSM 710, Zeiss) or the Results Metafer Scanning System (Metasystems). For removing Expression of PolH upon fotemustine exposure – non DNA-bound PolH, cells were washed with cold PBS In melanoma cells, toxicity induced by chloroethylating and then treated with 0.1% NP40 in PBS for 40 seconds on anticancer drugs like fotemustine depends on the p53 and ice. After a quick PBS washing step, the cells were fixed and 0 MGMT status (23, 37). The melanoma cell line D05 is p53 wild- treated as described above. For EdU (5-ethynyl-2 -deoxyur- type (wt) and expresses MGMT, whereas the melanoma cell idine) costaining, cells were washed with PBS and then line D03 is deficient for both proteins (23). Therefore, D05 cells treated with 10 mmol/L EdU (Click it EdU Imaging Kit, are highly resistant against fotemustine as compared with the C10338 Alexa Fluor 555, Invitrogen) for 1 hour. After a quick melanoma cell line D03. Treatment with the p53 inhibitor fi PBS washing step, the cells were xed as described above. pifithrin a (Ptha) or the MGMT inhibitor O6-benzylguanine Before the nuclear staining, the "Click it" reaction was (O6-BG) enhanced the cytotoxic potential of fotemustine in performed as proposed in the manufacturers' instructions. D05 cells (Fig. 1A). Combined treatment with the inhibitors further sensitized D05 cells to fotemustine nearly to the level MTT assay observed in D03 cells (Fig. 1A). Similar results were observed The metabolic activity of fotemustine-treated cells in com- using siRNA (data not shown). To further investigate the parison with untreated cells was determined by MTT assay. molecular mechanism underlying the protective effect of Seventy-two hours after exposure to the given anticancer drug, p53 on D05 cells upon treatment with fotemustine, MGMT the medium was removed and 50 mL MTT solution (5 mg/mL in was inhibited by O6-BG in all experiments to avoid repair of PBS) and 100 mL noncolored DMEM medium were added. After fotemustine-induced O6-ClG adducts. 3 to 4 hours of incubation, the medium was aspirated. The cells To identify DNA repair genes that contribute to p53-medi- were lysed and the blue redox product was dissolved by adding ated protection against chloroethylating agents, qRT-PCR 100 mL 0.04 mol/L HCl in isopropanol. The absorption at 570 arrays were conducted, analyzing the expression of 180 DNA nm was determined; the 650 nm background absorption was repair and DNA repair–associated genes. In this screening, we subtracted. observed the induction of the PolH in the p53 wt melanoma cell line D05 after fotemustine treatment (data not shown). To Host cell reactivation assay verify the induction of PolH upon fotemustine, the time- fi fl To induce DNA damage, the re y luciferase expression dependent expression of polH mRNA was examined by end vector pGL2-con (Promega) was ex vivo exposed to different point PCR (Fig. 1B) and qRT-PCR (Fig. 1C). An enhanced doses of fotemustine in Tris-EDTA buffer at room temperature expression of polH mRNA was detectable 8 hours after treat- fi for 12 hours. Thereafter, the plasmid was puri ed by phenol/ ment and was constantly increasing during the 24-hour post- chloroform extraction. Two-hundred nanograms of plasmids incubation period. Induction of polH mRNA was accompanied fi (180 ng of modi ed pGL2-con and 20 ng of the Renilla luciferase by an increase in the level of PolH protein (Fig. 1D). The expression vector pRLEF-1a) were used for transfection (Effec- increased expression of PolH was observed between 16 and tene Transfection Kit, Qiagen). Twenty-four hours after DNA 32 hours after exposure and was preceded by nuclear accu- transfection, the luciferase activities were measured using mulation of p53 (Fig. 1D). To clarify whether the induction of Dual-Glo luciferase assay. Reactivation of the pGL2-con plas- polH mRNA and protein is the result of promoter activation, fi fl mid was measured as activity of the re y luciferase. Activity of cells were treated with the transcription-blocking agent acti- the Renilla luciferase expressed by the cotransfected plasmid nomycin D (ActD). Treatment with the inhibitor only slightly fi pRLEF-1a was used as control for transfection ef ciency and reduced the basal level of polH mRNA, but completely pre- subtracted. vented the increase of polH mRNA upon fotemustine, suggest- ing the induction of polH mRNA to be dependent on RNA de BrdUrd incorporation novo synthesis (Fig. 1E). Cells were cultured in RPMI (10% FBS) and after exposure to fotemustine, bromodeoxyuridine (BrdUrd; 10 mmol/L) was Impact of p53 and replication arrest on fotemustine- added to the medium. One-hour later, the incorporation was induced PolH induction analyzed by the BrdU Incorporation Kit (Roche Diagnostics). Upregulation of polH was previously reported for human Experiments were repeated at least three times, mean values fibroblasts upon treatment with ionizing radiation, with p53 SD are shown, and data were statistically analyzed using being involved (33). Therefore, we analyzed the fotemustine- Student t test. mediated induction of polH in melanoma cell lines proficient and deficient for p53 (Supplementary Fig. S1A). Induction of ICL repair measured by single-cell gel electrophoresis polH mRNA was only observed in p53-proficient melanoma cell For the modified comet assay (35), cells were treated with 10 lines (Supplementary Fig. S1B). We also observed induction of mg/mL fotemustine and, after the indicated time periods, the canonical p53 targets p21, gadd45a, and fasR, substanti- trypsinized and washed with ice-cold PBS. Thereafter, cells ating the p53 wt status of the melanoma lines (Supplementary were irradiated by 8 Gy. Alkaline cell lysis and electrophoresis Fig. S1B). To further investigate the impact of p53 on polH was performed as described (36). The results are expressed as induction, p53 was inhibited by Ptha, which has been shown to relative tail moment (%) ¼ fluorescence intensity tail (%) inhibit p53-dependent gene transcription (38). Pretreatment of distance head center to tail end. D05 cells with 10 mg/mL Ptha completely abrogated the

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5587

Tomicic et al.

