University of Florida Thesis Or Dissertation Formatting

CHARACTERIZATION OF GUARD CELL PROTEOME AND STRESS HORMONE SIGNAL TRANSDUCTION

MENGMENG ZHU

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA 2011

In memory of my beloved grandpa

ACKNOWLEDGMENTS

My special thanks and appreciation must go to my academic committee throughout the time that took me to complete the dissertation research. Dr. Sixue Chen, as my supervisor and committee chair, has inspired me to work hard and make progress in research and to keep improving myself as a scientist. His care and understanding of me being an international student have facilitated my study and living in the U.S.A. The other members, Dr. Alice C. Harmon, Dr. Julie A. Maupin-Furlow and

Dr. David G. Oppenheimer have generously given their expertise and encouragement in different aspects of my research. I thank them for their great contribution and support.

Dr. Brigitte L. Simons from AB Sciex Inc., Drs. Sarah M. Assmann and Xiaofen Jin from Pennsylvania State University, and Drs. Wen-yuan Song and Qiang Chen in Plant

Pathogen Department are acknowledged for their help and collaboration in this project.

Technical support was provided by Divisions of Proteomics, Sanger Sequencing and

Hybridoma at the Interdisciplinary Center for Biotechnology Research, University of

Florida.

I am grateful to many people who have provided help during my Ph.D. training, especially Ning Zhu, Dr. Shaojun Dai, Marjorie Chow, Dr. Cecilia Silva-Sanchez, Dr.

Yan He, Jennifer Parker, Yazhou Chen, Carolyn Diaz, and other lab members and all of my friends. My parents, Guohua Zhu and Mei Feng, and my roommate Dr. Qiang Chen are specially thanked for their encouragement and emotional support.

This work was funded by a faculty start up fund from University of Florida, the

National Science Foundation (MCB 0818051) and the National Institute of Health

(1S10RR025418-01) to Sixue Chen. My thanks also go to the Ph.D. program of Botany in Biology Department, University of Florida, for providing financial support. 4

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... 4

LIST OF TABLES ...... 8

LIST OF FIGURES ...... 9

LIST OF ABBREVIATIONS ...... 11

ABSTRACT ...... 13

CHAPTER

1 INTRODUCTION AND LITERATURE REVIEW ...... 15

Stomata: the First Line of Plant Interaction with the Environment ...... 15 Hormone Interactions in Guard Cells ...... 17 Abscisic Acid (ABA) Signaling Pathway in Guard Cells ...... 17 Methyl Jasmonate (MeJA) Signaling Pathway in Guard Cells ...... 23 Other Hormones in Stomatal Function ...... 27 Regulative Mechanisms Underlying Stomatal Movement ...... 29 Phosphorylation/Dephosphorylation ...... 29 Thiol-based Redox Regulation ...... 37 Conclusions and Project Objectives ...... 41

2 COMPARATIVE PROTEOMICS PROVIDES EVIDENCE FOR CROSSTALK BETWEEN ABA AND MEJA SIGNAL TRANSDUCTION IN GUARD CELLS ...... 50

Introduction ...... 50 Material and Methods ...... 54 Plant Growth ...... 54 Preparation of Guard Cell Protoplasts and Mesophyll Cell Protoplasts ...... 54 Stomatal Bioassays ...... 55 Protein Extraction, Digestion, 8-plex iTRAQ Labeling and Fractionation ...... 56 Reverse Phase HPLC and Tandem Mass Spectrometry...... 56 Protein Identification and Relative Quantitation ...... 57 Promoter Analysis and Interactive Network Assessment ...... 58 Results ...... 58 Proteins Preferentially Expressed in Guard Cells Imply Functional Differentiation of Leaf Cell Types ...... 58 Guard cell isolation for proteomics ...... 58 Protein identification by off-line 2D HPLC-MS/MS ...... 59 Identification of proteins preferentially expressed in guard cells and mesophyll cells ...... 61

ABA and MeJA both Induce Stomatal Closure in Canola Associated with ROS Production ...... 63 Identification of ABA Responsive Proteins Improves Understanding of the Signal Transduction in Guard Cells ...... 64 Up-regulated proteins in guard cells under ABA treatment ...... 65 Down-regulated proteins in guard cells under ABA treatment...... 67 Promoter analysis of the gene homologs in Arabidopsis ...... 69 Identification of MeJA Responsive Proteins in Guard Cells Reveals Crosstalk in Plant Hormone Signaling Pathways ...... 71 Identification of MeJA responsive proteins in Brassica napus guard cells . 72 Promoter and functional network analysis of the homologous genes in Arabidopsis ...... 77 Discussion and Conclusion ...... 78

3 REDOX REGULATORY MECHANISMS IN GUARD CELL ABA AND MEJA SIGNALING PATHWAYS ...... 119

Introduction ...... 119 Material and Methods ...... 121 Plant Growth, Guard Cell Protoplast Preparation, and Hormone Treatment .. 121 Stomatal Aperture Measurement ...... 122 Reactive Oxygen Species Detection in Guard Cells ...... 122 Protein Extraction and ICAT Labeling ...... 123 Saturation DIGE Labeling, 2DE and Protein Digestion ...... 123 Reverse Phase Nanoflow HPLC, Tandem Mass Spectrometry and Protein Identification ...... 125 Data Analysis ...... 126 Results and Discussion...... 126 B. napus Guard Cells for Redox Proteomics ...... 126 Guard Cell Redox Responsive Proteins in ABA Signaling ...... 127 Redox Responsive Proteins in MeJA Signaling ...... 133 Common Components and Mechanisms in ABA and MeJA Signaling Pathways...... 135 Complementary ICAT and Saturation DIGE Approaches for Redox Proteomics ...... 137 Conclusion ...... 138

4 FUNCTIONAL CHARACTERIZATION OF A BRASSICA NAPUS SNRK2 ...... 156

Introduction ...... 156 Materials and Methods...... 158 RNA Extraction, Reverse Transcription and PCR ...... 158 Recombinant Protein Expression and Purification ...... 159 In vitro In-solution Kinase Assay ...... 160 Results ...... 160 The Serine/Threonine Protein Kinase Belongs to SnRK2 Subfamily ...... 160

Recombinant BnSnRK2 Requires Mn2+ for in vitro Autophosphorylation Activity with Multiple Phosphorylation Sites...... 161 BnSnRK2 Preferentially Phosphorylates Myelin Basic Protein and Casein in vitro ...... 163 In vitro BnSnRK2 Kinase Activity is Redox Regulated ...... 164 Cysteines of BnSnRK2 Contribute to the Redox Regulation ...... 167 Conclusions and Future Work ...... 167

5 SUMMARY AND PERSPECTIVES ...... 187

LIST OF REFERENCES ...... 191

BIOGRAPHICAL SKETCH ...... 222

LIST OF TABLES

Table page

1-1 Protein components of ABA and MeJA signaling pathways in Arabidopsis guard cells ...... 44

2-1 Proteins predominantly expressed in guard cells ...... 85

2-2 Proteins predominantly expressed in mesophyll cells ...... 88

2-3 List of proteins significantly up-regulated in guard cells by ABA...... 94

2-4 List of proteins significantly down-regulated in guard cells by ABA...... 97

2-5 Sequence enriched in upstream regions of the genes encoding proteins with more than 1.5-fold change in response to ABA ...... 99

2-6 List of proteins significantly up-regulated in guard cells by MeJA ...... 100

2-7 List of proteins significantly down-regulated in guard cells by MeJA ...... 104

2-8 Motif analysis of genes encoding the MeJA responsive proteins (upstream 500bp) ...... 107

3-1 Redox responsitive proteins identified in B. napus guard cells under ABA treatment ...... 140

3-2 Redox sensitive proteins identified in B. napus guard cells under MeJA treatment ...... 144

4-1 Primers used in this study...... 171

LIST OF FIGURES

Figure page

1-1 Updated ABA signaling pathways in guard cells...... 46

1-2 Double negative regulatory module in the ABA signal transduction in guard cells (Umezawa et al., 2010) ...... 47

1-3 A simple model of the signaling interaction between ABA and MeJA in Arabidopsis guard cells ...... 48

1-4 Redox-active cysteines are sensitive to oxidation ...... 49

2-1 Isolation of guard cell protoplasts from B. napus leaves ...... 110

2-2 Classification of the 1458 identified proteins into molecular functions ...... 111

2-3 Representative MS/MS spectra showing protein identification and relative quantification in guard cells (iTRAQ tag 114) and mesophyll cells (iTRAQ tag 116) ...... 112

2-4 Scatter plot of the ratio of GC/MC at the mRNA level and protein level ...... 113

2-5 Effect of diphenyleneiodonium (DPI), catalase (CAT) and ascorbic acid (ASC) on ABA/MeJA-induced stomatal closure and H2O2 production ...... 114

2-6 Classification of ABA increased and decreased proteins into biological functions ...... 115

2-7 Total protein identification from complementary mass spectrometry platforms 116

2-8 Classification of MeJA increased and decreased proteins into biological functions ...... 117

2-9 The involvement of the MeJA responsive components in response to other stress factors ...... 118

3-1 Complimentary approaches of saturation DIGE and ICAT used to identify redox sensitive proteins in response to the ABA or MeJA treatment...... 151

3-2 Functional classification of redox sensitive proteins in guard cells under ABA (A) and MeJA (B) treatment ...... 152

3-3 Example of redox protein identification using DIGE approach ...... 153

3-4 Example of redox protein identification and cysteine mapping using ICAT approach ...... 154

3-5 Venn diagram of guard cell thiol proteins responsive to ABA and MeJA identified by ICAT and saturation DIGE ...... 155

4-1 Phylogenetic tree of BnSnRK2 and related kinases in green plants ...... 173

4-2 Comparison of the amino acid sequence of BnSnRK2 with sequences of other protein kinases ...... 174

4-3 Effect of cation on SnRK2 autophosphorylation and phosphorylation activities...... 175

4-4 Optimization of Mn2+ concentrations in SnRK activity assay ...... 176

4-5 Phosphorylation of Ser158 is required for BnSnRK2 kinase activity ...... 177

4-6 Ser154 and Ser172 are phosphorylated to maintain the BnSnRK2 activity ...... 178

4-7 SnRK2 specifically phosphorylates myelin basic protein (MBP) and β-casein in vitro ...... 179

4-8 Effects of H2O2, S-nitrosoglutathione (GSNO), and oxidized glutathione (GSSG) on the autophosphorylation activity of BnSnRK2 in vitro...... 180

4-9 Effect of DTT on the autophosphorylation activity of SnRK2 treated with H2O2, GSNO (S-nitrosoglutathione), and GSSG (oxidized glutathione)...... 181

4-10 Effect of thioredoxin on the autophosphorylation activity of SnRK2 treated with GSNO and H2O2 ...... 182

4-11 Effect of thoredoxin f, h and m on the autophosphorylation activity of SnRK2 treated with GSSG...... 183

4-12 Redox titration of autophosphorylation activity of SnRK2 with DTT ...... 184

4-13 The autophosphorylation activity of SnRK2 is sensitive to the redox status ..... 185

4-14 Effect of oxidants on autophosphorylation activity of BnSnRK2 C142A mutant 186

LIST OF ABBREVIATIONS

ABA Abscisic acid

ATP Adenosine triphosphate bp Base pair

BSA Bovine serum albumin cDNA Complementary DNA

DIGE Differential gel electrophoresis

DNA Deoxyribonucleic acid

DTT Dithiothreitol

EDTA Ethylenediaminetetraacetic acid

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GSNO S-nitrosoglutathione

GSSG Oxidized glutathione h Hour

HILIC Hydrophilic interaction liquid chromatography

HPLC High performance liquid chromatography

IAM Iodoacetamide

ICAT Isotope coded affinity tag iTRAQ isobaric tag for relative and absolute quantitation kD KiloDalton

LB Lysogeny broth

LC Liquid chromatography

M Molarity

MeJA Methyl jasmonate min Minute

MS Mass spectrometry m/z Mass to charge

NADPH Nicotinamide adenine dinucleotide phosphate hydrate

NO Nitric oxide

PAGE Polyacrylamide gel electrophoresis

PBS Phosphate buffered saline

PCR Polymerase chain reaction ppm Parts per million qRT-PCR Quantitative reverse transcription-polymerase chain reaction

RNA Ribonucleic acid

RNase Ribonuclease

ROS Reactive oxygen species rpm Revolutions per minute s Second

SCX Strong cation exchange

SDS Sodium dodecyl sulfate

SNP Sodium nitroprusside

Tm Melting temperature

TCEP Tris-2-carboxyethyl-phosphine

UV Ultraviolet var. Variety

2D Two dimensional

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF GUARD CELL PROTEOME AND STRESS HORMONE SIGNAL TRANSDUCTION

Mengmeng Zhu

December 2011

Chair: Sixue Chen Major: Botany

Plants are sessile organisms on earth. During millions of years of evolution, plants have developed elaborate mechanisms to perceive and integrate signals from various environmental conditions. On the leaf surface, especially the lower epidermis, a structure called stoma is formed by a pair of guard cells, which controls gas exchange and transpiration as well as functions as the first line of defense against abiotic and biotic stresses. It has been observed that stomatal closure can be induced by drought, pathogens, wounding and other stresses. This is an instant defense mechanism employed by plants to prevent further damage by exogenous factors. Abscisic acid

(ABA) is a major plant hormone that regulates leaf desiccation, seed dormancy and germination, and it plays a role in plant stress responses. ABA synthesis is activated upon water deficiency, and the elevated ABA level causes stomatal closure and prevents stomatal opening to reduce water loss and cell dehydration. The key regulatory receptor complex and other important components in the ABA signaling

2+ pathway, such as reactive oxygen species (ROS) and cytosolic calcium ([Ca ]cyt) oscillation have been identified in the past decades. However, our knowledge of ABA

13 signal transduction in guard cells is still far from complete. Another group of phytohormones, jasmonates, was firstly characterized through the purification of methyl jasmonate (MeJA) from the jasmine flower. Besides participating in the reproductive process, jasmonates are generally believed to be important for plant defense against insects and necrotrophic pathogens. The increased levels of MeJA induced by herbivory and pathogen invasion have a similar effect on stomatal movement associated with

ROS production as ABA. Due to the presence of ROS as a messenger in the ABA and

MeJA signaling pathways in guard cells, crosstalk between them has been proposed, and a signaling network involving the two phytohormones in guard cells is intriguing.

Information about protein and metabolite components in the network is largely unknown.

To address this important knowledge gap, proteomic analyses have been conducted using canola (Brassica napus cultivar Global) guard cells to identify the protein components responsive to the two hormones and characterize the underlying regulatory mechanism. The proteomics data presented here not only support the crosstalk hypothesis but also set up an stage of potential candidates for bioengineering towards enhanced stress tolerance. Furthermore, a hormone-responsive serine/threonine protein kinase was characterized from a biochemical perspective. The autophosphorylation activity of the recombinant kinase is under redox regulation in vitro.

This finding highlights the phosphorylation switches in guard cell signal transduction and a novel link between the two regulatory mechanisms, i.e., phosphorylation/dephosphory

-lation and redox regulation.

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

Stomata: the First Line of Plant Interaction with the Environment

The importance of water to terrestrial plants can never be over emphasized just by simply looking at the molecular composition of a typical plant cell. Water makes up a large portion of the cell volume, and directly participates in essential biochemical reactions and physiological processes. However, land plants are constantly challenged by dehydration, which led to the evolution of vascular plant structures including an extensive root system to extract water from the soil, a low resistance pathway through the xylem for water transport, a hydrophobic cuticle covering the leaf surface to reduce evaporation, and microscopic stomatal structure to control gas exchange and transpiration (Taiz and Zeiger, 2006). The need for water conservation and carbon dioxide (CO2) uptake poses a dilemma for plants, especially when the two processes are controlled by the same structure, stomata on leaf surface. On one hand, plants need ready access to the atmosphere to obtain CO2 for photosynthesis, a process of organic carbon production for growth, development and yield. On the other hand, the large leaf surface area aggravates the problem of water loss and dehydration through stomatal transpiration. To survive, plants must delicately modulate stomatal movement to balance water conservation and carbon sequestration, especially under the current challenges of climate change and global warming.

Stomata are microscopic pores located in greater numbers on the lower side of the leaf, serving as the outward water gate and inward CO2 valve. Stomata first appeared in terrestrial land plants over 400 million years ago (Hetherington and Woodward, 2003).

Considering the change of atmospheric components, i.e., CO2 concentration increase

15 and emergence of new plant groups such as ferns and angiosperms, guard cells are showing considerable morphological diversity. The two major distinctive types include dumbbell-shaped guard cells typically found in grasses and a few monocots, whereas the kidney-shaped guard cells are commonly seen in dicotyledonous plants and non- grass monocots. It is noteworthy that the subsidiary cells are often absent in the species with kidney-shaped guard cells, in which case the guard cells are surrounded by ordinary epidermal cells. One of the guard cell structural features includes the specialized alignment of cellulose microfibrils, which contributes to its function. The microfibrils are arranged radially from the pore, making the cell girth reinforced like a steel-belted radial tire. This organization of microfibrils offers the least resistance when guard cells curve outward during stomatal opening (Taiz and Zeiger, 2006). In addition, multiple ion channels, such as K+ inward- and outward-rectifying channels, Ca2+ channels and anion channels distributed on the plasma membrane and vacuole membrane are coordinated to regulate the ion influx and efflux, thus the „turgidity‟ of guard cells (Assmann, 1993). Furthermore, previous studies that focused on guard cells metabolism and response to environmental signals have revealed important features of functional differentiation of guard cells (Assmann, 1993; Vavasseur and Raghavendra,

2005). Compared to mesophyll cells, guard cells contain fewer chloroplasts with limited structures and thus possess very low photosynthetic capability. The Calvin cycle in guard cells only assimilates 2-4% of CO2 fixed in mesophyll cells (Outlaw and De

16 distinguished features, e.g., high activities of energy metabolism and solute transport are consistent with the guard cell specific functions. Guard cells clearly possess a robust machinery to perceive and transduce environmental signals and regulate stomatal movement.

Given the fact that the guard cells play an essential role in plant terrestrial adaptation, it is obviously important for us to understand the mechanisms within the tiny cells for improving agricultural productivity, especifically considering our current grand challenges of water shortage, global warming and climate change. Since guard cells do not have plasmadesmata, the adaptive responses to the environment are thus cell- autonomous (Sirichandra et al., 2009). These properties, together with the correlation between stomatal closure and many environmental conditions, such as water availability, make the stomatal guard cells an ideal system for investigating molecular mechanisms underlying plant responses to environmental factors.

Hormone Interactions in Guard Cells

Abscisic Acid (ABA) Signaling Pathway in Guard Cells

Great effort has been made in the last decades to identify the molecular components in abscisic acid (ABA) signal transduction in guard cells because ABA is a well documented stress hormone in plants that regulates water conservation through promoting stomatal closure and readjustment of cellular osmotic pressure to cope with prolonged dehydration (Shinozaki and Yamaguchi-Shinozaki, 2007; Sirichandra et al.,

2009). ABA is a terpenoid synthesized from carotenoid precursors and is inducible by drought, salinity and cold. ABA was first isolated from cotton and sycamore in the 1950s but the phytohormone is now known to be conserved in all plant species (Wasilewska et al., 2008). Besides functioning as a key player in response to drought, ABA plays

17 important roles in plant developmental processes, including cell division, seed maturation, seed dormancy and germination, and post-germination seedling growth

(Leung and Giraudat, 1998; Finkelstein and Gibson, 2002).

Water deficiency triggers ABA synthesis, accumulation, and redistribution in the plant body, including transport from roots to shoots in xylem. In addition, drought- induced pH increases in the apoplast favor the extracellular retention of the anionic form of ABA, which may facilitate ABA delivery to guard cells through the efficient apoplast pathway (Wilkinson and Davies, 2002). ABA reduces transpirational water loss by triggering stomatal closure and preventing stomatal opening, and this modulation of stomatal movement is associated with multiple cascades of cellular events (Figure 1-1).

Briefly, ABA is perceived by ABA receptors (Razem et al., 2006; Shen et al., 2006; Liu et al., 2007; Ma et al., 2009; Park et al., 2009) and induces stomatal closure via

2+ 2+ messengers that include reactive oxygen species (ROS), cytosolic Ca ([Ca ]cyt) and pH increases (Irving et al., 1992; Allen et al., 2000; Pei et al., 2000; Murata et al., 2001).

2+ 2+ [Ca ]cyt increase is due to Ca influx from outside of guard cells and its release from internal stores such as endoplasmic reticulum (ER). Ca2+ influx is mediated by Ca2+- permeable channels and prompted by ROS (Pei et al., 2000; Zhang et al., 2001). ABA- induced ROS production relies on NADPH oxidases (nicotinamide adenine dinucleotide phosphate-oxidase) downstream of the ABA-activated protein kinase, OPEN STOMATA

1 (OST1) (Mustilli et al., 2002; Kwak et al., 2003). ROS also promotes the synthesis of nitric oxide (NO), which in turn elicits Ca2+ release from internal stores (Desikan et al.,

2002; Neill et al., 2002; Garcia-Mata et al., 2003; Sokolovski et al., 2005; Bright et al.,

2006). Downstream components responding to cytosolic Ca2+ increase include vacuolar

K+-permeable channels, plasma membrane K+-influx channels and anion efflux channels, e.g., malate, chloride and nitrate. An increase in cytosolic pH promotes the opening of anion and K+ efflux channels in the plasma membrane (Colcombet et al.,

2005; Li et al., 2006). Guard cell volume reduction and stomatal closure occur upon water efflux induced by K+ and anion efflux, sucrose removal, and conversion of malate to osmotically inactive starch (Schroeder and Hedrich, 1989; MacRobbie, 1998).

Phosphatidic acid (PA) and ROS negatively regulate a protein phosphatase 2C (PP2C), which plays a role in inhibiting anion efflux and ROS production (Leung et al., 1997;

Gosti et al. 1999; Merlot et al., 2001).

Recent advancement has revealed more ABA signaling components in guard cells including ABA receptors. Hormone signaling must be initiated by the specific recognition of the hormone molecules by receptors. Although the search for the ABA receptors in plants was launched over 27 years ago since the report of ABA-binding proteins in the plasma membrane of Vicia faba guard cells (Hornberg and Weiler, 1984), almost all the early reported receptors are controversial. For example, the Mg-chelatase H subunit

(CHLH) was identified to be an ABA receptor in 2006 (Shen et al., 2006), but recently it was disputed that the Mg-chelatase complex only affects ABA signaling, but not serving the role of being a receptor (Tsuzuki et al., 2011). Nevertheless, the year 2009 marked a real breakthrough in guard cell ABA signal transduction due to the identification of the soluble ABA receptor, PYRABACTIN (4-Bromo-N-[pyridin-2-ylmethyl] naphthalene-1- sulfonamide) RESISTANCE (PYR)/PYRABACTIN RESISTANCE-LIKE

(PYL)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family and the

19 elucidation of their biochemical mode of action, so called double negative regulatory core (Park et al., 2009; Ma et al., 2009).

One of the strategies used to isolate novel components of early ABA signaling was to identify proteins interacting with PP2C because the PP2C ABA-INSENSITIVE 1

(ABI1) is known to function upstream of all known rapid signaling events. The dominant negative mutant abi1-1 shows ABA-insensitive stomatal conductance (Koornneef et al.,

1989; Leung et al., 1994), whereas loss-of-function recessive mutants of ABI1 show hypersensitivity in ABA-mediated stomatal response, leading to the conclusion that

ABI1 is a negative regulator of ABA signaling. In response to ABA, dominant abi1-1 mutants lost the ability to generate ROS, but the dominant ABA-insensitive abi2-1 mutant could generate ROS. Thus it has been proposed that ABI1 acts upstream of

ROS production and ABI2 downstream of ROS production in ABA signaling (Murata et al., 2001). RCAR1/PYR1-LIKE9 (PYL9) was identified in a yeast two-hybrid screen using the PP2C ABI2 as a bait (Ma et al., 2009), and a similar strategy using

HOMOLOGY TO ABI1 (HAB1) as a bait identified PYL5, PYL6, and PYL8 (Santiago et al., 2009). With an alternative strategy, PYR1 gene was identified using chemical genetics based on insensitivity to the synthetic ABA agonist pyrabactin (Park et al.,

2009). Purification of in vivo ABI1 complex from Arabidopsis led to the identification of nine of the 14 PYR/PYL/RCARs as the major interactors of ABI1 in planta (Nishimura et al., 2010). And the pyr1/pyl1/pyl2/pyl4 quadruple mutants showed a strong ABA insensitive phenotype in double-blinded ABA-induced stomatal closing and ABA inhibition of stomatal opening analyses (Nishimura et al., 2010). These multiple independent lines of evidence indicated that the previously uncharacterized

PYR/PYL/RCAR proteins are major early ABA signaling components. PYR/PYL/RCARs are small soluble proteins belonging to the START/Bet v I superfamily and they contain a central hydrophobic ligand-binding pocket (Iyer et al., 2001). The Arabidopsis thaliana genome encodes 14 PYR/PYL/RCAR proteins that are highly conserved at the protein sequence level. The identification of this new class of ABA signaling proteins has shed light in the plant hormone signaling field, providing new avenues of research into ABA signal transduction. For example, after the crystallization of the ABA receptor, the action mechanism has started to emerge. Direct ABA binding to PYR/PYL/RCARs was subsequently established through the elucidation of PYR1, PYL1, and PYL2 crystal structures in the presence of ABA (Melcher et al., 2009; Miyazono et al., 2009; Santiago et al., 2009; Yin et al., 2009; Nishimura et al., 2010). It was established that

PYR/PYL/RCARs consist of homodimers with each subunit binding to ABA. The binding of ABA results in the dissociation of the dimer, introducing conformational changes of

PYR/PYL/RCARs. This creates a new surface for PP2Cs to interact with the receptor, and consequently the interaction inhibits the phosphatase activity of PP2Cs by blocking the access of their substrates to the catalytic center since the acting interface between

ABA-bound PYR/PYL/RCARs and PP2Cs is located at the PP2C active site.

As we understand how PYR/PYL/RCARs function through ABA-dependent inhibition of PP2C activity, the targets of PP2Cs in the signaling pathway become intriguing. To date, one of the best characterized PP2C target is the OPEN STOMATA 1

(OST1), a serine/threonine kinase with high homology to ABA-activated protein kinases

(AAPKs) found in V. faba (Li and Assmann, 1996). OST1 is a positive regulator in the

ABA signaling pathway under the regulation of the complex formed by ABA receptor

21 and phosphatase PP2C (Lee et al., 2009). With the presence of the hormone molecule binding to the receptor PYR/PYL/RCAR, the phosphatase is deactivated, which in consequence keeps the phosphorylated status of OST1 in an active form (Figure 1-2).

The substrates of OST1 identified so far include NADPH oxidase located on plasma membrane, S-type anion channel (SLAC1), inward-rectifying potassium channel (KAT1) and transcription factors such as ABSCISIC ACID RESPONSIVE ELEMENTS-BINDING

FACTOR 3 (ABF3) although the regulatory mechanisms may vary (Geiger et al., 2009;

Sato et al., 2009; Sirichandra et al., 2009; Sirichandra et al., 2010). Overall, the receptor, PP2C and OST1 form a double negative regulatory complex at the initial stage of ABA signaling pathway in guard cells to convey the signal to the downstream components, leading to the physiological output of stomatal movement.

Although key regulatory events in the ABA signaling pathway have been unraveled

(Table 1-1), the complete molecular networks, including nodes, edges and the regulatory mechanisms remain to be determined. For example, the structural details of the receptors imply the formation of homodimer without binding to ABA but the interaction with PP2C occurs on the receptor monomer with an ABA molecule, which implies the correlation of the complex formation with the dimer dissociation. However, it is not clear whether the receptor-PP2C complex formation precedes the homodimer dissociation or vice versa. The protein/hormone ratio or concentration in vivo could be balanced to tune the equilibrium for homodimer association/dissociation, thus appropriately respond to the environmental stimulus (Hubbard et al., 2010). In addition, the in vitro interaction of PYR/PYL/RCARs-PP2C has been intensively investigated and the interactions observed, for instance, ABI1 forms complexes with PYR1, PYL1, PYL8

22 and PYL9 (Ma et al., 2009; Miyazono et al., 2009; Park et al., 2009; Yin et al., 2009), may not represent those in vivo. The specificity of PYR/PYL/RCAR and PP2C complexes need to be determined in relation to different biochemical/physiological processes since many different homologs exist in the genome. Additionally, PP2C is known to target OST1 to regulate the activity of the kinase for downstream activation.

However, other targets of PP2C other than OST1 need to be explored. And the observation that OST1 can be activated by osmotic stress in the PP2C dominant negative mutants indicates the inhibition of the dephosphorylation activity is not the only strategy to activate OST1 (Yoshida et al., 2006). Other models, e.g., the existence of upstream kinases should be further tested. Other questions to be addressed include, but not exclusively, the relationships between the central regulatory module and other signaling intermediates, such as ion channels, ROS/NO production, Ca2+ oscillation and transcriptional responses. Recently Wang and his colleagues applied “omics” approach to discover common and unique elements of the ABA-regulated transcriptome of

Arabidopsis guard cells and found 1173 ABA responsive genes (696 ABA-induced and

441 ABA-repressed) out of around 24,000 profiled genes (Wang et al., 2011). This work set the stage for targeted gene functional characterization and further biotechnological manipulation to improve plant water use efficiency.

Methyl Jasmonate (MeJA) Signaling Pathway in Guard Cells

ABA is often categorized as a phytohormone closely related to abiotic stresses, while jasmonate (JA) is often recognized more as a biotic stress hormone since this group of plant hormones mediate plant defense responses against necrotrophic pathogen and insects (Liechti and Farmer, 2002; Fujita et al., 2006). Besides the roles in biotic stress, the lipid-derived plant hormone also participates in the regulation of 23 vegetative and reproductive growth, and defense responses against abiotic stresses, e.g., UV light and ozone (Katsir et al., 2008). Since the first report of MeJA-induced stomatal closure (Gehring et al., 1997) and the observation of JA accumulation during drought (Creelman and Mullet, 1997), JA has been proposed to play an important role in stomatal movement under stress conditions.

Although both ABA and MeJA are positive regulators of stomatal closure, knowledge on how MeJA and ABA signaling pathways interact and function in guard cells is lacking. The function of the jasmonate coreceptor CORONATINE INSENSITIVE

1 (COI1), encoding an F-box protein, together with JASMONATE ZIM-DOMAIN (JAZ) co-receptor were known for efficient ligand binding (Xie et al., 1998; Thines et al., 2007;

Katsir et al., 2008; Sheard et al., 2010). Due to the receptor specificity of each hormone, the divergence between the ABA and MeJA signal pathways can be reasonably predicated. However, the MeJA-mediated stomatal closure has been found to involve guard cell cytoplasmic alkalinization, ROS production via NADPH oxidase subunits

AtrbohD/F (Suhita et al., 2004), NO production (Munemasa et al., 2007; Saito et al.,

2009), and activation of K+ efﬂux channels (Evans, 2003) and slow anion channels

(Gehring et al., 1997; Suhita et al., 2003), which are processes common to ABA signaling. In detail, NADPH oxidase-mediated ROS production is necessary for activation of calcium permeable non-selective cation channels (ICa channels) by ABA and MeJA. Cytosolic Ca2+ elevation is involved in ABA- and MeJA-induced stomatal closure via S-type anion channel activation of guard cell plasma membrane and a regulatory subunit of protein phosphatase 2A, RCN1(ROOT CURLING IN N-

NAPHTHYLPHTHALAMIC ACID 1) regulates both MeJA signaling and ABA signaling in

24 guard cells (Murata et al., 2001). These lines of evidence suggest crosstalks between

ABA and MeJA signaling pathways in guard cells (Figure 1-3 and Table 1-1). This hypothesis is further supported by observation of MeJA hyposensitivity of stomatal closure in the ost1 (ABA hyposensitive) mutant, and reduced ABA-mediated stomatal closure in the jar1 (jasmonate resistant 1, MeJA insensitive) mutant (Suhita et al.,

2004). MeJA-induced stomatal closure was also studied in the ABA-insensitive PP2C mutant, abi2-1. In this mutant, no stomatal closure was observed in response to either

MeJA or ABA, but production of ROS and NO were retained (Munemasa et al., 2007).

All together, COI1 functions upstream of ROS and NO in MeJA but not ABA signaling, while ABI2 functions downstream of ROS and NO after the MeJA- and ABA-signaling pathways have converged. The activation of transcription factors are known to be the downstream events in the ABA signal transduction (Abe et al., 2003). Thus one more evidence came from the demonstration that the basic helix-loop-helix (bHLH) transcription factor AtMYC2, which was originally identified as a transcriptional activator in the ABA-mediated drought stress pathway, is involved in the JA signal transduction

(Abe et al., 2003; Lorenzo et al., 2004).

Interestingly, myrosinase-glucosinolate system has recently been demonstrated to be a novel component in ABA signaling in guard cells (Zhao et al., 2008). TGG1 encodes a myrosinase that is highly expressed in guard cells (Husebye et al., 2002;

Zhao et al., 2008). TGG1 was found to be involved in inhibition of light-induced stomatal opening by ABA, but not in ABA-induced stomatal closure (Zhao et al., 2008). Two functional myrosinase genes, TGG1 (At5g26000) and TGG2 (At5g25980), have been found to express at high levels in Arabidopsis shoots and they have redundant function

25 in glucosinolate hydrolysis (Barth and Jander, 2006). Recent work by Murata group suggests that the two myrosinases function downstream of ROS production and upstream of cytosolic Ca2+ elevation in ABA and MeJA signaling in guard cells (Islam et al., 2009). They have also provided evidence showing one of the glucosionlate degradation products, isothiocyanate can induce stomatal closure, which requires MeJA priming, but not ABA priming (Khokon et al., 2011a). Additionally, Lackman and colleagues have identified a tobacco gene, NtPYL4 encoding a protein with high homology to the PYR/PYL/RCAR family ABA receptors in Arabidopsis and it is involved in JA signaling (Lackman et al., 2011). Furthermore, recent transcriptomic analysis of

ABA responsive genes in Arabidopsis guard cells has also provided evidence for the crosstalks at transcriptional level between ABA and MeJA (Wang et al., 2011).

The evidence for the signaling crosstalk between ABA and MeJA is not limited on the molecular basis but also found in genetic and physiological experiments. Drought is known to alter the balance of different hormones (Dodd and Davies, 2010). To address the role of ABA in JA-mediated stomatal regulation, the JA-mediated stomatal response has been studied in ABA-biosynthetic tomato mutant sitiens. When the petioles of the sitiens leaves were incubated in JA, no stomatal movement was observed; however, stomatal closure is triggered by JA when the petioles were pretreated with ABA (Herde et al., 1997). This suggests that ABA is required by the JA-mediated stomatal response in tomato. In soybean, exogenous application of MeJA did not affect endogenous ABA levels, but water-stressed barley seedlings pretreated with JA showed more than 4-fold accumulation of ABA in comparison to water stressed-barley seedlings without pretreatment with JA. This indicates a role for JA in ABA biosynthesis under water

26 stress conditions (Bandurska et al., 2003). Many drought-responsive genes are regulated by MeJA and several MeJA-regulated, drought-responsive genes are also regulated by ABA with similar expression dynamics (Nemhauser et al., 2006; Huang et al., 2008). These data support that common signaling components are employed by

ABA and MeJA. However, unique components and regulatory mechanisms underlying each pathway of hormone signaling need to be further explored.

Other Hormones in Stomatal Function

Several other hormones, including salicylic acid (SA), auxins, cytokinins, ethylene and brassinosteroids (BRs) are also involved in the regulation of stomatal movement but the modes of action vary. Generally, BRs and SA are positive regulators triggering stomatal closure like ABA and JA, whereas cytokinins and auxins are positive regulators for stomatal opening (Lohse and Hedrich, 1992; Manthe et al., 1992; Lee, 1998; Mori et al., 2001; Wilkinson and Davies, 2002; Haubrick et al., 2006). Interestingly, ethylene alone promotes stomatal closure, whereas ethylene in concert with other hormones opposes stomatal closure. This dual regulatory role of ethylene on stomatal movement can be observed in a species and/or condition dependent manner (Jackson, 2002; Dat et al., 2004; Acharya and Assmann, 2009). Although gibberellins (GAs) modulate expression levels of drought-related genes like ABA, JA, auxins, cytokinins, ethylene and BRs, little or no effect was observed on the stomatal movement in Arabidopsis when GA was applied exogenously (Nemhauser et al., 2006; Tanaka et al., 2006;

Huang et al., 2008). Additional evidence also suggests GAs may not play critical roles in controlling stomatal aperture during water stress (Cramer et al., 1995).

Although the effect of each hormone on stomatal biology was often studied independently, it is believed that different hormones regulate plant responses to biotic 27 and abiotic stresses via synergistic and antagonistic mechanisms (Fujita et al., 2006).

For instance, interaction of auxin, cytokinins, or ethylene with ABA inhibits ABA-induced stomatal closure (Tanaka et al., 2006). Additionally, interaction of ABA and SA positively regulates stomatal closure to impede invasion of bacterial pathogens (Melotto et al.,

2006). However, such observations using exogenous hormone treatment may not reflect the effects of changes in endogenous hormone levels. In addition, despite recent progress on hormonal control of stomatal function, many questions remain unanswered.

Many plant hormonal responses are developmental in nature, whereas hormonal regulation of stomatal movement is a reversible, non-developmental process. Whether the subcellular targets of hormones discovered in guard cells (e.g., ion channels) are also cellular targets of hormonal regulation in the developmental processes and whether they are cell type specific are not known. The molecular switches in regulation that allow quick response of guard cells to changes in the environment remain to be a key question. Additional questions include whether stomatal regulatory mechanisms, which to date have been explored primarily in dicot species, prevail in other species as well, and in particular whether they occur in the graminaceous species with their unique guard cell morphology and dominance in agroecosystems. The concerted application of molecular, genetic, cell biology and biochemical approaches including modern “omics” technologies is anticipated to significantly advance our knowledge of guard cell signal transduction and system biology. The improved knowledge will contribute positively toward future biotechnology of enhanced plant yield and bioenergy.

Regulative Mechanisms Underlying Stomatal Movement

Phosphorylation/Dephosphorylation

Although plant hormones have been discovered for a long time, relatively little is known about their mechanisms of action at the protein level. The evolution of protein kinases/phosphatases indicates the phosphorylation/dephosphorylation switch dominates signal transduction processes in higher plants (Stone and Walker, 1995;

Luan, 2003). The reaction of transferring phosphate groups from high-energy donor molecules, such as ATP, to specific substrates is referred as phosphorylation and catalyzed by a kinase, alternatively known as a phosphotransferase. The reverse process, i.e., the removal of the phosphate group, known as dephosphorylation is catalyzed by another group of enzymes named phosphatases (Burnett and Kennedy,

1954). Such reactions occur on certain amino acid residues, such as histidine and aspartic acid in the two-component phosphotransfer system more commonly seen in bacteria, as well as serine, threonine and tyrosine typical for eukaryotes (Hanks and

Hunter, 1995; West and Stock, 2001). Undoubtedly such reversible protein modifications play a significant role since it could activate or deactivate target proteins with diverse functions, in a way similar to “on or off switches” (Mundy and Schneitz,

2002).

Prior to molecular identification of any kinases or phosphatases with functions in guard cells, early evidence has already suggested ion channels and H+ pump are targets of phosphorylation/dephosphorylation regulation in guard cells. For example, it has been reported the plasma membrane H+ pump in Vicia faba guard cells, which was activated by blue light, was inhibited by an inhibitor of myosin light-chain kinase

(Shimazaki et al., 1992). The activities of inward- and outward-rectifying K+ channels

29 were affected by protein phosphatase inhibitors (Li et al., 1994; Thiel and Blatt, 1994;

Armstrong et al., 1995). In late 1990s, direct evidence of the presence of protein kinases and protein phosphatases in guard cells was obtained through identification of an ABA-activated protein kinase (AAPK) in V. faba guard cells (Li and Assmann, 1996;

Mori and Muto, 1997). The 48 kD ABA-activated and Ca2+-independent protein kinase was discovered using in-gel kinase assay and the peptide information was obtained using mass spectrometry (Li et al., 2000). The functional characterization of AAPK suggests that the kinase is activated by ABA in vivo and it regulates the anion channels to induce stomatal closure (Li et al., 2000). It is noteworthy that a study by Mori and

Muto (1997), a 53 kD ABA-activated and Ca2+-dependent protein kinase was proposed to be the activator of AAPK (Mori and Muto, 1997). Ever since, more kinases have been found to function in guard cell physiology largely due to the advances in modern technologies. The discovery of an Arabidopsis serine/threonine kinase, known as OST1, acting upstream of ROS production in ABA signaling is a landmark of such progress

(Mustilli et al., 2002). OST1 belongs to the sucrose non-fermenting 1 (SNF1) related kinase 2 (SnRK2) subfamily and the members in the SnRK2 family are mainly involved in plant stress response and tolerance (Harmon, 2003; Halford and Hey, 2009).

Intensive studies have been conducted to characterize OST1 function, including its upstream activating kinase, downstream phosphorylation targets and interacting partners. To date, the upstream kinase remains elusive. However, the 53 kD ABA- activated and Ca2+-dependent protein kinase identified from V. faba guard cells is a likely candidate since the AAPK is highly homologous to OST1 (Mori and Muto, 1997;

Assmann, 2003). In contrast, studies on the OST1 targets have been fruitful. To date,

30 the identified OST1 substrates include NADPH oxidase, S-type anion channel (SLAC1), inward-rectifying potassium channel (KAT1) and transcription factors such as ABF3

(Geiger et al., 2009; Sato et al., 2009; Sirichandra et al., 2009; Sirichandra et al., 2010).

The regulatory domain of OST1 was found to interact with phosphatase ABI1 and integrate ABA and osmotic stress signals to regulate stomatal closure in Arabidopsis

(Yoshida et al., 2006; Vlad et al., 2009). When ABA binds its receptor PYR/PYL/RCAR, the phosphatase is deactivated, thus maintain the phosphorylated status of OST1 in an active form (Lee et al., 2009). In addition, the involvement of OST1 in JA, ROS and CO2 signaling pathways has been unraveled (Suhita et al., 2004; Vahisalu et al., 2010; Xue et al., 2011). All current results suggest the central role of OST1 in hormone signaling and stress response is mediated by protein phosphorylation/dephosphorylation molecular switches.

S-type anion channels contribute to chloride and nitrate export from guard cells, which in turn initiates stomatal closure. The first identified component of the guard cell

S-type anion channel SLAC1 is a target of OST1 in a Ca2+-independent manner (Geiger et al., 2009). However, since ABA-induced stomatal closure involves increases of cytosolic Ca2+ levels, it is not known whether S-type anion channels are also regulated by an Ca2+-dependent mechanism (Li et al., 2006). Impairment of ABA activation of S- type anion channels in cpk3cpk6 mutants implies the role of calcium-dependent protein kinase (CDPK) CPK3 and CPK6 function in ABA regulation of guard cells S-type anion channels and Ca2+-permeable channels in stomatal closure (Mori et al., 2006). Recently in vitro evidence of direct interaction between CPK21 and SLAC1 homolog 3 (SLAH3) and between CPK21 and ABI1/2 suggests a Ca2+-dependent activation of S-type anion

31 channels in ABA signal transduction in Arabidopsis through the receptor RCAR1-PP2C complex, which might parallel to the Ca2+-independent activation by OST1(Geiger et al.,

2011). The identification of the two types of kinases, SnRK2 and CDPK in the guard cell function demonstrates the existence of both Ca2+-dependent and Ca2+-independent

ABA activation. However, the specificity and redundancy of the kinases in regulating downstream targets is worthy of further investigation considering there are 34 CDPK and 10 SnRK2 genes in Arabidopsis genome.

Another important signaling cascade is mediated by mitogen-activated protein kinases (MAPKs), including MAP4K, MAP3K, MAP2K, MAPK that are sequentially activated in the cascade (Taj et al., 2010). MAP kinases MAPK9 and MAPK12 were found to express preferentially in guard cells and positively regulate ROS-mediated ABA signaling (Jammes et al., 2009). Additionally, stomatal closure caused by increased levels of ABA under drought involves MKK1, MAPK3 and MAPK6 (Hamel et al., 2006;

Gudesblat et al., 2007). Pathogen-induced stomatal closure restricts the invasion of bacteria and thus constitutes an important part of the plant innate immune response.

The stomata of guard cell specific MAPK3 antisense plants act normally upon ABA treatment, but are not responsive to bacteria, indicating the unique function of MAPK3 in the stomatal innate immunity response (Gudesblat et al., 2007). It is interesting to investigate whether pathogen-induced stomatal closure and ABA-induced stomatal closure are mediated via a common MAPK cascade or other MAPKs are involved in the stomatal movement.

Besides the three common kinase groups mentioned above, other types of kinases have been shown to function in guard cell signal transduction. A mutant (ahk5)

32 of Arabidopsis histidine kinase AHK5 localized in cytosol and on plasma membrane has shown reduced stomatal closure in response to abiotic stimuli, pathogen treatment, as well as exogenous application of H2O2 (Desikan et al., 2008). However, ABA-induced stomatal closure, H2O2 production induced by dark adaptation and H2O2 induced NO synthesis were preserved in the mutant. This observation suggests that AHK5 integrates multiple signaling pathways via H2O2 homeostasis and may be independent of ABA signaling in guard cells. In addition, a calcineurin B-like-interacting protein kinase (CIPK) belonging to the SnRK3 subfamily was isolated from V. faba guard cells and found to be negatively regulated by cytosolic Ca2+ through calcineurin B-like calcium-binding protein (CBL). The VfCIPK1 may be related to the mitochondrial functions in guard cells but the detailed mechanisms await further analysis (Tominaga et al., 2010). In summary, all the identified guard cell protein kinases participate in the signaling processes that regulate proper stomatal movement in response to environmental stimuli. Future work needs to map their functions in the sophisticated guard cell molecular networks to achieve an ultimate understanding of stomatal movement in response to internal and external stimuli.

The opposite direction of phosphorylation is dephosphorylation catalyzed by protein phosphatases. Similar to kinases, phosphatases are ubiquitous enzymes in all eukaryotes and could be classified based on their substrate specificity into serine/threonine phosphatases, tyrosine phosphatases, dual specificity phosphatases, histidine phosphatases and lipid phosphatases (Barford, 1996; Camps et al., 2000;

Bäumer et al., 2007). To date, the first two groups, especially the serine/threonine phosphatases have been found to function in guard cells. The serine/threonine

33 phosphatases can be classified into four major subgroups, protein phosphatase (PP) type 1, PP2A, PP2B and PP2C based on their substrate specificity, divalent cation requirement and inhibitor sensitivity (Cohen et al., 1989). The PP1 group phosphatases, utilizing the β subunits of phosphorylase kinases as substrate, are potently inhibited by okadaic acid and independent on divalent cations for activity. The PP2 groups generally use the subunits of phosphorylase kinases as substrate, but their inhibitor and cation dependence vary. For example, PP2As are okadaic acid sensitive but not dependent on divalent ions; PP2Bs (calcineurin) are dependent on Ca2+ and stimulated by calmodulin, but not inhibited by okadaic acid; PP2Cs are dependent on Mg2+ and not sensitive to okadaic acid (Cohen et al., 1989).

