Valentina KALICHUK

Mémoire présenté en vue de l’obtention du Grade de Docteur de l'Université de Nantes et de l’Université Catholique de Louvain

Écoles doctorales: Biologie-Sante (UN) et Secteur des sciences de la santé (UCL)

Discipline: Biomolécules, pharmacologie, thérapeutique (UN) et Sciences biomédicales et pharmaceutiques (UCL)

Spécialité: Biologie des organismes (UN) et Sciences pharmaceutiques (UCL)

Unité de recherche :

Inserm U1232 – CNRS – 6299 – CRCINA et Louvain Drug Research Institute IRS-UN, Team 13: Nuclear Oncoloy Research Advanced Drug Delivery and Biomaterials

Soutenue le 16/10/2017

A novel generation of Affitins for targeting cancer cells with drug-loaded lipid nanocapsules

JURY

Président du Jury : Nick DEVOOGDT, Professeur des universités, ICMI, Vrije Universiteit Brussel, Belgium

Rapporteurs : Nick DEVOOGDT, Professeur des universités, ICMI, Vrije Universiteit Brussel, Belgium Vladimir TOLMACHEV, Professeur des universités, IGP, Uppsala University, Sweden

Examinateurs : Diego ARANGO, Directeur de Recherche,Vall d’Hebron Hospital Research Institute, Barcelona, Spain Olivier FERON, Professeur des universités, FATH, Université Catholique de Louvain, Belgium Pierre SONVEAUX, Professeur des universités, FATH, Université Catholique de Louvain, Belgium

Directeurs de Thèse : Frédéric PECORARI, Chargé de Recherche, Inserm U1232, Université de Nantes, France Véronique PREAT, Professeur des universités, LDRI, Université Catholique de Louvain, Belgium

A novel generation of Affitins for targeting cancer cells with drug-loaded lipid nanocapsules

Valentina V. Kalichuk

Supervisors: Dr Frédéric Pecorari and Prof Véronique Préat

With the support of:

Папе. (To my father.)

Table of contents

Acknowledgements 3

Foreword 5

Abbreviations 7

Chapter I: Introduction 11

1. Cancer and the selectivity challenge in medicine 15

2. Molecular targeting in cancer 19

3. 7 kDa DNA-binding proteins as alternative scaffolds 45 4. The Epithelial cell adhesion molecule as a target in cancer

therapy 59

5. Nanoparticles in cancer therapy 69

Chapter II: Aims of the thesis 107 Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family 113 Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM 151 Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells 187

Chapter VI: Conclusion and perspectives 229

Scientific communications 241

Curriculum vitae 243

Acknowledgements

The accomplishment of this thesis would not have been possible without the support of my family, friends and my professional and personal mentors.

Foremost, I want to express my sincere gratitude to my supervisors Dr. Frédéric Pecorari and Prof. Véronique Préat for believing in my skills and giving me the opportunity to work under their guidance. They have been not only open to share their knowledge and discuss ideas, but also always supportive and patient with me.

I would like to thank the members of my thesis committee Prof. Olivier Feron and Dr. Patrick Chames for the insightful discussions and encouragement. I am also grateful to the members of my jury Prof. Vladimir Tolmachev, Prof. Nick Devoogdt, Prof. Pierre Sonveaux and Prof. Diego Arango for agreeing to evaluate this work.

During the last years I had the opportunity to work with colleagues from three different labs. First I want to thank my group in France: Stanimir, Petar, Benjamin, Axelle, Barbara, Georgi and Dessi for their friendship and support. I am especially grateful to Ghislaine, who was always there to help and to share her enormous experience and chocolate mousse. Furthermore I thank the other members of Team 13 that have supported me – Michel, Maxime, Sébastien, Stefanie, and others. I would also like to thank all the people who made my stay in Nantes a nice experience: Swapnil, Neha, Johann, Magali, Edouard, Benoit, Iyanar, Marine, Simon, 2T, Nadege, Kevin B., Kasia, Maxime J., Rémi, Celine, Kubat etc. Special thanks go also to the Teze family – Françoise, Hubert, Florence, Marie, Jeremie and Sam. I will always be especially grateful to David, who supported me through each step of my life and work during the last years.

Moving to Brussels, I was lucky to work with people like Bernard, Kevin, Nathalie and Murielle, who are always there to help with a smile, no matter how busy they are. I want to express my gratitude to Fabienne for her supervision, support and trust. I thank Chiara, Dario, Alessandra, Nikos and Thibaut not only for their help in the lab, but also for their support as friends. Same goes for Janske, Hanane, Carmen, Cécile, Audrey, Neha, Ana, Natalija, Sohaib, Mengnan and all the others, with whom we shared so many beautiful (and delicious!) moments together. I am grateful to Yoann, who did not let me give up even for a second and always had my back.

I want express my sincere gratitude towards John-Ivan, who was, and still is, my guardian angel. He and Gergana became like a family to me.

I would also use the opportunity to thank Prof. Andreas Plückthun, who accepted me for an internship in his lab. He has motivated me with his expertise and never-ending pool of ideas. I want to thank Sheena, Hännschen, Jonas, Brandy, Wolfgang, Dominik, David V. and the others who showed me how working hard and having fun should always go hand in hand.

Special thanks to Kevin and Caramel-the-cat for chasing away the demons while I was writing and for always finding a way to put the smile back on my face.

No words can express my gratitude towards my family and friends back home and around the world. Their constant support, unconditional love and care help me every day to do my best. Every progress and every small success in my life belongs to them.

Foreword

A progressive strategy against cancer is the targeting of tumour- associated antigens by specific ligands coupled to nanoparticles, carrying therapeutic or imaging agents. Antibodies are the most widely used targeting molecules, but they possess limitations as high production costs, complex structure and limited stability. Affitins are highly stable engineered affinity proteins, derived originally from Sac7d, an archaeal polypeptide from the 7 kDa DNA-binding family (also known as Sul7d family). These binders show comparable affinity and specificity to those of antibodies, while being thermally and chemically more stable, cheaper to produce, easier to engineer and present a simpler structure and 20-fold smaller size. Lipid nanocapsules (LNCs), prepared by solvent free process, possess great stability and high efficiency for lipophilic drugs encapsulation and protect the drug from rapid degradation. Targeting LNC to cancer cells can further decrease drug concentration in normal tissues and lower the toxicity. The aim of the thesis is to combine the advantages of Affitins as targeting agents and LNCs as carriers in order to create vehicles for delivering payloads to cancer cells. The first goal of this work is to characterize more extensively the Sul7d family and to identify a potential candidate for the generation of Affitins with improved properties. The second goal is to validate the chosen affinity scaffold by creating binders against EpCAM and to characterize them. The last goal is to attach the new binders as affinity moieties to LNCs and to assess the tumour targeting of these complexes in vitro.

Abbreviations

Ab Antibody ABD Albumin binding domain ADC Antibody-drug-conjugates ADCC Antibody-dependant cellular toxicity Ag Antigen AR Ankyrin repeat BSA Bovine serum albumin CD Circular dichroism CDC Complement-dependant cytotoxicity cDNA Complementary DNA CDR Complementarity-determining region CEA Canceroembryogenic antigen

CH Constant domain of a heavy chain of an antibody

CL Constant domain of a heavy chain of an antibody CTC Circulating tumour cells CSC Cancer stem cells ct-DNA Calf thymus DNA DARPins Designed Ankyrin Repeat Proteins DiD 1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine perchlorate DNA Deoxyribonucleic acid DOX Doxorubicin

Abbreviations

DSC Differential scanning calorimetry

DSPE-PEG 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol) EDTA Ethylene-diamine-tetraacetic acid EGFR Epidermal growth factor receptor ELISA Enzyme-linked immunosorbent assay EMA European Medicines Agency EMSA Electrophoretic mobility shift assay EMT Epithelial-to-mesenchymal transition EpCAM Epithelial cell adhesion molecule EpEX Extracellular domain of EpCAM EpICD Intracellular domain of EpCAM EPR Enhanced permeability and retention Fab/Fv Variable, antigen-binding fragment of an antibody FACS Fluorescence-activated cell sorting FDA Food and Drug Administration GFP Gren fluorescent protein HCAb Heavy-chain antibodies HER2 Human epidermal growth factor receptor 2 His6 Hexahistidine tag hrEpCAM human recombinant EpCAM HRP Horseradish peroxidase HSA Human serum albumin HWEL Hen white egg lysozyme IgG Immunoglobulin G IMAC Immobilized-metal ion affinity chromatography

Abbreviations

IPTG Isopropyl β-D-1-thiogalactopyranoside

KD Dissociation konstant kDa Kilodalton LC-ESI-HRMS Liquid chromatography-electrospray ionization-high resolution mass spectrometry LNC Lipid nanocalsules mAbs Monoclonal antibodies MNPs Magnetic nanoparticles MRI Magnetic resonance imaging mRNA Messenger ribonucleic acid MSA Mouse serum albumin MSNs Mesoporous silica nanoparticles Nb Nanobody NK Natural killer (cells) NP Nanoparticle PAGE Polyacrylamide gel electrophoresis PBS Phosphate-buffered saline PCR Polymerase chain reaction PDB Protein data bank PEG Polyethylene glycol PET Positron emission tomography PhoA Alkaline phosphatase PLGA Poly (lactic-co-glycolic acid) RES Reticuloendothelial system RIT Radioimmunotherapy RNA Ribonucleic acid

Abbreviations

SA Streptavidin scFv Single chain variable fragment sdAb Single-domain antibody SDS Sodium dodecyl sulfate SLN Solid lipid nanoparticles SPECT Single photon emission computed tomography TAE Tris/Acetate/EDTA buffer TBE Tris/Borate/EDTA buffer TBS Tris-buffered saline TCPE Tris(2-carboxyethyl)phosphine TEMED N,N,N’,N’- tetramethylethylenediamine TfR Transferrin receptor TNFα Tumour necrosis factor alpha VEGF Vascular endothelial growth factor receptor

VH Variable domain of a heavy chain of an antibody

VHH Variable domain of HCAb

VL Variable domain of a heavy chain of an antibody WB Washing buffer WBT Washing buffer-Tween-20 WHO World health organization

Chapter I:

Introduction

Chapter I: Introduction

Chapter I: Table of Contents

1. Cancer and the selectivity challenge in medicine ...... 15 1.1. The magic bullet ...... 15 1.2. The hallmarks of cancer ...... 15 2. Molecular targeting in cancer ...... 19 2.1. Antibodies ...... 19 2.2. Antibody fragments ...... 26 2.3. Nanobodies...... 27 2.4. Alternative scaffolds ...... 30 2.5. Examples for existing alternative scaffolds...... 39 3. 7 kDa DNA-binding proteins as alternative scaffolds ...... 45 3.1. Affitins – origin and structure ...... 45 3.2. Generation of DNA libraries and binder selection...... 46 3.3. Applications of Affitins ...... 47 3.4. Strategies for improving Affitins ...... 55 4. The Epithelial cell adhesion molecule as a target in cancer therapy ...... 59 4.1. EpCAM biology ...... 59 4.2. EpCAM expression ...... 62 4.3. Biology and oncogenic potential of EpCAM ...... 63 4.4. EpCAM and cancer therapy ...... 65 5. Nanoparticles in cancer therapy ...... 69 5.1. Nanotechnology – definition ...... 69 5.2. Nanoparticles – classification ...... 71 5.3. Surface modifications ...... 74 5.4. Tumour targeting ...... 75 5.4. Lipid nanocapsules ...... 83 6. References ...... 91

Chapter I: Introduction

Introduction

1. Cancer and the selectivity challenge in medicine

1.1. The magic bullet The discovery of antibiotics revolutionized medicine - they saved millions of lives and contributed enormously to the control of infectious diseases1. Although the beginning of the ‘’antibiotic era’’ is commonly associated with Fleming and the allegedly accidental discovery of penicillin in 19282, the story started even earlier with Paul Ehrlich. Ehrlich was popularizing a new concept of a “magic bullet’’ (Zauberkugel) – a drug that specifically targets disease-causing microbes, without harming the host3. His first magic bullet was arsphenamine (Salvarsan) – the first synthetic agent against syphilis, introduced in 1909-19104. Ehrlich was convinced that the concept of the magic bullet may be applied to different kinds of pathologies, including cancer – one of the biggest challenges for modern medicine5,6.

1.2. The hallmarks of cancer Cancer is the second cause of human mortality with 14 million new cases and 8.2 million deaths registered in 20127. According to the World Health Organization (WHO) the number of new cases will increase during the next two decades by 70%. In 2015 it was responsible for 8.8 million deaths – about 1 in 6 deaths8. Lung, prostate, colorectal, stomach and liver cancers are the most common types of cancer in men, whereas breast, colorectal, lung, cervix and stomach cancers are the most common among

Chapter I: Introduction

women9,10. Such pathologies are characterized by the rapid proliferation of abnormal cells that can spread to other organs.

Cancer presents a different challenge compared to infections, which the discovery of antibiotics defeated, at least for a while. Indeed, because of the many uncommon processes between prokaryotic and eukaryotic cells, the discrimination of pathogenic bacteria is quite straightforward. Thus, antibiotics can selectively kill these pathogens, without harming the host. However, when speaking about cancer, the cells causing the pathology originate from the same organism, which makes them harder to recognize and selectively kill. The morphologically changed tissues of solid tumours can be surgically removed, but unfortunately surgically treated patients often suffer from relapses - in 50% of the cases for patients with colorectal cancer11. Thus, the better understanding of the biological mechanisms associated with cancer is of great importance for an effective therapy against it.

The transformation of a normal cell into a cancer one is a complex process, based on the accumulation of genetic modifications, which lead to the activation of proto-oncogenes and/or inactivation of tumour-suppressor genes12,13. One of the principal consequences is the activation of signal pathways involved in cell proliferation, inhibition of apoptosis and differentiation, angiogenesis and metastasis. Cancer cells also communicate and influence the surrounding stromal and endothelial cells and hence create a specific tumour microenvironment that differs from normal tissues

Chapter I: Introduction

in terms of oxygenation, pH, metabolic states and vascular abnormalities14; Fig. 1.

Figure 1. The tumour microenvironment (from14). Upper: A set of distinct cell types are known to contribute to the biology of most solid tumours. Lower: Both the parenchyma and stroma of tumours contain distinct cell types and subtypes that collectively enable tumour growth and progression. Furthermore, primary, invasive, and metastatic tumours have distinct microenvironments.

Tumour blood vessels are generally characterized by abnormalities such as high proportion of proliferating endothelial cells, pericyte deficiency and aberrant basement membrane formation, leading to an enhanced vascular permeability15,16.

Hanahan and Weinberg suggested that most and perhaps all cancer cells have acquired essential alterations in cell physiology that collectively dictate malignant growth. They are described as ‘’hallmarks of cancer’’: genome instability and mutations, formation of new blood vessels, invasion

Chapter I: Introduction

of the adjacent tissues and metastasis, tumour promoting inflammation, avoidance of the immune system and deregulation of cellular energetics. Furthermore, cancer cells are able to evade growth suppressors, sustain proliferative signalling, whereas avoiding cell death and enabling replicative immortality (Fig.2).

Figure 2. The hallmarks of cancer (modified from14). Initially it was suggested that the vast catalogue of cancer cell genotypes is a manifestation of six essential alterations in cell physiology that collectively dictate malignant growth: self- sufficiency in growth signals, insensitivity to growth-inhibitory signals, evasion of programmed cell death, limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis9. Later, two more hallmarks emerged: the capability to modify cellular metabolism and the evasion of immunological destruction. Two additional characteristics play key roles: genomic instability in cancer cells and tumour-promoting inflammation.

Chapter I: Introduction

The molecular changes, both on nucleic and protein level, have been exploited for cancer diagnostic and treatment17. The currently clinically applied chemo- and radiotherapies for cancer patients are based on the changes in the behaviour of malignant cells, such as their rapid proliferation. Indeed, rapidly proliferating cells are more prone to the aforementioned treatments. However, they lack selectivity and are harmful for normal tissues as well as for cancerous ones. As an example, 5-Fluorouracil is a thymine analogue that blocks the production of DNA and is one of the drugs commonly used in the treatment of colorectal, oesophageal, gastric, breast and other cancers18. As it hampers one of the most important processes of the living cells, it also produces toxic effects on gastrointestinal, haematological, neural, cardiac, and dermatological tissues19.

Today’s challenge to find a way to create drug delivery systems that are selective against specific cells of one organism has been addressed by different targeted therapies of cancer.

2. Molecular targeting in cancer

2.1. Antibodies

2.1.1. Biology of Abs Historically, antibodies (Abs) or immunoglobulins (Ig) are the first affinity molecules used to target cancer-associated antigens20,21. Such antigens must be abundant on cancer cell and with limited or no expression in normal tissues22. Abs are proteins with molecular weight around 150 kDa, used by the immune system to recognize and neutralize pathogens. They consist of four polypeptidic chains – two identical heavy ones (H) and two

Chapter I: Introduction

identical light (L) ones, connected via disulfide bridges. Immunoglobulins G (IgGs) named after the type of their heavy chain, are the Abs used in cancer therapy. Each heavy chain is composed of three constant (CH1 to 3) and one variable (VH) domains and each light chain of one constant and one variable,

CL and VL, respectively (Fig.3).

Functionally Abs are divided in two antigen-binding fragments (Fab), formed by VH,

VL, CL and CH1 and one crystallisable fragment, that consists of 2x(CH2+CH3). The variable domains of Fab, also named Fv, have the ability to recognize and specifically bind various target molecules, or Figure 3. Schematic representation of IgG antigens (Ag). The large (from23). naturally existing amino acid sequence diversity of Fv (a human can produce more than 1012 different antibody molecules) leads to the ability of Abs to recognize many different targets24. The antigen binding sites are formed by the hyper-variable complementarity-determining regions (CDRs) of Fv. The function of constant Fc region is the activation of the immune system, as it is recognized by the receptor FcR on the surface of various immune cells (dendritic, natural killers, macrophages etc.) or by parts of the complement24.

Chapter I: Introduction

2.1.2. Antibody therapy of cancer

Antibody-based therapy has become one of the most successful strategies for treating cancer patients22,25. There are different mechanisms of action, used to fight malignancies with monoclonal Abs (mAbs): direct, immune mediated, or via the tumour microenvironment (Fig. 4).

2.1.2.1. Direct action of the mAbs

The antibody itself can bind to a specific receptor like the Epidermal growth factor receptor (EGFR) in order to block the signal cascade (Cetuximab26). Other antibodies can induce apoptosis, target the tumour microenvironment and block the vascular endothelial growth factor (VEGF) for preventing angiogenesis (Bevacizumab27). Furthermore, mAbs can activate components of the immune system to fight cancer cells. This can be achieved via complement-dependant cytotoxicity (CDC), antibody- dependant cellular toxicity (ADCC) and regulation of T cells (Rituximab28).

2.1.2.2. Conjugated antibodies

Besides being directly used alone, mAbs can serve as agents to deliver therapeutic agents - drugs, cytokines, toxins, radionuclides and, more recently, drug-loaded nanoparticles25. These strategies aim at increasing specificity of the therapeutics and minimizing their side effects. When antibodies are chemically conjugated via linkers or fused to cytotoxic drugs, one speaks about antibody-drug-conjugates (ADCs). One should consider different aspects here - the target on the cell must be internalized

Chapter I: Introduction

upon binding of the ADC for maximum effect and the drug must be suitable for modification in order to be coupled with the linker.

Figure 4. Different strategies for killing tumour cells with mAbs, alone or conjugated (modified from21). a) Direct tumour cell killing can be elicited by activating receptors, leading to apoptosis (represented by the mitochondrion). It can also be mediated by receptor antagonist activity, such as an antibody binding to a cell surface receptor and blocking dimerization, kinase activation and downstream signalling, leading to reduced proliferation and apoptosis. Conjugated antibodies can be used to deliver a payload (such as a drug, toxin, radioisotope or nanoparticle) to a tumour cell. b) Immune-mediated tumour cell killing can be carried out by the induction of phagocytosis; complement activation; antibody- dependent cellular cytotoxicity (ADCC); T cells being activated by antibody-mediated cross- presentation of antigen to dendritic cells. (Abbreviations: MHC - major histocompatibility complex; NK - natural killer) c) Vascular and stromal cell ablation can be induced by receptor antagonism; stromal cell inhibition; delivery of a toxin.

Chapter I: Introduction

Moreover, it should stay attached and stable until the target cells are reached29. Such ADC have been successfully created and approved byFDA for clinical use (see Table 1 for details). Currently, numerous more are in preclinical and clinical trials.

Table 1. Monoclonal antibodies in therapy: naked or conjugated (from22).

Chapter I: Introduction

2.1.2.3. Radioimmunotherapy and imaging

The same principle has been applied for conjugating mAbs with radionuclides for radioimmunotherapy (RIT) or for imaging, used for cancer diagnostics30. The efficacy of such radiopharmaceuticals or radiotracers is determined both by the carrier and the radionuclide. When treating malignancies, the therapeutic effect is due to the tumoural absorption of the energy emitted by alpha (α) or beta (β) particles (Table 2). Beta-emitters are the most widely used radionuclides in radiotherapy and they present a long path length and emit lower energy compared to the alpha ones. When passing through cells, they generate free radicals that induce DNA damage. Two products, based on beta-emitters carried by mAbs targeting the CD20 antigen are available in clinical practice for the treatment of Non-Hodgkin B- Lymphoma: the intact murine immunoglobulins iodine 131–tositumomab (Bexxar), and yttrium 90– ibritumomab tiuxetan (Zevalin, Table 1).

Recently, alpha-emitters gain more attention as agents for improved RIT31. They have limited tissue-penetration, but they emit higher energy, leading to more damaging double-strand DNA breaks. In nuclear imaging, radiolabelled carriers can be applied as non-invasive diagnostics tools for single photon emission computed tomography (SPECT) and positron emission tomography (PET)32 . An ideal radiotracer for molecular imaging should have short half-life and should be able to rapidly provide a good tumour-to-normal tissue contrast.

Chapter I: Introduction

In this context, it is Table 2. Some radionuclides used for tumour imaging and therapy (modified from32). important that the vectors not only stay attached to the site of interest, but as well clear fast from the organism – something that can be achieved with molecules with short half-lives. In both cases (imaging and therapy), the physical half-life of the radioisotope should correspond well to the biological half-life of the carrier.

The cytotoxic potency of antibody–drug conjugates can be further improved by increasing the number of drug molecules that can be delivered per targeting moiety and protecting them from degradation.

2.1.3. Limitations of mAbs

Although mAbs are the most widespread affinity proteins, they possess several characteristics that limit their use. Their complex structure (multi-domain proteins with disulfide bonds and glycosylation) requires the use of eukaryotic expression systems and, thus, their manufacturing process

Chapter I: Introduction

is costly and difficult. Their large size can limit their ability to penetrate tissues and/or bind epitopes that are not easily accessible33. Their size and the interaction with the neonatal Fc-receptor lead to long half-lives, which are not desired for imaging reagents that need to be cleared fast from the bloodstream to provide good image contrast34. Furthermore, because of their instability and formulation, one must pay attention to storage conditions. Advances in protein engineering have led to different strategies for overcoming the described above drawbacks of full-sized antibodies, such as the development of smaller-sized antibody fragments.

2.2. Antibody fragments

Smaller antibody fragments were initially generated by proteolytic digestion of full-length antibodies, resulting in Fab (55 kDa) or Fab2 (110 kDa) fragments with retained antigen binding activity, but altered pharmacokinetics35. Later were engineered single chain antibodies (scFv, 28 kDa) where the variable domains VL and VH are connected via linker and could be directly produced in E.coli. Fab and scFv are monovalent binders; however, they can be engineered in multivalent formats, like the bivalent fragments diabody and minibody, in order to gain avidity or to obtain desired half-lives. Another strategy is to design fragment formats with different

36 specificities - bispecific Fab2 or trispecific Fab3, Fig.5 .

Single domain antibodies, consisting only of VL or VH (15 kDa) have also been constructed, although at first they presented problems because of poor solubility and aggregation due to exposure of a large hydrophobic area, normally hidden in the complex Ab structure36.However, these issues have

Chapter I: Introduction

been addressed by introducing specific mutations that reduce the hydrophobic interface. Antibody fragments have been linked to different payloads (such as radionuclides, toxins, liposomes and others) and have demonstrated their usefulness as therapeutic and imaging tools. They provide good contrast in in vivo imaging of tumours, because of better tumour uptake and faster blood clearance35. Several antibody fragments are approved by FDA or currently undergo clinical trials.

Figure 5. Schematic representation of different antibody formats, showing an intact IgG molecules alongside a variety of antibody fragments, including Fab, scFv, single- domain VH, and multimeric formats, such as minibodies, bis-scFv, diabodies, triabodies, tetrabodies and chemically conjugated Fab´ multimers (Mw given in kilodaltons are approximate, modified from36).

2.3. Nanobodies

Apart from conventional antibodies, composed of two heavy and two light chains, camelids (camels, llamas, dromedary, etc) possess fully functional antibodies that consist only of two heavy chains, thus named heavy-chain antibodies (HCAbs), Fig.6. Each chain has three domains – two constant and a single variable domain VHH for antigen binding. VHH contains

Chapter I: Introduction

three CDRs and a few amino-acid changes in order to accommodate the absence of the light chain37. Interestingly, immunoglobulins lacking L chains and devoid of a conventional CH1 also occur in cartilaginous fish (wobbegong and nurse sharks), named IgNAR.

Figure 6. Conventional antibody, camelid heavy-chain antibody and Nanobody. (a) Conventional antibody consisting of heavy chains with three constant domains (CH, dark green) and a variable domain (VH, pink), as well as light chains with one constant and one variable domain (CL and VL, light green. (b) Camelid heavy-chain antibody with only two constant and one variable (VHH) domain. (c) VHH fragment or Nanobody (from41).

The recombinant antigen-specific VHH domain of HCAbs is also known as Nanobody (Nb) or single-domain antibody (sdAb). Nbs recognizing different targets can be obtained after immunization of a camelid, followed by PCR amplification of the VHH gene fragments from peripheral blood lymphocytes and selection by phage display (explained with more details in the following section). In cases where vaccination is not applicable (for example toxic or non-immunogenic targets), immune VHH libraries can be substituted by larger (109 members) naïve or synthetic libraries38,39. Besides phage display, other strategies for enrichment and selection of antigen- specific binders include surface bacterial and yeast display, bacterial two- hybrid selection and ribosome display40. The acquired Nbs can be produced in bacteria and yeast in large quantities and with good solubility. For the

Chapter I: Introduction

proper formation of disulfide bonds, it is preferable that expression in bacterial cells is located in the oxidizing periplasmic environment41.

These small affinity molecules (15 kDa) have been demonstrated to

42 resist chemical and thermal denaturation till 60-80°C . VHH can be multimerized by genetic fusion of two or more identical or different Nanobodies, thus increasing the avidity or generating multispecificity43.

Nanobodies have been selected against a broad variety of targets and have been successfully used in numerous applications. In research, they have been used to study protein-protein and DNA-protein interactions, to trace bacterial infections or antigens in different cellular compartments and as capturing agents40. Nbs serve well as chaperons to crystallize dynamic proteins44. They stabilize intrinsically flexible regions or shield aggregating surfaces from contact with solvents. Thus, they have helped for solving structures and better understanding the mechanisms of action of challenging targets, such as G protein-coupled receptors45.

With their small size of 15 kDa, monomeric Nbs and even their di- or trimeric constructs are rapidly removed from the body through filtration by the renal system, which has a clearance cut-off of 50 kDa. Such fast clearance makes possible the use of short-lived nuclides (68Ga, 18F) that allow more optimal imaging for patients within short period of time post-injection and with lower radiation burden41. Indeed, radiolabelled Nbs targeting EGFR, the canceroembryogenic antigen (CEA), or human epidermal growth factor receptor 2 (HER2) demonstrated rapid and specific tumour uptake in mouse models and provided specific contrast as early as one hour post-injection.

Chapter I: Introduction

Numerous Nanobodies are being developed for the treatment of a wide range of diseases, including inflammation, haematology, respiratory disease and cancer, among which eight are in clinical trial46. A summary of the three most clinically advanced Nanobodies is presented in Table 3. The release of the first potential product Caplacizumab is expected in 2018.

Table 3. Examples of Nanobodies in clinical trials. Abbreviations: MMA - Marketing Authorisation Application; H1 - first half; Q4 - last quarter. From47.

2.4. Alternative scaffolds

The immune system is not the only source of specific reconditioning molecules. Specific binding exists in many other naturally binding proteins that provide starting points for the design of novel affinity molecules. These alternative scaffold proteins should combine the molecular recognition properties of antibodies with improved characteristics like size, stability and easy and cheap production48. The scaffold should be preferably small and composed of a single chain polypeptide49. The lack of cysteine residues makes such molecules suitable for intracellular applications and provides the

Chapter I: Introduction

opportunity for introduction of a unique cysteine residue, for example for site-specific labelling or immobilization on a solid surface. Suitable candidates should possess intrinsic stability and tolerate changes such as amino acid substitutions and multimerization50. More than 50 non- immunoglobulin (non-Ig) binding proteins have been described as alternatives of mAbs. The most advanced among them are represented in Table 4. A non-exhaustive list of 102 target proteins that have been targeted by 139 different binding proteins from 20 different types of non-Ig scaffolds is provided in the supplementary data of the review of Sklerk et al.51. Alternative scaffolds in the context of cancer treatment mainly interfere with signalling pathways and are directed against targets overexpressed at the cancer cell surface, such as tyrosine kinases51 (Fig. 7). Induction of apoptosis is another strategy against cancer cells. This is archived, for example, with scaffolds that activate TRAIL (TNF-related apoptosis-inducing ligand) receptors – death receptors that trigger the caspase cascade (Fig. 7).

Chapter I: Introduction

Figure 7. Examples of non-Ig scaffolds for cancer treatment. Non-Ig scaffolds for the treatment of cancer prevent tyrosine kinase (TK) signaling or trigger apoptosis in cancer cells. TKs (yellow) relay the extracellular signal to the cell interior, eventually triggering proliferation, survival, or metastasis of the cancer cell. Apoptosis of cancer cells can be triggered by activation of TRAIL receptors which activate the caspase cascade. Non-Ig scaffolds against extracellular targets (black) are used for treatment or diagnostics. They inactivate TKs or their ligands, or activate TNF-related apoptosis-inducing ligands (TRAIL)-R1/DR4 and TRAIL-R2/DR5. Non-Ig scaffolds against intracellular targets [caspase-3, caspase-8, MAP kinase (MAPK), Raf; shown in blue] were developed primarily for research purposes. Abbreviation: EI-tandem, EGFR– IGFR tandem Adnectin51.

Chapter I: Introduction

Table 4.Overview of some non-IgG scaffolds and their basic characteristics51–53.

Scaffold name Parent Origin of Residues / Structure Randomization Selection Company (commercial protein the parent S-S method name) protein bridges ABD Albumin- Bacterial 46/0 Thee α- 15 surface Phage display, binding helices residues ribosome domain display Adhiron Phytocysta Plant ~ 100/0 Fours-trand Insertion of two Phage display tin protein antiparallel variable peptide β-sheet core regions with a central helix Monobody 10th Human 94/0 β-sandwich Residues in BC, Phage display, Adnexus (Adnectin) domain of of seven β- DE, and FG loops mRNA display, Therapeut human sheets (loop library) or yeast display, ics fibronecti in in C and D β- yeast-two- n sheets, DE and hybrid FG loops (side and loop library) Affibody Z-domain Bacterial 58/0 Three 13 residues in Phage display, Affibody of αhelices two helices ribosome AB staphyloco display ccal protein A Affilin γ-B- Human 176/0 β-sheet Eight residues Phage display SCIL crystallin Proteins Affilin Ubiquitin Human 76/0 α/β Six residues in Ribosome SCIL the β-sheet display Proteins

Affimer Protease Human 98/0 Threefold 12–36 residues Phage display, Avacta Life inhibitor clustering yeast-two- Sciences Stefin A hybrid, CIS display Affitin DNA- Archaea 66(64)/0 Five- 10-14 residues Ribosome Affilogic (Nanofitin) binding stranded located in the β- display protein incomplete sheet (surface Sac7d β-barrel and library); (Sso7d) α-helix additional elongated loop (surface and loop library) Alphabody Triple Artificial 70–100/0 Three α- 11 residues (A Phage display Complix antiparalle (de novo helices and C helix) l helices design) Anticalin Lipocalins Human/ 160– Eight- Four loops (up to Phage display Pieris AG insect 180/0–2 stranded β- 24 AA) S–S barrel Armadillo Armadillo Various/ n × ∼40/0 Three α- Six residues in Ribosome repeat (homologo artificial helices each internal proteins us to β- (consensu repeat catenin) s design)

Chapter I: Introduction

Table 4. Continued.