A 120 D05 D05+Ptha D05+O6BG D05+O6BG+PTHa D03 Figure 1. Fotemustine-triggered 100 induction of PolH in melanoma cells. A, sensitivity of D05 cells to 80 fotemustine (FM) was analyzed by MTT assay upon inhibition of MGMT by O6-BG, inhibition of p53 60 by Ptha, or combined inhibition of MGMT and p53. MGMT and 40 p53-deficient D03 cells were Cell viability (%) included for comparison. B and C, 20 D05 cells were exposed to 10 mg/mL fotemustine for different times. B, end point PCR was 0 performed using polH or, as Con 2 5 10 25 50 loading control, gapdh-specific m FM ( g/mL) primers. C, qRT-PCR was performed and the expression of B Con 4 8 16 24 Time (h) D Con 8 16 24 32 Time (h) polH was normalized to gapdh and b-actin; the untreated control was PolH polH set to one. Data are the mean of three independent experiments b-Actin gapdh SD. D, D05 cells were exposed to 10 mg/mL fotemustine. Expression p53 of PolH and p53 protein was C 5 analyzed by specific antibodies in b-Actin 4 whole-cell and nuclear extracts, respectively. b-Actin was used as 3 loading control. E, D05 cells were ActD FM ActD + FM E exposed to 10 mg/mL fotemustine 2 Con 816816 816Time (h) in the presence or absence of 1 1 mmol/L actinomycin D (ActD) and polH

Induction (x-fold) expression of polH mRNA was 0 analyzed by end point PCR. 0481624 gapdh Time (h)

induction of PolH upon fotemustine exposure, both on mRNA formation of DSBs was detected following fotemustine treat- (Fig. 2A) and on protein level (Fig. 2B), supporting the notion ment (Fig. 2G and Supplementary Fig. S1D and S1E). Upon HU that PolH is transcriptionally regulated by p53. Finally, ChIP exposure, no DSBs were observed 2 to 8 hours after treatment experiments showed in vivo binding of p53 protein to the p53- although a strong pan-staining of gH2AX was detected (data binding site of the polH promoter in D05 cells exposed to not shown), indicating the replication arrest triggered activa- fotemustine (Fig. 2C). tion of the DNA damage response (DDR) and, concomitantly, An intriguing question is whether induction of PolH is induced polH. However, following fotemustine, which only triggered by fotemustine-induced ICL, by the formation of modestly induced replication arrest in the dose range used, DNA repair intermediates like DSBs, or DNA replication arrest. the formation of DSBs seems to play a predominant role in To clarify this, the activation of p53 was analyzed via immu- activating the DDR and thereby the induction of polH. As nodetection of p53Ser15 (Fig. 2D), the induction of PolH by qRT- neither p53 activation nor polH induction was observed at PCR (Fig. 2E), replication blockage by BrdUrd assay (Fig. 2F) early time points following fotemustine, we conclude that the and the formation of DSBs via gH2AX foci (Fig. 2G). To inhibit monoadducts formed by the agent do not activate the DDR and replication, we used hydroxyurea (HU), a typical DNA repli- do not induce polH. cation blocking agent. Upon exposure of D05 cells to fotemustine or HU, activation of p53 and induction of polH mRNA was Induction of PolH in tumor cells, melanoma xenografts, observed. At early time points, p53 activation and polH induc- and nontransformed cells tion was more pronounced in the HU-exposed cells, reaching To analyze whether the induction of PolH is restricted to its maximum already 2 hours after treatment (Fig. 2D and E). melanoma cells or is a common response of tumor cells to Upon fotemustine, p53 activation and polH induction was crosslinking anticancer drugs, different cell systems were observed starting 8 hours postexposure. Measurement of cell analyzed concerning the inducibility of PolH. In U87 glioma proliferation showed a strong replication arrest between 2 and cells, a time-dependent induction of polH mRNA (Fig. 3A and B) 16 hours after HU exposure, whereas upon fotemustine expo- and PolH protein (Fig. 3C) was observed following treatment sure, replication decreased at late times, i.e., between 12 and 16 with CCNU (used for glioma therapy). Similar to melanoma hours (Fig. 2F). Concomitant with the activation of p53, cells, the induction of PolH was abrogated when cells were

5588 Cancer Res; 74(19) October 1, 2014 Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

A FM + Ptha FM - Ptha 0 481624Time (h) 0 4 8 16 24 polH

gapdh

IP-DNA B C Genomic FM + Ptha FM - Ptha DNA no Ab ERK2-Ab p53-Ab 0 816240 81624Time (h) Con FM Con FM FMCon FMCon

PolH polH promoter

b-Actin b-Actin cds

FM HU D Con 2hCon 4h Con 8h Con12hCon 16h Con 2hCon 4h Con 8h Con12hCon 16h p-p53Ser15

b-Actin

E 4 FM HU F 120 FM HU G 30 FM HU

100 25 3 80 20

2 60 15

40 10 1 BrdU incorporation 20 5 polH induction (x-fold) Cells >3 g H2AX foci (%)

0 0 0 Con 2 4 8 12 16 Con 2 4 8 12 16 Con 2 4 8 12 16 Time (h) Time (h) Time (h)