With the knowledge of the known inhibitors to each subgroup of the serine/threonine phosphatases, early pharmacological studies suggested the involvement of all the groups in guard cell signal transduction. The PP1/PP2A inhibitor okadaic acid can partially impair activation of anion channels and stomatal closure in

Arabidopsis (Ler) (Schmidt et al., 1995). The inhibitor disruption of the PP2A regulatory subunit RCN1 confers ABA insensitivity in Arabidopsis (WS), suggesting a role of RCN1

2+ as a positive transducer of ABA-elicited [Ca ]cyt transients in guard cells (Kwak et al.,

2002). In Arabidopsis rcn1 mutants, MeJA failed to induce stomatal closure. ROS production and suppression of inward-rectifying K+ channel activities were not observed in rcn1 when treated with ABA or MeJA, suggesting RCN1is a shared component between the two hormone pathways and is functioning upstream of ROS production and downstream of the branching point of hormone signal reception (Saito et al., 2008).

These results suggest that PP1s/PP2As act as positive regulators of MeJA or ABA

34 signal transduction in Ler and WS guard cells. Inconsistently, however, the application of okadaic acid promotes anion channel activation and ABA-induced stomatal closure in

Vicia and Commelina, and activates ABA-responsive promoters in tomato hypocotyls

(Pei et al., 1997; Wu et al., 1997). Therefore, PP1s and PP2As can be either positive or negative regulators in guard cell signaling, dependent upon plant species.

Ca2+ oscillation is an essential process in the guard cell ABA signaling pathway (Li et al., 2006). The Ca2+-dependent PP2B (calcineurin) was found to deactivate the plasma membrane inward-rectifying K+ channels in fava bean guard cells and the effect was blocked by PP2B specific inhibitor (Luan et al., 1993). This observation links the increase of cytosolic Ca2+ to the inhibition of inward-rectifying K+ channels in guard cells, and in consequence, stomatal closure by changing the phosphorylation status of plasma membrane inward K+ channels. Additionally, ABA responses in pea epidermal peels, including mRNA accumulation of ABA-induced dehydrin and stomatal closure were reduced by an inhibitor of PP2B (Hey et al., 1997). Furthermore, a Ca2+- permeable slow vacuolar channel in guard cells was shown to be modulated by calcineurin (protein phosphatase 2B) (Allen and Sanders, 1995). Since no catalytic

PP2B subunits are found in the Arabidopsis thaliana genome, whether the participation of PP2B in the guard cells signal transduction is universal in plants is not known (Kerk et al., 2002).

Due to the unavailability of pharmacological inhibitors to PP2Cs, initial discovery of

PP2Cs in the ABA pathway came from genetic studies of the ABA deficient mutant abi1

(Leung et al., 1994; Meyer et al., 1994). To date, it has been demonstrated that at least four Arabidopsis PP2Cs (ABI1, ABI2, AtP2C-HAB1 and PP2CA) are negative regulators

35 of the ABA signaling pathway in guard cells (Rodriguez et al., 1998; Gosti et al., 1999;

Merlot et al., 2001; Tahtiharju and Palva, 2001). Armstrong and colleagues reported that

ABI1 (ABA INSENSITIVE 1), a putative protein phosphatase 2C, regulates inward- and outward-rectifying K+ channels (Armstrong et al., 1995). In response to ABA, dominant abi1-1 mutants lost the ability to generate ROS, but the dominant ABA-insensitive abi2-

1 mutant could generate ROS. Thus, it has been proposed that ABI1 acts upstream of

ROS production and ABI2 downstream of ROS in guard cell ABA signaling (Murata et al., 2001). Particularly, the activity of ABI1 is inhibited when interacting with ABA bound receptor PYR/PYL/RCAR, leading to OST1 activation to initiate downstream signaling processes (Hubbard et al., 2010). The double negative regulatory core, composed of the three key elements, the receptor, the phosphatase and the kinase, highlights the phosphorylation switch in the guard cell signaling transduction. In addition, AtP2C-HAB1 is one of the closest relatives of ABI1 and ABI2 and over-expression of AtP2C-HAB1 impaired stomatal closure (Rodriguez et al., 1998). Similar to the kinases identified in the stomatal response, ion channels are targets of PP2Cs. For example, PP2CAs bind to ARABIDOPSIS POTASSIUM TRANSPORT 2 (AKT2), a K+ channel in vitro and regulate the AKT2 to control K+ channel activity and membrane polarization under stress conditions (Chérel et al., 2002). Compared to other subgroups of serine/threonine phosphatases, 76 Arabidopsis genes are identified as PP2C-type phosphatase candidates, much more than the 26 PP1s and PP2As and there is no representatives of

PP2Bs (Schweighofer et al., 2004; Farkas et al., 2007). Apparently, PP2Cs form a major class of phosphatases with important functions in plant stress signal transduction.

Another class of phosphatases, protein tyrosine phosphatase (PTPase) has also been shown to control ion efflux from guard cell vacuoles during stomatal closure.

PTPase specific inhibitor prevents stomatal closure caused by ABA, high external Ca2+,

H2O2 and dark, but promotes reopening of the closed stomata, implying that protein tyrosine dephosphorylation must occur at or downstream of the Ca2+ signal responsible for ion efflux from the vacuoles (MacRobbie, 2002). However, this conclusion is based on pharmacological studies, without genetic or other evidence.

The recurrent theme is that protein phosphatases negatively regulate signaling pathways activated by the action of particular protein kinases. The diversity of plant phosphatases suggests that individual phosphatase may have specificity in substrate recognition, as the case of kinases described in the previous section. The coordination between specific protein kinases and phosphatases, as well as the interaction with their diverse targets highlight sophisticated and orchestrated signaling networks. It has become clear that the regulatory mechanism of phosphorylation/dephosphorylation, best exemplified by research on ABA signaling in guard cells, plays a pivotal role in plant stomatal function.

Thiol-based Redox Regulation

Plants are subjected to constant challenges in their environment, and they have to adjust metabolism in real time to maintain a steady state balance between energy generation and consumption (Foyer and Noctor, 2009). Metabolic imbalance can induce oxidative stress in cells, as often indicated by the generation and accumulation of

2•- reactive oxygen species (ROS), including H2O2, superoxide ion (O ) and hydroxyl radical (OH•) (Valko et al., 2007). A common property of ROS is that they can cause oxidative damage to proteins, DNA, and lipids. Oxidized biomolecules have been 37 traditionally recognized as markers for oxidative stress (Suzuki et al., 2011). However, more and more evidence indicates that ROS can also serve as signaling molecules for regulating various physiological responses to environmental challenges (Buchanan and

Balmer, 2005). For example, Arabidopsis MAPK4 and MAPK6 are activated in vivo by oxidative stress such as H2O2 treatment and a MAP kinase responsible for tobacco sensitivity to ozone is also redox-activated (Desikan et al., 2001; Samuel and Ellis,

2002). However, it remains unclear whether cysteines are involved and whether the redox regulation is a direct effect of sensing cellular redox state (Figure 1-4).

The role of ROS in plant cell signal transduction is best exemplified in stomatal movement process, using guard cells as a premium signaling model system. ROS burst was characterized to be the second messenger in the ABA signaling in guard cells

(Allan and Fluhr, 1997; Lee et al., 1999; Pei et al., 2000). However, ROS production does not represent a unique mechanism in this pathway since JA-, SA-, CO2- and ozone-triggered stomatal closure is also associated with the elevation of ROS (Suhita et al., 2004; Kolla et al., 2007; Vahisalu et al., 2010; Khokon et al., 2011b). ROS accumulation in guard cells was shown to be a biphasic event, in which the production was initiated from chloroplasts, followed by ROS production through NADPH oxidases in plasma membrane (Joo et al., 2005; Vahisalu et al., 2010). Due to the dual function of

ROS, a tight control is essential to balance the oxidative damage to proteins and signaling activity, including reversible redox regulation of proteins, regulation of phosphoproteins, activation of ROS-responsive regulatory genes and buffering of ROS by ROS-scavenging enzymes and antioxidant molecules (Suzuki et al., 2011). There are a few key examples of guard cell protein redox regulation. The activities of protein

38 phosphatase ABI1 and ABI2 in guard cells are sensitive to redox state (Meinhard and

Grill, 2001; Meinhard et al., 2002). However, direct evidence for thiol-based redox regulation and a link between protein redox change and stomatal closure remain to be demonstrated. Great effort has been made to investigate the molecular mechanisms of

ROS production and identification of ROS-regulated molecular components in guard cell signaling. Plasma membrane NADPH oxidase is important in ROS production in guard cells (Kwak et al., 2003). The evidence came from the observation that disruption of two partially redundant Arabidopsis guard cell NADPH oxidase catalytic subunit genes,

AtrbohD and AtrbohF, impairs ABA-induced ROS production and stomatal closure

(Kwak et al., 2003). Recently, the activity of the NADPH oxidase has been shown to be regulated by the upstream kinase OST1 through phosphorylation, linking the phosphorylation event with ROS production and redox control of guard cells

2+ (Sirichandra et al., 2009). Exogenous H2O2 can rescue both Ca channel activation and stomatal closure in the ABA-insensitive mutant gca2 (growth controlled by abscisic acid

2), indicating the correlation between the ROS production and Ca2+ channel activation

(Pei et al, 2000). This was further confirmed by the observation that the ABA-induced cytosolic Ca2+ increase and activation of plasma membrane Ca2+-permeable channels were impaired in the atrbohD/F guard cells (Kwak et al., 2003).

Reactive nitrogen species (RNS), e.g., NO, has been recognized to be another important signaling messenger in plant cell physiology. NO participates in many key physiological processes such as pathogen defense, development, programmed cell death, and stress tolerance in plants (Foissner et al., 2000; Pedroso et al., 2000; Beligni and Lamattina, 2001). As a downstream element of ABA signaling pathway in guard

39 cells, NO was shown to selectively regulate Ca2+- sensitive ion channels of Vicia guard cells by promoting Ca2+ release from intracellular stores to raise cytosolic-free [Ca2+]

(Garcia-Mata et al., 2003). Together with RNS, ROS could alter the cellular redox environment. Two groups of ROS scavengers, non-enzymatic (e.g., ascorbate and glutathione) and enzymatic (e.g., superoxide dismutase, glutathione peroxidase and ascorbate peroxidase), function together to adjust and balance the redox state within the cells. ROS, RNS and the scavenging system maintain the cellular redox homeostasis (Pitzschke et al., 2006). The redox status of guard cells is important in stomatal movement. Chen and Gallie observed that the levels of H2O2 and ascorbate redox in guard cells are diurnally regulated, i.e., the former increases in the afternoon whereas the latter decreases in the course of stomatal closure (Chen and Gallie, 2004).

It is reasonable to predict the existence of signaling components in guard cells are under redox regulation or interact with ROS and RNS.

Besides the interaction between Ca2+ channels and ROS, only a few redox regulated components in guard cell signaling are known. For example, one of the

Arabidopsis annexins, known as the target of calcium signaling in eukaryotic cells, has been shown to be susceptible to oxidation-driven S-glutathionylation on the two cysteines in the calcium reactive S3 cluster (Konopka-Postupolska et al., 2009). The S- glutathionylation occurs in planta after ABA treatment, indicating the annexin could be regulated by the ABA induced ROS production. Recently, the activity of oxidized β- amylase (BAM1) was reported to be restored by thioredoxin isoform f1 and partially by

NADPH-thioredoxin reductase. This redox-regulated BAM1 plays a role in diurnal starch degradation important for stomatal opening (Valerio et al., 2011).

As described above, phosphorylation/dephosphorylation and redox control are major regulatory mechanisms in the guard cell signaling networks, where more components and interactions need to be discovered. In mammals, many signaling proteins have been shown to be redox regulated, including Ca2+-ATPase, Ras-related

GTPase Rac1 EGF growth factor, phosphorylase β kinase and voltage-dependent anion channel protein (Suzakawa et al., 2000; Adachi et al., 2004; Sethuraman et al., 2004).

In guard cells, little is known about the interaction between the redox regulation and kinase/phosphatase signaling cascades. Recently, it was found that stomata of the ethylene receptor mutant etr1 did not close in response to H2O2, and mutation of a cysteine residue in ETR1 disrupted H2O2-induced stomatal closure (Desikan et al.,

2005). These findings indicate that redox regulation is an important component of signaling in guard cells. In maize, the ABA-induced H2O2 production activates a 46kD mitogen-activated protein kinase (p46MAPK) and the activation of p46MAPK regulates the production of H2O2, suggesting a positive feedback loop involving NADPH oxidase,

H2O2, and the p46MAPK in ABA signaling (Lin et al., 2009). However, direct evidence for thiol modification and a link between protein redox change in guard cells and stomatal closure remains to be demonstrated.

Conclusions and Project Objectives

Although great progress has been made to elucidate hormone (e.g., ABA and

MeJA) signal transduction pathways in guard cells, our knowledge of the pathways and the molecular networks detailing the interactions between different signaling and metabolic components as well as pathways are far from complete. Recent years have seen great progress in plant proteomics (Chen and Harmon, 2006). However, only a few “whole proteome” analyses of guard cell signaling have been done. High throughput 41 proteomic approaches have been applied in our laboratory to identify hormone responsive proteins and protein post-translational modifications including phosphorylation and thiol redox using highly purified guard cells, in order to discover more novel nodes and edges in guard cell molecular networks.

Due to the presence of ROS as an important signaling messenger, it is our central hypothesis that protein redox modification and the dynamic changes are critical regulatory mechanisms in ABA and MeJA signal transduction. The first objective of this project is to characterize guard cell proteome and its functional specification in ABA and

MeJA signaling. The oxidization and reduction of the sulfhydryl group of cysteine are known to be an essential regulatory switch in a spectrum of physiological processes including photosynthesis in plants. However, thiol-based redox switches remain unknown in the stomatal opening and closing processes. The second objective of this project is to identify and characterize the redox-sensitive proteins in ABA and MeJA signaling pathway of guard cells. Two complementary proteomics approaches, Isotope

Coded Affinity Tag (ICAT) and saturation Differential In Gel Electrophoresis (DIGE), were utilized to identify guard cell thiol-based redox-regulated proteins in response to

ABA or MeJA. Accomplishing these objectives will reveal novel components of ABA signaling networks and provide knowledge of regulatory mechanisms underlying stomatal movements.

The third objective is to conduct detailed characterization of the interesting and novel components using molecular biology, biochemistry and reverse genetics approaches. Functional characterization of the selected protein components will put

42 them into the ABA and/or MeJA signaling networks and reveal the underlying mechanisms of important hormone signaling and stomatal movement.

Table 1-1. Protein components of ABA and MeJA signaling pathways in Arabidopsis guard cells. The numbers in the parenthesis indicate the number of protein homologs, some of which have been characterized and are listed here with references.

Reference Protein Gene locus Gene ABA signaling MeJA signaling

PYR/PYL/RCAR (14) At4g17870 PYR1 Ma et al., 2009 Bet v I domain protein At5g46790 PYL1 Park et al., 2009 At2g26040 PYL2 Santiago et al., 2009 At2g38310 PYL4 Nishimura et al., 2010 Lackman et al., 2011 At5g53160 PYL8/RCAR3 At1g01360 PYL9/RCAR1 PP2C Group A (9) At4g26080 ABI1 Leung et al., 1994 Munemasa et al., 2007 Mg2+-dependent Ser/Thr protein At5g57050 ABI2 Saez et al., 2004 Islam et al., 2010 phosphatase At1g72770 HAB1 Saez et al., 2004 At1g17550 HAB2 Leonhardt et al., 2004 At3g11410 AtPP2CA Yoshida et al., 2006 At5g51760 AHG1 Nishimura et al., 2007 SnRK2 (10) At3g50500 SnRK2.2 Merlot et al., 2002 Ser/Thr protein kinase At5g66880 SnRK2.3 Fujii et al., 2007 At4g33950 SnRK2.6/OST1 Mustilli et al., 2002 Suhita et al., 2004 CaM/CML (57) At3g51920 CML9 Delk et al., 2005 Calmodulin (-like) At5g37770 CML24 Magnan et al., 2008 CDPK (34) At4g23650 CPK3 Choi et al., 2005 Ca2+-dependent Ser/Thr kinase At4g09570 CPK4 Mori et al., 2006 At2g17290 CPK6 Ma and Wu, 2007 At1g35670 CPK11 Zhu et al, 2007 At4g04720 CPK21 Geiger et al., 2011 At4g07470 CPK23 At3g57530 CPK32

Table 1-1. Continued.

Reference Protein Gene locus Gene ABA signaling MeJA signaling

F-box protein (>568) At2g39940 COI1 Xie et al., 1998 Katsir et al., 2008 Jasmonate-ZIM domain protein (12) At1g19180 JAZ1 Sheard et al., 2008 Thines et al., 2007 CBL (10) At4g17615 CBL1/SCABP5 Cheong et al., 2003 Calcineurin-B like At5g47100 CBL9 Pandey et al., 2008 CIPK/SnRK3 (25) At5g01810 CIPK15/PKS3 Cheong et al., 2007 Ser/Thr protein kinase At1g30270 CIPK23 Pandey et al., 2008 Rboh (10) At5g47910 AtRbohD Kwak et al., 2003 Suhita et al., 2004 NADPH oxidase At1g64060 AtRbohF Suhita et al., 2004 PP2A (26) At1g25490 RCN1 Kwak et al., 2002 Saito et al., 2008 Protein Phosphatase regulatory subunit Murata et al., 2001 Myrosinase (6) At5g26000 TGG1 Zhao et al., 2008 Islam et al., 2009 At5g25980 TGG2 Islam et al., 2009 Transcription factors (>1500) At1g32640 MYC2/JAI1/JIN1 Abe et al., 2003 Lorenzo et al., 2004 At2g47190 MYB2

2+ 2+ Figure 1-1. Updated ABA signaling pathways in guard cells. [Ca ]cyt, cytosolic free Ca concentration; ABA, abscisic acid; ABC, ATP-binding cassette; ABI1, ABA insensitive 1; ABI2, ABA insensitive 2; ABI5, ABA insensitive 5; AREB 2, ABA responsive element binding protein 2; Asc, ascorbic acid; ATGPX3, Arabidopsis glutathione peroxidase 3; CDPK, calcium-dependent protein kinase; CHLH, magnesium chelatase H subunit; CP, carotenoid precursor; ETR1, ethylene response 1; G, glucosinolate; GCA2, growth controlled by abscisic acid 2; GCR2, G protein-coupled receptor; GPA1, Arabidopsis α- subunit of the trimeric G protein; GRX, glutaredoxin; HAB1&2, homology to ABI1 1&2; IP3, inositol trisphosphate; ITC, isothiocyanate; KAT1, potassium channel 1; M, myrosinase; MAPK, mitogen-activated protein kinase; OST1, open stomata 1; PA, phosphatidic acid; PI3K, phosphatidylinositol-3-kinase; PI4K, phosphatidylinositol-4-kinase; PIP2, phosphatidylinositol-4,5- bisphosphate; PLC, phospholipase C; PLD, phospholipase D; POX, peroxidase; PP2A, protein phosphatase 2A; PP2C, protein phosphatase 2C; PYL, pyrabactin resistance-like; PYR, pyrabactin resistance; RCAR, regulatory component of ABA receptor; SLAC1, slow anion channel 1; SnRK2, sucrose non-fermenting 1-related protein kinase 2; TF, transcription factor; TRX, thioredoxin.

Figure 1-2. Double negative regulatory module in the ABA signal transduction in guard cells (Umezawa et al., 2010). PYR/PYL/RCAR, PP2C and SnRK2 form a signaling complex referred to as the „ABA signalosome‟. A) Under normal conditions, PP2C negatively regulates SnRK2 by direct interactions and dephosphorylation of multiple residues of SnRK2. Once abiotic stresses or developmental cues up-regulate endogenous ABA, PYR/PYL/RCAR binds ABA and interacts with PP2C to inhibit protein phosphatase activity. In turn, SnRK2 is released from PP2C-dependent regulation and activated to phosphorylate downstream factors, such as the AREB/ABF bZIP-type transcription factor or membrane proteins involving ion channels. B) In contrast, the abi1-1-type mutated protein lacks PYR/PYL/RCAR binding, resulting in the constitutive inactivation of SnRK2, even in the presence of ABA, and strong insensitivity to ABA in the abi1-1 mutant.

Figure 1-3. A simple model of the signaling interaction between ABA and MeJA in Arabidopsis guard cells. Similar to ABA, MeJA also induces ROS production and NO production and activates ICa channels and S-type anion channels.

Sulfenamide Irreversible SH - + S SOH SO2H SO3H H H2O2 H2O2 H2O2

Thiol Thiolate Sulfenic acid Sulfinic acid Sulfonic acid

H C NO SH GSH 2 H : N N H O S H2C NO S SG : N N H S S S O : another protein G : glutathione S-nitrosylation Disulfide S-glutathionylation

Figure 1-4. Redox-active cysteines are sensitive to oxidation. Modifications of cysteine induced by oxidative stresses include, but not exclusively, sulfenic acid, sulfinic acid (−SO2H), sulfonic acid (−SO3H), S-glutathionylation, S- nitrosylation, and disulfide bond.

CHAPTER 2

COMPARATIVE PROTEOMICS PROVIDES EVIDENCE FOR CROSSTALK BETWEEN ABA AND MEJA SIGNAL TRANSDUCTION IN GUARD CELLS1

Introduction

The structure stomata on leaf epidermis are responsible for the gas exchange, allowing plants to have ready access to carbon dioxide (CO2) and control the rate of transpiration (Taiz and Zeiger, 2006). The major structural components for stomata are one pair of guard cells, known for their ability to change shape due to ion influx and efflux under certain conditions and consequently to control the stomatal aperture. Such feature provides a highly responsive system for plants to respond to a variety of stress factors, such as drought, heat, and pathogen invasion (Assmann, 1993).

Compared to mesophyll cells in leaves, guard cells contain fewer chloroplasts with limited structure; thereby possess very low photosynthetic capability. The Calvin cycle in guard cells only assimilates 2-4% of CO2 fixed in mesophyll cells (Outlaw and De

Vlieghere-He, 2001). In contrast, guard cells contain abundant mitochondria and display a high respiratory rate, suggesting that oxidative phosphorylation is an important source of ATP to fuel the guard cell machinery (Parvathi and Raghavendra, 1997). Such distinguished features (i.e., high activities of energy metabolism and solute transport) are consistent with the specific functions of guard cells. It is clear that guard cells possess a robust machinery to perceive and transduce environmental signals and regulate stomatal movement.

1 Partial content in this chapter has been published in Molecular & Cellular Proteomics 2009; 8(4):752-766 (PMID: 19106087) and Journal of Proteomics 2010; 73(4):790-805 (PMID: 19913118).

Using microarrays covering just one-third of the Arabidopsis genome, the large scale transcriptomics study identified 1309 guard cell expressed genes of which 64 transcripts mainly involved in transcription, signaling, and cytoskeleton were preferentially expressed in guard cells compared with mesophyll cells (Leonhardt et al.,

2004). However, functional grouping of the genes revealed only a 1.9% higher representation of photosynthesis genes in mesophyll cells than in guard cells. The percentages of genes in all other categories such as protein turnover, defense, signaling, channels and transporters, and metabolism are similar between the two distinct cell types (Leonhardt et al., 2004). However, these proteins are known to play specific roles in guard cell functions (Li et al., 2006). The very recent global transcriptomic analysis on ABA treated Arabidopsis guard cells identified 1173 ABA- regulated genes, which set the stage for targeted biotechnological manipulations to improve the plant tolerance against the water shortage (Wang et al., 2011). However, responsiveness of several genes might be resulted from the change of upstream transcription factors at the initial stage of ABA signaling. It will be inefficient and aimless to select targets from the large candidate pool. All the shortcomings within the transcriptomics necessitate of the studying guard cell functions at the translational level.

Due to the important roles in plant adaption, the signaling networks within guard cells have been of great interest for decades. As a phytohormone related to dehydration, both endogenous and exogenous abscisic acid (ABA) can trigger stomatal closure in a dose-dependent manner (Wang and Song, 2008). Many key components in this process have been discovered (Li et al., 2006). Recent work has suggested other hormones also participate in the regulation of stomatal function; and interestingly, the

hormone interaction exists during the regulation (Acharya and Assmann, 2009). Methyl jasmonate (MeJA) and its free-acid jasmonic acid (JA) regulate a spectrum of developmental processes and activate plant defense mechanisms under stress conditions (Alvarez et al., 2009). Since the first report of MeJA-induced stomatal closure, MeJA signal transduction has become a new area of guard cell signaling

(Gehring et al., 1997). Both ABA and MeJA elicit stomatal movement, but it is not clear whether the two hormones use similar or divergent signaling mechanisms. Overlapping components have been identified in both ABA-induced and MeJA-induced stomatal closure, e.g., production of reactive oxygen species (ROS) via AtrbohD/F and nitric oxide (NO), activation of K+ efflux channels and slow anion channels, as well as myrosinases (Gehring et al., 1997; Suhita et al., 2003; Munemasa et al., 2007; Saito et al., 2009; Islam et al., 2009). Therefore a crosstalk hypothesis was proposed between

ABA and MeJA pathways in guard cells and supported by observations of MeJA hyposensitivity of stomatal closure in the ost1 (ABA hyposensitive) mutant, reduced

ABA-mediated stomatal closure in the jar1 (MeJA insensitive) mutant, and the involvement of ABA receptor PYL4 in the JA signaling (Suhita et al., 2004; Munemasa et al., 2007; Lackman et al., 2011). The common responsive elements are not only seen between the two pathways mentioned above but also existing between other stress responses, which is known as cross-tolerance allowing plants to acclimate to a range of different stresses after exposure to one specific stress. However, the molecular details still remain scanty even the phenomenon has been recognized for long time.

Proteomics, the large scale analysis of cellular proteins, has become one of the most important tools in biology and biomedical areas during the past 15 years,

especially fueled by the ever-growing DNA sequence information. It provides several high-throughput platforms for characterizing gene function, building functional linkages between pathways, and providing insights into the molecular mechanisms underlying biological processes (Yanagida, 2002; Zhu et al., 2003). Mass spectrometry (MS) together with multiple-dimensional liquid chromatography (LC) have evolved into a versatile tool for examining the simultaneous expression of the total proteome as well as the identification and mapping of post-translational modifications (Templin et al., 2002).

Furthermore, facilitated by recent advances in quantitative MS, shotgun proteomic methods involving isobaric tagging of peptides enable simultaneous identification and quantification of peptides using tandem MS and permit simultaneous proteome analysis of many samples (Thompson et al., 2003). One such method is isobaric tags for relative and absolute quantitation (iTRAQ), which uses four (4plex: reporter ions 114.1, 115.1,

116.1 and 117.1 m/z) or eight (8plex: reporter ions 113.1-119.1, and 121.1 m/z) amine specific isobaric reagents to label the primary amines of peptides from four or eight different biological samples (Ross et al., 2004). The labeled peptides from each sample are mixed, separated using two-dimensional LC and analyzed using tandem mass spectrometry (MS/MS). Because of the isobaric nature of these reagents, the same peptide from each sample appears as a single peak in the MS spectrum. Upon collision induced dissociation, the iTRAQ-tagged peptides fragment to release reporter ions and b- and y-ion series among other fragments. The peak area of the reporter ions are used to determine the relative abundance of the proteins from which they are derived. The advantages of this technology are that it allows multiple samples to be analyzed

simultaneously and it is unbiased toward membrane proteins, very basic or acidic proteins.

In this study iTRAQ followed by MS identification was employed to discover the preferentially expressed proteins in Brassica napus guard cells. The data reveal functional differentiation between mesophyll cells and guard cells at protein level.

Furthermore, the responsive proteins to ABA and MeJA in guard cells were identified using the same technology, providing new evidence for the cross-tolerance phenomenon in plants and setting up a stage for further functional characterization of genes involved in the signaling pathways. The discovery and mapping of these responsive components will facilitate the elucidation of the molecular mechanisms underlying stomatal function.

Material and Methods

Plant Growth

Seeds of the B. napus var. Global were obtained from the United States

Department of Agriculture National Plant Germplasm System. Seeds were germinated in Metro-Mix 500 potting mixture (The Scotts Co., USA), and plants were grown in a growth chamber under a photosynthetic flux of 160 µmol of photons m-2s-1 with a photoperiod of 10 h at 24°C in light and 20°C in dark. Fully expanded leaves from 2- month-old plants were used for preparation of guard cell protoplasts and mesophyll cell protoplasts.

Preparation of Guard Cell Protoplasts and Mesophyll Cell Protoplasts

Guard cell protoplasts from B. napus leaves were isolated and purified mainly as described in the protocol developed for Arabidopsis (Pandey et al., 2002) with the

following modifications. Eight grams of fully expanded leaves with main veins removed were blended three times for 30 s each in cold tap water using a 14-speed Osterizer® blender (Oster Inc., USA). The first enzyme digestion of epidermal peels was 1 h at a shaking speed of 140 rpm. The second enzyme digestion was 40 min at a speed of 50 rpm. The pore size of the nylon mesh used after the first and the second digestions was

100 and 30 µm, respectively. After Histopaque®-1077 (Sigma-Aldrich Co., USA) purification, the cells were resuspended in 1 mL of basic solution. Ten microliters of the suspension was then taken, and the number of protoplasts was estimated with a hemocytometer. The cells were pelleted at 1000 rpm at 4C, frozen in liquid nitrogen immediately, and stored in - 80°C freezer. Mesophyll cell protoplasts were isolated as described previously (Chen et al., 2000) except the sucrose concentration for purification was 0.7 M instead of 0.5 M.

Stomatal Bioassays

Aperture and H2O2 measurements were carried out as previously described

(Zhang et al., 2001; Desikan et al., 2004) with slight modifications. A couple of leaves from a plant were blended and the epidermal strips were washed with cold tap water

(Pandey et al., 2002). The freshly prepared epidermal strips were incubated in degassed medium (50 μM CaCl2, 10 mM KCl and 10 mM MES-KOH, pH 6.2) for 3 h under light to promote stomata opening. After checking the stomatal aperture, the following chemicals were added: diphenyleneiodonium (DPI) 20 μM, catalase 200 U/ml, and ascorbic acid 10 mM, respectively. Tissues were incubated for 20 min before addition of ABA or MeJA. Images of stomata were captured using a Zeiss Axiostar Plus

microscope (Carl Zeiss Inc., USA). At least 60 stomata were analyzed in each experiment and three replicate experiments were conducted.

Protein Extraction, Digestion, 8-plex iTRAQ Labeling and Fractionation

Three independent guard cell preparations were pooled to yield one biological replicate, which contained 80 µg total protein as measured by a CB-XTM protein assay kit (Genotech, USA). Four control replicates and four ABA/or MeJA-treated replicates were used for overnight acetone precipitation. After protein precipitation, the pellet was dissolved in 1% SDS, 100 mM triethylammonium bicarbonate, pH 8.5. The samples were reduced, alkylated, trypsin digested and labeled using the 8-plex iTRAQ® reagent kit according to manufacturer's instructions (Applied Biosystems Inc., USA). The control samples were labeled with iTRAQ tags 113, 114, 115 and 116 and ABA/or MeJA- treated samples were labeled with tags 117, 118, 119 and 121. After labeling, the samples were combined and lyophilized. The peptide mixture was dissolved in strong cation exchange (SCX) solvent A (25% v/v acetonitrile, 10 mM ammonium formate, pH

2.8). The peptides were fractionated using SCX chromatography on an Agilent HPLC system 1100 using a polysulfoethyl A column (2.1×100 mm, 5 µm, 300 Å, PolyLC,

Columbia, USA). Peptides were eluted at a flow rate of 200 µL/min with a linear gradient of 0–20% solvent B (25% v/v acetonitrile, 500 mM ammonium formate) over 50 min, followed by ramping up to 100% solvent B in 5 min and holding for 10 min. The absorbance at 214 nm was monitored and a total of 19 fractions were collected.

Reverse Phase HPLC and Tandem Mass Spectrometry

Each SCX fraction was lyophilized and dissolved in Solvent A (3% acetonitrile v/v,

0.1% acetic acid v/v). The peptides were loaded onto a C18 capillary trap cartridge (LC

Packings, USA) and then separated on a 15 cm nanoflow analytical C18 column

(PepMapTM 75 µm id, 3 µm, 100 A) (LC Packings, USA) at a flow rate of 200 nL/min on a TempoTM nanoflow multidimensional LC system (Applied Biosystems/ MDS Analytical

Technologies, USA). Peptides were eluted from the HPLC column by application of a linear gradient from 3% solvent B (96.9% acetonitrile v/v, 0.1% acetic acid v/v) to 40% solvent B for 2 h, followed by ramping up to 90% solvent B in 10 min. Peptides were sprayed into the orifice of a quadrupole time-of-flight mass spectrometer (QSTAR® Elite

MS/MS system, Applied Biosystems Inc., USA), which was operated in an information- dependent data acquisition mode where a TOF MS scan (m/z 300-1800, 0.25 s) followed by three MS/MS scans (m/z 50-2000, 30-2000 ms) of three highest abundance peptide ions (with charge states 2-5) were acquired in each cycle. Former target ions were excluded for 60 s. Information dependant acquisition features of Analyst® QS software, such as automatic collision energy (smart CE), automatic MS/MS accumulation (smart exit) and dynamic exclusion were selected. The source nebulizing gas and curtain gas were set at 12 and 20, respectively. Ion spray voltage was 2200V and the temperature was 80°C.

Protein Identification and Relative Quantitation

The MS/MS data were analyzed for protein identification and quantification by

ProteinPilot™ software (Applied Biosystems Inc., USA). Proteins with one significant quantitative ratio were included in the report. Bias correction function was used to correct for potential labeling variation. False discovery rate was estimated by the integrated PSPEP tool in the ProteinPilot™ Software by performing the search against a target-decoy concatenated NCBI FASTA database for green plants (5,222,402 entries,

July 2, 2007). If one replicate showed a ratio with a p-value less than 0.05, it is considered as significant. Only the significant ratios from the replicates were used to

calculate the average ratio for the protein. It should be noted that each p-value was generated based on quantitative information derived from at least three independent peptides (Pierce et al., 2008).

Promoter Analysis and Interactive Network Assessment

Homologous genes encoding the ABA/or MeJA responsive proteins were identified in the NCBI Arabidopsis genome database (http://www.ncbi.nlm.nih.gov/). The motif analysis tool (http://www.arabidopsis.org/tools/bulk/motiffinder/index.jsp) compares the frequencies of 6 bp elements in the query set with the frequencies of the elements in the current genomic set of 33,602 sequences. The percentage of the motif occurrence and p-value was calculated. The p value is the probability of the occurrence of specific nucleotide combination in the selected genes by chance. In addition, a probabilistic functional gene network was generated by submitting all the gene loci to AraNet

(http://www.functionalnet.org/aranet/) (Lee et al., 2010).

Results

Proteins Preferentially Expressed in Guard Cells Imply Functional Differentiation of Leaf Cell Types

Guard cell isolation for proteomics

Very few analyses of single cell proteome have been reported in plants. Analysis of trichome and root hair proteomes identified less than 100 proteins (Amme et al.,

2005; Wan et al., 2005). The pollen proteome has been more widely studied, but pollen is not a single cell (Dai et al., 2007). Guard cells represent only a tiny percentage of the total cells in a leaf. It is essential to isolate guard cells with high purity and adequate quantity. The large-scale protocol for isolating Arabidopsis guard cell protoplasts was

established (Pandey et al., 2002). More than 1800 Arabidopsis guard cell proteins have been identified using 2D gel and shotgun proteomic techniques (Zhao et al., 2008).

We have adapted the Arabidopsis protocol to isolate B. napus guard cells. B. napus, the most important oilseed crop, is genetically related to Arabidopsis. The two species share 87% sequence identity in their protein coding regions (Love et al., 2005).

The rich source of genomic sequences available for both organisms, as well as the success in isolating high quality guard cells dramatically enhances our ability to apply proteomics tools. The yield and purity of guard cells from B. napus are superior to those obtained from Arabidopsis leaves. From 8 g of fully expanded leaves, the yield of guard cell protoplasts was on average 5×105 /mL, which corresponds to ~20 µg of protein.

The purity of final guard cell preparation was above 99.6% on a cell basis with little contamination originating from mesophyll cells and epidermal cells (Figure 2-1). Three preparations were pooled to make one “biological” replicate, and three or four independent experiments were conducted for proteomics analysis.

Protein identification by off-line 2D HPLC-MS/MS

After iTRAQ labeling and combination of guard cell (GC) and mesophyll cell (MC) samples, the peptides were fractionated by SCX chromatography. A total of 19 SCX fractions were collected. Each fraction was further separated by nanoflow reverse phase HPLC-MS/MS. Compared with on-line 2D LC-MS, the off-line 2D LC-MS work flow has been shown to display superior overall outcome in protein identification and sequence coverage (Nägele et al., 2004; Qian et al., 2005). After merging the data obtained from different experiments, a total of 1116 unique proteins were identified to be present in both guard cells and mesophyll cells. A second set of iTRAQ LC-MS

experiments using purified GC identified an additional 342 guard cell proteins. So altogether 1458 proteins from GC were identified (Figure 2-2). The 1458 proteins were all confidently identified in guard cells because the signals for iTRAQ 114 and 115 tags that had been used to label specifically guard cell proteins were clearly present in the

MS/MS spectra of all 1458 proteins. Searching against a reversed database allowed calculation of false discovery rates for these experiments as 4% at the protein level. A complete annotated sequence of the B. napus genome is not yet available. Thus other plant species were included in our database searching to enhance the success rate of protein identification. For cross-species identification, the mass spectra and identification quality were carefully inspected. The identified proteins were functionally assigned according to 1) their homology with other proteins based on protein-protein basic local alignment search tool (BLAST) searches with an enabled conserved domain option (Finn et al., 2006), 2) protein family database information, and/or 3) available literature information. The proteins were classified with reference to the functional categories established by Bevan et al. (1998). A Venn diagram for the functional classification is shown in Figure 2-2. The identified proteins cover a wide range of molecular functions, including photosynthesis (8%), energy (respiration) (9%), metabolism (26%), transcription (5%), protein synthesis (9%), protein destination (11%), signaling (7%), membrane and transport (9%), stress and defense (8%), cell structure

(2%), cell division and fate (1%), miscellaneous (3%), and unknown (3%). It should be noted that the percentages of proteins identified in different functional categories do not imply their representation in GC because GC and MC were combined for identification

in the iTRAQ experiments. Those proteins that are of low abundance in GC would probably not be identified if only GC were used.

Identification of proteins preferentially expressed in guard cells and mesophyll cells

Of the proteins identified, 427 proteins could be quantified with at least three different peptide MS/MS spectra and a p value smaller than 0.05 in at least one of the experiments, and 311 proteins could be quantified in at least two of the three independent experiments. To determine the significance threshold, ratios of replicate samples were plotted against p values of the ratios. Repetition of the same sample type, i.e., identical iTRAQ experiment, showed very similar overall quantification results, whereas comparison between GC and MC revealed differentially expressed proteins.

Based on this analysis, only proteins with calculated p values (based on multiple peptide measurements) smaller than 0.05 and a -fold change of at least 2 are included as guard cell or mesophyll cell preferentially expressed proteins (Tables 2-1, 2-2 and

Figure 2-2). Although most published results are based on a -fold change threshold of

1.2-1.5, our criterion of 2-fold is stringent (Drummelsmith et al., 2007; Duthie et al.,

2007; Guo et al., 2007; Sui et al., 2008). There are 74 proteins and 143 proteins differentially expressed in GC and MC, respectively. Proteins involved in energy

(respiration), signaling, transport, and transcription account for the majority of proteins that show preferential expression in GC. In addition, four proteins involved in nucleosome and three involved in cell structure were highly expressed in GC (Table 2-1 and Figure 2-2). On the contrary, in MC the majority of proteins (~50%) are involved in photosynthesis followed by 23 proteins involved in metabolism and 17 disease/defense/stress proteins (Table 2-2 and Figure 2-2). Representative MS/MS

spectra for peptides identified from a photosystem II protein and plasma membrane H+-

ATPase AHA1 are shown in Figure 2-3. The peaks of iTRAQ signature ions (114.1for guard cells and 116.1 for mesophyll cells) are shown as insets, representing the relative abundance of the proteins in MC and GC, respectively. It is important to note that we identified proteins known to specifically function in GC (most of low abundance) but were not able to obtain reproducible quantitative information. These proteins include G protein (Fairley-Grenot and Assmann, 1991; Wang et al., 2001b), Rac GTPase

(Lemichez et al., 2001; Mishra et al., 2006), phospholipase D 1 (Lee and Assmann,

1991), protein kinase C (Sokolovski et al., 2005), OPEN STOMATA 1 kinase (Mustilli et al., 2002), Atrboh NADPH oxidase (Kwak et al., 2003), potassium channel (Pandey et al., 2007), chloride channel (Pandey et al., 2007), lipid transfer protein (Smart et al.,

2000), calreticulin (Chen et al., 1994), and profilin (Kim et al., 1995).

The only available transcriptomics analysis of guard cell and mesophyll cell genes was carried out in Arabidopsis using a microarray covering one-third of the Arabidopsis genome (Leonhardt et al., 2004). Although 1309 genes were identified to be guard cell- expressed, the study did not identify functional specialization of guard cells. Our comparative proteomics of GC and MC revealed specific functions associated with the two types of cells. When comparing proteome data with transcriptome data, 85 genes of the 1309 genes could be matched to 110 proteins by identity (proteins identified in

Arabidopsis database) or by high homology (proteins identified in Brassica or other species database). When the relative protein expression levels were compared with mRNA levels, 80 displayed a similar expression trend, and 30 showed an opposite trend of expression. For those that follow a similar expression trend at the mRNA and protein

levels, the -fold changes at the two levels were mostly different. The correlation coefficient is only 0.37 (Figure 2-4). Among the 74 proteins enriched in GC described in the previous section, 15 are represented on the microarray, and nine transcripts were identified as enriched in GC. These results confirm the general observation that mRNA levels are not always consistent with protein levels because of post-transcriptional, translational, or post-translational regulations (Gygi et al., 1999; Li et al., 2003;

Washburn et al., 2003), and also highlight the importance of proteomics analysis.

ABA and MeJA both Induce Stomatal Closure in Canola Associated with ROS Production

ABA has been shown to induce stomatal closure in Arabidopsis, Vicia faba and

Pisum sativum (Zhang et al., 2001; Desikan et al., 2004; Israelsson et al., 2006). MeJA can also trigger stomatal closure in a similar pattern to ABA (Gehring et al., 1997). To test whether this effect can be extended to B. napus, epidermal peels were treated with different concentrations of ABA or MeJA and stomatal movement was examined. It has been observed that 20 µM ABA or MeJA caused significant stomatal closure within an hour. As the concentration increased, the treatment became more effective (Figure 2-5).

ROS are known to play an important role in both ABA and MeJA induced stomatal closure (Suhita et al., 2004; Li et al., 2006). Here we confirmed ROS production in ABA- and MeJA-treated epidermal tissues of B. napus. The oxidatively sensitive fluorophore dichlorofluorescein was used to assay intracellular H2O2 levels (Zhang et al., 2001;

Desikan et al., 2004). Under ABA or MeJA treatment, ROS level increased dramatically.

ABA- and MeJA-induced stomatal closure and ROS production were inhibited by diphenylene iodonium (DPI), catalase (CAT) and ascorbic acid (ASC). Catalase converts H2O2 to water and oxygen, DPI reduces the generation of superoxide and

H2O2 through inhibiting NAD(P)H oxidase (Chen and Schopfer, 1999), and ascorbate is an important reducing compound for H2O2 removal (Noctor and Foyer, 1998). Its function depends on ascorbate peroxidase and dehydroascorbate reductase, which regulate the cellular redox state (Chen and Gallie, 2004). These results suggest that

ROS and/or the guard cell redox state are important in the ABA and MeJA signaling processes leading to stomatal closure.

Identification of ABA Responsive Proteins Improves Understanding of the Signal Transduction in Guard Cells

The identical strategy (i.e., iTRAQ and offline 2D LC-MS) were employed for protein identification and quantification in this study. A total of 431 unique proteins were successfully identified based on homology searching with a common protein confidence cutoff of 95% and with relative quantitative information in control and ABA-treated samples. Approximately 23% and 66% of the identification matched to proteins in

Brassica and Arabidopsis accessions, respectively. When the concatenated database was searched, the false discovery rate at protein level was estimated to be 1%. To determine ABA-responsive guard cell proteins, the relative levels of different proteins

(indicated by the peak areas of the different iTRAQ tags) were compared between control samples and ABA-treated samples. A threshold of 1.5-fold change together with p-value smaller than 0.05 were set as stringent criteria for significant difference between control and treatment. A total of 66 proteins were observed with increased expression and 38 showed substantial decreases in abundance (Tables 2-3 and 2-4). The ABA- responsive proteins were grouped into different functional categories (Figure 2-6) with reference to Bevan et al. (Bevan et al., 1998).

Up-regulated proteins in guard cells under ABA treatment

Proteins involved in photosynthesis and stress/defense are the two large groups of proteins whose levels were increased by ABA. Although photosynthesis is not a dominant process in guard cells, it is supposed to provide energy and reductants to maintain the redox state through the ferredoxin/thioredoxin (TRX) system (Vavasseur and Raghavendra, 2005; Fujino et al., 2006). In this study, several proteins in the two photosystems, ATP synthase CF1 subunit, ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) activase, and cytochrome C oxidase and enolase involved in respiration were found to be increased in response to ABA (Table 2-3).

These results are consistent with the function of energy-providing and redox state maintenance in guard cells.

Stress and defense related proteins constitute another large group of proteins increased in abundance by ABA (Table 2-3). Among them are stress-induced protein

KIN2 and lipoxygenase (LOX). The expression of their genes has already been shown to be ABA inducible. KIN2 expression was initially reported to be cold-inducible, but later shown to be elevated by ABA, drought and salinity (Acevedo-Hernández et al.,

2005). Rapid induction of LOX gene expression was observed as a result of water deficit (Erin and Mullet, 1991). Transcriptional changes of these genes correlate well with the protein level changes observed here. In addition, an enhancer of SOS3-1,

ENH1 was found to be induced by ABA. ENH1 encodes a chloroplast-localized rubredoxin-like protein, which plays an important role in the detoxification of ROS under salt stress (Zhu, 2004). Interestingly, proteins such as myrosinase, myrosinase- associated protein (MyAP) and thiol methyl-transferase were also found with increased levels by ABA (Table 2-3). Myrosinases, which degrade glucosinolates, belong to a

family of enzymes involved in plant defense against pathogens and herbivores (Yan and

Chen, 2007). Recently, the glucosinolate-myrosinase system has been reported to be a key element in ABA signaling in guard cells (Zhao et al., 2008). Myrosinase is a thioredoxin (TRX) target and is subjected to thiol-base redox regulation in Arabidopsis

(Marchand et al., 2004). MyAP has been purified from seeds of B. napus both in complex with myrosinase and in a free form (Taipalensuu et al., 1996). It contains at least one intramolecular disulfide bond and was observed to respond to wounding and methyl jasmonate (Taipalensuu et al., 1996). Thiol methyltransferase was found to be involved in the detoxification of glucosinolate hydrolysis products in B. oleracea (Attieh et al., 2000). Our data together with the previous reports suggest that guard cell ABA networks involve plant stress and defense components, some of which such as myrosinases are potentially redox regulated.