Scaffold name Parent Origin of Residues / Structure Randomization Selection Company (commercial protein the parent S-S method name) protein bridges Atrimer / C-type Human n × 40/3 Five flexible 11 residues Phage display Anaphore Tetranectin lectin S–S loops domain CTLD3 Avimer / Multimeri Human/ar n × ∼43/3 Four loops 28 residues Phage display Amgen Maxibody zed LDLRA tificial S–S + Ca2+ module (consensu s design) Centryn Fn3 Human 89/0 β-Sheet 13 residues CIS display, domains phage display of hTenascin C (Tencon) DARPin Ankyrin Human/ar 67 + n × α2/β2 7-8 residues in Ribosome Molecular repeat tificial 33/0 repeated each n-repeat; display, phage Partners proteins (consensu additional 13 display, yeast s design) residues in display elongated loop (LoopDARPin library)

Fynomer SH3 Human 63/0 β-Sandwich Six residues in Phage display, Covagen domain of two loops (RT- DNA display the and n-Src-loop) human Fyn tyrosine kinase Kunitz domain BPTI/LACI Human 58/3 S–S α-helices, β- 1–2 loops Phage display DYAX D1/ITID2/ sheets APPI L35Ae 10x 50S Archaea 78/0 Six-stranded 20-24 residues in Phage display ribosomal β-barrel, 3 loop reions; RNA- CDR-like additional binding loops, α- elongated loop protein helix OB-fold OB-fold of Archaea 111/0 Five- 17 residues Phage display (Obody) the stranded β- aspartyl barrel tRNA synthetase

Chapter I: Introduction

Table 4. Continued.

Scaffold name Parent Origin of Residues / Structure Randomization Selection Company (Commercial protein the parent S-S method name) protein bridges Pronectin 14th Human 90–95/0 Two β- Three loops (BC, Phage display Protelica extracellul sheets and DE, FG loops) ar domain three of human surface fibronecti exposed n III loops rcSso7d DNA- Archaea 62/0 Five- 9 residues in the Yeast display binding stranded β-sheet protein incomplete Sac7d β-barrel and (Sso7d) α-helix

Repebody Leucine- Jawless 170 + n x β-strand Five residues in Phage display rich repeat vertebrate 20-29/0 turn, α-helix each LRR (LRR) s artificial modules (consensu of variable s design) lymphocyt e receptors (VLRs)

2.4.1. Diversity and selection

Different approaches could be applied when engineering proteins. The rational approach relies on existing data and knowledge about protein structure and function, which can be used to predict the result of specific changes in the amino-acid sequence. However, proteins are extremely complex biomolecules and such rational design is often unproductive. In contrast, the combinatorial approach relies on the generation of large libraries with many protein variants, created by the introduction of number of random mutations simultaneously54. Thus, the generated variants have different surface areas, some of them being potentially able to interact with a target of interest. The library is exposed to the target proteins to allow the

Chapter I: Introduction

selection of specific binders. The use of larger libraries increases the chances of finding proper affinity ligands. As the sequencing of polypeptides is inefficient for long sequences, an important part of the affinity selection systems is the link between the genotype and the phenotype that enables amplification of the desired proteins via their nucleotide sequences. The different types of selection systems can be divided in three groups: cell- based display, cell-free display and non-display systems.

2.4.1.1. Cell-dependent display systems

In the cell-dependent display systems, affinity proteins are displayed on the surface of phage particles or cells. The most used in this group is the phage display55. Briefly, libraries of proteins are displayed on the surface of phage particles as fusions to their coat proteins. The library is exposed to the target protein and bound phage-target complexes are captured. The recovered phage particles are then amplified after infection in E.coli and the selection cycle can be repeated. One of the first alternatives of phage display is the yeast surface display56, better suited for the expression of eukaryotic proteins. When bacterial cells are used as a display system, the library can be presented either on the surface of the cells57, or anchored to the periplasmic side of the inner membrane of E.coli, followed by disruption of the outer membrane58. An advantage of using bacterial or yeast display is the application of flow cytometry sorting for screening. However, the library size in the cell-based display systems is limited by the transformation step that allows hardly up to 1010 members for phage and 107-109 for yeast display35.

Chapter I: Introduction

2.4.1.2. Cell-free display systems

Compared to cell-based systems, the cell-free ones offer some advantages. First, they do not require transformation in a host and therefore larger libraries with 1012-1013 members can be used59. Furthermore, they are performed entirely in vitro, without the need to grow cells. Since the amplification between two selection cycles is done by PCR, additional mutation for increasing the diversity can be introduced. The most widely used from the cell-free methods is the ribosome display, first described in 199460 for peptides and then explored for selection of single-chain Fv fragments in 199761. In general, in vitro transcription of the combinatorial DNA library (1012 members) yields mRNA, used for in vitro translation. The ribosome stalls at the end of the mRNA because of the absence of a stop codon and does not release the encoded protein62. To ensure the proper folding and accessibility of the protein, a linker is introduced after the encoded library member. The mRNA-ribosome-protein ternary complexes are used for affinity selection on an immobilized target (Fig. 8). Another option is selection in solution, using for example biotinylated target, followed by capturing on (strepta/neutra)avidin support63. The unbound complexes are then washed away and the mRNA of the associated complexes is recovered, reverse transcribed and amplified by PCR. Further, the selected pools of binders can be used for the next cycle of ribosome display or analysis of single clones after cloning into expression vectors, which are then used for production in E. coli.

Chapter I: Introduction

Figure 8. Schematic representation of a ribosome display selection. A DNA library is obtained in the form of a PCR product. In vitro transcription of the PCR product yields mRNA that is used for in vitro translation. The ribosome stalls at the end of the mRNA and does not release the encoded and properly folded protein because of absence of a stop codon. The ternary mRNA–ribosome–protein complexes are used for affinity selection on an immobilized target. The mRNA of bound complexes is recovered after washing from dissociated ribosomes, reverse transcribed and amplified by PCR. Thereby the selected pools of binders can be used directly for the next cycle of ribosome display or analysis of single clones after cloning into expression vectors, which are then used for Escherichia coli transformation and small-scale in vivo expression63.

Another example of cell-free approaches is mRNA display that relies on a covalent linkage between mRNA and polypeptide molecules via the antibiotic puromycin64. Furthermore, there exist different strategies linking the displayed protein directly to the corresponding DNA molecules: CIS display, DNA display and covalent DNA display54.

Chapter I: Introduction

2.4.1.3. Non-display systems

In addition, there are selection systems that are not based on display of libraries and selection by incubation with the target molecule. These non- display systems rely on protein-target interaction, which leads to reconstitution of a protein activity in vivo. In the protein complementary assay (PCA65), a reporter protein, like an enzyme needed for the host to survive, is split in two parts on two different vectors used to transform E. coli cells. One vector encodes a fusion of the first part of the reported and the target, the other – a fusion of the second part of the reporter with the combinatorial library. Thus, interaction between members of the library and the target restores the enzyme activity and survival of the cells. Similarly, in the yeast two-hybrid system, a desired interaction between a target and its binder leads to transcription of a reporter protein essential for cell growth66. Although these approaches offer a high-throughput screening, there are still some challenges that need to be addressed, like non-specific intracellular interactions and difficulties in affinity discrimination54.

2.5. Examples of existing alternative scaffolds.

2.5.1. DARPins

Among the most widely studied scaffolds are the Designed Ankyrin Repeat Proteins or DARPins – artificially constructed scaffolds that resemble human Ankyrin repeat (AR) domains. Naturally found AR proteins participate in various protein-protein interactions related to transcription, cell cycle regulation and signalling67. They are built of tightly joined repeats of usually 33 amino acids, each forming a β-turn, followed by two antiparallel α-helices

Chapter I: Introduction

and loop (Fig.9). The number of repeats can differ depending on the target molecule; however, the AR domains usually consist of four to six repeats forming a right-handed solenoid with a continuous hydrophobic core and a large solvent-accessible surface68. In 2003 was described the generation of AR-based combinatorial libraries for the creation of DARPins69. DARPins consist of N- and C-terminal capping repeats and several internal repeats, the number of which can vary usually between 2 and 4. As one module is around 3.5 kDa, whole DARPins can vary between 14 to 21kDa70. Binders for different targets are created by randomization of 7 to 8 of the surface residues from each 33 amino acids repeat. More recently was developed a new generation of loop DARPins with inserted loop and additional randomized residues71. Binders against various targets with affinities up to picomolar ranges have been selected from DARPin libraries by ribosome, phage and yeast display72. These affinity proteins show high thermal (resistant to boiling) and chemical (up to 5M guanidinium chloride) stabilities, and can be expressed at high yield in soluble form in the cytoplasm of E.coli (up to 200 mg per litre of shake-flask culture). DARPins have been used for various applications such as enzymatic inhibition, immunohistochemistry, tumour targeting (radiolabelled DARPins and immunotoxins), viral retargeting, and as biosensors and crystallization chaperones (for a review see72). Among the tumour associated molecular targets of DARPins, are EpCAM, EGFR, HER2, VEGF and HGF (hepatocyte growth factor). EpCAM-specific DARPin, fused to a truncated form of Pseudomonas aeruginosa exotoxin A, caused tumour regression in mice73, and DARPins against EGFR of HER2 have been demonstrated to reduce cell

Chapter I: Introduction

viability of tumour cell lines overexpressing the corresponding receptors74,75. Furthermore, a PEGylated (polyethylene glycol) anti-VEGF DARPin MP0112 (Abicipar pegol) was tested in a Phase II clinical trial for the treatment of age related macular degeneration (AMD). MP0112 was well tolerated and led to decrease in retinal thickness, thus representing a promising treatment option76. In October 2016, Molecular Partners presented a completed Phase I study77 in patients with advanced solid tumours with the trispecific MP0250 (inhibiting both VEGF and HGF and binding to human serum albumin to increase plasma half-life). MP0250 was well tolerated and the side effects were consistent with inhibition of the VEGF pathway. Thus, MP0250 has a strong potential to become a valuable treatment option in several solid tumours and hematological malignancies, including multiple myeloma, head & neck cancers and others. Two Phase II trials are planned to further examine MP0250 in the year 201778.

Figure 9. Structure of representative non-immunoglobulin scaffolds and their protein data bank (PDB) codes: Affibodies, obtained from synthetic domain Z based on the B domain of Staphylococcal Protein A; Anticalins, derived from lipocalins; and Designed ankyrin repeat proteins (DARPins). Diversified positions are highlighted in red (modified from79).

Chapter I: Introduction

2.5.2. Affibodies The most investigated among alternative scaffolds, in terms of imaging, are Affibody molecules. They are based on the 58-amino-acid Z- domain derived from the immunoglobulin-binding B-domain of Protein A from Staphylococcus aureus. The B-domain was mutated at certain positions for improving its chemical stability and its resulting variant with high thermal

o 80 stability (Tm = 78 C) was named Z-domain . This small soluble protein is cysteine-free, displays reversible folding and consists of three α-helices forming a bundle structure (Fig. 9). In 1995, Affibody molecule libraries based on the Z-domain were constructed by combinatorial randomization of 13 amino acids from helices 1 and 2, participating in Fc-binding81. Affibody libraries are typically used in phage display selections, although recently other strategies, like ribosome and cell display, have also been applied82,83. Since 1997 have been reported Affibody molecules, selected against a wide range of different targets (Taq-DNA polymerase, insulin, fibrinogen, tumour necrosis factor alpha (TNFα) , human serum albumin, immunoglobulins, HER2, EGFR, VEGFR and others) with affinities down to the picomolar range84–87. The use of Affibodies has been demonstrated in a number of applications such as for bioseparation, detection reagents, inhibition of receptor interactions, structure determinations, purification tags, and for tumour-targeting applications (for reviews see 86,88,89).

The small size of Affibody molecules is associated with fast tumour accumulation and rapid pharmacokinetics, leading to excellent contrast in

90 124 molecular imaging . I-labeled Affibody against HER2 (ZHER2:342) was directly compared to the monoclonal antibody Trastuzumab (Herceptin) for

Chapter I: Introduction

the imaging of HER2-expressing tumours in a murine xenograft model.

ZHER2:342 provided better contrast, as tumour-to-organ ratios were higher due to the fast clearance of the smaller molecules from blood and normal organs91.

The pharmacokinetics of Affibodies can be modulated in order to be suitable for applications like imaging and therapy. This can be achieved for example by fusion with an albumin-binding domain (ABD), as demonstrated

92 with a dimeric Affibody molecule (ZHER2:342)2 . The fusion with ABD enabled a 25-fold reduction of renal uptake and improved the in vivo biodistribution. Tumour growth reduction was achieved in a mouse model with the use of

177 Lu-labelled (ZHER2:342)2 fused to ABD. Biparatopic Affibody molecules, comprising two Affibody domains binding different epitopes on VEGFR, were also engineered as constructs with or without ABD, in order to adjust the pharmacokinetic properties depending on the applications87,93.

EGFR- and HER2-targeting Affibodies have also been conjugated to different nanoparticles and studied for drug delivery94–96, molecular imaging97 and the combination of the two (theranostics). For example, mesoporous organosilica nanoparticles loaded with doxorubicin were

98 conjugated to near-infrared fluorescent dye and ZHER2:342 . These complexes demonstrated inhibition of tumour cell growth in a murine model, whereas the incorporation of the dye allowed for fluorescent imaging.

ABY-002 and ABY-025 Affibodies against HER2 in combination with radioisotopes like 111In and 68Ga have been tested in clinical trials on breast cancer patients99,100. Results indicate that Affibodies are a promising non-

Chapter I: Introduction

invasive tool for detection of metastatic breast cancer and determination of the HER2 status.

2.5.3. Anticalins Another example of a non-antibody scaffold used for the generation of binding molecules is the lipocalin family – a large group of resilient extracellular proteins, abundant in nature, that participate in molecular recognition101. Despite their high sequence diversity, these single chain proteins (150-190 amino acids) possess a conserved structure that consists of a β-barrel formed by antiparallel β-strands and four flexible loops at one of the ends of the barrel that participate in the formation of the natural ligand-binding site102. Up to now three human and one butterfly lipocalin molecules have been used as scaffolds to generate Anticalins with high affinities for different targets. These 20 kDa binders are stable, well expressed in E.coli, and have been obtained after randomization of 16-20 AA103 and following selection by phage, bacterial surface or ribosome display. A PEGylated Anticalin (Angiocal or PRS-050-PEG40) targeting and antagonizing VEGF-A was well tolerated in Phase I clinical studies in patients with advanced solid tumours, and appeared to be devoid immunogenicity104, but the project was not pursued due to commercial reasons. Anticalin PRS-080 is addressing anemia by targeting hepcidin that traps iron and leads to functional iron deficiency and impaired erythropoiesis. The compound has successfully shown a favorable safety profile in healthy volunteers and is expected to complete a multi-dose trial in anemic patients with chronic kidney disease on hemodialysis in the second half of 2017105.

Chapter I: Introduction

3. 7 kDa DNA-binding proteins as alternative scaffolds

An important place among the myriad of protein scaffolds belongs to the archaeal proteins naturally interacting with nucleic acids. Their high robustness, small size and less intricate structure compared to the one of eukaryotic proteins makes them attractive candidates for the development of engineered affinity reagents. In 2007, the group of Frédéric Pecorari described for the first time the successful use of archaeal proteins for the generation of artificial affinity reagents - Affitins106,107.

3.1. Affitins – origin and structure

Affitins (commercially available as Nanofitins) are derived from two archaeal proteins – Sac7d and Sso7d from the hyperthermophilic and acidophilc Sulfolobus acidocaldarius108 and Sulfolobus solfataricus109, respectively. Sac7d (66 amino acids) and Sso7d (64 amino acids) consist of a single polypeptide chain without disulfide bridges and are extremely stable

110,111 thermally (Tm = 90.4°C and 100.2°C, respectively) and chemically - from pH 0 up to at least pH 12112,113. Both Sac7d and Sso7d belong to the ‘7kDa DNA-binding’ or Sul7d family and protect the genomic DNA of their parental organisms from the extreme condition that they live in (high temperature and acidity). The two proteins share 79% sequence identity113 and their crystal structures reveal that they consist of a five-stranded, incomplete β- barrel (with three-stranded β-sheet orthogonal to a β-hairpin) capped at the opening by a C-terminal α-helix114. They bind to the minor groove of a DNA duplex via the triple-stranded β-sheet (Fig. 10).

Chapter I: Introduction

The natural affinity of Sso7d for DNA has led to its use as fusions with various DNA-processing enzymes in order to improve their properties. These enzymes are widely used in molecular biology protocols, and it is noteworthy to mention that one of them is the well-known commercial product “Phusion DNA polymerase” broadly used for polymerase chain reaction (PCR), performed in order to amplify a specific DNA sequence with an improved processivity115.

A B

Figure 10. Schematic representation of Sac7d from Sulfolobus acidocaldarius (PDB code: 1AZP). A) Sac7d (green) in complex with dsDNA (blue). B) The amino acids that interact with DNA and were substituted for the generation of Affitins are depicted in purple. Images were generated using The PyMOL Molecular Graphics System, Schrödinger, LLC.

3.2. Generation of DNA libraries and binder selection The first step for obtaining Affitins for potentially any target is the generation of large DNA libraries. This is achieved in vitro by randomizing 10 to 14 amino acids located in the DNA binding sites of Sac7d or Sso7d, and optionally in an artificially extended loop112. The use of alternative library designs increases the diversity of the obtained binders and their properties. It has been demonstrated that such extended loop in Affitins gains flexibility and has a potential to bind clefts116.

Chapter I: Introduction

The selection of different target-specific Affitins is based on the ribosome display system. With this approach have been isolated and characterized binders specific for the bacterial protein PulD117–119, glycosidases (chicken egg lysozyme and CelD116,120), human IgGs121, and the tumour-associated marker CD138122. Affitins have been reported with production yields up to 200 mg/L of E.coli flask culture, high stabilities (temperature up to 90°C and pH from 0 to 12) and dissociation constants in the nanomolar and subnanomolar ranges (down to 140 pM)117. Binders against numerous targets are currently under development with commercial purposes by Affilogic – a company created in 2010 and based on the Affitin technology123. Affitins have been used with success as tools for in vitro and in vivo inhibitions, immunolocalization protein chip arrays, biosensors, affinity chromatography, magnetic fishing and tumour targeting, as detailed hereafter.

3.3. Applications of Affitins

3.3.1. In vivo inhibitors and immunolocalization

The first Sac7d derivatives were created by random mutagenesis of the 14 amino acids, participating in the DNA binding117. The target for the proof-of-concept study was PulD – a secretin from the part of the pullanase type II secretion system (T2SS) of the Gram-negative Klebsiella oxytoca. For secretion purposes a channel is formed in the outer membrane of the bacterium via multimerisation of C-terminal half of 8 PulD monomers, and thus ribosome display selection was performed against the accessible N- terminal half of PulD (PulD-N). Obtained Affitins were expressed in E.coli

Chapter I: Introduction

with yields up to 200 mg per litre of culture and demonstrated affinities in vitro down to KD =140 pM, combined with high specificity. Despite the fact that 21% of the parental backbone was mutated (14 from 66 amino acids), the binders preserved a high thermal stability. Furthermore, fusions of Affitins with the green fluorescent protein (GFP) and alkaline phosphatase (PhoA) did not hamper target recognition and were used to evaluate binding in vivo.

Two years later, a fusion of anti-PulD Affitin with GFP was used as a reporter for examining the localization of wild-type PulD in Escherichia coli by indirect fluorescent detection 119. The system confirmed the results obtained with chromosome-encoded PulD-mCherry, namely that PulD localizes in clusters in the outer membrane. This suggested that GFP-tagged Affitins can be used as alternatives for fluorescein-labelled antibodies in immunofluorescence-like tests.

3.3.2. In vitro inhibitors As a proof of concept that Affitins may inhibit different glycosidases specifically, binders were selected against the thermophilic CelD from Clostridium thermocellum (inverting endoglycosidase) and the lysozyme from hen egg (HWEL, retaining endoglycosidase)116. From libraries with randomization of a surface or randomization of a surface and an artificially- extended loop were obtained binders with affinities in the nanomolar range with no cross-recognition. They were well expressed in E.coli in soluble form and were able to inhibit the activity of lysozyme (Ki=45 nM) and CelD (Ki=95 and 111 nM), respectively. The crystal structure of the different complexes

Chapter I: Introduction

showed that binder-target interaction was located in the catalytic cleft for both enzymes. Affitins demonstrated two modes of binding: covering the cleft, when derived from the “surface” library, or penetrating the catalytic site via the extended loop when coming from the other library design (Fig. 11). These results indicated that possible application of Affitins as inhibitor of different types of enzymes is worth exploring.

Figure 11. Different modes of interacting between Affitins (cartoons) and target glycosidases (gray). E12 and H3 are binders, derived from libraries with longer and randomized loop 2, and use it to penetrate the catalytic cleft (blue, catalytic residues in red) of CelD. H4 is from a library with randomization of a surface only and covers the cleft of HEW (from116).

3.3.3. Biosensors Biosensors are analytical devices, combing biological components with physicochemical detection of the analytes. Affitins, together with the aforementioned DARPins, have been used for developing and validating an approach to turn artificial scaffolds into fluorescent (RF) biosensors, specific for a particular target124. To do so, chosen randomized residues of each binder (16 positions for Affitin H4S and 12 for DARPin MBP3_16) were changed individually into Cys and then each of the mutants was coupled with the thiol reactive fluorophore, IANBD ester. As the binding of the

Chapter I: Introduction

corresponding antigen caused variations of the fluorescence, the different conjugates were evaluated for their affinity and sensitivity. Thus, randomized position with little or no importance for the antigen binding were identified. This strategy could be applied to different types of fluorophores and affinity molecules, in order to provide detection of a specific antigen in a fast and selective way, without the need of many reagents or manipulations.

3.3.4. Affitins and fusion tags

As previously stated, fusions of Affitins with GFP and PhoA did not preven target recognition and have been used for a better understanding of the way these affinity proteins function117. Other applications have also been reported about Affitins and fusion tags.

Protein microarrays (or protein chips) are widely used for analytical studies that need to follow interaction between different molecules. The immobilization of proteins on solid supports is a key step in this process, as it aims not only for high binding capacity, but as well conservation of the activities of the proteins and their oriented binding. Affitins are generally expressed in E.coli with a hexahistidine tag used for affinity purification. This feature was used to immobilize them on a glass surface covered with a zirconium phosphonate monolayer120. The specific and oriented anchoring was achieved with a bifunctional adaptor, containing a multivalent phosphonic acid anchor at one extremity, allowing a stable attachment to the zirconium surface, and a Ni-nitrilotriacetic acid (Ni-NTA) group at the other end, leading to reversible binding to the His6-tag. Not only was high-

Chapter I: Introduction

density coverage achieved, but the two Affitins (H4 and B3) preserved their ability to capture the target protein (AlexaFluor 647-labeled lysozyme). The obtained microarrays demonstrated high signal-to-noise ratio with limit concentration of detection below 1 nM lysozyme for H4 and 0.1 µM for B3.

Three years later was demonstrated a new approach for not only specific, but also direct immobilization of Affitins on zirconium phosphonate surfaces125. The strategy consisted in designing and fusing a phosphorylable tag (DSDSSSEDE) at the C-terminal end of H4 and B3. In vitro phosphorylation of the four serines residues by kinase II led to the creation of a phosphate assemblage that enabled oriented and irreversible attachment of the proteins to the zirconium surface. The new microarrays were tested for their ability to capture AlexaFluor 647-labeled lysozyme and demonstrated high signal-to-noise ratio and detection sensitivity below 50 pM of the target. Moreover, these zirconium-based microarrays showed superior efficiency compared to other commercial substrates (nitrocellulose-based or epoxide) that bound H4 in an un-oriented way.

In 2015, the strategy of using such a tag was further developed into a new system for phosphorylation of proteins in E.coli126. In this study, the anti-lysozyme Affitin H4 fused with the phosphorylable tag was co- expressed with the alpha subunit of casein kinase II (CKIIα). The amount of expressed CKIIα was controlled by an arabinose promoter, leading to optimal levels of phosphorylation. The resulting phosphorylated tag was used as well for efficient purification of the Affitin by IMAC, using Fe(III) instead of the Ni(II) usually used for His6-tagged proteins. This demonstrated

Chapter I: Introduction

that the described system could be applied both for protein purification and the following analysis.

3.3.5. Affitins as fusion tags

As mentioned above, Sso7d fusions have been used for improving DNA processing enzymes. Additionally, in 2015, a work was published concerning the use of Sac7d-based targeting ligands as fusion tags127. Ribosome display selection was used for the generation of a binder, called a GFP-ready fusion tag that displays nanomolar affinity towards the green fluorescent protein GFP and its blue, cyan and yellow variants. This tag was then genetically fused to the recombinant human TNFα, chosen as a model protein. It was demonstrated that both partners of the fusion remained active, which allowed simultaneous binding to anti-TNFα Ab and GFP variants.

3.3.6. Affinity chromatography

Even though the addition of tags for protein purification is widely used, sometimes this approach is not applicable. The use of ligands specific for the proteins has proven to be a successful strategy in such situations. Indeed, Protein A from Staphylococcus aureus naturally binds to human immunoglobulins (IgG) and thus Protein A columns are used for capturing IgG in affinity chromatography128. However, naturally occurring ligands, suitable to be used as affinity purification reagents, could not always be found. Then comes into play the tailoring of artificial affinity ligands. Such molecules should not only be highly specific for the target protein, but should also be resistant to harsh conditions in order to withstand several

Chapter I: Introduction

regeneration procedures of the column. As Affitins possess these desirable properties and could moreover be produced in E.coli with high yields, leading to a cost-effective production, their potential as ligands in affinity columns was explored129. Sso7d and Sac7d-based Affitins, binding different targets (human IgGs121 bacterial PulD protein and hen egg white lysozyme), were covalently immobilized on agarose columns. All of the obtained columns were specific for their respective target and high degrees of protein purity and recovery were obtained even in the presence of cell culture media, ascites and bacterial lysates. The robustness of the IgG-specific columns was also studied, and the results showed that they could be reused with up to 90% of their initial capacity after 25 purification/cleaning (performed with 0.25 M NaOH) cycles. Furthermore, the degree of purity of IgG after the Affitin-based column was well comparable with the one after the Protein A column, which is a widely used but expensive purification system, demonstrating the efficiency of Affitins as ligands for affinity chromatography.

3.3.7. Magnetic fishing

An alternative of the chromatography for protein purification is the use of magnetic particles (MNPs). MNPs possess large accessible surface area and can be removed from biological solutions, selectively and easily. Different affinity binders have been used for the modification of the surface of MNPs in order to separate various molecules130. In 2016, a study that explored the use of Affitin-functionalized MNPs for protein purification was published131. Two Affitins, anti-lysozyme and anti-IgG, were immobilized on

Chapter I: Introduction

MNPs and tested for protein binding. When used for magnetic fishing of lysozyme from E.coli extract and IgG from plasma, a purity of 95% and 81%, respectively, was obtained. This study confirmed the successful use of Affitins, immobilized on a matrix, for protein purification – a system that has the potential to be developed against a multitude of molecules of interest.

3.3.8. Tumour imaging

In 2014, a biodistribution study of Affitins was performed a in mice122. Five minutes after intravenous injection, 40% of the injected dose was present in the kidneys, 25% in the liver and 13% in spleen. Two hours later, the amount of Affitins in these organs decreased to 2.4%, 6% and 3% respectively. Fast clearance without accumulation was observed for all organs, which is in correlation with the small size of Affitins. This illustrates that these binders could be particularly suitable for radioimaging of tumours, where fast clearance is an advantage for the use of short-life isotopes such as 68Ga.

The first Affitin to specifically recognize cancer cells is A872, selected against CD138 (syndecan-1). Immunohistochemistry was performed on tissues isolated 2h after intravenous injection of A872 in mice carrying subcutaneous human MDN myeloma tumours. The results obtained showed a very rapid biodistribution in the body with accumulation at the tumour site and significant renal elimination during the first hour after injection (Fig. 12). These results validated the binding to CD138 in vivo and showed that the pharmacokinetics of an Affitin is suitable for the use of short half-life radioisotopes. Furthermore, A872 demonstrated an absence of an

Chapter I: Introduction

immunogenic effect in experiments with mice, where the Affitin was repeatedly injected intravenously (unpublished results).

Tumour

Kidney

Liver

Figure 12. Histological sections from the tumour, kidney and liver at different time after intravenous of A872. Anti-6-His antibody conjugated with horse radish peroxidase was used for revelation. Magnification x80 (from122).

3.4. Strategies for improving Affitins Besides the use of alternative library designs, other strategies to increase the diversity of Affitins have been applied, such as affinity transfer or use of an alternative scaffold.

3.4.1. Insertion of complementarity-determining region (CDR) A fragment of 10 residues from the CDR of cAb-Lys3 camel anti-HEWL antibody was inserted in one of the three loops of Sac7d, indicated on Figure 13132. The obtained mutants mL1, mL2 and mL3 tolerated such insertion and demonstrated secondary structure and pH stability similar to the parental protein. In correlation with the importance of the loops for thermal stability, the values for thermal unfolding for mL-Affitins were 30oC lower (60.9, 65.1

Chapter I: Introduction

Figure 13. Structure and sequence of Sac7d. The arrows indicate the loops, where the CDR domain from cAb-Lys 3was inserted 132. and 66.oC compared to 90.4oC). Furthermore, mL3 was able to bind both DNA because of the scaffold and HEWL because of the CDR, being thus a bispecific binder.

3.4.2. Use of an alternative scaffold: Sso7d

The first attempt to further improve the stabilities of Affitins was performed via transferring the Ig-binding site of Sac7d-based binder (D1Sac7d) into the scaffold of Sso7d113. The resulting D1Sso7d was functional, well expressed in E.coli and had improved pH stability in alkaline conditions. However, it was less thermally stable than the original Affitin (Tm

= 74.2 ◦C vs. Tm = 80.4 ◦C). The further optimisation by introducing two single mutations, described as thermally stabilizing wild type Sso7d, nearly restored thermal stability of the new binder (Tm = 76.9 ◦C). This leads to the assumption that the use of such mutations in the design of new libraries is worth considering.

Chapter I: Introduction

Recently, research groups independently reported binders derived from Sso7d. In the first case 10 amino acids of the DNA-binding surface were randomized and used for selection by yeast surface display. The authors selected proteins binding to six different targets: fluorescein, 12 amino acids peptide from β-catenin, HEL, streptavidin and immunoglobulins from chicken and mouse. The obtained binders had thermal stabilities between 72°C and 89°C, with protein yields ranging from 5 to 60 mg per litre of bacterial culture133. One year later, the same group engineered Sso7d-based pH-sensitive binding proteins for the Fc portion of human IgG (hFc) – using two different strategies: random mutagenesis or histidine scanning, where a His mutation was introduced one by one at the ten mutated amino acid residues. They demonstrated that it is possible to isolate binders that have a higher binding affinity for hFc at pH 7.4 than at pH 4.5, which may be used in applications such as affinity chromatography, where elution under mild conditions is desirable 134.

In 2016, it the first successful application of phage display on Sso7d was reported. This method was used for generation of binders with equilibrium dissociation constants in the low micromolar range for bovine and rabbit serum albumins and in the low nanomolar range for GFP and neutravidin. Furthermore these affinity molecules displayed high thermostabilities from 83 to 94°C135.