Figure 2. p53-dependent and fotemustine-triggered induction of PolH in melanoma cells. A and B, D05 cells were exposed to 10 mg/mL fotemustine (FM) in the presence or absence of 10 mmol/L Ptha. Expression of polH mRNA was analyzed by end point PCR (A) and expression of PolH protein was analyzed by Western blot analysis using nuclear protein extracts (B). C, ChIP analysis was performed in untreated D05 cells and cells exposed to 10 mg/mL fotemustine for 16 hours. One percent of cell extracts from each of the samples was taken as input. Protein-DNA complexes were immunoprecipitated with anti-p53, anti-ERK1/2, or without antibody and end point PCR was performed using primers flanking the p53-responsive element within the polH promoter or primers specific for the b-actin coding sequence. D–G, D05 cells were exposed to 10 mg/mL fotemustine or 1 mmol/L HU for indicated times. D and E, phosphorylation of p53Ser15 was analyzed by Western blot analysis (D) and expression of polH mRNA by qRT-PCR (E). F, DNA replication was measured by BrdUrd incorporation. G, formation of gH2AX foci was analyzed by microscopy. Eight-hundred cells were scored for each time point and the percentage of cells showing >3 gH2AX foci are presented. pretreated with Ptha (Fig. 3D). To further analyze the p53 Induction of polH mRNA was also observed in breast cancer dependency of polH induction in glioma cells, we used a panel cells (MCF7) and lymphoblastoid cells (TK6) upon treatment of glioma cell lines well characterized to the p53 status (30). By with mafosfamide (Fig. 3F). As fotemustine, CCNU, and MAF all using these lines, induction of polH mRNA was only observed in induce ICLs, the data support the view that induction of PolH is the p53-proficient glioma cell line LN229, but not the p53- a common response to ICL-inducing anticancer drugs. deficient (LN308) or p53-mutated (T98G, LN18, LN319, U138) To study whether PolH becomes upregulated in cells grown cells (Fig. 3E), indicating that p53 mutations impairing p53 in a host in vivo, A375 melanoma cells wt for p53 were injected activity prevent polH upregulation following ICL drug into immunodeficient mice. Upon tumor formation, mice were treatment. either mock-treated or treated with fotemustine (70 mg/kg,

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5589

Tomicic et al.

A B 8 0 2448162 32 48 Time (h) 6 polH 4 gapdh Figure 3. Induction of PolH by U87, CCNU 2 chloroethylating drugs in tumor cells. A–C, U87 glioma cells were

C Time (h) Induction (x-fold) 0 2448162 32 48 0 exposed to 20 mg/mL CCNU. PolH 0 8 16 24 48 Expression of polH mRNA was Time (h) analyzed by end point PCR (A) and qRT-PCR (B); expression of PolH b-Actin E 4 U87, CCNU Con protein was analyzed by Western 8 blot analysis (C). D, U87 cells were 3 24 – Ptha + Ptha exposed to 20 mg/mL CCNU in the D presence or absence of 10 mmol/L 0 816240 81624Time (h) 2 Ptha and expression of PolH PolH protein was analyzed by Western 1 blot analysis. E, a panel of glioma

b-Actin Induction (x-fold) cell lines were exposed to 20

U87, CCNU 0 mg/mL CCNU for 8 or 24 hours LN229 T98G LN18 LN308 LN319 U138 and the expression of polH mRNA was analyzed by qRT-PCR. F, F 4 6 exponentially growing MCF7 FAM ,7FCM FAM ,6KT FAM breast cancer cells and TK6 3 lymphoblastoid cells were 4 exposed to 5 mg/mL MAF and the 2 expression of polH mRNA was analyzed by qRT-PCR. 2 1 Induction (x-fold) Induction (x-fold) 0 0 0 8 16 24 48 0 8 16 24 48 Time (h) Time (h)

i.p.). Tumors were removed 40 hours thereafter and the (33). To analyze the impact of PolH on chloroethylating expression of PolH was measured on mRNA and protein level. anticancer drug-induced toxicity, PolH was downregulated via As indicated by end point PCR (Supplementary Fig. S1C) and siRNA or ectopically overexpressed. The determination of cell qRT-PCR (Fig. 4A), the expression of polH mRNA was higher in viability via the MTT assay showed a protective effect of PolH all samples obtained from fotemustine-treated animals com- against several crosslink inducing anticancer drugs. In detail, pared with samples obtained from untreated mice, which were PolH knockdown sensitized melanoma cells to fotemustine, randomly crosspaired. An enhanced expression of PolH and glioma cells to CCNU, and breast cancer cells to MAF (Fig. 5A), p53 was also observed on protein level in the melanoma drugs used in the treatment of the corresponding types of xenografts following treatment of mice with fotemustine tumors. To further analyze the impact of PolH on cell death, the (Fig. 4B). sub-G1 fraction was determined. Also in this assay, knockdown PolH induction is not a tumor-specific trait; it was also found of PolH had a strong impact on fotemustine-induced toxicity in in nontransformed cells like human diploid fibroblasts D05 cells and clearly enhanced cell death (Fig. 5B). The (VH10tert; Fig. 4C) and in replicating (CD3/CD28 stimulated) efficiency of PolH knockdown was verified in parallel experi- PBLCs obtained from healthy donors (Fig. 4D and E) following ments by Western blot analysis (Fig. 5B, left). To assess the exposure to fotemustine. Of note, polH induction was impact of PolH induction on fotemustine resistance, p53- not observed in nonstimulated PBLCs, which are in G0 deficient D03 melanoma cells, showing no induction of PolH (>95%; Fig. 4E). The lack of induction of polH in nonproliferat- upon fotemustine exposure (Supplementary Fig. S1B), were ing PBLCs, along with lack of p53 activation (Fig. 4F), supports transfected with a PolH expression vector (Fig. 5C, left plot for the view that not the primary DNA damage, but replication- efficiency of PolH expression) and exposed to fotemustine. associated lesions (DSB) trigger the response. Overexpression of PolH clearly protected the cells against fotemustine-induced cytotoxicity (Fig. 5C, right panel). Impact of PolH on the sensitivity to chloroethylating anticancer drugs Impact of PolH on the repair of fotemustine-induced PolH was related to both, resistance and sensitivity to DNA damage genotoxic stress. Thus, PolH deficiency renders human fibro- Next, we analyzed whether PolH is involved in the repair blasts sensitive to UV light, but resistant to ionizing radiation of fotemustine-induced DNA damage. Therefore, host

5590 Cancer Res; 74(19) October 1, 2014 Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

A 5 B T4 Figure 4. Fotemustine-triggered 4 _ induction of PolH in the melanoma + 3 xenograft model and PolH nontransformed cells. A and B, 2 A375 cells were injected into p53 immunodeﬁcient (NOD.CB17- 1