It is interesting to note that while ABA-induced ROS production (Figure 2-5), it may also activate ROS/oxidative stress removal systems. The proteins in this category include ascorbate peroxidase (APX) (a key enzyme for H2O2 removal in plants), phospholipid hydroperoxide glutathione peroxidase (PHGP) (an important enzyme for removing lipid hydroperoxides from cell membranes), glutathione S-transferase 8

(GST8) (essential for detoxification of xenobiotic compounds), and cyclophilins (CYP)

(important for peroxiredoxin (PRX) regeneration) (Chatfield and Dalton, 1993; Marrs,

1996; Neuefeind et al., 1997; Wang et al., 2001a; Motohashi et al., 2003). Surprisingly,

PRX and TRX were actually decreased in abundance by ABA (Table 2-4). This finding implies that additional complexity exists in the redox signaling network in guard cells. In addition, different isozymes may be regulated differently and thus exhibit different

functions. For example, the increased GST8 was found to be induced by drought- associated oxidative stress and counteract ROS production (Bianchi et al., 2002). In contrast, GST6 was decreased in levels by ABA (Table 2-4). These two GSTs share very low amino acid sequence identity and their functions in ABA signaling remain to be characterized.

Other interesting proteins increased by ABA include protein disulfide isomerase

(PDI), Rab GDP dissociation inhibitor and ALTERED RESPONSE TO GRAVITY 1

(ARG1). PDI is known to assist in the folding of proteins through disulfide bond formation. Its active site closely resembles that of TRX and it is regulated by TRX

(Freedman et al., 1997; Marchand et al., 2004). Rab GDP dissociation inhibitor plays an essential role in regulating the nucleotide state and subcellular localization of small guanosine triphosphatases Rab/Ypt proteins. It controls the GTPase cycle of Rab/Ypt proteins to ensure their proper functions in membrane trafficking, which might be related to ABA signal reception (Ueda et al., 1998). ARG1 was hypothesized to function in gravitropic signaling and affects the localization and activity of the auxin transporter,

PIN1 (Boonsirichai et al., 2003). ARG1 is a peripheral membrane protein that modulates gravity-induced cytoplasmic alkalization. Since ABA also triggers cytosolic alkalization to enhance K+ out-rectifying channel activity in guard cells, ARG1 may be a common node shared between ABA and gravity signaling pathways (Ilan et al., 1994).

Down-regulated proteins in guard cells under ABA treatment

Distinct from the functions of the proteins with increased abundance, the 38 proteins decreased in abundance occupy a wide variety of functional categories including metabolism, protein synthesis, energy, protein folding/transport/degradation, and membrane and transport (Table 2-4 and Figure 2-6). Metabolism, protein synthesis

and energy constitute the three largest groups. In the metabolism group, proteins decreased in abundance belong to a variety of pathways including spermidine synthesis, rhamnose biosynthesis, jasmonic acid biosynthesis, fatty acid beta-oxidation, purine metabolism and alkaloid biosynthesis. Some of the pathways are important to plant stress and defense. Spermidine synthase was found to be essential for

Arabidopsis growth (Imai et al., 2004). Overexpression of this enzyme enhanced plant tolerance to multiple environmental stresses (Kasukabe et al., 2004). Spermidine was suggested to function as a regulator in stress signaling pathways that led to the build-up of stress tolerance mechanisms in plants (Kasukabe et al., 2004). The enzyme 12- oxophytodienoate-10,11-reductase (OPR) catalyzes the reduction of 12- oxophytodienoic acid to produce jasmonic acid (JA) (Turner et al., 2002). The reduced expression of OPR induced by ABA suggests that there is crosstalk between the ABA and JA signaling pathways in guard cells. ABA regulation of these metabolic enzymes has not been reported and deserves further investigation.

Several enzymes involved in cellular respiration were found to be repressed following ABA treatment, including glyceraldehyde-3-phosphatedehydrogenase

(GAPDH), putative malate dehydrogenase (MD), galactose kinase, succinic semialdehyde dehydrogenase (ALDH5F1), and fructose-1,6-bisphosphate aldolase

(F1,6BP). Several of these enzymes are known to be redox regulated. For example, cysteine 149 of GAPDH is critical because it can be S-nitrosylated and thereby regulates enzyme activity (Giustarini et al., 2005). MD also contains thiols with potential to be oxidized. Both GAPDH and MD have been identified as TRX targets (Hara et al.,

2006; Fermani et al., 2007). How the redox regulation and activity changes relate to

their protein levels is not known. It is worth noting that the expression of ALDH5F1 was decreased by ABA. This enzyme is part of a metabolic pathway that bypasses two steps of the tricarboxylic acid cycle. It was reported to be rapidly increased in response to stress conditions in order to prevent ROS accumulation and cell death (Bouché et al.,

2003).

It should be noted that some membrane and transport proteins were reduced in abundance by ABA (Table 2-4). Coatomer is a cytosolic heterooligomeric protein complexed with dilysine motifs typically found in the cytoplasmic domains of ER membrane proteins. It might function in the signal perception and transduction process

(Harter et al., 1996). Ca2+-dependent membrane-binding annexins are implicated in the cellular response to cytosolic acidification (Gorecka et al., 2007). An Arabidopsis annexin mutant displayed hypersensitivity to osmotic stress and ABA. It was suggested that annexins play important roles in osmotic stress and ABA signaling (Lee et al.,

2004). Furthermore, Rubisco was the only protein in photosynthesis found to be decreased by ABA. In embryogenesis, exposure of cotyledons to ABA led to decreased

Rubisco levels in Phaseolus vulgaris, but the underlying mechanism remains unknown

(Medford and Sussex, 1989).

Promoter analysis of the gene homologs in Arabidopsis

Previous studies of ABA-inducible promoters identified the cis-acting sequences, including the G-box-containing elements designated ABA-regulated elements (ABREs), the functionally equivalent coupling element 3 (CE3) like sequences and the Myb/Myc binding sequences (Busk and Pages, 1998). Here we used the classical ABREs available in the PLACE database to evaluate our data set. In this study, 66 and 38 guard cell proteins were increased and decreased in abundance by ABA, respectively.

The upstream 500 bp of the genes encoding these ABA-regulated proteins were examined for the common cis-regulatory elements. Table 2-5 lists all motifs containing an ACGT core sequence and occurrence in each group. Most of these genes (76 out of

104, 73.1%) contain an ACGT sequence, which has been reported to be the core of

ABA-responsive elements (ABREs) (Skriver et al., 1991; Simpson et al., 2003).

Derivative elements include ACGTG, ACGTGKC, YACGTGGC and CCACGTGG. The

ACGTG sequence is required for etiolation-induced expression of ERD1 (EARLY

RESPONSE TO DEHYDRATION 1) (Simpson et al., 2003). It is the most abundant element of ABREs in our analysis (40 out of 76, 52.6%). ACGTGKC was experimentally determined to be an ABRE of a rice gene OSEM and an Arabidopsis dehydration and high-salinity inducible gene RD29A (Hattori et al., 2002; Narusaka et al., 2003).

YACGTGGC and CCACGTGG have also been found to be ABREs in the promoters of

ABA and/or stress-regulated genes in Arabidopsis, maize and Populus spp (Choi et al.,

2000; Guan et al., 2000; Kang et al., 2002; Benedict et al., 2006). Interestingly, the occurrence of ACGT core sequence in the increased group (52 out of 66, 78.8%) is higher than that in the decreased group (24 out of 38, 63.2%). This finding is consistent with the result of microarray data analysis, in which the occurrence of ACGT-containing sequences in the up-regulated genes is much higher than that of the down-regulated ones in Arabidopsis guard cells (Leonhardt et al., 2004). Table 2-5 B to D lists the most abundant ACGT-containing 6 bp sequences in each group. ACGTGG, CCACGT,

ACACGT and ACGTGT are the most abundant elements in increased group. It was noted that a G or C next to the core sequence occurs much more frequently. However, the forms of such core-containing elements vary in the decreased group. T or A occurs

more frequently adjacent to the ACGT core in the motifs within this group. Among all regulated groups, the ACGTG and CACGT motifs show the highest occurrence, which is consistent with the PLACE analysis. The result of ABRE analysis provides strong support to the hypothesis that these genes are potentially regulated at transcriptional level.

Identification of MeJA Responsive Proteins in Guard Cells Reveals Crosstalk in Plant Hormone Signaling Pathways

Two complementary ionization methods - electrospray ionization (ESI) and matrix- assisted laser desorption/ionization (MALDI) with tandem MS were utilized to identify and quantify iTRAQ samples. Each iTRAQ labeled fraction was divided into three aliquots and submitted onto three different mass spectrometry platforms, i.e., AB SCIEX

QSTAR® XL, AB SCIEX TOF/TOF™ 5800 and AB SCIEX TripleTOF™ 5600 (Applied

Biosystems Inc., USA) separately. Figure 2-7 A shows 491, 892 and 1137 proteins were identified with a threshold 1.3 of the unused score by the three MS platforms, respectively. Based on the sequence, the three platforms profiled 1220 non-redundant proteins in total for the Brassica napus guard cell proteome. Figure 2-7 B shows the

Venn diagram of the guard cell proteins for the three parts of results. Within the overlapping IDs from different mass spectrometers, TOF/TOF™ 5800 and Triple TOF

5600 usually give higher unused scores, indicating better significance for the identification. This could be either due to the higher sensitivity of the new generation mass spectrometry or the advantages of the MALDI method. All these results support that the two ionization methods and different analyzers will generate better coverage of the proteome components in a certain material.

Identification of MeJA responsive proteins in Brassica napus guard cells

Based on the data collected from the three mass spectrometry platforms, a total of

76 and 47 proteins were identified to be up- and down- regulated under MeJA treatment in Brassica napus guard cells using threshold with at least 1.5-fold change and p value smaller than 0.05 (Table 2-6 and Table 2-7). Figure 2-8 shows the functional classification of the responsive proteins. The majority groups among these responsive proteins include metabolism, stress and defense, energy and photosynthesis.

Compared to the data of guard cell ABA responsive proteins, the profile of MeJA responsive proteins are similar, indicating convergence of signaling cascades and analogous metabolic changes under different treatments.

Among the up-regulated proteins, it is interesting, but not surprising to note several proteins related to ROS scavenging (Table 2-6), e.g., two different superoxide dismutases and ascorbate peroxidase. Superoxide dismutases (SOD) catalyze the dismutation of superoxide into oxygen and hydrogen peroxide and thus constitute the first line of the antioxidant defense for plants. SODs are classified by the metal cofactors, the copper/zinc (Cu/Zn SOD), manganese (Mn SOD), and iron (Fe SOD) forms. In plants, Fe SOD has been inferred to locate in chloroplasts while Mn SOD is only present in mitochondria and peroxisomes (Alscher et al., 2002). The expression level and enzyme activity of two types SOD are sensitive to various stresses, like chilling, drought and salinity. However, the regulative mechanism may differ due to their different subcellular locations (Tsang et al., 1991; Bowler et al., 1992). The large distribution of responsive proteins identified in the photosynthesis and energy groups

(Table 2-6, Table 2-7 and Figure 2-8) indicate significant changes of the physiological processes occurring in chloroplast and mitochondria. Therefore, Fe SOD and Mn SOD

might be involved in separate antioxidant pathways under MeJA treatment and have specific targets in each compartment. Some other proteins were also activated to remove the ROS/oxidative stress induced by MeJA, including lipoxygenase (LOX), ascorbate peroxidase (APX), 2-cysteine peroxiredoxin (PRX) and two glutathione-S- transferases (GST). Rapid induction of LOX gene expression was observed as a result of water deficit, wounding and MeJA (Erin and Mullet, 1991). Thus, the transcriptional level change correlates well with the protein level observed here. APXs are key regulators of intracellular levels of H2O2 in plants and APX1 has been found to accumulate during the acclimation to drought and heat stress (Chatfield and Dalton,

1993; Koussevitzky et al., 2003). The 2-cysteine peroxiredoxin was identified as a thioredoxin target protein and involved in the protection of the photosynthetic apparatus against oxidative damage (Broin et al., 2002). GSTs are glutathione-dependent detoxifying enzymes with diverse functions in plants. These antioxidant proteins may interact with each other to modulate the redox status in guard cells, which is important in the MeJA signal transduction.

Not only is the ROS scavenging system activated in response to MeJA, but also a group of stress protein called heat shock proteins (HSPs). HSPs protect cells from injury and facilitate recovery and survival from stress conditions. HSP70-1 is a molecular chaperone responsive to various environmental stresses. The tobacco NtHSP70-1 was found to be a drought-/ABA-inducible gene and the over-expression contributes to plant drought-stress tolerance (Cho and Hong, 2006). The protective role of the chaperone

HSP70 against stress may be associated with preservation of protein structure and membrane integrity as well as with the maintenance of high secretory activity mediated

by stress adaptive cellular response (Finka et al., 2011). HSP81-3 and HSP81-4 are members of HSP90 gene family in Arabidopsis, which are highly conserved and essential for cell survival. HSP81-3 is constitutively expressed and only moderately induced by heat treatment. Unexpectedly, over-expression of HSP81-3 could impair plant tolerance to heat stress (Xu et al., 2010). HSP81-4 has high DNA sequence identity (97%) to HSP81-3 and they locate closely on the same chromosome, suggesting that they arise from a recent gene duplication event. In general, the homeostasis of HSP90 is critical for cellular stress response and/or tolerance in plants

(Takahashi et al., 2003). Although HSP-ubiquitin conjugates were not detected, one of the 26S proteasome regulatory subunit RPT5a was up-regulated. In addition, the increase of other 26S proteasome subunits RPN6a and RPN1a were detected with low significance. All the data indicate HSPs and the ubiquitin/26S proteasome system are important to control the activities and levels of cellular proteins in plant stress response and tolerance (Smalle and Vierstra, 2004).

Other defensive mechanisms might include gene silencing based on the proteomics data. The WD-40 repeat protein MSI4 has been reported to express in guard cells and epigenetically regulate various developmental processes via forming ubiquitin ligase complex (Zhao et al., 2008; Pazhouhandeh et al., 2011). An aminomethyltransferase-like precursor protein was found to be MeJA responsive, suggesting the epigenetic regulation in the MeJA signaling in guard cells. Other proteins involved in the small interfering RNA (siRNA)-mediated gene silencing, e.g., argonaute

4 (AGO4) were detected to be down-regulated. The same observation was reported in

the ABA guard cell proteomics studies, revealing another common node between the two pathways (Zhu et al., 2010).

Among all the stress related proteins, Arabidopsis NONHOST1 (NHO1,

AT1G80460) encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate. It is required for limiting the in-planta growth of nonhost

Pseudomonas bacteria but completely ineffective against the virulent bacterium

Pseudomonas syringae pv. tomato DC3000 (Lu et al., 2001). Most of the stress induced proteins identified here have been reported to be responsive to abiotic stimuli. The

NHO1 is an interesting component considering MeJA induction by pathogen invasion

(Liechti and Farmer, 2002). Remarkably, several other interesting proteins were also increased in abundance under MeJA treatment. Protein phosphatase 2A (PP2A) regulatory subunit was found to interact with chaperone co-factors CHIP (Carboxyl terminus of Hsc70-Interacting Protein) and plays a role in temperature and dark stress responses (Luo et al., 2006; Blakeslee et al., 2007). The data indicate a potential phosphorylation switch, which is regulated by phosphatase and protein kinase, is involved in MeJA signaling. In addition, a serine-threonine protein kinase SRK2E was identified to be responsive to MeJA, the homolog of which in Arabidopsis is OPEN

STOMATA 1 (OST1). OST1 is known to mediate the ABA induced stomatal movement and act upstream of ROS production (Mustilli et al., 2002). Recently the OST1 kinase has been reported to function in bicarbonate activation of S-type anion currents in guard cells and in CO2-induced stomatal closure (Xue et al., 2011). The observation of OST1 as responsive protein to MeJA implies the central role of OST1 kinase and the convergence of the ABA, MeJA, and CO2 signal transduction pathways in stomatal

guard cells (Munemasa et al., 2007). Together with other identified proteins related to phosphorylation, including a mitogen-activated protein kinase and phospholipase D, it is obvious that phosphorylation and dephosphorylation play pivotal roles in MeJA signal transduction in guard cells. Furthermore, the increase of cytosolic-free calcium

2+ concentration ([Ca ]cyt) was suggested to be a common event in the course of stomatal closure, e.g., induced by ABA (Li et al., 2006; Acharya and Assmann, 2009). Here we found calmodulin, calcium binding proteins, and an extracellular calcium sensing receptor were responsive to MeJA, which indicates the calcium plays a key role in MeJA signal transduction.

The four major groups of proteins (metabolism, energy, photosynthesis, stress and defense) dominate the 47 down-regulated proteins, but not the up-regulated proteins.

Other functional categories include membrane and transport, transcriptional related and signaling (Table 2-7 and Figure 2-3). The levels of several membrane proteins decreased after MeJA treatment, for example, aquaporin, a vacuolar membrane proton pump (AVP1), and two subunits of coatomer. The aquaporin contributes to hydrostatic pressure-induced water transport in Arabidopsis roots and leaves, and facilitates the transport of CO2 (Postaire et al., 2010; Heckwolf et al., 2011). AVP1 belonging to the V-

PPase (H+ translocating pyrophosphatases) family was also decreased after MeJA treatment. The enzyme exists in homodimeric form and utilizes energy from pyrophosphate (PP) hydrolysis to drive H+ uptake into vacuoles. The expression of

AVP1 in cotton was reported to enhance drought- and salt-tolerance and to increase fiber yield (Pasapula et al., 2011). In contrast, DET3, representing a V-ATPase

(vacuolar-type H+-ATPase) subunit was found to be up-regulated. Here the role of

vacuole as a proton sink is highlighted since the accumulation of H+ into vacuole depends on the activity of V-ATPase and V-PPase (Assmann, 1993). The H+ pumping activity in vacuolar membranes may energize the dynamic changes of vacuoles.

Coatomer, with the clathrin binding capacity, functions in the vesicle-mediated transport.

The abundance decrease of coatomer was also observed in the ABA treated guard cells

(Table 2-4). All these membrane transport proteins might coordinate to establish and maintain the transmembrane electrochemical gradient, especially in vacuoles, to control stomatal movement. Myrosinase TGG2 has been reported to be highly abundant in the vacuoles (Catter et al., 2004). The identification of TGG2, although the changes are different between the ABA and MeJA treatments, supports the notion that ABA and

MeJA signaling pathways share common components.

Promoter and functional network analysis of the homologous genes in Arabidopsis

To correlate protein changes with transcriptional control, the upstream 500bp of homologous genes in Arabidopsis encoding the identified MeJA-responsive proteins were examined for the common cis-acting elements. Different (Me)JA-responsive elements (JREs) have been identified in several plant species, including potato, soybean, tobacco and Arabidopsis. The most common JREs include a GCC motif or a

G box CACGTG (Rouster et al., 1997; Menke et al., 1999; Vom Endt et al., 2007; Brown et al., 2003).Table 2-8 lists all 6bp elements containing the GCC core sequence and the

G box with the occurrence in all the genes. The majority of the genes (114 out of 123) contain either the GCC motif or a G box sequence in the upstream 500bp region. Our result of JRE analysis provides strong support to the hypothesis that these genes are potentially regulated at transcriptional level. Additionally, all the MeJA responsive genes

were submitted to AraNet (http://www.functionalnet.org/aranet/) for probabilistic functional network analysis (Lee et al., 2010). Among the 123 genes, 105 are connected to one another, which provides hints for potential protein-protein interactions and coexpression at transcriptional levels. The responsive genes not only form a functional network, but also show high overlapping with other stress responsive genes. Functional annotation clustering shows the MeJA responsive genes were also involved in abiotic stress response, such as heat, cold and metal and biotic stress defense, e.g., bacteria

(Figure 2-9). This provides further molecular evidence for plant cross-tolerance to stress conditions.

Discussion and Conclusion

Here the guard cell isolation procedure from Arabidopsis was adapted to isolate guard cells from B. napus, one of the most important oil crops in the world and a close relative to Arabidopsis. A recently developed iTRAQ proteomics technology was employed to profile the B. napus guard cell proteome and identify ABA/MeJA responsive proteins in guard cells. More than 1450 non-redundant proteins were identified from guard cell and mesophyll cell samples, of which 74 are preferentially expressed in guard cells. The results have not only revealed the functional differentiation between guard cells and mesophyll cells but also provide molecular evidence correlating the proteins to the guard cell functions.

Although most proteomics studies tend to use intact organs and tissues that contain many different cells, proteomics of individual cell types or organelles has become increasingly important because it allows fine dissection of cellular or organelle functions (Majeran et al., 2005; Dunkley et al., 2006; Sarry et al., 2007). Although the guard cell isolation procedure is tedious and the yield is relatively low, obtaining

proteomics quality and quantity material is not limiting. The advantages of working with a crop plant closely related to Arabidopsis are severalfold. First, B. napus guard cells are larger and have higher protein contents than Arabidopsis guard cells. Second, the knowledge gained in Arabidopsis and B. napus may be transferrable based on the conservation of the two plant species (Love et al., 2005). Third, the genomics resources and functional genomics tools developed in Arabidopsis can be harnessed to address fundamental questions of guard cell functions. Last and not the least, results obtained in

B. napus can be applied to the enhancement of stress tolerance and production of oilseeds and biofuels.

iTRAQ labeling technology has been developed for relative and absolute quantification of proteins. It has immense potential to improve the sensitivity and quality of mass spectrometric analysis of the proteome (Gan et al., 2006; Pierce et al., 2008).

We demonstrated the usefulness of the technology to label peptide mixtures derived from proteins extracted from GC and MC and, using LC-MS/MS, to identify and quantify the relative levels of the peptides emanating from the two types of samples. In the iTRAQ approach, the peptides from different samples are combined and appear as one peak in MS, thus increasing the total ion current for that peptide. This is advantageous for obtaining good quality MS/MS spectra for identification of low abundance proteins. In this study, we identified 1458 unique proteins, many of which are of low abundance and would otherwise have escaped identification if the samples had not been combined. For quantification, because it is based on individual iTRAQ tags associated with different samples, the combination of different samples has little effect on quantitative results.

For almost every identified protein, relative quantitative information was obtained from

at least one of the three different experiments. However, the relative expression ratios of over half of the proteins either have high p values (>0.05) or no p values. This generally seems to be the case when iTRAQ experiments are done and analyzed using the current version of ProteinPilot software. ProteinPilot software only uses MS/MS spectra unique to a particular protein and peak pairs with a sum of the signal-to-noise ratio over 9 for quantification (default software settings). In addition, at least three spectra are needed to determine the statistical significance of a change in protein levels

(Shilov et al., 2007). This software algorithm aiming at high quality and high accuracy quantitation may compromise the end results of the total number of proteins with confident changes.

Comparative proteomics using iTRAQ technology and LC-MS/MS has revealed the functional differences between MC and GC. Proteins involved in respiration were much more abundant in GC than in MC. Proteins associated with transport and signal transduction, including channels, ATP synthase, protein kinases, 14-3-3 protein, calmodulin, and phosphatases, were also more abundant in GC. In contrast, proteins associated with photosystems, the Calvin cycle, and starch synthesis were more abundant in MC than in GC. A higher proportion of proteins for respiration, signal transduction, and transport and a lower proportion of the photosynthetic proteins indicate that GC devote more cellular activities to processing environmental or endogenous stimuli than to metabolic activities. Several signaling proteins were found to be highly expressed in B. napus GC, including calmodulin, 14-3-3 proteins, mitogen- activated protein kinases (MAPKs), protein phosphatase 2A protein and a glycine-rich

RNA-binding protein (Table 2-1). This is consistent with the expected roles of guard

cells in processing diverse signals to regulate stomatal movement. The lower proportion of photosynthetic activity, in particular, is consistent with the previously known physiological data (Parvathi and Raghavendra, 1997; Outlaw and De Vlieghere-He,

2001). In the protein turnover category, several proteins preferentially expressed in GC are involved in ubiquitination and proteasome degradation (Table 2-1). Protein degradation activity has rarely been studied in GC. This finding highlights the potential significance of protein turnover in guard cell function. Consistent with the possibly high protein turnover rate, GC may have high gene transcriptional activities or regulations, facilitating efficient responses to environmental factors.

Despite advances in transcriptomics, global analysis of protein components is important. Comparison of the iTRAQ proteomics data set with the Arabidopsis cDNA microarray data set allows estimation of the correlation between transcripts and proteins.

Although many proteins shown to be highly abundant in guard cells displayed a similar trend at the transcriptional level, the exact -fold changes were mostly of a low degree of consistency (Figure 2-4). This is not surprising because post-transcriptional, translational, and post-translational mechanisms regulate protein isoforms and their quantities. iTRAQ proteomics is important to identify quantitative changes of different protein species for which little can be reflected at the mRNA levels. The iTRAQ proteomics approach allows the analysis of relative abundance of all proteins in a sample including both membrane and soluble proteins, whereas the traditional 2D gel electrophoresis-based proteomics tends to focus on identifying soluble proteins and to quantify gel spots, each often containing more than one protein (Chen and Harmon,

2006). With the development of 8-plex iTRAQ reagents, protein identification and

quantification technology will be greatly advanced, especially the possibility of including more replicates within the same sample preparation, and mass spectrometry analysis will greatly improve reliability and accuracy of protein quantification (Gan et al., 2006;

Pierce et al., 2008). In conclusion, we have shown the utility of iTRAQ proteomics technology in identifying and quantifying proteins in GC and MC. This study has unveiled many differentially expressed proteins, indicating functional specialization of the two types of cells in B. napus. Although the homologs of some of the proteins have been studied in other species, rarely any has been functionally characterized in B. napus GC.

With the successful application of iTRAQ technology in characterization of B. napus guard cell and mesophyll cell proteomes, another two sets of experiments were designed to investigate ABA and MeJA responsive protein in guard cells. Physiological analysis has confirmed that both ABA and MeJA could promote stomatal closure in association with enhanced ROS generation in B. napus epidermal peels. In total 66 proteins were found with abundance increase whereas 38 were found to be decreased in response in ABA (Table 2-3, Table 2-4 and Figure 2-6). The functional distribution of increased and decreased proteins is distinct. Many of the genes encoding these proteins contained ABREs in their upstream regions, suggesting direct ABA regulation at the transcriptional level. In MeJA experiments, 76 and 47 proteins were identified to be up- and down-regulated (Table 2-6, Table 2-7 and Figure 2-8). Functional classification of the MeJA responsive proteins shows a similar distribution pattern as

ABA. The identification of redox proteins in both cases together with the physiological observation of ROS levels highlights redox regulation as a potential mechanism in the

guard cell ABA and MeJA signaling. Our results established a comprehensive inventory of ABA- and MeJA-responsive proteins, providing clues to identify new proteins that are potential components of ABA and MeJA signaling networks in guard cells. For example, a Bet v I allergen family protein was identified from our ABA treated guard cells and later proven to be a soluble ABA receptor PYL2 (Melcher et al., 2009).

Recently more and more reports on the identification of stress responsive proteins in plants using robust proteomic tools have been published (Chen et al., 2009; Pastori and Foyer, 2009; Chen et al., 2011). The high throughput workflow has facilitated the discovery of stress biomarkers, either universal or unique in certain process. Here we observed common components in MeJA treated guard cells with samples of other stress treatment. Although it is not surprising since plants make use of common pathways and elements in the stress-response relationship, known as cross-tolerance, the molecular details are still largely unknown (Sabehat et al., 1998; Capiati et al.,

2006). The interaction between ABA and MeJA signaling pathways in guard cells is of our great interest because both phytohormones are stress inducible and associated with stomatal closure. Our data have provided strong evidence for the crosstalk hypothesis in which the key regulative elements, e.g., phosphorylation/dephosphorylation, ROS production and calcium dependent signaling events, together with other shared components, such as myrosinase are known to be involved in both pathways

(Munemasa et al., 2007; Islam et al., 2009). The activation of ROS scavenging system might serve as an important mechanism towards quenching the ROS burst as the consequence of ABA and MeJA application. Considering proteins related to other stresses, especially proteins participating in redox regulation, common sets of proteins

are often observed, indicating that similar stress responsive mechanisms are used. This explains the cross-tolerance phenomenon, i.e., plant response to one type of stress condition will generate tolerance to another stress condition (Pastori and Foyer, 2002).

The cross-tolerance is a very important protective mechanism to plants‟ survival and productivity since plants could be simultaneously subject to various environmental stresses. Additionally, the identification of common components such as AGO4 between the ABA and MeJA data highlights that gene silencing mediated by small RNA could be employed as another protective mechanism in the two pathways. It will be interesting to investigate the role of coatomer and the function of its corresponding subcellular vesicles in guard cell signaling networks. Although the comparison was conducted from protein level to transcriptional level and usually the two don‟t correlate well, it still provides new information on the interaction of responses to different stresses, and most importantly, the components regulating these responses. Future research focusing on functional characterization using multidisciplinary tools including reverse genetics, biochemistry and physiology will detail involvement of the proteins and improve understanding of ABA and MeJA signaling networks in guard cells. This knowledge can be applied via modeling to predict routes for rational engineering of important crops for improving water usage, better yield and enhanced stress tolerance.

Table 2-1. Proteins predominantly expressed in guard cells. 2 Experiment 1 Experiment 2 Experiment 3 Average Accession Protein GC/MC P-value GC/MC P-value GC/MC P-value GC/MC Energy (16) gi|15226479 Triose-phosphate isomerase (TIM ) 1.781 0.000 2.044 0.000 2.226 0.001 2.000 gi|15229231 Glyceraldehyde-3-phosphate dehydrogenase C subunit 5.087 0.070 2.777 0.004 5.453 0.020 3.680 gi|15233272 Cytosolic triose phosphate isomerase 1.920 0.000 2.018 0.000 4.702 0.007 2.441 gi|15236591 Aldose 1-epimerase family protein 2.370 0.001 2.603 0.001 4.070 0.063 2.481 gi|15238151 6-phosphogluconate dehydrogenase 2.051 0.012 2.582 0.009 2.286 gi|15240075 Succinate dehydrogenase 1-1(SDH1-1 ) 2.248 0.023 2.041 0.026 1.001 0.998 2.139 gi|21536853 Putative phosphoglycerate kinase 2.166 0.026 2.467 0.020 2.779 0.043 2.445 gi|21592878 Inorganic pyrophosphatase-like protein 2.132 0.003 2.027 0.001 2.078 gi|30689081 Phosphoenolpyruvate carboxylase 2(ATPPC2) 7.017 0.000 4.701 0.001 3.180 0.232 5.630 gi|30696904 Xylose isomerase family protein 2.252 0.043 2.169 0.019 1.939 0.381 2.210 gi|3676296 Mitochondrial ATPase beta subunit 3.088 0.003 2.567 0.003 2.121 0.009 2.532 gi|79314806 Mithochondrial ATP synthase D chain(ATPQ) 2.171 0.017 1.919 0.011 2.037 gi|51102306 Putative glyceraldehyde 3-phosphate dehydrogenase 2.142 0.014 2.089 0.021 2.115 gi|34597332 Enolase 1.807 0.003 1.516 0.206 2.525 0.003 2.106 gi|4874272* Putative protein with PEP/pyruvate binding domain. 2.223 0.045 1.870 0.219 2.223 gi|68426 Triose-phosphate isomerase 2.021 0.000 2.043 0.000 2.276 0.135 2.032 Metabolism(13) gi|15222072 UDP-D-glucose/UDP-D-galactose 4-epimerase 1 (UGE1) 1.923 0.004 2.187 0.001 2.046 Hypothetical protein,containing PRK10675 UDP- gi|147742770 1.902 0.018 2.190 0.008 2.036 galactose-4-epimerase domain gi|15242351* Reversibly glycosylated polypeptide-3 0.181 0.635 3.872 0.013 3.872 gi|15241721* Putative protein,containing pfam02719 domain 3.630 0.383 3.064 2.055 0.025 2.055 gi|15239735* Thiazole biosynthetic enzyme precursor (ARA6) 2.438 0.005 2.438 gi|15239772 Aspartate aminotransferase 2 (ASP2) 2.293 0.005 2.127 0.045 2.207 gi|599625* Aconitase 1.132 0.749 1.135 0.589 3.311 0.020 3.311 gi|3334244 S-D-lactoylglutathione methylglyoxal lyase 2.464 0.043 1.994 0.005 1.338 0.338 2.205

2 Proteins with p value smaller than 0.05 in only one of the independent replicates are highlighted with asterisk.

Table 2-1. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein GC/MC P-value GC/MC P-value GC/MC P-value GC/MC gi|7385217* Beta-ketoacyl-ACP synthetase 1 1.406 0.161 2.113 0.036 1.375 0.526 2.113 gi|15226618* Putative fumarase 2.467 0.006 1.860 0.052 2.467 gi|116077986 Pterocarpan reductase 2.479 0.021 3.614 0.021 2.941 gi|157890952* Putative lactoylglutathione lyase 3.311 0.254 2.559 0.320 3.114 0.011 3.114 gi|15241492 Formate dehydrogenase (FDH) 2.419 0.007 2.347 0.007 1.491 0.566 2.383 Protein synthesis (3) gi|15228111* 40S ribosomal protein S5 1.019 0.909 1.080 0.744 2.085 0.049 2.085 gi|7489746* Golgi associated protein se-wap41 0.229 0.462 3.535 0.015 3.535 gi|79322680 40S ribosomal protein S25 (RPS25E) 2.109 0.006 2.621 0.015 2.338 Protein folding, tansporting and Degradation (7) gi|15234781* Peptidylprolyl isomerase ROC1 1.191 0.097 1.021 0.886 13.072 0.004 13.072 gi|15229559* Mitochondrial chaperonin hsp60 1.019 0.909 1.080 0.744 2.085 0.049 2.085 gi|15232760 Polyubiquitin (UBQ8) 3.297 0.001 3.373 0.001 1.449 0.010 2.326 gi|40060485 Heat shock protein HSP101 2.315 0.007 1.867 0.008 2.067 gi|15229559 Mitochondrial chaperonin hsp60 2.364 0.024 2.132 0.028 1.600 0.083 2.242 gi|15224993* 20S proteasome subunit (PAA2) 1.149 0.790 1.189 0.810 3.018 0.004 3.018 gi|5921735* 10 kDa chaperonin (Protein CPN10) 2.335 0.026 2.249 0.285 2.335 Membrane and transport (9) gi|124360090 Plasma-membrane proton-efflux P-type ATPase 4.576 0.007 4.317 0.016 5.797 0.065 4.443 gi|1352830 Vacuolar ATP synthase catalytic subunit A 3.352 0.004 2.785 0.036 2.184 0.003 2.690 gi|15224264 Plasma membrane proton ATPase (PMA), AHA1 1.977 0.005 2.333 0.003 3.674 0.008 2.486 gi|15232300* Plasma membrane H+-ATPase, AHA7 7.210 0.083 6.631 0.035 2.181 6.631 gi|15234666 Plasma membrane H+-transporting ATPase type 2, AHA2 3.209 0.038 2.171 0.763 5.012 0.070 3.209 gi|18844793 Putative H+-exporting ATPase 2.316 0.010 2.546 0.003 2.580 0.067 2.426 gi|2493131 Vacuolar ATP synthase subunit B 1 1.932 3.050 0.004 1.905 0.005 2.345 gi|15231937 Adenylate translocator 2.163 0.000 2.150 0.002 1.766 0.246 2.157 gi|758355* H+-transporting ATPase 1.590 0.099 1.565 0.627 2.694 0.015 2.694 Stress and Defense (9) gi|15222163* Putative GSH-dependent dehydroascorbate reductase 1 3.586 0.017 1.750 0.070 1.903 3.586

Table 2-1. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein GC/MC P-value GC/MC P-value GC/MC P-value GC/MC gi|15225245* Bet v I allergen family protein 3.134 0.064 2.572 0.031 2.572 gi|15231718 Putative peroxiredoxin type 2 5.085 0.010 4.522 0.006 9.075 0.148 4.787 gi|15239697 Resistant to agrobacterium transformation 5 2.372 0.015 4.025 0.032 4.783 0.003 3.412 gi|157849770 Early-responsive to dehydration 12 (ERD12 protein) 2.039 0.039 2.058 0.040 1.454 0.272 2.048 gi|18397457 Peroxiredoxin IIF (ATPRXIIF/PRXIIF) 2.038 0.000 1.999 0.002 1.935 2.018 gi|18404709 Unknown protein,containing pfam00407 domain 2.532 0.019 3.279 0.041 11.657 2.857 gi|21555213* Vegetative storage protein-like 2.030 0.023 1.019 0.911 4.052 2.030 gi|9795585* Putative GSH-dependent dehydroascorbate reductase 2.255 0.011 2.046 0.068 2.275 0.113 2.255 Signal transduction(8) gi|15219510 14-3-3 protein, putative 2.428 0.006 1.995 0.014 2.099 0.051 2.190 gi|21553354 Glycine-rich RNA binding protein 7 2.161 0.002 2.280 0.004 1.766 0.158 2.219 gi|3702349 Putative mitogen-activated protein kinase 3.134 0.000 3.250 0.002 3.191 gi|78102508 Cytokinin-binding protein CBP57 2.791 0.034 3.798 0.031 1.770 3.217 gi|79317272 Calmodulin binding/translation elongation factor 3.253 0.013 3.799 0.001 1.459 0.044 2.389 gi|81248479* Mitogen-activated protein kinase 4 2.140 0.138 2.609 0.077 5.013 0.034 5.013 gi|899058 Calmodulin 2.340 0.002 3.475 0.002 2.025 0.000 2.482 gi|9958062* Putative protein phosphotase 2a 65kd regulatory subunit 2.063 0.045 2.075 0.155 2.063 Transcription related (4) gi|145323776 Histone H4 1.988 0.000 2.621 0.000 4.369 0.014 2.695 gi|15224536 Histone H1 6.491 0.000 8.080 0.002 6.445 0.090 7.199 gi|15241858 Histone H2B, putative 1.877 0.001 2.299 0.000 5.443 0.000 2.605 gi|5777792* Histone H2A 2.282 0.223 2.173 0.182 4.860 0.001 4.860 Cell structure(3) gi|34733239* Putative tubulin alpha-2/alpha-4 chain 1.650 0.184 1.639 0.397 2.697 0.034 2.697 gi|4139264* Actin 1.181 0.073 1.210 0.059 2.238 0.010 2.238 gi|77549556* Tubulin alpha-3 chain 3.413 0.016 3.413 Unknown (2) gi|30681554 Unknown protein 1.696 0.000 1.855 0.000 2.994 0.048 2.051 gi|30690673* CP12 domain-containing protein 1 (CP12-1) 1.095 0.800 2.112 0.014 2.112

Table 2-2. Proteins predominantly expressed in mesophyll cells. 3 Experiment 1 Experiment 2 Experiment 3 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC Photosynthesis (71) gi|108796808 Photosystem I subunit VII 2.759 0.000 3.149 0.000 2.397 0.004 2.768 gi|109389998 Chloroplast chlorophyll a/b binding protein 3.072 0.000 4.745 0.000 8.345 0.000 5.387 gi|110377793 Chloroplast pigment-binding protein CP26 2.427 0.000 3.157 0.000 8.325 0.000 4.636 gi|121582119 Photosystem I P700 apoprotein A1 2.568 0.000 3.643 0.000 7.325 0.000 4.512 gi|125656346 Chloroplast PSI type III chlorophyll a/b-binding protein 3.966 0.000 3.969 0.000 6.431 0.006 4.789 gi|12805303 Putative chlorophyll A-B binding protein.. 3.877 0.000 5.377 0.000 4.627 gi|145688411 LhCa2 protein 3.576 0.000 4.421 0.000 8.994 0.000 5.664 gi|147864470 Hypothetical protein 2.848 0.001 3.886 0.002 3.367 gi|15219418 Photosystem II 22kDa protein, putative 2.464 0.000 3.370 0.000 5.037 0.000 3.624 gi|15221681 Putative photosystem I subunit III precursor 2.388 0.000 2.777 0.000 6.347 0.000 3.837 gi|15222551 Phosphoribulokinase precursor 2.382 0.000 2.562 0.000 2.958 0.000 2.634 gi|15222956 Plastocyanin 2.261 0.000 1.918 0.000 2.504 0.025 2.228 gi|15223331 Starch synthase, putative 2.894 0.000 5.181 0.000 7.577 0.000 5.217 gi|15225630 LHCB4.3 (light harvesting complex PSII) 2.896 0.000 3.081 0.000 3.356 0.025 3.111 gi|15230324 Photosystem II subunit O-2 (PSBO-2/PSBO2) 3.155 0.000 3.520 0.000 4.605 0.005 3.760 gi|15232815 Chlorophyll A-B biding protein 4 percursor homolog 2.989 0.000 3.937 0.000 7.748 0.000 4.891 gi|15234637 Photosystem II subunit Q-2; calcium ion binding 2.198 0.000 2.053 0.000 5.744 0.016 3.332 gi|15235490 Putative photosystem I chain XI precursor 2.316 0.000 3.125 0.000 6.426 0.006 3.956 gi|15235503 Putative photosystem I reaction center subunit II 3.541 0.000 3.855 0.000 3.259 0.000 3.552 gi|15236722 H+-transporting ATP synthase chain 9 - like protein 2.222 0.000 1.949 0.000 5.552 0.005 3.241 gi|15237225 Photosystem II stability/assembly factor HCF136 1.688 0.000 1.532 0.001 3.280 0.032 2.167 gi|15240013 33 kDa polypeptide of oxygen-evolving complex 4.216 0.000 4.515 0.000 8.552 0.001 5.761 gi|15241005 Chlorophyll A-B binding protein CP29 (LHCB4) 2.668 0.000 3.712 0.000 7.691 0.000 4.690 gi|1644289 Chlorophyll a/b-binding protein CP26 in PS II 3.098 0.000 4.077 0.000 3.554 0.000 3.576 gi|17852 Rubisco small subunit 2.018 0.001 2.742 0.000 3.667 0.000 2.809 gi|18405061 Thylakoid lumen 18.3 kDa protein 1.961 0.000 2.821 0.000 4.095 0.000 2.959

3 Proteins with p value smaller than 0.05 in only one of the independent replicates are highlighted with asterisk.

Table 2-2. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC gi|21554335 PSI type III chlorophyll a/b-binding protein, putative 3.194 0.000 3.684 0.000 5.179 0.002 4.019 gi|28141361 Granule bound starch synthase 1.469 0.007 3.509 0.001 8.831 0.020 4.603 gi|29470191 Photosystem II protein D1 2.009 0.000 2.897 0.000 6.049 0.000 3.651 gi|3914442 Photosystem I reaction center subunit VI, PSI-H 2.514 0.032 2.847 0.011 2.170 2.681 gi|401249 Cytochrome b6-f complex iron-sulfur subunit 2 4.364 0.000 2.852 0.000 4.349 0.002 3.855 gi|407769 PSI-D1 precursor 3.536 0.001 3.996 0.012 9.398 0.043 5.644 gi|42571761 Nonphotochemical quenching (NPQ4) 1.916 0.000 2.760 0.000 4.849 0.002 3.175 gi|49359169 Photosystem II protein 3.717 0.000 4.621 0.001 6.645 0.003 4.994 gi|50313237 Lhcb6 protein 2.760 0.000 3.545 0.000 7.888 0.043 4.731 gi|515616 LHC II Type III chlorophyll a /b binding protein 2.591 0.000 3.611 0.000 3.215 0.058 3.101 gi|56784285 Chloroplast photosystem I P700 apoprotein A2 1.977 0.010 3.737 0.198 7.440 0.034 4.709 gi|58700507 Chloroplast oxygen-evolving protein 16 KDa subunit 2.135 0.000 2.103 0.000 4.720 0.008 2.986 gi|6006283 Photosystem I subunit PSI-L 2.856 0.001 3.849 0.001 3.353 gi|62318781 Protochlorophyllide reductase precursor like protein 2.633 0.026 2.716 0.019 2.675 gi|75107089 Photosystem I reaction center subunit N (PSI-N) 1.741 0.012 2.528 0.009 2.135 gi|7525059 photosystem II 47 kDa protein 1.777 0.000 2.711 0.000 6.051 0.005 3.513 gi|79013990 Chloroplast Rubisco small subunit precursor 1.738 0.000 2.227 0.000 4.068 0.000 2.678 gi|81176267 Photosystem II protein V 1.889 0.001 2.299 0.001 4.801 0.118 2.094 gi|83641952 PSII cytochrome b559 8kDa subunit 2.381 0.056 3.952 0.001 3.971 0.003 3.962 gi|8745521 Ribulose-1,5-bisphosphate carboxylase/oxygenase 2.008 0.000 2.079 0.000 3.706 0.000 2.598 gi|902201 PSII 32 KDa protein 3.543 0.001 6.049 0.000 4.796 gi|902207 PSII 43 KDa protein 6.378 0.000 6.886 0.000 7.120 0.000 6.795 gi|91983987 Photosystem II protein D2 2.271 0.000 3.056 0.000 5.407 0.001 3.578 gi|91983988 Photosystem II 44 KDa protein 1.900 0.000 2.476 0.000 8.091 0.000 4.155 gi|92884121 4Fe-4S ferredoxin, iron-sulfur binding 2.147 0.098 2.158 0.035 6.393 0.000 4.275 gi|9843639 Rieske FeS protein 2.690 0.000 3.375 0.000 3.033 gi|967968 Photosystem II 10kDa polypeptide 2.206 0.018 1.942 0.145 6.386 0.009 4.296 gi|110377772 Chloroplast pigment-binding protein CP24 3.143 0.000 4.320 0.000 7.529 0.004 4.997 gi|116309995 Chlorophyll A-B binding protein, containing pfam00504 3.495 0.024 4.319 0.007 3.689 0.077 3.907

Table 2-2. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC gi|126633416 Unnamed protein product, containing pfam00504 2.981 0.000 4.176 0.000 5.965 0.001 4.374 gi|15222757* putative photosystem I subunit V precursor 5.941 0.011 5.941 gi|15231990 Light harvesting complex PSII (LHCB4.2) 4.652 0.000 6.258 0.000 8.524 0.001 6.478 gi|15233115 LHCA1; chlorophyll binding 3.008 0.000 3.606 0.000 4.962 0.000 3.859 gi|15237593 Photosystem I reaction center subunit PSI-N 2.102 0.000 1.987 0.000 4.536 0.000 2.875 gi|1620920 23kD protein of oxygen evolving system 1.717 0.000 1.850 0.000 3.043 0.005 2.203 gi|24210533 Chlorophyllase 1 2.121 0.022 3.635 0.002 2.878 gi|29839389 Ferritin-1, chloroplast precursor 1.557 0.018 3.280 0.001 3.540 0.185 2.418 gi|34393511 Putative photosystem I antenna protein 3.388 0.000 4.382 0.000 9.827 0.000 5.865 gi|3885892 Photosystem-1 F subunit precursor 2.056 0.001 2.550 0.002 3.757 0.009 2.788 gi|458797* Cytochrome b 1.264 2.175 3.970 0.012 3.970 gi|54043095 Glycolate oxidase 1.990 0.002 1.784 0.018 6.224 0.000 3.333 gi|544122 Apocytochrome f precursor 2.174 0.000 2.641 0.000 6.393 0.000 3.736 gi|67463833* Plastocyanin with cytochrome f 7.934 0.000 7.934 gi|81301580* Cytochrome f 1.265 0.845 1.372 0.773 4.468 0.005 4.468 gi|15229349 Putative ribose 5-phosphate isomerase 2.198 0.000 2.381 0.002 4.961 0.016 3.180 Energy (7) gi|1480014 Putative delta subunit of ATP synthase 3.540 0.000 2.721 0.000 4.664 0.000 3.641 gi|15234900 Putative fructose-bisphosphate aldolase 1.811 0.000 1.619 0.000 4.383 0.000 2.604 gi|20339362 Ribulose-5-phosphate-3-epimerase 1.743 0.009 2.295 0.011 2.899 0.018 2.312 gi|27530932 Cytosolic NADP-malic enzyme 2.388 0.024 2.327 0.005 2.357 Unknown protein containing F0F1-ATP synthase gi|15233597 1.957 0.000 2.091 0.000 5.336 0.000 3.128 gamma domain gi|4995091 Malate dehydrogenase 2 2.392 0.001 2.322 0.008 4.982 0.051 2.357 gi|75336517 ATP synthase subunit beta 1.772 0.000 1.775 0.000 3.254 0.000 2.267 Metabolism (23)

gi|114324489 Geranylgeranyl reductase 2.582 0.000 1.613 0.005 1.835 2.097 Unknown protein containing UDP-galactose-4- gi|15217485 2.619 0.000 2.426 0.000 2.523 epimerase domain gi|15221892 Protein containing methanol dehydrogenase domain 2.103 0.000 2.989 0.000 4.391 0.000 3.161