In the same year the use of charge-neutralized variants of Sso7d was suggested for reducing potential non-specific interactions with mammalian cells. The deletion of the two C-terminal Lys and the mutation of 4 Lys to

Chapter I: Introduction

neutral amino acids resulted in reduced charge Sso7d (rcSso7d) with thermal stability of 95.5oC and decreased non-specific binding to HeLa cells. Yeast- display libraries based on rcSso7d yielded binders with low nanomolar affinities against mouse serum albumin and hEGFR – targets with differently charged epitopes52. Despite all introduced changes, the resulting affinity molecules were thermostable and expressed in monomeric forms, most probably due to the high robustness of the starting scaffold. rcSso7d library was also used in a study to evaluate Sso7d variants as capture agents in paper-based diagnostic tests136. After selection by yeast display against streptavidin (SA) and subsequent selective pressure by fluorescent activated cell sorting, the obtained binder rcSso7d-SA was immobilized on aldehyde- functionalized chromatography paper. Assessments with fluorescein- labelled SA demonstrated that the binder retained its activity following surface immobilization and outperformed polyclonal antibodies in retaining its binding activity even after thermal challenge (t ½ = 94 min vs. 20.5 sec).

In conclusion, a large number of protein scaffolds have been studied during the last decade for the generation of novel affinity proteins. They are comparable with antibodies in terms of specificity and affinity, and in the same time display more favourable properties like small size, high stability, and lower production costs. These scaffolds vary from each other in origin, structure, binding properties etc., and each one has its strengths and weaknesses. For example, although the fast blood clearance of smaller scaffolds is an asset in tumour imaging, it is a disadvantage when speaking of therapy. Different approaches have been used to address this limitation, like PEGylation, fusions to serum albumin or other molecules, combinations

Chapter I: Introduction

with nanoparticles. In parallel with the different strategies to improve existing affinity molecules, the search for novel scaffolds with even more attractive properties continues. Thus, the potential to find new useful tools for research and medical applications in the future is increased.

4. The Epithelial cell adhesion molecule as a target in cancer therapy

An attractive target for cancer therapy is the epithelial cell adhesion molecule (EpCAM) discovered in 1979 as an antigenic determinant in human colorectal carcinomas137. Initially described as a homotypic cell-cell adhesion molecule138,139, EpCAM was found to be abundantly expressed in different primary epithelial tumours and metastases140,141. Recent studies not only show that EpCAM is present on cancer stem cells, but correlate its overexpression with cell proliferation and differentiation and reveal the potential of EpCAM as an oncogenic signalling molecule142–147.

4.1. EpCAM biology

Since its discovery, EpCAM was independently identified by different research groups and was thus given different names, many of them based on the monoclonal antibody that was used for its recognition148, Table 5. EpCAM is a 40 kDa type I trans-membrane glycoprotein that consists of 3 domains: N-terminal extracellular domain of 242 amino acids, transmembrane domain of 23 amino acids and C-terminal cytoplasmic domain of 26 amino acids149 (Fig. 14).

Chapter I: Introduction

Table 5. Different names of EpCAM, modified from150. Abbreviation Name EpCAM Epithelial cell adhesion molecule EGP-2 Epithelial glycoprotein-2 EGP40 Epithelial glycoprotein of 40 kDa EGP34 Epithelial glycoprotein of 34 kDa gp 38 Glycoprotein of 38 kDa ESA Epithelial surface antigen KSA Adenorarcinoma-associated antigen KS1/4 Carcinoma-associated glycoprotein HEA125 Human epithelium antigen TROP-1 Trophoblast cell-surface antigen TACSTD-1 Tumour-associated calcium signal inducer 1 CD326 Cluster of differenciation 326 Other names, corresponding to the mAb used for its identification (CO)17-1A MH99 AUA1 Ber-EP4 MOC31 GA733-2 FU-MK-1 MK-1 323/A3

The EpCAM gene is conserved in many species, and the human and mouse EpCAM proteins share 81% sequence homology150. EpCAM forms complexes with claudin-7, Tetraspanin, CO-029 and CD44 variant isoform v6, located in tetraspanin-enriched membrane microdomains151. Notably, EpCAM was shown to modify tight junction composition and function by regulating amounts and locations of claudins152.

Chapter I: Introduction

Figure 14. EpCAM amino acid sequence and post-translational modifications. EpCAM is comprised of a short intracellular domain (EpICD) and an extracellular domain (EpEX) with EpCAM motif 1 (green) and thyroglobulin type-1 repeat (motif 2, purple). Approximate region of the epitope recognized by monoclonal antibody MOC31 is indicated. Modified from150.

Chapter I: Introduction

The extracellular domain (EpEX) possess a thyroglobulin (TY) type 1A module, participating in dimer formation153. Association of dimers to form tetramers has been demonstrated and was explained as interaction between dimers on opposing cells, illustrating the cell-cell adhesion activity of EpCAM154. Additionally, the intracellular domain (EpICD) regulates the adhesion function of EpCAM, as it interacts with the actin cytoskeleton through α-actinin155

4.2. EpCAM expression

EpCAM is extensively expressed in various solid tumours and metastases of different origins such as adenocarcinomas of the colon, pancreas, prostate, breast, ovaries etc., as well as some squamous cell carcinomas, hepatocellular carcinoma and retinoblastoma. In healthy tissues EpCAM is expressed at low levels on the basolateral cell membrane of some epithelia, and thus is much less accessible for binding molecules140,141,156. The National Institutes of Health Biomarkers Definitions Working Group defined a biomarker as “a characteristic that is objectively measured and evaluated as an indicator of normal biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention”157. Thus, the expression level of EpCAM is considered as a cancer biomarker. Furthermore, EpCAM overexpression is a marker for the so-called tumour-initiating cells with the ability to induce new tumours. Also named cancer stem cells (CSCs), they possess stem-like features like self-renewal and multipotency, and are responsible for tumour growth158,159.

Chapter I: Introduction

Additionally, EpCAM is present on circulating tumour cells (CTCs) that possess a metastatic potential, and their detection is important for prognostics and for monitoring therapy response160. However, accumulating evidence suggests that CTCs show heterogeneous EpCAM expression due to the epithelial-to-mesenchymal transition (EMT)161,162. EMT is a process that allows polarized, immotile epithelial cells to convert to motile mesenchymal cells163. EMT leads to enhanced migration of cancer cells, whereas the opposite process epithelial-to-mesenchymal transition is a driving force of metastasis164. EpCAM-high phenotypes correlate with proliferative stages, whereas EpCAM-low/negative phenotypes are associated with migration, invasion and dissemination165. Therefore, assays using EpCAM as a target for isolation of CTCs may underestimate the total number of CTCs in the circulation166.

4.3. Biology and oncogenic potential of EpCAM

In addition to its role as an adhesion molecule, EpCAM has proven to be involved in cellular signalling and the consequent regulation of cell proliferation, differentiation and migration159,167. In areas of cell-to-cell contact, EpCAM signalling is activated via proteolytic intramembrane cleavage that leads to the release of its intracellular domain in the cytoplasm. Full-length EpCAM is cleaved by tumor-necrosis-factor alpha converting enzyme (TACE, also disintegrin and metalloprotease ADAM17), releasing EpEX. In a second cleavage step a γ-secretase (presenilin-2, PS-2) releases EpICD168. It then interacts with four and one-half LIM domains protein 2 (FHL2) and β-catenin – a component of the wnt pathway, which

Chapter I: Introduction

plays a role in carcinogenesis158,169, Fig. 15. Upon translocation to the nucleus, the EpICD-containing complex together with Lef-1, another component of the wnt pathway, enhances the expression of specific genes, including c-myc and cyclins and other genes involved in cell cycle, proliferation and death170. The whole process is further stimulated by EpEX that triggers the intramembrane cleavage of EpCAM167. Studies have shown, than upon binding to antibodies171 and other targeting ligands (such as DARPins172), EpCAM is rapidly internalized. Thus, it is well suited for delivery of anti-cancer agents to intracellular targets173,174.

Figure 15. EpCAM signalling and its participation in the wnt pathway158. Upon cleavage by TACE/PS-2, EpICD translocates into the nucleus in a multiprotein complex. Together with FHL2, h-catenin, and Lef-1, EpICD contacts DNA at Lef-1 consensus sites. Among EpCAM-regulated target genes are c-myc and cyclins.

Chapter I: Introduction

4.4. EpCAM and cancer therapy

4.4.1. EpCAM and antibodies

Different antibodies, novel scaffolds and drug-conjugates targeting EpCAM have been studied for cancer therapy175. The first anti-EpCAM antibody tested in patients was murine IgG2 antibody 17-1A, later named Erdecolomab176. Large clinical evaluation of Erdecolomab177,178 led to its approval by FDA, and it was introduced on the market for treatment of metastasized colon cancer as Panorex. However, it was subsequently withdrawn from the market because of its lack of efficacy179,180.

Among other clinically tested monoclonal antibodies against EpCAM, Adecatumumab is showing particularly promising results in patients with prostate or metastatic breast cancer. Adecatumumab is a fully human IgG displaying high tolerated dose, also in combination with Taxotere181,182. The only anti-EpCAM antibody approved for the European market is Catumaxomab (Removab) – a trifunctional mouse-rat hybrid antibody. It binds not only to cancer cells via EpCAM, but also to cytotoxic T-cells via the CD3 receptor. It also contains an Fc part, and thus is able to activate accessory cells of the immune system via their Fc-receptors, such as natural killer and dendritic cells. Approved in 2009 in the European Union for the treatment of patients with malignant ascites, Catumaxomab is also studied for the treatment of other malignancies like ovarian and gastric cancers183,184.

Chapter I: Introduction

Figure 16. Overview of some EpCAM-targeting strategies for cancer therapy (modified from175). EpCAM- specific binding molecules can be payloaded with various effector functions for tumor targeting. They include bispecific antibodies for immune cell activation, activation of prodrugs (ADEPT) and a variety of constructs which act on intracellular targets and require internalization by receptor-mediated endocytosis: antibody-drug conjugates, toxin fusions, nanoparticles.

Antibody fragments185 and novel antibodies recognizing EpCAM186,187 continue to be investigated for their potential use in therapy, often as chemical conjugates or fusions with chemotherapeutic agents, toxins, immunostimulatory cytokines and enzymes for antibody-directed enzyme prodrug therapy (ADEPT)175, Fig. 16. Beside mAbs and IgG fragments,

Chapter I: Introduction

different alternatives of antibodies have been used, such as aptamers and DARPins.

4.4.2. EpCAM and aptamers

Different antibody alternatives against EpCAM have also been created, such as the specific nuclease resistant aptamer EpDT3. Aptamers are short single stranded DNA or RNA oligonucleotides. From a large oligonucleotide library, one may select aptamers specific for desired targets, including cancer cell receptors.

This 19 nucleotides aptamer showed high affinity towards EpCAM and was well internalized188. In 2015, two different strategies of targeting EpCAM expressing cancer cells, involving aptamers, were reported. In one of the preclinical studies, a polyethyleneimine nanocomplex was synthesized with EpCAM aptamer (EpApt) and EpCAM small interfering RNA (siRNA, SiEp) for targeting not only the EpCAM protein, but also its gene expression. These aptamer-loaded complexes were spherical particles of around 150 nm and led to downregulation of EpCAM mRNA and decreased cancer cell proliferation189. In another case, a chimera was created between an anti-EpCAM aptamer and a siRNA against survivin, a key protein implicated in drug resistance that is overexpressed in doxorubicin resistant CSCs from breast tumours. The in vivo delivery of these chimeras to such CSCs in xenograft tumours in combination with DOX led to reversal of the drug-resistance and CSC elimination190. Further, in 2016 DOX-loaded mesoporous silica nanoparticles were modified with aptamer against

Chapter I: Introduction

EpCAM. This led to the increased cytotoxicity of DOX on colon cancer cells SW620 overexpressing EpCAM191.

4.4.3. EpCAM and DARPins

Besides aptamers, DARPins targeting EpCAM have also been created in order to overcome the limitations of antibodies and their fragments, such as the tendency of scFv-toxin fusions to aggregate175,185. These have been used for the generation of EpCAM-targeted drug conjugates, like the fusion with protamine-1 for complexation of siRNA complementary to antiapoptotic bcl-2, a potent inhibitor of apoptosis implicated in cancer drug resistance, leading to significant sensitization of cells to doxorubicin173. Furthermore, DARPin Ec4 were genetically fused to the truncated form of Pseudomonas aerruginos exotoxin A (ETA’’) and were expressed in high yields and soluble form in E.coli192. Strong antitumour effect was observed both in vitro and in vivo, however the circulation half-life of the fusion protein was very short, 11 min. The flexibility and robustness of the DARPin scaffold allowed the implementation of different strategies to increase the serum half-life of DARPin-toxin fusions193. Regiospecific functionalization by bio-orthogonal conjugation with PEG-polymer increased the half-life in mice (82 vs 14 min) and thus the effects on tumour xenografts were lasting longer194. Another successful strategy was the conjugation of anti-EpCAM DARPin Ec1 on its C-terminal to the small molecule cytotoxin monomethylauristatin F (MMAF). The N-terminal end of Ec1 was further linked to mouse serum albumin (MSA) for half-life extension using Cu-free click chemistry. All modules of MSA-Ec1-MMAF stayed

Chapter I: Introduction

functionally active including EpCAM-specific binding and internalization cytotoxic potency. The conjugation increased the serum half-life from 11 min to 17.4 h, creating a molecule with improved pharmacokinetic properties for tumour targeting195.

As a conclusion, EpCAM is a transmembrane protein, highly expressed in various solid tumours and metastases. Recent studies shed light on its function not only as an adhesion molecule, but as well as oncogenic signal transducer. Additionally, its abundance on CSCs and circulating tumour cells contributes to its attractiveness for cancer targeting, particularly intracellular drug delivery. From the diverse palette of EpCAM- targeting strategies, including mAbs, ADC and alternative scaffolds, only the bispecific antibody Catumaxomab has been approved for therapy up to now. This shows the necessity to further investigate the existing formulations and to develop novel therapeutic approaches.

5. Nanoparticles in cancer therapy

5.1. Nanotechnology – definition

In his talk “There's Plenty of Room at the Bottom” in 1960, Richard Feynman proposed the concept of the “nanosurgeons” and nanodrug delivery devices, capable of interacting with the body at the cellular level196. At the present time, nanomedicines are being exploited for the targeted delivery of a variety of drugs - hydrophilic or hydrophobic small drugs, vaccines, biological molecules etc., with two-thirds of them being oncology- based197.

Chapter I: Introduction

The National Nanotechnology Initiative (NNI) defines nanotechnology as science, engineering, and technology conducted at the nanoscale, which is about 1 to 100 nanometers198.

Many agencies, including the FDA, the Patent and Trademark Office (PTO) and International Union of Pure and Applied Chemistry (IUPAC) continue to use this definition, although the term nanoparticles (NPs) commonly applies to structures that are up to several hundred nanometers in size199,200.

As mentioned before, conventional chemotherapeutics for cancer treatment present some serious side effects, including damage of the immune system and other organs with rapidly proliferating cells due to nonspecific targeting. Other limitations are also the lack of solubility for some drugs and the inability to enter the core of the tumours201. Nanotechnology provides the opportunity to overcome such limitations of conventional drug delivery systems. NPs can carry multiple drugs and/or imaging agents and because of their high surface-area-to-volume ratio, one may achieve high ligand density for targeting purposes. The aim of NPs in cancer therapy is to improve the solubility and efficacy of drugs, while decreasing adverse side effects (Table 6). This strategy should allow the administration of lower effective dose to patients and a higher dose arriving at the tumour202.

Chapter I: Introduction

Table 6. Goals and specifications of targeted nanoscale drug delivery system, from16.

1. Increase drug concentration in the tumour through: (a) passive targeting (b) active targeting 2. Decrease drug concentration in normal tissue 3. Improve pharmacokinetics and pharmacodynamics profiles 4. Improve the solubility of drug to allow intravenous administration 5. Release a minimum of drug during transit 6. Release a maximum of drug at the targeted site 7. Increase drug stability to reduce drug degradation 8. Improve internalization and intracellular delivery 9. Biocompatible and biodegradable

5.2. Nanoparticles – classification

NPs used for medical applications have to be biocompatible and nontoxic. It is generally accepted that NPs with a hydrodynamic diameter of 10–100 nm have optimal pharmacokinetic properties for in vivo applications. Smaller NPs are subjects to tissue extravasation and renal clearance, whereas larger ones are quickly opsonized and removed from the bloodstream by macrophages of the reticuloendothelial system (RES)203.

NPs can be polymer-based (polymeric or hydrogel NPs, dendrimers, etc); lipid-based (liposomes, micelles, lipid nanocapsules etc); inorganic (gold or magnetic NPs, quantum dots, etc.) and others (Fig. 17).

Chapter I: Introduction

Figure 17. Examples of polymeric, lipid and inorganic nanoparticles (modified from235). Polymeric nanoparticles can be divided into “nanospheres” in which the drug is dispersed throughout the particles and “nanocapsules” in which the drug is entrapped in a cavity surrounded by a polymer membrane. Polymeric micelles are arranged in a spheroidal structure with hydrophobic core and hydrophilic corona. Dendrimers are highly branched macromolecules with controlled three-dimensional architecture. Liposomes are closed spherical vesicles formed by one or several phospholipid bilayers surrounding an aqueous core in which drugs can be entrapped, whereas solid lipid nanoparticles are based on solid matrix. The structure of lipid nanocapsules is a hybrid between polymeric nanocapsules and liposomes because of their oily core where lipophilic drugs are encapsulated, and which is surrounded by a tensioactive rigid membrane. Inorganic nanoparticles, like iron oxide or gold nanoparticles and quantum dots, have been studied for the development of nano-imaging. Magnetic nanoparticles can be guided with the use of magnets16.

5.2.1. Polymer-based NPs Polymers are among the most commonly explored materials for constructing nanoparticle-based drug carriers204. Poly (lactic-co-glycolic

Chapter I: Introduction

acid) or PLGA is one of the most effectively used biodegradable polymers for the development of nanomedicines because it undergoes hydrolysis in the body to produce the biodegradable metabolite monomers, lactic acid and glycolic acid. The US FDA and European Medicine Agency (EMA) approve PLGA in different drug-delivery systems in humans205. They can be PEGylated and grafted with targeting ligands.

5.2.2. Lipid-based NPs Lipid-based carriers have attractive properties, including biocompatibility, biodegrability and the ability to entrap both hydrophilic and hydrophobic drugs. Liposomes are spherical structures, formed by one or several lipid bilayers with inner aqueous phase. The first anti-cancer nanomedicine approved by FDA in 1995 was DoxilTM/CaelyxTM – liposomal doxorubicin (DOX), designed to exploit the enhanced permeability and retention effect (see below). It contains DOX, a member of the anthracycline group, enclosed in an 80-90 nm size unilamellar liposome coated with PEG that allows the drug to stay in the bloodstream longer so that more of the drug reaches the cancer cell206.

Micelles are spherical structures where molecules with a hydrophobic end aggregate to form the central core and the hydrophilic ends of other molecules are in contact with the liquid environment surrounding the core. Micelles are effective carrier for the delivery of water- insoluble drugs carried in the hydrophobic core 207.

Solid lipid nanoparticles (SLN) are particles made of solid lipids and have good physical stability and tolerability. However, SLN have a relatively

Chapter I: Introduction

low loading capacity compared to other NPs. Nanostructured lipid carriers (NLC) are produced by mixing solid lipids with liquid lipids (oil), which leads to a special unstructured matrix with increased drug loading208. Lipid nanocapsules are prepared by a phase-inversion temperature process and have a hybrid structure between polymeric NPs and liposomes because of their oily core which is surrounded by a rigid membrane209.

5.2.3. Inorganic NPs Inorganic NPs, like iron oxide NPs, gold NPs and quantum dots, have been studied for the development of nano-imaging through fluorescent imaging and magnetic resonance imaging (MRI). They demonstrate the potential to detect and diagnose cancer at an earlier stage than with current imaging methods. Their surface can also be “functionalized” in order to achieve specific tumour targeting199. A formulation of superparamagnetic iron-oxide NPs, Ferumoxytol (AMAG Pharmaceuticals), approved by FDA as an iron supplement for the treatment of iron deficiency anemia, has also been demonstrated as promising agents for cell tracking by MRI210. Meanwhile other formulations are under clinical investigation211.

5.3. Surface modifications

Depending on their surface characteristics, NPs are taken up by the liver, spleen, and other parts of the reticuloendothelial system (RES). Surface modification of NPs is significant for escaping the body’s natural defense systems when transporting drugs to the bloodstream. It has been shown, that hydrophilic particles remain in the circulation for a longer time and are taken up by the liver at a minor extent212. Different strategies have been

Chapter I: Introduction

used to make a hydrophilic cloud around NPs and to reduce their uptake by RES organs. These strategies comprise coating of NPs with Tween 80, PEG (polyethylene glycol), PEO (polyethylene oxide), poloxamers and poloxamines, polysorbate 80 and polysaccharides like dextran205.

The most preffered among these surface modifications is the PEGylation. PEG protects NPs from clearance from the blood by the RES, thus increasing both circulation times and drug uptake by target cells. Examples of such “stealth” nano-carriers include PEGylated liposomal doxorubicin (Doxil) and the polylactic acid (PLA)–PEG micelle form of paclitaxel (Genexol- PM)213. Magnetic nanoparticles (MNPs) also need to be coated with surfactants or polymers (e.g. dextran, PEG) to stabilise them and attach functional groups to their surfaces. Functionalisation is used to bind the appropriate molecules, such as anti-cancer drugs or targeting agents214.

5.4. Tumour targeting

Tumour targeting with NPs may be achieved by using either passive, active or triggered mechanisms. Passive targeting is a result of the enhanced vascular permeability and retention (EPR), which is characteristic of tumour vessels – the NPs get through the gaps between the leaky endothelial cells207. The second strategy uses recognition ligands attached to the surface of the NPs: antibodies215, hyaluronic acid216, peptides217 etc., that bind to a specific target. This is a promising approach, shown to prevail over passive targeting.

Chapter I: Introduction

5.4.1 Passive targeting – EPR effect

Passive targeting exploits features of the tumour and its environment that allow NPs to accumulate in the tumour by EPR effect (Fig.18A). A characteristic of tumour blood vessels is the rapid and defective angiogenesis. This leads to abnormalities such as high proportion of proliferating endothelial cells, pericyte deficiency and vessels with fenestrations that enhance vascular permeability. Furthermore, lymphatic vessels are absent or non-functional, which contributes to inefficient drainage from the tumour tissue16. Whereas free drugs may diffuse non- specifically, the leaky vasculature allows NPs to enter into the tumour tissue. Furthermore, the supressed lymphatic filtration allows NPs to stay in the vicinity of the tumour cells. This passive process is called “enhanced permeability and retention (EPR) effect” and it was discovered in 1986218.

Nanomedicines without targeting ligands that exploit the EPR effect and have been approved for clinical use in cancer patients include DoxilTM, MyocetTM, DaunoXomeTM, DepocytTM, AbraxaneTM, Genoxol-PMTM and OnivydeTM, while many other are currently in clinical trials (Table 7).

5.4.2. Active targeting

However, the passive targeting strategy is limited, as certain tumours do not exhibit the EPR effect. For example, pancreatic tumours are generally very poorly vascularized and, hence, systemic delivery via the EPR effect is thought to be inefficient. In addition, the permeability of vessels may vary depending on the type and stage of the tumour, the age of the patient and may not be the same even throughout a single tumour.

Chapter I: Introduction

In general, the EPR situation in humans is quite unclear, as various studies show that it works in rodents, but not in humans219. Thus, there is a need to maximize the accumulation of NP at the site of interest by other methods.

Figure 18. A) Passive targeting of NPs. (1) NPs reach tumours selectively through the leaky vasculature surrounding the tumors. (2) Schematic representation of the influence of the size for retention in the tumour tissue. Drugs alone diffuse freely in and out the tumour blood vessels because of their small size. By contrast, drug-loaded NPs cannot diffuse back into the blood stream. B) Active targeting with ligands grafted at the surface of NPs that bind to receptors (over)expressed by (1) cancer cells or (2) angiogenic endothelial cells16

Chapter I: Introduction

Table 7: Examples of anti-cancer nanomedicines in clinical trials or on the market197. Nanomedicine type Drug Product name/company Indication Phase Liposomes Doxorubicin Myocet™/Teva UK Metastatic breast cancer Approved Doxil™/Janssen Kaposi's sarcoma Approved

Ovarian cancer (post-first line failure) Multiple myeloma ThermoDox™/Celsion Primary hepatocellular carcinoma Phase III Refractory chest wall breast cancer Colorectal liver metastases Phase II

2B3–101/2-BBB Medicines BV Brain metastases Glioma Phase II Vincristine Marqibo™/Spectrum Pharmaceuticals Acute lymphoblastic leukaemia Approved Daunorubicin DaunoXome™/Galen HIV-related Kaposi's sarcoma Approved Cytarabine Depocyt™/Pacira Pharmaceuticals Lymphomatous meningitis Approved Metastatic pancreatic cancer (2nd Irinotecan Onivyde™/Merrimack Pharmaceuticals line) Approved

Gastric cancer Phase II

Cytarabine: daunorubicin CPX-351/Celator Acute myeloid leukaemia Phase III 5:1 fixed ratio Cisplatin Lipoplatin/Regulon Non-small cell lung cancer Phase III SPI-77/ALZA Pharmaceuticals Ovarian cancer Phase II Aroplatin/Aronex Pharmaceuticals Malignant mesothelioma Phase II Oxaliplatin MBP-426/Mebiopharm Gastrointestinal adenocarcinoma Phase II Paclitaxel LEP—ETU/Insys Breast cancer Phase II EndoTAG-1/MediGene Breast cancer Phase II PNU-91934/MSKCC Esophageal cancer Phase II SN-38 LE-SN38/Neopharm Metastatic colorectal cancer Phase II Irinotecan: Floxuridine CPX-1/Celator Colorectal cancer Phase II 1:1 ratio Polymeric CRLX101 (cyclodextrin conjugates Camptothecin adamantane)/Cerulean Renal cancer Phase II Small cell lung cancer Ovarian cancer Asparaginase Oncaspar™ (PEG)/Baxalta Acute lymphoblastic leukaemia Approved Phase III Opaxio™ (Polyglycerol adipate)/CTI maintena Paclitaxel Biopharma Ovarian cancer nce Phase II Non-small cell lung cancer (women) Irinotecan NKTR102 (PEG)/Nektar Metastatic breast cancer Phase III Camptothecin CRLX101 (nanoparticle)/Cerulean Renal cell carcinoma (3rd/4th line) Phase II Ovarian cancer (2nd/3rd line) XMT1001 (Fleximer™)/Mersana Gastric cancer (2nd line) Phase II Non-small cell lung cancer (2nd/3rd line)

Diaminocycloh exane (DACH) AP 5346 (Hydroxypropylmethacrylate)/ Platinum ProLindac™ Ovarian cancer Phase II

Docetaxel DEP™ (G5 PEG-Polylysine)/StarPharma Advanced cancers Phase I CriPec™ docetaxel (nanoparticle)/Cristal Therapeutics Solid tumours Phase I 78

Chapter I: Introduction

Table 7: Continued. Nanomedicine type Drug Product name/company Indication Phase Docetaxel + Prostate - Specific Membrane Polymeric Antigen BIND-014 (Accurin™)/BIND nanoparticles (PSMA) Therapeutics Cholangiocarcinoma Phase II Cervical cancer Bladder cancer Head and neck cancer Non-small cell lung cancer subtypes AZD2811 (AZD1152 hydroxyquinazo line pyrazol anilide; Aurora- B Kinase AZD2811 (Accurin™) Inhibitor) nanoparticle/AstraZeneca Advanced solid tumours Phase I Polymeric Genexol-PM™/Samyang micelles Paclitaxel Biopharmaceuticals Breast cancer Approved Non-small cell lung cancer Ovarian cancer NK105/NanoCarrier™ Stomach cancer Phase III Breast cancer NC-4016/NanoCarrier™ Solid tumours Phase I Nanoxel™/Samyang Biopharmaceuticals Advanced breast cancer Phase I DACH-platin NC-6004 Nanoplatin™/NanoCarrier™ Pancreatic cancer Phase III Head and neck cancer Non-small cell lung cancer

Bladder cancer Other Irinotecan HA-irinotecan HyACT™/Alchemia Colorectal cancer Phase II

Lung cancer Phase III Tumour Necrosis Factor (TNF) CYT-6091/CytImmune Non-small cell lung cancer Phase II Paclitaxel Abraxane ™/Celgene Advanced breast cancer Approved Advanced non-small cell lung cancer Advanced pancreatic cancer

5.4.2.1. Targeting the cancer cell

A way to overcome the limitations of passive targeting is active targeting – a strategy where NPs actively bind to specific cells (Fig. 18B). This may be achieved by attaching targeting ligands to the surface of the NPs,

Chapter I: Introduction

which will help for the recognition and binding onto antigens, abundantly expressed by the cancer cells. Numerous targeting ligands have been employed to actively target NPs including antibodies, antibody fragments, aptamers, peptides and whole proteins (e.g., transferrin) and different receptor ligands (e.g., folic acid)220.

The binding of certain ligands to their receptors, such as the transferrin one, may promote internalization, which triggers drug release from NPs221. This may allow bypassing the activity of integral membrane proteins, known as MDR transporters, which transport a variety of anticancer drugs out of the cancer cell and thus lead to resistance against chemotherapy222. For example, folate receptor-mediated cell uptake of DOX-loaded liposomes (targeted with folic acid) was shown to be unaffected by P-glycoprotein (P-gp) mediated drug efflux in vitro, in contrast to the uptake of free DOX223.

No cancer nanomedicines equipped with targeting ligands have thus far been approved, although many authors report the evidence of this strategy in preclinical models201,224. Ligand-targeted nanomedicines in clinical trials are presented in Table 8. An interesting example of an actively targeted nanomedicine formulation is BIND-014, which has recently completed a phase II trial in patients suffering from Non-Small Cell Lung Cancer (NSCLC) and metastatic castration resistant prostate cancer. BIND- 014 refers to docetaxel-loaded poly (lactic-co-glycolic acid)-poly (ethylene glycol) (PLGA-PEG) NPs equipped with targeting ligands directed at prostate- specific membrane antigen. Although docetaxel polymeric NPs seemed to

Chapter I: Introduction

be effective in metastatic castration resistant prostate cancer and NSCLC, no effect was observed in cervical and head and neck cancer. It is unsure whether the development of docetaxel polymeric NPs will be continued, due to financial reasons225,226.

Table 8. Ligand-targeted nanomedicines undergoing clinical evaluation227. Updated from https://clinicaltrials.gov/ (2017).

Active targeted NPs have also been studied for improving methods

for imaging and staging cancers228. As an example, gold NPs functionalized with 89Zr-labeled Cetuximab (anti-EGFR mAb) have been documented as a tool for cancer theranostic229. Fluorescent NPs conjugated with anti-EpCAM antibodies have been proposed as sensitive and selective sensor for detecting human colon cancer cells230. Anti-CEA Nanobodies conjugated with quantum dots for imaging have also been developed231,232. A full

Chapter I: Introduction

antibody against CEA has been used for tumour pre-targeting with radiolabelled liposomes233.

5.4.2.2. Targeting the tumour environment Targeted therapies reduce the toxic side effects of anticancer drugs in normal cells and tissues by targeting a cell-surface receptor that either directly or indirectly kills cancer cells. Indirect strategies include inducing an immune response that leads to cancer cell apoptosis or inhibiting angiogenesis.

NPs designed to target immune molecules and cells may allow the development of approaches that use the patient’s immune system as a more specific tool to fight cancer. Extensive research has been made regarding cell surface receptors in immune cells234, as NPs that target them may trigger immune responses in addition to the delivered payloads235.

Another strategy for inhibition of cancer growth is to actively target tumour endothelial cells. By attacking the growth of angiogenic blood vessels, one indirectly targets the tumour cells that they supply. Among the main targets for the tumoural endothelium belong VEGF and its receptors, as well as integrins and their receptors. RGD peptide is the most popular

236 ligand that targets integrin αvβ3 .

5.4.3. Stimuli-responsive nanoparticles

Site-specific release of a drug contained in NPs can be achieved by the application of external stimuli, such as temperature changes, magnetic fields, ultrasounds, as well as light and electric fields. Among these stimuli, low pH has become the focus of numerous investigations in oncology

Chapter I: Introduction

because the extracellular pH of normal tissues and blood is approximately 7.4, whereas that in a tumour microenvironment is between 6.0 and 7.0,

16 which is mainly caused by high glycolysis rate and high level of CO2 . Therefore, the abnormal pH gradient provides opportunities to realize pH- responsive controlled drug delivery systems for cancer treatment, such as mesoporous silica NPs237.