Prkdcscid/J) mice. Upon tumor Induction (x-fold) b-Actin formation, the mice were either 0 mock-treated or treated with T1 T2 T3 mean fotemustine (70 mg/kg, i.p.). Forty 5 hours later, the expression of polH C was analyzed using qRT-PCR in 4 three paired animals (T1-T3; A) and 0 8162448Time (h) the expression of PolH and p53 3 polH was analyzed by Western blot analysis (B) in an additional animal 2 pair (T4). C, human ﬁbroblasts gapdh 1 were exposed to 10 mg/mL

VH10tert, FM Induction (x-fold) fotemustine and the expression of 0 polH mRNA was analyzed by end 48241680 point PCR (left) and qRT-PCR Time (h) (right). D–F, PBLCs were isolated from different buffy coats obtained from healthy donors and either not D 0244872 96 Time (h) E 0 24 48 Time (h) stimulated or stimulated to polH proliferate by anti-CD3 and anti- polH CD28 antibodies and exposed to fotemustine. D, expression of PolH gapdh gapdh was analyzed by end point PCR Stimulated (top) and Western blot analysis (bottom) in stimulated PBLCs. PolH polH E, expression of polH was Non analyzed by end point PCR in Stimulated PBLCs ERK2 gapdh stimulated (top) and nonstimulated stimulated (bottom) PBLCs. F, expression of p53 was analyzed by Western blot F Stimulated Nonstimulated analysis using nuclear extracts in 48240 9672 Time (h) 967248240 stimulated (left) and nonstimulated (right) PBLCs. p53

PBLCs ERK2

reactivation assays were performed, transfecting ex vivo ICLs represent a severe block of DNA replication, causing fotemustine-exposed pGL2-con plasmids into D05 cells. DSB at blocked replication forks. To analyze the impact of PolH After dose-finding experiments (Supplementary Fig. S1F), on replication and DSB formation, replication was analyzed by pGL2-con plasmids alkylated with 5 and 25 mg/mL fotemus- BrdUrd assay and DSB formation by gH2AX foci. Knockdown tine were transfected either in polH siRNA-transfected, of PolH clearly extended the fotemustine-induced block to nonsilencing (ns) siRNA-transfected or nontransfected cells replication (Fig. 6C) and, in parallel, increased the amount of and reactivation of the plasmid was determined 24 hours gH2AX foci (Fig. 6D). Whereas the amount of gH2AX foci per later. The data clearly show that knockdown of PolH neg- cell was <3 in untreated cells, fotemustine (10 mg/mL) induced atively affects the ability of cells to reactivate the plasmid approximately 40 gH2AX foci per cell 24 hours after exposure (Fig. 6A), indicating its involvement in the repair of chlor- (Fig. 6D). Upon siRNA-mediated knockdown of PolH, the oethylating agent-induced DNA damage. Besides performing number of gH2AX foci was significantly enhanced 48 and 72 host cell reactivation assays, we also analyzed the formation hours after fotemustine in comparison with ns-siRNA–trans- and repair of fotemustine-induced DNA damage in vivo. fected cells (Fig. 6D). We should note that only a subfraction of Therefore, the modified alkaline comet assay was used to cells showed gH2AX foci. Therefore, only cells showing >3 foci monitor the repair of DNA crosslinks. The data show that per cell were included in the quantification. Also, the percent- PolH is not involved in the early step of ICL repair as its age of cells showing >3 gH2AX foci upon fotemustine exposure knockdown does not affect ICL formation or its resolution was higher in PolH siRNA-transfected cells (Supplementary (Fig. 6B). Fig. S1G). The finding that only a subpopulation of cells showed

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5591

Tomicic et al.

A 100 100 100 * * ** * 80 80 80 * * * * ** 60 60 ** 60 Figure 5. Impact of PolH on cell death triggered by chloroethylating agents. A, U87,

Cell viability (%) Cell viability 40 40 40 D05, and MCF7 cells were D05-ns-si U87-ns-si MCF7-ns-si transiently transfected with D05-polH-si U87-polH-si MCF7-polH-si 20 20 20 polH-speciﬁc siRNA (polH-si) or 50251052Con 1005025105Con 50251052Con ns-si and 24 hours later, exposed FM (mg/mL) CCNU (mmol/L) MAF (mg/mL) to different doses of CCNU, fotemustine (FM), or MAF, respectively. Cytotoxicity was ** B 35 ** measured using MTT assay. B and 30 C, D05 cells were transiently transfected with polH-speciﬁc 25 siRNA (polH-si) or ns-si (B) or polH-siRNA ns-siRNA ns-siRNA polH-siRNA ns-siRNA polH-siRNA (%) 1 20 transiently transfected using a PolH 15 PolH expression vector (vec-polH) SubG D05 b-Actin 10 or mock-transfected (vec-con; C). Twenty-four hours later, the 5 expression of PolH was analyzed 0 by Western blot analysis (left) or con ns-siCon polH-si FoteFM ns-si polH-si the cells were exposed to 10 FM FM mg/mL fotemustine (B) or different 40 vec-con vec-polH doses of fotemustine (C) for 72 hours and the cytotoxicity was measured as sub-G1 fraction (%) 30 C 1 * (right). A–C, data are the mean of * three independent experiments vec-polH vec-polH vec-polH vec-con vec-con vec-con 20 ** SD. , P < 0.05; , P < 0.01. PolH