Table 2-2. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC gi|15225026 Alanine-glyoxylate aminotransferase 2.071 0.000 2.099 0.000 3.575 0.021 2.582 gi|15232133 Carbonic anhydrase, chloroplast precursor 2.907 0.000 3.599 0.001 7.765 0.001 4.757 gi|1711296 Myrosinase binding protein 2.916 0.000 4.833 0.000 6.517 0.000 4.755 gi|1769968 Myrosinase-associated protein 2.110 0.003 3.561 0.000 4.843 0.027 3.505 gi|18410661 Unknown protein 3.384 0.035 2.543 0.008 2.963 gi|28192642 Cysteine lyase BOCL-3 1.737 0.013 2.714 0.005 3.658 0.027 2.703 gi|42408130 Putative aminotransferase 2.063 0.007 2.003 0.001 2.793 0.025 2.286 gi|50508805 Putative (S)-2-hydroxy-acid oxidase 2.087 0.000 2.299 0.000 4.892 0.020 3.093 gi|79313265 Jacalin lectin family protein (JR1) 4.524 0.014 4.677 0.007 4.600 gi|15220620 Hydroxypyruvate reductase 1.813 0.027 1.482 0.161 3.574 0.033 2.693 gi|15221119 Aminomethyltransferase-like precursor protein 1.707 0.002 1.819 0.003 4.426 0.021 2.650 gi|15225449 Putative transketolase precursor 2.424 0.013 2.195 0.327 2.369 0.044 2.396 gi|15239032* Allene oxide synthase 3.500 0.054 4.163 0.049 4.163 gi|15239406 P-nitrophenylphosphatase-like protein 2.126 0.001 2.017 0.004 2.634 0.006 2.259 gi|157849706 Catalytic/coenzyme binding protein 1.746 0.067 2.301 0.043 2.301 gi|1617272* AMP-binding protein 1.502 0.091 2.404 0.017 2.404 gi|296223 Glutamate--ammonia ligase precursor 2.353 0.000 2.249 0.000 5.250 0.002 3.284 gi|30692947 Putative phosphoglycolate phosphatase 1.956 0.000 1.826 0.005 2.569 0.006 2.117 Hydroperoxide lyase (HPOL) like protein, containing gi|5281016* 2.933 0.215 7.273 0.011 7.273 pfam00067 Cytochrome P450 domain gi|6966930* Glutamine synthetase 1.173 0.395 1.301 0.317 5.327 0.000 5.327 Protein synthesis (2) gi|15232276* 50S ribosomal protein L12-C 2.399 0.002 0.958 0.764 0.982 0.962 2.399 gi|30692346* RPS1 (ribosomal protein S1); RNA binding 2.148 0.040 1.323 0.326 0.975 2.148 Protein folding, transporting and Degradation(11) gi|15241314 ATP-dependent Clp protease, ATP-binding subunit 2.283 0.014 2.597 0.002 2.167 0.148 2.440 60-kDa beta-polypeptide of plastid chaperonin-60 gi|167117 2.155 0.013 2.945 0.013 1.693 0.059 2.550 precursor gi|18399551 Complex 1 family protein / LVR family protein 1.412 0.038 2.675 0.014 2.044 gi|42565672 Plastid transcriptionally active 18 (PTAC16 ) 1.924 0.000 2.218 0.001 2.071

Table 2-2. Continued. Experiment 1 Experiment 2 Experiment 3 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC gi|75321947 DEAD-box ATP-dependent RNA helicase 35B 6.686 0.001 12.884 0.000 12.754 0.007 10.775 Hypothetical protein, containing COG1222 ATP- gi|15225545 2.303 0.000 1.600 0.000 3.433 0.000 2.446 dependent 26S proteasome regulatory subunit domain gi|15238369* Ribosomal protein L29 family protein 2.135 0.019 1.127 0.216 2.135 gi|2565436 DEGP protease precursor 1.481 0.007 2.053 0.003 4.659 0.040 2.731 gi|30684767* ATP-dependent peptidase/ATPase/ metallopeptidase 1.597 0.170 1.592 0.186 5.722 0.031 5.722 gi|77554415 Stromal 70 kDa heat shock-related protein, chloroplast 2.745 0.008 3.427 0.001 3.086 gi|841208 Trypsin inhibitor propeptide 1.907 0.005 2.707 0.016 4.022 0.024 2.879 Membrane and transport (5) gi|124360831 H+-transporting two-sector ATPase, alpha/beta subunit 1.693 0.000 1.587 0.001 5.066 0.004 2.782 Translocon at the inner envelope membrane of gi|15224625 2.460 0.004 1.934 0.005 2.197 chloroplast 55 gi|15228268* Apolipoprotein D-related 2.077 0.082 2.246 0.013 1.529 2.246 gi|2199574* Aquaporin PIP1b2 2.809 0.086 3.693 0.000 3.693 gi|5081423 Plasma membrane intrinsic protein 2 3.546 0.030 5.095 0.013 7.000 0.013 5.214 Stress and Defence (17) Unknown protein containing cd01958 and pfam00234 gi|15227359 domain, putative seed storage proteins and lipid 7.321 0.000 6.978 0.002 11.961 0.008 8.754 transfer proteins gi|1755154 Germin-like protein 3.626 0.000 4.533 0.000 8.589 0.000 5.583 gi|17813 BnD22 drought induced protein 2.490 0.000 2.913 0.000 9.806 0.000 5.070 gi|27372775 Lipoxygenase 2 2.180 0.001 3.319 0.000 9.880 0.000 5.126 gi|336422 Triazine-resistance 2.444 0.000 3.408 0.000 5.522 0.000 3.791 gi|5487875 Catalase 2.816 0.000 3.485 0.000 5.072 0.000 3.791 Unknown protein, containingg pfam04755 PAP-fibrillin gi|15229440 2.011 0.000 3.419 0.000 4.592 0.005 3.341 domain gi|158523427 Myrosinase 3.835 0.002 4.232 0.001 4.544 0.022 4.204 gi|18405273* Kelch repeat-containing protein 4.795 9.490 13.694 0.032 13.694 gi|18423233 Early responsive to dehydration 1 2.670 0.003 1.837 0.008 2.253 Jasmonate inducible protein containing pfam01419 gi|1883008* 1.390 1.902 7.666 0.000 7.666 Jacalin-like lectin domain

Table 2-2. Continued. Experiment 1 Experiment 2 Experiment 2 Average Accession Protein MC/GC P-value MC/GC P-value MC/GC P-value MC/GC gi|21554102 Putative chloroplast drought-induced stress protein 2.094 0.001 2.036 0.006 2.494 2.065 gi|30688146 Plastid-lipid associated protein PAP 2.093 0.000 2.967 0.000 3.739 2.530 gi|33285912* Putative myrosinase-binding protein 3 2.068 0.079 4.370 0.040 3.839 4.370 gi|62900701 Plastid lipid-associated protein 1, chloroplast precursor 1.638 0.000 2.574 0.000 2.811 2.106 gi|6522943 Myrosinase-associated protein 1.956 0.033 4.132 0.016 3.044 gi|66734182 Epithiospecifier protein 2.099 0.001 2.909 0.001 8.182 0.002 4.397 Signal transduction (2) gi|15220216 Ca2+-dependent membrane-binding protein annexin 1.447 0.029 2.911 0.018 5.720 0.085 2.179 gi|89513072* Annexin 1 3.404 0.003 3.404 Transcription (1) gi|15229384 Putative mRNA-binding protein 1.861 0.006 1.447 0.228 3.902 0.023 2.882 unknown (2) gi|15232724 Unknown protein 2.832 0.001 2.670 0.015 2.751 gi|18394322* Unknown protein 2.073 0.030 2.258 0.365 2.073 Miscellaneous (2) gi|15237201 Unknown protein, containing RHOD domain 2.037 0.007 2.271 0.015 3.465 2.154 gi|18418200* Rubredoxin family protein 2.141 0.047 2.783 0.089 1.976 0.474 2.141

Table 2-3. List of proteins significantly up-regulated in guard cells by ABA. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 Photosynthesis (14) gi|15231990 Light harvesting complex PSII (LHCB4.2) 2.23 0.02 2.13 0.40 3.30 0.02 2.06 0.10 2.77 gi|81301629 Photosystem I subunit VII 1.70 0.00 1.72 0.00 4.21 0.00 1.74 0.00 2.34 gi|8918361 Rubisco activase small isoform precursor 1.61 0.00 1.66 0.01 3.91 0.00 1.59 0.01 2.19 gi|18402859 Photosystem II subunit 1.26 0.16 1.26 0.25 1.91 0.00 1.29 0.04 1.60 gi|15232249 Putative chlorophyll A-B binding protein 1.64 0.00 1.99 0.00 1.91 0.00 1.68 0.00 1.80 gi|18266039 Chlorophyll a/b binding protein 1.53 0.00 1.81 0.00 2.18 0.00 1.58 0.00 1.77 gi|49359169 Photosystem II protein 1.52 0.00 1.83 0.00 1.20 0.32 1.40 0.00 1.58 gi|15230324 Photosystem II subunit O-2 1.75 0.01 1.67 0.00 1.52 0.07 1.45 0.00 1.62 gi|15224572 Photosystem II subunit P-2 1.72 0.00 1.52 0.03 1.77 0.03 1.41 0.03 1.61 gi|153012221 Photosystem I P700 apoprotein A1 1.59 0.00 1.06 0.84 1.98 0.01 1.35 0.05 1.64 LHC II Type III chlorophyll a /b binding gi|515616 1.58 0.00 1.42 0.06 1.18 0.13 1.43 0.00 1.50 protein gi|29839389 Ferritin-1, chloroplast precursor 1.53 0.02 1.54 0.14 1.71 0.13 1.68 0.01 1.60 Unnamed protein product, containing gi|126633416 pfam00504 1.82 0.01 2.31 0.01 2.80 0.03 1.67 0.04 2.15 chlorophyll A-B binding protein domain gi|15234637 Photosystem II subunit Q-2 1.26 0.01 1.62 0.02 1.83 0.00 1.36 0.02 1.52 Energy (7) gi|7431171 Cytosolic malate dehydrogenase 2.03 0.01 3.10 0.00 2.13 0.01 2.35 0.01 2.40 gi|153012206 ATP synthase CF1 alpha subunit 1.61 0.00 1.64 0.00 2.37 0.00 1.62 0.00 1.81 gi|30684540 DNA-directed DNA polymerase 1.12 0.16 1.70 0.01 1.77 0.00 1.14 0.12 1.74 gi|4218951 Fructose-1,6-bisphosphatase precursor 0.96 0.70 1.58 0.00 1.75 0.00 1.02 0.68 1.67 gi|90194338 LOS, containing cd03313 enolase domain 2.01 0.00 2.30 0.00 2.00 0.07 1.35 0.21 2.15 Putative glycosyl hydrolase of unknown gi|30684197 1.09 0.20 0.93 0.66 2.10 0.00 1.79 0.03 1.95 function gi|15235720 Cytochrome c oxidase-related 1.06 0.09 1.88 0.00 1.06 0.48 0.99 0.90 1.88 Metabolism (10) gi|15229530 Putative glutamine synthetase 1.40 0.00 1.83 0.00 2.19 0.00 1.22 0.01 1.66 gi|51091903 Sterol carrier protein 2-like 1.43 0.01 1.74 0.24 1.81 0.00 1.32 0.01 1.52

Table 2-3. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 gi|79327530 Asparagine synthase 3 1.00 0.98 1.59 0.00 1.44 0.01 1.10 0.12 1.51 Aspartate/glutamate/uridylate kinase family gi|15230338 1.43 0.03 1.84 0.00 1.82 0.00 1.50 0.02 1.65 protein gi|79328724 Uridylate kinase 1.04 0.64 1.68 0.00 1.53 0.04 1.17 0.11 1.60 gi|121550795 Nitrilase 1 1.78 0.02 1.87 0.06 3.90 0.02 1.57 0.10 2.84 Phospholipid/glycerol acyltransferase family gi|42566190 1.23 0.12 1.80 0.02 2.33 0.02 1.17 0.37 2.07 protein gi|14388188 Biotin carboxylase 1.37 0.03 1.22 0.13 2.04 0.01 1.30 0.03 1.57 Dihydroorotate dehydrogenase/oxidase gi|15229529 1.14 0.14 1.47 0.22 1.54 0.03 1.19 0.09 1.54 family protein gi|1777375 Aspartate kinase-homoserine 1.10 0.56 0.71 0.49 1.53 0.01 0.86 0.22 1.53 dehydrogenase Transcription (5) gi|18410283 SC35-like splicing factor 30 1.14 0.07 1.29 0.25 1.89 0.04 1.29 0.07 1.89 Unnamed protein product,containing gi|147224051 1.64 0.03 1.04 0.80 3.77 0.02 1.40 0.04 2.27 cd01732 LSm5 domain gi|124360159 Histone H2A; Histone-fold 1.23 0.16 3.07 0.01 2.22 0.00 1.94 0.01 2.41 gi|15226943 Putative histone H2B 1.47 0.04 1.68 0.03 2.26 0.03 1.50 0.13 1.80 gi|15223948 HTA5; DNA binding 1.16 0.43 1.48 0.04 1.86 0.00 1.35 0.14 1.67 Protein synthesis (3) gi|15234970 40S ribosomal protein S25 1.41 0.00 1.47 0.04 1.88 0.00 1.43 0.00 1.55 gi|15229706 60S acidic ribosomal protein 1.27 0.00 2.14 0.00 1.56 0.00 1.41 0.00 1.60

4D11_26,containing histone H3 domain and gi|72384424 1.47 0.01 2.22 0.03 2.54 0.00 1.53 0.00 1.94 ribosomal protein S6e domain

Signaling (1) gi|15232210 Rab GDP-dissociation inhibitor 1.11 0.35 1.55 0.01 1.58 0.00 1.13 0.11 1.56 Membrane and transport (3) gi|15232110 Vacuolar membrane ATPase subunit G 1.32 0.19 1.66 0.00 3.15 0.00 1.37 0.00 2.06 gi|15225796 Synaptobrevin-related protein 1 1.32 0.07 2.06 0.00 1.61 0.01 1.55 0.00 1.74 gi|157849742 Altered response to gravity 1 1.66 0.06 2.06 0.02 2.69 0.01 1.66 0.04 2.14

Table 2-3. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 Protein folding and degradation (4) gi|15226467 Cyclophilin 2.23 0.00 2.06 0.01 8.25 0.00 2.08 0.00 3.66 gi|22331378 DEGP protease 1 1.39 0.00 1.69 0.00 1.96 0.00 1.35 0.00 1.60 gi|18391078 Xylem bark cysteine peptidase 3 1.26 0.46 1.86 0.09 1.65 0.02 1.46 0.14 1.65 gi|18416749 COP9 signalosome subunit 6B 1.22 0.10 1.53 0.00 1.70 0.01 1.20 0.20 1.61 Stress and defense (14) gi|157849658 Stress-induced protein KIN2 1.17 0.22 1.35 0.02 1.92 0.02 1.15 0.05 1.64 gi|18418200 Enhancer of SOS3-1 (ENH1) 1.45 0.00 1.55 0.04 1.68 0.00 1.37 0.06 1.56 gi|130845790 Lipoxygenases (LOX) 1.21 0.52 1.85 0.05 1.37 0.27 1.40 0.01 1.63 gi|40388501 Glutathione peroxidase (GPX) 1.01 0.86 1.62 0.04 0.86 0.36 0.96 0.65 1.62 gi|119655911 Thiol methyltransferase 1.33 0.03 1.68 0.00 1.97 0.00 1.29 0.06 1.66 gi|2204102 Glutathione-S-transferase 8 (GST8) 1.24 0.00 1.96 0.01 2.27 0.00 1.19 0.04 1.67 gi|1890354 L-ascorbate peroxidase (APX) 0.94 0.72 1.61 0.00 0.80 0.37 1.06 0.74 1.61 gi|45593261 Putative protein disulphide isomerase 1.56 0.01 1.71 0.04 3.09 0.00 1.49 0.00 1.96 gi|18418013 Glutamine synthetase 1;4 1.43 0.01 1.65 0.00 0.93 0.70 1.20 0.16 1.54 gi|146150661 Resistance-gene-interacting protein RIN4 1.18 0.13 1.45 0.05 1.96 0.00 1.20 0.11 1.70 Phospholipid hydroperoxide glutathione gi|15234243 1.47 0.07 1.97 0.02 2.08 0.03 1.69 0.05 1.91 peroxidase gi|15225245 Bet v I allergen family protein 1.04 0.59 1.45 0.01 1.56 0.00 1.07 0.36 1.51 gi|15239559 Myrosinase TGG2 1.72 0.04 1.19 0.26 1.29 0.01 1.14 0.54 1.50 gi|1769968 Myrosinase-associated protein 1.63 0.02 1.57 0.03 1.50 0.03 1.36 0.04 1.52 Cell structure (1) gi|15241179 Tubulin alpha-5 1.00 0.93 2.06 0.00 1.40 0.01 0.99 0.70 1.73 Cell division and fate (1) gi|15238333 Cell division protein FtsH 1.06 0.53 1.57 0.00 1.46 0.00 1.10 0.17 1.51 Unknown (3) gi|15222996 Unknown protein 1.17 0.28 1.13 0.39 1.84 0.01 1.26 0.03 1.55 gi|18405887 Unknown protein 1.20 0.01 1.44 0.28 2.55 0.01 1.18 0.13 1.87 gi|30681554 Unknown protein 1.10 0.10 1.73 0.00 0.91 0.43 1.10 0.10 1.73

Table 2-4. List of proteins significantly down-regulated in guard cells by ABA. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 Photosynthesis (2) gi|406727 Rubisco small subunit 0.86 0.09 0.64 0.03 0.52 0.00 0.63 0.00 0.60 gi|552959 Rubisco large subunit 0.91 0.18 0.52 0.02 0.42 0.01 0.66 0.18 0.47 Energy (6) gi|15219721 Putative malate dehydrogenase 0.99 0.60 1.03 0.40 0.66 0.00 0.98 0.24 0.66 gi|15222848 Glyceraldehyde-3-phosphate dehydrogenase 0.75 0.04 0.44 0.00 0.32 0.00 0.55 0.01 0.51 gi|15230749 Galactose kinase 0.86 0.22 0.95 0.62 0.49 0.04 0.75 0.22 0.49 gi|15219379 Succinic semialdehyde dehydrogenase 0.95 0.10 0.63 0.01 0.63 0.00 0.87 0.28 0.63 ORF B, containing plant ATP synthase F0 gi|1096966 0.91 0.28 0.53 0.00 0.67 0.00 0.74 0.02 0.64 domain Hypothetical protein,containing fructose-1,6- gi|125524180 0.84 0.09 0.66 0.00 0.60 0.02 0.87 0.23 0.63 bisphosphate aldolase domain Metabolism (8) gi|15231926 Rhamnose biosynthesis 3 1.00 0.97 0.51 0.00 0.68 0.01 0.80 0.04 0.66 gi|15220885 Spermidine synthase 1 0.80 0.19 0.67 0.02 0.74 0.26 0.64 0.03 0.65 gi|15225045 12-oxophytodienoate-10,11-reductase 0.93 0.24 0.54 0.00 0.70 0.01 0.84 0.42 0.62 gi|15220946 Acyl-CoA oxidase 3 0.89 0.28 0.69 0.05 0.54 0.01 1.01 0.95 0.62 gi|145337526 Phosphoribosylformylglycinamidine synthase 0.60 0.01 1.08 0.53 1.31 0.65 0.64 0.02 0.62 gi|18390900 Strictosidine synthase family protein 1.02 0.92 0.75 0.00 0.57 0.01 0.84 0.06 0.66 gi|15240774 Tudor domain-containing protein 0.67 0.01 0.99 0.88 0.61 0.01 0.91 0.45 0.64 Diadenosine 5',5'''-P1,P4-tetraphosphate gi|15228345 1.03 0.88 1.00 0.97 0.58 0.05 0.93 0.20 0.58 hydrolase Transcription (2) gi|15232536 HTA11 0.83 0.06 0.62 0.00 0.70 0.01 0.70 0.15 0.66 gi|18401305 Argonaute 4 (AGO4) 0.78 0.09 0.73 0.02 0.53 0.01 0.82 0.11 0.63 Protein synthesis (7) Translationally-controlled tumor protein gi|20140684 0.66 0.00 0.91 0.44 0.45 0.03 0.73 0.01 0.62 homolog gi|23928437 Putative 40S ribosomal protein 1.01 0.95 0.46 0.02 0.70 0.18 0.74 0.05 0.60 gi|15226755 60S ribosomal protein L18A 0.88 0.15 0.53 0.00 0.67 0.01 0.90 0.42 0.60

Table 2-4. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 gi|15218274 U2 small nuclear ribonucleoprotein A 0.88 0.42 0.61 0.01 0.66 0.02 0.93 0.53 0.64 gi|118197456 Putative elongation factor 1-beta 1.04 0.82 0.50 0.04 0.97 0.91 0.88 0.61 0.50 gi|15223829 ATP binding / aminoacyl-tRNA ligase 0.92 0.10 0.65 0.00 0.76 0.12 0.99 0.88 0.65 Small nuclear ribonucleoprotein gi|15241519 0.80 0.10 0.65 0.02 0.74 0.32 0.90 0.18 0.65 associated protein Protein folding and degradation (4) gi|15240578 Heat shock protein 70-7 (cpHSC70-2) 0.59 0.00 0.69 0.01 0.35 0.00 0.55 0.01 0.55 gi|15233268 20S proteasome subunit C1 (PAC1) 1.02 0.91 1.34 0.63 0.51 0.04 0.90 0.77 0.51 gi|78059506 26S proteasome subunit alpha 4 (PAD1) 0.90 0.79 0.68 0.02 0.64 0.41 0.56 0.04 0.62 gi|15222913 Putative chloroplast FtsH protease 0.79 0.15 0.66 0.04 0.82 0.13 0.79 0.46 0.66 Signaling (1) gi|44917165 14-3-3 i-2 protein 1.54 0.09 0.23 0.00 0.74 0.01 0.79 0.21 0.48 Membrane and transport (4) gi|15235964 Putative coatomer beta subunit 0.76 0.14 0.60 0.00 0.66 0.10 0.73 0.01 0.66 Chloroplast inner membrane gi|15229430 0.93 0.44 0.61 0.00 0.59 0.01 0.75 0.02 0.65 methyltransferase gi|55274626 Plasma membrane proton ATPase 5 0.76 0.29 0.58 0.05 0.61 0.02 0.71 0.07 0.60 Ca2+-dependent membrane-binding gi|15220216 0.99 0.96 0.49 0.05 0.88 0.68 1.00 0.99 0.49 protein annexin Stress and defense (3) gi|15231718 Peroxiredoxin type 2 0.67 0.01 0.66 0.03 0.69 0.36 0.63 0.02 0.65 gi|15227119 Glutathione S-transferase 6 1.02 0.95 0.86 0.57 0.57 0.03 0.96 0.79 0.57 gi|3062793 Thioredoxin 0.78 0.06 0.58 0.01 0.43 0.02 0.71 0.02 0.57 Unknown (1) gi|15224568 Unknown protein 1.07 0.64 0.63 0.02 0.70 0.05 0.92 0.20 0.67

Table 2-5. Sequence enriched in upstream regions of the genes encoding proteins with more than 1.5-fold change in response to ABA. (A) PLACE analysis Group ACGT ACGTG ACGTGKC YACGTGGC CCACGTGG Up- 66IDs 52/66(78.8%) 30/52(57.7%) 0/52(0.0%) 2/52(3.8%) 3/52(5.8%) Down- 38IDs 24/38(63.2%) 10/24(41.7%) 1/24(4.2%) 3/24(12.5%) 0/24(0.0%) All 76/104(73.1%) 40/76(52.6%) 1/76(1.3%) 5/76(6.6%) 3/76(3.9%)

(B) Motif analysis of up-regulated group (66 IDs)

Absolute number in Observed in Absolute number Observed in Sequence P value the selected genes selected genes in genomic set genomic set

ACGTGG 36 24/66(36.4%) 5420 4361/33282 1.12e-06 CCACGT 36 24/66(36.4%) 5420 4361/33282 1.12e-06 CACGTG 46 18/66(27.3%) 7678 3212/33282 2.77e-05 ACACGT 36 24/66(36.4%) 7331 5565/33282 6.55e-05 ACGTGT 36 24/66(36.4%) 7331 5565/33282 6.55e-05

Absolute number in Observed in Absolute number Observed in Sequence P value the selected genes selected genes in genomic set genomic set

ACGTAG 8 8/38(21.1%) 3121 2850/33282 9.64e-03 CTACGT 8 8/38(21.1%) 3121 2850/33282 9.64e-03 ACGTAC 9 8/38(21.1%) 3740 2855/33282 9.73e-03 GTACGT 9 8/38(21.1%) 3740 2855/33282 9.73e-03 CACGTA 10 9/38(23.7%) 4165 3781/33282 1.56e-02 TACGTG 10 9/38(23.7%) 4165 3781/33282 1.56e-02

(D) Motif analysis of total ABA-responsive group (104 IDs)

Absolute number in Observed in Absolute number Observed in Sequence P value the selected genes selected genes in genomic set genomic set

ACGTGG 44 30/104(28.8%) 5420 4361/33282 1.19e-05 CCACGT 44 30/104(28.8%) 5420 4361/33282 1.19e-05 CACGTG 54 22/104(21.2%) 7678 3212/33282 2.14e-04 ACACGT 48 31/104(29.8%) 7331 5565/33282 3.69e-04 ACGTGT 48 31/104(29.8%) 7331 5565/33282 3.69e-04

Table 2-6. List of proteins significantly up-regulated in guard cells by MeJA. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116

Photosynthesis (8)

Putative chlorophyll A-B binding gi|15232249 2.88 0.03 3.19 0.03 2.07 0.08 8.09 0.01 4.72 protein 2.3 gi|18266039 Chlorophyll a/b binding protein 3.94 0.01 6.37 0.01 3.63 0.01 3.31 0.03 4.31 LHCII Type III chlorophyll a/b binding gi|405617 3.63 0.01 2.94 0.02 4.53 0.04 3.84 0.19 3.70 protein gi|7267731 Chlorophyll a/b-binding protein-like 3.22 0.03 2.86 0.05 1.87 0.08 3.70 0.18 3.04 gi|15222551 Phosphoribulokinase precursor 1.42 0.21 0.95 0.87 2.15 0.03 0.81 0.65 2.15 Chloroplast Rubisco small subunit gi|79013990 2.03 0.03 1.17 0.53 1.34 0.52 0.97 0.88 2.03 precursor gi|262400776 Photosystem I subunit VII 0.95 0.50 1.00 0.75 1.00 0.87 2.00 0.03 2.00 gi|75250014 Photosystem II subunit S 2.27 0.01 2.25 0.02 2.40 0.02 2.75 0.02 2.42 Energy (14) gi|75325224 Cytochrome c oxidase subunit 2 0.93 0.81 0.95 0.90 0.95 0.92 2.27 0.03 2.27 NADP-dependent malate gi|75311627 1.84 0.01 1.71 0.01 1.72 0.01 1.15 0.07 1.75 dehydrogenase gi|743641 Phosphoenolpyruvate carboxylase 2.47 0.01 1.28 0.22 1.58 0.04 0.69 0.19 2.03 gi|12643432 V-type proton ATPase subunit E1 2.05 0.01 1.87 0.02 1.94 0.01 1.50 0.13 1.95 gi|12644156 ATPase 1, plasma membrane-type 1.87 0.00 1.07 0.64 1.38 0.03 1.53 0.01 1.59 gi|262400757 ATP synthase subunit beta 1.64 0.00 1.58 0.00 1.57 0.00 1.45 0.01 1.56 ATP synthase subunit beta-3, gi|75333362 2.33 0.00 2.23 0.00 2.03 0.00 1.27 0.04 1.97 mitochondrial gi|262400756 ATP synthase subunit alpha 1.19 0.09 1.15 0.11 0.98 0.14 4.06 0.00 4.06 gi|75218880 ATP synthase gamma chain 1.53 0.10 1.45 0.20 1.60 0.03 1.00 0.79 1.60 gi|75246084 Phosphoglycerate kinase 1.67 0.00 1.56 0.01 1.56 0.00 1.85 0.00 1.66 gi|119720766 Hydrogen-transporting ATP synthase 4.17 0.05 4.09 0.06 4.33 0.05 1.15 0.79 4.25 ATP synthase subunit d, gi|25089786 2.54 0.03 3.66 0.01 1.98 0.05 1.38 0.22 3.10 mitochondrial gi|461550 ATP synthase gamma chain 1 3.80 0.00 2.73 0.01 2.68 0.02 1.60 0.14 3.07 gi|18391442 Subunit C of the vacuolar H+-ATPase 2.05 0.02 1.89 0.03 1.82 0.04 1.12 0.88 1.92

100

Table 2-6. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116

Metabolism (21) gi|15241189 Embryo defective 2734 (EMB2734) 1.34 0.09 1.36 0.09 1.69 0.00 1.13 0.28 1.69 gi|122178786 Gamma-glutamylcysteine synthetase 2.44 0.02 2.27 0.03 2.33 0.02 1.46 0.26 2.35 gi|122236395 Cysteine synthase 1.46 0.59 1.33 0.45 1.28 0.41 2.19 0.04 2.19 gi|75265389 Alpha-xylosidase (XYL1) 1.54 0.12 1.57 0.45 1.37 0.56 2.33 0.02 2.33 gi|30696904 Xylose isomerase family protein 2.65 0.04 1.50 0.33 2.05 0.07 0.60 0.09 2.65 gi|17827 3-isopropylmalate dehydrogenase 2.40 0.04 2.29 0.04 2.44 0.04 2.31 0.05 2.38 Unnamed protein product, containing gi|134273558 serine-glycine 1.12 0.43 2.05 0.00 1.09 0.82 0.74 0.06 2.05 hydroxymethyltransferase domain dTDP-glucose 4-6-dehydratase - like gi|15237853 2.03 0.04 1.61 0.11 1.50 0.15 0.86 0.57 2.03 protein UDP-d-apiose/UDP-d-xylose gi|75315930 1.84 0.00 1.49 0.01 1.63 0.02 1.54 0.01 1.62 synthase gi|15236129 Aspartate aminotransferase 5 1.77 0.04 1.91 0.04 1.77 0.03 1.36 0.11 1.82 gi|15241486 Carbonic anhydrase 2 1.66 0.09 1.98 0.04 1.21 0.66 1.02 0.60 1.98 Formate dehydrogenase, gi|21263610 1.69 0.08 1.82 0.02 1.50 0.04 0.69 0.64 1.66 mitochondrial gi|122216331 Glycolate oxidase 2.40 0.00 2.07 0.00 2.01 0.00 1.92 0.00 2.10 gi|54043095 Glycolate oxidase 1.61 0.04 1.57 0.03 1.25 0.16 1.58 0.03 1.59 gi|75103951 Oxalic acid oxidase 1.32 0.28 1.34 0.20 1.84 0.05 18.54 0.01 18.54 gi|75249348 Enoyl-[acyl-carrier protein] reductase 1.67 0.03 1.56 0.10 1.82 0.02 1.64 0.19 1.75 UTP-glucose-1-phosphate gi|12585448 1.54 0.01 1.57 0.01 1.49 0.01 1.42 0.03 1.50 uridylyltransferase 1

Glucose-1-phosphate gi|17865468 adenylyltransferase small subunit, 2.29 0.00 2.33 0.00 2.11 0.00 1.24 0.61 2.24 chloroplastic (GLGS) gi|187936039 Putative ADP-ribosylation factor 4.74 0.05 2.44 0.05 1.67 0.78 2.42 0.18 2.44 Aldehyde dehydrogenase family 2 gi|118595573 2.23 0.02 2.36 0.02 2.15 0.04 2.70 0.02 2.36 member B7, mitochondrial (AL2B7) gi|13432260 Triosephosphate isomerase, cytosolic 3.05 0.08 2.31 0.13 2.36 0.04 0.53 0.39 2.36

101

Table 2-6. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116

Protein synthesis (2) gi|15238142 40S ribsomal protein S6 6.14 0.03 3.10 0.03 3.16 0.17 0.30 0.48 4.62 4D11_26, containing histone H3 and gi|72384424 2.88 0.03 2.25 0.06 2.40 0.05 0.99 0.79 2.88 ribosomal protein S6e domain

Protein synthesis and degradation (6)

60-kDa beta-polypeptide of plastid gi|167117 1.66 0.03 1.37 0.11 1.53 0.03 1.36 0.11 1.59 chaperonin-60 precursor

RuBisCO large subunit-binding gi|1351030 1.94 0.00 1.92 0.00 1.96 0.00 1.85 0.00 1.92 protein subunit alpha, chloroplastic

Probable mitochondrial-processing gi|85700445 3.05 0.00 3.13 0.00 2.40 0.00 1.36 0.88 2.86 peptidase subunit beta (MPPB) 26S protease regulatory subunit 6A gi|75337114 1.89 0.05 2.29 0.01 1.56 0.20 1.47 0.37 2.29 homolog gi|99676 Chaperonin hsp60 precursor 1.92 0.05 1.53 0.14 1.20 0.50 1.74 0.15 1.92 Protein disulfide isomerase (PDI)-like gi|75283326 1.91 0.03 1.63 0.07 1.92 0.03 1.21 0.35 1.91 protein Signaling (4)

Protein phosphatase 2A regulatory gi|15222248 8.02 0.03 12.59 0.00 5.75 0.01 4.25 0.08 8.79 subunit Probable calcium-binding protein gi|75332066 1.71 0.04 1.80 0.03 2.01 0.01 1.56 0.05 1.77 CML13 Serine/threonine-protein kinase gi|75331830 1.50 0.05 1.53 0.04 1.34 0.13 1.29 0.21 1.51 SRK2E gi|122215093 Calmodulin 5 2.05 0.01 2.11 0.03 1.79 0.06 2.94 0.01 2.37 Membrane and transport (1)

Hypothetical protein OsI_024484, gi|125557716 containing Arf1-Arf5-like subfamily 1.50 0.03 1.53 0.00 1.80 0.00 1.27 0.00 1.53 domain Stress and defense (18) gi|914911 Germin-like protein 2.01 0.04 1.09 0.11 1.45 0.12 11.48 0.02 6.75 gi|157849698 Superoxide dismutase 2.81 0.00 2.47 0.00 3.05 0.00 1.89 0.03 2.55

102

Table 2-6. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 gi|15218518 Putative glutathione S-transferase 3.25 0.05 3.31 0.06 2.61 0.06 2.44 0.08 3.25 gi|83032224 Type 2 peroxiredoxin 1.34 0.44 1.27 0.55 3.16 0.04 1.37 0.56 3.16 Putative 2-cys peroxiredoxin BAS1 gi|15229806 2.56 0.03 2.81 0.02 2.31 0.04 1.32 0.67 2.56 precursor gi|75248680 Ascorbate peroxidase 3.22 0.02 2.83 0.02 2.65 0.02 1.14 0.64 2.90 gi|15241113 Heat shock protein 81-3 (HSP81-3) 1.22 0.10 1.33 0.08 1.57 0.01 1.01 0.53 1.57 Late embryogenesis abundant family gi|75099813 2.31 0.00 2.31 0.00 2.61 0.00 1.60 0.00 2.21 protein gi|169244541 Superoxide dismutase 1.91 0.02 2.01 0.02 1.94 0.02 1.32 0.07 1.95 gi|2204102 Glutathione-S-transferase 1.61 0.11 1.82 0.05 1.89 0.07 1.20 0.56 1.82 gi|15240578 Heat shock protein 70-7 1.42 0.18 1.38 0.15 1.77 0.02 0.55 0.43 1.77 gi|15237159 Root phototropism 3 (RPT3); ATPase 1.20 0.50 1.75 0.05 1.49 0.12 1.22 0.31 1.75 gi|15241849 Heat shock cognate 70 kDa protein 1 1.63 0.03 1.14 0.40 1.26 0.41 0.65 0.10 1.63 gi|157849720 Heat shock protein 81-4 1.56 0.04 1.61 0.04 1.26 0.23 1.67 0.02 1.62 gi|75312290 Glycerol kinase NHO1 1.63 0.02 1.49 0.03 1.53 0.01 1.61 0.01 1.56 gi|75299507 Lipoxygenase 1.77 0.02 1.98 0.03 1.67 0.04 2.44 0.54 1.81 gi|75263009 Early-responsive to dehydration 9 2.11 0.04 1.92 0.05 2.13 0.04 1.66 0.07 2.05 Polygalacturonase inhibitor-like gi|75274048 1.69 0.05 1.75 0.06 1.94 0.05 2.00 0.04 1.97 protein

Cell division, differentiation and fate (1) gi|2499441 Proliferating cell nuclear antigen 1.61 0.13 1.56 0.11 1.80 0.08 2.86 0.02 2.86

Cell structure (1) gi|75216938 Curculin-like lectin family protein 1.53 0.21 1.67 0.10 1.56 0.19 2.51 0.04 2.51

103

Table 2-7. List of proteins significantly down-regulated in guard cells by MeJA. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116

Photosynthesis (9) gi|262400730 Photosystem II CP43 chlorophyll apoprotein 0.31 0.00 0.28 0.00 0.39 0.01 1.22 0.50 0.33 gi|262400729 Photosystem II protein D2 0.54 0.10 0.47 0.04 0.56 0.07 1.31 0.50 0.47 gi|262400775 Photosystem I P700 chlorophyll a apoprotein 0.41 0.01 0.41 0.01 0.34 0.01 0.36 0.16 0.38 gi|75294948 Rubisco large chain 0.53 0.01 0.44 0.01 0.43 0.18 0.42 0.00 0.46 gi|4033349 Phosphoenolpyrovate carboxylase 0.74 0.28 0.36 0.02 0.42 0.01 0.49 0.02 0.43 gi|81301541 Photosystem II protein D1 0.31 0.01 0.37 0.00 0.45 0.03 1.47 0.29 0.38 gi|262400743 Photosystem II CP47 chlorophyll apoprotein 0.28 0.00 0.21 0.00 0.27 0.00 0.34 0.01 0.28 gi|22329337 Sucrose-phosphate synthase/ transferase 0.34 0.01 0.28 0.03 0.60 0.19 1.32 0.63 0.31 gi|262400774 Photosystem I P700 apoprotein A1 0.14 0.00 0.12 0.00 0.15 0.00 0.20 0.00 0.15 Energy (5) gi|15235730 Putative phosphoenolpyruvate carboxykinase 0.66 0.13 0.19 0.00 0.54 0.08 0.11 0.03 0.15 gi|15219234 ATPase 70 kDa subunit, putative 0.63 0.06 0.52 0.02 0.55 0.04 0.67 0.34 0.54 2-oxoglutarate dehydrogenase, E1 gi|15239128 0.28 0.00 0.36 0.00 0.36 0.01 0.35 0.01 0.34 component 2-oxoglutarate dehydrogenase, E1 -like gi|75183214 0.58 0.22 0.53 0.14 0.63 0.24 0.23 0.03 0.23 protein NADH-ubiquinone oxidoreductase 75 kDa gi|30693102 0.72 0.20 0.66 0.05 0.86 0.44 0.77 0.14 0.66 subunit Metabolism (6) gi|75707983 2-isopropylmalate synthase 1 0.44 0.01 0.57 0.02 0.42 0.00 0.52 0.01 0.49 gi|121550795 Nitrilase 1 0.29 0.02 0.61 0.02 0.43 0.02 1.57 0.85 0.44 Succinate dehydrogenase flavoprotein gi|15240075 0.28 0.00 0.30 0.02 0.48 0.01 0.57 0.03 0.41 subunit gi|15226055 Putative fatty acid elongase 0.29 0.02 0.39 0.03 0.33 0.02 0.52 0.09 0.34 gi|15221119 Aminomethyltransferase-like precursor protein 0.20 0.00 0.50 0.03 0.31 0.02 0.32 0.04 0.33 gi|75180270 Alanine-2-oxoglutarate aminotransferase 0.47 0.05 0.61 0.16 0.91 0.83 0.37 0.02 0.42 Transcription related (5) gi|18401305 Argonaute 4 (AGO4) 0.34 0.05 0.31 0.03 0.41 0.09 0.30 0.03 0.32

104

Table 2-7. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116 gi|15218011 High mobility group protein (HMG1), putative 0.24 0.02 0.13 0.31 0.20 0.05 0.12 0.11 0.22 gi|15238563 Histone H2B-like protein 1.19 0.78 1.24 0.87 1.07 0.91 0.21 0.05 0.21 gi|121907 Histone H1.2 0.61 0.09 0.69 0.18 0.75 0.42 0.46 0.00 0.46 gi|22326646 Tudor domain-containing protein 0.22 0.05 0.14 0.02 0.35 0.00 0.31 0.04 0.26 Protein synthesis (2) gi|15241316 40S ribosomal protein S8 (RPS8A) 0.59 0.17 0.74 0.33 0.43 0.03 1.12 0.89 0.43 gi|75328787 Elongation factor 1-alpha 0.75 0.18 0.46 0.00 0.90 0.63 0.50 0.00 0.48 Signaling (4) gi|15222111 Putative calcium-binding protein, calreticulin 0.64 0.01 0.63 0.01 0.66 0.01 0.52 0.03 0.61 gi|15225924 Putative mitogen-activated protein kinase 0.57 0.05 0.44 0.01 0.51 0.02 0.34 0.00 0.46 gi|4324971 Phospholipase D2 0.44 0.02 0.60 0.07 0.38 0.01 0.65 0.15 0.41 gi|75262749 Extracellular calcium sensing receptor 0.88 0.38 0.70 0.29 1.00 0.75 0.44 0.04 0.44 Membrane and transport (6) gi|15218215 Coatomer protein complex subunit beta 2 0.40 0.01 0.44 0.02 0.43 0.01 0.65 0.16 0.43 gi|15220684 Coatomer protein complex subunit alpha 0.39 0.00 0.40 0.01 0.34 0.00 0.28 0.00 0.35 gi|157849652 Pollen coat protein 0.94 0.98 0.79 0.27 1.05 0.72 0.38 0.00 0.38 gi|42563757 Clathrin heavy chain, putative 0.34 0.08 0.33 0.05 0.50 0.16 0.51 0.14 0.33 gi|1199503 Transmembrane channel protein 0.39 0.05 0.19 0.01 0.47 0.07 0.95 0.93 0.29 gi|399091 Vacuolar membrane proton pump 1 (AVP1) 0.26 0.05 0.17 0.02 0.22 0.04 0.70 0.55 0.22 Stress and defense (8) gi|15224796 Putative WD-40 repeat protein (MSI4) 0.53 0.04 0.47 0.03 0.60 0.14 0.45 0.08 0.50 gi|15234010 Glycine-rich protein 2 (GRP2) 0.47 0.05 1.00 0.99 0.54 0.16 0.82 0.68 0.47 gi|158523427 Myrosinase 0.39 0.02 0.35 0.03 0.36 0.00 0.15 0.04 0.31 gi|15225798 3-ketoacyl-CoA thiolase 0.44 0.01 0.48 0.03 0.62 0.09 0.50 0.11 0.46 gi|157849770 ERD12 protein 0.69 0.02 0.61 0.31 0.50 0.08 0.21 0.01 0.45 gi|75127356 Water stress induced protein 0.03 0.00 0.03 0.00 0.07 0.01 0.04 0.01 0.04 gi|77999357 Protein disulfide isomerase 0.74 0.91 1.03 0.95 1.06 0.65 0.02 0.04 0.02 gi|231995 Dehydrin Rab18 (DHR18) 0.37 0.12 0.48 0.28 0.31 0.02 0.35 0.09 0.31

105

Table 2-7. Continued. P Val P Val P Val P Val Accession Name 117:113 118:114 119:115 121:116 Average 117:113 118:114 119:115 121:116

Cell structure (1) gi|15230191 Actin 2 0.53 0.03 0.65 0.11 0.57 0.04 0.73 0.30 0.55 Unknown (1) gi|37999993 Unknown protein, containing CBS domain 0.52 0.06 0.35 0.08 0.15 0.04 0.21 0.03 0.18

106

Table 2-8. Motif analysis of genes encoding the MeJA responsive proteins (upstream 500bp). Absolute Number in Observed in Absolute Number Observed in Motif Sequence P Value Selected Genes Selected Genes in Genomic Set Genomic Set

TGAGCC 23 23/123 (18.70%) 3032 2805/33602 (8.35%) 1.30E-04 GCCCAT 46 37/123 (30.08%) 7924 5749/33602 (17.11%) 1.52E-04 GCCCAG 15 15/123 (12.20%) 1712 1590/33602 (4.73%) 4.99E-04 TGCCTT 8 6/123 (4.88%) 4957 4518/33602 (13.44%) 1.16E-03 ACGGCC 15 13/123 (10.57%) 1512 1388/33602 (4.13%) 1.21E-03 GGCCGT 15 13/123 (10.57%) 1512 1388/33602 (4.13%) 1.21E-03 GGCCCA 56 34/123 (27.64%) 8914 5930/33602 (17.65%) 1.90E-03 TGGGCC 56 34/123 (27.64%) 8914 5930/33602 (17.65%) 1.90E-03 GCCAAT 33 29/123 (23.58%) 5342 4853/33602 (14.44%) 2.31E-03 AGGCCC 33 26/123 (21.14%) 5238 4180/33602 (12.44%) 2.32E-03 GGGCCT 33 26/123 (21.14%) 5238 4180/33602 (12.44%) 2.32E-03 AGCCGC 14 12/123 (9.76%) 1451 1377/33602 (4.10%) 3.10E-03 TTGCCC 18 18/123 (14.63%) 2748 2576/33602 (7.67%) 3.38E-03 GCCCCA 11 11/123 (8.94%) 1311 1265/33602 (3.76%) 4.51E-03 CGCCAT 17 17/123 (13.82%) 2625 2456/33602 (7.31%) 4.63E-03 GGCCCC 7 7/123 (5.70%) 666 640/33602 (1.90%) 6.94E-03 GGGGCC 7 7/123 (5.70%) 666 640/33602 (1.90%) 6.94E-03 GCCCAA 48 33/123 (26.83%) 8666 6384/33602 (19.00%) 8.63E-03

107

Table 2-8. Continued. Absolute Number in Observed in Absolute Number Observed in Motif Sequence P Value Selected Genes Selected Genes in Genomic Set Genomic Set

GGGCCA 19 17/123 (13.82%) 2920 2663/33602 (7.92%) 9.04E-03 TGGCCC 20 17/124 (13.82%) 2921 2663/33602 (7.92%) 9.04E-03 AGCCCA 52 31/123 (25.20%) 8502 6092/33602 (18.13%) 1.24E-02 GCCAAA 23 21/123 (17.07%) 9731 8218/33602 (24.46%) 1.33E-02 CGGCCC 13 12/123 (9.76%) 1931 1736/33602 (5.17%) 1.44E-02 GGGCCG 13 12/123 (9.76%) 1931 1736/33602 (5.17%) 1.44E-02 GAGCCC 12 12/123 (9.76%) 1841 1737/33602 (5.17%) 1.45E-02 GCCTCA 16 15/123 (12.20%) 2709 2529/33602 (7.53%) 2.11E-02 GAGCCG 12 11/123 (8.94%) 1788 1644/33602 (4.89%) 2.15E-02 TTGCCG 4 4/123 (3.25%) 2721 2558/33602 (7.61%) 2.47E-02 GCCCAC 15 14/123 (11.38%) 2650 2381/33602 (7.08%) 2.58E-02 CGCCGT 3 3/123 (2.44%) 2473 2179/33602 (6.48%) 2.65E-02 AAGGCC 26 20/123 (16.26%) 4531 3830/33602 (11.40%) 2.67E-02 GGCCTT 26 20/123 (16.26%) 4531 3830/33602 (11.40%) 2.67E-02 GCCTAA 25 22/123 (17.89%) 4814 4372/33602 (13.01%) 2.88E-02 ATAGCC 19 18/123 (14.63%) 3680 3411/33602 (10.15%) 3.02E-02 TAAGCC 25 22/123 (17.89%) 4911 4426/33602 (13.17%) 3.14E-02 GCCCGA 7 7/123 (5.70%) 968 927/33602 (2.76%) 3.37E-02

108

Table 2-8. Continued. Absolute Number in Observed in Absolute Number Observed in Motif Sequence P Value Selected Genes Selected Genes in Genomic Set Genomic Set

GCCCGA 7 7/123 (5.70%) 968 927/33602 (2.76%) 3.37E-02 AAGCCC 35 25/123 (20.32%) 6960 5443/33602 (16.20%) 4.31E-02 TGCCGT 3 3/123 (2.44%) 2099 1949/33602 (5.80%) 4.54E-02 AGGCCG 9 7/123 (5.70%) 1051 1009/33602 (3.00%) 4.55E-02 CGGCCT 9 7/123 (5.70%) 1051 1009/33602 (3.00%) 4.55E-02 CTGGCC 8 8/123 (6.50%) 1314 1235/33602 (3.68%) 4.62E-02 GGCCAG 8 8/123 (6.50%) 1314 1235/33602 (3.68%) 4.62E-02 AGGGCC 8 8/123 (6.50%) 1330 1246/33602 (3.70%) 4.77E-02 GGCCCT 8 8/123 (6.50%) 1330 1246/33602 (3.70%) 4.77E-02 TATGCC 6 6/123 (4.88%) 3030 2871/33602 (8.54%) 4.79E-02 GCCATT 26 24/123 (19.51%) 5888 5280/33602 (15.71%) 4.81E-02 AGCCGT 13 13/123 (10.57%) 2787 2453/33602 (7.30%) 4.91E-02 GCCTTG 14 14/123 (11.38%) 2930 2712/33602 (8.07%) 4.99E-02 CACGTG 32 15/123 (12.20%) 7766 3253/33602 (9.68%) 7.22E-02

109

A B C D

Figure 2-1. Isolation of guard cell protoplasts from B. napus leaves. A) Stomata and epidermal cells on a leaf epidermal peel. B) After the second enzyme digestion, guard cells round up and are released from stomata. C) Guard cell protoplasts collected after separating from epidermal peels. Note the contamination by a mesophyll cell. D) Guard cell protoplasts purified by Histopaque centrifugation (400 ).