More recently, magnetic drug targeting has been studied. In this approach, magnetic NPs are guided to the tumour site using magnets238. It is also possible to use two active targeting systems (for example magnetic field + targeting agent) in the so-called multifunctional NPs. The use of this double active targeting can, therefore, increase the concentration and the retention time in targeted tissues thus improving the efficacy of the anti- cancer properties of these carriers214.

5.4. Lipid nanocapsules Although liposome-based systems are already used in some cancer therapies (Table 7), they possess some drawbacks – their manufacturing processes involve organic solvents, they are unstable in biological fluids and have low encapsulation capacity for lipophilic drugs209. To address these disadvantages, lipid nanocapsules (LNC)239 have been developed – prepared by a solvent-free process, they are stable for at least one year in suspension and have the ability to efficiently encapsulate lipophilic drugs.

5.4.1. LNC formulation Lipid nanocapsules can be prepared with sizes from 20 to 100 nm and are characterized by a hybrid structure between polymer nanocapsules and

Chapter I: Introduction

liposomes. They have an oily core based on medium-chain triglycerides and are surrounded by a membrane containing lecithin and PEGylated surfactant (Fig. 19). All components used for LNC formulation are approved by regulatory agencies for oral, topical and parenteral administration209.

A) LNC B) Liposome

Figure 19. LNC and liposome. A) Schematic representation of LNC. Their structure is a hybrid between polymeric nanocapsules and liposomes because of their oily core where lipophilic drugs are encapsulated, and which is surrounded by a tensioactive rigid membrane209. B) Liposome, for comparison, are phospholipid and cholesterol self-assembled bilayer membranes that enclose an aqueous core, where hydrophilic molecules can be incorporated. Hydrophobic compounds can also be incorporated in the lipid bilayer235.

The preparation process is based on a phase-inversion temperature (PIT) phenomenon of an emulsion, leading to lipid nanocapsule formation239,240. The first step is to mix all the components with porportion, varying according to the desired result, followed by several heating and cooling cycles that cross the phase inversion zone (PIZ) leading to transformation from water-in-oil emulsion to oil-in-water and vice versa. The last step is an irreversible shock by dilution with cold water that breaks down the microemulsions obtained in PIZ and forms stable LNC. Prepared LNCs are stable in solution for at least one year at 4°C209. Commonly used components and their influence on the formulation are listed in Table 9.

Chapter I: Introduction

Table 9. Factors influencing the formulation and stability of LNC209.

Factor (component) Effect

Nonionic surfactant amount (Solutol®) Major influence on LNC formation and stability

Temperature cycles Favouring LNC formation and improving the quality of LNC dispersion Oil proportions (Labrafac®) Increase of LNC size

NaCl Decrease of phase-inversion temperature

Lipophile surfactant (Lipoid®) Stabilizing the LNC rigid shell and favouring the freeze- drying process

5.4.2. LNC for cancer targeting LNC allow the encapsulation of a wide range of molecules, including both hydrophilic and hydrophobic therapeutics241 and also fluorescent dyes that allow their tracing242. Among them are various anticancer agents: etoposide, paclitaxel, tripentone etc209. Importantly, LNC have demonstrated inhibition of P-gp mediated drug efflux243. In addition, LNC can be loaded with different radionuclides, such as 99mTc, 188Re, 125I or 111In, thus providing opportunities for imaging and radiotherapy209,244.

The surface of LNC can be modified in order to improve both the passive and the active targeting of anti-cancer drugs. For example, post- inserting distearoylphosphatidylethanolamine (DSPE)-PEG2000 or DSPE-

PEG5000 at their surface leads to prolonged systemic circulation with half-life

245 times of over 6h . Indeed, docetaxel-loaded LNC coated with DSPE-PEG2000 significantly and substantially accumulated in C26 colon adeno - carcinoma

Chapter I: Introduction

subcutaneous tumours, whereas uncoated LNCs showed poor tumoural accumulation246.

Different strategies for active targeting of LNCs have also been exploited, like the attachment of OX26 mAb or Fab’ fragments, binding to the transferrin receptor (TfR). Both types of nanocapsules provided effective in vitro binding to cells overexpressing TfR, as well as significant accumulation in the brain of healthy rats 24h after administration, when compared to non-targeted LNC244,247.

LNC have also been functionalized with mAb directed against AC133 – a cancer stem cell-associated marker. AC133-LNC were able to bind specifically cells overexpressing AC133248. Furthermore, LNC were grafted with cRGD peptides, known to recognize αvβ3 integrins. Functionalization improved in vitro internalization by U87MG glioma cells. Accumulation in subcutaneous tumours in mice was significantly higher, compared to negative control LNC249.

LNC formulations have also been adapted for siRNA encapsulation via strong electrostatic interactions250. The transfection efficacy of siRNA LNC was demonstrated first on glioma cells251 (targeted protein EGFR) and, after, on melanoma cells252 (targeted protein alpha-1 subunit of sodium pump Na-K ATPase). A significant inhibition of the targeted protein in vitro was reported in both cases.

Functionalization of LNC with a neurofilament derived cell- penetrating peptide NLF-TBS.40-63 (LNC-NLF) was shown to increase the uptake of paclitaxel-loaded LNC by glioblastoma cells and reduce their

Chapter I: Introduction

proliferation253. Furthermore, interaction of LNC-NLF with neural stem cells was studied in vitro and in vivo. The results demonstrated preferential uptake by neuron stem cells from the brain, whereas they did not interact with neural stem cells from the spinal cord. Thus, LNC-NLF present a promising strategy for the selective delivery of molecules to brain neural stem cells242.

5.4.3. LNC and paclitaxel

5.4.3.1. Paclitaxel

Paclitaxel (PTX), commercially available as Taxol, causes cell death by disordering the dynamics of tubulin necessary for mitosis. PTX binds to the β-subunit of tubulin and promotes its polymerisation, leading to the formation of extremely stable microtubules and inhibiting cell replication254. It belongs to the group of taxans – highly hydrophobic molecules with very low solubility in water (Fig. 20).

Figure 20. Paclitaxel (C47H51NO14), Mw = 853 Da.

PTX was shown to have neoplastic activity against a variety of cancers, including ovarian, breast, colon, head and non-small lung cancer254. However, treatments with Taxol are always associated with serious side

Chapter I: Introduction

effects such as arrhythmias, ischemia, nausea, vomiting, diarrhoea, alopecia, fatigue etc.

In order to solubilize PTX, one has to use Cremophor EL (polyoxyethylated castor oil) and Ethanol (50:50) – also known with the commercial name Taxol. However, the use of this solvent-based formulation is associated with serious and dose-limiting toxicities255. Abraxane – a solvent-free albumin-bound paclitaxel NP formulation, was designed to address the insolubility problems encountered with PTX256. Also known as nab-palcitaxel257, the formulation allows the delivery of the water insoluble drug in the form of nanospheres (130 nm). Albumin is a plasma protein with long circulation life, well tolerated by the immune system. Abraxane formulation has increased the bioavailability of paclitaxel and resulted in higher intra-tumor concentrations facilitated by albumin-receptor (gp60)- mediated endothelial transcytosis255. It was approved by the FDA as a second-line treatment for metastatic breast cancer (2005), as a first line treatment for advanced non-small cell lung cancer (2012) and for the treatment of advanced pancreatic cancer (2013)255.

NPs other than liposomes have been pre-clinically studied for the development of Cremophor® EL-free nanoformulations258. Among them are PEGylated PLGA-based NPs259, PEGylated PLGA-based NPs grafted with the RGD peptide for targeting the tumour endothelium217, polymeric micelles260,261, polymersomes262, multifunctional iron oxide-loaded NPs238 and LNC.

Chapter I: Introduction

5.4.3.2. LNC-PTX

Lipid nanocapsules have been used for the development of PTX formulation. High encapsulation efficiency (up to 100% 263,264) and drug loading (1.6 -1.9 mg/mL263,264) of PTX in LNC have been reported. An in vivo study demonstrated that a five-day i.v. injection schedule of PTX-LNC dispersions induced no histological or biochemical abnormalities in mice (subcutaneously injected with human large cell lung cancer cells) and improved PTX efficacy and therapeutic index in comparison with Taxol264.

In addition, a single intratumoural injection of LNC-PTX in subcutaneous glioma rat model significantly reduced the tumour mass as well as the evolution of the tumour volume265.

Oral administration of anticancer drugs is very attractive, because it is practical and convenient and eliminates the need for infusion equipment. However, PTX has a very low level of oral bioavailability because of its limited aqueous solubility and the efflux pump P-gp present abundantly in the gastrointestinal track266. Noteworthy, the in vitro gastrointestinal stability of LNC267 and their capacity to inhibit P-gp (see above) have been highlighted. Results of a study where PTX-loaded LNC have been orally administered to rats indicated about a 3-fold increase in the bioavailability of PTX, compared to Taxol alone, even without the use of P-gp inhibitors263. Furthermore, the interaction between PTX-LNC and intestinal pig mucus was evaluated. The study showed that LNC are stable in mucus and improve PTX diffusion at low concentrations, thus making the system a good candidate for oral delivery268.

Chapter I: Introduction

To conclude: the history of the nanotechnology started long time ago and it is ever evolving, faster and faster (Fig. 20). Nanomedicines have already revolutionized cancer therapy by overcoming limitations of conventional chemotherapies, more precisely by improving the efficacy and specificity and lowering the toxicity of drug-delivery systems. However, nanotechnology-based cancer therapies and diagnostics need to be further improved, especially in terms of selective recognizing of the cancerous cells and targeted drug delivery, before they reach popularity in clinical applications.

Figure 21. Historical timeline of major developments in the field of cancer nanomedicine (modified from200).

Chapter I: Introduction

6. References

1. Aminov, R. I. A brief history of the antibiotic era: Lessons learned and challenges for the future. Front. Microbiol. 1, 1–7 (2010). 2. Tan, S. Y. & Tatsumura, Y. Alexander Fleming (1881-1955): Discoverer of penicillin. Singapore Med J 56, 366–367 (2015). 3. Witkop, B. Paul Ehrlich and His Magic Bullets , Revisited Published by : American Philosophical Society Paul Ehrlich and His Magic Bullets-Revisited. Proc. Am. Phil. Soc. 143, 540–557 (1999). 4. Tan, S. Y. & Grimes, S. Paul Ehrlich (1854-1915): Man with the magic bullet. Singapore Med J 51, 842–843 (2010). 5. Valent, P. et al. Paul Ehrlich (1854-1915) and His Contributions to the Foundation and Birth of Translational Medicine. J Innate Immune 8, 111–120 (2016). 6. PEI Gesamtliste der Publikationen von Paul Ehrlich. Available at: http://www.pei.de/DE/institut/paul-ehrlich/publikationen-gesamtliste-paul- ehrlich/publikationen-gesamtliste-paul-ehrlich-node.html. (Accessed: 22nd June 2017) 7. Torre, L. A., Bray, F., Siegel, R. L. & Ferlay, J. Global Cancer Statistics , 2012. CA Cancer J Clin 65, 87–108 (2015). 8. WHO | Cancer. WHO (2017). Available at: http://www.who.int/mediacentre/factsheets/fs297/en/. (Accessed: 22nd June 2017) 9. Hanahan, D., Weinberg, R. A. & Francisco, S. The Hallmarks of Cancer. Cell 100, 57–70 (2000). 10. WHO | Cancer. WHO (2017). Available at: http://www.who.int/cancer/en/. (Accessed: 22nd June 2017) 11. Fortina, P. et al. Applications of nanoparticles to diagnostics and therapeutics in colorectal cancer. Trends Biotechnol. 25, 145–52 (2007). 12. Balmain, A. Cancer genetics : from Boveri and Mendel to microarrays. Nat Rev Cancer 1, 77– 82 (2001). 13. Hoeijmakers, J. H. J. Genome maintenance mechanisms for preventing cancer. Nature 411, 366–374 (2001). 14. Hanahan, D. & Weinberg, R. A. Review Hallmarks of Cancer : The Next Generation. Cell 144, 646–674 (2011). 15. Hillen, F. & Griffioen, A. W. Tumour vascularization : sprouting angiogenesis and beyond. Cancer Metastasis rev 489–502 (2007). 16. Danhier, F., Feron, O. & Préat, V. To exploit the tumor microenvironment: Passive and active tumor targeting of nanocarriers for anti-cancer drug delivery. J Control Release 148, 135–46 (2010). 17. Sawyers, C. Targeted cancer therapy. Nature 432, 294–7 (2004). 18. Longley, D. B., Harkin, D. P. & Johnston, P. G. 5-Fluorouracil: mechanisms of action and clinical strategies. Nat. Rev. Cancer 3, 330–338 (2003). 19. Jain, A. & Jain, S. K. In vitro and cell uptake studies for targeting of ligand anchored

Chapter I: Introduction

nanoparticles for colon tumors. Eur. J. Pharm. Sci. 35, 404–416 (2008). 20. Gold, P. & Freedman, S. O. Demonstration Of Tumor-Specific Antigens In Human Colonic Carcinomata By Immunological Tolerance And Absorption Techniques. J Exp Med 121, 439– 462 (1965). 21. Scott, A. M., Allison, J. P., Wolchok, J. D. & Hughes, H. Monoclonal antibodies in cancer therapy. Cancer Immun 12, 1–8 (2012). 22. Scott, A. M., Wolchok, J. D. & Old, L. J. Antibody therapy of cancer. Nat. Rev. Cancer 12, 278– 87 (2012). 23. Loureiro, L. R. et al. Challenges in antibody development against Tn and sialyl-Tn antigens. Biomolecules 5, 1783–1809 (2015). 24. Alberts, B. et al. Molecular Biology of the Cell: 4th Edition. J. Chem. Inf. Model. (2002). 25. Schrama, D., Reisfeld, R. a & Becker, J. C. Antibody targeted drugs as cancer therapeutics. Nat. Rev. Drug Discov. 5, 147–59 (2006). 26. Van Cutsem, E. et al. Cetuximab and Chemotherapy as Initial Treatment for Metastatic Colorectal Cancer. N Engl J Med 360, 1408–1417 (2009). 27. Fernando, N. H. & Hurwitz, H. I. Targeted therapy of colorectal cancer: clinical experience with bevacizumab. Oncologist 9, 11–8 (2004). 28. Weiner, G. J. Rituximab : mechanism of action. Semin Hematol 47, 115–123 (2010). 29. Trail, P. Antibody Drug Conjugates as Cancer Therapeutics. Antibodies 2, 113–129 (2013). 30. Koppe, M. J., Bleichrodt, R. P., Oyen, W. J. G. & Boerman, O. C. Radioimmunotherapy and colorectal cancer. Br. J. Surg. 92, 264–76 (2005). 31. Kraeber-Bodéré, F. et al. Radioimmunoconjugates for the Treatment of Cancer. Semin Oncol 41, 613–622 (2014). 32. Hamoudeh, M., Anas, M., Diab, R. & Fessi, H. Radionuclides delivery systems for nuclear imaging and radiotherapy of cancer ☆. Adv Drug Deliv Rev 60, 1329–1346 (2008). 33. Mintz, C. S. & Crea, R. Protein Scaffolds. Bioprocess Int 11, 40–48 (2013). 34. Schmidt, M. M. & Wittrup, K. D. A modeling analysis of the effects of molecular size and binding affinity on tumor targeting. Mol Cancer Ther 8, 2861–71 (2009). 35. Friedman, M. & Ståhl, S. Engineered affinity proteins for tumour-targeting applications. Biotechnol. Appl. Biochem. 53, 1–29 (2009). 36. Holliger, P. & Hudson, P. J. Engineered antibody fragments and the rise of single domains. Nat. Biotechnol 23, 1126–1136 (2008). 37. Muyldermans, S. Nanobodies: Natural Single-Domain Antibodies. Annu. Rev. Biochem. 82, 775–797 (2013). 38. Goldman, E. R. et al. Facile Generation of Heat-Stable Antiviral and Antitoxin Single Domain Antibodies from a Semisynthetic Llama Library. Anal. Chem. 78, 8245–8255 (2006). 39. Monegal, A. et al. Immunological applications of single-domain llama recombinant antibodies isolated from a na??ve library. Protein Eng. Des. Sel. 22, 273–280 (2009).

Chapter I: Introduction

40. Hassanzadeh-Ghassabeh, G., Devoogdt, N., De Pauw, P., Vincke, C. & Muyldermans, S. Nanobodies and their potential applications. Nanomedicine 8, 1013–1026 (2013). 41. Vaneycken, I. et al. Immuno-imaging using nanobodies. Curr. Opin. Biotechnol. 22, 877–81 (2011). 42. Dumoulin, M. et al. Single-domain antibody fragments with high conformational stability. Protein Sci. 11, 500–515 (2009). 43. Wurch, T., Pierré, A. & Depil, S. Novel protein scaffolds as emerging therapeutic proteins: from discovery to clinical proof-of-concept. Trends Biotechnol. 30, 575–82 (2012). 44. Koide, S. Engineering of recombinant crystallization chaperones. Curr. Opin. Struct. Biol. 19, 449–457 (2009). 45. Manglik, A., Kobilka, B. K. & Steyaert, J. Nanobodies to Study G Protein–Coupled Receptor Structure and Function. Annu. Rev. Pharmacol. Toxicol. 57, 19–37 (2017). 46. Ablynx. Overview. (2017). Available at: http://www.ablynx.com/rd-portfolio/overview/. (Accessed: 23rd June 2017) 47. Ablynx. Clinical Programmes. (2017). Available at: http://www.ablynx.com/rd- portfolio/clinical-programmes/. (Accessed: 23rd June 2017) 48. Gebauer, M. & Skerra, A. Engineered protein scaffolds as next-generation antibody therapeutics. Curr. Opin. Chem. Biol. 13, 245–55 (2009). 49. Owens, B. Faster, deeper, smaller—the rise of antibody-like scaffolds. Nat. Biotechnol 35, 602–603 (2017). 50. Nygren, P. Å. & Skerra, A. Binding proteins from alternative scaffolds. J. Immunol. Methods 290, 3–28 (2004). 51. Skrlec, K., Strukelj, B. & Berlec, A. Non-immunoglobulin scaffold: a focus on their targets. Trends Biotechnol. 33, 408–418 (2015). 52. Traxlmayr, M. W. et al. Strong enrichment of aromatic residues in binding sites from a charge- neutralized hyperthermostable Sso7D scaffold library. J. Biol. Chem. 291, 22496–22508 (2016). 53. Lomonosova, A. V. et al. Derivative of Extremophilic 50S Ribosomal Protein L35Ae as an Alternative Protein Scaffold. PLoS One 12, e0170349 (2017). 54. Grönwall, C. & Ståhl, S. Engineered affinity proteins--generation and applications. J. Biotechnol. 140, 254–69 (2009). 55. Barbas Iii, C. F., Kang, A. S., Lerner, R. A. & Benkovict, S. J. Assembly of combinatorial antibody libraries on phage surfaces: The gene III site. Proc. Natl. Acad. Sci. USA 88, 7978–7982 (1991). 56. Boder, E. T. & Wittrup, K. D. Yeast surface display for screening combinatorial polypeptide libraries. Nat. Biotechnol. 15, 553–7 (1997). 57. Daugherty, P. S., Chen, G., Olsen, M. J., Iverson, B. L. & Georgiou, G. Antibody affinity maturation using bacterial surface display. Protein Eng. 11, 825–32 (1998). 58. Harvey, B. R. et al. Anchored periplasmic expression, a versatile technology for the isolation of high-affinity antibodies from Escherichia coli-expressed libraries. Proc. Natl. Acad. Sci. 101, 9193–9198 (2004).

Chapter I: Introduction

59. Roberts, R. W. Totally in vitro protein selection using mRNA-protein fusions and ribosome display. Curr. Opin. Chem. Biol. 3, 268–273 (1999). 60. Mattheakis, L. C., Bhatt, R. R. & Dower, W. J. An in vitro polysome display system for identifying ligands from very large peptide libraries. Proc. Natl. Acad. Sci. U. S. A. 91, 9022–6 (1994). 61. Hanes, J. & Plückthun, a. In vitro selection and evolution of functional proteins by using ribosome display. Proc. Natl. Acad. Sci. U. S. A. 94, 4937–42 (1997). 62. Zahnd, C., Amstutz, P. & Plückthun, A. Ribosome display : selecting and evolving proteins in vitro that specifically bind to a target. Nat. Methods 4, 269–279 (2007). 63. Plückthun, A. Ribosome Display: A Perspective. Methods Mol. Biol. 805, 3–28 (2012). 64. Nemoto, N., Miyamoto-Sato, E., Husimi, Y. & Yanagawa, H. In vitro virus: Bonding of mRNA bearing puromycin at the 3’-terminal end to the C-terminal end of its encoded protein on the ribosome in vitro. FEBS Lett. 414, 405–408 (1997). 65. Koch, H., Gräfe, N., Schiess, R. & Plückthun, A. Direct selection of antibodies from complex libraries with the protein fragment complementation assay. J. Mol. Biol. 357, 427–441 (2006). 66. Parrish, J. R., Gulyas, K. D. & Finley, R. L. Yeast two-hybrid contributions to interactome mapping. Curr. Opin. Biotechnol. 17, 387–393 (2006). 67. Li, J., Mahajan, A. & Tsai, M.-D. Ankyrin Repeat: A Unique Motif Mediating Protein-Protein Interactions. Biochemistry 45, 15168–15178 (2006). 68. Kohl, A. et al. Designed to be stable: Crystal structure of a consensus ankyrin repeat protein. Proc. Natl. Acad. Sci. 100, 1700–1705 (2003). 69. Binz, H. K., Stumpp, M. T., Forrer, P., Amstutz, P. & Plückthun, A. Designing Repeat Proteins: Well-expressed, Soluble and Stable Proteins from Combinatorial Libraries of Consensus Ankyrin Repeat Proteins. J. Mol. Biol. 332, 489–503 (2003). 70. Stumpp, M. T., Binz, H. K. & Amstutz, P. DARPins: a new generation of protein therapeutics. Drug Discov. Today 13, 695–701 (2008). 71. Schilling, J., Schöppe, J. & Plückthun, A. From DARPins to LoopDARPins : Novel LoopDARPin Design Allows the Selection of Low Picomolar Binders in a Single Round of Ribosome Display. J. Mol. Biol. 426, 691–721 (2014). 72. Plückthun, A. Designed Ankyrin Repeat Proteins (DARPins): Binding Proteins for Research, Diagnostics, and Therapy. Annu Rev Pharmacol Toxicol 55, 489–511 (2015). 73. Martin-Killias, P. et al. A novel fusion toxin derived from an EpCAM-specific designed ankyrin repeat protein has potent antitumor activity. Clin. Cancer Res. 17, 100–10 (2011). 74. Boersma, Y. L., Chao, G., Steiner, D., Wittrup, K. D. & Plückthun, A. Bispecific designed ankyrin repeat proteins (DARPins) targeting epidermal growth factor receptor inhibit A431 cell proliferation and receptor recycling. J. Biol. Chem. 286, 41273–85 (2011). 75. Jost, C. et al. Article Structural Basis for Eliciting a Cytotoxic Effect in HER2-Overexpressing Cancer Cells via Binding to the Extracellular Domain of HER2. Structure 21, 1979–1991 (2013). 76. Souied, E. H. et al. Treatment of Exudative Age-Related Macular Degeneration with a Designed Ankyrin Repeat Protein that Binds Vascular Endothelial Growth Factor: a Phase I/II Study. Am. J. Ophthalmol. 158, 724–732.e2 (2014).

Chapter I: Introduction

77. Middleton, M. R. et al. Interim results from the completed first-in-human phase I dose escalation study evaluating MP0250, a multi-DARPin® blocking HGF and VEGF, in patients with advanced solid tumors. Ann. Oncol. 27, (2016). 78. MP0250/MP0274 - Molecular Partners. (2017). Available at: https://www.molecularpartners.com/our-products/mp0250mp0274/. (Accessed: 23rd June 2017) 79. Vazquez-Lombardi, R. et al. Challenges and opportunities for non-antibody scaffold drugs. Drug Discov Today 20, 1271–1283 (2015). 80. Nilsson, B. et al. A synthetic IgG-binding domain based on staphylococcal protein A. Protein Eng 1, 107–13 (1987). 81. Nord, K., Nilsson, J., Nilsson, B., Uhl?n, M. & Nygren, P.-?ke. A combinatorial library of an alpha-helical bacterial receptor domain. Protein Eng Des Sel 8, 601–608 (1995). 82. Grimm, S., Yu, F. & Nygren, P. Å. Ribosome display selection of a murine IgG1 fab binding affibody molecule allowing species selective recovery of monoclonal antibodies. Mol. Biotechnol. 48, 263–276 (2011). 83. Kronqvist, N., Lofblom, J., Jonsson, A., Wernerus, H. & Stahl, S. A novel affinity protein selection system based on staphylococcal cell surface display and flow cytometry. Protein Eng Des Sel 21, 247–255 (2008). 84. Orlova, A. et al. Tumor imaging using a picomolar affinity HER2 binding Affibody molecule. Cancer Res. 66, 4339–4348 (2006). 85. Nygren, P. Å. Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold. FEBS J. 275, 2668–2676 (2008). 86. Löfblom, J. et al. Affibody molecules: engineered proteins for therapeutic, diagnostic and biotechnological applications. FEBS Lett 584, 2670–2680 (2010). 87. Fleetwood, F. et al. Novel affinity binders for neutralization of vascular endothelial growth factor (VEGF) signaling. Cell. Mol. Life Sci. 73, 1671–1683 (2016). 88. Frejd, F. Y. & Kim, K.-T. Affibody molecules as engineered protein drugs. Exp. Mol. Med. 49, e306 (2017). 89. Ståhl, S. et al. Affibody Molecules in Biotechnological and Medical Applications. Trends Biotechnol. 35, 691–712 (2017). 90. Tolmachev, V. et al. Affibody molecules: potential for in vivo imaging of molecular targets for cancer therapy. Expert Opin. Biol. Ther. 7, 555–568 (2007). 91. Orlova, A., Wallberg, H., Stone-Elander, S. & Tolmachev, V. On the Selection of a Tracer for PET Imaging of HER2-Expressing Tumors: Direct Comparison of a 124I-Labeled Affibody Molecule and Trastuzumab in a Murine Xenograft Model. J Nucl Med 50, 417–425 (2009). 92. Tolmachev, V. et al. Radionuclide therapy of HER2-positive microxenografts using a 177Lu- labeled HER2-specific affibody molecule. Cancer Res. 67, 2773–2782 (2007). 93. Fleetwood, F. et al. Simultaneous targeting of two ligand-binding sites on VEGFR2 using biparatopic Affibody molecules results in dramatically improved affinity. Sci. Rep. 4, 7518 (2014). 94. Nishimura, Y., Ezawa, R., Ishii, J., Ogino, C. & Kondo, A. Affibody-displaying bio-nanocapsules

Chapter I: Introduction

effective in EGFR, typical biomarker, expressed in various cancer cells. Bioorg Med Chem Lett 27, 336–341 (2017). 95. Zhang, Y. et al. DNA–affibody nanoparticles for inhibiting breast cancer cells overexpressing HER2. Chem. Commun. 53, 573–576 (2017). 96. Alavizadeh, S. H., Akhtari, J., Badiee, A., Golmohammadzadeh, S. & Jaafari, M. R. Improved therapeutic activity of HER2 Affibody-targeted cisplatin liposomes in HER2-expressing breast tumor models. Expert Opin Drug Deliv 13, 325–336 (2016). 97. Yang, H. et al. Nanobubble–Affibody: Novel ultrasound contrast agents for targeted molecular ultrasound imaging of tumor. Biomaterials 37, 279–288 (2015). 98. Lu, N. et al. Smart Cancer Cell Targeting Imaging and Drug Delivery System by Systematically Engineering Periodic Mesoporous Organosilica Nanoparticles. ACS Appl Mater Interfaces 8, 2985–2993 (2016). 99. Baum, R. P. et al. Molecular imaging of HER2-expressing malignant tumors in breast cancer patients using synthetic 111In- or 68Ga-labeled affibody molecules. J. Nucl. Med. 51, 892–7 (2010). 100. Sorensen, J. et al. Measuring HER2-Receptor Expression In Metastatic Breast Cancer Using [68Ga]ABY-025 Affibody PET/CT. Theranostics 6, 262–271 (2016). 101. Gebauer, M. & Skerra, A. Chapter seven - Anticalins: Small Engineered Binding Proteins Based on the Lipocalin Scaffold. Methods Enzymol. 503, 157–188 (2012). 102. Skerra, A. Anticalins: a new class of engineered ligand-binding proteins with antibody-like properties. Rev. Mol. Biotechnol. 74, 257–275 (2001). 103. Richter, A., Eggenstein, E. & Skerra, A. Anticalins: Exploiting a non-Ig scaffold with hypervariable loops for the engineering of binding proteins. FEBS Lett 588, 213–218 (2014). 104. Mross, K. et al. First-in-human phase i study of PRS-050 (Angiocal), an anticalin targeting and antagonizing VEGF-A, in patients with advanced solid tumors. PLoS One 8, 1–11 (2013). 105. PRS-080 :: Pieris Pharmaceuticals, Inc. (PIRS). (2017). Available at: http://www.pieris.com/pipeline/anemia-and-other-disease-areas/prs-080. (Accessed: 23rd June 2017) 106. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc Natl Acad Sci USA 104, 17983–17988 (2007). 107. Pecorari, F. & Alzari, P. M. OB-fold used as scaffold for engineering new specific binders. Pat. Publ. Nos. PCT/IB2007/004388 (2008). 108. McAfee, J. G., Edmondson, S. P., Datta, P. K., Shriver, J. W. & Gupta, R. Gene Cloning , Expression , and Characterization of the Sac7 Proteins from the Hyperthermophile Sulfolobus acidocaldarius. Biochemistry 34, 10063–10077 (1995). 109. Baumann, H., Knapp, S., Karshikoff, A., Ladenstein, R. & Ha, T. DNA-binding Surface of the Sso7d Protein from Sulfolobus solfataricus. J Mol Biol 247, 840–846 (1995). 110. McCrary, B. S., Edmondson, S. P. & Shriver, J. W. Hyperthermophile Protein Folding Thermodynamics: Differential Scanning Calorimetry and Chemical Denaturation of Sac7d. J. Mol. Biol. 264, 784–805 (1996). 111. Catanzano, F., Graziano, G., Fusi, P., Tortora, P. & Barone, G. Differential Scanning Calorimetry