D03 10 b

-Actin Induced subG

0 5102550 FM (mg/mL)

gH2AX foci indicates that its formation is associated with Discussion replication. This is supported by EdU labeling experiments. In glioblastoma and melanoma cells, p53 is one of the Formation of gH2AX foci was observed predominantly in major factors influencing toxicity of anticancer drugs. In replicating cells (Supplementary Fig. S2A); 24 hours after case of the chloroethylating agents, ACNU (22) and fote- fotemustine exposure, more than 85% of cells positive for EdU mustine (25), this protective effect was related to the showed gH2AX foci (Supplementary Fig. S2B), indicating that induction of the nucleotide excision repair genes xpc and DSB formation following fotemustine is restricted to S-phase ddb2, which are robustly regulated by p53. To identify cells. additional factors involved in p53-mediated resistance to To further prove that PolH is involved in the replication- ICL-inducing agents, we analyzed the p53-mediated regu- associated repair of chloroethylating agent-induced DNA dam- lation of all known DNA repair genes and identified the age, notably ICL, the cellular localization of PolH was analyzed. PolH as an important p53-regulated factor involved in the Enhanced nuclear expression of PolH was observed in fote- cellular protection against fotemustine and other ICL- mustine-exposed cells (Supplementary Fig. S2C). In experi- inducing anticancer drugs. ments, in which strong washing conditions were applied to Induction of PolH by fotemustine was found in melanoma remove non DNA-bound proteins (39), PolH was not detectable cell lines, normal fibroblasts, and proliferating PBLCs on the in untreated cells (Fig. 6E). In fotemustine-treated cells, how- level of mRNA and protein. Furthermore, induction of PolH ever, a strong staining of PolH was observed in 20% to 30% of was observed in glioma cells upon exposure to CCNU used in the cells. Parallel detection of EdU incorporation showed that glioma therapy and in breast cancer cells upon exposure binding of PolH to the DNA in fotemustine-treated cells occurs to MAF, a derivative of the crosslink inducing anticancer predominantly (>80%) in replicating (S-phase) cells (Fig. 6E drug cyclophosphamide used in breast cancer therapy. PolH and Supplementary Fig. S2B). induction was mediated by p53 as substantiated by ChIP

5592 Cancer Res; 74(19) October 1, 2014 Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

A 100 B 100 Figure 6. Impact of PolH on the nt ns-si repair of fotemustine-triggered ns-si 80 polH-si DNA damage. A–D, D05 cells were polH-si 80 either nontransfected (nt) or 60 transfected with ns-siRNA or 60 polH-speciﬁc siRNA. A, host cell 40 reactivation assay. Cells were ** 40 transfected 24 hours later with the 20 20 plasmid pGL2-con, which was Luciferase activity *

ex vivo exposed to 5 or 25 mg/mL Relative tail moment (%) fotemustine (FM) and with the 0 0 0525 Con 24 48 plasmid pRLEF-1a. Sixteen hours FM (mg/mL) Time (h) later, the cells were harvested, protein extracts isolated, and C 100 D 50 ns-si ns-si subjected to the dual luciferase polH-si 40 polH-si assay. B, ICL repair was measured 80 ** by modiﬁed comet assay at 24 and 30 * 48 hours after fotemustine (10 60 * mg/mL) treatment. C, DNA replication was measured by 40 20 BrdUrd incorporation assay 24, 48, ** g H2AX foci /cell and 72 hours after fotemustine 20 10

(10 mg/mL) treatment. D, formation (%) BrdU incorporation of gH2AX foci was analyzed by 0 0 0244872 24 48 72 confocal laser scanning microscopy at 24, 48, and 72 hours Time (h) Time (h) after fotemustine (10 mg/mL) E Control FM treatment. Fifty cells (showing >3 foci) were scored for each time point. A–D, data are the mean of three independent experiments SD. , P < 0.05; , P < 0.01. EdU EdU PolH E, binding of PolH to fotemustine- PolH damaged DNA was determined using immunoﬂuorescence and confocal laser scanning microscopy 16 hours after exposure to 10 mg/mL fotemustine. Nuclear staining was performed using TO-PRO3 and detection of Overlay Overlay TO-PRO3 replicating cells was analyzed by TO-PRO3 EdU incorporation.

experiments and experiments using the p53 inhibitor Ptha. fotemustine, supporting the notion that PolH induction con- This notion is in line with a previous report showing p53- tributes to ICL drug resistance. dependent induction of PolH by IR and camptothecin (33). Our data suggest that PolH represents a potential marker of The observation of PolH induction in tumor cell lines grown cancer cell resistance. How is PolH expressed in tumors? As in vitro and as xenografts, and in PBLCs upon exposure to data are scarce, we initially analyzed the expression of PolH in various crosslink-inducing agents clearly hints to an important malignant glioma cell lines (Supplementary Fig. S3A) and in and widely spread biologic function of PolH upregulation. PolH human breast cancer and corresponding normal tissue (Sup- seems to play different roles in cellular toxicity according to the plementary Fig. S3B and S3C). The results showed clear varia- type of DNA damage. Thus, knockdown of PolH on the one tions in the PolH expression, which was overall slightly higher hand enhanced the sensitivity to UV light and, on the other, in cancer than in the normal tissue, indicating that PolH might enhanced cellular resistance to IR (33). To analyze the impact be upregulated during tumor development. However, more of PolH on anticancer drug–induced cytotoxicity, PolH was studies concerning the expression of PolH in tumors are downregulated using siRNA. Downregulation of PolH clearly needed to clarify this point. sensitized melanoma cells to fotemustine, glioma cells to We also analyzed whether PolH is directly involved in the CCNU, and MCF7 cells to MAF, indicating that PolH is a repair of chloroethylating agent–derived DNA adducts. Fote- general player involved in the protection of cancer cells against mustine chloroethylates the O6-position of guanine, forming crosslink-inducing agents. Furthermore, ectopic expression of O6-ClG, which thereafter undergoes intramolecular rearrange- PolH in D03 melanoma cells rendered them more resistant to ment to form an ICL (5). Whereas O6-ClG is repaired by MGMT

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5593

Tomicic et al.