110

Figure 2-2. Classification of the 1458 identified proteins into molecular functions. The pie chart shows the distribution of the non-redundant proteins into their functional classes in percentage. The classification was performed with reference to Bevan et al. A) All 1458 proteins. B) Proteins enriched in guard cells. C) Proteins enriched in mesophyll cells.

111

Figure 2-3. Representative MS/MS spectra showing protein identification and relative quantification in guard cells (iTRAQ tag 114) and mesophyll cells (iTRAQ tag 116). A) An MS/MS spectrum identified the peptide QLDASGKPDNFTGK (confidence 99%) derived from photosystem II protein and its relative abundance in the two types of cells. B) An MS/MS spectrum identified the peptide DSNIASIPVEELIEK (confidence 99%) derived from plasma membrane P-type ATPase AHA1 and its relative abundance in the two types of cells.

112

Figure 2-4. Scatter plot of the ratio of GC/MC at the mRNA level and protein level. The correlation coefficient was estimated to be 0.37.

113

Figure 2-5. Effect of diphenyleneiodonium (DPI), catalase (CAT) and ascorbic acid (ASC) on ABA/MeJA-induced stomatal closure and H2O2 production. A) DPI, CAT and ASC reverse closure induced by ABA/MeJA. B and C) DPI, CAT and ASC reduce the ROS level elevated by ABA/MeJA. The pseudocolor key beside the stomata indicates increase of the fluorescence from bottom to top.

114

Figure 2-6. Classification of ABA increased and decreased proteins into biological functions. The pie charts show the distribution of the non-redundant proteins into their functional classes in percentage. A) Sixty six proteins increased in abundance in response to ABA treatment. B) Thirty eight proteins decreased in abundance in response to ABA treatment.

115

Figure 2-7. Total protein identification from complementary mass spectrometry platforms. A) Protein identified from three MS platforms with a threshold 1.3 of the unused score. B) Venn diagram of the guard cell proteins for the three parts of results. Based on the sequence, the three platforms profiled 1220 non-redundant proteins in total for the B. napus guard cell proteome.

116

Figure 2-8. Classification of MeJA increased and decreased proteins into biological functions. The pie charts show the distribution of the non-redundant proteins into their functional classes in percentage. A) Seventy three proteins increased in abundance in response to MeJA treatment. B) Forty seven proteins decreased in abundance in response to MeJA treatment.

117

Figure 2-9. The involvement of the MeJA responsive components in response to other stress factors. The accessions identified from the MeJA treated guard cells were also responsive to other stress factors. Red color represents reported responsiveness to the corresponding stress whereas black color indicates non-responsiveness.

118

CHAPTER 3

REDOX REGULATORY MECHANISMS IN GUARD CELL ABA AND MEJA SIGNALING PATHWAYS

Introduction

Guard cells are highly specialized epidermal cells that border tiny pores called stomata on plant leaf surfaces. Guard cells rapidly change volume and shape so that the pores open or close in response to environmental signals, thus regulating CO2 uptake and water transpiration. Hence, stomatal function is essential for plant growth, development, yield and interaction with the environment. In response to drought, the phytohormone abscisic acid (ABA) triggers guard cell responses that inhibit stomatal opening and promote stomatal closure, thus minimizing water loss. ABA signaling cascade in guard cells is one of the best understood plant signaling processes

(Assmann, 1993; Schroeder et al., 2001; Fedoroff, 2002; Li et al., 2006). Classic genetic screens, reverse genetics, and cell biological analyses have revealed over 30 components participating in guard cell ABA signaling, and the information has been synthesized into a network model (Li et al., 2006; Figure 1-1). H2O2 has been recognized as a central component in this network (Wang and Song, 2008). Recently nitric oxidize (NO) has been found to function as another second messenger (Saito et al., 2009). The elevation of H2O2 and NO is also observed in the methyl jasmonate

(MeJA)-triggered stomatal closure (Munemasa et al., 2007; Saito et al., 2009). The generation of the weak oxidants could lead to mild oxidative stress in guard cells.

Protein cysteines are particularly susceptible to the oxidative insults due to the nucleophilic property of the sulfhydryl groups (Di Simplicio et al., 2003). Modification of

119

the cysteine thiol by redox is an important signaling mechanism for conveying cellular responses (Finkel, 2003; Tonks, 2005).

In mammals, many signaling proteins have been shown to be redox regulated, including Ca2+-ATPase, Ras-related GTPase, EGF growth factor, phosphorylase β kinase and voltage-dependent anion channel protein (Yuan et al., 1994; Matsunaga et al., 2003; Heo and Campbell, 2005; Aram et al., 2010; Cuddihy et al., 2011). In plants, reduction of specific cysteine residues activates Calvin cycle enzymes such as fructose-

1, 6-bisphosphatase and phosphoribulokinase (Jacquot et al., 2002). In guard cells, the activities of protein phosphatase ABI1 and ABI2 are sensitive to redox state (Meinhard and Grill, 2001; Meinhard et al., 2002). Recently, it was found that stomata of the ethylene receptor mutant etr1 did not close in response to H2O2, and mutation of a cysteine residue in ETR1 disrupted H2O2-induced stomatal closure (Radhika et al.,

2005). However, direct evidence for thiol-based redox regulation and a link between protein redox change and stomatal closure remain to be demonstrated. Proteomics is a powerful technology that has moved beyond simple protein cataloging towards large scale analysis of post-translational modifications (PTMs) (Mann and Jensen, 2003).

Two complementary proteomics approaches, saturation differential in-gel electrophoresis (DIGE) and isotope-coded affinity tag (ICAT) can be employed to investigate thiol-based protein redox regulation (Fu et al., 2008). The principle underlying the approaches is that free thiols are irreversibly alkylated by iodoacetamide

(IAM), leading to carbamidomethylation (CAM). When exposed to oxidative conditions, the sensitive cysteine thiols are oxidized. After reduction, these thiols can be specifically labeled by fluorescent dyes or ICAT reagents, which can be differentiated by 2D gel

120

electrophoresis (2-DE) and mass spectrometry (MS) analysis (Figure 3-1). Here we demonstrate the first application of the redox proteomics technologies to investigate thiol-based protein redox switches in guard cell phytohormone signaling. In total, 73 and

130 redox sensitive proteins were identified in ABA and MeJA treated guard cells, respectively, among which 37 were common. A total of 54 redox sensitive cysteines were mapped by MS/MS. This study creates an inventory of potential redox switches and highlights crosstalk between ABA and MeJA signaling pathways in guard cells. The evidence of phytohormone signaling mediated by novel redox switches has greatly improved our understanding of the molecular networks underlying stomatal function.

Material and Methods

Plant Growth, Guard Cell Protoplast Preparation, and Hormone Treatment

Brassica napus var. Global seeds were obtained from Svalöv Weibull AB (Svalöv,

Sweden). Seeds were germinated in Metro-Mix 500 potting mixture (The Scotts Co.,

USA) and plants were grown in a growth chamber under photosynthetic flux of 160 µmol photons m-2s-1 with a photoperiod of 8 hours at 22°C light and 20°C dark. Fully expanded leaves from eight weeks old plants were used for isolation of guard cell protoplasts as previously described. For ABA treatment of guard cells, ABA was added to the second enzyme digestion and the basic solution used in the following steps at a final concentration of 100 µM. The treatment time lasted for 3 hours. MeJA treatment was conducted in the same way but its concentration varied at 100 µM in enzyme digestion followed by 50 µM in the basic solution. The concentration of MeJA in the basic solution was adjusted because exposure to 100 µM MeJA resulted in the breakage of the guard cell protoplasts and finally a much lower yield. This concentration range is effective to promote stomatal closure in Brassica napus epidermal peels and

121

has been used by other research groups (Munemasa et al., 2007; Dombrecht et al.,

2007).

Stomatal Aperture Measurement

Stomatal aperture was measured as previously described with slight modifications

(Zhang et al., 2001). A couple of leaves from a plant were blended and the epidermal strips were washed with cold tap water. The freshly prepared epidermal strips were incubated in a degassed medium (50 µM CaCl2, 10 mM KCl and 10 mM MES-KOH, pH

6.2) under white light 125 μE, 22°C for 3 h to promote stomatal opening. After checking the stomatal aperture, the following chemicals were added: diphenyleneiodonium (DPI)

20 µM, catalase 200 U/mL, and ascorbic acid 10 mM, respectively. The epidermal peels were incubated for 20 min before addition of 20 µM ABA or MeJA. Images of stomata were captured by a light microscope Zeiss Axiostar Plus (Carl Zeiss Inc., USA) and apertures were measured by the software Axiovison 4.1. At least 60 stomata were analyzed in each experiment and three replicate experiments were conducted.

Reactive Oxygen Species Detection in Guard Cells

Epidermal peels were prepared as described above. Fifty micromolar 2', 7'- dichlorodihydrofluorescein diacetate (H2DCF-DA), a fluorescent dye for detection of

H2O2 level in guard cell, was added to the incubation medium for 30 min of dye loading

(Desikan et al., 2004). The peels were collected using a nylon mesh and washed with distilled water. Then the following chemicals were added to the incubation medium with the dye-loaded peels: ABA 20 µM, MeJA 20 µM, DPI 20 µM, catalase 200 U/ml, ascorbic acid 10 mM, respectively. The peels were treated for 20 min. Stomata were observed under a fluorescence microscope (Zeiss Axioplan 2, excitation 488 nm, emission 515 nm, Carl Zeiss Inc., USA), exposure limited to 20 ms and only one image

122

captured per sample. The fluorescence emission of stomata was quantified by software

Progenesis PG200 (Nonlinear Dynamics Ltd., USA).

Protein Extraction and ICAT Labeling

A solution of 10% trichloroacetic acid (TCA) in acetone was used to precipitate protein for 2 hours on ice. Samples were washed with 80% acetone followed by washing with 100% acetone twice. Pellets were briefly dried and dissolved in the

ReadyPrepTM Sequential Extraction Reagent 3 (Bio-Rad Inc., USA). Samples were quantified using a CB-XTM protein assay kit (G Biosciences Inc., USA). A protein aliquot of 100 µg was alkylated by 100 mM iodoacetamide (IAM) at 75°C for 5 min followed by

37°C for 1 hour (Alvarez et al., 2009). The sample was then precipitated in 100% cold acetone over night. The pellet was briefly dried and dissolved in 80 μL ICAT denaturing buffer (pH 8.5) provided in an ICAT kit. Reduction, labeling and trypsin digestion were performed according to the manufacturer‟s manual (Applied Biosystems Inc., USA).

Tryptic peptides were fractionated on an Agilent HPLC system 1100 using a Luna®

HILIC (hydrophilic interaction chromatography) column (150 x 2.00 mm, 3 µm, 200 Å,

Phenomenex, USA). Ten fractions were collected for each replicate. The peptides in each fraction were purified using an avidin affinity cartridge provided in the kit, and were dried and suspended in trifluoroacetic acid to release the peptides from the acid- cleavable linker by incubating at 37°C for 2 h. The peptides were lyophilized and dissolved in a loading buffer (3% acetonitrile v/v, 0.1% acetic acid v/v) for mass spectrometry analysis.

Saturation DIGE Labeling, 2DE and Protein Digestion

Procedures for protein sample preparation, quantification and alkylation was performed as described above for ICAT labeling. Control and treated guard cell protein

123

samples were mixed equally to generate an internal standard. The DIGE labeling procedure was adapted from the manufacturer‟s protocol (GE Healthcare, USA). Cy3 maleimide (Cy3m) was used to label six equal aliquots (10 μg each) of the internal standard. Cy5 maleimide (Cy5m) was used to label three control or three treated

(ABA/MeJA) samples (10 μg each). The amount of tris-2-carboxyethyl-phosphine

(TCEP) and Cy dye was adjusted to 3 nmol and 6 nmol, respectively. The final volume of each combined reaction mixture was 183 µL in rehydration buffer (8 M urea, 2%

CHAPS, 1% DTT, and 1% ampholytes 4-7). Samples were loaded onto 24 cm IPG strips (pH 4-7, GE Healthcare, USA), rehydrated with the sample buffer for 12 h, and subsequently focused in an EttanTM IPGphorTM 3 IEF system (GE Healthcare, USA) for

80,000 V-hr, at a maximum voltage of 10,000 V and a current limit of 50 mA/strip.

Proteins were then separated in the second dimension on 24 cm 8-16% gradient Tris-

HCl gels (Jule Biotechnologies Inc., USA) using an Ettan TM DALTsix electrophoresis unit (GE Healthcare, USA). After electrophoresis, gels were rinsed with Milli-Q water and scanned on a Typhoon TM 9400 imager (GE Healthcare, USA) with 100 µm resolution and appropriate photomultiplier tube voltages to ensure no spot saturation.

DeCyder TM software (v5.0, GE Healthcare, USA) was used to analyze the gel images.

Protein spots (with 1.5 fold change) with p-values less than 0.05 were matched to the preparative gel. Spots were excised for identification according to a standard protocol

(Alvarez et al., 2009). Briefly, a 50 mM ammonium bicarbonate/50% acetonitrile (ACN) solution was used to wash the gel spots prior to digestion by 12 h incubation at 37°C in

30 µL of 6 ng/µL trypsin (Promega Corp., USA). Peptide extraction was performed in two rounds; first with 2% ACN, 1% formic acid, and then with 60% ACN.

124

Reverse Phase Nanoflow HPLC, Tandem Mass Spectrometry and Protein Identification

ICAT fractions or peptides from each spot of DIGE experiment was dissolved in 10

µL solvent A (0.1% v/v acetic acid, 3% v/v acetonitrile) and loaded onto a C18

PepMapTM nanoliter-flow column (75 µm id, 3 µmm, 100 A, LC Packings, USA). The elution gradient of the column started at 97% solvent A/3% solvent B (0.1% v/v acetic acid, 96.9% v/v acetonitrile) and finished at 40% solvent A/60% solvent B within 1 h for

ICAT sample and 20 min for DIGE sample, respectively. Tandem MS analysis was carried out on a hybrid quadrupole-time of flight mass spectrometer (QSTAR® XL,

Applied Biosystems Inc., USA). The focusing potential and ion spray voltages were set to 275 V and 2,600 V, respectively. The information-dependent data acquisition (IDA) was employed in which a survey scan from m/z 400–1,500 was acquired followed by collision induced dissociation of three most intense ions. Survey scan and each MS/MS spectrum in an IDA cycle were accumulated for 1 s and 3 s, respectively. The analysis on the MS data for ICAT was performed in the software ProteinPilotTM 2.0.1 (Applied

Biosystems Inc., USA) searching a target-decoy concatenated NCBI FASTA database for green plants (5,222,402 entries, July 2, 2007). For the DIGE experiment, the MS spectra for each spot were searched against the same database using Mascot search engine (http://www.matrixscience.com). The following parameters were selected: tryptic peptides with no more than 1 missed cleavage site, mass tolerance of precursor ion and

MS/MS ion of 0.3 Da and variable methionine oxidation, and ICAT and DIGE modifications of cysteines were selected respectively. At least 2 peptides identified or 1 peptide with at least 6 continuous ions in the MS/MS spectrum was accepted as

125

threshold for significant IDs. Sequence coverage and Mascot score were also taken into consideration for unambiguous identification (Chen and Harmon, 2006).

Data Analysis

For ICAT, after the export of all peptides from the .group file generated by the software ProteinPilot, the following criteria were used for the identification of the redox sensitive cysteine-containing proteins: 1) contain at least one ICAT modified cysteine; 2) at least 20% increase or decrease in ICAT MS ion intensity under treatment; 3) peptide confidence over 95%; 4) the peptide appears in at least two replicates, and 5) each peptide assigned to only one protein without redundancy. IDs from DIGE experiments were screened by the proteins sequence and those without cysteines were not considered. The protein IDs from both ICAT and saturation DIGE are combined to generate a redox sensitive protein list for each treatment. The protein sequence was used to determine the overlapping components between the data sets. The redox sensitive proteins were classified according to the molecular functions. All the protein sequences were analyzed by the software DiANNA

(http://clavius.bc.edu/~clotelab/DiANNA/) for intra-disulfide bond prediction using a neural network-based approach (Ferre and Clote, 2005).

Results and Discussion

B. napus Guard Cells for Redox Proteomics

Exogenous ABA and MeJA can induce stomatal closure and elevation of the stomatal ROS levels in several species (Desikan et al., 2004; Islam et al., 2009). In

Chapter 2 it was shown the application of 20 μM ABA or MeJA have the similar effect on

Brassica napus stomata (Figure 2-5). Additionally, the induced stomatal closure and the

ROS production can be reversed by ROS scavengers such as diphenylene iodonium

126

(DPI), catalase and ascorbic acid. These results not only suggest that the guard cell redox state are important in the ABA and MeJA signaling processes leading to stomatal closure but also confirm that Brassica napus guard cells have similar responses as other plant species. Considering the good quality and quantity of guard cells as well as the proteomics data generated (e.g., Chapters 2), we choose to use B. napus guard cells to investigate redox responsive proteins in guard cell hormone signaling.

Guard Cell Redox Responsive Proteins in ABA Signaling

Here a reverse strategy was employed in which the proteins were firstly alkylated by IAM to block free thiols, then reduced by tris(2-carboxyethyl)phosphine (TCEP) to expose those sulflhydryl groups that had been reversibly oxidized due to hormone treatment. The reverse labeling strategy was preferred considering cysteines buried inside the proteins may be easily accessible for the DIGE or ICAT tags (Fu et al., 2008).

Thus the increase of signal intensity in ABA or MeJA treated samples indicates the presence of more thiol groups after reduction, i.e., more oxidized cysteines in the original treated protein samples, compared to control samples. Compared to the forward strategy which labels the sample directly without the initial alkylation and reduction steps, the reverse strategy has the advantage of exposing the oxidized cysteines buried in the protein molecules. In addition, the reverse labeling strategy keeps the initial redox state of the proteins and covers more modifications spatially (Fu et al., 2008).

Table 3-1 lists the 73 redox sensitive proteins in guard cells under ABA treatment, of which 27 and 54 were identified from ICAT and saturation DIGE, respectively. Eight proteins were identified in both methods. Functional classification shows these redox responsive proteins largely fall into the groups of energy, metabolism, cell structure, photosynthesis, and stress and defense (Figure 3-2). A large number of guard cell

127

proteins belonging to the energy function group were found to be changed at expression levels, mostly up-regulated under ABA treatment (Table 2-3 and Table 2-4). This is consistent with the high energy consumption related to the guard cell physiology of stomatal movement (Parvathi and Raghavendra, 1997). The identified redox responsive proteins in this group include several ATP synthase subunits, fructose-bisphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase, malate dehydrogenase, phosphoglycerate kinase 1 and succinyl-CoA synthetase, most of which have been established or identified as potential thioredoxin targets using proteomics approaches

(Table 3-1; Buchanan and Balmer, 2005). Identified redox responsive proteins participating in photosynthesis include Rubisco large and small subunits, photosystem II

44 kD reaction center protein, phosphoribulokinase, ferredoxin and sedoheptulose- bisphosphatase (Table 3-1). Both phosphoribulokinase and ferredoxin have the conserved cysteine residues necessary for thioredoxin-dependent regulation (Walters and Johnson, 2004; Michels et al., 2005). The enzyme sedoheptulose-bisphosphatase has thiol group in the active site (Raines et al., 1999). Rubisco subunits are newly reported thioredoxin targets (Motohashi et al., 2001; Lemaire et al., 2004). Cell respiration and photosynthesis involve an assembly of redox reactions and thus represents highly redox regulated processes (Jacquot et al., 2002; Rouhier et al., 2002;

Giraud et al., 2011). Hydrogen peroxide produced by electron transport chain in mitochondria and pseudocyclic phosphorylation (Mehler reaction) in chloroplasts is an oxidant signal (op den Camp et al., 2003). Thioredoxin is a small protein reduced enzymatically by NADPH and ferredoxin, and thus active in thiol/disulﬁde exchange. It enables chloroplasts and mitochondria to communicate via a network of transportable

128

metabolites such as malate and glycolate through redox sensing (Buchanan and

Balmer, 2005). Several proteins in the two processes are reported to be thiol-based redox regulated, e.g., fructose bisphosphatase, NADP-malate dehydrogenase and

NADP-glyceraldehyde 3-phosphate dehydrogenase (Ocheretina and Scheibe, 1994;

Carr et al., 1999; Chiadmi et al., 1999). Proteomics approaches have facilitated the identification of potential thioredoxin target proteins in the two important processes and an updated list of thioredoxin target proteins have been generated (Motohashi et al.,

2001; Lemaire et al., 2004; Buchanan and Balmer, 2005). Our data have provided extra evidence for those identified thiol-based (thioredoxin) regulated proteins and revealed new redox responsive components in guard cell chloroplasts and mitochondria after

ABA treatment.

Proteins involved in the metabolism constitute another large group of redox responsive groups in ABA treated guard cells (Table 3-1). Several proteins have been reported to be thioredoxin targets, including aspartate aminotransferase, glutamine synthetase, and threonine synthase (Buchanan and Balmer, 2005). A few of the enzymes, such as glutamine synthetase and oxalic acid oxidase, have thiol groups in the active sites (Chiriboga, 1966; Ericson and Brunn, 1985). This finding implies that amino acid metabolism might adapt to oxidative stress by post-translational modification to the cysteines in the active sites, and consequently activate or inhibit the enzymes to alter the metabolism. The underlying mechanisms deserve further investigation.

Other groups of great interest include stress and defense, cell structure and signal transduction. Unlike the iTRAQ results (Chapter 2), not many redox responsive proteins were identified in stress and defense group (Table 2-3, Table 2-4 and Table 3-1). The

129

senescence-associated cysteine protease, with a cysteine residue at the active center, have been extensively studied because they appear to play a central role in a wide range of proteolytic functions from embryo development to programmed cell death

(Tajima et al., 2011). A senescence-associated cysteine protease was reported to be redox regulated by ascorbate and thiols during pea root nodule senescence (Groten et al., 2006). An enolase LOS2 is involved in cold-responsive gene transcription (Lee et al., 2002). Enolase has been identified to be a thioredoxin target protein (Buchanan and

Balmer, 2005). Here our data show that LOS2 is potentially under redox regulation in the ABA response (Table 3-1). ERD12 encodes allene oxide cyclase, an enzyme catalyzing an essential step in jasmonic acid biosynthesis. The identification of ERD12 here indicates the crosstalk between the ABA and MeJA signal transduction in guard cells. Allene oxide cyclase is also a thioredoxin target and has been identified to be S- nitrosylated in A. thaliana undergoing hypersensitive response (Buchanan and Balmer,

2005; Romero-Puertas et al., 2008). Myrosinase has been found to be a key regulatory element in both ABA and MeJA signaling pathways in guard cells (Zhao et al., 2008;

Islam et al., 2009; Figure 3-3). Plant myrosinase is not activated by most reducing agents, e.g., gluthatione and cysteine but is activated by L-ascorbic acid (Nagashima and Uchiyama, 1959; Ohtsuru and Hata, 1979). The interaction of myrosinase and ROS production in the ABA signal transduction in guard cells is not clear. Work in our lab is under way to validate redox regulation of myrosinases. Ascorbate peroxidase (APX) is an enzyme that detoxifies peroxides such as hydrogen peroxide using ascorbate as a substrate (Noctor and Foyer, 1998). It has been reported that cysteine oxidation is involved in the inactivation of APXs, and glutathione protects APX from irreversible

130

oxidation of the cysteine thiol and loss of enzyme activity by binding to the cysteine thiol group (Kitajima et al., 2007). In plants, the monodehydroascorbate reductase (MDAR) is an enzymatic component of the glutathione-ascorbate cycle that is one of the major antioxidant systems of plant cells for the protection against ROS damages (Asada,

1997). Previous work suggested that a conserved cysteine residue of the cucumber

MDAR is required for electron transfer between MDAR-FAD and NAD(P)H prior to the reduction of monodehydroascorbate to ascorbate (Sano et al., 1995).

Cytoskeleton reorganization is one of the distinguished events in stomatal closure triggered by ABA (Li et al., 2006). Actin and tubulin reorganization in Arabidopsis guard cells was observed in the process of ABA-induced stomatal closure (Lemichez et al.,

2001). Specifically, ABA induces rapid depolymerization of cortical actin filaments and the slower formation of a new type of actin that is randomly oriented throughout the cell.

The actin reorganization in guard cells is mediated by cytosolic calcium levels and by protein kinase and protein phosphatase activities (Hwang and Lee, 2001). Both actin and tubulin have also been identified to be thioredoxin target proteins in proteomic studies, indicating the possibility of redox regulation in addition to phosphorylation events (Buchanan and Balmer, 2005). Here we have identified actin, tubulins, extensin- like protein, protein containing stomatin domain and plastid-lipid associated proteins

(PAP) as redox responsive proteins in B. napus guard cells under ABA treatment.

Extensins are essential for cell wall assembly and growth through cell extension and expansion (Everdeen et al., 1988). Stomatin is a 32 kD membrane protein as a partner of a membrane-bound proteolytic process (Green et al., 2004). But it has been rarely studied in plants. The accumulation of PAPs in plastids and the biogenesis of structures

131

that sequester hydrophobic compounds are enhanced by various stresses (Murphy,

2004). How these proteins contribute to the cytoskeleton reorganization of guard cells in response to ABA and the redox regulatory mechanisms are worth of investigation.

Very interestingly, a few signaling proteins were found to be redox responsive, such as 14-3-3 protein, calmodulin-binding protein, an osmotic stress-activated protein kinase and a serine/threonine phosphatases 2C. Cysteine of the 14-3-3 protein was found to be S-nitrosylated (Greco et al., 2006). Redox regulation of calmodulin-binding protein, kinase and phosphatase has rarely been reported but the interaction between phosphorylation/dephosphorylation and redox regulation deserves more investigation

(Saze et al., 2001; Cabrillac et al., 2001; Gupta and Luan, 2003).

Overall, ABA treatment has been demonstrated to associate with oxidative stress involving ROS and RNS production. The identification of the redox responsive proteins in this process highlights the importance of the redox state in guard cell in the stress response and the redox regulation as an essential regulatory mechanism. It is noteworthy a great portion of the identified components have been reported to be thioredoxin target proteins by proteomics. In addition to the ones mentioned above, elongation factor Tu, eukaryotic initiation factor 4A and GTP-binding nuclear protein

RAN1 are also in the thioredoxin target list (Table 3-1; Buchanan and Balmer, 2005).

This suggests thioredoxin plays an important role in guard cell redox regulation.

However, the existence of six different types of thioredoxin in A. thaliana raises the question about target specificity (Buchanan and Balmer, 2005).

In addition, the sequence of each protein was submitted for intra-molecular disulfide prediction (http://clavius.bc.edu/~clotelab/DiANNA/). Forty three out of 73 were

132

predicted to form significant intra-molecular disulfide bonds. It should be noted that dithiol-disulfide exchange only represents one modification on the thiol group of cysteine. Other types of modifications include S-nitrosylation, sulfinic acid, sulfenic acid and sulfonic acid (Depuydt et al., 2011; Figure 1-4). Our data have set a stage for further characterization of the potential redox regulated proteins in guard cell ABA signaling.

Redox Responsive Proteins in MeJA Signaling

Table 3-2 lists the redox responsive proteins in guard cells under MeJA treatment.

Functional classification of the proteins has revealed a very similar pattern to that of

ABA (Figure 3-2). Proteins related to energy, metabolism, stress and defense, protein folding, transporting and degradation, and photosynthesis are dominant followed by minor groups such as protein synthesis and cell structure. Forty proteins belong to the group of metabolism, constituting the largest group of the redox responsive proteins in guard cells under MeJA treatment. Except for some overlapping ones with the ABA redox responsive proteins, leucine aminopeptidase, cysteine synthase, triosephosphate isomerase, 3-isopropylmalate dehydrogenase, dihydrolipoamide dehydrogenase, dihydrolipoamide S-acetyltransferase, serine hydroxymethytransferase and aldehyde dehydrogenase are MeJA redox responsive proteins that have been listed as thioredoxin target proteins (Table 3-2; Buchanan and Balmer, 2005).

Proteins involved in cell respiration constitute the secondary dominant group.

Nearly half of them (11 out of 23) are common components between the ABA and MeJA treated guard cells (Table 3-1 and Table 3-2). More ATP synthase subunits or isoforms have been identified in the MeJA data set. Not surprisingly, the novel ones in the MeJA list, e.g., NADH-ubiquinone oxidoreductase, isocitrate dehydrogenase, pyruvate

133

dehydrogenase E1 and succinyl-CoA ligase are known to be under thioredoxin regulation (Table 3-2; Buchanan and Balmer, 2005). This is consistent with the previous knowledge that reactions in mitochondria are highly redox regulated.

More proteins in photosynthesis have been discovered to be redox responsive to

MeJA than to ABA in guard cells. Rubisco activase contains numerous cysteines and it has been identified to a thioredoxin target protein (Buchanan and Balmer, 2005). It has been observed that incubation of the Rubisco activase with DTT and thioredoxin f increased activity, whereas incubations with DTT alone or with thioredoxin m were ineffective (Zhang et al., 1999). Ferredoxin-NADP(+)-oxidoreductase (FNR) is the last enzyme for the step from photosystem I to NADPH in the photoelectron transport chain

(Talts et al., 2007). Two cysteines in the spinach FNR are essential for the enzyme activity in the ferredoxin-dependent reaction (Aliverti et al., 1993). However, the redox modification of the cysteines needs to be elucidated.

Compared to the ABA data, more proteins involved in stress and defense were identified in the MeJA treated guard cells. Except for the overlapping ones, some unique proteins, such as heat shock proteins, have been reported to contain redox-sensitive cysteines in animals (Nardai et al., 2000). Other proteins, including 2-Cys peroxiredoxin, germin-like protein, ascorbate peroxidase, manganese superoxide dismutase, heat shock protein HSC70 and peroxiredoxin type 2 are known to be thioredoxin target proteins (Table 3-2; Figure 3-4; Buchanan and Balmer, 2005). Since both ABA and

MeJA trigger stomatal closure involving the cytoskeleton reorganization, it is not surprising to find apparent overlap between the two data sets in the cell structure functional group, including actin, tubulins and extensin-like protein (Table 3-1 and Table

134

3-2). Other redox responsive proteins worth noting include phospholipase D alpha 1

(PLD1), mitogen-activated protein kinase 12 (MPK12) and potassium channel protein.

PLD1, MPK12 and potassium channel are known to function in ABA signal transduction in guard cells (Zhang et al., 2004; Li et al., 2006; Jammes et al., 2009). The identification of these proteins as redox responsive proteins to MeJA provides new evidence to the crosstalk hypothesis between ABA and MeJA pathways in guard cells.

Nevertheless, how these proteins are regulated in a redox dependent manner needs to be further investigated.

Up to date, the evidence for the crosstalk hypothesis mainly comes from genetic studies and some transcriptomic studies, which are fragmentary (Wang et al., 2011). No proteomic analysis has been reported on the MeJA responsive protein in guard cells, either on the abundance level or thiol-based redox changes. Here 130 proteins in total were identified to be redox regulated under MeJA treatment in B. napus guard cells, all of which contain at least one cysteine. The intra-molecular disulfide prediction indicated over half (70 out of 130) can form significant disulfide bond(s) within the molecule. Due to the fact that ABA and MeJA treatment can lead to cellular oxidative changes, the elucidation of redox responsive proteins in the processes are extremely important to the understanding of initial signaling stage as well as the adaptive responses in the MeJA signaling transduction and also may provide new insight to the hormone molecular networks.

Common Components and Mechanisms in ABA and MeJA Signaling Pathways

Based on the sequence comparison, a total of 37 proteins are shared between

ABA and MeJA treatment (labeled with asterisks in Tables 3-1 and Table 3-2; Figure 3-

5). About one third (12/37) of the proteins were identified by ICAT and two thirds (25/37)

135

by saturation DIGE. In our previous study, we employed iTRAQ to identify guard cell

ABA and MeJA responsive proteins at protein levels (Tables 2-3, Table 2-4, Table 2-6 and Table 2-7). It didn‟t reveal as many shared components as here in this study

(Tables 3-1 and Table 3-2). This result indicates not only the abundance change but also post-translational modifications, i.e., thiol-based redox modification analyzed here, are pivotal regulatory mechanisms for the ABA/MeJA signal transduction in guard cells.

Among the 37 shared proteins, 11 fall into the energy group. Guard cells contain abundant mitochondria and display a high respiratory rate. This suggests that oxidative phosphorylation is an important source of ATP to fuel the guard cell machinery for stomatal movement, and this process is known to be redox regulated (Parvathi and

Raghavendra, 1997; Giraud et al., 2011). In the metabolism group, 8 overlapped proteins involved in the amino acid and carbohydrate metabolism indicate the importance of these processes in ABA/MeJA signaling. Furthermore, a few cell structure proteins are shared between the two data sets, which implies cytoskeleton reorganization in ABA and MeJA induced stomatal closure. Moreover, we have also observed four shared proteins in the stress and defense group, which supports the long- standing notion of cross-tolerance in plants (Sabehat et al., 1998; Capiati et al., 2006;

Table 3-1). Other overlapping components fall into groups of protein synthesis, folding, transport and degradation, as well as cell division, differentiation and fate. Our proteomic results here and those shown in Chapter 2 have greatly enhanced the depth and scope of previous knowledge obtained from genetics and physiology aspects

(Table 1-1) and global transcriptomic analysis of hormone interactions in guard cells

(Wang et al., 2011).

136

Complementary ICAT and Saturation DIGE Approaches for Redox Proteomics

Recently, gel-based methods employing cysteine-specific fluorochromes or radioactive tags have been developed to identify redox-sensitive proteins in complex protein samples (Yano et al., 2001; Kim et al., 2000; Fu et al., 2008). Unlike minimal

DIGE, saturation DIGE has only two dyes (Cy3 and Cy5) available to label cysteines and thus the experiment design is more complicated due to potential gel-to-gel variation

(Figure 3-1). This is the reason why we used one dye for the normalization standard.

Statistical analysis is very important to ensure that the spots picked for identification exhibit reproducible significant change (Figure 3-3 G). Although saturation DIGE is robust in identifying potentially redox-regulated proteins, the effort to locate the specific

CyDye-labeled cysteines has not been successfull (Tables 3-1 and Table 3-2) due to the loss of the labeled dyes during the fragmentation stage. Another disadvantage of this method is that more than one protein could be identified from one spot, therefore it is often impossible to assign the spot volume changes to specific responsive proteins.

In contrast to DIGE results, we didn‟t identify as many redox responsive proteins using ICAT. This is due to the lower amount of protein was used for ICAT experiments and only cysteine-containing peptides were retained for mass spectrometry analysis, leading to fewer peptides for protein identification. However, an advantage of ICAT is that it enabled mapping of the redox sensitive cysteines because the ICAT tags were retained on the cysteines during fragmentation and sequencing of the peptides (Table

3-1, Table 3-2 and Figure 3-4). The mapping of responsive cysteines provides detailed information about the redox regulation of proteins.

In total, 27 and 54 proteins were identified to be potentially redox responsive to

ABA treatment in guard cells by ICAT and DIGE, respectively. Of these, eight proteins

137

were identified using both methods (Figure 3-5). For the MeJA treated guard cells, ICAT and DIGE identified 18 and 118 potentially redox-responsive proteins, respectively, with six proteins identified using both methods (Figure 3-5). Such observation indicates a disadvantage of saturation DIGE is the incapability of locating the exact sites of cysteine modifications. This finding is consistent with a previous report (Fu et al., 2008).

Compared with ICAT, other disadvantages of saturation DIGE include those associated with 2D gels, i.e., little coverage of very acidic or basic proteins as well as proteins with extreme large or small size. Overall, saturation DIGE is a good option when large-scale screening is conducted. ICAT, on the other hand, does not have the above DIGE limitations, and it provides detailed information of redox regulated cysteines. Therefore, the two methods are complementary in analyzing redox responsive proteins.

Conclusion

ABA and MeJA are the most intensively studied phytohormones in guard cells.

The syntheses of both hormones are stress inducible and can promote stomatal closure. The interaction between the ABA and MeJA signaling pathways in guard cells have been observed. However, the molecular details are far from complete, not to mention the regulatory mechanisms. Elevation of ROS and RNS levels is an early event common to both signaling pathways, where these molecules serve as secondary messengers. Although redox regulation in plants has been widely studied in the context of photosynthesis and plastid antioxidant defense systems under stressful environmental conditions, the interaction between other signaling components/processes and ROS/RNS, i.e., redox status change of those proteins by

ROS/RNS, is unknown.

138

Here complementary proteomics approaches employing ICAT tags/DIGE dyes specific for labeling cysteines were applied to investigate the thiol-based redox regulated proteins in response to ABA and MeJA in guard cells. In total, saturation

DIGE and ICAT experiments led to identification of 73 and 130 redox responsive proteins to ABA and MeJA, respectively. Many of the identified proteins are predicted to form intra-molecular disulfide bonds. Additionally, a great percentage of the redox responsive proteins have been identified to be the targets of thioredoxin, a universal enzyme with the reducing power in cellular redox homeostasis. Functional classification of ICAT and DIGE data sets showed very similar patterns. The findings support that common signaling events exist between the ABA and MeJA signaling pathways in guard cells. Proteomic analysis using iTRAQ to identify abundance change proteins in response to ABA and MeJA didn‟t provide strong evidence to the crosstalk hypothesis.

However, the redox proteomic analysis identified 37 overlapping proteins, representing a large portion of redox responsive proteins to each hormone. This work has revealed a novel regulatory mechanism in the guard cell signaling networks. This work represents the most comprehensive redox proteomics analysis of ABA and MeJA treated guard cells and highlights several interesting nodes and edges for further investigation.

139

Table 3-1. Redox responsitive proteins identified in B. napus guard cells under ABA treatment. 4 Unused Fold Fold Peptide Mascot Redox Name MW pI Score Change Change (ICAT) Score Switch (ICAT) (ICAT) (DIGE) Photosynthesis (8) * Chloroplast chlorophyll a/b binding protein 28363 5.48 127 *1.64 O

Photosystem II 44 kDa reaction center protein 52213 6.71 130 -2.81 R

Ribulose-5-phosphate kinase 45406 5.84 135 1.85 O

GRPLLGCTIKPK 1.54 CYHIEPVPGEETQFIAY 1.46 *Ribulose bisphosphate carboxylase large VALEACVQAR 1.45 53436 5.88 27.81 220 *-2.60 O/R chain precursor WSPELAAACEVWK 1.29 YGRPLLGCTIKPK 0.77 GHYLNATAGTCEEMMK 0.75 FITPEGEQEVECDDDVYVLDAAEEAGI Ferredoxin 10367 3.82 2.03 1.31 O DLPYSCR *33 kDa polypeptide of oxygen-evolving GTGTANQCPTIDGGSETFSFKPGK 1.36 35142 5.55 6.62 O complex (OEC) in photosystem II KFCFEPTSFTVK 1.29 *Sedoheptulose-bisphosphatase (SBPASE) 42787 6.17 208 1.75 O

*Rubisco small subunit 20183 8.23 8.55 WIPCVEFELEHGFVYR 1.38 181 -2.81 O/R Energy (20) ATP synthase subunit beta, mitochondrial 59181 6.01 139 1.87 O precursor

*F1-ATPase alpha subunit 46684 5.64 220 -3.46 R

ATP synthase gamma chain, chloroplast 33475 6.12 112 C U R precursor *Fructose-bisphosphate aldolase, putative 38858 6.05 238 *-2.12/*1.97 O/R

*Malate dehydrogenase, cytosolic, putative 35890 6.11 246 *-2.33/2.02 O/R

*De-etiolated 3 (DET3), V-ATPase subunit C 42878 5.40 130 1.85 O

4 Overlapping components with MeJA redox responsive proteins are highlighted with asterisks in column “Accession”. MW, molecular weight; pI, isoelectric point; Asterisk in column “Fold Change (DIGE)”, average of spot intensity change; C U, unique spot in control gel; O and R, oxidation and reduction of cysteine, respectively.

