Binding sites for USF1, USF2 and regions of histone 3 acetylation mapped genome-wide
Claes Wadelius Prof, MD Department of genetics and pathology Introduction
Metabolic disorders: epidemic proportions.
Aetiological similarities with familial combined hyperlipidaemia (FCHL).
Association of FCHL with non-coding variants of the USF1.
USFs role in glucose and lipid metabolism. Western blot – antibody specificity ChIP signal after siRNA Experimental design
ChIPs for USF1, USF2, H3ac and IgG. Input DNA. Sonicated to small sizes.
3 biological replicates.
Human Tiling 2.0R Array set (Affymetrix).
126 hybridizations. Correlations between replicates - USF1
1 vs 2 1 vs 3
All data points Log2>0.6 2 vs 3 Correlations between data sets Data points after peak finding Signal for IgG vs input
B statistic
3
Positive experiment Log2 USF1, USF2, H3ac
Negative control IgG signal 0 High B score Low B score Data analysis and overall results
Stringent and Relaxed data sets: - At least four consecutive spots. - Double cut-off: B-score (reproducibility and different from IgG) + Log2 (enrichment over input)
Enriched regions Enriched regions Enriche regions Number Mean size (bp) Median size (bp)
Stringent USF1 2519 511 345 Relaxed USF1 3499 - - Stringent USF2 1352 381 270 Relaxed USF2 2311 - -
Stringent H3ac 10901 609 458 Relaxed H3ac 12915 - - 2,5 29 Kb 6 Kb Kb
ApoA-IV ApoC-III ApoC-III Promoter ApoA-I Promoter Apo A-V Promoter enhancer Promoter HNF-4α HNF-3β USF1 (-0.9-0.5 KB) HNF-4α HNF-4α C/EBP HNF-4α PPARα Sp1 USF1 C/EBP
Cis-element between ApoA-IV and ApoC-III HNF-4α qPCR validation of ChIP-chip data
USF1 vs H86 qPCR USF1 vs C20 qPCR R=0,81 R=0,81
1000
USF1 100 (H86) USF2 vs qPCR H3ac vs qPCR USF1 R=0,79 R=0,85 (C20)
USF2
Fold enrichment (log scale) (log Fold enrichment 10
1 1 6 11 16 21 26 31 36 41 46 USF bound regions
48 bound and 6 unbound regions Correlation between ChIP-chip and analyzed by qPCR. qPCR binding signals qPCR for USF1, USF2 and H3ac USF binding close to TSS of active genes
USFs bind promoters of transcriptionally active genes
Architecture of USF and H3ac bound promoters
USF1
USF1 H3ac
USF2
USF2 H3ac
USFs preferentially bind upstream of TSS in the context of H3 hyperacetylated chromatin USF binding determinants. E-boxes
USF1
log2>2 (422)
ENCODE (31) 1.5 TRANSFAC 1.25 JASPAR 1 log2<=1 (485) Validation of tentative binding sites (TBS) against established ones Gene/element ENCODE ID OUR TBS Established binding site TF ApoA4/C3 >ENm003:stSG60180 GTCCAGAGGTCA TCAAACCAGGGGTCAGTCCAGAGGTCAGAGTCA intergenic 7 HNF-4α >ENm003:stSG60180 APOA4 promoter TGTCAAGGTACA TCGATAGTCTCAGGGTCACAAAAAGTCCAAGAGGCC 4 HNF-4α >ENm003:stSG60180 APOA4 promoter GGGGCAAAGTCCA GGGAGATGTGGACTTTGCCCCCCATGAGCCC 4 HNF-4α >ENm003:stSG60181 APOC3 promoter GGGCAGAGGCCA 0 HNF-4α >ENm003:stSG60181 APOC3 promoter GGGCAAAGGTCA TCGAGGTCAGCAGGTGACCTTTGCCCAGCG 0 HNF-4α F10 promoter >ENr132:stSG621988 GAGCAAAGTCCA TCCCAGGTGGGGCGTGGACTTTGCTCCA HNF-4α >ENm003:stSG60181 APOA1 promoter GCTCAAGGTTCA CCGCCCCCACTGAACCCTTGACCCCTGCCCT 7 HNF-4α >ENm003:stSG60181 CCTTGAACTCTTAAGTTCCACATTGCCAGGACCA APOA1 promoter 7 GTGAGCAGCAACAGGGCC HNF-4α >ENm003:stSG60181 HNF- APOA1 promoter TGCCCACTCTATTTGCCCAGCCCCAG 7 3β Validation of TBS by EMSA HNF-4α USF1 HNF-3β p p p p α p p β m 4 m 1 m 3 o m - α o m - o m - o F 2 o F 1 o F 1 C c C c S C c g s f . N P g s f . p g s f . N p e o l r e o l r U S e o l r S e n H A e n - - e n H - N P - - N P N P - S U α α S U Α Α S U α Α stSG634982 stSG627950 stSG611299 Validating DNA-protein interactions by proximity ligation Genomic distribution H3ac USF binding determinants. Chromatin Negatives TSS 500 bp TSS 1 kb TSS 5 kb 3’en 5 kb Intragenic Intergenic TSS 1kb Human mRNAs/Spliced ESTs High signal Low signal Conclusions Carefully controlled experiments with <1% false positives. Promoter architecture of USF1 and H3ac promoters. H3ac as a transcriptional dependent mark. USF binding determinants: chromatin and DNA sequence. TF binding may be predicted at bp resolution. USF1 and FCHL: candidate genes identified. Acknowledgements Department of Genetics and Wellcome Trust Sanger Institute Pathology, Uppsala Christoph Koch Alvaro Rada-Iglesias Ian Dunham Ola Wallerman Mehdi Motallebipour Affymetrix Sigrun Gustafsdottir Tom Gingeras Ulf Landegren Phil Kapranov Linnaeus Centre for Bioinformatics, Uppsala Adam Ameur Stefan Enroth Jan Komorowski