Chapter I: Introduction

Study of the Thermodynamic Stability of Some Mutants of Sso7d from Sulfolobus solfataricus†. Biochemistry 37, 10493–10498 (1998). 112. Béhar, G. et al. Tolerance of the archaeal Sac7d scaffold protein to alternative library designs: characterization of anti-immunoglobulin G Affitins. Protein Eng. Des. Sel. 26, 267–75 (2013). 113. Béhar, G., Pacheco, S., Maillasson, M., Mouratou, B. & Pecorari, F. Switching an anti-IgG binding site between archaeal extremophilic proteins results in Affitins with enhanced pH stability. J Biotechnol 192, 123–129 (2014). 114. Su, S. et al. Crystal structures of the chromosomal proteins Sso7d/Sac7d bound to DNA containing T-G mismatched base-pairs. J. Mol. Biol. 303, 395–403 (2000). 115. Ishino, S. & Ishino, Y. DNA polymerases as useful reagents for biotechnology - The history of developmental research in the field. Front. Microbiol. 5, 1–8 (2014). 116. Correa, A. et al. Potent and specific inhibition of glycosidases by small artificial binding proteins (affitins). PLoS One 9, e97438 (2014). 117. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc. Natl. Acad. Sci. U.S.A. 104, 17983–8 (2007). 118. Krehenbrink, M. et al. Artificial Binding Proteins ( Affitins ) as Probes for Conformational Changes in Secretin PulD. J Mol Biol 383, 1058–1068 (2008). 119. Buddelmeijer, N., Krehenbrink, M. & Pugsley, A. P. Type II Secretion System Secretin PulD Localizes in Clusters in the Escherichia coli Outer Membrane. J Bacteriol 191, 161–168 (2009). 120. Cinier, M. et al. Bisphosphonate Adaptors for Specific Protein Binding on Zirconium Phosphonate-based Microarrays. Bioconjug Chem 20, 2270–2277 (2009). 121. Mouratou, B., Béhar, G. & Pecorari, F. Artificial Affinity Proteins as Ligands of Immunoglobulins. Biomolecules 5, 60–75 (2015). 122. Matous, E. Développement d’une Affitin anti-CD138 comme nouvel outil pour l’imagerie phénotypique. Dr. thesis (2014). 123. Affilogic. Pipeline: antibody-mimetics in Inflammation, Oncology, ... (2017). Available at: http://www.affilogic.com/pipeline. (Accessed: 23rd June 2017) 124. Miranda, F. F., Brient-Litzler, E., Zidane, N., Pecorari, F. & Bedouelle, H. Reagentless fluorescent biosensors from artificial families of antigen binding proteins. Biosens Bioelectron 26, 4190 (2011). 125. Cinier, M. et al. Engineering of a phosphorylatable tag for specific protein binding on zirconium phosphonate based microarrays. J. Biol. Inorg. Chem. 17, 399–407 (2012). 126. Goux, M., Fateh, A., Defontaine, A., Cinier, M. & Tellier, C. In vivo phosphorylation of a peptide tag for protein purification. Biotechnol. Lett. 38, 767–772 (2016). 127. Huet, S., Gorre, H., Perrocheau, A., Picot, J. & Cinier, M. Use of the nanofitin alternative scaffold as a GFP-ready fusion tag. PLoS One 10, 1–17 (2015). 128. Roque, A. C. A., Silva, C. S. O. & Taipa, M. A. Affinity-based methodologies and ligands for antibody purification: Advances and perspectives. J. Chromatogr. A 1160, 44–55 (2007). 129. Béhar, G., He, X., Mouratou, B. & Pecorari, F. Affitins as robust tailored reagents for affinity chromatography purification of antibodies and non-immunoglobulin proteins. J Chromatogr

Chapter I: Introduction

1441, 44–51 (2016). 130. Horák, D., Babič, M., Macková, H. & Beneš, M. J. Preparation and properties of magnetic nano- and microsized particles for biological and environmental separations. J Sep Sci 30, 1751–1772 (2007). 131. Fernandes, C. S. M. et al. Affitins for protein purification by affinity magnetic fishing. J Chromatogr A 1457, 50–58 (2016). 132. Pacheco, S., Béhar, G., Maillasson, M., Mouratou, B. & Pecorari, F. Affinity transfer to the archaeal extremophilic Sac7d protein by insertion of a CDR. Protein Eng. Des. Sel. 27, 431–8 (2014). 133. Gera, N., Hussain, M., Wright, R. C. & Rao, B. M. Highly stable binding proteins derived from the hyperthermophilic Sso7d scaffold. J. Mol. Biol. 409, 601–616 (2011). 134. Gera, N., Hill, A. B., White, D. P., Carbonell, R. G. & Rao, B. M. Design of pH Sensitive Binding Proteins from the Hyperthermophilic Sso7d Scaffold. PLoS One 7, e48928 (2012). 135. Zhao, N., Schmitt, M. A. & Fisk, J. D. Phage display selection of tight specific binding variants from a hyperthermostable Sso7d scaffold protein library. FEBS J. 283, 1351–1367 (2016). 136. Miller, E. A., Traxlmayr, M. W., Shen, J. & Sikes, H. D. Activity-based assessment of an engineered hyperthermophilic protein as a capture agent in paper-based diagnostic tests. Mol. Syst. Des. Eng. 1, 377–381 (2016). 137. Herlyn, M., Steplewski, Z., Herlyn, D. & Koprowski, H. Colorectal carcinoma-specific antigen : Detection by means of monoclonal antibodies. Proc Natl Acad Sci USA 76, 1438–1442 (1979). 138. Litvinov, S. V & Bakker, H. A. M. Ep-CAM: A Human Epithelial Antigen Is a Homophilic Cell- Cell Adhesion Molecule. J Cell Biol 125, 437–446 (1994). 139. Balzar, M., Winter, M. J., de Boer, C. J. & Litvinov, S. V. The biology of the 17 – 1A antigen ( Ep-CAM ). J Mol Med 77, 699–712 (1999). 140. Went, P. T. H. et al. Frequent EpCam Protein Expression in Human Carcinomas. Hum Pathol 35, 122–128 (2004). 141. Spizzo, G. et al. EpCAM expression in primary tumour tissues and metastases : an immunohistochemical analysis. J Clin Pathol 64, 415–421 (2011). 142. Münz, M. et al. The carcinoma-associated antigen EpCAM upregulates c-myc and induces cell proliferation. Oncogene 23, 5748–58 (2004). 143. Baeuerle, P. a & Gires, O. EpCAM (CD326) finding its role in cancer. Br. J. Cancer 96, 417–23 (2007). 144. Trzpis, M., McLaughlin, P. M. J., de Leij, L. M. F. H. & Harmsen, M. C. Epithelial Cell Adhesion Molecule. Am. J. Pathol. 171, 386–395 (2007). 145. Carpenter, G. & Brewer, M. R. Previews EpCAM : Another Surface-to-Nucleus Missile. Cancer Cell 15, 165–166 (2009). 146. van der Gun, B. T. F. et al. EpCAM in carcinogenesis: the good, the bad or the ugly. Carcinogenesis 31, 1913–21 (2010). 147. Vasanthakumar, S. et al. EpCAM as a novel therapeutic target for hepatocellular carcinoma. J Oncol Sci 3 3, 71–76 (2017).

Chapter I: Introduction

148. Schnell, U., Cirulli, V. & Giepmans, B. N. G. EpCAM: structure and function in health and disease. Biochim. Biophys. Acta 1828, 1989–2001 (2013). 149. Strnad, J. et al. Molecular Cloning and Characterization of a Human Adenocarcinoma / Epithelial Cell Surface Antigen Complementary DNA. Cancer Res 49, 314–317 (1989). 150. Schnell, U., Kuipers, J. & Giepmans, B. N. G. EpCAM proteolysis : new fragments with distinct functions ? Biosci Rep 33, e00030 (2013). 151. Kuhn, S. et al. A complex of EpCAM, claudin-7, CD44 variant isoforms, and tetraspanins promotes colorectal cancer progression. Mol. Cancer Res. 5, 553–67 (2007). 152. Wu, C., Mannan, P., Lu, M. & Udey, M. C. Epithelial Cell Adhesion Molecule ( EpCAM ) Regulates Claudin Dynamics and Tight Junctions. J Biol Chem 288, 12253–12268 (2013). 153. Pavšič, M., Gunčar, G., Djinović-Carugo, K. & Lenarčič, B. Crystal structure and its bearing towards an understanding of key biological functions of EpCAM. Nat Commun 5, 4764 (2014). 154. Trebak, M. et al. Oligomeric State of the Colon Carcinoma-associated Glycoprotein GA733-2 ( Ep-CAM / EGP40 ) and Its Role in GA733-mediated Homotypic Cell-Cell Adhesion. J Biol Chem 276, 2299–2309 (2001). 155. Balzar, M. et al. Cytoplasmic Tail Regulates the Intercellular Adhesion Function of the Epithelial Cell Adhesion Molecule. Mol. Cell. Biol. 18, 4833–4843 (1998). 156. Terris, B., Cavard, C. & Perret, C. EpCAM, a new marker for cancer stem cells in hepatocellular carcinoma. J. Hepatol. 52, 280–1 (2010). 157. Biomarkers Definitions Working Group. Biomarkers and surrogate endpoints: Preferred definitions and conceptual framework. Clin Pharmacol Ther 69, 89–95 (2001). 158. Munz, M., Baeuerle, P. A. & Gires, O. The Emerging Role of EpCAM in Cancer and Stem Cell Signaling. Cancer Res 69, 5627–5630 (2009). 159. Imrich, S., Hachmeister, M. & Gires, O. EpCAM and its potential role in tumor-initiating cells. Cell Adhes Migr 6, 30–38 (2012). 160. Allard, W. J. et al. Tumor Cells Circulate in the Peripheral Blood of All Major Carcinomas but not in Healthy Subjects or Patients With Nonmalignant Diseases. Clin Cancer Res 10, 6897– 6904 (2004). 161. Kim, Y. J. et al. A microchip filter device incorporating slit arrays and 3-D flow for detection of circulating tumor cells using CAV1-EpCAM conjugated microbeads. Biomaterials 35, 7501– 7510 (2014). 162. Massoner, P. et al. EpCAM is overexpressed in local and metastatic prostate cancer, suppressed by chemotherapy and modulated by MET-associated miRNA-200c/205. Br J Cancer 111, 955–964 (2014). 163. Yang, J. & Weinberg, R. A. Epithelial-Mesenchymal Transition: At the Crossroads of Development and Tumor Metastasis. J Dev Cell 14, 818–829 (2008). 164. Brabletz, T. EMT and MET in Metastasis: Where Are the Cancer Stem Cells? Cancer Cell 22, 699–701 (2012). 165. Driemel, C. et al. Context-dependent adaption of EpCAM expression in early systemic esophageal cancer. Oncogene 33, 4904–4915 (2014).

Chapter I: Introduction

166. Königsberg, R. et al. Detection of EpCAM positive and negative circulating tumor cells in metastatic breast cancer patients. Acta Oncol. 50, 700–10 (2011). 167. Martowicz, A. et al. EpCAM overexpression prolongs proliferative capacity of primary human breast epithelial cells and supports hyperplastic growth. Mol. Cancer 12, 56 (2013). 168. Schnell, U., Cirulli, V. & Giepmans, B. N. G. EpCAM: structure and function in health and disease. Biochim. Biophys. Acta 1828, 1989–2001 (2013). 169. Maetzel, D. et al. Nuclear signalling by tumour-associated antigen EpCAM. Nat. Cell Biol. 11, 162–71 (2009). 170. Maaser, K. & Borlak, J. A genome-wide expression analysis identifies a network of EpCAM- induced cell cycle regulators. B J Cancer 99, 1635–1643 (2008). 171. Selbo, P. K., Sivam, G., Fodstad, O., Sandvig, K. & Berg, K. Photochemical internalisation increases the cytotoxic effect of the immunotoxin MOC31-gelonin. Int J Cancer 87, 853–859 (2000). 172. Stefan, N. et al. DARPins recognizing the tumor-associated antigen EpCAM selected by phage and ribosome display and engineered for multivalency. J Mol Biol 413, 826–43 (2011). 173. Winkler, J., Martin-Killias, P., Plückthun, A. & Zangemeister-Wittke, U. EpCAM-targeted delivery of nanocomplexed siRNA to tumor cells with designed ankyrin repeat proteins. Mol Cancer Ther 8, 2674–83 (2009). 174. Bhavsar, D., Subramanian, K., Sethuraman, S. & Krishnan, U. M. EpCAM-targeted liposomal si-RNA delivery for treatment of epithelial cancer. Drug Deliv. 7544, 1–14 (2014). 175. Simon, M., Stefan, N., Plückthun, A. & Zangemeister-Wittke, U. Epithelial cell adhesion molecule-targeted drug delivery for cancer therapy. Expert Opin Drug Deliv 10, 451–468 (2013). 176. Sears, H. F., Herlyn, D., Steplewski, Z. & Koprowski, H. Effects of monoclonal antibody immunotherapy on patients with gastrointestinal adenocarcinoma. J Biol Response Mod 3, 138–50 (1984). 177. Riethmüller, G. Randomised trial of monoclonal antibody for adjuvant therapy of resected Dukes’ C colorectal carcinoma. Lancet 343, 1177–1183 (1994). 178. Riethmüller, G. et al. Monoclonal antibody therapy for resected Dukes’ C colorectal cancer: seven-year outcome of a multicenter randomized trial. J. Clin. Oncol. 16, 1788–94 (1998). 179. Schmoll, H., Arnold, D. & Medicine, I. When Wishful Thinking Leads to a Misty-Eyed Appraisal : The Story of the Adjuvant Colon Cancer Trials With Edrecolomab. J Clin Oncol 27, 1926–1929 (2017). 180. Gires, O., Klein, C. a & Baeuerle, P. a. On the abundance of EpCAM on cancer stem cells. Nat Rev Cancer 9, 143 (2009). 181. Münz, M. et al. Side-by-side analysis of five clinically tested anti-EpCAM monoclonal antibodies. Cancer Cell Int. 10, 44 (2010). 182. Schmidt, M. et al. An open-label, randomized phase II study of adecatumumab, a fully human anti-EpCAM antibody, as monotherapy in patients with metastatic breast cancer. Ann. Oncol. 21, 275–82 (2010). 183. Ott, M. G. et al. Humoral response to catumaxomab correlates with clinical outcome : results

100

Chapter I: Introduction

of the pivotal phase II / III study in patients with malignant ascites. Int J Cancer 2203, 2195– 2203 (2012). 184. Seimetz, D. et al. Development and approval of the trifunctional antibody catumaxomab (anti-EpCAM?anti-CD3) as a targeted cancer immunotherapy. Cancer Treat. Rev. 36, 458–467 (2010). 185. Willuda, J. et al. High thermal stability is essential for tumor targeting of antibody fragments. Cancer Res 59, 5758–5767 (1999). 186. Liao, M. et al. An anti-EpCAM antibody EpAb2-6 for the treatment of colon cancer. Oncotarget 6, 24947–24968 (2015). 187. Liao, M., Kuo, M. Y., Lu, T., Wang, Y. & Wu, H. Generation of an anti-EpCAM antibody and epigenetic regulation of EpCAM in colorectal cancer. Int J Oncol 46, 1788–1800 (2015). 188. Shigdar, S. et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci. 102, 991–998 (2011). 189. Subramanian, N. et al. EpCAM aptamer mediated cancer cell specific delivery of EpCAM siRNA using polymeric nanocomplex. J Biomed Sci 22, 1–10 (2015). 190. Wang, T. et al. EpCAM Aptamer-mediated Survivin Silencing Sensitized Cancer Stem Cells to Doxorubicin in a Breast Cancer Model. Theranostics 5, 1456–1472 (2015). 191. Xie, X. et al. European Journal of Pharmaceutical Sciences EpCAM aptamer-functionalized mesoporous silica nanoparticles for ef fi cient colon cancer cell-targeted drug delivery. PHASCI 83, 28–35 (2016). 192. Martin-Killias, P., Stefan, N., Rothschild, S., Plückthun, A. & Zangemeister-Wittke, U. A novel fusion toxin derived from an EpCAM-specific designed ankyrin repeat protein has potent antitumor activity. Clin. Cancer Res. 17, 100–110 (2011). 193. Simon, M., Zangemeister-Wittke, U. & Plückthun, A. Facile double-functionalization of designed ankyrin repeat proteins using click and thiol chemistries. Bioconjug. Chem. 23, 279– 286 (2012). 194. Simon, M., Stefan, N., Borsig, L., Plückthun, A. & Zangemeister-Wittke, U. Increasing the antitumor effect of an EpCAM-targeting fusion toxin by facile click PEGylation. Mol. Cancer Ther. 13, 375–85 (2014). 195. Simon, M., Frey, R., Zangemeister-Wittke, U. & Plückthun, A. Orthogonal assembly of a designed ankyrin repeat protein-cytotoxin conjugate with a clickable serum albumin module for half-life extension. Bioconjug. Chem. 24, 1955–66 (2013). 196. Feynman, R. There is plenty of room at the bottom. Eng Sci 23, 22–36 (1960). 197. Hare, J. I. et al. Challenges and strategies in anti-cancer nanomedicine development: An industry perspective. Adv. Drug Deliv. Rev. 108, 25–38 (2017). 198. What is Nanotechnology? | Nano. NNI (2017). Available at: https://www.nano.gov/nanotech-101/what/definition. (Accessed: 4th July 2017) 199. Ventola, C. L., Bharali, D. J. & Mousa, S. A. The Nanomedicine Revolution: Part 1: Emerging Concepts. Pharmacy and Therapeutics. Pharmacol. Ther. 128, 512–525 (2010). 200. Shi, J., Kantoff, P. W., Wooster, R. & Farokhzad, O. C. Cancer nanomedicine: progress, challenges and opportunities. Nat. Rev. Cancer 17, 20–37 (2016).

101

Chapter I: Introduction

201. Sutradhar, K. B. & Amin, M. L. Nanotechnology in Cancer Drug Delivery and Selective Targeting. ISRN Nanotechnol. 2014, 1–12 (2014). 202. Venditto, V. J. & Szoka, F. C. Cancer nanomedicines: So many papers and so few drugs! Adv. Drug Deliv. Rev. 65, 80–88 (2013). 203. Wilczewska, A. Z., Niemirowicz, K., Markiewicz, K. H. & Car, H. Nanoparticles as drug delivery systems. Pharmacol. Rep. 64, 1020–37 (2012). 204. Danhier, F. et al. PLGA-based nanoparticles: an overview of biomedical applications. J Control Release 161, 505–22 (2012). 205. Mirakabad, F. S. T. et al. PLGA-based nanoparticles as cancer drug delivery systems. Asian Pac J Cancer Prev 15, 517–535 (2014). 206. Park, J. W. Liposome-based drug delivery in breast cancer treatment. Breast Cancer Res. 4, 95–99 (2002). 207. Haley, B. & Frenkel, E. Nanoparticles for drug delivery in cancer treatment. Urol oncol 26, 57– 64 (2008). 208. Müller, R. H., Radtke, M. & Wissing, S. A. Nanostructured lipid matrices for improved microencapsulation of drugs. Int J Pharm 242, 121–8 (2002). 209. Huynh, N. T., Passirani, C., Saulnier, P. & Benoit, J. P. Lipid nanocapsules: A new platform for nanomedicine. Int J Pharm 379, 201–209 (2009). 210. Liu, L. et al. A New Method for Preparing Mesenchymal Stem Cells and Labeling with Ferumoxytol for Cell Tracking by MRI. Sci. Rep. 6, 26271 (2016). 211. Issa, E. P. & Ramaswamy, S. in Magnetic Resonance Imaging in Tissue Engineering 71–89 (John Wiley & Sons, Inc., 2017). 212. Mozafari, M. R. et al. Role of nanocarrier systems in cancer nanotherapy. J Liposome Res 19, 310–321 (2009). 213. Xu, X., Ho, W., Zhang, X., Bertrand, N. & Farokhzad, O. Cancer nanomedicine: From targeted delivery to combination therapy. Trends Mol. Med. 21, 223–232 (2015). 214. Gobbo, O. L., Sjaastad, K., Radomski, M. W., Volkov, Y. & Prina-Mello, A. Magnetic nanoparticles in cancer theranostics. Theranostics 5, 1249–1263 (2015). 215. Lima, K. M. G., Junior, R. F. A., Araujo, A. a., Oliveira, A. L. C. S. L. & Gasparotto, L. H. S. Environmentally compatible bioconjugated gold nanoparticles as efficient contrast agents for colorectal cancer cell imaging. Sens. Acuat B-Chem 196, 306–313 (2014). 216. Jain, A., Jain, S. K., Ganesh, N., Barve, J. & Beg, A. M. Design and development of ligand- appended polysaccharidic nanoparticles for the delivery of oxaliplatin in colorectal cancer. Nanomedicine NBM 6, 179–190 (2010). 217. Danhier, F. et al. Targeting of tumor endothelium by RGD-grafted PLGA-nanoparticles loaded with Paclitaxel. J Control Release 140, 166–173 (2009). 218. Matsumura, Y. & Maeda, H. A. A new concept for macromolecular therapeutics in cancer- chemotherapy - mechanism of tumoritropic acumulation of proteins and the antitumor agent Smancs. Cancer Res 46, 6387–6392. (1986). 219. Danhier, F. To exploit the tumor microenvironment: Since the EPR effect fails in the clinic,

102

Chapter I: Introduction

what is the future of nanomedicine? J. Control. Release 244, 108–121 (2016). 220. Bazak, R. et al. Cancer active targeting by nanoparticles: a comprehensive review of literature. J Cancer Res Clin Oncol 141, 769–784 (2015). 221. Peer, D. et al. Nanocarriers as an emerging platform for cancer therapy. Nat. Nanotechnol. 2, 751–760 (2007). 222. Gottesman, M. M., Fojo, T. & Bates, S. E. Multidrug resistance in cancer: role of ATP– dependent transporters. Nat Rev Cancer 2, 48–58 (2002). 223. Goren, D. et al. Nuclear Delivery of Doxorubicin via Folate-Targeted Liposomes With Bypass of Multidrug-Resistance Efflux Pump. Clin Cancer Res 6, 1949–1957 (2000). 224. Bar-Zeev, M., Livney, Y. D. & Assaraf, Y. G. Targeted Nanomedicine for Cancer Therapeutics: Towards Precision Medicine Overcoming Drug Resistance. Drug Resist Updat 31, 15–30 (2017). 225. Arranja, A. G., Pathak, V., Lammers, T. & Shi, Y. Tumor-targeted nanomedicines for cancer theranostics. Pharmacol. Res. 115, 87–95 (2017). 226. van der Meel, R., Lammers, T. & Hennink, W. E. Cancer nanomedicines: oversold or underappreciated? Expert Opin. Drug Deliv. 14, 1–5 (2017). 227. van der Meel, R., Vehmeijer, L. J. C., Kok, R. J., Storm, G. & van Gaal, E. V. B. Ligand-targeted particulate nanomedicines undergoing clinical evaluation: Current status. Adv. Drug Deliv. Rev. 65, 1284–1298 (2013). 228. Nagahara, L. A. et al. Strategic workshops on cancer nanotechnology. Cancer Res. 70, 4265– 4268 (2010). 229. Karmani, L. et al. Antibody-functionalized nanoparticles for imaging cancer: influence of conjugation to gold nanoparticles on the biodistribution of 89Zr-labeled cetuximab in mice. Contrast Media Mol Imaging 8, 402–8 (2013). 230. Tao, L. et al. Anti-epithelial cell adhesion molecule monoclonal antibody conjugated fluorescent nanoparticle biosensor for sensitive detection of colon cancer cells. Biosens Bioelectron 35, 186–92 (2012). 231. Sukhanova, A. et al. Oriented conjugates of single-domain antibodies and quantum dots: toward a new generation of ultrasmall diagnostic nanoprobes. Nanomedicine NBM 8, 516– 25 (2012). 232. Hafian, H. et al. Multiphoton imaging of tumor biomarkers with conjugates of single-domain antibodies and quantum dots. Nanomedicine NBM 10, 1701–9 (2014). 233. Rauscher, A. et al. Influence of pegylation and hapten location at the surface of radiolabelled liposomes on tumour immunotargeting using bispecific antibody. Nucl Med Biol 41, e66–e74 (2014). 234. Kumar, H., Kawai, T. & Akira, S. Pathogen Recognition by the Innate Immune System. Biochem. J. 420, 1–16 (2009). 235. Conniot, J. et al. Cancer immunotherapy: nanodelivery approaches for immune cell targeting and tracking. Front. Chem. 2, 1–27 (2014). 236. Danhier, F., Le Breton, A. & Preat, V. RGD-Based Strategies To Target Alpha(v) Beta(3) Integrin in Cancer Therapy and Diagnosis. Mol Pharma 9, 2961–2973 (2012).

103

Chapter I: Introduction

237. Yang, K.-N. et al. pH-responsive mesoporous silica nanoparticles employed in controlled drug delivery systems for cancer treatment. Cancer Biol. Med. 11, 34–43 (2014). 238. Schleich, N. et al. Comparison of active, passive and magnetic targeting to tumors of multifunctional paclitaxel/SPIO-loaded nanoparticles for tumor imaging and therapy. J. Control. Release 194, 82–91 (2014). 239. Heurtault, B., Saulnier, P., Pech, B., Proust, J. & Benoit, J. A Novel Phase Inversion-Based Process for the Preparation of Lipid Nanocarriers. Pharma Res 19, 875–880 (2002). 240. Minkov, I., Ivanova, T., Panaiotov, I., Proust, J. & Saulnier, P. Reorganization of lipid nanocapsules at air-water interface. Colloids Surf B Biointerfaces 44, 197–203 (2005). 241. Anton, N. et al. Aqueous-Core Lipid Nanocapsules for Encapsulating Fragile Hydrophilic and/or Lipophilic Molecules. Langmuir 25, 11413–11419 (2009). 242. Carradori, D., Saulnier, P., Preat, V., des Rieux, A. & Eyer, J. NFL-lipid nanocapsules for brain neural stem cell targeting in vitro and in vivo. J. Control. Release 238, 253–262 (2016). 243. Roger, E., Lagarce, F., Garcion, E. & Benoit, J. P. Reciprocal competition between lipid nanocapsules and P-gp for paclitaxel transport across Caco-2 cells. Eur. J. Pharm. Sci. 40, 422– 429 (2010). 244. Beduneau, A. et al. Brain targeting using novel lipid nanovectors. J Control Release 126, 44– 49 (2008). 245. Hoarau, D., Delmas, P., David, S., Roux, E. & Leroux, J.-C. Novel Long-Circulating Lipid Nanocapsules. Pharm Res 21, 1783–1789 (2004). 246. Khalid, M. N., Simard, P., Hoarau, D., Dragomir, A. & Leroux, J.-C. Long Circulating Poly(Ethylene Glycol)-Decorated Lipid Nanocapsules Deliver Docetaxel to Solid Tumors. Pharm Res 23, 752–758 (2006). 247. Béduneau, A. et al. Design of targeted lipid nanocapsules by conjugation of whole antibodies and antibody Fab’ fragments. Biomaterials 28, 4978–4990 (2007). 248. Bourseau-Guilmain, E. et al. Development and characterization of immuno-nanocarriers targeting the cancer stem cell marker AC133. Int. J. Pharm. 423, 93–101 (2012). 249. Hirsjärvi, S., Belloche, C., Hindré, F., Garcion, E. & Benoit, J. P. Tumour targeting of lipid nanocapsules grafted with cRGD peptides. Eur. J. Pharm. Biopharm. 87, 152–159 (2014). 250. David, S. et al. SiRNA LNCs - A novel platform of lipid nanocapsules for systemic siRNA administration. Eur. J. Pharm. Biopharm. 81, 448–452 (2012). 251. Resnier, P. et al. EGFR siRNA lipid nanocapsules efficiently transfect glioma cells in vitro. Int J Pharma 454, 748–755 (2013). 252. Resnier, P. et al. Efficient in vitro gene therapy with PEG siRNA lipid nanocapsules for passive targeting strategy in melanoma. Biotechnol. J. 9, 1389–1401 (2014). 253. Balzeau, J. et al. The effect of functionalizing lipid nanocapsules with NFL-TBS.40-63 peptide on their uptake by glioblastoma cells. Biomaterials 34, 3381–3389 (2013). 254. Singla, A. K., Garg, A. & Aggarwal, D. Paclitaxel and its formulations. Int. J. Pharm. 235, 179– 192 (2002). 255. Pillai, G. Nanomedicines for Cancer Therapy: An Update of FDA Approved and Those under

104

Chapter I: Introduction

Various Stages of Development. SOJ Pharm Pharm Sci 1, 13 (2014). 256. Damascelli, B. et al. Intraarterial chemotherapy with polyoxyethylated castor oil free paclitaxel, incorporated in albumin nanoparticles (ABI-007): Phase I study of patients with squamous cell carcinoma of the head and neck and anal canal: preliminary evidence of clinical activity. Cancer 92, 2592–602 (2001). 257. Dawidczyk, C. M. et al. State-of-the-art in design rules for drug delivery platforms: Lessons learned from FDA-approved nanomedicines. J. Control. Release 187, 133–144 (2014). 258. Sofias, A. M., Dunne, M., Storm, G. & Allen, C. The battle of ‘nano’ paclitaxel. Adv. Drug Deliv. Rev. (2016). 259. Danhier, F. et al. Paclitaxel-loaded PEGylated PLGA-based nanoparticles: in vitro and in vivo evaluation. J Control Release 133, 11–7 (2009). 260. Danhier, F. et al. Novel self-assembling PEG-p-(CL-co-TMC) polymeric micelles as safe and effective delivery system for paclitaxel. Eur. J. Pharm. Biopharm. 73, 230–8 (2009). 261. Danhier, F. et al. Paclitaxel-loaded micelles enhance transvascular permeability and retention of nanomedicines in tumors. Int. J. Pharm. 479, 399–407 (2015). 262. Simon-Gracia, L. et al. Paclitaxel-Loaded Polymersomes for Enhanced Intraperitoneal Chemotherapy. Mol. Cancer Ther. 15, 670–679 (2016). 263. Peltier, S., Oger, J. M., Lagarce, F., Couet, W. & Benoît, J. P. Enhanced oral paclitaxel bioavailability after administration of paclitaxel-loaded lipid nanocapsules. Pharm. Res. 23, 1243–1250 (2006). 264. Hureaux, J. et al. Toxicological study and efficacy of blank and paclitaxel-loaded lipid nanocapsules after i.v. administration in mice. Pharm. Res 27, 421–430 (2010). 265. Garcion, E. et al. A new generation of anticancer, drug-loaded, colloidal vectors reverses multidrug resistance in glioma and reduces tumor progression in rats. Mol. Cancer Ther. 5, 1710–1722 (2006). 266. Kruijtzer, C. M. F., Beijnen, J. H. & Schellens, J. H. M. Improvement of oral drug treatment by temporary inhibition of drug transporters and/or cytochrome P450 in the gastrointestinal tract and liver: An overview. Oncologist 7, 516–530 (2002). 267. Roger, E., Lagarce, F. & Benoit, J.-P. The gastrointestinal stability of lipid nanocapsules. Int J Pharma 379, 260–265 (2009). 268. Groo, A. C. et al. Fate of paclitaxel lipid nanocapsules in intestinal mucus in view of their oral delivery. Int. J. Nanomedicine 8, 4291–4302 (2013).

105

Chapter I: Introduction

106

Chapter II:

Aims of the thesis

Chapter II: Aims of the thesis

108

Chapter II: Aims of the thesis

Aims of the thesis

One of the well-established approaches against cancer is the recognition of tumour-associated antigens by different targeting ligands. Although monoclonal antibodies are the most widely used recognition molecules, they possess several limitations due to their large size, intricate structure, instability and high production cost. To address these issues, different alternative protein scaffolds, such as Affitins, have been developed1.

Affitins are highly stable engineered affinity proteins, developed by the group of Dr. Frédéric Pecorari2,3, patent: PCT/IB2007/004388). Originally derived from Sac7d (66 amino acids) and later Sso7d (64 amino acids), archaeal polypeptides from the 7 kDa DNA-binding family, these binders show comparable affinity and specificity to those of antibodies. In the same time, they are thermally and chemically more stable, cheaper to produce, present a simpler monomeric structure and 20-fold smaller size. However, Sac7d and Sso7d belong to an expanding protein family with novel sequences described as whole genome sequencing is developing. Thus, it is interesting to further explore this growing family for the identification of members that could potentially possess even more favourable properties to expand the arsenal of alternative affinity scaffolds.

A progressive addition to the strategies against cancer is the attachment of different tumour-targeting ligands to nanoparticles carrying a therapeutic or imaging agent. These targeted particles can not only protect the drug from rapid degradation, but also decrease its concentration in

109

Chapter II: Aims of the thesis

normal tissues. The group of Prof. Véronique Préat has experience in developing nanomedicines for targeted drug delivery4,5. Among the different nanoformulations studied in this laboratory are the lipid nanocapsules (LNCs) - prepared from FDA approved components by a solvent free process, they possess great stability and high efficiency for lipophilic drugs encapsulation6.

Thus, we hypothesised that combining the advantages of Affitins as targeting agents and LNCs as carriers may lead to the creation of vehicles effective for delivering payloads to cancer cells. To reach this goal, the following aims were set:

1. To study the archaeal 7kD DNA-binding family and identify a potential candidate for the generation of Affitins with improved properties (Chapter III). 2. To validate the chosen affinity scaffold by creating binders against EpCAM via ribosome display selection and to characterize them (Chapter IV). 3. To attach the new binders as affinity moieties to LNCs and to assess the tumour targeting of these complexes in vitro (Chapter V).