140

Table 3-1. Continued. Unused Fold Fold Peptide Mascot Redox Name M.W. pI Score Change Change (ICAT) Score Switch (ICAT) (ICAT) (DIGE) *Glyceraldehyde-3-phosphate 43168 5.60 220 -2.01 R dehydrogenase B precursor, chloroplast *Putative fructose bisphosphate aldolase 43033 6.48 93 C U R

*Phosphoglycerate kinase 1 (PGK1) 50195 5.91 142 *1.86/*-2.10 O/R

*Chloroplast NAD-dependent malate 42623 8.48 164 1.67 O dehydrogenase Similar to mitochondrial malate 37197 8.54 86 3.06 O dehydrogenase Adenosine triphosphatase 53930 5.05 130 1.87 O

Putative fructokinase 35405 5.30 123 -2.00 R

*Vacuolar ATP synthase subunit A (VHA-A) 68812 5.11 6.01 YSNSDAVVYVGCGER 11.58 368 7.45/-1.9 O/R *Glyceraldehyde-3-phosphate 36914 6.62 8.04 SDLDIVSNASCTTNCLAPLAK 1.29 O dehydrogenase C subunit (GapC) Transitional endoplasmic reticulum ATPase 89393 5.13 4.46 QSAPCVLFFDELDSIATQR 1.24 O

Cytosolic triosephosphatisomerase 27169 5.39 7.72 IIYGGSVNGGNCK 1.46 118 -4.03 O/R Succinyl-CoA synthetase, alpha subunit 35317 8.84 2.07 LIGPNCPGIIKPGECK 1.31 O

*Malate dehydrogenase, mitochondrial YCPHALVNMISNPVNSTVPIAAEIFK 1.35 35711 8.81 10.32 66 -2.44 O/R precursor GLNGVPDVVECSYVQSTITELPFFASK 0.80 Succinate dehydrogenase flavoprotein 69656 5.86 4.49 AAIGLSEHGFNTACITK 0.76 192 -1.90 R Metabolism (13) *Aspartate aminotransferase 44497 6.80 114 -2.01 R

Glutamine synthetase 47889 6.37 83 -2.81 R

Biotin carboxyl carrier protein 20791 4.60 74 C U R

Cinnamyl alcohol dehydrogenase 36053 8.15 56 1.75 O

*Adenosine kinase 1 (ADK1) 38268 5.29 59 C U R

Dihydrodipicolinate reductase family protein 37754 6.02 70 -2.00 R

Putative lactoylglutathione lyase 31740 5.19 58 2.01 O

*3-ketoacyl-acyl carrier protein synthase I 50890 7.99 52 3.47 O

*Reversibly glycosylated polypeptide-1 40629 5.61 7.31 NLLCPSTPFFFNTLYDPYR 1.40 O

*Glycolate oxidase 28165 9.52 84 C U R

141

Table 3-1. Continued. Unused Fold Fold Peptide Mascot Redox Name M.W. pI Score Change Change (ICAT) Score Switch (ICAT) (ICAT) (DIGE) *Enoyl-[acyl-carrier-protein] reductase 40633 8.93 67 3.06 O

Threonine synthase 57777 7.11 2.38 HCGISHTGSFK 0.66 R

SVQDFCVANLKR 1.90

*Oxalic acid oxidase 21504 9.06 9.45 SVQDFCVANLK 1.87 O

AETPAGYPCIRPIHVK 1.82

Protein synthesis (5) *Eukaryotic initiation factor 4A-2 47084 5.38 95 C U R

Hypothetical protein, containing (EF1) domain 59829 6.66 74 -1.50 R

*Initiation factor 5A-4, putative 17140 5.55 2.01 KLEDIVPSSHNCDVPHVNR 1.23 O

Mitochondrial elongation factor Tu 49410 6.25 4.06 QVGVPSLVCFLNK 1.38 O

60S ribosomal protein L2 27859 10.9 2.00 SIPEGAVVCNVEHHVGDR 0.57 R

Protein folding, transporting and degradation (5) *Mitochondrial processing peptidase alpha 54539 5.94 81 C U R subunit *Putative aspartic protease 28008 8.34 51 1.67 O

Putative proteasome 20S beta1 subunit 19000 7.71 110 3.09 O

Peptidylprolyl isomerase ROC4 28208 8.83 2.16 HTGPGILSMANAGPNTNGSQFFICTVK 1.24 O

Ubiquitin extension protein (UBQ5) 17797 9.83 1.52 CGLTYVYQK 0.64 R

Stress and defense (6) *Senescence-associated cysteine protease 49581 5.49 92 2.55 O

*Low expression of osmotically responsive 47974 5.54 127 1.87 O genes 1 (LOS2) Early response to dehydration (ERD12) 29229 9.34 2.02 NPQQLCIGDLVPFTNK 1.29 O

*Myrosinase, thioglucoside glucohydrolase 62265 6.30 48.95 QIIQDFKDYADLCFKEFGGK 1.29 330 *-2.70/2.80 O/R VDTSGPHECPEEGRLPDAGPPSPANH Stromal ascorbate peroxidase 38532 7.12 2.80 1.67 O LR *Monodehydroascorbate reductase 46462 5.81 2.03 LPGFHCCVGSGGEK 0.70 115 -2.70 R Signal transduction (4) 14-3-3 protein homolog 29361 4.83 48 2.01 O

Calmodulin-binding protein 20718 4.86 65 2.66 O

142

Table 3-1. Continued. Unused Fold Fold Peptide Mascot Redox Name M.W. pI Score Change Change (ICAT) Score Switch (ICAT) (ICAT) (DIGE) Osmotic stress-activated protein kinase 41399 5.64 63 C U R

Serine/threonine phosphatases 2C (PP2C) 40100 5.32 51 2.89 O family Transcription (1) Retrotransposon protein, putative 92125 7.23 49 7.45 O

Cell structure (7) *Tubulin beta-4 chain(TUB4) 50361 4.76 217 C U R

*Actin 41888 5.29 298 *2.02/-2.01 O/R

*Plastid-lipid associated protein PAP2 34689 4.79 54 2.55 O

Plastid-lipid associated protein PAP3 39278 4.55 128 1.67 O

Putative protein, containing band 7 stomatin 56003 5.17 75 -2.16 R domain Tubulin beta-7 chain 50747 4.74 6.90 VNVYYNEASCGR 0.67 R

*Extensin-like protein 82246 6.49 2.00 IPASICQLPK 1.53 O

Cell division, differentiation and fate (3) *GTP-binding nuclear protein RAN1 25512 6.25 76 2.01 O

Cell division protein FtsH 75232 5.37 3.12 GCLLVGPPGTGK 0.79 R

*Proliferating cell nuclear antigen (PCNA) 29375 4.61 62 C U R

Unknown(1) Unnamed protein product 51670 6.81 2.19 LLICGGSAYPR 1.26 O

143

Table 3-2. Redox sensitive proteins identified in B. napus guard cells under MeJA treatment. 5 Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Photosynthesis (11) Chlorophyll a/b binding protein 28363 5.48 65 1.79 / -1.75 O/R Light harvesting chlorophyll A/B binding 28659 5.29 75 1.51 O protein Rubisco activase (RCA) 52347 5.87 342 *1.76/ -1.93 O/R High chlorophyll fluorescence 136 44133 6.79 118 1.57 O Thylakoid lumenal 15 kDa protein, chloroplast 24106 7.55 134 -2.84 R Oxygen-evolving complex of photosystem II 28079 6.84 135 -1.78 R Precursor of the 33 kDa subunit of the 35226 5.92 158 1.99 O oxygen evolving complex CYHIEPVPGEETQFIAY 0.66 Ribulose-1,5-bisphosphate GHYLNATAGTCEEMMKR 0.71 52956 5.87 10.86 535 * 2.10/-1.67 O/R carboxylase/oxygenase GHYLNATAGTCEEMMK 0.74 ELGVPIVMHDYLTGGFTANTSLAHYCR 0.42 Ribulose bisphosphate carboxylase small chain, chloroplast precursor (RuBisCO small 20183 8.23 8.09 LPLFGCTDSAQVLK 1.32 O subunit) Ferredoxin-NADP(+)-oxidoreductase 2 41484 8.51 66 1.70 O Sedoheptulose-1,7-bisphosphatase 42787 6.17 310 * 1.58 O Energy (23) ATP synthase subunit alpha, mitochondrial 55393 6.23 244 1.57 / * -1.67 O/R Tonoplast ATPase 70 kDa subunit 69030 5.19 545 1.54 O Gamma subunit of mitochondrial F1-ATPase 35597 9.01 83 1.81 O Nucleotide-binding vacuolar ATPase 54819 4.98 725 1.56 / -1.66 O/R Mitochondrial F1 ATP synthase beta subunit 63560 6.52 694 * 2.29 O De-etiolated 3 (DET3), V-ATPase subunit C 42878 5.40 195 4.04 O

5 Overlapping components with MeJA redox responsive proteins are highlighted with asterisks in column “Accession”. MW, molecular weight; pI, isoelectric point; Asterisk in column “Fold Change (DIGE)”, average of spot intensity change; C U, unique spot in control gel; O and R, oxidation and reduction of cysteine, respectively.

144

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Glyceraldehyde-3-phosphate dehydrogenase 37015 7.70 360 * 1.65 O Glyceraldehyde 3-phosphate dehydrogenase 37937 7.00 99 1.70 O A subunit Glyceraldehyde 3-phosphate dehydrogenase 43168 5.60 201 -1.39 R B subunit Phosphoglycerate kinase (PGK) 42162 5.49 129 1.52 O Phosphoglycerate kinase 1 (PGK1) 50195 5.91 282 * 1.99 / -1.78 O/R Malate dehydrogenase, cytosolic, putative 35890 6.11 338 * 1.82 O Chloroplast malate dehydrogenase 42520 8.51 186 1.69 O Fructose-bisphosphate aldolase, putative 38858 6.05 551 1.51 / *-2.04 O/R Putative fructose bisphosphate aldolase 43033 6.48 77 4.04 O Enolase 47631 5.46 683 2.41 O EMB1467 (embryo defective 1467); NADH 82557 6.24 128 -1.63 R dehydrogenase NADH-ubiquinone oxidoreductase 75 kDa 80831 5.87 135 -1.62 R subunit, mitochondrial Isocitrate dehydrogenase, putative 46059 6.13 130 * -1.97 R Pyruvate dehydrogenase E1 beta subunit 39448 5.67 223 1.52 / -1.88 O/R Succinyl-CoA ligase (GDP-forming) beta- 45602 6.30 314 * 2.49 / -1.52 O/R chain, mitochondrial ATP synthase beta subunit 53717 5.20 4.00 DTLGQEINVTCEVQQLLGNNR 1.24 1158 * 1.81 O GLNGVPDVVECSYVQSTITELPFFASK 1.24 Malate dehydrogenase, mitochondrial 35711 8.81 8.04 AGKGSATLSMAYAGALFADACLK 1.44 114 -1.86 O/R precursor YCPHALVNMISNPVNSTVPIAAEIFKK 1.22 Metabolism (40) Adenosine kinase 1 (ADK1) 38268 5.29 149 * 2.59 / -1.88 O/R Allene oxide cyclase 4 (AOC4) 27963 9.15 75 -1.66 R Glutamine synthetase 38722 5.93 99 1.95 O Thi1 protein 36755 5.82 206 1.74 O Leucine aminopeptidase 54760 5.66 62 1.65 O

145

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Glycolate oxidase 40907 9.38 117 1.66 O Cysteine synthase 41976 8.13 198 1.78 O Unnamed protein product with CIMS domain 84728 6.05 238 -2.21 R Putative triosephosphate isomerase 33553 7.67 200 1.99 O Aconitate hydratase, cytoplasmic 98570 5.74 79 * -1.94 R Cytosol aminopeptidase family protein 61667 6.62 212 -1.82 R Cytokinin-O-glucosyltransferase 1 54361 5.59 47 -1.67 R 3-isopropylmalate dehydrogenase 44305 5.75 88 1.81 O Dihydrolipoamide dehydrogenase 1, 54239 6.96 141 -1.64 R mitochondrial / lipoamide dehydrogenase 1 Reversibly glycosylated polypeptide-2 41377 5.76 78 -1.88 R S-adenosyl-L-homocysteine hydrolase 53744 5.69 252 * -1.72 R Isoflavone reductase, putative 34515 5.44 112 1.74 O Glutamate-1-semialdehyde-2,1-aminomutase 50737 6.43 211 -2.10 R Fumarate hydratase (FUM1) 53479 8.01 102 -1.81 R Enoyl-[acyl-carrier-protein] reductase 40625 8.78 191 1.74 O [NADH], chloroplastic Dihydrolipoamide S-acetyltransferase 50106 8.33 64 -1.53 R Transketolase-like protein 81937 5.80 280 * -1.85 R Beta-ketoacyl-ACP synthetase 1 32334 9.47 168 * -1.84 R Oligopeptidase A-like protein 81777 5.39 63 -1.69 R 3-ketoacyl-acyl carrier protein synthase I 50890 7.99 379 * -1.69 R 9-cis-epoxycarotenoid dioxygenase 4 64534 7.65 53 -1.81 R Delta1-pyrroline-5-carboxylate synthetase 78170 6.00 108 -2.30 R Aldo-keto reductase, putative 36795 5.49 118 1.69 O Serine hydroxymethytransferase 1 (SHM1); glycine hydroxymethyltransferase/ poly(U) 57535 8.13 198 3.03 O binding

146

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Nucleotide-rhamnose synthase/epimerase- 33861 5.73 140 -1.86 R reductase (NRS/ER) Glucose-1-phosphate adenylyltransferase 57294 5.87 222 1.53 O small subunit, chloroplastic 3-chloroallyl aldehyde dehydrogenase/ 54782 5.47 60 -1.64 R aldehyde dehydrogenase (NAD) Unnamed protein product, containing 23362 4.91 125 -1.78 R chalcone-flavanone isomerase domain ADP-glucose pyrophosphorylase small 57294 5.87 3.22 SCISEGAIIEDTLLMGADYYETDADR 1.66 182 1.70 O subunit Putative aldehyde dehydrogenase 55264 6.09 2.01 LGPALACGNTVVLK 1.53 O Aspartate aminotransferase Asp2 44267 6.80 1.52 VGALSIVCK 0.72 R 3-isopropylmalate dehydratase-like protein 27208 6.44 1.53 EHAPVCLGAAGAK 1.39 O (small subunit) Oxalic acid oxidase 21504 9.06 4.77 AETPAGYPCIRPIHVK 1.24 O 5-methyltetrahydropteroyltriglutamate-- 84357 6.09 4.11 CVKPPVIYGDVSRPK 1.20 O homocysteine S-methyltransferase Streptomyces cyclase/dehydrase family 21395 5.98 2.00 SELAQSIAEFHTYHLGPGSCSSLHAQR 0.78 90 -2.31 R protein Transcription (2) RNA helicase 51617 5.68 156 1.53 / * -1.97 O/R KH domain-containing protein NOVA 33857 5.70 91 1.95 O Protein synthesis (10) 40S ribosomal protein S3 27612 9.57 154 1.99 O 60S ribosomal protein L12-like 18073 9.05 128 -1.64 R RIbosomal protein L16 21033 9.94 118 1.57 O Ribosomal protein S1; RNA binding 45310 5.13 272 -1.98 R Elongation factor 1-alpha 49799 9.19 199 * 1.81 O Eukaryotic initiation factor 4A 47187 5.29 155 * -1.85 R HYAHVDCPGHADYVK 0.74 Arabidopsis Rab GTPase homolog E1b 51630 5.84 5.00 106 1.91 O/R IVVELIVPVACEQGMR 1.33 Elongation factor Tu, chloroplastic 52177 6.21 79 1.81 O

147

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Eukaryotic translation initiation factor-5A 17315 5.71 210 * -1.98 R Translation initiation factor 3, subunit g 32865 8.31 142 1.99 O Protein folding, transporting and degradation (13) Putative ATP-dependent Clp protease 29534 9.38 77 -1.76 R proteolytic subunit ClpP6 ClpC protease 99588 8.78 97 -1.69 R Cyclophilin 38 (CYP38); peptidyl-prolyl cis- 48480 5.06 126 1.66 O trans isomerase Cyclophilin 28532 8.83 116 1.67 O Mitochondrial processing peptidase alpha 54539 5.94 302 * -1.84 R subunit, putative Putative aspartic protease 28008 8.34 48 1.50 O Molecular chaperone Hsp90-2 80430 4.98 145 * -1.89 R Chaperonin 60 beta (CPN60B) 64169 6.21 185 -1.82 R 20S proteasome beta subunit; multicatalytic 29847 6.66 179 2.66 O endopeptidase 20S proteasome subunit PAE1 26102 4.70 61 -1.75 R Proteasome 30685 4.99 243 1.87 O ATPDIL1-3 (PDI-LIKE 1-3); thiol-disulfide 64400 4.74 135 * -1.61 R exchange intermediate Multicatalytic endopeptidase complex, 25151 5.31 2.07 ITQLTDNVYVCR 1.29 O proteasome precursor, beta subunit Signal transduction (3) Phospholipase D alpha 1 (PLD1) 92236 5.52 270 * -1.77 R Arabidopsis thaliana MAP kinase 12 42904 8.05 131 1.81 O (ATMPK12); MAP kinase Predicted protein, containing calcium 36689 8.61 67 * -1.90 R binding motif Membrane and transport (3) Potassium channel protein 36596 8.22 62 1.74 O 2-Cys peroxiredoxin 29708 5.81 210 3.28 O P-Protein - like protein 113852 6.51 69 -1.96 R

148

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Unnamed protein product, containing pfam00153 (mitochondrial carrier protein) 32398 9.35 122 1.50 O domain Stress and defense (14) Unnamed protein product, containing 21623 8.97 178 -1.60 R cd03013 (peroxiredoxin family) domain Monodehydroascorbate reductase 46604 5.81 410 * -2.12 R Low expression of osmotically responsive 47974 5.54 344 -1.81 R genes 1 (LOS2) Daikon cysteine protease RD21 32085 4.57 218 * 1.60 O Early-responsive to dehydration 8 80299 4.95 586 * -1.61 R Heat shock cognate protein HSC70 71129 5.08 459 * -1.92 R Germin-like protein 22020 6.81 79 1.64 / -1.72 O/R Ascorbate peroxidase 27726 5.73 142 2.66 O Putative manganese superoxide dismutase 25499 8.47 83 -1.66 R Late embryogenesis abundant family 36185 4.69 72 * 1.69 O protein QIIQDFKDYADLCFK 0.71 Myrosinase 62265 6.30 18.20 QIIQDFKDYADLCFKEFGGK 0.70 O/R CSPMVDTKHRCYGGNSSTEPYIVAHN 1.22 QLLAHATVVDLYR Type 2 peroxiredoxin 17432 5.37 2.00 VILFGVPGAFTPTCSMK 1.27 O Glycine-rich RNA binding protein 16351 5.56 260 * -2.68 R Cell Structure (5) Actin 41888 5.29 547 * -1.60 R Plastid-lipid associated protein PAP2 34689 4.79 61 1.79 O TUB4 (tubulin beta-4 chain) 50361 4.76 427 1.55 O Putative tubulin alpha-2/alpha-4 chain 50089 4.91 250 * 1.56 O Extensin-like protein 82246 6.49 2.00 IPASICQLPK 1.20 O Cell divison, differentiation and fate (2) Proliferating cell nuclear antigen 29375 4.61 226 * 1.75 O

149

Table 3-2. Continued. Unused Fold Mascot Fold Change Redox Name M.W. pI Score Peptide Change Score (DIGE) Switch (ICAT) (ICAT) Guanine nucleotide regulatory protein 25616 6.39 89 1.87 O (RAN2) Unknown (4) CBS domain-containing protein 22829 9.10 205 -1.60 R Hypothetical protein 41562 8.77 55 -1.67 R Hypothetical protein 49100 7.55 2.02 MCCLFINDLDAGAGR 1.34 O Unknown protein 29648 9.52 2.00 LGACVDLLGGLVK 0.64 R

150

Control SH SCAM SCAM +IAM +TCEP cy3m SH SCAM SCAM

SH SCAM SCAM + ICAT light cy5m

Alkylation of Reduction Labeling of the free –SH of S-S –SH groups

ABA or MeJA

SH SCAM SCAM +IAM +TCEP S S SH + ICAT S S SH heavy

Figure 3-1. Complimentary approaches of saturation DIGE and ICAT used to identify redox sensitive proteins in response to the ABA or MeJA treatment. Control and treated guard cells were firstly alkylated to block free -SH groups that were not responsive, then the oxidized cysteines in response to the hormone treatment were reduced and labeled by Cy dyes or ICAT reagents.

151

Figure 3-2. Functional classification of redox sensitive proteins in guard cells under ABA (A) and MeJA (B) treatment. The pie charts show the distribution of the proteins into their functional classes in percentage.

152

Figure 3-3. Example of redox protein identification using DIGE approach. A) DIGE image of control guard cell proteins; B) DIGE image of ABA treated guard cell proteins; C) A redox protein spot from control sample; D) The redox protein spot from treated sample; E) 3D view of (C); F) 3D view of (D); G) Quantitative volume changes of the spot across replicate samples. The protein spot was identified as myrosinase.

153

Figure 3-4. Example of redox protein identification and cysteine mapping using ICAT approach. A) Summary of protein identification (germin-like protein) and quantitative change; B) Peptide quantification in the control sample (light) and ABA treated sample (heavy); C) Peptide MS/MS spectrum indicating a heavy ICAT labeled cysteine residue. Control and treated guard cells were firstly alkylated to block free thiol groups of cysteines, then the oxidized cysteines in response to ABA or MeJA treatment were reduced and differentially labeled using ICAT reagents.

154

Figure 3-5. Venn diagram of guard cell thiol proteins responsive to ABA and MeJA identified by ICAT and saturation DIGE. The circled area is proportional to the number of proteins identified for each treatment using single method. The overlapping region is labeled with the number of the same proteins identified between the two treatments. A) A total of 27 and 54 proteins were identified to be redox responsive to ABA treatment in guard cells by ICAT and DIGE, respectively. Eight proteins were identified by both methods. B) For the MeJA treated guard cells, a total of 18 and 118 were identified to be redox responsive by ICAT and DIGE, respectively. Six proteins were identified by both methods. C) A total of 12 and 25 proteins were found to be common between ABA treated and MeJA treated guard cells analyzed in ICAT and saturation DIGE experiments, respectively.

155

CHAPTER 4

FUNCTIONAL CHARACTERIZATION OF A BRASSICA NAPUS SNRK2

Introduction

Reversible phosphorylation/dephosphorylation is a universal regulatory mechanism widely found in both prokaryotic and eukaryotic organisms. Protein kinases and phosphatase catalyze the transferring and removal of a phosphate group, respectively (Burnett and Kennedy, 1954). Undoubtedly, this reversible modification plays an important role in cellular processes since it often acts like an on/off switch to activate or deactivate certain target proteins with different functions (Mundy and

Schneitz, 2002). It also facilitates the responses to ever changing environment and thus the survival of living organisms. In plants, this regulatory mechanism in signaling pathways have been extensively studied due to the fact that plants are sessile and continuously subjected to different environmental stimuli and challenges. Based on the currently available sequence information, more than 1000 genes in Arabidopsis genome are found to encode protein kinases, indicating the broad and fundamental functions of kinases in plant biology (Tchieu et al., 2003).

Plant protein kinases have been classified into several families. Groups such as mitogen-activated protein kinase (MAPK), calcium-dependent protein kinase (CDPK) and sucrose non-fermenting 1 related protein kinase (SnRK) play pivotal roles in plant responses towards a spectrum of environmental factors. SnRK has three subfamilies,

SnRK1, 2 and 3 (Harmon, 2003). SnRK1 subfamily was firstly identified in plants closely related to the sucrose non-fermenting 1 (SNF1) from yeast and AMP-activated protein kinase (AMPK) from animals. The members of SnRK1 mainly participate in carbon and nitrate metabolism in plants (Halford and Hey, 2009). In contrast, SnRK2 and SnRK3

156

are unique to plants with dominant roles in stress response (Halford and Hey, 2009).

For instance, ten genes have been classified into SnRK2 subfamily in A. thaliana, nine of which are activated upon hyperomostic stress such as drought and salinity

(Boudsocq et al., 2004).

One of the best characterized SnRK2 is the OPEN STOMATA 1 (OST1) in the abscisic acid (ABA) signal transduction in guard cells. OST1 is a positive regulator that forms a complex with ABA receptor and phosphatase PP2C (Lee et al., 2009). When

ABA binds to the receptor PYR/PYL/RCAR, the phosphatase PP2C is deactivated, which in turn keeps OST1 in an active phosphorylated form. To date, the identified substrates of OST1 include NADPH oxidase located on plasma membrane, S-type anion channel (SLAC1), inward-rectifying potassium channel (KAT1) and transcription factors such as ABF3 (Sirichandra et al., 2009; Geiger et al., 2009; Sato et al., 2009;

Sirichandra et al., 2010). In addition, the involvement of OST1 in jasmonate (JA), reactive oxygen species (ROS) and CO2 signaling pathways has been recently unraveled (Suhita et al., 2004; Vahisalu et al., 2010; Xue et al., 2011). Together with the discovery of OST1 targets with divergent functions, all the data imply a central role of

OST1 in plant stress response and signal transduction, which is mediated by the phosphorylation/ dephosphorylation mechanism.

Although several lines of evidence indicate that OST1 acts upstream of ROS production, a common event in ABA and JA signal transduction in guard cells, the question of whether OST1 is under redox regulation has been intriguing and remains untackled. Our knowledge about redox regulation of plant kinases is scarce. It has been reported that deactivation of PEPC-PK (phosphoenolpyruvate carboxylase protein-

157

serine/threonine kinase) by oxidized glutathione (GSSG) was reversed by adding DTT and the process could be accelerated by thioredoxin (Saze et al., 2001). However, inhibitory effect of thioredoxin was observed with an S-locus kinase in Brassica stigma

(Cabrillac et al., 2001). Recently an osmotic stress-activated protein kinase from tobacco (NtOSAK) has been found to form a cellular complex with glyceraldehyde 3- phosphate dehydrogenase (GAPDH) and both proteins are regulated directly or indirectly by nitric oxide (NO) (Wawer et al., 2010). These data indicate a complex orchestrated regulatory mechanism underlying the connection between redox and phosphorylation events.

In our previous experiments, a serine/threonine protein kinase BnSNRK2 was identified to be redox responsive in ABA treated B. napus guard cells. To investigate the function and regulation of this kinase, the gene was cloned from B. napus, expressed in

E. coli and characterized using biochemical approaches. The results demonstrate that the BnSNRK2 activity is Mn2+-dependent and redox responsive in vitro. Hydrogen peroxide, NO donor S-nitrosoglutathione (GSNO) and GSSG can inhibit the in vitro kinase activity and the inhibitory effect could be reversed by DTT. The cysteines contributing to the redox regulation have been identified. This work has revealed a novel regulatory mechanism interconnecting phosphorylation and redox switch in plant hormone signaling under stress conditions.

Materials and Methods

RNA Extraction, Reverse Transcription and PCR

RNA was extracted from different B. napus tissues using an RNeasy® plant mini kit

(Qiagen, USA). Briefly, liquid nitrogen frozen tissues were ground into fine powder.

Powder material of approximately 100 mg was transferred to RNase free tubes with

158

RLT buffer. The lysate was transferred to a QIAshredder spin column and the flow- through was collected. Mix the clear lysate with 0.5 volume of ethanol by pipetting, and then load the mixture on an RNeasy spin column. The column was centrifuged multiple times for RNA binding and washing purposes with appropriate buffers supplied in the kit.

Finally, RNA was eluted from the column in 50 µL of RNase free water. The quality and quantity of the RNA was measured using a NanoDrop® 1000 spectrometer (Thermo

Fisher Scientific, USA). cDNA was synthesized from 1 µg of total RNA using a

SuperScript® II kit (Invitrogen, USA) in a 20 µL reaction with oligo(dT) following the manufacturer‟s manual. The major steps include synthesis reaction at 42°C for one hour after denaturing RNA at 70°C for 5 min, inactivation at 80°C for 5 min, and adding nuclease free water for downstream PCR. Please refer to Table 4-1 for PCR primers in each experiment.

Recombinant Protein Expression and Purification

The cDNA of BnSnRK2 was cloned into the pET28a expression vector (Novagen,

USA) using primers SnRK2-F1 and SnRK2-R1 (Table 4-1). To generate the cysteine (C) mutants and serine (S)/threonine (T) mutants of BnSnRK2, the residues were substituted by alanine (A) or aspartic acid (D) residues using a site-directed mutagenesis kit (Stratagene, USA) with appropriate primers (Table 4-1). The fidelity of the mutated sequences in the constructs BnSnRK2 C90A, C114A, C142A, C186A,

C90A/C114A, C142A/C186A, C114A/C142A, C114A/C186A, S158A, S158D, T159A,

T159D, S154A, S154D, S172A and S172D was confirmed by DNA sequencing. The constructs were expressed in E. coli strain BL21 (DE3) by growing in LB medium (1% w/v tryptone, 0.5% w/v yeast extract, 1% w/v NaCl) at 37°C to an absorbance of 0.6, and then the expression was induced with 1 mM isopropyl-beta-D-

159

thiogalactopyranoside (IPTG) at 37°C for 4 h. BnSnRK2 and mutant proteins were purified as His-tagged proteins using a Midi PrepEase® kit (Affymetrix/USB, USA).

Purified protein was dialyzed against 25 mM Tris-HCl pH 7.5 containing 0.5 mM DTT and a bacterial protease inhibitor cocktail (Sigma-Aldrich Co., USA) at 4°C overnight.

The protein preparations were concentrated by ultra-ﬁltration using a 3 kD cut-off membrane (Millipore, USA) at 4°C. Protein concentration was determined by the

Bradford protein assay (Bio-Rad Laboratories Inc., USA) with bovine serum albumin

(BSA) as a standard. The homogeneity of the purified protein was determined by SDS-

PAGE, and the identity was confirmed by LC-MS.

In vitro In-solution Kinase Assay

The reaction buffer for phosphorylation of BnSnRK2 with or without substrates

(myelin basic protein, β-casein or histone type III-S) contains 50 mM Tris-HCl pH 7.5, 10

32 mM MnCl2 (or other divalent ions), 2 µM cold ATP and 2 µCi [γ- P] ATP. One microgram BnSnRK2 was added to initiate the reaction unless otherwise stated. After incubation at 30°C for 30 min, the reaction was stopped by adding SDS-PAGE sample buffer and denaturing at 100°C for 5 min. Proteins were separated on 12% SDS gels.

Phosphorylated proteins were visualized by autoradiography after the gel was washed with a buffer containing 5% trichloroacetic acid and 1% sodium pyrophosphate and dried.

Results

The Serine/Threonine Protein Kinase Belongs to SnRK2 Subfamily

The serine/threonine protein kinase was identified in the previous proteomic analysis of ABA treated B. napus guard cells. The sequence in the GenBank

(Accession: AAA33004) was used to design primers for cloning from B. napus var.

160

Global. The sequence from our variety has one amino acid difference from its homolog in other varieties and was submitted to the GenBank (Accession: HM563040) after sequencing. Sequence alignment with other species suggests that the serine/threonine kinase belongs to the SnRK2 (SNF1-related protein kinase 2) subfamily (Figure 4-1).

This kinase contains all 11 conserved kinase subdomains characteristic of Ser/Thr kinases (Hanks et al., 1988). The stretch of aspartic acid residues present at the C terminal classified the kinase to SnRK2b, whereas SnRK2a has dominant glutamic acid repeat at the C terminal (Figure 4-2). Phylogenetic analysis shows the close homologs of the BnSnRK2 include SnRK2.4 and SnRK2.10 from Arabidopsis and an osmotic stress-activated protein kinase from tobacco (NtOSAK) (Figure 4-1). The Arabidopsis

SnRK2.4 and SnRK2.10 have been found to be activated by ionic (salt) and non-ionic

(mannitol) osmotic stress (Boudsocq et al., 2004). NtOSAK is rapidly activated within 1 min after osmotic stress and the activity maintained for about 2 h (Mikołajczyk et al.,

2000). The known functions of the BnSnRK2 homologs imply that this serine/threonine protein kinase from B. napus may be activated by stress conditions and involved in stress signal transduction.

Recombinant BnSnRK2 Requires Mn2+ for in vitro Autophosphorylation Activity with Multiple Phosphorylation Sites

To investigate the biochemical characteristics of the kinase, the BnSnRK2 cDNA was cloned into pET28a vector with an IPTG inducible lac operon. After expression in E. coli and nickel affinity purification, the protein identity was confirmed by mass spectrometry. Autophosphorylation is one of the most important features of kinases

(Smith et al., 1993), but it is not uncommon that some recombinant kinases do not exhibit any activities under in vitro conditions (Mustilli et al., 2002; Kelner et al., 2004).

161

Here we tested three different divalent cations, Mg2+, Mn2+, and Ca2+, for in vitro autophosphorylation of recombinant BnSnRK2. The autophosphorylation activity could only be observed in presence of Mn2+ (Figure 4-3). The presence of any other divalent ions did not inhibit the activity (Figure 4-3). Alkaline phosphatase treatment could completely inhibit the autophosphorylation activity. It is interesting to note that BnSnRK2 and Arabidopsis OST1 share 84% sequence identity at amino acid level, and their cation preference in vitro is identical (Geiger et al., 2009). The maximum BnSnRK2

2+ activity was achieved with 5 mM of MnCl2 and maintained with 10 mM [Mn ] (Figure 4-

4). To ensure optimal assay conditions, 10mM MnCl2 was used for all the in vitro kinase assays.

To determine the phosphorylated amino acid residues, the autophosphorylation reaction was conducted with non-radioactive ATP and the sample was separated on

SDS gels. Gel band containing BnSnRK2 protein was excised and digested with trypsin.

The peptides were subject to tandem MS analysis to detect phosphorylation sites. The

MS/MS data suggested serine 154 (Ser154), serine 158 (Ser158), threonine 159

(Thr159) and serine 172 (Ser172) are phosphorylated. These residues were mutated to alanine (A) or aspartic acid (D) to test their significance to the kinase activity. Ser158 and Thr159 are located in the activation loop of the kinase (Figure 4-2). Figure 4-5 shows a slight band could be detected when the serine 158 is mutated to an alanine, which indicates a critical role of Ser158 in the kinase autophosphorylation activity.

However, the phosphorylation activity of the S158A mutant didn‟t decrease using its generic substrate. This implies the Ser158 does not contribute to the phosphorylation activity of BnSnRK2. The mutant S158D, however, appeared to mimic the constitutive

162

phosphorylation of the residue and the phosphorylation activity has been retained

(Figure 4-5). In contrast, the mutation of Thr159 to alanine showed no effect on the kinase activity, demonstrating the phosphorylation of this residue is not required for the

BnSnRK2 activity. This result is consistent with the features identified of OST1 (Belin et al., 2006). Unexpectedly, no activity was detected for the T159D mutant. The reasons could be either phosphorylation of this residue inactivates the kinase mutant, or the

T159D mutation results in a misfolded protein when expressed in E. coli, which could explain the very low activity. At this stage the two hypotheses cannot be discriminated.

Other residues, serine 154 and serine 172 were also tested for their roles in the autophosphorylation and phosphorylation activities. The mutation of both residues to alanine decreased the autophosphorylation activity, but the remaining activity suggests other residues are phosphorylated to keep the kinase activity (Figure 4-6). Unlike the

S154D mutant, the S172D mutant didn‟t show activity comparable to wild type and the ability to phosphorylate substrate decreased dramatically (Figure 4-6). All together, the recombinant BnSnRK2 shows in vitro activity with multiple phosphorylation sites, e.g.,

Ser154, Ser158, Thr159 and Ser172. However, the role of each residue in the kinase activity may be distinct.

BnSnRK2 Preferentially Phosphorylates Myelin Basic Protein and Casein in vitro

To determine the substrate specificity of the kinase, three generic substrates, myelin basic protein (MBP), histone type III and β-casein were tested. The purchased substrates incubated without BnSnRK2 showed no autographic signal, confirming no introduction of phosphate groups to the proteins without BnSnRK2 (data not shown). In the kinase assay, each reaction contains 0.2 µg recombinant BnSnRK2 and 5 µg substrate to mimic a general enzyme/substrate ratio (Figure 4-7). Both MBP and β-

163

casein showed strong phosphorylation signals but not histone type III (Figure 4-7).

Interestingly, the well-studied Arabidopsis OST1 phosphorylates histone type III in vitro whereas the naturally purified NtOSAK phosphorylates MBP and β-casein (Kelner et al.,

2004; Belin et al., 2006). The elucidation of the BnSnRK2 substrate specificity is useful for monitor its activities in vivo using the in-gel kinase assay, which is simple, sensitive and specific. It may also provide hints about the in vivo phosphorylation targets when comparing to other known stress-induced protein kinases.

In vitro BnSnRK2 Kinase Activity is Redox Regulated

Since BnSnRK2 was identified in the guard cell ABA redox proteomics (Chapter 3;

Table 3-1), it is intriguing to test whether its activity is indeed under redox regulation and what the physiological significance is. Recombinant BnSnRK2 (approximately 1 µg) was pretreated with 0.2 mM H2O2. After the treatment, the kinase activity was significantly decreased (Figure 4-8). With 5 mM H2O2, the activity was completely abolished (Figure

4-8). This concentration range has been used by other groups in testing protein redox regulation (Cabrillac et al., 2001; He et al., 2009; Lindermayr et al., 2010). However, the

-14 natural H2O2 concentration in plants is extremely low (10 M), thus whether the redox response occurs in vivo remains to be investigated (Keppler et al., 1989). Reactive nitrogen species (RNS) also serve as second messengers in guard cell signal transduction (Li et al., 2006; Saito et al., 2009). The effect of two NO donors were tested, i.e., sodium nitroprusside (SNP) and S-nitrosoglutathione (GSNO). SNP inhibits the activity of BnSnRK2 in a dose-independent manner (Figure 4-8). The underlying mechanism is not clear. However, SNP was not preferred as a nitric oxide donor in biological experiments due to its side effect in the presence of ferrous ion (Fe2+).

Therefore, another NO donor, S-nitrosoglutathione (GSNO) was tested. GSNO is a

164

general physiological transport and storage form of NO in plants and animals (Zhang and Hogg, 2004). In contrast to SNP, GSNO inhibits the BnSnRK2 activity in a dose- dependent manner (Figure 4-8). One millimolar GSNO has obvious inhibitory effect based on the autoradiographic signal (Figure 4-8). The activity of 5 mM GSNO treated

BnSnRK2 was not detectable and a shift of the gel band was observed (Figure 4-8), which indicates the loss of activity might be resulted from certain modification, e.g., S- nitrosylation. Another oxidant, GSSG has a similar inhibitory effect on the kinase activity as H2O2. With the increase of GSSG concentration, the activity of the kinase decreases dramatically, with no detection at 5 mM (Figure 4-8). Overall, ROS and RNS have inhibitory effect on the activity of BnSnRK2 in vitro, suggesting the kinase activity is sensitive to the oxidation state.

The other direction, i.e., whether the reducing reagents or enzymes could reverse the inhibition caused by the oxidants is very important and of our great interest to understand the regulatory mechanism. The most commonly used reducing reagent,

DTT was firstly employed to test whether the redox response is reversible. At concentration of 10 mM, DTT can rescue the kinase activity which was inhibited by

H2O2, GSNO and GSSG (Figure 4-9). Additionally, enzyme with reducing capability was also tested. Active recombinant thioredoxin isoforms f, h, and m from B. napus var.

Global were added to the pretreated kinase sample and then the activity was assayed.

The inhibition casued by H2O2 could be reversed by thioredoxin h, which is an isoform from cytosol while the isoforms from from chloroplast, f and m were inefficient (Figure 4-

10). All three isofoms could partially reverse the inhibitory effect from GSNO at low concentration (Figure 4-10). In animal, thioredoxin is known to catalyze either

165

transnitrosylation or denitrosylation of specific proteins, depending on the redox status of the cysteines within its conserved oxidoreductase CXXC motif (Wu et al., 2011). On the contrary, none of the thioredoxin isoforms was able to recover the GSSG treated kinase activity (Figure 4-11). This is consistent with that thioredoxins have generally been thought to be relatively inefficient in deglutathionylation in many plant and mammalian species (Greetham et al., 2010). All these evidence demonstates the divergent and reversible responses of the in vitro BnSnRK2 kinase activity to the redox status.

To address the question that whether the kinase activity is correlated to the redox homeostasis, the activity of the kinase samples with different redox states was analyzed. After treatment by GSSG or H2O2 (5 mM) at room temperature for 15 min, reducing reagent DTT was added to each sample at different final concentrations, incubated for another 15 min, and then the activity was assayed. Figure 4-12 shows the protein level didn‟t exhibit obvious changes for the GSSG pretreated kinase; however, the kinase activity is greatly enhanced when the kinase is reduced. Thus the in vitro kinase activity is dynamically responding to the redox state change in a reversible manner. The observation of the H2O2 pretreated kinase was different. At lower concentrations of DTT, the kinase at the monomer size (~42 kD) was barely observed but with visible bands of larger molecular weight on the gel (Figure 4-10). Thus the loss of activity caused by H2O2 treatment is partially due to the decreased protein level since the kinase might be cross-linked to other E. coli protein or forming polymers. Not surprisingly, high concentration of DTT recovered the inhibitory effect on the kinase activity from H2O2 treatment (Figure 4-13). Considering the different modications from

166

the two oxidants, i.e., inter-molecular disulfide bonds by H2O2 treatment and S- glutathionylation by GSSG treatment, the involvement of cysteine(s) in the redox response can be reasonably exoected.

Cysteines of BnSnRK2 Contribute to the Redox Regulation

The thiol containing amino acid cysteine plays a very important role in the redox regulation (Depuydt et al., 2011). The BnSnRK2 protein sequence has six cysteines,

Cys90, Cys114, Cys120, Cys142, Cys186 and Cys233. Based on the intracellular disulfide prediction (http://clavius.bc.edu/~clotelab/DiANNA/), Cys90, Cys114, Cys142 and Cys186 are potentially involved disulfide formation. Among these residues, Cys142 is located right before the activation loop of the kinase (Figure 4-2). The crystal structure of a human 5‟-AMP activated kinase sharing 40% identity with BnSnRK2 suggested

Cys142 is spatially close to the ATP binding motif (PDB ID: 2H6D; Littler et al., 2010).

Therefore, kinase activity was tested with BnSnRK2 mutant C142A exposed to H2O2 and GSNO. The mutant did show the kinase activity, although not as potent as the wild type (Figure 4-14). After treated with 5 mM H2O2, the activity of the mutant was partially maintained rather than being inhibited (Figures 4-8 and 4-14). No obvious differences between untreated and GSNO treated BnSnRK2 C142A mutant activity could be observed (Figure 4-14). These results suggest the contribution of cysteine 142 to the redox response of BnSnRK2. The involvement of other cysteines in the redox response and the modification of the redox-responsive cysteines, e.g., disulfide bond, sulfonic acid and S-nitrosylation etc., deserve further investigation.

Conclusions and Future Work

From the inventory of redox responsive proteins identified in hormone treated guard cells, a serine/threonine protein kinase BnSnRK2 with potential function in stress

167

response was selected for detailed biochemical and functional characterization. Cation preference and substrate preference are important features of kinases. Recombinant

BnSnRK2 exhibits autophosphorylation activity with a divalent cation preference of manganese. No activity was detected with presence of magnesium or calcium. Such cation preference is also seen in other plant kinase, such as the OPEN STOMATA 1

(OST1) in the guard cell ABA signaling pathway (Geiger et al., 2009). However, the concentration of Mn2+ at millimolar range may not reflect the cellular physiological level.

Plants contain 15-150 ppm free Mn2+ but in some species it can go up to 1000 ppm

(Mukhopadhyay and Sharma, 1991). Considering the natural abundance of kinase is usually low, the in vitro autoradiography results may not reflect the activity in vivo because of the high concentrations of both kinase and manganese in the reaction tube.

Similar to the osmotic stress-activated protein kinase from tobacco (NtOSAK),

BnSnRK2 preferentially phosphorylates myelin basic protein and β-casein. Mass spectrometry analysis revealed multiple phosphorylation sites of BnSnRK2. The contribution of each serine or threonine to the kinase activity was investigated. The data suggested that serine 158 located in the activation loop is critical for the kinase activity but not the threonine 159. Serine 154 and serine 172 both are phosphorylated and contribute to the kinase activity. All these results laid a foundation for further in vitro and in vivo studies of BnSnRK2 functions.

A few kinases in animal have been known to be redox regulated. For example,

Janus kinase activity is nitric oxide and thiol redox regulated (Duhé et al., 1998).

However, redox regulated kinase has been rarely reported in plants. An S-locus receptor kinase from B. oleracea was found to be inhibited by thioredoxin, a class of

168

small redox proteins with reducing capability (Cabrillac et al., 2001). In contrast, thioredoxin-mediated reductive activation of a protein kinase for the regulatory phosphorylation of C4-form phosphoenolpyruvate carboxylase from maize has been reported and the activity was inhibited by oxidized glutathione (Saze et al., 2001). These two may represent the only cases of redox-regulated protein kinases in plants. The work presented here is the first time that a redox-regulated kinase in guard cell hormone signaling has ever been studied. The activity of recombinant BnSnRK2 is sensitive to oxidant treatment, such as hydrogen peroxide and reactive nitrogen species. One of the cysteines has been shown to contribute to the redox response of the kinase. Whether other cysteines contribute and what type of modification on the cysteine will be further investigated. These results suggest a novel regulatory mechanism in guard cell signaling, i.e., redox regulation of kinase activity.

Since the SnRK2 and SnRK3 subfamilies are mainly involved in plant stress response (Harmon, 2003; Halford and Hey, 2009). BnSnRK2 may also participate in the

B. napus response to external environmental stimuli, e.g., drought or osmotic stresses.

This hypothesis need to be further tested in vivo. First of all, the expression profiling will be studied using promoter GUS and qRT-PCR. The cellular and tissue specificities may provide hints on the function of BnSnRK2. Meanwhile, an antibody against BnSnRK2 has been developed. In-gel kinase assay will be used to investigate the activators of the natural kinase activity, including drought, salt and mannitol etc. In addition, the transgenic plants of over-expression and RNA interference (RNAi) are being generated.

The phosphoproteomics as a robust and high-throughput tool will be applied to identify the upstream kinase and downstream phosphorylation targets of BnSnRK2.

169

The BnSnRK2 was originally isolated from guard cells under ABA treatment. This brings up the question that whether BnSnRK2 functions as the OST1 in Arabidopsis although the two kinases only share 84% sequence identity. In the ABA signaling pathway in guard cells, OST1 is known to act upstream of ROS production (Mustilli et al., 2002). Based on current results, the feedback regulation of BnSnRK2/OST1 activity can be hypothesized. Our in vitro data support a novel link between the phosphorylation events and the redox regulation in guard cell signal transduction. Future in vivo characterization of BnSnRK2 will provide insights to how this kinase regulate B. napus responses to stress conditions.

170

Table 4-1. Primers used in this study. Primer Sequence Note

BnSnRK2 F-1 CGGATCCATGGAGAAGTACGAGCTGG E.coli expression forward

BnSnRK2 R-1 CAAGCTTTCACACTTCTCCACTTGCG E.coli expression reverse

SRK2E C142 F CCTGCTCCACGTCTCAAAATCGCAGATTTTGGTTATTCCAAGTCC Cys142Ala forward

SRK2E C142 R GGACTTGGAATAACCAAAATCTGCGATTTTGAGACGTGGAGCAGG Cys142Ala reverse

SRK2E C186 F CAAGATGGCTGATGTATGGTCTGCAGGTGTAACTCTTTATGTCATG Cys186Ala forward

SRK2E C186 R CATGACATAAAGAGTTACACCTGCAGACCATACATCAGCCATCTTG Cys186Ala reverse

SnRK2 C90F GTGAATTATTCGAGCGTATAGCAAGTGCTGGAAGATTCAG Cys90Ala forward

SnRK2 C90R CTGAATCTTCCAGCACTTGCTATACGCTCGAATAATTCAC Cys90Ala reverse

SnRK2 C114F CTTATATCAGGTGTTAGCTATGCACATGCTATGCAAATATGC Cys114Ala forward

SnRK2 C114R GCATATTTGCATAGCATGTGCATAGCTAACACCTGATATAAG Cys114Ala reverse

SnRK2-S158A-F CTACTGCACTCGAGGCCCAAAGCAACAGTTGGAACTCCAGC Ser158Ala forward

SnRK2-S158A-R GCTGGAGTTCCAACTGTTGCTTTGGGCCTCGAGTGCAGTAG Ser158Ala reverse

SnRK2-S158E-F CTACTGCACTCGAGGCCCAAAGATACAGTTGGAACTCCAGC Ser158Asp forward

SnRK2-S158E-R GCTGGAGTTCCAACTGTATCTTTGGGCCTCGAGTGCAGTAG Ser158Asp reverse

SnRK2-T159A-F CTGCACTCGAGGCCCAAATCCGCAGTTGGAACTCCAGCATA Thr159Ala forward

SnRK2-T159A-R TATGCTGGAGTTCCAACTGCGGATTTGGGCCTCGAGTGCAG Thr159Ala reverse

SnRK2-T159E-F CTGCACTCGAGGCCCAAATCCGATGTTGGAACTCCAGCATA Thr159Asp forward

171

Table 4-1. Continued. Primer Sequence Note

SnRK2-T159E-R TATGCTGGAGTTCCAACATCGGATTTGGGCCTCGAGTGCAG Thr159Asp reverse

SnRK2-S172A-F CATATATTGCACCTGAGGTCCTTGCACGGAGAGAGTATGATG Ser172Ala forward

SnRK2-S172A-R CATCATACTCTCTCCGTGCAAGGACCTCAGGTGCAATATATG Ser172Ala reverse

SnRK2-S172E-F CATATATTGCACCTGAGGTCCTTGATCGGAGAGAGTATGATG Ser172Asp forward

SnRK2-S172E-R CATCATACTCTCTCCGATCAAGGACCTCAGGTGCAATATATG Ser172Asp reverse

SnRK2-S154A-F CAAGTCCTCTCTACTGCACGCAAGGCCCAAATCCACAGTTG Ser154Ala forward

SnRK2-S154A-R CAACTGTGGATTTGGGCCTTGCGTGCAGTAGAGAGGACTTG Ser154Ala reverse

SnRK2-S154E-F CAAGTCCTCTCTACTGCACGATAGGCCCAAATCCACAGTTG Ser154Asp forward

SnRK2-S154E-R CAACTGTGGATTTGGGCCTATCGTGCAGTAGAGAGGACTTG Ser154Asp reverse

BnEF-1a-F CCAGATCAACGAGCCAAAG qRT-PCR control

BnEF-1a-R GCGAATGTCACAACCATACC qRT-PCR control qRT-SnRK2-FWD2 GCTCCACGTCTCAAAATCTG qRT-PCR BnSnRK2 qRT-SnRK2-RVS2 CCATACATCAGCCATCTTGC qRT-PCR BnSnRK2

172

Figure 4-1. Phylogenetic tree of BnSnRK2 and related kinases in green plants. References for the sequences of the listed kinases are as follows: ZmSAPK6- serine/threonine-protein kinase SAPK6 from Zea mays (GI: 195623946); Os04g0432000-Os04g0432000 from Oryza sativa (GI: 115458454); FsPK- serine/threonine-protein kinase from Fagus sylvatica (GI: 38228677); GmPK3-protein kinase 3 from Glycine max (GI: 310582); AtSnRK2.10- serine/threonine protein kinase SRK2B from Arabidopsis thaliana (GI: 334182444); AtSnRK2.4- serine/threonine protein kinase SRK2A from A. thaliana (GI: 1168529); Al888390-hypothetical protein ARALYDRAFT_888390 from A. lyrata (GI:297849460); CsPK- serine/threonine protein kinase from Camellia sinensis (GI: 110665974); Vv028464-hypothetical protein VITISV_028464 from Vitis vinifera (GI: 147864363); MtSK-stress kinas from Medicago truncatula (GI: 55140609); PtPP-predicted protein from Populus trichocarpa (GI: 224122666); RcASK1- serine/threonine-protein kinase ASK1 from Ricinus communis (GI: 255579673); NtOSAK-osmotic stress-activated protein kinase from Nicotiana tabacum (GI: 19568098).