(40) the repair of ICL is complex, involving multiple repair replication-associated repair of ICL. This finding is in contrast mechanisms (1). Also to consider, ICL repair differs between to data showing that DNA damage–induced PolH recruitment replicating and nonreplicating cells. In nonreplicating cells, the takes place independently of the cell-cycle phase (49). This, repair depends on nucleotide excision repair (NER)-mediated however, was observed after treatment with UV light, which recognition of the crosslink and dual NER-mediated incision at induces intrastrand crosslinks that are repaired independently positions flanking the crosslinked DNA. After flipping the of replication, whereas ICL are more severe lesions that are excised DNA fragment out of the helix, resynthesis of DNA repaired predominantly within the S-phase, which is supported occurs and a second cycle of NER finally removes the flipped- by a large fraction of the cells showing gH2AX foci in the S- out crosslink (1). Whether resynthesis of DNA is accomplished phase upon fotemustine treatment. by replicative or translesion polymerases is unclear. In repli- Upregulation of PolH following anticancer drug treatment cating cells, when the crosslink encounters the replication fork, was not only observed in malignant cells, but also in fibroblasts NER, TLS, and HR are implicated in the repair (1). and PBLCs isolated from healthy individuals. As PolH plays a To analyze the role of PolH in the repair of fotemustine- protective role, the data suggest that PolH may also protect the induced DNA adducts, host reactivation assays were per- normal tissue from the therapeutic side effects of ICL-inducing formed. Upon knockdown of PolH, a clear decrease in anticancer drugs. We should also note another interesting side plasmid reactivation was observed, indicating that PolH is effect. As PolH, a low fidelity TLS polymerase, is able to insert involved in the repair of fotemustine-induced DNA damage. wrong nucleotides opposite to the lesion in the DNA (26), its An intriguing question is whether PolH is involved in the activity is error-prone, leading to the formation of mutations. repair of the monoadducts or ICL. In vitro,conversionofa These might be a source of therapy-induced secondary tumors, monoadduct to a crosslink occurs within a period of 3 hours which is indeed a serious deleterious side effect of ICL-induc- (5). In cells upon exposure to chloroethylating drugs, the ing drugs such as nitrogen mustards and nitrosoureas (50). formation of ICL was finished within 8 hours (41). As ex vivo In summary, we show for the first time upregulation of PolH modification of the plasmid was performed in our experi- upon exposure of cells to crosslink-inducing anticancer drugs. ments for 12 hours, O6-ClG adducts should not be present The process is dependent on p53 and was observed in mela- anymore, supporting the notion that PolH is involved in the noma, glioma, and breast cancer cell lines. It was also observed repair of ICL. This is in line with data showing repair of in a mouse melanoma xenograft model in the absence of mitomycin C-induced ICL using in vivo reactivation assays. systemic toxicity, indicating that it occurs in a relevant dose In these experiments, using xeroderma pigmentosum range. Furthermore, we show that the elevated expression of patient–derived XPV cells, partial requirement for PolH was PolH enhances the resistance of cancer cells to crosslinking observed (42). Moreover, XPV cells are hypersensitive to anticancer drugs, including chloroethylating agents and cyclo- cisplatin (43, 44), and PolH was associated with processing phosphamide derivatives, resulting from a participation of of psoralen-induced crosslinks (45). PolH in the repair of DNA crosslinks. We also performed modified alkaline comet assays to mea- sure the repair of ICL in vivo. No difference was observed in the Disclosure of Potential Conflicts of Interest formation and initial cleavage of ICL, indicating that PolH is No potential conflicts of interest were disclosed. not involved in the first steps of ICL repair, namely recognition and incision. However, a prolonged replication block and an Authors' Contributions enhanced persistence of gH2AX foci were observed, indicating Conception and design: M.T. Tomicic, B. Kaina, M. Christmann fi Development of methodology: D. Aasland that the ef cient execution of later steps of ICL repair is Acquisition of data (provided animals, acquired and managed patients, reduced in PolH-compromised cells. Besides its role in TLS, provided facilities, etc.): R. Meise, C. Barckhausen, M. Christmann PolH displays an important function in mitotic gene conver- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): M.T. Tomicic, R. Meise, B. Kaina, M. Christmann sion and homologous recombination (46). Furthermore, PolH Writing, review, and/or revision of the manuscript: M.T. Tomicic, B. Kaina, possesses a dual role at stalled replication forks, promoting M. Christmann TLS and reinitiating DNA synthesis during HR by primer Administrative, technical, or material support (i.e., reporting or orga- nizing data, constructing databases): S.C. Naumann, B. Kaina extension of D-loop structures (47). More recently it was shown Study supervision: M. Christmann that PolH provides a supportive role for PolD during normal replication (48). Therefore, the question arises whether the Acknowledgments function of PolH in ICL repair following anticancer drugs is The authors thank Birgit Rasenberger for excellent technical assistance. associated with replication events. To address this, we analyzed whether PolH can directly interact with fotemustine- damaged DNA in vivo and whether this reaction is associated Grant Support with replication. Upon removal of non-DNA–bound PolH, the The work was supported by a grant from the Deutsche Forschungsge- meinschaft (DFG CH 665/2-2). remaining DNA-bound PolH was only detected in fotemustine- The costs of publication of this article were defrayed in part by the treated, but not in unexposed cells. Parallel detection of EdU payment of page charges. This article must therefore be hereby marked incorporation showed that binding of PolH to the DNA of advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fotemustine-exposed cells occurs predominantly in replicating fact. cells (>80% of PolH-positive cells were at the same time Received April 4, 2014; revised June 7, 2014; accepted June 30, 2014; positive for EdU incorporation), indicating a role for PolH in published OnlineFirst August 14, 2014.