110

Chapter II: Aims of the thesis

References

1. Skrlec, K., Strukelj, B. & Berlec, A. Non-immunoglobulin scaffold: a focus on their targets. Trends Biotechnol. 33, 408–418 (2015). 2. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc Natl Acad Sci USA 104, 17983–17988 (2007). 3. Béhar, G., He, X., Mouratou, B. & Pecorari, F. Affitins as robust tailored reagents for affinity chromatography purification of antibodies and non-immunoglobulin proteins. J Chromatogr 1441, 44–51 (2016). 4. Danhier, F., Feron, O. & Préat, V. To exploit the tumor microenvironment: Passive and active tumor targeting of nanocarriers for anti-cancer drug delivery. J. Control. Release 148, 135–46 (2010). 5. Schleich, N. et al. Comparison of active, passive and magnetic targeting to tumors of multifunctional paclitaxel/SPIO-loaded nanoparticles for tumor imaging and therapy. J. Control. Release 194, 82–91 (2014). 6. Carradori, D., Saulnier, P., Preat, V., des Rieux, A. & Eyer, J. NFL-lipid nanocapsules for brain neural stem cell targeting in vitro and in vivo. J. Control. Release 238, 253–262 (2016).

111

Chapter II: Aims of the thesis

112

Chapter III:

The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

114

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Chapter III: Table of Contents

I. Introduction ...... 119 II. Materials and Methods ...... 122 II.1. Materials ...... 122 II.2. Protein production ...... 122 II.2. Detection of DNA-binding activity by Electrophoretic Mobility Shift Assay (EMSA) ...... 124 II.3. Affinity measurements by fluorescence ...... 124 II.4. ELISA ...... 126 II.6. Circular dichroism measurements ...... 127 II.7. Thermostability Measurements ...... 127 III. Results ...... 128 III.1. Choice of protein set and sequence alignment ...... 128 III.2. Production of soluble proteins ...... 131 III.3. DNA binding properties ...... 133 III.3.1. dsDNA binding activity ...... 133 III.3.2. Determination of affinity for dsDNA ...... 134 III.3.3. Sequence selectivity of proteins for dsDNA ...... 134 III.4. Biophysical properties of the proteins ...... 137 III.4.2. Circular dichroism spectra ...... 137 III.4.3. pH stability of the proteins ...... 138 III.4.4. Thermostability of the proteins ...... 138 IV. Discussion ...... 140 V. Acknowledgements ...... 145 VI. References ...... 146

115

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

116

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Kalichuk V., Béhar G., Renodon-Cornière A., Danovski G., Obal G., Barbet J., Mouratou B., Pecorari F. Adapted from Scientific Reports, 6:37274 (2016)

Abstract The “7 kDa DNA-binding” family, also known as the Sul7d family, is composed of chromatin proteins from the Sulfolobales archaeal order. Among them, Sac7d and Sso7d have been the focus of several studies with some characterization of their properties. Here, we studied eleven other proteins alongside Sac7d and Sso7d under the same conditions. The dissociation constants of the purified proteins for binding to double- stranded DNA (dsDNA) were determined in phosphate-buffered saline at 25°C and were in the range from 11 µM to 22 µM with a preference for G/C rich sequences. In accordance with the extremophilic origin of their hosts, the proteins were found highly stable from pH 0 to pH 12 and at temperatures from 85.5 °C to 100°C. Thus, these results validate eight putative “7 kDa DNA-binding” family proteins and show that they behave similarly regarding both their function and their stability among various genera and species. As Sac7d and Sso7d have found numerous uses as molecular biology reagents and artificial affinity proteins, this study also sheds light on even more attractive proteins that will facilitate engineering of novel highly robust reagents. Keywords

7 kDa DNA-binding protein, Sul7d, archaea, chromatin protein, Affitin.

117

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

118

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

I. Introduction

In living organisms, the long genomic DNA has to be packed in order to fit into cells, while the genetic information must stay accessible for replication and transcription events. To this aim, organisms have developed different compaction systems, such as the wrapping of DNA around histones to form the chromatin in Eukarya, and the supercoiling of DNA with the help of non-histone proteins to form the nucleoid in Bacteria. Archaea often live in extreme environments and have the additional challenge to protect their genomic DNA from extreme conditions, such as high temperatures.

Many Archaea contain homologs of eukaryotic histones, but Desulfurococcales, Thermoplasmatales and Sulfolobales use a different kind of packaging proteins1,2. Hyperthermophile and acidophile archaea of the Sulfolobales order from the Crenarchaeota kingdom express small basic DNA-binding proteins, which represent about 5% of the total soluble cellular proteins, sufficient to coat the entire genome of a Sulfolobus cell3. These proteins constitute the family called “7 kDa DNA-binding” or Sul7d4. They were first isolated from Sulfolobus acidocaldarius, which produces five of them, named Sac7a, b, c, d, and e. Sac7d and Sac7e are encoded by distinct genes, while Sac7a and b are truncated versions of Sac7d5-7. Highly similar homologs have been found in all Sulfolobus species, such as Sso7d from Sulfolobus solfataricus8, and Ssh7a and Ssh7b from Sulfolobus shibatae - two proteins encoded by two distinct genes3,9. Sac7d and Sso7d are the two most studied proteins of this family. They have been characterized for their structure, function, chemical stability and biophysical properties7. Sac7d and

10,11 Sso7d are hyperthermostable (Tm = 90.4°C and 100.2°C, respectively)

119

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

and are resistant from pH 0 up to at least pH 1212,13. Although Sac7d and Sso7d sequences show only few differences, Sso7d is more stable than Sac7d. Their three-dimensional structures show that they both fold as an SH3-like domain capped by a C-terminal α-helix14,15 and that they sharply kink the double DNA helix upon binding into the minor groove16,17. It has been shown that Sac7d and Sso7d are general dsDNA binders with KD values varying in a salt-dependent manner from 20 nM (low salt) to 3.8 µM (high salt) for Sac7d, and from 116 nM to 12.8 µM for Sso7d, and with a preference for G/C rich sequences18,19. Sac7d has the property to increase the thermal stability of DNA duplexes by as much as 43.5°C6,15. Furthermore, Ssh7a and Ssh7b have been partially characterized and an affinity for dsDNA of about 100 nM was reported in a low salt buffer9. Thus, the biological role of these chromatin proteins is most probably to bind genomic DNA in order to prevent its melting at the high growth temperatures of these Archaea (~75-85°C)6.

The combined high stability and ability to bind any dsDNA sequences of the “7 kDa DNA-binding” proteins have paved the way for developing improved tools for molecular biology by the genetic fusion of the genes encoding Sso7d and various enzymes, some of them being now marketed20. Furthermore, proteins from the “7 kDa DNA-binding” family have been described by our group as the first archaeal scaffolds used for the generation of artificial affinity proteins21,22, that we named Affitins23. Two other research groups independently confirmed the interest of this approach24,25.

Although the “7 kDa DNA-binding” proteins are important for the biology of Sulfolobales and for various applications, this family remains

120

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

poorly characterized with putative proteins from genera such as Metallosphaera and Acidianus. Whether these members have similar DNA binding properties and robustness remains an open question. Here, in addition to Sac7d and Sso7d, we report the production and characterization of a set of eleven sequences from this family of proteins under the same in vitro conditions to allow comparison of their properties. We have determined their dissociation constants for DNA as well as their thermal and pH stabilities under the same conditions. This study reveals interesting common properties as well as differences and gives new insights about this family of proteins.

121

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

II. Materials and Methods

II.1. Materials

Nucleic sequences corresponding to the thirteen homologous proteins studied in this work were computed by back translation of protein sequences registered in Uniprot database as P13123, P13125, A4YEA2, F4FYY6, F4B8X5, F4B9I5, F4B991, Q96X56, O59632, D2PHL8, F0NJT3, P61990, and P39476 using optimal codons for E. coli. These sequences were fully synthetized (GeneCust). Enzymes for molecular biology and DNA ladders were purchased from Thermo Fisher Scientific, calf thymus DNA (ct- DNA) from Sigma-Aldrich, Bugbuster from Novagen and oligonucleotides from Eurofins.

II.2. Protein production

Nucleic sequences encoding the thirteen “7 kDa DNA-binding” proteins were cloned in pFP1001 expression vector45 between BamHI and HindIII restriction sites using T4 DNA ligase. The resulting ligations were used to transform the E. coli DH5α Iq cells that were spread on petri dishes. Fifty milliliters of 2YT medium supplemented with 100 µg/mL ampicillin, 25 µg/mL kanamycin and 1% glucose were inoculated with a single colony and incubated overnight at 37°C with shaking at 200 rpm. 20 mL of this culture were used to inoculate 1 L 2YT medium supplemented with 100 µg/mL ampicillin, 25 µg/mL kanamycin and 0.1% glucose. After the optical density at 600 nm had reached a value of 0.8-1.0, expression of the cloned gene was induced by the addition of 0.5 mM Isopropyl β-D-1- thiogalactopyranoside (IPTG) and incubation at 30°C for 3h under shaking.

122

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Cells were pelleted by centrifugation (4500 x g) and the supernatants were discarded. Proteins were extracted with 15 mL TBS500 (20 mM Tris-HCl at pH 7.4, 500 mM NaCl) containing 25 mM imidazole, 25 mM MgSO4, 2 mg/mL lysozyme, 6 µg/mL DNAse I, and Bugbuster, Cell debris were pelleted by centrifugation for 10 min (8000 x g). Supernatants were purified by IMAC using a 1 mL column of Chelating Sepharose Fast Flow resin charged with Ni2+ (GE Healthcare) and equilibrated with TBS500 containing 25 mM imidazole. The resin was washed with 15 mL of this buffer, 20 ml of 20 mM Tris/2 M NaCl pH7,4 containing 25 mM imidazole and then with 20 mL of PBS

(130 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) containing 25 mM imidazole. Purified proteins were eluted with PBS containing 250 mM imidazole. Proteins were then injected into a Superdex75 16/60 column (GE Healthcare) equilibrated with PBS and quantified spectrophotometrically at 280 nm using an extinction coefficient of 8250 M-1 cm-1. To check their monomeric state, purified proteins were loaded on an analytical Superdex 75 10/300 GL (GE Healthcare) column at a 500 µM concentration. The calibration proteins included: bovine serum albumin (BSA) (66 kDa), ovalbumin (44.3 kDa), ribonuclease A (13.7 kDa), and aprotinin (6.5 kDa). The Molecular weights of the studied proteins were checked by electrospray ionization liquid chromatography mass spectrometry (ESI-LC-MS).

123

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

II.2. Detection of DNA-binding activity by Electrophoretic Mobility Shift Assay (EMSA)

For this assay, a 415 bp DNA fragment (42% G/C) was produced by polymerase chain reaction (PCR) amplification using pFP1001 containing the wild type sac7d gene as template, and Qe30for (5’- CTTTCGTCTTCACCTCGAG-3’) and Qe30rev (5’-GTTCTGAGGTCATTACTGG-3’) as primers. 200 ng of this dsDNA probe was incubated with different concentrations of the proteins (10 µМ, 5 µМ, 2.5 µМ, 1.25 µМ, 625 nМ) for 40 min at 25°C. The total volume of each reaction was 10 µL in PBS. Samples were analyzed on 6 % polyacrylamide gels in 45 mM Tris-borate buffer/1 mM EDTA at pH 8.0 (TBE). Gels were run at 80 V for 3h, stained in TBE containing 1:10000 dilution of Gel-Red nucleic acid stain, scanned with GelDoc EZ Imager (Bio-Rad) and analyzed with Image Lab (Bio-Rad) software.

II.3. Affinity measurements by fluorescence

ct-DNA was used for these experiments (42% G/C). 30 mg of lyophilized ct-DNA was dissolved in 0.2 M NaCl (10 mL) and incubated overnight at room temperature. ct-DNA was then fragmented on ice by sonication with a Vibracell sonicator for 3 min at 8 W. Obtained DNA fragments were evaluated on 1% agarose gel in TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDTA, pH 8.5). The ct-DNA sample was then dialyzed against PBS for 24 h at 4°C and the ct-DNA concentration was determined spectrophotometrically at 260 nm using an extinction coefficient of 6600 M-1 cm-1, representing the concentration of the nucleotides in solution. Affinities between proteins and dsDNA from ct-DNA

124

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

were measured by reverse titration with a spectrofluorometer FP-6500 (Jasco) as previously described18,46 with some modifications: excitation at 295 nm (3 nm band width), emission at 350 nm (5 nm band width) and protein concentration 5-6 µM. All measurements were performed at 25°C in PBS. Fluorescence titration data were analysed using the following formula:

(퐹푖 − 퐹표푏푠) 푄표푏푠 = (eq. 1) 퐹표푏푠

Where Fi and Fobs represent the measured fluorescence in absence or presence of DNA, respectively. The fractional change in the fluorescence intensity due to quenching corresponds to the amount of DNA bound to a recombinant protein. It follows the equation:

푄표푏푠 푃푏 = 푃푡 (eq. 2) 푄푚푎푥

Where Pb corresponds to the concentration of protein bound to DNA,

Pt represents the total protein concentration in the solution, and Qmax is the maximum observed fluorescence quenching at higher concentrations of added DNA. The concentration of the free protein (Pf) can be represented by the following equation:

푄표푏푠 푃푓 = 푃푡 − 푃푏 = 푃푡 (1 − ) (eq. 3) 푄푚푎푥

According to the model of McGhee - von Hippel47 for non- cooperative binding of proteins to DNA: 푣 푃 = (eq. 4) 푓 1 − 푛푣 푛−1 퐾(1 − 푛푣) ( ) 1 − (푛 − 1)푣

125

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Where K represents the binding constant, n corresponds to the size in nucleotides of the bound region of DNA by one protein molecule, and 푣 represents density of binding and can be defined by the equation:

푃푏 푣 = (eq. 5) 퐷푡

Where Dt represents the final concentration of added DNA. As n, K and Qmax are unknown parameters, they were determined by means of a nonlinear least-squares fit of eq. 4 to the experimental data (Qobs) by an iterative procedure. For this purpose, an algorithm that iteratively solves equation (4) by bisection and then minimizes the weighted sum of squares of the deviations using the Levenberg–Marquardt algorithm was programmed in Visual Basic for Excel (Microsoft). The routine is available upon request.

II.4. ELISA

ELISAs were performed using 96-well Maxisorb Nunc plates coated with 100 ng Neutravidin (Pierce) in PBS mainly as previously described 48. To produce the 40 bp dsDNA, targets the 3’-biotinylated plus-strand oligonucleotides poly(dAdT)20, poly(dAdC)20, poly(dAdG)20, poly(dGdC)20, and poly(dA)40, were annealed with their complementary ones at the ratio of 2:3 by incubation for 30 s at 90 °C followed by slow cooling to 20°C. Then, 2.5 ng of these biotinylated dsDNA in PBS was immobilized in each well. 100

µL of 200 nM purified proteins in 10 mM KH2PO4 50 mM KCl, pH 7 containing 0.1% Tween 20, were used to test the binding to dsDNA. Binding to BSA was used as a negative control. The detection was performed as described previously using the RGS His6 (Arg-Gly-Ser-(His)x6) antibody horseradish

126

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

peroxidase (HRP) conjugate (Qiagen), which detects the RGS His6-tag from proteins12.

II.6. Circular dichroism measurements

Circular dichroism (CD) spectra and the monitoring of ellipticity vs pH were done for each protein as published elsewhere for Affitins12,13.

II.7. Thermostability Measurements

Differential scanning calorimetry (DSC) experiments were carried out in PBS as described previously49 using a VP-DSC instrument (Microcal, Northampton, MA) and data was analyzed with the software supplied with the equipment.

127

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

III. Results

III.1. Choice of protein set and sequence alignment

The Sulfolobales order comprises the generas Sulfolobus, Acidianus, Metallosphaera, Stygiolobus, Sulfurisphaera, and the proposed novel Candidatus Aramenus genus that has been recently reported26. A search for protein sequences homologous to Sac7d in the Uniprot database returned 48 sequences from Archaea, 18 being unique and belonging to the Sulfolobus, Acidianus, Metallosphaera, and the proposed Candidatus Aramenus genera. The analysis of the multiple sequences alignment for these 18 proteins showed that their sequences mostly differ at their N- and C-terminus and share 71 to 98% identity according to the “Sequence Identity And Similarity” tool available online (http://imed.med.ucm.es/Tools/sias.html). For further analysis, the amino- acids were divided into eight standard similarity groups based on their common characteristics, defined by the side chains: GAVLI (aliphatic without proline), FYW (aromatic), CM (sulphur-containing), ST (hydroxylic), KRH (basic), DE (acidic) NQ (amidic), P (proline). By analysing the distribution of these eight groups among the sequences, the proteins showed a similarity comprised between 83% and 100% (Fig. 1A). Interestingly, all amino-acids known to interact with dsDNA are conserved (Fig. 1A). In addition to Sac7d and Sso7d, eleven representative members of the “7 kDa DNA-binding” family, including eight putative ones, were chosen for this study. We propose to name those from Acidianus hospitalis

128

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Figure 1. Sequence analysis of Sac7d homologs. A) The multiple-sequence alignment was performed by T-Coffee50 and was colored using “The Sequence Manipulation Suite”51 (grey: G, A, V, L, I; orange: F, Y, W; yellow: M; green: S, T; red: K, R, H; blue: D, E; brown: N, Q; pink: P) to highlight residues which are identical or similar, according to their biochemical properties, for all sequences at a given position. The residues involved in the dsDNA binding according to the three-dimensional structure of Sac7d are indicated with an asterisk16. Amino-acid numbering is according that of Sac7d. For each homologous protein are indicated: the Uniprot accession number, the common name when known in black (and the names we proposed in red for the proteins that were not characterized before this study), the sequence length and the hosting archaea. The sequences of the proteins studied in this work have a region “RGSHHHHHHGS” inserted just after the initial methionine and “LN” after the last lysine residue resulting from their sub-cloning and allowing their purification and detection. B) Two orientations of the three-dimensional structure of Sac7d (pdb code 1AZP) representing identical residues among the thirteen proteins (green), those which are not conserved (red) and Thr17 (blue). The side chains of residues which are involved in DNA interaction are depicted as green sticks.

129

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

as Aho7a, Aho7b, Aho7c, and those from Sulfolobus islandicus as Sis7a, and Sis7b, as the proteins from this family are traditionally named according to the organism from which they were isolated followed by a lowercase letter in order of increasing basicity if several copies exist in cells (Fig. 1). The proteins from Metallosphaera sedula and Metallosphaera cuprina were named Mse7 and Mcu7 as we found only one copy of a sul7 gene in their respective genomes. In the genome of Sulfolobus tokodaii, we found two copies of a sul7 gene with a difference of only one base, encoding the same protein that we named Sto7.

While the three β-strands most involved in the DNA-binding interaction are perfectly conserved (Fig. 1B), two main variations can be seen among the studied proteins: i) a longer loop between β-strand 4 and 5, with three consecutive glycines for Ssh7b, Sis7a, Sis7b, Ssh7a and Sso7d; and ii) the length of the α-helix, being twice shorter in the smaller homologs compared to Sac7d. Some particular sequences can be highlighted here: Sto7, which has a quite similar α-helix to those of Ssh7b, Sis7a, Sis7b, Ssh7a, and Sso7d without having the “GGG loop”, Aho7c which is the only protein that does not have the otherwise conserved penultimate lysine; and finally Mse7, Mcu7, Aho7a, Aho7b, and Aho7c which have shorter helices.

All studied proteins possess sequence lengths ranging from 60 to 66 amino-acids (i.e. the minimal and maximal lengths known for this family) and they originate from three archaeal genera known to host proteins from this family, Sulfolobus, Metallosphaera, and Acidianus. Three sequences available for Acidianus hospitalis were studied as they correspond to several genes of the same W1 strain. Furthermore, being the shortest members of

130

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

the “7 kDa DNA-binding” family, these three proteins are particularly attractive considering the importance of a minimal size for biomedical applications. The proteins from Candidatus Acidianus copahuensis27 and from Candidatus Aramenus sulfurataquae26 were not studied as their sequences were released after the beginning of this study.

III.2. Production of soluble proteins

The proteins were overproduced in the cytoplasm of Escherichia coli (E. coli) with an expression induced for 3h at 30°C. Generally it is possible to purify the proteins of this family without affinity tags due to their expected high temperature and acidic stabilities7. However, we chose to use N- terminal His6-tagged variants in order to facilitate their detection, for instance in enzyme-linked immunosorbent assays (ELISA). The proteins could be purified to homogeneity by immobilized metal ion affinity chromatography (IMAC), followed by gel filtration. They showed the expected molecular weight (~9 kDa) according to sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE), Fig. 2A, in line with molecular weights calculated from their sequences. The molecular weights of proteins were confirmed by mass spectrometry analysis (Table 1). Furthermore, all proteins were eluted as a sharp symmetric peak from the size-exclusion chromatography at the volume corresponding to monomeric species of about 9 kDa, Fig. 2B. This result suggests that the proteins had a globular conformation compatible with a native state. Production yields were in the range of 5-10 mg of purified protein per liter of culture (Table 1).

131

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Figure 2. Characterization of the molecular weights of the proteins. (A) SDS-PAGE analysis of the purified proteins. The proteins (1 µg) were analysed on 15% polyacrylamide gel after IMAC and gel filtration purification. Lane M corresponds to protein markers: 250, 150, 100, 75, 50, 37, 25, 20, 15, 10 kDa from top to bottom. (B) Gel filtration analysis of the proteins. All proteins were loaded on an analytical Superdex 75 10/300 GL (Vt = 24 mL) at a concentration of 500 µM. Vo indicates the void volume of the column determined by injection of dextran.

a b c d e f Protein M.W.(Da.) Yield (mg/L) KD (µM) n (bases) Tm (°C) pI Sac7d 9108 (9103) 8.0 13 ± 1 6,4 ± 0,2 89,6 10.25 Sac7e 8968 (8964) 5.5 11 ± 1 6,9 ± 0,4 85,5 10.37 Mse7 8477 (8473) 6.5 15 ± 1 6,2 ± 0,3 87,4* 10.38 Mcu7 8449 (8446) 7.0 16 ± 1 6,7 ± 0,2 88,8* 10.38 Aho7a 8533 (8531) 5.0 16 ± 1 6,1 ± 0,1 94,7 10.25 Aho7b 8618 (8615) 6.0 13 ± 1 5,7 ± 0,3 95,8 10.22 Aho7c 8374 (8372) 8.0 16 ± 1 5,7 ± 0,2 96,8 10.11 Sto7 8808 (8804) 8.5 14 ± 1 6,5 ± 0,3 100,0 10.25 Ssh7b 8795 (8790) 10.0 22 ± 1 6,3 ± 0,2 89,0 10.25 Sis7a 8806 (8803) 8.0 15 ± 2 6,7 ± 0,4 95,6 10.37 Sis7b 8797 (8791) 7.0 16 ± 1 6,0 ± 0,3 87,2 10.37 Ssh7a 8776 (8773) 7.0 18 ± 2 7,9 ± 0,4 95,6 10.37 Sso7d 8778 (8774) 8.0 17 ± 1 8,1 ± 0,3 96,5 10.25 Table 1. Properties of the recombinant proteins. aMolecular weights determined by mass spectrometry; those calculated from sequences including the tag (see legend of Fig. 1A) are in brackets. bmg of purified protein obtained from 1L growth medium. c,dDissociation constants and site sizes of DNA binding from fluorescence experiments. eMelting temperatures from DSC experiments, *aggregation at high temperatures. fTheoretical values, provided by PepCalc.com, Innovagen AB.

132

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

III.3. DNA binding properties

III.3.1. dsDNA binding activity

The DNA-binding properties of the proteins were first studied by electrophoretic mobility shift assay under non-denaturing conditions. In these experiments, a fixed concentration of a 415 bp PCR product was incubated with various concentrations of the proteins and the resulting complexes were analyzed on polyacrylamide gels stained with Gel-Red, Fig. 3. As expected for the “7 kDa DNA-binding” family, all proteins bound to dsDNA, and a reduced mobility of the dsDNA band was observed for protein concentrations ≥ 0.625 µM (Sac7e, Mse7), ≥ 1.25 µM (Sac7d, Aho7a, Aho7b, Aho7c, Sis7a, Sis7b, Sso7d, Ssh7a), ≥ 2.5 µM (Mcu7, Sto7) and ≥ 5 µM

Figure 3. DNA-binding properties of proteins. Electrophoretic mobility shift assay (EMSA) of the proteins at 0, 0.625, 1.25, 2.5, 5 and 10 µM following incubation with ct-DNA. An electrophoretic mobility shift of the dsDNA was observed in presence of proteins at concentration higher or equal to 5 µM.

133

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

(Ssh7b). These results confirmed that all expressed recombinant proteins were functional.

III.3.2. Determination of affinity for dsDNA

The binding of proteins to double-stranded DNA from calf-thymus (ct-DNA) was followed at 25°C by monitoring the change in fluorescence quenching of their single tryptophan, Fig4. The affinities were determined using a mathematical model developed for non-cooperative binding of proteins to DNA that was used in previous studies18. All proteins were shown to bind ct-DNA. The dissociation constants were quite similar and in the range from 11 to 22 µM (Table 1), with an average value of 16 µM. Ssh7b had the lowest affinity for ct-DNA (KD = 22 µM) and Sac7e the highest affinity

(KD = 11 µM). The binding site sizes (n) were about 6-8 bases per protein (Table 1), as previously reported for Sac7d and Sso7d18,19.

III.3.3. Sequence selectivity of proteins for dsDNA

Enzyme-linked immunosorbent assay (ELISA) for dsDNA sequence selectivity was designed by preparing several dsDNA: [poly(dAdT)]2, poly(dAdC).poly(dGdT), poly(dAdG).poly(dCdT), [poly(dGdC)]2, and poly(dA).poly(dT). Collectively, the dsDNA thus obtained contained various and significantly different sequences, corresponding to 18 different triplets and quadruplets, to test specificity of the proteins. The assays were first performed using phosphate buffered saline, pH 7.4 (PBS), but the micromolar affinity prevented the observation of a signal. As it is known for Sac7d and Sso7d that their affinities for dsDNA are in the nanomolar range

134

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Figure 4. Affinities between proteins and dsDNA. Affinity measurements were performed by reverse titration of proteins with ct-DNA in PBS pH 7.4 at 25°C monitored by quenching of intrinsic tryptophan fluorescence intensity at 350 nm. Data (•) were analysed using the McGhee-von Hippel model (red curve) to determine KD.

135

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

15,18 in low ionic strength buffers , we performed ELISA in 10 mM KH2PO4, 50 mM KCl, pH 7. A dissociation constant of 203 nM was determined for Sac7d with ct-DNA in this buffer, a value compatible with ELISA assays, Fig. 5.

Figure 5. Affinity between Sac7d and dsDNA. Affinity measurement was performed by reverse titration of proteins with ct-DNA in 10 mM KH2PO4, 50 mM KCl, pH 7 at 25°C monitored by quenching of intrinsic tryptophan fluorescence intensity at 350 nm. Data (•) were analyzed with McGhee-von Hippel model (red curve) to determine KD.

Figure 6 shows the results of protein addition to dsDNA products after analysis by ELISA. All proteins showed binding to each dsDNA sequences with a preference for those being G/C rich.

Figure 6. Sequence selectivity of proteins for dsDNA. Proteins show similar binding preferences by ELISA. Plates were coated with 1 µg/mL Neutravidin and 2.5 ng per well of biotinylated dsDNA were immobilized. Proteins were added at 200 nM. Binding of proteins to dsDNA was detected with anti-RGS(His)6-HRP antibody conjugate. As the recorded absorbance is proportional to the amount of bound protein, higher values correspond to higher affinities for dsDNA. Results are representative of 3 experiments.

136

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

III.4. Biophysical properties of the proteins

III.4.2. Circular dichroism spectra

To investigate whether the thirteen proteins had similar secondary structures, we used circular dichroism (CD) spectroscopy. These experiments were performed in a 10 mM phosphate buffer (pH 7.4) while omitting chloride salts to minimize noise for short wavelengths. Figure 7A shows that the shapes of CD spectra measured in the far-UV region were similar for the thirteen proteins. In correlation with the known crystallographic structures of Sac7d and Sso7d, these spectra were characteristic of proteins with an anti-parallel β-sheet and an α-helix28. As reported by Edmondson and Shriver7, we observed that Sac7d showed the lowest CD signal value at 222 nm14, likewise Sac7e, which is consistent with their longer α-helix region (Fig. 1A).

Figure 7. Characterization by circular dichroism. (A) CD spectra of proteins in 10 mM phosphate buffer, pH 7.4. (B) Study of the effect of pH on the protein structure. Proteins were incubated at room temperature overnight in a solution adjusted to each pH unit from pH 0 to pH 14 and the residual ellipticity were measured by CD at 222 nm. The continuous curves are drawn for clarity only.

137

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

III.4.3. pH stability of the proteins

To study their pH stability, the proteins were incubated overnight at 20°C in buffers at different pH from 0 to 14. CD measurements at 222 nm indicated that the secondary structure of all proteins remained largely stable under alkaline conditions up to pH 12 (Fig. 7B).

III.4.4. Thermostability of the proteins

Figure 8 and Table 1 show that thermal stabilities of the proteins determined in PBS by DSC analysis ranged from 85.5°C (Sac7e) up to 100°C (Sto7). With an average temperature of 92.5°C, these results show that all studied members from this family of proteins are hyperthermostable. DSC scans were characteristic of cooperative unfolding, indicating that variants were well folded. However, two behaviors were observed at high temperature. Mse7 and Mcu7 showed an irreversible unfolding, while all the other proteins showed no sign of aggregation after Tm was reached.

138

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

Figure 8. Thermal stabilities of proteins. DSC curves were recorded for proteins in PBS 7.4.

139

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

IV. Discussion

All the proteins produced were shown to be monomeric, with a native fold, and highly pH- and thermally-stable. They were able to bind various dsDNA sequences in PBS with affinities similar to those reported for Sac7d and Sso7d using similar buffers18,19 with a preference for sequences containing G/C bases. However, some interesting differences between proteins could be observed.

Despite the fact that all the sixteen residues known to be involved in DNA recognition16,17,29 are strictly conserved among the studied chromatin proteins, reflecting a strong selection pressure to maintain this function in the Sulfolobales order, variations could be observed for their dsDNA binding properties. For instance, according to fluorescence measurements, Ssh7b and Sac7e display the lowest and highest affinities of 22 ± 1 µM and 11 ± 1 µM, respectively. This is also seen with EMSA experiments for which Ssh7b is the only protein not showing a clear binding at 2.5 µM dsDNA, while Sac7e shows the strongest migration shift for 0.625 µM dsDNA. This could not be explained by an electrostatic effect, as we did not find a correlation between the affinities and the number of charges, which is quite homogeneous with a net charge of +7.8 ± 0.7 at pH 7.4 for all studied proteins. No correlation was found between helix and polypeptide chain lengths and affinities either. Ssh7b can be considered as a double mutant of Sis7b and Sso7d (V2T/E14Q and V2A/T17I, respectively, using Sac7d numbering), and a triple mutant of

Sis7a and Ssh7a (V2T/E14Q/T17I and V2A/E14Q/T17I, respectively). The KD values for Sis7a (15 ± 2 µM), Sis7b (16 ± 1 µM), Ssh7a (18 ± 2 µM) and Sso7d (17 ± 1 µM) are not significantly different, but are collectively significantly

140

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

lower than that of Ssh7b (22 ± 1 µM). These observations suggest that the mutations E14Q and T17I alone are not responsible for the affinity variations, while their combination with position 2 seems to be important for affinity. However, other proteins with a valine in position 2, such as Sto7, display higher affinities. This highlights that variations of affinities in these small proteins are probably the result of slight readjustments in the structure induced by residue substitutions which are not being in direct contact with the ligand, the so called “second sphere” residues, as it was observed in other proteins such as antibodies30. Further mutagenesis and crystal structure studies will be needed to decipher the role of each position to fine-tune affinity. This study also shows that the three genes encoding 7 kDa DNA-binding proteins (Aho7a, Aho7b, and Aho7c) in Acidianus hospitalis are functional, as it was reported for the variants of Sulfolobus acidocaldarius and Sulfolobus shibatae3,6. These genes are probably resulting from duplication events, and further strengthen the idea that these chromatin proteins are important for the Sulfolobales order.