173

Figure 4-2. Comparison of the amino acid sequence of BnSnRK2 with sequences of other protein kinases. The ATP binding motif, T-loop and the C terminal stretch of aspartic acid residues are highlighted in red, green and purple, respectively. AtSnRK2.4 and AtSnRK2.10 are two members of A. thaliana SnRK2 family (AT1G10940 and AT1G60940). MtSK is a stress responsive kinase from M. truncatula. NtOSAK is an osmotic stress-activated kinase from tobacco (Kelner et al., 2004).

174

Figure 4-3. Effect of cation on SnRK2 autophosphorylation and phosphorylation activities. Upper panel: autoradiograph of SnRK2 phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Lane 1: protein molecular marker. The band in lower panel indicates 37kDa. Lane 2: elution sample from pET28a transformed BL21 as negative control. Lane 3: SnRK2 in the reaction buffer containing 10mM MnCl2. Lane 4: SnRK2 and alkaline phosphatase (CIP) in the Mn2+ buffer. Lane 5: SnRK2 and generic substrate histone III (HIS) in the Mn2+ buffer. Lane 6: SnRK2 in reaction buffer containing 10mM MgCl2. Lane 7: SnRK2 in reaction buffer containing 10mM CaCl2. Lane 8: SnRK2 in reaction buffer containing 10mM MnCl2 and 10mM MgCl2. Lane 9: SnRK2 in reaction buffer containing 10mM MnCl2 and 10mM CaCl2. Lane 10: SnRK2 in reaction buffer containing 10mM MgCl2 and 10mM CaCl2.

175

Figure 4-4. Optimization of Mn2+ concentrations in SnRK activity assay. Upper panel: autoradiograph of SnRK2 phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Phosphorylation buffer contains 50 mM Tris-HCl pH 7.5, different concentrations of MnCl2 as indicated, 2 μM cold ATP and 2 μCi [γ-32P] ATP.

176

Figure 4-5. Phosphorylation of Ser158 is required for BnSnRK2 kinase activity. Upper panel: autoradiograph of SnRK2 and substrate phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Phosphorylation buffer contains 50 mM Tris-HCl pH 7.5, 10 mM MnCl2, 2 μM cold ATP and 2 μCi [γ- 32P] ATP.

177

Figure 4-6. Ser154 and Ser172 are phosphorylated to maintain the BnSnRK2 activity. Upper panel: autoradiograph of SnRK2 and substrate phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Phosphorylation buffer contains 50 mM Tris-HCl pH 7.5, 10 mM MnCl2, 2 μM cold ATP and 2 μCi [γ-32P] ATP.

178

Figure 4-7. SnRK2 specifically phosphorylates myelin basic protein (MBP) and β-casein in vitro. Left panel: Coomassie blue stained gel as loading control. Right panel: autoradiograph of SnRK2 with different substrates after phosphorylation reaction in vitro. Phosphorylation buffer contains 50 mM Tris- 32 HCl pH 7.5, 10 mM MnCl2, 10 mM MgCl2, 2 μM cold ATP and 2 μCi [γ- P] ATP. The protein molecular marker is as indicated. Lanes from left to right are 1): eluted SnRK2 sample dialyzed against 25 mM Tris-HCl pH 7.5 and 0.5 mM DTT overnight; 2): SnRK2 sample with myelin basic protein (MBP); 3): SnRK2 with histone type III (HIS III); 4): SnRK2 with β-casein.

179

Figure 4-8. Effects of H2O2, S-nitrosoglutathione (GSNO), and oxidized glutathione (GSSG) on the autophosphorylation activity of BnSnRK2 in vitro. Another type of nitric oxide donor sodium nitroprusside (SNP) inhibits the activity in a dose- independent manner. Protein samples were treated with for 10 min at room temperature. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50mM Tris-HCl pH 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ-32P] ATP. SDS-PAGE running buffer without DTT was added to stop reaction then mixtures were loaded onto the gel.

180

Figure 4-9. Effect of DTT on the autophosphorylation activity of SnRK2 treated with H2O2, GSNO (S-nitrosoglutathione), and GSSG (oxidized glutathione). Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min for each step at room temperature. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50 mM Tris-HCl pH 32 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ- P] ATP.

181

Figure 4-10. Effect of thioredoxin on the autophosphorylation activity of SnRK2 treated with GSNO and H2O2. Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min for each step at room temperature. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50 mM Tris-HCl pH 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ-32P] ATP.

182

Figure 4-11. Effect of thoredoxin f, h and m on the autophosphorylation activity of SnRK2 treated with GSSG. Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min for each step at room temperature. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50 mM Tris-HCl pH 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ-32P] ATP.

183

Figure 4-12. Redox titration of autophosphorylation activity of SnRK2 with DTT. Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min at room temperature for each step. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50mM Tris-HCl pH 32 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ- P] ATP. SDS-PAGE running buffer without DTT was added to stop reaction then mixtures were loaded onto the gel.

184

Figure 4-13. The autophosphorylation activity of SnRK2 is sensitive to the redox status. Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min at room temperature for each step. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50 mM Tris-HCl 32 pH 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ- P] ATP. SDS-PAGE running buffer without DTT was added to stop reaction then mixtures were loaded onto the gel.

185

Figure 4-14. Effect of oxidants on autophosphorylation activity of BnSnRK2 C142A mutant. Upper panel: autoradiograph of the kinase phosphorylation in vitro. Lower panel: Coomassie blue stained gel as loading control. Protein samples were treated for 15 min at room temperature. Kinase activity assay was carried out at 30 °C for 30 min. Reaction buffer contains 50 mM Tris-HCl pH 32 7.5, 10 mM MnCl2, 2 μM ATP and 2 μCi [γ- P] ATP.

186

CHAPTER 5

SUMMARY AND PERSPECTIVES

Stomata have been recognized as the first line of plants to sense, respond and adapt to the external environmental changes. Stomatal movement controls the rate of carbon dioxide intake and water evaporation, as well as pathogen invasion. Thus stomatal function is extremely important to the plants‟ survival and fitness considering their sessile nature. The main function of stomatal guard cells is to perceive, integrate and transduce the external signals. Thus changes in ion/solute influx and efflux of the guard cells directly regulate the stomatal movement. In contrast to guard cells, mesophyll cells constitute the major part of the leaf organ with a predominant function of photosynthesis. Here isotope tagging technology iTRAQ was employed to profile the

Brassica napus guard cell proteome and identify proteins preferentially expressed in both the guard cell and mesophyll cell. Overall 1458 non-redundant proteins were identified with 74 proteins highly expressed in guard cells. The majority of these proteins fall into the functional groups of energy (respiration), signaling, transport, and transcription. In addition, four proteins involved in nucleosome and three involved in cell structure were highly expressed in guard cells. On the contrary, in mesophyll cells over half of the proteins are involved in photosynthesis followed by 23 proteins involved in metabolism and 17 disease/defense/stress proteins. Our comparative proteomics of the guard cells and mesophyll cells provides molecular evidence to the functional differentiation between the two types of cells.

Stomatal closure, as a fast response to environmental stimuli, can be induced by a spectrum of factors, such as water deficiency, ozone and UV light, flooding and pathogen invasion. Phytohormones, including abscisic acid (ABA) and jasmonate (JA)

187

are small molecules associated with stress conditions and can also trigger stomatal closure in some species, including V. faba, A. thaliana and B. napus. Hormone signal transduction in guard cells has been studied for decades. Only until very recently, the initial stages of the ABA signaling pathway in guard cells have been elucidated, including the receptors belonging to the START/Bet v I superfamily, protein phosphatase 2C as a negative regulator and a kinase OPEN STOMATA 1 (OST1) as positive regulator composing a double negative regulatory module (Figure 1-2). A few signaling events in ABA signal transduction in guard cells were found to be involved in the MeJA signal transduction, e.g., ROS and NO production, cytosolic alkalinization and cytosolic Ca2+ elevation. Thus, a hormone crosstalk hypothesis was proposed

(Munemasa et al., 2007). The same technology iTRAQ was applied to investigate the responsive proteins in B. napus guard cells to ABA and MeJA. Each study has established an inventory of potential components in the hormone signaling pathway.

However, there are only very limited number of proteins shared between the two data sets. This indicates the crosstalk may occur mostly at post-translational level rather than the expression (abundance) level.

ROS production was observed in B. napus epidermal peels when treated with ABA and MeJA, which might change the redox status of the cellular environment. To profile redox responsive proteins under such treatments, two complementary redox proteomics approaches were employed, i.e., ICAT and saturation DIGE, which tags or labels cysteines specifically. Under ABA and MeJA treatment, 73 and 130 proteins were identified to be redox responsive, respectively. Very interestingly, a large portion of proteins (37) are shared between the two data sets. Redox regulation of these identified

188

proteins needs to be validated in vitro and in vivo and deserves further investigation.

These results not only provide molecular details to the crosstalk hypothesis between the

ABA and MeJA signaling pathways in guard cells, but also set a stage to explore the function of each signaling node.

Another universal post-translational modification is phosphorylation/dephosphory

-lation, which also plays an important role in the guard cell physiology. For example, the kinase OST1 phosphorylates different targets, including NADPH oxidase, potassium channel, slow anion channel, and transcription factors. Based on the results from the proteomic analysis of the hormone treated guard cells, a serine/threonine protein kinase

(BnSnRK2) was cloned and heterogeneously expressed. Recombinant BnSnRK2 exhibits autophosphorylation activity in vitro in a Mn2+-dependent manner with preferred generic substrates myelin basic protein and casein. Hydrogen peroxide, nitric oxide donor GSNO and oxidized glutathione (GSSG) have inhibitory effects on the in vitro

BnSnRK2 activity. Furthermore, the inhibitory effect by these oxidants could be reversed and the activity was even enhanced by DTT. Thioredoxin isoform h also shows the recovery effect on the kinase activity after H2O2 treatment. However, three types of thioredoxin f, h, and m could only partially reverse the inhibition on activity caused by S- nitrosylation and show inefficiency to rescue the loss of activity caused by S- glutathionylation. Mutation of one cysteine (Cys142) resulted in the impairment of

BnSnRK2 ability to respond to the oxidants. All these in vitro data suggest redox regulation of phosphorylation process in guard cell signal transduction, which set up a novel link between these two regulatory mechanisms. Detailed functional characterization is under way, including the expression profiling, BnSnRK2 activity in

189

vivo, as well as the upstream activating kinase and downstream phosphorylation targets.

Up to date, most of the knowledge about the hormone signal transduction and interaction is obtained from the model plant Arabidopsis thaliana, of which the economic value is very limited. In addition, knowledge from the model plant may not be directly transferable to crop plants. Brassica napus is one of the most important oilseed crops around the world. Using the highly purified guard cells from B. napus, direct evidence is collected to improve the understanding of the stomatal function in this economic crop.

Once the regulatory mechanisms are elucidated, the knowledge can be applied to potentail rational engineering for better yield and enhanced stress tolerance.

190

LIST OF REFERENCES

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15, 63-78.

Acevedo-Hernández, G.J., León, P., and Herrera-Estrella, L.R. (2005). Sugar and ABA responsiveness of a minimal RBCS light-responsive unit is mediated by direct binding of ABI4. Plant J. 43, 506-519.

Acharya, B.R., and Assmann, S.M. (2009). Hormone interactions in stomatal function. Plant Mol. Biol. 69, 451-462.

Adachi, T., Pimentel, D.R., Heibeck, T., Hou, X., Lee, Y.J., Jiang, B., Ido, Y., and Cohen, R.A. (2004). S-glutathiolation of Ras mediates redox-sensitive signaling by angiotensin II in vascular smooth muscle cells. J. Biol. Chem. 279, 29857- 29862.

Aliverti, A., Piubelli, L., Zanetti, G., Lübberstedt, T., Herrmann, R.G., and Curti, B. (1993). The role of cysteine residues of spinach ferredoxin-NADP+ reductase As assessed by site-directed mutagenesis. Biochemistry 32, 6374-6380.

Allan, A.C., and Fluhr, R. (1997). Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells. Plant Cell 9, 1559-1572.

Allen, G.J., Chu, S.P., Schumacher, K., Shimazaki, C.T., Vafeados, D., Kemper, A., Hawke, S.D., Tallman, G., Tsien, R.Y., Harper, J.F., Chory, J., and Schroeder, J.I. (2000). Alteration of stimulus-specific guard cell calcium oscillations and stomatal closing in Arabidopsis det3 mutant. Science 289, 2338-2342.

Allen, G., and Sanders, D. (1995). Calcineurin, a type 2B protein phosphatase, modulates the Ca2+-permeable slow vacuolar ion channel of stomatal guard cells. Plant Cell 7, 1473-1483.

Alscher, R.G., Erturk, N., and Heath, L.S. (2002). Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 53, 1331-1341.

Alvarez, S., Zhu, M., and Chen, S. (2009). Proteomics of Arabidopsis redox proteins in response to methyl jasmonate. J. Proteomics 73, 30-40.

Amme, S., Rutten, T., Melzer, M., Sonsmann, G., Vissers, J.P., Schlesier, B., and Mock, H.P. (2005). A proteome approach defines protective functions of tobacco leaf trichomes. Proteomics 5, 2508-2518.

Aram, L., Geula, S., Arbel, N., and Shoshan-Barmatz, V. (2010). VDAC1 cysteine residues: topology and function in channel activity and apoptosis. Biochem. J. 427, 445-454.

191

Armstrong, F., Leung, J., Grabov, A., Brearley, J., Giraudat, J., and Blatt, M. (1995). Sensitivity to abscisic acid of guard cell K+ channels is suppressed by ABI1-1, a mutant Arabidopsis gene encoding a putative protein phosphatase. Proc. Natl. Acad. Sci. USA 92, 9520-9524.

Assmann, S.M. (1993). Signal transduction in guard cells. Annu. Rev. Cell. Biol. 9, 345- 375.

Assmann, S.M. (2003). OPEN STOMATA1 opens the door to ABA signaling in Arabidopsis guard cells. Trends Plant Sci. 8, 151-153.

Attieh, J., Kleppinger-Sparace, K., Nunes, C., Sparace, S., and Saini, H. (2000). Evidence implicating a novel thiol methyltransferase in the detoxification of glucosinolate hydrolysis products in Brassica oleracea L. Plant Cell Environ. 23, 165-174.

Bandurska, H., Stroinski, A., and Kubis, J. (2003). The effect of jasmonic acid on the accumulation of ABA, proline and spermidine and its influence on membrane injury under water deficit in two barley genotypes. Acta Physiologiae Plantarum 25, 279- 285.

Barford, D. (1996). Molecular mechanisms of the protein serine/threonine phosphatases. Trends Biochem. Sci. 21, 407-412.

Barth, C., and Jander, G. (2006). Arabidopsis myrosinases TGG1 and TGG2 have redundant function in glucosinolate breakdown and insect defense. Plant J. 46, 549-562.

Bäumer, N., Mäurer, A., Krieglstein, J., and Klumpp, S. (2007). Expression of protein histidine phosphatase in Escherichia coli, purification, and determination of enzyme activity. Methods Mol. Biol. 365, 247-260.

Beligni, M.V., and Lamattina, L. (2001). Nitric oxide: a non-traditional regulator of plant growth. Trends Plant Sci. 6, 508-509.

Belin, C., de Franco, P.O., Bourbousse, C., Chaignepain, S., Schmitter, J.M., Vavasseur, A., Giraudat, J., Barbier-Brygoo, H., and Thomine, S. (2006). Identification of features regulating OST1 kinase activity and OST1 function in guard cells. Plant Physiol. 141, 1316-1327.

Benedict, C., Skinner, J.S., Meng, R., Chang, Y., Bhalerao, R., Huner, N.P., Finn, C.E., Chen, T.H., and Hurry, V. (2006). The CBF1-dependent low temperature signalling pathway, regulon and increase in freeze tolerance are conserved in Populus spp. Plant Cell Environ. 29, 1259-1272.

192

Bevan, M., Bancroft, I., Bent, E., Love, K., Goodman, H., Dean, C., Bergkamp, R., Dirkse, W., Van Staveren, M., Stiekema, W., Drost, L., Ridley, P., Hudson, S., Patel, K., Murphy, G., Piffanelli, P., Wedler, H., Wedler, E., Wambutt, R., Weitzenegger, T., Pohl, T., Terryn, N., Gielen, J., Villarroel, R., De Clerck, R., Van Montagu, M., Lecharny, A., Auborg, S., Gy, I., Kreis, M., Lao, N., Kavanagh, T., Hempel, S., Kotter, P., Entian, K., Rieger, M., Schaeffer, M., Funk, B., Mueller-Auer, S., Silvey, M., James, R., Montfort, A., Pons, A., Puigdomenech, P., Douka, A., Voukelatou, E., Milioni, D., Hatzopoulos, P., Piravandi, E., Obermaier, B., Hilbert, H., Dusterhoft, A., Moores, T., Jones, J., Eneva, T., Palme, K., Benes, V., Rechman, S., Ansorge, W., Cooke, R., Berger, C., Delseny, M., Voet, M., Volckaert, G., Mewes, H., Klosterman, S., Schueller, C., Chalwatzis, N., and Project, E.A.G. (1998). Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of Arabidopsis thaliana. Nature 391, 485-488.

Bianchi, M.W., Roux, C., and Vartanian, N. (2002). Drought regulation of GST8, encoding the Arabidopsis homologue of ParC/Nt107 glutathione transferase/peroxidase. Physiol. Plant 116, 96-105.

Blakeslee, J.J., Zhou, H.W., Heath, J.T., Skottke, K.R., Barrios, J.A., Liu, S.Y., and DeLong, A. (2008). Specificity of RCN1-mediated protein phosphatase 2A regulation in meristem organization and stress response in roots. Plant Physiol. 146, 539-553.

Boonsirichai, K., Sedbrook, J., Chen, R., Gilroy, S., and Masson, P. (2003). ALTERED RESPONSE TO GRAVITY is a peripheral membrane protein that modulates gravity-induced cytoplasmic alkalinization and lateral auxin transport in plant statocytes. Plant Cell 15, 2612-2625.

Bouche, N., Fait, A., Bouchez, D., Moller, S., and Fromm, H. (2003). Mitochondrial succinic-semialdehyde dehydrogenase of the gamma-aminobutyrate shunt is required to restrict levels of reactive oxygen intermediates in plants. Proc. Natl. Acad. Sci. USA 100, 6843-6848.

Boudsocq, M., Barbier-Brygoo, H., and Laurière, C. (2004). Identification of nine sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. J. Biol. Chem. 279, 41758-41766.

Bowler, C., Vanmontagu, M., and Inze, D. (1992). Superoxide dismutase and stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43, 83-116.

Bright, J., Desikan, R., Hancock, J.T., Weir, I.S., and Neill, S.J. (2006). ABA-induced NO generation and stomatal closure in Arabidopsis are dependent on H2O2 synthesis. Plant J. 45, 113-122.

Broin, M., Cuiné, S., Eymery, F., and Rey, P. (2002). The plastidic 2-cysteine peroxiredoxin is a target for a thioredoxin involved in the protection of the photosynthetic apparatus against oxidative damage. Plant Cell 14, 1417-1432.

193

Brown, R.L., Kazan, K., McGrath, K.C., Maclean, D.J., and Manners, J.M. (2003). A role for the GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. Plant Physiol. 132, 1020-1032.

Buchanan, B.B., and Balmer, Y. (2005). Redox regulation: a broadening horizon. Annu. Rev. Plant Biol. 56, 187-220.

Burnett, G., and KennedyY, E. (1954). The enzymatic phosphorylation of proteins. J. Biol. Chem. 211, 969-980.

Busk, P., and Pages, M. (1998). Regulation of abscisic acid-induced transcription. Plant Mol. Biol. 37, 425-435.

Cabrillac, D., Cock, J.M., Dumas, C., and Gaude, T. (2001). The S-locus receptor kinase is inhibited by thioredoxins and activated by pollen coat proteins. Nature 410, 220-223.

Camps, M., Nichols, A., and Arkinstall, S. (2000). Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J. 14, 6-16.

Capiati, D.A., País, S.M., and Téllez-Iñón, M.T. (2006). Wounding increases salt tolerance in tomato plants: evidence on the participation of calmodulin-like activities in cross-tolerance signalling. J. Exp. Bot. 57, 2391-2400.

Carr, P.D., Verger, D., Ashton, A.R., and Ollis, D.L. (1999). Chloroplast NADP-malate dehydrogenase: structural basis of light-dependent regulation of activity by thiol oxidation and reduction. Structure 7, 461-475.

Carter, C., Pan, S., Zouhar, J., Avila, E.L., Girke, T., and Raikhel, N.V. (2004). The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. Plant Cell 16, 3285-3303.

Chatfield, M., and Dalton, D. (1993). Ascorbate peroxidase from soybean root nodules. Plant Physiol. 103, 661-662.

Chen, F., Hayes, P., Mulrooney, D., and Pan, A. (1994). Identification and characterization of cDNA clones encoding plant calreticulin in barley. Plant Cell 6, 835-843.

Chen, S., and Harmon, A.C. (2006). Advances in plant proteomics. Proteomics 6, 5504-5516.

Chen, S., and Schopfer, P. (1999). Hydroxyl-radical production in physiological reactions - A novel function of peroxidase. Eur. J. Biochem. 260, 726-735.

Chen, X., Wang, Y., Li, J., Jiang, A., Cheng, Y., and Zhang, W. (2009). Mitochondrial proteome during salt stress-induced programmed cell death in rice. Plant Physiol. Biochem. 47, 407-415.

194

Chen, Y., Pang, Q., Dai, S., Wang, Y., Chen, S., and Yan, X. (2011). Proteomic identification of differentially expressed proteins in Arabidopsis in response to methyl jasmonate. J. Plant Physiol. 168, 995-1008.

Chen, Z., and Gallie, D.R. (2004). The ascorbic acid redox state controls guard cell signaling and stomatal movement. Plant Cell 16, 1143-1162.

Chen, Z., Walker, R., Acheson, R., Tecsi, L., Wingler, A., Lea, P., and Leegood, R. (2000). Are isocitrate lyase and phosphoenolpyruvate carboxykinase involved in gluconeogenesis during senescence of barley leaves and cucumber cotyledons? Plant Cell Physiol. 41, 960-967.

Cheong, Y.H., Kim, K-N., Pandey, G.K., Gupta, R., Grant, J.J., and Luan, S. (2003). CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis. Plant Cell 15, 1833-1845.

Cheong, Y.H., Pandey, G.K., Grant, J.J., Batistic, O., Li, L., Kim, B-G., Lee, S-C., Kudla, J., and Luan, S. (2007). Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant J. 52, 223-239.

Chérel, I., Michard, E., Platet, N., Mouline, K., Alcon, C., Sentenac, H., and Thibaud, J.B. (2002). Physical and functional interaction of the Arabidopsis K+ channel AKT2 and phosphatase AtPP2CA. Plant Cell 14, 1133-1146.

Chiadmi, M., Navaza, A., Miginiac-Maslow, M., Jacquot, J.P., and Cherfils, J. (1999). Redox signalling in the chloroplast: structure of oxidized pea fructose-1,6- bisphosphate phosphatase. EMBO J. 18, 6809-6815.

Chiribog.J. (1966). Purification and properies of oxalic acid oxidase. Arch. Biochem. Biophys. 116, 516-523.

Cho, E., and Hong, C. (2006). Over-expression of tobacco NtHSP70-1 contributes to drought-stress tolerance in plants. Plant Cell Rep. 25, 349-358.

Choi, H., Hong, J., Ha, J., Kang, J., and Kim, S. (2000). ABFs, a family of ABA- responsive element binding factors. J. Biol. Chem. 275, 1723-1730.

Choi, H-I., Park, H-J., Park, J.H., Kim, S., Im, M-Y., Seo, H-H., Kim, Y-W., Hwang, I., and Kim, S.Y. (2005). Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity. Plant Physiol. 139: 1750-1761.

Cohen, P., Cottrell, G., and Hillvenning, C. (1989). The protein phosphatase inhibitor okadaic acid potentiates the 5-HT induced suppression of a K current in the C1- neuron of Helix aspersa. J. Physiol. Lond. 415, P33-P33.

195

Colcombet, J., Lelièvre, F., Thomine, S., Barbier-Brygoo, H., and Frachisse, J.M. (2005). Distinct pH regulation of slow and rapid anion channels at the plasma membrane of Arabidopsis thaliana hypocotyl cells. J. Exp. Bot. 56, 1897-1903.

Cramer, M.D., Nagel, O.W., Lips, S.H., and Lambers, H. (1995). Reduction, assimilation and transport of N in normal and gibberellin deficient tomato plants. Physiol. Plant 95, 347–354.

Creelman, R.A., and Mullet, J.E. (1997). Biosynthesis and action of jasmonates in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 355-381.

Cuddihy, S.L., Winterbourn, C.C., and Hampton, M.B. (2011). Assessment of redox changes to hydrogen peroxide-sensitive proteins during EGF signaling. Antioxid. Redox Signal. 15, 167-174.

Dai, S., Wang, T., Yan, X., and Chen, S. (2007). Proteomics of pollen development and germination. J. Proteome Res. 6, 4556-4563.

Dat, J.F., Capelli, N., Folzer, H., Bourgeade, P., and Badot, P.M. (2004). Sensing and signalling during plant flooding. Plant Physiol. Biochem. 42, 273-282.

Delk, N.A., Johnson, K.A., Chowdhury, N.I., and Braam, J. (2005). CML24, regulated in expression by diverse stimuli, encodes a potential Ca2+ sensor that functions in responses to abscisic acid, daylength, and ion stress. Plant Physiol. 139, 240-253.

Depuydt, M., Messens, J., and Collet, J.F. (2011). How proteins form disulfide bonds. Antioxid. Redox Signal. 15, 49-66.

Desikan, R., Cheung, M.K., Bright, J., Henson, D., Hancock, J.T., and Neill, S.J. (2004). ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells. J. Exp. Bot. 55, 205-212.

Desikan, R., Griffiths, R., Hancock, J., and Neill, S. (2002). A new role for an old enzyme: nitrate reductase-mediated nitric oxide generation is required for abscisic acid-induced stomatal closure in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 99, 16314-16318.

Desikan, R., Hancock, J.T., Bright, J., Harrison, J., Weir, I., Hooley, R., and Neill, S.J. (2005). A role for ETR1 in hydrogen peroxide signaling in stomatal guard cells. Plant Physiol. 137, 831-834.

Desikan, R., Hancock, J.T., Ichimura, K., Shinozaki, K., and Neill, S.J. (2001). Harpin induces activation of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6. Plant Physiol. 126, 1579-1587.

196

Desikan, R., Horák, J., Chaban, C., Mira-Rodado, V., Witthöft, J., Elgass, K., Grefen, C., Cheung, M.K., Meixner, A.J., Hooley, R., Neill, S.J., Hancock, J.T., and Harter, K. (2008). The histidine kinase AHK5 integrates endogenous and environmental signals in Arabidopsis guard cells. PLoS One 3, e2491.

Di Simplicio, P., Franconi, F., Frosalí, S., and Di Giuseppe, D. (2003). Thiolation and nitrosation of cysteines in biological fluids and cells. Amino Acids 25, 323-339.

Dombrecht, B., Xue, G.P., Sprague, S.J., Kirkegaard, J.A., Ross, J.J., Reid, J.B., Fitt, G.P., Sewelam, N., Schenk, P.M., Manners, J.M., and Kazan, K. (2007). MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. Plant Cell 19, 2225–2245.

Drummelsmith, J., Winstall, E., Bergeron, M.G., Poirier, G.G., and Ouellette, M. (2007). Comparative proteomics analyses reveal a potential biomarker for the detection of vancomycin-intermediate Staphylococcus aureus strains. J. Proteome Res. 6, 4690-4702.

Duhé, R.J., Evans, G.A., Erwin, R.A., Kirken, R.A., Cox, G.W., and Farrar, W.L. (1998). Nitric oxide and thiol redox regulation of Janus kinase activity. Proc. Natl. Acad. Sci. USA 95, 126-131.

Dunkley, T., Hester, S., Shadforth, I., Runions, J., Weimar, T., Hanton, S., Griffin, J., Bessant, C., Brandizzi, F., Hawes, C., Watson, R., Dupree, P., and Lilley, K. (2006). Mapping the Arabidopsis organelle proteome. Proc. Natl. Acad. Sci. USA 103, 6518-6523.

Duthie, K.A., Osborne, L.C., Foster, L.J., and Abraham, N. (2007). Proteomics analysis of interleukin (IL)-7-induced signaling effectors shows selective changes in IL-7Ralpha449F knock-in T cell progenitors. Mol. Cell. Proteomics 6, 1700- 1710.

Ericson, M., and Brunn, S. (1985). Cysteine residues at the active site of glutamine synthetase from spinach leaves. Biochem. Biophys. Res. Commun. 133, 527-531.

Erin, B., and Mullet, J.E. (1991). Lipoxygenase gene expression is modulated in plants by water deficit, wounding, and methyl jasmonate. Mol. Gen. Genet. 230, 456-462.

Evans, N.H. (2003). Modulation of guard cell plasma membrane potassium currents by methyl jasmonate. Plant Physiol. 131, 8-11.

Everdeen, D., Kiefer, S., Willard, J., Muldoon, E., Dey, P., Li, X., and Lamport, D. (1988). Enzymic cross-linkage of monomeric extensin precursors in vitro. Plant Physiol. 87, 616-621.

Fairley-Grenot, K., and Assmann, S.M. (1991). Evidence for G-protein regulation of inward K+ channel current in guard cells of fava bean. Plant Cell 3, 1037-1044.

197

Farkas, I., Dombrádi, V., Miskei, M., Szabados, L., and Koncz, C. (2007). Arabidopsis PPP family of serine/threonine phosphatases. Trends Plant Sci. 12, 169-176.

Fedoroff, N.V. (2002). Cross-talk in abscisic acid signaling. Sci. STKE 140, re10.

Fermani, S., Sparla, F., Falini, G., Martelli, P.L., Casadio, R., Pupillo, P., Ripamonti, A., and Trost, P. (2007). Molecular mechanism of thioredoxin regulation in photosynthetic A2B2-glyceraldehyde-3-phosphate dehydrogenase. Proc. Natl. Acad. Sci. USA 104, 11109-11114.

Ferrè, F., and Clote, P. (2005). DiANNA: a web server for disulfide connectivity prediction. Nucleic Acids Res. 33, W230-232.

Finka, A., Mattoo, R.U., and Goloubinoff, P. (2011). Meta-analysis of heat- and chemically upregulated chaperone genes in plant and human cells. Cell Stress Chaperones 16, 15-31.

Finkel, T. (2003). Oxidant signals and oxidative stress. Curr. Opin. Cell Biol. 15, 247- 254.

Finkelstein, R.R., and Gibson, S.I. (2002). ABA and sugar interactions regulating development: cross-talk or voices in a crowd? Curr. Opin. Plant Biol. 5, 26-32.

Finn, R., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R., Eddy, S., Sonnhammer, E., and Bateman, A. (2006). Pfam: clans, web tools and services. Nucleic Acids Res. 34, D247-D251.

Foissner, I., Wendehenne, D., Langebartels, C., and Durner, J. (2000). In vivo imaging of an elicitor-induced nitric oxide burst in tobacco. Plant J. 23, 817-824.

Foyer, C.H., and Noctor, G. (2009). Redox regulation in photosynthetic organisms: signaling, acclimation, and practical implications. Antioxid. Redox Signal. 11, 861- 905.

Freedman, R., Hirst, T., and Tuite, M. (1994). Protein disulphide isomerase: building bridges in protein folding. Trends Biochem. Sci. 19, 331-336.

Fu, C., Hu, J., Liu, T., Ago, T., Sadoshima, J., and Li, H. (2008). Quantitative analysis of redox-sensitive proteome with DIGE and ICAT. J. Proteome Res. 7, 3789-3802.

Fujii, H., Verslues, P.E., and Zhu, J.K. (2007). Identification of two protein kinases required for abscisic acid regulation of seed germination, root growth, and gene expression in Arabidopsis. Plant Cell 19, 485-494.

Fujino, G., Noguchi, T., Takeda, K., and Ichijo, H. (2006). Thioredoxin and protein kinases in redox signaling. Semin. Cancer Biol. 16, 427-435.

198

Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi- Shinozaki, K., and Shinozaki, K. (2006). Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9, 436-442.

Gan, C.S., Chong, P.K., Pham, T.K., and Wright, P.C. (2007). Technical, experimental, and biological variations in isobaric tags for relative and absolute quantitation (iTRAQ). J. Proteome Res. 6, 821-827.

Garcia-Mata, C., Gay, R., Sokolovski, S., Hills, A., Lamattina, L., and Blatt, M.R. (2003). Nitric oxide regulates K+ and Cl- channels in guard cells through a subset of abscisic acid-evoked signaling pathways. Proc. Natl. Acad. Sci. USA 100, 11116-11121.

Gehring, C., Irving, H., McConchie, R., and Parish, R. (1997). Jasmonates induce intracellular alkalinization and closure of Paphiopedilum guard cells. Annals of Botany 80, 485-489.

Geiger, D., Maierhofer, T., Al-Rasheid, K.A., Scherzer, S., Mumm, P., Liese, A., Ache, P., Wellmann, C., Marten, I., Grill, E., Romeis, T., and Hedrich, R. (2011). Stomatal closure by fast abscisic acid signaling is mediated by the guard cell anion channel SLAH3 and the receptor RCAR1. Sci. Signal. 4, ra32.

Geiger, D., Scherzer, S., Mumm, P., Stange, A., Marten, I., Bauer, H., Ache, P., Matschi, S., Liese, A., Al-Rasheid, K.A., Romeis, T., and Hedrich, R. (2009). Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair. Proc. Natl. Acad. Sci. USA 106, 21425-21430.

Giraud, E., Van Aken, O., Uggalla, V., and Whelan, J. (2011). REDOX regulation of mitochondrial function in plants. Plant Cell Environ. doi: 10.1111/j.1365- 3040.2011.02293.x

Giustarini, D., Milzani, A., Aldini, G., Carini, M., Rossi, R., and Dalle-Donne, I. (2005). S-nitrosation versus S-glutathionylation of protein sulfhydryl groups by S- nitrosoglutathione. Antioxid. Redox Signal. 7, 930-939.

Gorecka, K.M., Thouverey, C., Buchet, R., and Pikula, S. (2007). Potential role of annexin AnnAt1 from Arabidopsis thaliana in pH-mediated cellular response to environmental stimuli. Plant Cell Physiol. 48, 792-803.

Gosti, F., Beaudoin, N., Serizet, C., Webb, A., Vartanian, N., and Giraudat, J. (1999). ABI1 protein phosphatase 2C is a negative regulator of abscisic acid signaling. Plant Cell 11, 1897-1909.

Greco, T.M., Hodara, R., Parastatidis, I., Heijnen, H.F., Dennehy, M.K., Liebler, D.C., and Ischiropoulos, H. (2006). Identification of S-nitrosylation motifs by site- specific mapping of the S-nitrosocysteine proteome in human vascular smooth muscle cells. Proc. Natl. Acad. Sci. USA 103, 7420-7425.

199

Green, J., Fricke, B., Chetty, M., von During, M., Preston, G., and Stewart, G. (2004). Eukaryotic and prokaryotic stomatins: the proteolytic link. Blood Cells Mol. Dis. 32, 411-422.

Greetham, D., Vickerstaff, J., Shenton, D., Perrone, G.G., Dawes, I.W., and Grant, C.M. (2010). Thioredoxins function as deglutathionylase enzymes in the yeast Saccharomyces cerevisiae.BMC Biochem. 11, 3.

Groten, K., Dutilleul, C., van Heerden, P.D., Vanacker, H., Bernard, S., Finkemeier, I., Dietz, K.J., and Foyer, C.H. (2006). Redox regulation of peroxiredoxin and proteinases by ascorbate and thiols during pea root nodule senescence. FEBS Lett. 580, 1269-1276.

Guan, L., Zhao, J., and Scandalios, J. (2000). Cis-elements and trans-factors that regulate expression of the maize Cat1 antioxidant gene in response to ABA and osmotic stress: H2O2 is the likely intermediary signaling molecule for the response. Plant J. 22, 87-95.

Gudesblat, G.E., Iusem, N.D., and Morris, P.C. (2007). Guard cell-specific inhibition of Arabidopsis MPK3 expression causes abnormal stomatal responses to abscisic acid and hydrogen peroxide. New Phytol. 173, 713-721.

Guo, Y., Singleton, P.A., Rowshan, A., Gucek, M., Cole, R.N., Graham, D.R., Van Eyk, J.E., and Garcia, J.G. (2007). Quantitative proteomics analysis of human endothelial cell membrane rafts: evidence of MARCKS and MRP regulation in the sphingosine 1-phosphate-induced barrier enhancement. Mol. Cell. Proteomics 6, 689-696.

Gupta, R., and Luan, S. (2003). Redox control of protein tyrosine phosphatases and mitogen-activated protein kinases in plants. Plant Physiol. 132, 1149-1152.

Gygi, S., Rochon, Y., Franza, B., and Aebersold, R. (1999). Correlation between protein and mRNA abundance in yeast. Mol. Cell. Biol. 19, 1720-1730.

Halford, N.G., and Hey, S.J. (2009). Snf1-related protein kinases (SnRKs) act within an intricate network that links metabolic and stress signalling in plants. Biochem. J. 419, 247-259.

Hamel, L.P., Nicole, M.C., Sritubtim, S., Morency, M.J., Ellis, M., Ehlting, J., Beaudoin, N., Barbazuk, B., Klessig, D., Lee, J., Martin, G., Mundy, J., Ohashi, Y., Scheel, D., Sheen, J., Xing, T., Zhang, S., Seguin, A., and Ellis, B.E. (2006). Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci. 11, 192-198.

Hanks, S., Quinn, A., and Hunter, T. (1988). The protein kinase family: conserved features and deduced phylogeny of the catalytic domains.Science 241, 42-52.

200

Hanks, S.K., and Hunter, T. (1995). Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9, 576-596.

Hara, S., Motohashi, K., Arisaka, F., Romano, P.G., Hosoya-Matsuda, N., Kikuchi, N., Fusada, N., and Hisabori, T. (2006). Thioredoxin-h1 reduces and reactivates the oxidized cytosolic malate dehydrogenase dimer in higher plants. J. Biol. Chem. 281, 32065-32071.

Harmon, A.C. (2003). Calcium-regulated protein kinases of plants. Gravit. Space Biol. Bull. 16, 83-90.

Harter, C., Pavel, J., Coccia, F., Draken, E., Wegehingel, S., Tschochner, H., and Wieland, F. (1996). Nonclathrin coat protein gamma, a subunit of coatomer, binds to the cytoplasmic dilysine motif of membrane proteins of the early secretory pathway. Proc. Natl. Acad. Sci. USA 93, 1902-1906.

Hattori, T., Totsuka, M., Hobo, T., Kagaya, Y., and Yamamoto-Toyoda, A. (2002). Experimentally determined sequence requirement of ACGT-containing abscisic acid response element. Plant Cell Physiol. 43, 136-140.

Haubrick, L.L., and Assmann, S.M. (2006). Brassinosteroids and plant function: some clues, more puzzles. Plant Cell Environ. 29, 446-457.

He, Y., Mawhinney, T.P., Preuss, M.L., Schroeder, A.C., Chen, B., Abraham, L., Jez, J.M., and Chen, S. (2009). A redox-active isopropylmalate dehydrogenase functions in the biosynthesis of glucosinolates and leucine in Arabidopsis. Plant J. 60, 679-690.

Heckwolf, M., Pater, D., Hanson, D.T., and Kaldenhoff, R. (2011). The Arabidopsis thaliana aquaporin AtPIP1;2 is a physiologically relevant CO2 transport facilitator. Plant J. 67, 795-804.

Heo, J., and Campbell, S.L. (2005). Mechanism of redox-mediated guanine nucleotide exchange on redox-active Rho GTPases. J. Biol. Chem. 280, 31003-31010.

Herde, O., PenaCortes, H., Willmitzer, L., and Fisahn, J. (1997). Stomatal responses to jasmonic acid, linolenic acid and abscisic acid in wild-type and ABA-deficient tomato plants. Plant Cell Environ. 20, 136-141.

Hetherington, A.M., and Woodward, F.I. (2003). The role of stomata in sensing and driving environmental change. Nature 424, 901-908.

Hey, S., Bacon, A., Burnett, E., and Neill, S. (1997). Abscisic acid signal transduction in epidermal cells of Pisum sativum L. Argenteum: Both dehydrin mRNA accumulation and stomatal responses require protein phosphorylation and dephosphorylation. Planta 202, 85-92.

201

Hornberg, C., and Weiler, E. (1984). High-affinity binding sites for abscisic acid on the plasmalemma of Vicia faba guard cells. Nature 310, 321-324.

Huang, D., Wu, W., Abrams, S., and Cutler, A. (2008). The relationship of drought- related gene expression in Arabidopsis thaliana to hormonal and environmental factors. J. Exp. Bot. 59, 2991-3007.

Hubbard, K.E., Nishimura, N., Hitomi, K., Getzoff, E.D., and Schroeder, J.I. (2010). Early abscisic acid signal transduction mechanisms: newly discovered components and newly emerging questions. Genes Dev. 24, 1695-1708.

Husebye, H., Chadchawan, S., Winge, P., Thangstad, O.P., and Bones, A.M. (2002). Guard cell- and phloem idioblast-specific expression of thioglucoside glucohydrolase 1 (myrosinase) in Arabidopsis. Plant Physiol. 128, 1180-1188.

Hwang, J.U., and Lee, Y. (2001). Abscisic acid-induced actin reorganization in guard cells of dayflower is mediated by cytosolic calcium levels and by protein kinase and protein phosphatase activities. Plant Physiol. 125, 2120-2128.

Ilan, N., Schwartz, A., and Moran, N. (1994). External pH effects on the depolarization-activated K channels in guard cell protoplasts of Vicia faba. Gen. Physiol. 103, 807-831.

Imai, A., Matsuyama, T., Hanzawa, Y., Akiyama, T., Tamaoki, M., Saji, H., Shirano, Y., Kato, T., Hayashi, H., Shibata, D., Tabata, S., Komeda, Y., and Takahashi, T. (2004). Spermidine synthase genes are essential for survival of Arabidopsis. Plant Physiol. 135, 1565-1573.

Irving, A.J., Collingridge, G.L., and Schofield, J.G. (1992). L-glutamate and acetylcholine mobilise Ca2+ from the same intracellular pool in cerebellar granule cells using transduction mechanisms with different Ca2+ sensitivities. Cell Calcium 13, 293-301.

Islam, M.M., Tani, C., Watanabe-Sugimoto, M., Uraji, M., Jahan, M.S., Masuda, C., Nakamura, Y., Mori, I.C., and Murata, Y. (2009). Myrosinases, TGG1 and TGG2, redundantly function in ABA and MeJA signaling in Arabidopsis guard cells. Plant Cell Physiol. 50, 1171-1175.

Israelsson, M., Siegel, R., Young, J., Hashimoto, M., Iba, K., and Schroeder, J. 2+ (2006). Guard cell ABA and CO2 signaling network updates and Ca sensor priming hypothesis. Curr. Opin. Plant Biol. 9, 654-663.

Iyer, L.M., Koonin, E.V., and Aravind, L. (2001). Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily. Proteins 43, 134- 144.

Jackson, M.B. (2002). Long-distance signalling from roots to shoots assessed: the flooding story. J. Exp. Bot. 53, 175-181.

202

Jacquot, J.P., Rouhier, N., and Gelhaye, E. (2002). Redox control by dithiol-disulfide exchange in plants: I. The chloroplastic systems. Ann. N. Y. Acad. Sci. 973, 508- 519.

Jammes, F., Song, C., Shin, D., Munemasa, S., Takeda, K., Gu, D., Cho, D., Lee, S., Giordo, R., Sritubtim, S., Leonhardt, N., Ellis, B.E., Murata, Y., and Kwak, J.M. (2009). MAP kinases MPK9 and MPK12 are preferentially expressed in guard cells and positively regulate ROS-mediated ABA signaling. Proc. Natl. Acad. Sci. USA 106, 20520-20525.

Joo, J.H., Wang, S., Chen, J.G., Jones, A.M., and Fedoroff, N.V. (2005). Different signaling and cell death roles of heterotrimeric G protein alpha and beta subunits in the Arabidopsis oxidative stress response to ozone. Plant Cell 17, 957-970.

Kang, J., Choi, H., Im, M., and Kim, S. (2002). Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 14, 343- 357.

Kasukabe, Y., He, L., Nada, K., Misawa, S., Ihara, I., and Tachibana, S. (2004). Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol. 45, 712- 722.

Katsir, L., Chung, H.S., Koo, A.J., and Howe, G.A. (2008). Jasmonate signaling: a conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 11, 428-435.

Kelner, A., Pekala, I., Kaczanowski, S., Muszynska, G., Hardie, D.G., and Dobrowolska, G. (2004). Biochemical characterization of the tobacco 42-kD protein kinase activated by osmotic stress. Plant Physiol. 136, 3255-3265.

Keppler, L., Baker, C., and Atkinson, M. (1989). Active oxygen production during a bacteria-induced hypersensitive reaction in tobacco suspension cells. Phytopathology 79, 974-978.

Kerk, D., Bulgrien, J., Smith, D.W., Barsam, B., Veretnik, S., and Gribskov, M. (2002). The complement of protein phosphatase catalytic subunits encoded in the genome of Arabidopsis. Plant Physiol. 129, 908-925.

Khokon, A.R., Jahan, S., Rahman, T., Hossain, M.A., Muroyama, D., Minami, I., Munemasa, S., Mori, I.C., Nakamura, Y., and Murata, Y. (2011a). Allyl isothiocyanate (AITC) induces stomatal closure in Arabidopsis. Plant Cell Environ. 34,1900-1906.

Khokon, A.R., Okuma, E., Hossain, M.A., Munemasa, S., Uraji, M., Nakamura, Y., Mori, I.C., and Murata, Y. (2011b). Involvement of extracellular oxidative burst in salicylic acid-induced stomatal closure in Arabidopsis. Plant Cell Environ. 34, 434- 443.

203

Kim, J.H., Cho, H., Ryu, S.E., and Choi, M.U. (2000). Effects of metal ions on the activity of protein tyrosine phosphatase VHR: highly potent and reversible oxidative inactivation by Cu2+ ion. Arch. Biochem. Biophys. 382, 72-80.

Kim, M., Hepler, P., Fun, S., Ha, K., and Lee, Y. (1995). Actin filaments in mature guard cells are radially distributed and involved in stomatal movement. Plant Physiol. 109, 1077-1084.

Kitajima, S., Shimaoka, T., Kurioka, M., and Yokota, A. (2007). Irreversible cross- linking of heme to the distal tryptophan of stromal ascorbate peroxidase in response to rapid inactivation by H2O2. FEBS J. 274, 3013-3020.

Kolla, V.A., Vavasseur, A., and Raghavendra, A.S. (2007). Hydrogen peroxide production is an early event during bicarbonate induced stomatal closure in abaxial epidermis of Arabidopsis. Planta 225, 1421-1429.

Konopka-Postupolska, D., Clark, G., Goch, G., Debski, J., Floras, K., Cantero, A., Fijolek, B., Roux, S., and Hennig, J. (2009). The role of annexin 1 in drought stress in Arabidopsis. Plant Physiol. 150, 1394-1410.