5594 Cancer Res; 74(19) October 1, 2014 Cancer Research

Involvement of Polymerase h in Anticancer Drug Resistance

References 1. Muniandy PA, Liu J, Majumdar A, Liu ST, Seidman MM. DNA inter- 23. Naumann SC, Roos WP, Jost E, Belohlavek C, Lennerz V, Schmidt CW, strand crosslink repair in mammalian cells: step by step. Crit Rev et al. Temozolomide- and fotemustine-induced apoptosis in human Biochem Mol Biol 2010;45:23–49. malignant melanoma cells: response related to MGMT, MMR, DSBs, 2. Emadi A, Jones RJ, Brodsky RA. Cyclophosphamide and cancer: and p53. Br J Cancer 2009;100:322–33. golden anniversary. Nat Rev Clin Oncol 2009;6:638–47. 24. Li G, Tang L, Zhou X, Tron V, Ho V. Chemotherapy-induced apo- 3. Ludlum DB. The chloroethylnitrosoureas: sensitivity and resistance to ptosis in melanoma cells is p53 dependent. Melanoma Res 1998;8: cancer chemotherapy at the molecular level. Cancer Invest 1997;15: 17–23. 588–98. 25. Barckhausen C, Roos WP, Naumann SC, Kaina B. Malignant mela- 4. Pegg AE. Repair of O(6)-alkylguanine by alkyltransferases. Mutat Res noma cells acquire resistance to DNA interstrand cross-linking che- 2000;462:83–100. motherapeutics by p53-triggered upregulation of DDB2/XPC-mediat- 5. Tong WP, Kirk MC, Ludlum DB. Formation of the cross-link 1-[N3- ed DNA repair. Oncogene 2014;33:1964–74. deoxycytidyl),2-[N1-deoxyguanosinyl]ethane in DNA treated with N, 26. Hoffmann JS, Cazaux C. Aberrant expression of alternative DNA N0-bis(2-chloroethyl)-N-nitrosourea. Cancer Res 1982;42:3102–5. polymerases: a source of mutator phenotype as well as replicative 6. Fischhaber PL, Gall AS, Duncan JA, Hopkins PB. Direct demonstration stress in cancer. Semin Cancer Biol 2010;20:312–9. in synthetic oligonucleotides that N,N0-bis(2-chloroethyl)-nitrosourea 27. Rey L, Sidorova JM, Puget N, Boudsocq F, Biard DS, Monnat RJ Jr, cross links N1 of deoxyguanosine to N3 of deoxycytidine on opposite et al. Human DNA polymerase eta is required for common fragile site strands of duplex DNA. Cancer Res 1999;59:4363–8. stability during unperturbed DNA replication. Mol Cell Biol 2009;29: 7. Brulikova L, Hlavac J, Hradil P. DNA interstrand cross-linking agents 3344–54. and their chemotherapeutic potential. Curr Med Chem 2012;19: 28. Bergoglio V, Boyer AS, Walsh E, Naim V, Legube G, Lee MY, et al. DNA 364–85. synthesis by Pol eta promotes fragile site stability by preventing under- 8. Avril MF, Aamdal S, Grob JJ, Hauschild A, Mohr P, Bonerandi JJ, et al. replicated DNA in mitosis. J Cell Biol 2013;201:395–408. Fotemustine compared with dacarbazine in patients with disseminat- 29. Roos W, Baumgartner M, Kaina B. Apoptosis triggered by DNA ed malignant melanoma: a phase III study. J Clin Oncol 2004;22: damage O6-methylguanine in human lymphocytes requires DNA rep- 1118–25. lication and is mediated by p53 and Fas/CD95/Apo-1. Oncogene 9. Di Giacomo AM, Ascierto PA, Pilla L, Santinami M, Ferrucci PF, 2004;23:359–67. Giannarelli D, et al. Ipilimumab and fotemustine in patients with 30. Wischhusen J, Naumann U, Ohgaki H, Rastinejad F, Weller M. CP- advanced melanoma (NIBIT-M1): an open-label, single-arm phase 2 31398, a novel p53-stabilizing agent, induces p53-dependent and trial. Lancet Oncol 2012;13:879–86. p53-independent glioma cell death. Oncogene 2003;22:8233–45. 10. Del Vecchio M, Mortarini R, Canova S, Di Guardo L, Pimpinelli N, Sertoli 31. Christmann M, Kaina B. Nuclear translocation of mismatch repair MR, et al. Bevacizumab plus fotemustine as first-line treatment in proteins MSH2 and MSH6 as a response of cells to alkylating agents. metastatic melanoma patients: clinical activity and modulation of J Biol Chem 2000;275:36256–62. angiogenesis and lymphangiogenesis factors. Clin Cancer Res 32. Christmann M, Tomicic MT, Aasland D, Berdelle N, Kaina B. Three 2010;16:5862–72. prime exonuclease I (TREX1) is Fos/AP-1 regulated by genotoxic 11. Guida M, Cramarossa A, Fistola E, Porcelli M, Giudice G, Lubello K, stress and protects against ultraviolet light and benzo(a)pyrene- et al. High activity of sequential low dose chemo-modulating Temo- induced DNA damage. Nucleic Acids Res 2010;38:6418–32. zolomide in combination with Fotemustine in metastatic melanoma. A 33. Liu G, Chen X. DNA polymerase eta, the product of the xeroderma feasibility study. J Transl Med 2010;8:115. pigmentosum variant gene and a target of p53, modulates the DNA 12. Hoeijmakers JH. DNA damage, aging, and cancer. N Engl J Med damage checkpoint and p53 activation. Mol Cell Biol 2006;26: 2009;361:1475–85. 1398–413. 13. Christmann M, Tomicic MT, Roos WP, Kaina B. Mechanisms of human 34. Tomicic MT, Friedrichs C, Christmann M, Wutzler P, Thust R, Kaina B. DNA repair: an update. Toxicology 2003;193:3–34. Apoptosis induced by (E)-5-(2-bromovinyl)-20-deoxyuridine in varicella 14. Christmann M, Kaina B. Transcriptional regulation of human DNA zoster virus thymidine kinase-expressing cells is driven by activation of repair genes following genotoxic stress: trigger mechanisms, inducible c-Jun/activator protein-1 and Fas ligand/caspase-8. Mol Pharmacol responses and genotoxic adaptation. Nucleic Acids Res 2013;41: 2003;63:439–49. 8403–20. 35. Spanswick VJ, Hartley JM, Ward TH, Hartley JA. Measurement of 15. Harper JW, Elledge SJ. The DNA damage response: ten years after. drug-induced DNA interstrand crosslinking using the single-cell gel Mol Cell 2007;28:739–45. electrophoresis (comet) assay. Methods Mol Med 1999;28:143–54. 16. Lakin ND, Jackson SP. Regulation of p53 in response to DNA damage. 36. Tomicic MT, Thust R, Sobol RW, Kaina B. DNA polymerase beta Oncogene 1999;18:7644–55. mediates protection of mammalian cells against ganciclovir- 17. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW. induced cytotoxicity and DNA breakage. Cancer Res 2001;61: Participation of p53 protein in the cellular response to DNA damage. 7399–403. Cancer Res 1991;51:6304–11. 37. Christmann M, Pick M, Lage H, Schadendorf D, Kaina B. Acquired 18. Tomicic MT, Christmann M, Kaina B. Topotecan-triggered degrada- resistance of melanoma cells to the antineoplastic agent fotemustine is tion of topoisomerase I is p53-dependent and impacts cell survival. caused by reactivation of the DNA repair gene MGMT. Int J Cancer Cancer Res 2005;65:8920–6. 2001;92:123–9. 19. Tomicic MT, Christmann M, Kaina B. Topotecan triggers apoptosis in 38. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon p53-deficient cells by forcing degradation of XIAP and survivin thereby JS, Chernov MV, et al. A chemical inhibitor of p53 that protects mice activating caspase-3-mediated Bid cleavage. J Pharmacol Exp Ther from the side effects of cancer therapy. Science 1999;285:1733–7. 2010;332:316–25. 39. Andersen PL, Xu F, Ziola B, McGregor WG, Xiao W. Sequential 20. Tomicic MT, Kaina B. Topoisomerase degradation, DSB repair, p53 assembly of translesion DNA polymerases at UV-induced DNA dam- and IAPs in cancer cell resistance to camptothecin-like topoisomerase age sites. Mol Biol Cell 2011;22:2373–83. I inhibitors. Biochim Biophys Acta 2013;1835:11–27. 40. Kaina B, Christmann M, Naumann S, Roos WP. MGMT: key node in the 21. Wang Y, Zhu S, Cloughesy TF, Liau LM, Mischel PS. p53 disruption battle against genotoxicity, carcinogenicity and apoptosis induced by profoundly alters the response of human glioblastoma cells to DNA alkylating agents. DNA Repair 2007;6:1079–99. topoisomerase I inhibition. Oncogene 2004;23:1283–90. 41. Brent TP, Lestrud SO, Smith DG, Remack JS. Formation of DNA 22. Batista LF, Roos WP, Christmann M, Menck CF, Kaina B. Differential interstrand cross-links by the novel chloroethylating agent 2-chlor- sensitivity of malignant glioma cells to methylating and chloroethylat- oethyl(methylsulfonyl)methanesulfonate: suppression by O6-alkyl- ing anticancer drugs: p53 determines the switch by regulating xpc, guanine-DNA alkyltransferase purified from human leukemic lympho- ddb2, and DNA double-strand breaks. Cancer Res 2007;67:11886–95. blasts. Cancer Res 1987;47:3384–7.

