Table S1. Oligonucleotide primers used for RT-PCR.
Prod, Annl Protein /gene Accession # Forward Primer (5’3’) Reverse Primer (5’3’) bp °C β-actin / Actb NM_007393 caccctgtgctgctcacc gcacgatttccctctcag 328 58 NTPDase2 / Entptd2 NM_009849 agctggaggatgccacagag gagagcaacccaggagctga 299 63 Pr #1 Pr #2 226 58 ctcgctttgggaagtttgc gcattgactgtcatcgggt † PLCβ2 / Plcb2 NM_177568 Pr #3 Pr #4 163 60 gagcaaatcgccaagatgat ccttgtctgtggtgaccttg SNAP25 /Snap25 NM_011428 ggcaataatcaggatggagtag agatttaaccacttcccagca 310 58 GAD1 / Gad1 NM_008077 agatagccctgagcgacgag atggccgatgattctggttc 240 59 Pr #1 Pr #2 217 59 aatggtgtttgatgggaagc agggtttgagatgaccatgc † GAD2 / Gad2 NM_008078 Pr #3 Pr #4T 271 59 cattcctgtccttgcctctc gtgcatcctttgtccatgt GABA-B1 / Gabbr1 NM_019439 gaatggcagtctgaagcaca tcgactcccatcacagctaa 273 59 GABA-A α1 / Gabra1 NM_010250 ccaagtctccttctggctca cggttctatggtcgcacttt 261 59 GABA-A α2 / Gabra2 NM_008066 ttgggacgggaagagtgtag catcctgtcgattttgctga 232 59 GABA-A α3 / Gabra3 NM_008067 tctcaccatgaccaccttga ccttggccagattgatagga 281 59 GABA-A α4 / Gabra4 NM_010251 gaagttccagctgctcctgt tgctgaatggatttggactg 229 59 GABA-A α5 / Gabra5 NM_176942 gccctggaagcagctaaaat cgggacattttgtcgatctt 227 59 GABA-A α6 / Gabra6 NM_008068 ctgaaaggcaggcacaaact taagagcaatgggggagaga 221 59 GABA-A β1 / Gabrb1 NM_008069 catgggctgttttgtgtttg acgagtacatggtggccttg 260 59 Pr #1 Pr #2 204 59 tatggcccttctggaatacg cccattactgcttcggatgt † GABA-A β2 / Gabrb2 NM_008070 Pr #3 Pr #4 283 59 acacaccacagagcatcgtc caaatttctggagctggtacg GABA-A β3 / Gabrb3 NM_008071 gaagaagcttgcggagaaga tggcattcacatcggttaga 326 59 GABA-A γ1 / Gabrg1 NM_010252 aggcaggaagctgaaaaaca gcaaaagctgttgggaaaaa 255 59 GABA-A γ2 / Gabrg2 NM_177408 atcaatggaagcgcagttct taggagaccttgggcagaga 334 59 GABA-A γ3 / Gabrg3 NM_008074 gccaaccatcaggaagaaaa agcagcagaagaagctctgg 227 59 Pr #1 Pr #2 275 59 atgcatttgcccacttcaa atgggtttgagtctggaacg † GABA-A δ / Gabrd NM_008072 Pr #3 Pr #4 321 59 ccaaaatgggacagagagga atttcatgctgggaccaaag Pr #1 Pr #2 287 59 cctacccaacaccaactgct acttgtcgctggctttcatt † GABA-A π / Gabrp NM_146017 Pr #3 Pr #4 312 59 cgactgttctgaacgatgga cagagccatgctgatgaaaa GABA-A ε / Gabre NM_017369 tctcacggctttggacttct tccagggacactgaggtctt 331 59 GABA-A θ / Gabrq NM_020488 accgctaccaagaagtggtg ggcagatcactcaggctttc 250 59 GABA-A ρ1 / Gabrr1 NM_008075 tgcctgctagagtcccctta caggtcgttcacctctccat 299 59 GABA-A ρ2 / Gabrr2 NM_008076 cagagtctcactgggcatca ctggcagaatgtggcttctt 323 59 GABA-A ρ3 / Gabrr3 BC151105 caactcaacaggaggggaaa ctcccagggatttccttttt 205 59
† Two primer pairs were used for these genes. Primers 1,2 were used for end-point RT-PCR. Primers 3,4 were used only on single cell amplified RNA to improve yield.