Koornneef, M., Hanhart, C., Hilhorst, H., and Karssen, C. (1989). In vivo inhibition of seed development and reserve protein accumulation in recombinants of abscisic acid biosynthesis and responsiveness mutants in Arabidopsis thaliana. Plant Physiol. 90, 463-469.

Koussevitzky, S., Suzuki, N., Huntington, S., Armijo, L., Sha, W., Cortes, D., Shulaev, V., and Mittler, R. (2008). Ascorbate peroxidase 1 plays a key role in the response of Arabidopsis thaliana to stress combination. J. Biol. Chem. 283, 34197-34203.

Kwak, J.M., Moon, J.H., Murata, Y., Kuchitsu, K., Leonhardt, N., DeLong, A., and Schroeder, J.I. (2002). Disruption of a guard cell-expressed protein phosphatase 2A regulatory subunit, RCN1, confers abscisic acid insensitivity in Arabidopsis. Plant Cell 14, 2849-2861.

Kwak, J.M., Mori, I.C., Pei, Z.M., Leonhardt, N., Torres, M.A., Dangl, J.L., Bloom, R.E., Bodde, S., Jones, J.D., and Schroeder, J.I. (2003). NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis. EMBO J. 22, 2623-2633.

Lackman, P., González-Guzmán, M., Tilleman, S., Carqueijeiro, I., Pérez, A.C., Moses, T., Seo, M., Kanno, Y., Häkkinen, S.T., Van Montagu, M.C., Thevelein, J.M., Maaheimo, H., Oksman-Caldentey, K.M., Rodriguez, P.L., Rischer, H., and Goossens, A. (2011). Jasmonate signaling involves the abscisic acid receptor PYL4 to regulate metabolic reprogramming in Arabidopsis and tobacco. Proc. Natl. Acad. Sci. USA 108, 5891-5896.

204

Lee, H., Guo, Y., Ohta, M., Xiong, L., Stevenson, B., and Zhu, J.K. (2002). LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi- functional enolase. EMBO J. 21, 2692-2702.

Lee, I., Ambaru, B., Thakkar, P., Marcotte, E.M., and Rhee, S.Y. (2010). Rational association of genes with traits using a genome-scale gene network for Arabidopsis thaliana. Nat. Biotechnol. 28, 149-156.

Lee, J-S. (1998). The mechanism of stomatal closing by salicylic acid in Commelina communis L. J. Plant Biol. 41, 97-102.

Lee, S., Choi, H., Suh, S., Doo, I.S., Oh, K.Y., Choi, E.J., Schroeder Taylor, A.T., Low, P.S., and Lee, Y. (1999). Oligogalacturonic acid and chitosan reduce stomatal aperture by inducing the evolution of reactive oxygen species from guard cells of tomato and Commelina communis. Plant Physiol. 121, 147-152.

Lee, S., Lee, E.J., Yang, E.J., Lee, J.E., Park, A.R., Song, W.H., and Park, O.K. (2004). Proteomic identification of annexins, calcium-dependent membrane binding proteins that mediate osmotic stress and abscisic acid signal transduction in Arabidopsis. Plant Cell 16, 1378-1391.

Lee, S.C., Lan, W., Buchanan, B.B., and Luan, S. (2009). A protein kinase- phosphatase pair interacts with an ion channel to regulate ABA signaling in plant guard cells. Proc. Natl. Acad. Sci. USA 106, 21419-21424.

Lee, Y., and Assmann, S. (1991). Diacylglycerols induce both ion pumping in patch- clamped guard-cell protoplasts and opening of intact stomata. Natl. Acad. Sci. USA 88, 2127-2131.

Leitner-Dagan, Y., Ovadis, M., Shklarman, E., Elad, Y., David, D., and Vainstein, A. (2006). Expression and functional analyses of the plastid lipid-associated protein CHRC suggest its role in chromoplastogenesis and stress. Plant Physiol. 142, 233-244.

Lemaire, S.D., Guillon, B., Le Maréchal, P., Keryer, E., Miginiac-Maslow, M., and Decottignies, P. (2004). New thioredoxin targets in the unicellular photosynthetic eukaryote Chlamydomonas reinhardtii. Natl. Acad. Sci. USA 101, 7475-7480.

Lemichez, E., Wu, Y., Sanchez, J.P., Mettouchi, A., Mathur, J., and Chua, N.H. (2001). Inactivation of AtRac1 by abscisic acid is essential for stomatal closure. Genes Dev. 15, 1808-1816.

Leonhardt, N., Kwak, J.M., Robert, N., Waner, D., Leonhardt, G., Schroeder, J.I. (2004). Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. Plant Cell 16, 596-615.

205

Leung, J., and Giraudat, J. (1998). ABSCISIC ACID SIGNAL TRANSDUCTION. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 199-222.

Leung, J., Bouvierdurand, M., Morris, P., Guerrier, D., Chefdor, F., and Giraudat, J. (1994). Arabidopsis ABA response gene ABI1: features of a calcium-modulated protein phosphatase. Science 264, 1448-1452.

Leung, J., Merlot, S., and Giraudat, J. (1997). The Arabidopsis ABSCISIC ACID- INSENSITIVE2 (ABI2) and ABI1 genes encode homologous protein phosphatases 2C involved in abscisic acid signal transduction. Plant Cell 9, 759-771.

Li, J., and Assmann, S.M. (1996). An abscisic acid-activated and calcium-independent protein kinase from guard cells of fava bean. Plant Cell 8, 2359-2368.

Li, J., Steen, H., and Gygi, S. (2003). Protein profiling with cleavable isotope-coded affinity tag (cICAT) reagents - The yeast salinity stress response. Mol. Cell. Proteomics 2, 1198-1204.

Li, J., Wang, X.Q., Watson, M.B., and Assmann, S.M. (2000). Regulation of abscisic acid-induced stomatal closure and anion channels by guard cell AAPK kinase. Science 287, 300-303.

Li, S., Assmann, S.M., and Albert, R. (2006). Predicting essential components of signal transduction networks: a dynamic model of guard cell abscisic acid signaling. PLoS Biol. 4, e312.

Li, W., Luan, S., Schreiber, S., and Assmann, S. (1994). Evidence for protein phosphatase 1 and 2A regulation of K+ channels in two types of leaf cells. Plant Physiol. 106, 963-970.

Liechti, R., and Farmer, E.E. (2002). The jasmonate pathway. Science 296, 1649- 1650.

Lin, F., Ding, H., Wang, J., Zhang, H., Zhang, A., Zhang, Y., Tan, M., Dong, W., and Jiang, M. (2009). Positive feedback regulation of maize NADPH oxidase by mitogen-activated protein kinase cascade in abscisic acid signalling. J. Exp. Bot. 60, 3221-3238.

Lindermayr, C., Sell, S., Müller, B., Leister, D., and Durner, J. (2010). Redox regulation of the NPR1-TGA1 system of Arabidopsis thaliana by nitric oxide. Plant Cell 22, 2894-2907.

Littler, D.R., Walker, J.R., Davis, T., Wybenga-Groot, L.E., Finerty, P.J., Newman, E., Mackenzie, F., and Dhe-Paganon, S. (2010). A conserved mechanism of autoinhibition for the AMPK kinase domain: ATP-binding site and catalytic loop refolding as a means of regulation. Acta. Crystallogr. Sect. F. Struct. Biol. Cryst. Commun. 66, 143-151.

206

Liu, X., Yue, Y., Li, B., Nie, Y., Li, W., Wu, W.H., and Ma, L. (2007). A G protein- coupled receptor is a plasma membrane receptor for the plant hormone abscisic acid. Science 315, 1712-1716.

Lohse, G., and Hedrich, R. (1992). Characterization of the plasma membrane H+- ATPase from Vicia faba guard cells modulation by extracellular factors and seasonal changes. Planta 188, 206-214.

Lorenzo, O., Chico, J.M., Sánchez-Serrano, J.J., and Solano, R. (2004). JASMONATE-INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16, 1938-1950.

Love, C.G., Robinson, A.J., Lim, G.A., Hopkins, C.J., Batley, J., Barker, G., Spangenberg, G.C., and Edwards, D. (2005). Brassica ASTRA: an integrated database for Brassica genomic research. Nucleic Acids Res. 33, D656-659.

Lu, M., Tang, X., and Zhou, J. (2001). Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria. Plant Cell 13, 437-447.

Luan, S. (2003). Protein phosphatases in plants. Annu. Rev. Plant Biol. 54, 63-92.

Luo, J., Shen, G., Yan, J., He, C., and Zhang, H. (2006). AtCHIP functions as an E3 ubiquitin ligase of protein phosphatase 2A subunits and alters plant response to abscisic acid treatment. Plant J. 46, 649-657.

Ma, S.Y., and Wu, W.H. (2007). AtCPK23 functions in Arabidopsis responses to drought and salt stresses. Plant Mol. Biol. 65, 511-518.

Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., and Grill, E. (2009). Regulators of PP2C phosphatase activity function as abscisic acid sensors. Science 324, 1064-1068.

MacRobbie, E.A. (1998). Signal transduction and ion channels in guard cells. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 353, 1475-1488.

MacRobbie, E.A. (2002). Evidence for a role for protein tyrosine phosphatase in the control of ion release from the guard cell vacuole in stomatal closure. Proc. Natl. Acad. Sci. USA 99, 11963-11968.

Magnan, F., Ranty, B., Charpenteau, M., Sotta, B., Galaud, J-P., and Aldon, D. (2008). Mutations in AtCML9, a calmodulin-like protein from Arabidopsis thaliana, alter plant responses to abiotic stress and abscisic acid. Plant J. 56, 575-589

Majeran, W., Cai, Y., Sun, Q., and van Wijk, K.J. (2005). Functional differentiation of bundle sheath and mesophyll maize chloroplasts determined by comparative proteomics. Plant Cell 17, 3111-3140.

207

Mann, M., and Jensen, O.N. (2003). Proteomic analysis of post-translational modifications. Nat. Biotechnol. 21, 255-261.

Manthe, B., Schulz, M., and Schnabl, H. (1992). Effects of salicylic acid on growth and stomatal movements of Vicia faba L.: evidence for salicylic acid metabolization. J. Chem. Ecol. 18, 1525-1539.

Marchand, C., Le Maréchal, P., Meyer, Y., Miginiac-Maslow, M., Issakidis- Bourguet, E., and Decottignies, P. (2004). New targets of Arabidopsis thioredoxins revealed by proteomic analysis. Proteomics 4, 2696-2706.

Marrs, K. (1996). The functions and regulation of glutathione S-transferases in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47, 127-158.

Matsunaga, S., Inashima, S., Yamada, T., Watanabe, H., Hazama, T., and Wada, M. (2003). Oxidation of sarcoplasmic reticulum Ca2+-ATPase induced by high- intensity exercise. Pflugers Arch. 446, 394-399.

Medford, J., and Sussex, I. (1989). Regulation of chlorophyll and Rubisco levels in embryonic cotyledons of Phaseolus vulgaris. Planta 179, 309-315.

Meinhard, M., and Grill, E. (2001). Hydrogen peroxide is a regulator of ABI1, a protein phosphatase 2C from Arabidopsis. FEBS Lett. 508, 443-446.

Meinhard, M., Rodriguez, P.L., and Grill, E. (2002). The sensitivity of ABI2 to hydrogen peroxide links the abscisic acid-response regulator to redox signalling. Planta 214, 775-782.

Melcher, K., Ng, L.M., Zhou, X.E., Soon, F.F., Xu, Y., Suino-Powell, K.M., Park, S.Y., Weiner, J.J., Fujii, H., Chinnusamy, V., Kovach, A., Li, J., Wang, Y., Peterson, F.C., Jensen, D.R., Yong, E.L., Volkman, B.F., Cutler, S.R., Zhu, J.K., and Xu, H.E. (2009). A gate-latch-lock mechanism for hormone signalling by abscisic acid receptors. Nature 462, 602-608.

Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant stomata function in innate immunity against bacterial invasion. Cell 126, 969-980.

Menke, F., Champion, A., Kijne, J., and Memelink, J. (1999). A novel jasmonate- and elicitor-responsive element in the periwinkle secondary metabolite biosynthetic gene Str interacts with a jasmonate- and elicitor-inducible AP2-domain transcription factor, ORCA2. Embo J. 18, 4455-4463.

Merlot, S., Gosti, F., Guerrier, D., Vavasseur, A., and Giraudat, J. (2001). The ABI1 and ABI2 protein phosphatases 2C act in a negative feedback regulatory loop of the abscisic acid signalling pathway. Plant J. 25, 295-303.

Meyer, K., Leube, M., and Grill, E. (1994). A protein phosphatase 2C involved in ABA signal transduction in Arabidopsis thaliana. Science 264, 1452-1455.

208

Michels, A.K., Wedel, N., and Kroth, P.G. (2005). Diatom plastids possess a phosphoribulokinase with an altered regulation and no oxidative pentose phosphate pathway. Plant Physiol. 137, 911-920.

Mikołajczyk, M., Awotunde, O.S., Muszyńska, G., Klessig, D.F., and Dobrowolska, G. (2000). Osmotic stress induces rapid activation of a salicylic acid-induced protein kinase and a homolog of protein kinase ASK1 in tobacco cells. Plant Cell 12, 165-178.

Mishra, G., Zhang, W., Deng, F., Zhao, J., and Wang, X. (2006). A bifurcating pathway directs abscisic acid effects on stomatal closure and opening in Arabidopsis. Science 312, 264-266.

Miyazono, K., Miyakawa, T., Sawano, Y., Kubota, K., Kang, H.J., Asano, A., Miyauchi, Y., Takahashi, M., Zhi, Y., Fujita, Y., Yoshida, T., Kodaira, K.S., Yamaguchi-Shinozaki, K., and Tanokura, M. (2009). Structural basis of abscisic acid signalling. Nature 462, 609-614.

Mori, I.C., and Muto, S. (1997). Abscisic acid activates a 48-Kilodalton protein kinase in guard cell protoplasts. Plant Physiol. 113, 833-839.

Mori, I.C., Murata, Y., Yang, Y., Munemasa, S., Wang, Y.F., Andreoli, S., Tiriac, H., Alonso, J.M., Harper, J.F., Ecker, J.R., Kwak, J.M., and Schroeder, J.I. (2006). CDPKs CPK6 and CPK3 function in ABA regulation of guard cell S-type anion- and Ca2+-permeable channels and stomatal closure. PLoS Biol. 4, e327.

Mori, I.C., Pinontoan, R., Kawano, T., and Muto, S. (2001). Involvement of superoxide generation in salicylic acid-induced stomatal closure in Vicia faba. Plant Cell Physiol. 42, 1383–1388.

Motohashi, K., Kondoh, A., Stumpp, M.T., and Hisabori, T. (2001). Comprehensive survey of proteins targeted by chloroplast thioredoxin. Proc. Natl. Acad. Sci. USA 98, 11224-11229.

Motohashi, K., Koyama, F., Nakanishi, Y., Ueoka-Nakanishi, H., and Hisabori, T. (2003). Chloroplast cyclophilin is a target protein of thioredoxin. Thiol modulation of the peptidyl-prolyl cis-trans isomerase activity. J. Biol. Chem. 278, 31848- 31852.

Mukhopadhyay, M., and Sharma, A. (1991). Manganese in cell metabolism of higher plants. Botanical Review 57, 117-149.

Mundy, J., and Schneitz, K. (2002). Protein phosphorylation in and around signal transduction. Trends Plant Sci. 7, 54-55.

209

Munemasa, S., Oda, K., Watanabe-Sugimoto, M., Nakamura, Y., Shimoishi, Y., and Murata, Y. (2007). The coronatine-insensitive 1 mutation reveals the hormonal signaling interaction between abscisic acid and methyl jasmonate in Arabidopsis guard cells. Specific impairment of ion channel activation and second messenger production. Plant Physiol. 143, 1398-1407.

Murata, Y., Pei, Z.M., Mori, I.C., and Schroeder, J. (2001). Abscisic acid activation of plasma membrane Ca2+ channels in guard cells requires cytosolic NAD(P)H and is differentially disrupted upstream and downstream of reactive oxygen species production in abi1-1 and abi2-1 protein phosphatase 2C mutants. Plant Cell 13, 2513-2523.

Mustilli, A.C., Merlot, S., Vavasseur, A., Fenzi, F., and Giraudat, J. (2002). Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14, 3089-3099.

Nagashima, Z., and Uchiyama, M. (1959). Possibility that myrosinase is a signal enzyme and mechanism of decomposition of mustard oil glucoside by myrosinase. Bulletin of the Agricultural Chemical Society of Japan 23, 555-556.

Nardai, G., Sass, B., Eber, J., Orosz, G., and Csermely, P. (2000). Reactive cysteines of the 90-kDa heat shock protein, Hsp90. Arch. Biochem. Biophys. 384, 59-67.

Narusaka, Y., Nakashima, K., Shinwari, Z., Sakuma, Y., Furihata, T., Abe, H., Narusaka, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2003). Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34, 137-148.

Nägele, E., Vollmer, M., Hörth, P., and Vad, C. (2004). 2D-LC/MS techniques for the identification of proteins in highly complex mixtures. Expert. Rev. Proteomics 1, 37-46.

Neill, S.J., Desikan, R., Clarke, A., and Hancock, J.T. (2002). Nitric oxide is a novel component of abscisic acid signaling in stomatal guard cells. Plant Physiol. 128, 13-16.

Nemhauser, J.L., Hong, F., and Chory, J. (2006). Different plant hormones regulate similar processes through largely nonoverlapping transcriptional responses. Cell 126, 467-475.

Neuefeind, T., Reinemer, P., and Bieseler, B. (1997). Plant glutathione S-transferases and herbicide detoxification. Biol. Chem. 378, 199-205.

210

Nishimura, N., Sarkeshik, A., Nito, K., Park, S.Y., Wang, A., Carvalho, P.C., Lee, S., Caddell, D.F., Cutler, S.R., Chory, J., Yates, J.R., and Schroeder, J.I. (2010). PYR/PYL/RCAR family members are major in vivo ABI1 protein phosphatase 2C- interacting proteins in Arabidopsis. Plant J. 61, 290-299.

Nishimura, N., Yoshida, T., Kitahata, N., Asami, T., Shinozaki, K., and Hirayama, T. (2007). ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed. Plant J. 50, 935-949.

Noctor, G., and Foyer, C. (1998). Ascorbate and glutathione: keeping active oxygen under control. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 249-279.

Ocheretina, O., and Scheibe, R. (1994). Cysteines of chloroplast NADP-malate dehydrogenase form mixed disulfides. FEBS Lett. 355, 254-258.

Ohtsuru, M., and Hata, T. (1979). Interaction of L-ascorbic acid with the active center of myrosinase. Biochimica Et Biophysica Acta 567, 384-391. op den Camp, R.G., Przybyla, D., Ochsenbein, C., Laloi, C., Kim, C., Danon, A., Wagner, D., Hideg, E., Göbel, C., Feussner, I., Nater, M., and Apel, K. (2003). Rapid induction of distinct stress responses after the release of singlet oxygen in Arabidopsis. Plant Cell 15, 2320-2332.

Outlaw, W.H., and De Vlieghere-He, X. (2001). Transpiration rate. An important factor controlling the sucrose content of the guard cell apoplast of broad bean. Plant Physiol. 126, 1716-1724.

Pandey, S., Wang, X., Coursol, S., and Assmann, S. (2002). Preparation and applications of Arabidopsis thaliana guard cell protoplasts. New Phytol. 153, 517- 526.

Pandey, S., Zhang, W., and Assmann, S.M. (2007). Roles of ion channels and transporters in guard cell signal transduction. FEBS Lett. 581, 2325-2336.

Park, S.Y., Fung, P., Nishimura, N., Jensen, D.R., Fujii, H., Zhao, Y., Lumba, S., Santiago, J., Rodrigues, A., Chow, T.F., Alfred, S.E., Bonetta, D., Finkelstein, R., Provart, N.J., Desveaux, D., Rodriguez, P.L., McCourt, P., Zhu, J.K., Schroeder, J.I., Volkman, B.F., and Cutler, S.R. (2009). Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. Science 324, 1068-1071.

Parvathi, K., and Raghavendra, A. (1997). Both Rubisco and phosphoenolpyruvate carboxylase are beneficial for stomatal function in epidermal strips of Commelina benghalensis. Plant Sci. 124, 153-157.

211

Pasapula, V., Shen, G., Kuppu, S., Paez-Valencia, J., Mendoza, M., Hou, P., Chen, J., Qiu, X., Zhu, L., Zhang, X., Auld, D., Blumwald, E., Zhang, H., Gaxiola, R., and Payton, P. (2011). Expression of an Arabidopsis vacuolar H+- pyrophosphatase gene (AVP1) in cotton improves drought- and salt tolerance and increases fibre yield in the field conditions. Plant Biotechnol. J. 9, 88-99.

Pastori, G.M., and Foyer, C.H. (2002). Common components, networks, and pathways of cross-tolerance to stress. The central role of "redox" and abscisic acid-mediated controls. Plant Physiol. 129, 460-468.

Pazhouhandeh, M., Molinier, J., Berr, A., and Genschik, P. (2011). MSI4/FVE interacts with CUL4-DDB1 and a PRC2-like complex to control epigenetic regulation of flowering time in Arabidopsis. Proc. Natl. Acad. Sci. USA 108, 3430- 3435.

Pedroso, M.C., Magalhaes, J.R., and Durzan, D. (2000). Nitric oxide induces cell death in Taxus cells. Plant Sci. 157, 173-180.

Pei, Z.M., Kuchitsu, K., Ward, J.M., Schwarz, M., and Schroeder, J.I. (1997). Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abi1 and abi2 mutants. Plant Cell 9, 409-423.

Pei, Z.M., Murata, Y., Benning, G., Thomine, S., Klüsener, B., Allen, G.J., Grill, E., and Schroeder, J.I. (2000). Calcium channels activated by hydrogen peroxide mediate abscisic acid signalling in guard cells. Nature 406, 731-734.

Pierce, A., Unwin, R.D., Evans, C.A., Griffiths, S., Carney, L., Zhang, L., Jaworska, E., Lee, C.F., Blinco, D., Okoniewski, M.J., Miller, C.J., Bitton, D.A., Spooncer, E., and Whetton, A.D. (2008). Eight-channel iTRAQ enables comparison of the activity of six leukemogenic tyrosine kinases. Mol. Cell. Proteomics 7, 853-863.

Pitzschke, A., Forzani, C., and Hirt, H. (2006). Reactive oxygen species signaling in plants. Antioxid. Redox Signal. 8, 1757-1764.

Postaire, O., Tournaire-Roux, C., Grondin, A., Boursiac, Y., Morillon, R., Schäffner, A.R., and Maurel, C. (2010). A PIP1 aquaporin contributes to hydrostatic pressure-induced water transport in both the root and rosette of Arabidopsis. Plant Physiol. 152, 1418-1430.

Qian, W.J., Jacobs, J.M., Camp, D.G., Monroe, M.E., Moore, R.J., Gritsenko, M.A., Calvano, S.E., Lowry, S.F., Xiao, W., Moldawer, L.L., Davis, R.W., Tompkins, R.G., and Smith, R.D. (2005). Comparative proteome analyses of human plasma following in vivo lipopolysaccharide administration using multidimensional separations coupled with tandem mass spectrometry. Proteomics 5, 572-584.

Raines, C., Lloyd, J., and Dyer, T. (1999). New insights into the structure and function of sedoheptulose-1,7-bisphosphatase; an important but neglected Calvin cycle enzyme. J. Exp. Bot. 50, 1-8.

212

Razem, F.A., El-Kereamy, A., Abrams, S.R., and Hill, R.D. (2006). The RNA-binding protein FCA is an abscisic acid receptor. Nature 439, 290-294.

Rodriguez, P.L., Leube, M.P., and Grill, E. (1998). Molecular cloning in Arabidopsis thaliana of a new protein phosphatase 2C (PP2C) with homology to ABI1 and ABI2. Plant Mol. Biol. 38, 879-883.

Romero-Puertas, M.C., Campostrini, N., Mattè, A., Righetti, P.G., Perazzolli, M., Zolla, L., Roepstorff, P., and Delledonne, M. (2008). Proteomic analysis of S- nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitive response. Proteomics 8, 1459-1469.

Ross, P.L., Huang, Y.N., Marchese, J.N., Williamson, B., Parker, K., Hattan, S., Khainovski, N., Pillai, S., Dey, S., Daniels, S., Purkayastha, S., Juhasz, P., Martin, S., Bartlet-Jones, M., He, F., Jacobson, A., and Pappin, D.J. (2004). Multiplexed protein quantitation in Saccharomyces cerevisiae using amine-reactive isobaric tagging reagents. Mol. Cell. Proteomics 3, 1154-1169.

Rouhier, N., Gelhaye, E., and Jacquot, J.P. (2002). Redox control by dithiol-disulfide exchange in plants: II. The cytosolic and mitochondrial systems. Ann. N. Y. Acad. Sc.i 973, 520-528.

Rouster, J., Leah, R., Mundy, J., and CameronMills, V. (1997). Identification of a methyl jasmonate-responsive region in the promoter of a lipoxygenase 1 gene expressed in barley grain. Plant J. 11, 513-523.

Sabehat, A., Weiss, D., and Lurie, S. (1998). Heat-shock proteins and cross-tolerance in plants. Physiologia Plantarum 103, 437-441.

Saito, N., Munemasa, S., Nakamura, Y., Shimoishi, Y., Mori, I.C., and Murata, Y. (2008). Roles of RCN1, regulatory A subunit of protein phosphatase 2A, in methyl jasmonate signaling and signal crosstalk between methyl jasmonate and abscisic acid. Plant Cell Physiol. 49, 1396-1401.

Saito, N., Nakamura, Y., Mori, I.C., and Murata, Y. (2009). Nitric oxide functions in both methyl jasmonate signaling and abscisic acid signaling in Arabidopsis guard cells. Plant Signal. Behav. 4, 119-120.

Samuel, M.A., and Ellis, B.E. (2002). Double jeopardy: both overexpression and suppression of a redox-activated plant mitogen-activated protein kinase render tobacco plants ozone sensitive. Plant Cell 14, 2059-2069.

Sano, S., Miyake, C., Mikami, B., and Asada, K. (1995). Molecular characterization of monodehydroascorbate radical reductase from cucumber highly expressed in Escherichia coli. J. Biol. Chem. 270, 21354-21361.

213

Santiago, J., Rodrigues, A., Saez, A., Rubio, S., Antoni, R., Dupeux, F., Park, S.Y., Márquez, J.A., Cutler, S.R., and Rodriguez, P.L. (2009). Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade A PP2Cs. Plant J. 60, 575-588.

Sarry, J.E., Chen, S., Collum, R.P., Liang, S., Peng, M., Lang, A., Naumann, B., Dzierszinski, F., Yuan, C.X., Hippler, M., and Rea, P.A. (2007). Analysis of the vacuolar luminal proteome of Saccharomyces cerevisiae. FEBS J. 274, 4287- 4305.

Sato, A., Sato, Y., Fukao, Y., Fujiwara, M., Umezawa, T., Shinozaki, K., Hibi, T., Taniguchi, M., Miyake, H., Goto, D.B., and Uozumi, N. (2009). Threonine at position 306 of the KAT1 potassium channel is essential for channel activity and is a target site for ABA-activated SnRK2/OST1/SnRK2.6 protein kinase. Biochem. J. 424, 439-448.

Saze, H., Ueno, Y., Hisabori, T., Hayashi, H., and Izui, K. (2001). Thioredoxin- mediated reductive activation of a protein kinase for the regulatory phosphorylation of C4-form phosphoenolpyruvate carboxylase from maize. Plant Cell Physiol. 42, 1295-1302.

Schmidt, C., Schelle, I., Liao, Y.J., and Schroeder, J.I. (1995). Strong regulation of slow anion channels and abscisic acid signaling in guard cells by phosphorylation and dephosphorylation events. Proc. Natl. Acad. Sci. USA 92, 9535-9539.

Schroeder, J., and Hedrich, R. (1989). Involvement of ion channels and active transport in osmoregulation and signaling of higher plant cells. Trends Biochem. Sci. 14, 187-192.

Schweighofer, A., Hirt, H., and Meskiene, I. (2004). Plant PP2C phosphatases: emerging functions in stress signaling. Trends Plant Sci. 9, 236-243.

Sethuraman, M., McComb, M.E., Huang, H., Huang, S., Heibeck, T., Costello, C.E., and Cohen, R.A. (2004). Isotope-coded affinity tag (ICAT) approach to redox proteomics: identification and quantitation of oxidant-sensitive cysteine thiols in complex protein mixtures. J. Proteome Res. 3, 1228-1233.

Sheard, L.B., Tan, X., Mao, H., Withers, J., Ben-Nissan, G., Hinds, T.R., Kobayashi, Y., Hsu, F.F., Sharon, M., Browse, J., He, S.Y., Rizo, J., Howe, G.A., and Zheng, N. (2010). Jasmonate perception by inositol-phosphate-potentiated COI1- JAZ co-receptor. Nature 468, 400-405.

Shen, Y., Wang, X., Wu, F., Du, S., Cao, Z., Shang, Y., Wang, X., Peng, C., Yu, X., Zhu, S., Fan, R., Xu, Y., and Zhang, D. (2006). The Mg-chelatase H subunit is an abscisic acid receptor. Nature 443, 823-826.

214

Shilov, I.V., Seymour, S.L., Patel, A.A., Loboda, A., Tang, W.H., Keating, S.P., Hunter, C.L., Nuwaysir, L.M., and Schaeffer, D.A. (2007). The Paragon Algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol. Cell. Proteomics 6, 1638-1655.

Shimazaki, K., Kinoshita, T., and Nishimura, M. (1992). Involvement of calmodulin and calmodulin-dependent myosin light chain kinase in blue light-dependent H pumping by guard cell protoplasts from Vicia faba L. Plant Physiol. 99, 1416-1421.

Shinozaki, K., and Yamaguchi-Shinozaki, K. (2007). Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 58, 221-227.

Simpson, S., Nakashima, K., Narusaka, Y., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2003). Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J. 33, 259-270.

Sirichandra, C., Wasilewska, A., Vlad, F., Valon, C., and Leung, J. (2009). The guard cell as a single-cell model towards understanding drought tolerance and abscisic acid action. J. Exp. Bot. 60, 1439-1463.

Sirichandra, C., Davanture, M., Turk, B.E., Zivy, M., Valot, B., Leung, J., and Merlot, S. (2010). The Arabidopsis ABA-activated kinase OST1 phosphorylates the bZIP transcription factor ABF3 and creates a 14-3-3 binding site involved in its turnover. PLoS One 5, e13935.

Skriver, K., Olsen, F., Rogers, J., and Mundy, J. (1991). cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc. Natl. Acad. Sci. USA 88, 7266-7270.

Smalle, J., and Vierstra, R.D. (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu. Rev. Plant Biol. 55, 555-590.

Smart, L., Cameron, K., and Bennett, A. (2000). Isolation of genes predominantly expressed in guard cells and epidermal cells of Nicotiana glauca. Plant Mol. Biol. 42, 857-869.

Smith, J., Francis, S., Chu, D., and Corbin, J. (1993). Autophosphorylation of the cGMP-dependent protein kinase type I beta occurs at physiological concentration of enzyme and cGMP (or cAMP). Faseb J. 7, A1123-A1123.

Sokolovski, S., Hills, A., Gay, R., Garcia-Mata, C., Lamattina, L., and Blatt, M.R. (2005). Protein phosphorylation is a prerequisite for intracellular Ca2+ release and ion channel control by nitric oxide and abscisic acid in guard cells. Plant J. 43, 520-529.

215

Stone, J.M., and Walker, J.C. (1995). Plant protein kinase families and signal transduction. Plant Physiol. 108, 451-457.

Suhita, D., Kolla, V., Vavasseur, A., and Raghavendra, A. (2003). Different signaling pathways involved during the suppression of stomatal opening by methyl jasmonate or abscisic acid. Plant Sci. 164, 481-488.

Suhita, D., Raghavendra, A.S., Kwak, J.M., and Vavasseur, A. (2004). Cytoplasmic alkalization precedes reactive oxygen species production during methyl jasmonate- and abscisic acid-induced stomatal closure. Plant Physiol. 134, 1536- 1545.

Sui, J., Zhang, J., Tan, T.L., Ching, C.B., and Chen, W.N. (2008). Comparative proteomics analysis of vascular smooth muscle cells incubated with S- and R- enantiomers of atenolol using iTRAQ-coupled two-dimensional LC-MS/MS. Mol. Cell. Proteomics 7, 1007-1018.

Suzukawa, K., Miura, K., Mitsushita, J., Resau, J., Hirose, K., Crystal, R., and Kamata, T. (2000). Nerve growth factor-induced neuronal differentiation requires generation of Rac1-regulated reactive oxygen species. J.Biol. Chem. 275, 13175- 13178.

Suzuki, N., Koussevitzky, S., Mittler, R., and Miller, G. (2011). ROS and redox signalling in the response of plants to abiotic stress. Plant Cell Environ. doi: 10.1111/j.1365-3040.2011.02336.x.

Tahtiharju, S., and Palva, T. (2001). Antisense inhibition of protein phosphatase 2C accelerates cold acclimation in Arabidopsis thaliana. Plant J. 26, 461-470.

Taipalensuu, J., Falk, A., and Rask, L. (1996). A wound- and methyl jasmonate- inducible transcript coding for a myrosinase-associated protein with similarities to an early nodulin. Plant Physiol. 110, 483-491.

Taiz, L., and Zeiger, E. (2006). Plant physiology. 4th Edition

Taj, G., Agarwal, P., Grant, M., and Kumar, A. (2010). MAPK machinery in plants: recognition and response to different stresses through multiple signal transduction pathways. Plant Signal. Behav. 5, 1370-1378.

Tajima, T., Yamaguchi, A., Matsushima, S., Satoh, M., Hayasaka, S., Yoshimatsu, K., and Shioi, Y. (2011). Biochemical and molecular characterization of senescence-related cysteine protease-cystatin complex from spinach leaf. Physiol. Plant 141, 97-116.

Takahashi, A., Casais, C., Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl. Acad. Sci. USA 100, 11777-11782.

216

Talts, E., Oja, V., Rämma, H., Rasulov, B., Anijalg, A., and Laisk, A. (2007). Dark inactivation of ferredoxin-NADP reductase and cyclic electron flow under far-red light in sunflower leaves. Photosynth. Res. 94, 109-120.

Tanaka, N., Matsuoka, M., Kitano, H., Asano, T., Kaku, H., and Komatsu, S. (2006). gid1, a gibberellin-insensitive dwarf mutant, shows altered regulation of probenazole-inducible protein (PBZ1) in response to cold stress and pathogen attack. Plant Cell Environ. 29, 619-631.

Tchieu, J.H., Fana, F., Fink, J.L., Harper, J., Nair, T.M., Niedner, R.H., Smith, D.W., Steube, K., Tam, T.M., Veretnik, S., Wang, D., and Gribskov, M. (2003). The PlantsP and PlantsT Functional Genomics Databases. Nucleic Acids Res. 31, 342-344.

Templin, M.F., Stoll, D., Schrenk, M., Traub, P.C., Vöhringer, C.F., and Joos, T.O. (2002). Protein microarray technology. Drug Discov. Today 7, 815-822.

Thiel, G., and Blatt, M. (1994). Phosphatase antagonist okadaic acid inhibits steady ste K+ currents in guard cells of Vicia faba. Plant J. 5, 727-733.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He, S., Howe, G., and Browse, J. (2007). JAZ repressor proteins are targets of the SCFCO11 complex during jasmonate signalling. Nature 448, 661-U662.

Thompson, A., Schafer, J., Kuhn, K., Kienle, S., Schwarz, J., Schmidt, G., Neumann, T., and Hamon, C. (2003). Tandem mass tags: A novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS. Anal. Chem. 75, 1895-1904.

Tominaga, M., Harada, A., Kinoshita, T., and Shimazaki, K. (2010). Biochemical characterization of calcineurin B-like-interacting protein kinase in Vicia guard cells. Plant Cell Physiol. 51, 408-421.

Tonks, N.K. (2005). Redox redux: revisiting PTPs and the control of cell signaling. Cell 121, 667-670.

Tsang, E., Bowler, C., Herouart, D., Vancamp, W., Villarroel, R., Genetello, C., Vanmontagu, M., and Inze, D. (1991). Differential regulation of superoxide dismutase in plants exposed to environmental stress. Plant Cell 3, 783-792.

Tsuzuki, T., Takahashi, K., Inoue, S., Okigaki, Y., Tomiyama, M., Hossain, M.A., Shimazaki, K., Murata, Y., and Kinoshita, T. (2011). Mg-chelatase H subunit affects ABA signaling in stomatal guard cells, but is not an ABA receptor in Arabidopsis thaliana. J. Plant Res. 124, 527-538.

Turner, J., Ellis, C., and Devoto, A. (2002). The jasmonate signal pathway. Plant Cell 14, S153-S164.

217

Ueda, T., Yoshizumi, T., Anai, T., Matsui, M., Uchimiya, H., and Nakano, A. (1998). AtGDI2, a novel Arabidopsis gene encoding a Rab GDP dissociation inhibitor. Gene 206, 137-143.

Umezawa, T., Nakashima, K., Miyakawa, T., Kuromori, T., Tanokura, M., Shinozaki, K., and Yamaguchi-Shinozaki, K. (2010). Molecular basis of the core regulatory network in ABA responses: sensing, signaling and transport. Plant Cell Physiol. 51, 1821-1839.

Ushimaru, T., Maki, Y., Sano, S., Koshiba, K., Asada, K., and Tsuji, H. (1997). Induction of enzymes involved in the ascorbate-dependent antioxidative system, namely, ascorbate peroxidase, monodehydroascorbate reductase and dehydroascorbate reductase, after exposure to air of rice (Oryza sativa) seedlings germinated under water. Plant Cell Physiol. 38, 541-549.

Vahisalu, T., Puzõrjova, I., Brosché, M., Valk, E., Lepiku, M., Moldau, H., Pechter, P., Wang, Y.S., Lindgren, O., Salojärvi, J., Loog, M., Kangasjärvi, J., and Kollist, H. (2010). Ozone-triggered rapid stomatal response involves the production of reactive oxygen species, and is controlled by SLAC1 and OST1. Plant J. 62, 442-453.

Valerio, C., Costa, A., Marri, L., Issakidis-Bourguet, E., Pupillo, P., Trost, P., and Sparla, F. (2011). Thioredoxin-regulated beta-amylase (BAM1) triggers diurnal starch degradation in guard cells, and in mesophyll cells under osmotic stress. J. Exp. Bot. 62, 545-555.

Valko, M., Leibfritz, D., Moncol, J., Cronin, M.T., Mazur, M., and Telser, J. (2007). Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 39, 44-84.

Vavasseur, A., and Raghavendra, A.S. (2005). Guard cell metabolism and CO2 sensing. New Phytol. 165, 665-682.

Vlad, F., Rubio, S., Rodrigues, A., Sirichandra, C., Belin, C., Robert, N., Leung, J., Rodriguez, P.L., Laurière, C., and Merlot, S. (2009). Protein phosphatases 2C regulate the activation of the Snf1-related kinase OST1 by abscisic acid in Arabidopsis. Plant Cell 21, 3170-3184.

Vom Endt, D., Soares e Silva, M., Kijne, J.W., Pasquali, G., and Memelink, J. (2007). Identification of a bipartite jasmonate-responsive promoter element in the Catharanthus roseus ORCA3 transcription factor gene that interacts specifically with AT-Hook DNA-binding proteins. Plant Physiol. 144, 1680-1689.

Walters, E.M., and Johnson, M.K. (2004). Ferredoxin: thioredoxin Reductase: disulfide reduction catalyzed via novel site-specific [4Fe-4S] cluster chemistry. Photosynth. Res. 79, 249-264.

218

Wan, J., Torres, M., Ganapathy, A., Thelen, J., DaGue, B.B., Mooney, B., Xu, D., and Stacey, G. (2005). Proteomic analysis of soybean root hairs after infection by Bradyrhizobium japonicum. Mol. Plant Microbe Interact. 18, 458-467.

Wang, H., Qian, S., Schafer, F., Domann, F., Oberley, L., and Buettner, G. (2001a). Phospholipid hydroperoxide glutathione peroxidase protects against singlet oxygen-induced cell damage of photodynamic therapy. Free Radic. Biol. Med. 30, 825-835.

Wang, P., and Song, C.P. (2008). Guard-cell signalling for hydrogen peroxide and abscisic acid. New Phytol. 178, 703-718.

Wang, R.S., Pandey, S., Li, S., Gookin, T.E., Zhao, Z., Albert, R., and Assmann, S.M. (2011). Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells. BMC Genomics 12, 216.

Wang, X., Ullah, H., Jones, A., and Assmann, S. (2001b). G protein regulation of ion channels and abscisic acid signaling in Arabidopsis guard cells. Science 292, 2070-2072.

Washburn, M., Koller, A., Oshiro, G., Ulaszek, R., Plouffe, D., Deciu, C., Winzeler, E., and Yates, J. (2003). Protein pathway and complex clustering of correlated mRNA and protein expression analyses in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 100, 3107-3112.

Wasilewska, A., Vlad, F., Sirichandra, C., Redko, Y., Jammes, F., Valon, C., Frei dit Frey, N., and Leung, J. (2008). An update on abscisic acid signaling in plants and more…. Mol. Plant 1, 198-217.

Wawer, I., Bucholc, M., Astier, J., Anielska-Mazur, A., Dahan, J., Kulik, A., Wysłouch-Cieszynska, A., Zareba-Kozioł, M., Krzywinska, E., Dadlez, M., Dobrowolska, G., and Wendehenne, D. (2010). Regulation of Nicotiana tabacum osmotic stress-activated protein kinase and its cellular partner GAPDH by nitric oxide in response to salinity. Biochem. J. 429, 73-83.

West, A.H., and Stock, A.M. (2001). Histidine kinases and response regulator proteins in two-component signaling systems. Trends Biochem. Sci. 26, 369-376.

Wilkinson, S., and Davies, W.J. (2002). ABA-based chemical signalling: the coordination of responses to stress in plants. Plant Cell Environ. 25, 195-210.

Wu, C., Parrott, A.M., Liu, T., Jain, M.R., Yang, Y., Sadoshima, J., and Li, H. (2011). Distinction of thioredoxin transnitrosylation and denitrosylation target proteins by the ICAT quantitative approach.J Proteomics. 74, 2498-2509.

Wu, Y., Kuzma, J., Maréchal, E., Graeff, R., Lee, H.C., Foster, R., and Chua, N.H. (1997). Abscisic acid signaling through cyclic ADP-ribose in plants. Science 278, 2126-2130.

219

Xie, D., Feys, B., James, S., Nieto-Rostro, M., and Turner, J. (1998). COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280, 1091-1094.

Xu, X., Song, H., Zhou, Z., Shi, N., Ying, Q., and Wang, H. (2010). Functional characterization of AtHsp90.3 in Saccharomyces cerevisiae and Arabidopsis thaliana under heat stress. Biotechnol. Lett. 32, 979-987.

Xue, S., Hu, H., Ries, A., Merilo, E., Kollist, H., and Schroeder, J.I. (2011). Central functions of bicarbonate in S-type anion channel activation and OST1 protein kinase in CO2 signal transduction in guard cell. EMBO J. 30, 1645-1658.

Yan, X., and Chen, S. (2007). Regulation of plant glucosinolate metabolism. Planta 226, 1343-1352.

Yanagida, M. (2002). Functional proteomics; current achievements. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 771, 89-106.

Yano, H., Wong, J.H., Lee, Y.M., Cho, M.J., and Buchanan, B.B. (2001). A strategy for the identification of proteins targeted by thioredoxin. Proc. Natl. Acad. Sci. USA 98, 4794-4799.

Yin, P., Fan, H., Hao, Q., Yuan, X., Wu, D., Pang, Y., Yan, C., Li, W., Wang, J., and Yan, N. (2009). Structural insights into the mechanism of abscisic acid signaling by PYL proteins. Nat. Struct. Mol. Biol. 16, 1230-1236.

Yoshida, R., Umezawa, T., Mizoguchi, T., Takahashi, S., Takahashi, F., and Shinozaki, K. (2006). The regulatory domain of SRK2E/OST1/SnRK2.6 interacts with ABI1 and integrates abscisic acid (ABA) and osmotic stress signals controlling stomatal closure in Arabidopsis. J. Biol. Chem. 281, 5310-5318.

Yuan, C.J., Huang, C.Y., and Graves, D.J. (1994). Oxidation and site-directed mutagenesis of the sulfhydryl groups of a truncated gamma catalytic subunit of phosphorylase kinase. Functional and structural effects. J. Biol. Chem. 269, 24367-24373.

Zhang, N., and Portis, A.R. (1999). Mechanism of light regulation of Rubisco: a specific role for the larger Rubisco activase isoform involving reductive activation by thioredoxin-f. Proc. Natl. Acad. Sci. USA 96, 9438-9443.

Zhang, S., and Klessig, D.F. (1997). Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 9, 809-824.

Zhang, X., Zhang, L., Dong, F., Gao, J., Galbraith, D.W., and Song, C.P. (2001). Hydrogen peroxide is involved in abscisic acid-induced stomatal closure in Vicia faba. Plant Physiol. 126, 1438-1448.

220

Zhang, Y., and Hogg, N. (2004). The mechanism of transmembrane S-nitrosothiol transport. Proc. Natl. Acad. Sci. USA 101, 7891-7896.

Zhao, Z., Zhang, W., Stanley, B.A., and Assmann, S.M. (2008). Functional proteomics of Arabidopsis thaliana guard cells uncovers new stomatal signaling pathways. Plant Cell 20, 3210-3226.

Zhu, H., Bilgin, M., and Snyder, M. (2003). Proteomics. Annu. Rev. Biochem. 72, 783- 812.

Zhu, J. (2004). Using T-DNA tagging to isolate novel genes from Arabidopsis essential for abiotic stress tolerance. Purdue University PhD dissertation.

Zhu, M., Simons, B., Zhu, N., Oppenheimer, D.G., and Chen, S. (2010). Analysis of abscisic acid responsive proteins in Brassica napus guard cells by multiplexed isobaric tagging. J. Proteomics 73, 790-805.

Zhu, S., Yu, X., Wang, X., Zhao, R., Li, Y., Fan, R., Shang, Y., Du, S., Wang, X., Wu, F., Xu, Y., Zhang, X., and Zhang, D. (2007). Two calcium-dependent protein kinases, CPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis. Plant Cell 19, 3019-3036.

221

BIOGRAPHICAL SKETCH

Mengmeng Zhu was born in April, 1982 in Anhui Province, China. She was admitted to Xi‟an Jiaotong University in Shaanxi Province, China for undergrad study, majoring in bioengineering. Upon graduation in July 2004, she was recruited into the master program of molecular biology and biochemistry in Xi‟an Jiaotong University.

From July 2005 to August 2006, Mengmeng Zhu did her thesis research in Dr. De Ye‟s laboratory at the State Key Laboratory of Plant Physiology and Biochemistry, China

Agriculture University. Her research focus was on the characterization of a kinase in the polar growth of pollen tubes during the male gametophyte development. Upon her completion of the master study in China, Mengmeng Zhu entered the Ph.D. program of botany in the Biology Department of University of Florida at Gainesville, Florida in July

2007. She has been under the supervision of Dr. Sixue Chen and working on guard cell proteomics and hormone signaling. Mengmeng Zhu received her Ph.D. degree in

December 2011. She would like to further develop her career in plant biology related areas.

222