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5595

Tomicic et al.

42. Zheng H, Wang X, Warren AJ, Legerski RJ, Nairn RS, Hamilton JW, recombination and translesion DNA synthesis. Mol Cell 2005;20: et al. Nucleotide excision repair- and polymerase eta-mediated error- 793–9. prone removal of mitomycin C interstrand cross-links. Mol Cell Biol 47. McIlwraith MJ, Vaisman A, Liu Y, Fanning E, Woodgate R, West SC. 2003;23:754–61. Human DNA polymerase eta promotes DNA synthesis from strand 43. Albertella MR, Green CM, Lehmann AR, O'Connor MJ. A role for invasion intermediates of homologous recombination. Mol Cell polymerase eta in the cellular tolerance to cisplatin-induced damage. 2005;20:783–92. Cancer Res 2005;65:9799–806. 48. Sneeden JL, Grossi SM, Tappin I, Hurwitz J, Heyer WD. Reconstitution 44. Chen YW, Cleaver JE, Hanaoka F, Chang CF, Chou KM. A novel role of of recombination-associated DNA synthesis with human proteins. DNA polymerase eta in modulating cellular sensitivity to chemother- Nucleic Acids Res 2013;41:4913–25. apeutic agents. Mol Cancer Res 2006;4:257–65. 49. Soria G, Belluscio L, van Cappellen WA, Kanaar R, Essers J, Gottifredi 45. Mogi S, Butcher CE, Oh DH. DNA polymerase eta reduces the gamma- V. DNA damage induced Pol eta recruitment takes place independently H2AX response to psoralen interstrand crosslinks in human cells. Exp of the cell cycle phase. Cell Cycle 2009;8:3340–8. Cell Res 2008;314:887–95. 50. Tucker MA, Meadows AT, Boice JD Jr., Stovall M, Oberlin O, Stone BJ, 46. Kawamoto T, Araki K, Sonoda E, Yamashita YM, Harada K, Kikuchi et al. Leukemia after therapy with alkylating agents for childhood K, et al. Dual roles for DNA polymerase eta in homologous DNA cancer. J Natl Cancer Inst 1987;78:459–64.

5596 Cancer Res; 74(19) October 1, 2014 Cancer Research

Translesion Polymerase η Is Upregulated by Cancer Therapeutics and Confers Anticancer Drug Resistance

Maja T. Tomicic, Dorthe Aasland, Steffen C. Naumann, et al.

Cancer Res 2014;74:5585-5596. Published OnlineFirst August 14, 2014.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-14-0953

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2014/08/16/0008-5472.CAN-14-0953.DC1

Cited articles This article cites 50 articles, 20 of which you can access for free at: http://cancerres.aacrjournals.org/content/74/19/5585.full#ref-list-1

Citing articles This article has been cited by 4 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/74/19/5585.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/74/19/5585. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.