Our results show that all proteins are hyperthermostable in PBS 7.4, in good agreement with previous studies31. Two groups of proteins can be defined according to their thermostabilities: Sto7, Aho7c, Sso7d, Aho7b, Sis7a, Ssh7a, Aho7a (Tm = 96.4 ± 1.7 °C; high Tm group), and Sac7d, Ssh7b, Mcu7, Mse7, Sis7b, Sac7e (Tm = 87.9 ± 1.5 °C; low Tm group). No correlation can be found between the thermal stabilities of the studied proteins and the optimal growth temperatures of the host they come from (Sulfolobus, Acidianus, Metallosphaera). Interestingly, Sis7b (low Tm group) can be considered as the single mutant I17T of Sis7a (high Tm group) which has a

141

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

deleterious effect on stability (-8.4°C). This substitution at position 17 occurs in a partially buried region. In a previous study of the hydrophobic cores of Sac7d and Sso7d, Clark et al. hypothesized that this substitution could be partly responsible for the difference in stability between the two proteins31. Excluding Mse7 and Mcu7, which aggregated irreversibly upon heating, we found that all proteins from low Tm group have a threonine at position 17. Our results confirm that an isoleucine is preferable to a threonine at this position in term of hydrophobicity and/or volume to contribute to the thermostability. The V30I substitution in Sac7d was shown by DSC to increase the thermal stability by 5.8°C31. Interestingly, except Ssh7b and Sis7b, which both have the deleterious substitution I17T, all proteins from low Tm group have a valine at position 30. None of the proteins from the high Tm group have either the I17T or the V30I substitutions. This analysis shows and confirms that the positions 17 and 30 are two determinants for obtaining proteins with a higher thermostability. Thus, these positions, and probably their neighbouring ones, may represent interesting targets for mutagenesis studies aiming to stabilize proteins from this family, as this was done for other positions in Sso7d32. It is not obvious what other differences between proteins may be responsible for thermostability variations. Like for affinity, further studies are needed, for instance to understand what is responsible for the +3.2°C increase observed between Aho7c and Sto7, the last being the most stable protein of this study (Tm = 100°C). It is also interesting to note that Mse7 and Mcu7, which are the most unrelated proteins to the others according to sequences, are presenting an aggregating behaviour. These two proteins are notably characterized by the solvent-exposed QDL sequence at positions 11 to 13, at the beginning of the

142

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

second β-strand, while every other variant presents an E(E/D)K sequence. Thus, Mse7 and Mcu7 display a smaller charge density in this area, trading three charged amino acids for only one. It is therefore likely that this more hydrophobic area could be involved in the aggregation of Mse7 and Mcu7 at high temperatures. Other substitutions not found in other proteins could also contribute to aggregation: V4I, I20V, R25K, as well as the particular sequence of their α-helix.

The proteins displayed a remarkable stability from pH 0 to at least pH 12. We previously reported that Sac7d and Sso7d are highly resistant from low to high pH12,13, and here, we confirm this as a general property of the “7 kDa DNA-binding” proteins. This is interesting considering that the pH inside Sulfolobus cells is about 6.55 while the pH outside is 3.533, suggesting there has been no selection pressure for these pH resistances.

Finally, a comparison of published data7,10,11,14,15,18,31,34-38 with those reported in this work shows that the his-tag has no influence on the remarkable properties of Sac7d and Sso7d (monomeric state, affinities, CD spectra, stabilities), and most likely of the other members from this family. This is noteworthy for future studies of novel Sul7 members, as well as for the use of these proteins in applications requiring their detection.

Overall, this work shows that these proteins share similar high thermal/pH stabilities and DNA-recognition properties which are not so common to find in one small monomeric protein. This is why they are so attractive for various applications. In fact, we have not only one protein, but a natural repertoire provided by evolution. Indeed, we found differences which may be assets for some applications. Sso7d is principally used as a

143

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

general DNA binding protein to develop molecular biology reagents with improved properties. Several studies have reported that processivity of different polymerases (Taq, Pfu, Tpa and KOD) can be greatly improved by fusion to Sso7d39-42. It might be interesting to use a more thermostable protein than Sso7d, Sto7 for example, to make reagents more resilient to PCR cycles at high temperature. For the design of artificial binders, a more stable scaffold is expected to withstand better high mutagenesis loads needed for their generation43. Also, a smaller size is interesting for in vivo applications, such as imaging and therapy, as it allows a better diffusion across barriers or to reach tumors for example44. Up to now, Sac7d and Sso7d have been used as scaffolds to design Affitins13,21,24,25. However, this study teaches us that Sto7 and Aho7c should be a good basis to generate more robust Affitins. We believe there will be no obvious reasons, but the historical ones, to continue using only Sac7d and Sso7d proteins for designing novel reagents.

As far as we know, this is the first time that a number of “7 kDa DNA- binding” proteins have been characterized simultaneously. With the continuous efforts to sequence whole genomes from archaeal microorganisms1, it is also likely that further discoveries will be made and the repertoire of this family of proteins will be extended.

144

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

V. Acknowledgements

Circular dichroism spectra and fluorescence data were acquired with apparatus from the Biogenouest IMPACT Core Facility, UMR CNRS 6286 (UFIP), UMR INSERM 892 CNRS 6299 (CRCNA) (Nantes, France). We are grateful to Mikaël Croyal from the “Plateforme de spectrométrie de masse”, University of Nantes, for ESI-LC-MS experiments, and we would like to acknowledge John Bianco for critical reading of the manuscript. The authors are grateful to Dr. David Teze for comments and help with Figure 1. This work was supported by the European Erasmus Mundus Joint Doctorate in nanomedicine and pharmaceutical innovation (Nanofar) with financial support, and a doctoral fellowship for V.K.

145

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

VI. References 1. Brochier-Armanet, C., Forterre, P. & Gribaldo, S. Phylogeny and evolution of the Archaea: one hundred genomes later. Curr. Opin. Microbiol. 14, 274-281, (2011). 2. Peeters, E., Driessen, R. P., Werner, F. & Dame, R. T. The interplay between nucleoid organization and transcription in archaeal genomes. Nature reviews 13, 333-341, (2015). 3. Mai, V. Q., Chen, X., Hong, R. & Huang, L. Small abundant DNA binding proteins from the thermoacidophilic archaeon Sulfolobus shibatae constrain negative DNA supercoils. J Bacteriol 180, 2560-2563, (1998). 4. White, M. F. & Bell, S. D. Holding it together: chromatin in the Archaea. Trends Genet. 18, 621-626, (2002). 5. Grote, M., Dijk, J. & Reinhardt, R. Ribosomal and DNA binding proteins of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. Biochimica et Biophysica Acta (BBA)-Protein Structure and Molecular Enzymology 873, 405-413, (1986). 6. McAfee, J. G., Edmondson, S. P., Datta, P. K., Shriver, J. W. & Gupta, R. Gene cloning, expression, and characterization of the Sac7 proteins from the hyperthermophile Sulfolobus acidocaldarius. Biochemistry. 34, 10063-10077., (1995). 7. Edmondson, S. P. & Shriver, J. W. DNA binding proteins Sac7d and Sso7d from Sulfolobus. Methods Enzymol. 334, 129-145., (2001). 8. Choli, T., Henning, P., Wittmann-Liebold, B. & Reinhardt, R. Isolation, characterization and microsequence analysis of a small basic methylated DNA-binding protein from the Archaebacterium, Sulfolobus solfataricus. Biochim. Biophys. Acta 950, 193-203, (1988). 9. Chen, X., Guo, R., Huang, L. & Hong, R. Evolutionary conservation and DNA binding properties of the Ssh7 proteins from Sulfolobus shibatae. Sci. China. C. Life Sci. 45, 583- 592, (2002). 10. McCrary, B. S., Edmondson, S. P. & Shriver, J. W. Hyperthermophile protein folding thermodynamics: differential scanning calorimetry and chemical denaturation of Sac7d. J Mol Biol 264, 784-805., (1996). 11. Catanzano, F., Graziano, G., Fusi, P., Tortora, P. & Barone, G. Differential scanning calorimetry study of the thermodynamic stability of some mutants of Sso7d from Sulfolobus solfataricus. Biochemistry 37, 10493-10498, (1998). 12. Béhar, G. et al. Tolerance of the archaeal Sac7d scaffold protein to alternative library designs: characterization of anti-immunoglobulin G Affitins. Protein Eng Des Sel 26, 267- 275, (2013). 13. Béhar, G., Pacheco, S., Maillasson, M., Mouratou, B. & Pecorari, F. Switching an anti-IgG binding site between archaeal extremophilic proteins results in Affitins with enhanced pH stability. J. Biotechnol. 192, Part A, 123-129, (2014).

146

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

14. Edmondson, S. P., Qiu, L. & Shriver, J. W. Solution structure of the DNA-binding protein Sac7d from the hyperthermophile Sulfolobus acidocaldarius. Biochemistry 34, 13289- 13304, (1995). 15. Baumann, H., Knapp, S., Lundback, T., Ladenstein, R. & Hard, T. Solution structure and DNA-binding properties of a thermostable protein from the archaeon Sulfolobus solfataricus. Nat Struct Biol 1, 808-819, (1994). 16. Robinson, H. et al. The hyperthermophile chromosomal protein Sac7d sharply kinks DNA. Nature 392, 202-205., (1998). 17. Gao, Y. G. et al. The crystal structure of the hyperthermophile chromosomal protein Sso7d bound to DNA. Nat Struct Biol 5, 782-786., (1998). 18. McAfee, J. G., Edmondson, S. P., Zegar, I. & Shriver, J. W. Equilibrium DNA binding of Sac7d protein from the hyperthermophile Sulfolobus acidocaldarius: fluorescence and circular dichroism studies. Biochemistry 35, 4034-4045., (1996). 19. Lundbäck, T. & Härd, T. Salt Dependence of the Free Energy, Enthalpy, and Entropy of Nonsequence Specific DNA Binding. J Phys Chem 100, 17690-17695, (1996). 20. Ishino, S. & Ishino, Y. DNA polymerases as useful reagents for biotechnology - the history of developmental research in the field. Front Microbiol 5, 465, (2014). 21. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc Natl Acad Sci U S A 104, 17983-17988, (2007). 22. Pecorari, F. & Alzari, P. M. OB-fold used as scaffold for engineering new specific binders. Patent Publication Nos. PCT/IB2007/004388, (2008). 23. Krehenbrink, M. et al. Artificial binding proteins (Affitins) as probes for conformational changes in secretin PulD. J Mol Biol 383, 1058-1068, (2008). 24. Gera, N., Hussain, M., Wright, R. C. & Rao, B. M. Highly stable binding proteins derived from the hyperthermophilic Sso7d scaffold. J Mol Biol 409, 601-616, (2011). 25. Zhao, N., Schmitt, M. A. & Fisk, J. D. Phage display selection of tight specific binding variants from a hyperthermostable Sso7d scaffold protein library. The FEBS journal 283, 1351-1367, (2016). 26. Servin-Garciduenas, L. E. & Martinez-Romero, E. Draft Genome Sequence of the Sulfolobales Archaeon AZ1, Obtained through Metagenomic Analysis of a Mexican Hot Spring. Genome announc 2, (2014). 27. Urbieta, M. S. et al. Draft Genome Sequence of the Novel Thermoacidophilic Archaeon Acidianus copahuensis Strain ALE1, Isolated from the Copahue Volcanic Area in Neuquen, Argentina. Genome announc 2, (2014). 28. Greenfield, N. J. Using circular dichroism collected as a function of temperature to determine the thermodynamics of protein unfolding and binding interactions. Nature protocols 1, 2527-2535, (2006).

147

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

29. Agback, P., Baumann, H., Knapp, S., Ladenstein, R. & Hard, T. Architecture of nonspecific protein-DNA interactions in the Sso7d-DNA complex. Nat Struct Biol 5, 579-584., (1998). 30. Zahnd, C. et al. Directed in vitro evolution and crystallographic analysis of a peptide binding scFv antibody with low picomolar affinity. J Biol Chem 279, 18870-18877, (2004) 31. Clark, A. T., McCrary, B. S., Edmondson, S. P. & Shriver, J. W. Thermodynamics of core hydrophobicity and packing in the hyperthermophile proteins Sac7d and Sso7d. Biochemistry 43, 2840-2853., (2004). 32. Consonni, R., Arosio, I., Recca, T., Fusi, P. & Zetta, L. Structural determinants responsible for the thermostability of Sso7d and its single point mutants. Proteins 67, 766-775, (2007). 33. Moll, R. & Schäfer, G. Chemiosmotic H+ cycling across the plasma membrane of the thermoacidophilic archaebacterium Sulfolobus acidocaldarius. FEBS Lett. 232, 359-363, (1988). 34. Knapp, S. et al. Thermal unfolding of the DNA-binding protein Sso7d from the hyperthermophile Sulfolobus solfataricus. J Mol Biol 264, 1132-1144, (1996). 35. Lundback, T., Hansson, H., Knapp, S., Ladenstein, R. & Hard, T. Thermodynamic characterization of non-sequence-specific DNA-binding by the Sso7d protein from Sulfolobus solfataricus. J Mol Biol 276, 775-786, (1998). 36. McCrary, B. S., Bedell, J., Edmondson, S. P. & Shriver, J. W. Linkage of protonation and anion binding to the folding of Sac7d. J Mol Biol 276, 203-224, (1998). 37. Bedell, J. L., Edmondson, S. P. & Shriver, J. W. Role of a surface tryptophan in defining the structure, stability, and DNA binding of the hyperthermophile protein Sac7d. Biochemistry. 44, 915-925., (2005). 38. Peters, W. B., Edmondson, S. P. & Shriver, J. W. Thermodynamics of DNA binding and distortion by the hyperthermophile chromatin protein Sac7d. J Mol Biol 343, 339-360, (2004). 39. Wang, Y. et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Res. 32, 1197-1207, (2004). 40. Ppyun, H. et al. Improved PCR performance using mutant Tpa-S DNA polymerases from the hyperthermophilic archaeon Thermococcus pacificus. J. Biotechnol. 164, 363-370, (2012). 41. Wang, F. et al. Expression and Characterization of the RKOD DNA Polymerase in Pichia pastoris. PLoS One 10, e0131757, (2015). 42. Norholm, M. H. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. BMC biotechnology 10, 21, (2010). 43. Bloom, J. D., Labthavikul, S. T., Otey, C. R. & Arnold, F. H. Protein stability promotes evolvability. Proc Natl Acad Sci U S A 103, 5869-5874, (2006).

148

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

44. Zahnd, C. et al. Efficient tumor targeting with high-affinity designed ankyrin repeat proteins: effects of affinity and molecular size. Cancer Res 70, 1595-1605, (2010). 45. Mouratou, B., Béhar, G., Paillard-Laurance, L., Colinet, S. & Pecorari, F. Ribosome display for the selection of Sac7d scaffolds. Methods Mol Biol 805, 315-331, (2012). 46. Shehi, E. et al. Thermal stability and DNA binding activity of a variant form of the Sso7d protein from the archeon Sulfolobus solfataricus truncated at leucine 54. Biochemistry 42, 8362-8368, (2003). 47. McGhee, J. D. & von Hippel, P. H. Theoretical aspects of DNA-protein interactions: cooperative and non-co-operative binding of large ligands to a one-dimensional homogeneous lattice. J Mol Biol 86, 469-489, (1974). 48. Mouratou, B., Rouyre, S., Pauillac, S. & Guesdon, J. L. Development of nonradioactive microtiter plate assays for nuclease activity. Anal Biochem. 309, 40-47., (2002). 49. Correa, A. et al. Potent and Specific Inhibition of Glycosidases by Small Artificial Binding Proteins (Affitins). PLoS One 9, e97438, (2014). 50. Notredame, C., Higgins, D. G. & Heringa, J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J Mol Biol 302, 205-217, (2000). 51. Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 28, 1102, 1104, (2000).

149

Chapter III: The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family

150

Chapter IV:

A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

152

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

Chapter IV: Table of Contents

I. Introduction ...... 157 II. Materials and Methods ...... 160 II. 1. Generation of DNA libraries ...... 160 II. 2. Selection of EpCAM-specific binders by ribosome display ...... 160 II.3. Screening for hrEpCAM binding by bio-layer Interferometry ...... 163 II.4. Protein production and purification ...... 164 II.5. LC-ESI-HRMS analysis ...... 164 II.6. Enzyme-linked immunosorbent assay ...... 165 II.7. Surface plasmon resonance ...... 166 II.8. Biophysical characterisation of Affitins ...... 167 III. Results ...... 168 III.1. Generation of the Aho7c library and selection by ribosome display ...... 168 III.2. Screening for positive clones and sequence analysis ...... 169 II.3. Protein production and purification ...... 170 III.4. Specificity of the selected Affitins ...... 171 III.5. SPR characterisation and affinity determination ...... 172 III.6. Biophysical properties of the proteins ...... 174 IV. Discussion ...... 176 V. Conclusion ...... 181 VI. Acknowledgements ...... 182 VII. Conflict of interest ...... 182 VIII. References ...... 183

153

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

154

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

Kalichuk V., Renodon-Cornière A., Béhar G., Carrión F., Obal G., Maillasson M., Mouratou B., Préat V., Pecorari F. Adapted from Biotechnology and bioengineering, Provisionally accepted

Abstract Affitins are highly stable engineered affinity proteins, originally derived from Sac7d and Sso7d, two 7 kDa DNA-binding polypeptides from Sulfolobus genera. Their efficiency as reagents for intracellular targeting, enzyme inhibition, affinity purification, immunolocalization and various other applications has been demonstrated. Recently, we have characterized the 7 kDa DNA-binding family, and Aho7c originating from Acidianus hospitalis was shown to be its smallest member with thermostability comparable to those of Sac7d and Sso7d. Here, after four rounds of selection by ribosome display against the human recombinant Epithelial Cell Adhesion Molecule (hrEpCAM), we obtained novel Aho7c- based Affitins. The binders were expressed in soluble form in E. coli, displayed high stability (up to 74°C; pH 0-12) and were shown to be specific for the hrEpCAM extracellular domain with picomolar affinities (KD = 110 pM). Thus, we propose Aho7c as a good candidate for the creation of Affitins with a 10% smaller size than the Sac7d-based ones (60 versus 66 amino acids). Keywords Affitin, EpCAM, protein engineering, Sac7d, Aho7c, ribosome display.

155

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

156

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

I. Introduction

The development of biomedical research and protein-based technologies to capture, detect or inhibit various targets of interest has induced a need for binding molecules with high affinity and specificity. Monoclonal antibodies (mAbs) and their fragments are the most used affinity reagents, essentially because they are natural binders, part of the immune system and therefore can be obtained by immunization or rational / combinatorial design against nearly any target. However, mAbs are not ideal for every application, as they possess limiting characteristics like low stability, complex structure with disulfide bridges and high costs of production. Their fragments also present some drawbacks (low stability, low recombinant expression yields, tendency to aggregate), and they often need large engineering efforts such as design or selection of favourable mutations and linkers1. To tackle these issues, alternative protein scaffolds have been developed in order to obtain artificial affinity proteins with simple structure (no disulfide bridges, one polypeptide chain), small size (usually <20 kDa), high stability (thermal and chemical), high recombinant production yields and high solubility2–4. While a number of engineered scaffolds have been successfully used to replace or complement antibodies and their fragments, there are perpetual needs to improve the panel of the available affinity tools, as the required properties vary depending on the particular application. For instance, the smaller the size of a protein, the easier becomes full chemistry synthesis5, which allows the inclusion of specific groups at

157

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM chosen positions for labelling and conjugation reactions. Additionally, it has been demonstrated that size also matters in the context of in vivo tumour targeting for imaging applications. Indeed, small high-affinity proteins show higher tumour accumulation/localisation due to efficient extravasation and retention, when compared to molecules with intermediate size of ~25 kDa6,7. Moreover, because of their rapid blood clearance, they provide better tumour-to-normal tissue ratio than mAbs8 . We have previously described such non-antibody scaffolds: the Affitins (for artificial affinity proteins), which are based on members of the “7 kDa DNA-binding” protein family, also known as Sul7d family9–11. These Sul7d proteins are found in various Archaea such as Sulfolobus, Acidianus and Metallospharea genera, and are resistant to high temperatures (up to 90-100°C) and pH (0-12)12. Affitins, originally derived from Sac7d (Sulfolobus acidocaldarius) and Sso7d (Sulfolobus solfataricus), inherit the favourable properties of their parental proteins: they are stable (temperature and pH) and show comparable affinity/specificity as those of antibodies, being twenty times smaller (7 kDa compared to 150 kDa) at the same time. The crystal structures of Affitin/target complexes have shown that binding can be achieved using either a flat surface of interaction or a flat surface+loop13. Affitins have been demonstrated as reagents for intracellular inhibition9, affinity purification10, immunolocalization14, protein chip array15, biosensors16, enzyme inhibition13 , affinity chromatography17 and magnetic fishing18. Affitins are among the smallest engineered scaffolds described. It is of great interest to discover smaller scaffolds which are stable and soluble. As a step in that direction, we have recently characterized 13 members of

158

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM the “7 kDa DNA-binding” family, among which eight putative proteins12. One of these proteins, Aho7c, originating from Acidianus hospitalis was shown to possess thermal stability comparable with Sso7d (96.8 °C vs. 96.5°C) and higher than the one of Sac7d (89.6 °C). Moreover, Aho7c is the shortest among the three proteins (60 amino acids compared to 66 for Sac7d and 64 for Sso7d), mainly due to the shortening of the α-helix at the C-terminus (where EKLKL replaces DMLARAEREKKL (Sac7d) or QMLEKQKK (Sso7d)). Shortening an existing scaffold protein is a challenging task. Indeed, even for robust proteins, stability and solubility can be considerably impaired, as demonstrated with previous attempts on Sso7d19,20. Thus, Aho7c drew our attention. The aim of this work was to use Aho7c as an alternative affinity scaffold in order to create Affitins with improved properties, particularly in term of size, while keeping their other remarkable properties. As a proof of concept, selection by ribosome display was performed against the epithelial cell adhesion molecule (EpCAM), a 40-kDa transmembrane glycoprotein21 identified as a marker of cell proliferation, cancer-stem cells and circulating cancer cells22. The newly engineered anti-EpCAM binders were characterized and their stability and affinity were analysed.

159

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

II. Materials and Methods

II. 1. Generation of DNA libraries

The DNA library was created by saturation mutagenesis of the 10 codons coding for the amino acid residues in positions 9, 10, 22, 23, 25, 32, 34, 41, 43 and 45, which are expected to participate in the interaction between DNA and Aho7c12. The protocol has previously been described for Sac7d13,23. Briefly, library L5 was obtained in the ribosome display format by PCR using a combination of four classical (with non-degenerated sequences) and three degenerate oligonucleotides that include NNS or NHK triplets (encoding for 20 and 16 different amino acids, respectively), followed by a final PCR assembly step to complete the construct (primer sequences are shown in Table 1).

II. 2. Selection of EpCAM-specific binders by ribosome display

The biotinylated extracellular domain of human recombinant EpCAM (hrEpCAM) for the selection by ribosome display was purchased from ACROBiosystems. As the first round is generally not highly selective, at that step, we immobilized the target at high concentration on a plate, in order to create a surface with high density that may facilitate the capturing of larger diversity of binders24. For that, 66 nM neutravidin was coated for

160

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

1h on MaxiSorb plates (Nunc) and blocked for 1h with PBS containing 0.5 % bovine serum albumin (BSA). Both steps were performed at room temperature with agitation. Then the biotinylated target was immobilized for 1 h at 4°C under stirring and the wells were washed three times with PBS, and once with washing buffer (WBT, 50 mM Tris-acetate pH 7.4, 150 mM NaCl, 50 mM Magnesium acetate, 0.1% (v/v) Tween-20). Ribosome

Table 1. Sequences of used primers.

161

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM display selection with the translation mix containing mRNA-ribosome- Affitin complexes was performed at 4°C as previously described23. Briefly, the translation mix was added to the wells with the immobilized target and incubated for 1h with gentle shaking. The unbound complexes were removed by washing with WBT containing 0.5% BSA and the mRNA were collected with elution buffer (50 Mm Tris-acetate pH 7.4, 150 mM NaCl, 20 mM ethylenediaminetetraacetic acid (EDTA)). For the following three rounds, the binding with the target was performed in solution so that the conformational changes caused by the immobilization could be avoided and the binders with slow off-rates could compete easily with the fast dissociating ones. Thus, the translation mix was incubated in solution with hrEpCAM for 1h and the complexes, formed with the biotinylated target, were captured with 50 µL streptavidin or neutravidin coated magnetic beads, 300 nm, stock solution 5 mg/mL (Abcam) for 15 min at 4 °C. To avoid binders against streptavidin or neutravidin, the two proteins were alternated in subsequent rounds. Furthermore, the translation mix was preincubated with the corresponding surface or beads in the absence of the target for 1h at 4°C and transferred to a new tube. To isolate high- affinity binders, the duration and the number of the washing steps were increased, while the concentration of the target was diminished during the four rounds of selection (Table 2). The conditions of the RT-PCR, used to obtain DNA at the end of the first round were as follows: an initial denaturation step at 98°C for 30 s, followed by 35 cycles of 10 s at 98°C, 30 s at 61°C, and 10 s at 72°C with a final elongation step of 5 min at 72°C. For the following rounds, the program was the same, with 30 cycles for round 2 and 35 cycles for rounds 3 and 4. The primers are shown in Table S1.

162

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

Table 2. Conditions for the ribosome display selection against hrEpCAM.

Target concentration, Number of Total duration of Round nM washings washings, min 1 200 6 1 2 150 6 20 3 100 8 35 4 10 10 60

II.3. Screening for hrEpCAM binding by bio-layer Interferometry In order to screen for hrEpCAM binders, Affitins were expressed as already described25. Briefly, the DNA sequences, obtained after 4 rounds of selection, were sub-cloned in expression vector pFP1001, followed by isolation of single clones and protein production in deep-well plates. The Affitins, expressed with MRGS-His6 tag, were purified on spin columns in 96-well format (Macherey & Nagel), containing 100 µL of Ni-Fast Flow Chelating Sepharose (GE Healthcare) equilibrated with TBS pH 7.4, and containing 20 mM imidazole. After washing the proteins were eluted with 200 µL of TBS, pH 7.4, containing 250 mM imidazole.

The screening for binders was performed by bio-layer interferometry (BLI) with an Octet RED96 instrument (ForteBio). 100 nM hrEpCAM in ForteBio kinetic buffer (PBS containing 0,1 % BSA and 0,002 % Tween20) was coated on high precision streptavidin sensor (SAX). Association was followed for 1 min, and then dissociation was monitored for 2 to 5 min. Regeneration was performed with 100 mM glycine, pH 2.5. Positive clones were ranked based on their dissociation constants and sequenced (Eurofins).

163

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

II.4. Protein production and purification To evaluate the bacterial production and the yield, selected Affitins were expressed in 200 mL to 1 L scale in E.coli DH5α Iq strain and purified by metal ion affinity chromatography (IMAC). The previously described protocol9 was followed, except that an additional washing step with TBS, pH 7.4, containing 2 M NaCl was performed. Briefly, cultures were grown at 37°C with shaking in 2xYT media containing 100 µg/mL ampicillin, 25 µg/mL kanamycin and 0.1% glucose until the optical density at 600 nm reached 0.8. Protein expression was induced with iso-propyl thiogalactopyranoside (IPTG) for 16h at 30°C. Cells were harvested by centrifugation, lysed by sonication, and the His-tagged Affitins were captured on a Ni-NTA resin (GE Healthcare). The proteins were eluted with PBS pH 7.4, containing 250 mM imidazole. Their purity and size were evaluated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) on a 15% gel. Affitins chosen for further experiments were additionally purified by size-exclusion chromatography on a Superdex 75 gel filtration column (GE Healthcare) with running buffer PBS pH 7.4.

II.5. LC-ESI-HRMS analysis Proteins were dissolved in water to get a final concentration at 100 µg/mL. Desalting and separation of proteins were achieved on an H-Class UPLC system (Waters Corporation, Milford, USA) by injection of 10 µL of solutions onto an Acquity® BEH300 C4 column (2.1 mm x 50 mm, 1.7 µm; Waters) held at 60°C. The mobile phase was composed of 5% acetonitrile as solvent A and 100% acetonitrile as solvent B, each containing 0.1% formic acid. The elution was carried out using a simple gradient of solvent

164

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

B in solvent A over 12 min at a constant flow rate of 600 µL/min (from 0 to 8 min: from 5 to 95% of solvent B, from 8 to 10 min: kept constant at 95% of solvent B, from 10 to 12 min: from 95 to 5% of solvent B). High- resolution mass spectrometry (HRMS) detection of proteins was performed by a Synapt G2 HRMS Q-TOF mass spectrometer equipped with a Z-Spray interface for electrospray ionization (ESI, Waters). The resolution mode was applied in a mass-to-charge (m/z) ratio ranging from 200 to 4,000 at a mass resolution of 25,000 Full Width Half Maximum in the positive ionization mode. Ionization parameters were as follow: capillary voltage of 3 kV, cone voltage of 30 V, desolvatation gas flow of 900 L/h, source temperature of 120°C, desolvatation temperature of 450°C, Nitrogen as desolvatation gas. Data were collected in the continuum mode at a rate of 4 spectra per second. Leucine enkephalin solution prepared at 2 µg/mL in an acetonitrile/water (50/50/, v/v) mixture was infused at a constant flow in the lock spray channel. A spectrum of 1 s was acquired every 10 s and allowed mass correction during experiments. The experimental molecular weights of proteins were finally deducted from their different charge states obtained by electrospray by using the MaxEnt 1 extension of MassLynx® software (version 4.1, Waters).

II.6. Enzyme-linked immunosorbent assay Enzyme-linked immunosorbent assay (ELISA) was designed for evaluating the specificity of selected binders for hrEpCAM. A Maxisorp plate (Nunc) was coated with 100 µL of 66 nM neutravidin and blocked with 300 µL 0.5 % BSA, followed by the addition of 100 µL of the biotinylated hrEpCAM or the control biotinylated Immunoglobulins G (IgG)

165

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM at 50 nM. 100 µL of 100 nM Affitins or the control hrEpCAM-recognizing mAb MOC31 (Thermo Scientific) were added to the wells. Affitins were also tested for non-specific binding against directly coated BSA (76 nM), streptavidin and neutravidin (66 nM). Bound proteins were detected with 100 µL anti-MRGS-His6 antibody (Qiagen, dilution 1:5000) for Affitins, or anti-mouse-goat-mAb (Jackson Immunoresearch, dilution 1:5000) for the MOC31, both conjugated with horseradish peroxidase, using 100 µL ortho-

-1 phenylenediamine (1 mg.mL OPD, 0.05 % H2O2, 100 mM sodium citrate pH 5.0) as substrate. The absorbance at 450 nm was recorded with a plate reader (Tecan infinite M200 Pro). All steps were performed at room temperature with 1 h of incubation in 100 µL PBS pH 7.4 before the addition of Affitins or PBS pH 7.4 containing 0.1 % Tween 20 for the following steps. Unbound molecules were removed by washing with the corresponding buffer. The wild type Aho7c and an irrelevant Affitin were used as negative controls.

II.7. Surface plasmon resonance Biacore 3000 instrument was used to determine the affinity of the selected binders towards hrEpCAM by surface plasmon resonance (SPR). 1000 resonance units of the biotinylated target were immobilized on a streptavidin-chip. The monomeric Affitins, purified by IMAC and size- exclusion chromatography, were diluted in the running buffer HBSEP pH 7.4 (20 mM HEPES, 150 mM NaCl, and 0,005 % Surfactant P20) at concentrations ranging from 0.78 to 25 nM. Proteins were injected and the association and dissociation times were followed for 3 and 10 min, respectively. Regeneration was performed with 10 mM glycine, pH 1.5. The

166

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

kinetic parameters kon, koff and KD were determined by fitting the data to a simple 1:1 binding model using BIAevaluation 3.1 software. The competition between Affitins and MOC31 mAb for hrEpCAM binding was monitored similarly by cross-blocking analysis using Affitins at 5 µM and MOC31 at 1 µM. The cross-blocking study aimed at evaluating if two affinity molecules share or overlap the same binding epitopes. In order to achieve so, the target was saturated with one Affitin, then a second protein (Affitin or MOC31) was added.