Conditions for PCR were 95ºC for 5 min, followed by 40 cycles (30 sec each at 94ºC, annealing temperature, and 72ºC). Figure S1. Biosensors do not respond to GABAergic agonists or antagonists. A. 5-HT biosensors show robust Ca2+ responses to bath-applied serotonin (3 nM), but not to GABA (10 μM), Bac (baclofen, 1 μM), Mus (muscimol, 1 μM), Bic (bicuculline, 10 μM), CGP (CGP55845, 10 μM). Similarly, responses to 5-HT itself were unaffected by these compounds (not shown). B. ATP biosensors respond to ATP (1 μM) but not to the GABAergic drugs as in A. Responses to ATP also were not affected by the presence of these drugs (not shown). For A and B alike, three representative, highly sensitive biosensor cells are shown. A B C vp tb1 tb2 nt -- br vp tb1 tb2 nt -- br vp tb1 tb2 nt -- br GABA-A α1 GABA-A α 2 GABA-A α 3
GABA-A α 5 GABA-A α 4 GABA-A α 6
GABA-A γ3 GABA-A γ 2 GABA-A γ 1
GABA-A ρ2 GABA-A ρ 3 GABA-A ρ 1
GABA-A θ
GABA-A ε
Figure S2. RT-PCR for GABA receptor subunits that are expressed at low abundance or not at all in mouse taste buds. A. GABA-A receptor subunits α1, α5, ρ2 and γ3 are expressed in tissue dissected from the vallate papilla (va) and in some (but not all) samples of taste buds (tb1, tb2). The vallate sample contains muscle, connective tissue, and importantly, nerves. Thus, reaction product in some taste bud samples may represent either very low levels of expression in taste buds or contamination from other cells in the papilla. Controls as in Figures 5, 7 are non-taste lingual epithelium (nt), no cDNA (-), and brain (br). B. GABA- A receptor subunits α2, α4, γ2, θ, ε, and ρ3 are detectable only in vallate tissue pieces (va) and not in isolated taste buds (tb1, tb2). C. GABA-A receptor subunits α3, α6, γ1, and ρ1 were undetectable in all taste bud containing samples. A GAD67 1.5
1.0 [SNAP25] /
0.5 D67] A [G
CV Fol Fun Pal
B GAD65 1.5 25] P
1.0 [SNA /
0.5 [GAD65]
CV Fol Fun Pal
Figure S3. Relative expression of GAD 65 and GAD67 in vallate, foliate, fungiform, and palatal taste buds. Three independent samples of taste buds from each taste field were processed for qRT-PCR for for GAD65 (A), GAD67 (B) and SNAP25, a marker for taste bud cells. Bars are mean ± sems.e.m. for relative expression of each GABA-synthetic enzyme, normalized to expression of SNAP25 in the same sample. A Palate
GABA GAD67-GFP merge B Fungiform
GABA GAD67-GFP merge
Figure S4. Immunoreactivity for GABA is also detected in mouse palatal and fungiform taste buds. Figure 7 in the manuscript demonstrates that GAD67-expressing (Presynaptic) taste cells in vallate taste buds accumulate GABA. Here we show similar results for taste buds from palate (A) fungiform papillae (B) and palate. GFP fluorescence (green) in taste cells from GAD67-GFP transgenic mice overlaps with, and is a subset of cells that are immunopositive for GABA (red). Scale, 20 µm.