II.8. Biophysical characterisation of Affitins Secondary structures and pH stability were analysed by circular dichroism, and thermal stability by differential scanning calorimetry. All experimental procedures have been described in26. Briefly, circular dichroism spectra of proteins diluted to 0.25 mg/mL in PBS were measured in the far-UV spectral region on a Jasco J-810 instrument (Jasco), using a quartz cell with a path length of 0.2 cm (Hellma). The temperature was maintained at 20°C with a programmable 482 Peltier single cell holder. To study their pH stability, proteins were diluted to 0.33 mg/mL in a solution corresponding to each pH unit from 0 to 14 containing 300 mM NaCl. Protein samples were incubated overnight in these solutions at room temperature and CD spectra were recorded at 20°C as described above. DSC experiments were carried out in PBS, in a VP-DSC instrument (Microcal, Northampton, MA). The temperature was increased by 1°C per min from 30 to 120°C and data analysed with the software supplied with the equipment.

167

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

III. Results

III.1. Generation of the Aho7c library and selection by ribosome display Previous studies with Sac7d described the generation of different libraries (L1 to L4) by randomization of chosen positions, corresponding to amino acids that are involved in the DNA binding13,25. As the sequence identity between Sac7d and Aho7c is high enough (91%) to suggest that the same strategy could be transferred between the two, we created a library L5 for the latter by randomly substituting 10 residues (9, 10, 22, 23, 25, 32, 34, 41, 43 and 45) (Fig. 1A). The primers used for the assembly PCR were carrying NNS triplets that encode all amino acids and only one stop-codon. Exception was made for positions 9 and 10, for which were used NHK codons (that do not encode Trp, Gly, Cys and Arg), as Trp in these positions could promote oligomerisation13. After sequencing 13 random clones, only one showed an open reading frame shift, based on an insertion (data not shown). As the rest of the clones were correct, the generated Affitin library L5 was used for selection by ribosome display against the biotinylated extracellular domain of hrEpCAM. Four rounds were performed, from which the first one was carried out with the target immobilized on a surface, and the following three rounds in solution. ELISA against hrEpCAM, performed with the translation products after each round, showed enrichment of specific binders (data not shown). Affitins obtained after the fourth round were further analysed.

168

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

Figure 1. Sequences and structures of Sac7d, Aho7c and selected Aho7c-based binders with their koffs. (A) Sequence alignment of wild type Aho7c and its variants after selection for binding to hrEpCAM. The common residues are indicated by dots and the positions, chosen for randomization, are highlighted in gray. The residues in bold and underlined are those encoded by sequences of restriction sites necessary for sub-cloning. The sequences of Sac7d and clone C8 which are not binders for hrEpCAM are also included in the alignment for comparison. The numbering of the residues corresponds to that of Aho7c. The dissociation constants for hrEpCAM binding obtained by BLI are displayed on the right. (B) Left: a model of Aho7c, based on its primary sequence and created by I-TASSER server27,28. Mutated residues are represented as blue sticks and Pro in position 52 is in red. Right: the model of WT Aho7c (in green) superimposed on the structure of the wild type Sac7d (in gray; pdb code 1AZP).

III.2. Screening for positive clones and sequence analysis After four rounds of selection, the enriched pool of variants was cloned into the expression vector pFP100123 and binders were produced with N-terminal MRGS-His6-tag in the cytoplasm of E.coli DH5α Iq. 35

169

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM randomly chosen clones were purified by IMAC. The resulting Affitins were screened by BLI with a chip coated with hrEpCAM to identify rapidly binders with the slowest koff-rates. Thirty of these proteins (86%) were able to recognize the target. The analysis of their DNA sequence revealed that 26 were unique sequences, although similar, suggesting convergence of the selection (Fig. 1A). Based on their sequences, the binders can be divided in two main groups: first one with Affitins C4, A5, B5, B2, D7 A6, A9 and E7; and second one with the remaining binders, showing clearly lower dissociation rates (Fig. 1A and Fig. 2). Among all binders, only B4 contained a cysteine residue and was discarded from further experiments in order to avoid complications induced by potential unwanted covalent dimerization.

III.3. Protein production and purification The 25 remaining clones were produced in larger scale for 4h and accumulated in large amounts in the E. coli cytoplasm at 30°C and could be purified by IMAC. All clones were produced in a soluble form and when analysed on a 15% SDS-PAGE showed migration at a position corresponding to the expected size with high purity. Among the 25 clones identified as hrEpCAM binders, Affitins A2, B10, and C7 were further purified by size-exclusion chromatography (final yields in Table 3) and characterized. B10 was chosen as it has the slowest dissociation rate according to BLI experiments (Fig. 1). The sequence of C7 was presented more than once (C7 is identical with C1) and its single mutant C8, that had only one substitution P52S, showed no binding to hrEpCAM (Fig. 1). A2 was chosen as it displayed a binding association phase among those with the largest amplitudes and one of the slowest dissociation rates. The molecular

170

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM masses of these three Affitins including the tag were confirmed by mass spectrometry analysis and corresponded well with the ones, calculated from the amino-acid sequences (presented in brackets): A2 = 8296 (8290) Da, B10 = 8298 (8296) Da and C7 = 8198 (8196) Da.

Figure 2. Phylogenic tree for the selected Affitins showing the distribution of sequences among two main families. Created using Phylogeny.fr web service in “One click” mode29.

III.4. Specificity of the selected Affitins The specificity of A2, B10 and C7 was evaluated by ELISA against hrEpCAM, IgG as an irrelevant target, and also against BSA, neutravidin, and streptavidin – components, used during the selection cycles by ribosome display. All three proteins recognized only hrEpCAM, without

171

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM unspecific binding to any of the control proteins (Fig. 3A). Aho7c and the irrelevant Affitin H4 were used as negative controls and MOC31 - mAb, recognizing EpCAM, as a positive one.

Figure 3. Specificity and affinity of selected Affitins. (A) A2, B10, C7, Aho7c and an irrelevant Affitin H413 were tested by ELISA for binding to hrEpCAM and to IgG, neutravidin, streptavidin and BSA. Affitins and the hrEpCAM recognizing mAb MOC31 were used at 100 nM. The backgrounds of the used components in the absence of Affitins are also shown. (B) The affinity of the clones towards hrEpCAM was evaluated by surface plasmon resonance. Displayed is the association of the clones injected at different concentrations (0.78, 1.56, 3.125, 6.25, 12.5 nM for A2 and C7; 1.56, 3.125, 6.25, 12.5, 25 nM for B10) followed by dissociation after washing. kon, koff and KD were calculated after the fitting indicated with dashed lines. The results for the kinetic data are summarized in Table 1.

III.5. SPR characterisation and affinity determination The dissociation constants of A2, B10 and C7 were studied against immobilized hrEpCAM by SPR and were revealed to be in the picomolar

172

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

range (Fig. 3B and Table 3). C7 showed the highest affinity (KD = 110 pM), followed by A2 and B10 (160 and 300 pM, respectively), while all of them demonstrated slow dissociation rates from the target over time. The wild type Aho7c and an irrelevant Affitin H4, specific for lysozyme13, displayed no binding to hrEpCAM. A cross-blocking study showed that A2, B10 and C7 recognized a common EpCAM epitope, which is different than the one recognized by MOC31 monoclonal antibody (Fig. 4).

Table 3. Characteristics of selected anti-hrEpCAM Affitins.

-1 -1 a -1 a a b c Affitin kon (M s ) koff (s ) KD (M) Yield (mg/L) Tm (°C) A2 3.9 x 106 6.1 x 10-4 1.6 x 10-10 15±5 75.9±0.1 B10 1.2 x 106 3.5 x 10-4 3.0 x 10-10 5±2 69.3±0.1 C7 3.0 x 106 3.4 x 10-4 1.1 x 10-10 15±3 73.2±0.1 a determined by SPR; b after IMAC and size exclusion chromatography; c obtained by DSC. SPR results have been obtained using a global fitting procedure for 5 concentrations of each Affitin (with Chi2.values of 0.47, 0.30 and 0.71 for A2, B10 and C7, respectively). Other experiments were performed in duplicates.

Figure 4. Cross-blocking study. The binding of proteins A2, B10, C7 (5 µM) and mAb MOC31 (1 µM) to hrEpCAM was monitored by SPR after initial incubation of the target with each of the Affitins (first injection). The amplitude of association for each binder after initial injection of buffer was used as a reference for conditions without competition.

173

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

III.6. Biophysical properties of the proteins The circular dichroism spectra of the anti-hrEpCAM Affitins were measured in the far-UV spectral region (Fig. 5). All CD spectra were characteristic of mostly β-stranded proteins with an α-helix contribution as previously reported for Sul7d proteins30. The shape of these spectra correlates well with the one of Aho7c12, however a shift of the ellipticity minima towards a higher wavelength (228 nm) was observed for B10. In order to investigate whether mutants A2, B10 and C7 adopted the pH stability of Aho7c, these novel Affitins were incubated overnight at pH from 0 to 14. Circular dichroism measurements at 222 nm indicated that secondary structures of A2 and C7 remained stable from pH 0 to 12, with a profile similar to the one of Aho7c.

Figure 5. Characterization by circular dichroism. (A) CD spectra of Affitins in 10 mM phosphate buffer, pH 7.4. (B) Study of the effect of pH on the protein structure. Proteins were incubated at room temperature overnight in a solution adjusted to each pH unit from pH 0 to pH 14 and the residual ellipticity was measured by CD at 222 nm. The continuous curves are drawn for clarity only. In correlation with its different CD spectra, B10 showed an apparent different profile from pH 3 to 12. This behaviour was not due to a contribution of buffers used for measurements at the different pH (Fig. 6A). A plot of all spectra recorded from pH 0 to pH 14 showed that B10

174

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM displayed a structured state whatever the pH (Fig. 6B). It is noteworthy that a shift of the spectra toward 228 nm was particularly observed for pH from 4 to 10, suggesting a loss in helical content. It is more probable that the main contribution to a low ellipticity at 222 nm seen for pH from 4 to 10 was this shift rather than an overall stability decrease of the protein.

Figure 6. Study of the pH effect on the circular dichroism spectra for the Affitin B10. CD spectra for pH from 0 to 14 were recorded in the far-UV region. A) Study of the contribution of buffers to the background ellipticity. B) The protein was incubated at room temperature overnight in solutions adjusted to each pH.

175

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

The thermal stability of anti-hrEpCAM binders was determined by differential scanning calorimetry measurements (Fig. 7 and Table 3). The three Affitins were thermostable with Tm ranging from 69.3 to 75.9°C and no signs of aggregation were observed after several cycles of unfolding (data not shown).

Figure 7. Thermal stabilities of selected Affitins. DSC curves were recorded in PBS, pH 7.4.

IV. Discussion

We have previously described Affitins as artificial affinity proteins derived from the archaeal extremophilic 7kDa DNA-binding proteins, such as Sac7d and Sso7d9–11,26. Recently, we have also extensively characterized this family of proteins12. Here we report the successful selection of binders derived from Aho7c, the smallest member of this family, identified to date. The obtained binders, while being 10% smaller than Sac7d (Fig. 1), still display the remarkable properties of Affitins, as they are pH-stable, lack cysteine, are produced from E. coli in soluble form and keep important thermal stability. In addition, these novel Affitins presented high affinity and specificity for hrEpCAM.

176

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

None of the amino acids chosen for randomization fully reverted to those corresponding to the wild type (wt) Aho7c sequence. Only variants B2 and C4 displayed the presence of one residue each, found in wt Aho7c (Y9 and K22, respectively). Thus we can conclude that the chosen positions in this novel scaffold were well suited for the creation of the combinatorial library, and none of them played an essential role for maintaining the protein structure. This is noteworthy as the present work is the first mutagenesis study of Aho7c. It showed that this protein can tolerate impressive changes, as about 17% of the sequence was randomized.

Overall, we found only two non-programmed mutations, in the sequences of the clones C8 and B2, while our previous selections in the framework of Sac7d showed up to three non-programmed mutations per binder sequence25 . This is probably due to the use of a polymerase with higher fidelity in all PCR needed for the ribosome display process in this study. One of these non-programmed mutations was P52S, which almost fully prevented the production of clone C8. This Pro52 is the last amino acid in the loop connecting the terminal α-helix with the fifth β-strand and is strictly conserved among the other studied members of the 7-kDa DNA binding-family12. As proline is known for its higher rigidity than other amino acids, this result suggests that Pro52 has an essential structural role, for instance by ensuring the correct orientation of the α-helix (Fig. 1B).

All isolated binders have an arginine in position 25, encoded by three possible codons. This indicates that this is not the result of a bias and that Arg25 is essential for binding to hrEpCAM. Position 22 is mainly occupied by serine (62%) and threonine (32%), suggesting that a hydroxyl

177

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM group is important for the binding. The next most uniform position is 32, with an alanine in 81% of the sequences, followed by positions 23 and 34 (73% histidine), and 43 (62% proline). In correlation with these observations, all clones with the slowest dissociation rates according to BLI screening have a His23 and a His34 in their sequence. It is noteworthy that three of the preferred positions (His23, Arg25 and His34) are involved in the display of positive charges on the interaction face. A likely explanation for this outcome may lay in the organization of the EpCAM molecule. Indeed, its crystal structure reveals that the N-terminal domain of the extracellular part presents on its surface negatively charged regions. Moreover, most of the antibodies isolated so far against EpCAM recognize this negatively charged patch, including the ones approved and used in therapy31. On the other hand, positions 9 and 10 display the highest diversity among selected sequences (Fig. 1A), suggesting that these positions are marginally contributing to the hrEpCAM binding. A similar result was obtained with the Sac7d-based Affitin C3 which did not show contribution of the equivalent positions to the immunoglobulin G binding25. However, these randomized positions between β-strands 1 and 2 were found to interact with other targets, as shown elsewhere13. Thus, their importance seems to be target-dependent.

The three Affitins, which have been further characterized (A2, B10 and C7) present a high sequence homology (6 out of 10 randomized positions are identical) and bind to the same epitope (Fig. 4). Therefore, they all belong to the vicinity of one particular Affitin-EpCAM solution which has been preferentially selected. Interestingly, Aho7c-based system

178

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM is able to provide other Affitin sequences specific for the target, best exemplified with D7 which is substantially different with only 2 identical residues out of the 10 randomized.

ELISA experiments showed that the three Affitins are specific and recognize hrEpCAM. It is worth mentioning that BSA (pI=4.95), used as a control, also presents negatively charged surface patches32, both in solution or surface-immobilized33. No binding was observed not only for the negatively charged BSA, but also for the slightly negatively charged proteins streptavidin and neutravidin. Thus, the interaction of the binders could not be only charge-dependent.

Another likely explanation for the positive charged surface of the binders is the nature of their parental protein Aho7c as a DNA-binding molecule. And while one can speculate that this could hamper selection against positively charged targets, no such obstructions were met with Sac7d. As an example, one of the first Sac7d-based Affitins was selected against lysozyme from hen egg (KD = 11 nM), a highly positive charged molecule (pI = 11)13.

First, BLI was used for binder screening, as this technology is well suited for the fast analysis of larger data sets and their ranking. However, SPR is more adapted for the precise determination of kinetic parameters, as previously described34. The affinities of the selected anti-hrEpCAM, determined by SPR, Affitins were in the picomolar range, and C7 displayed the highest affinity ever obtained with Affitins (KD = 110 pM), without performing affinity maturation. The most affine binder we have characterized prior to this work was the Sac7d-based Affitin “Sac7*6”

179

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM specific of the bacterial protein PulD with a dissociation constant of 140 pM9. In addition, the high affinity of C7 is associated with a good specificity towards EpCAM (Fig. 2). The affinity of C7 compares well with those obtained for anti-EpCAM Ec1 DARPin (KD ~ 68 pM, after affinity maturation

35 36 step) and for anti-EpCAM mAbs Catumaxomab and HO-3 (KD ~ 550 pM) , with sizes 2.6 and 22.7 times larger than Aho7c-based Affitins, respectively.

The anti-hrEpCAM binders from this work show stabilities (thermal from 69.3 to 75.9°C, Fig.7 and pH 0 to 12, Fig. 5), comparable with those of Affitins derived from Sac7d9,13,17,25,26. Such robust scaffolds are advantageous for performing downstream experiments that require harsh conditions, such as labelling with chelators of radionuclides and fluorescent dyes3.

The stability profile of B10 for pH values between 3 and 12 differed from the ones of A2 and C7 measured at 222 nm (Fig. 5). All ELISA and SPR experiments to assess B10 function were performed at pH 7.4 and indicated the full functionality of the protein. Also, the high thermal stability of 69.3°C was determined for B10 in solution at pH 7.4. These results strongly suggest, according to the changes of shapes of CD spectra, (Fig.6), that the structure in the helical region of B10 is probably more labile than in the other Affitins of this study, while it does not seem to be deleterious for the thermal stability and the functionality of the protein as we did not observed aggregation, degradation or loss of activity during our studies of B10 at pH 7.4. It also suggests that the measure of ellipticity at 222 nm, which is widely used to follow denaturation of proteins with helical content, gives only a partial idea of the overall stability of these

180

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM mostly β-stranded Sul7d proteins (Fig.6). Further structural studies will be necessary to decipher the determinant of this specific behaviour.

The size of Aho7c-based Affitins (60 amino acids versus 66 for Sac7d, without tag) places this novel scaffold among the shortest ones without disulfide bridges, such as DARPins, Monobodies, Affibodies, and ADAPT6 (122 to 155, 96, 58, and 46 amino acids, respectively)37–40. The binders obtained with ADAPT6 scaffold are smaller than Affitins, but they display a lower average thermal stability and seem to need affinity maturation to reach sub-nanomolar affinities39.

V. Conclusion

In summary, in this study we used for the first time the recently characterized Aho7c as an alternative scaffold for the generation of affinity molecules. As a proof of concept, Aho7c-based binders with high affinity and stability were selected against the tumour-associated antigen EpCAM. Sac7d-based Affitins were previously described as plastic enough to tolerate several randomization schemes, while conserving their fold and their favourable properties13,25,26,41. Thus, we anticipate that the novel generation of binding molecules presented in this work may provide new routes for the tailored design of shorter Affitins. Further studies are ongoing to isolate binders from Aho7c against a larger set of targets, both in vitro and in vivo.

181

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

VI. Acknowledgements

We are grateful to Mikael Croyal from the "Plateforme de spectrométrie de masse", University of Nantes, for LC-ESI-HRMS experiments, and we would like to acknowledge John Bianco for the critical reading of the manuscript. We are grateful to ForteBio for providing the Octet RED96 system, Arnaud Vonarburg (ForteBio) for advises about screening and to the IMPACT Core Facility Biogenouest for the CD and SPR instruments. We thank David Teze for the helpful discussions. This work was supported by the European Erasmus Mundus Joint Doctorate in nanomedicine and pharmaceutical innovation (Nanofar) with financial support and a doctoral fellowship for V.K. VII. Conflict of interest

F.P. is an inventor of a patent application (PCT/IB2007/004388), owned by the Institut Pasteur and Centre National de la Recherche Scientifique (CNRS), which covers one process for the generation of Affitins. F.P. is a co-founder of a spin-off company of the Institut Pasteur/CNRS/Université de Nantes, which has a license agreement related to this patent application.

182

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

VIII. References

1. Holliger, P. & Hudson, P. J. Engineered antibody fragments and the rise of single domains. Nat. Biotechnol 23, 1126–1136 (2008). 2. Binz, H. K., Amstutz, P. & Pluckthun, A. Engineering novel binding proteins from nonimmunoglobulin domains. Nat Biotechnol 23, 1257–1268 (2005). 3. Gebauer, M. & Skerra, A. Engineered protein scaffolds as next-generation antibody therapeutics. Curr. Opin. Chem. Biol. 13, 245–55 (2009). 4. Mouratou, B., Béhar, G. & Pecorari, F. Artificial Affinity Proteins as Ligands of Immunoglobulins. Biomolecules 5, 60–75 (2015). 5. Hojo, H. Recent progress in the chemical synthesis of proteins. Curr. Opin. Struct. Biol. 26, 16–23 (2014). 6. Schmidt, M. M. & Wittrup, K. D. A modeling analysis of the effects of molecular size and binding affinity on tumor targeting. Mol. Cancer Ther 8, 2861–71 (2009). 7. Zahnd, C. et al. Efficient tumor targeting with high-affinity designed ankyrin repeat proteins: Effects of affinity and molecular size. Cancer Res 70, 1595–1605 (2010). 8. Orlova, A., Wallberg, H., Stone-Elander, S. & Tolmachev, V. On the Selection of a Tracer for PET Imaging of HER2-Expressing Tumors: Direct Comparison of a 124I- Labeled Affibody Molecule and Trastuzumab in a Murine Xenograft Model. J Nucl Med 50, 417–425 (2009). 9. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc Natl Acad Sci USA 104, 17983–17988 (2007). 10. Krehenbrink, M. et al. Artificial Binding Proteins ( Affitins ) as Probes for Conformational Changes in Secretin PulD. J Mol Biol 383, 1058–1068 (2008). 11. Pecorari, F. & Alzari, P. M. OB-fold used as scaffold for engineering new specific binders. Pat. Publ. Nos. PCT/IB2007/004388 (2008). 12. Kalichuk, V. et al. The archaeal extremophilic ‘ 7kDa DNA- binding ’ proteins : overall characterization of an old gifted family. Sci Rep 6, 37274 (2016). 13. Correa, A. et al. Potent and specific inhibition of glycosidases by small artificial binding proteins (affitins). PLoS One 9, e97438 (2014). 14. Buddelmeijer, N., Krehenbrink, M. & Pugsley, A. P. Type II Secretion System Secretin PulD Localizes in Clusters in the Escherichia coli Outer Membrane. J Bacteriol 191, 161–168 (2009). 15. Cinier, M. et al. Bisphosphonate Adaptors for Specific Protein Binding on Zirconium Phosphonate-based Microarrays. Bioconjug Chem 20, 2270–2277 (2009).

183

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

16. Miranda, F. F., Brient-Litzler, E., Zidane, N., Pecorari, F. & Bedouelle, H. Reagentless fluorescent biosensors from artificial families of antigen binding proteins. Biosens Bioelectron 26, 4190 (2011). 17. Béhar, G., He, X., Mouratou, B. & Pecorari, F. Affitins as robust tailored reagents for affinity chromatography purification of antibodies and non-immunoglobulin proteins. J Chromatogr 1441, 44–51 (2016). 18. Fernandes, C. S. M. et al. Affitins for protein purification by affinity magnetic fishing. J Chromatogr A 1457, 50–58 (2016). 19. Merlino, A., Graziano, G. & Mazzarella, L. Structural and dynamic effects of alpha- helix deletion in Sso7d: implications for protein thermal stability. Proteins 57, 692– 701 (2004). 20. Shehi, E. et al. Thermal stability and DNA binding activity of a variant form of the Sso7d protein from the archeon Sulfolobus solfataricus truncated at leucine 54. Biochemistry 42, 8362–8 (2003). 21. Balzar, M., Winter, M. J., de Boer, C. J. & Litvinov, S. V. The biology of the 17 – 1A antigen ( Ep-CAM ). J Mol Med 77, 699–712 (1999). 22. Simon, M., Stefan, N., Plückthun, A. & Zangemeister-Wittke, U. Epithelial cell adhesion molecule-targeted drug delivery for cancer therapy. Expert Opin Drug Deliv 10, 451–468 (2013). 23. Mouratou, B., Béhar, G., Paillard-laurance, L., Colinet, S. & Pecorari, F. Ribosome Display and Related Technologies. Methods Mol. Biol. 805, 315–331 (2012). 24. Dreier, B. & Plückthun, A. Rapid Selection of High-Affinity Binders Using Ribosome Display. Methods Mol. Biol. 805, 261–286 (2012). 25. Béhar, G. et al. Tolerance of the archaeal Sac7d scaffold protein to alternative library designs: characterization of anti-immunoglobulin G Affitins. Protein Eng. Des. Sel. 26, 267–75 (2013). 26. Béhar, G., Pacheco, S., Maillasson, M., Mouratou, B. & Pecorari, F. Switching an anti-IgG binding site between archaeal extremophilic proteins results in Affitins with enhanced pH stability. J Biotechnol 192, 123–129 (2014). 27. Roy, A., Kucukural, A. & Zhang, Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc 5, 725–738 (2010). 28. Zhang, Y. I-TASSER server for protein 3D structure prediction. BMC Bioinformatics 9, 40 (2008). 29. Dereeper, A. et al. Phylogeny.fr: robust phylogenetic analysis for the non- specialist. Nucleic Acids Res 1;36, 465–469 (2008). 30. Edmondson, S. P. & Shriver, J. W. [11] DNA-binding proteins Sac7d and Sso7d from Sulfolobus. Methods Enzym. 334, 129–145 (2001). 31. Pavšič, M., Gunčar, G., Djinović-Carugo, K. & Lenarčič, B. Crystal structure and its

184

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

bearing towards an understanding of key biological functions of EpCAM. Nat Commun 5, 4764 (2014). 32. Jachimska, B. & Pajor, A. Physico-chemical characterization of bovine serum albumin in solution and as deposited on surfaces. Bioelectrochem 87, 138–146 (2012). 33. Sarangapani, P. S., Hudson, S. D., Migler, K. B. & Pathak, J. A. The limitations of an exclusively colloidal view of protein solution hydrodynamics and rheology. Biophys J 105, 2418–2426 (2013). 34. Yang, D., Singh, A., Wu, H. & Kroe-Barrett, R. Comparison of biosensor platforms in the evaluation of high affinity antibody-antigen binding kinetics. Anal Biochem 508, 78–96 (2016). 35. Stefan, N. et al. DARPins recognizing the tumor-associated antigen EpCAM selected by phage and ribosome display and engineered for multivalency. J Mol Biol 413, 826–43 (2011). 36. Ruf, P. et al. Characterisation of the new EpCAM-specific antibody HO-3: implications for trifunctional antibody immunotherapy of cancer. Br J Cancer 97, 315–321 (2007). 37. Binz, H. K. et al. High-affinity binders selected from designed ankyrin repeat protein libraries. Nat Biotechnol 22, 575–582 (2004). 38. Koide, A., Bailey, C. W., Huang, X. & Koide, S. The fibronectin type III domain as a scaffold for novel binding proteins. J Mol Biol 284, 1141–1151 (1998). 39. Nilvebrant, J. et al. Engineering of bispecific affinity proteins with high affinity for ERBB2 and adaptable binding to albumin. PLoS One 9, 103094 (2014). 40. Nord, K., Nilsson, J., Nilsson, B., Uhl?n, M. & Nygren, P.-?ke. A combinatorial library of an alpha-helical bacterial receptor domain. Protein Eng Des Sel 8, 601– 608 (1995). 41. Pacheco, S., Béhar, G., Maillasson, M., Mouratou, B. & Pecorari, F. Affinity transfer to the archaeal extremophilic Sac7d protein by insertion of a CDR. Protein Eng. Des. Sel. 27, 431–8 (2014).

185

Chapter IV: A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM

186

Chapter V:

Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

188

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Chapter V: Table of contents

I. Introduction ...... 193 II. Materials and Methods ...... 196 II.1. Library generation ...... 196 II.2. Selection of Affitins by ribosome display and epitope masking ..... 196 II.3. Protein production and purification ...... 197 II.4. Surface plasmon resonance ...... 197 II.5. Cell cultures ...... 199 II.6. Screening for EpCAM binding on cells ...... 199 II.7. LNC preparation ...... 200 II.8. Paclitaxel-loaded LNC ...... 201 II.9. Characterization of the particles ...... 202 II.10. Coupling Affitins to LNC ...... 202 II.11. Interaction of LNC with cells ...... 204 II.11.1. FACS analysis ...... 204 II.11.2. Confocal microscopy ...... 204 III. Results ...... 205 III.1. Selection of EpCAM-specific Affitins and binding on cells ...... 205 III.2. Characterisation of selected Affitins ...... 208 III.3. Introduction of terminal cysteine and protein production ...... 209 III.4. LNC preparation and conjugation with Affitns ...... 211 III.5. LNC interaction with cells ...... 212 IV. Discussion ...... 219 IV.1. Binding EpCAM on cells ...... 219 IV.2. Affitin-functionalized LNC ...... 221 V. Conclusion ...... 224 VI. References ...... 225

189

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

190

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Affitin-functionalized lipid nanocapsules for

targeting colorectal cancer cells

Kalichuk V., Renodon-Cornière A., Béhar G., Danhier F., Vanvarenberg K., Mouratou B., Pecorari F, Préat V.

Abstract A progressive strategy against cancer is the attachment of different tumour-targeting ligands to nanoparticles carrying a therapeutic or imaging agent. Such particles are the lipid nanocapsules (LNC) – prepared by solvent free process, they possess great stability and high efficiency for lipophilic drugs encapsulation, like paclitaxel. Targeted particles can not only protect the drug from rapid degradation, but also decrease its concentration in normal tissues. Recently we have reported for the first time the use of Aho7c as an alternative affinity scaffold for the generation of short and stable Affitins, binding to the human recombinant Epithelial Cell Adhesion Molecule (hrEpCAM). Here, we screened for Aho7c-based Affitins, recognizing EpCAM on cells and then we used these molecules as affinity moieties to functionalize LNC, loaded with a fluorescent dye. The tumour targeting properties of the LNC-Affitins complexes were then evaluated in vitro with colorectal cancer cell lines.

Keywords

Lipid nanocapsules, Affitins, EpCAM, tumour targeting.

191

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

192

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

I. Introduction

The development of tumour-targeted drugs or imaging agents that discriminate efficiently between normal and malignant tissues has become one of the main focuses of research in the field of cancer treatment and diagnostics1. A way to achieve this is the use of targeting ligands, which specifically recognize tumour-associated antigens. Up to now, the most widely used class of targeting agents are antibodies and their fragments2,3. Despite their success in the field4, they present several limitations, such as their instability, large size, complex structure and costly manufacturing procedure. Recently, different non-immunoglobulin protein scaffolds and oligonucleotide aptamers have been introduced as alternative binding molecules that overcome some of the drawbacks of antibodies5,6. For example Affitins7, commercially available as Nanofitins, are small artificial affinity proteins, derived from Sac7d (66 amino acids) and Sso7d (64 amino acids) - members of the archaeal 7kDa-DNA binding family8. Affitins are stable (temperature up to 90°C, and pH from 0 to 12), cysteine free, easy to produce in the cytoplasm of E.coli and show affinity and specificity comparable to those of antibodies. These molecules have been demonstrated as reagents for intracellular inhibition9, affinity purification10, immunolocalization11, protein chip array12, biosensors13, enzyme inhibition14, affinity chromatography15 and magnetic fishing16. Recently, we have reported for the first time the use of Aho7c, another member of the 7-kDa DNA-binding family, as an alternative affinity

193

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

scaffold for the generation of Affitins with even smaller size (60 amino acids). Ribosome display was used to select Aho7c-based binders against the human recombinant Epithelial Cell Adhesion Molecule (hrEpCAM). The obtained Affitins demonstrated high stability (up to 74°C; pH 0-12) and high affinity against the hrEpCAM extracellular domain in vitro (KD = 110 pM, see Chapter IV). EpCAM is a 40-kDa transmembrane protein, highly expressed in epithelial tumours, circulating tumour cells and cancer stem cells17 . Recent studies shed light on its function not only as an adhesion molecule, but also as an oncogenic signal transducer. From the diverse palette of EpCAM- targeting strategies, including antibodies, antibody fragments and alternative scaffolds, only the bispecific antibody Catumaxomab is currently approved for therapy18. This shows the necessity to further develop novel therapeutic approaches. Small recognition ligands are particularly suitable for tumour imaging, as they provide good in vivo contrast, due to their rapid tumour uptake and fast clearance from blood and normal tissues19,20. However, in therapy such short half-life is rather disadvantageous, and thus different strategies for modulating pharmacokinetics have been developed. This can be achieved for example by conjugation with polyethylene glycol PEG21, serum albumin22 or fusion with an albumin binding domain23. Furthermore, the use of nanoparticles as a drug delivery system in cancer treatment can not only provide a suitable size for therapy, but can also improve the solubility and stability and thus efficacy of the drugs24. For this study, we have selected lipid nanocapsules (LNC) as a drug delivery system. LNC are prepared by a solvent-free process, based on a

194

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

phase inversion temperature method25 from components, approved by FDA and EMA for oral, topical and parenteral administration26. LNC possess an oily core based on medium-chain triglycerides and are surrounded by membrane containing lecithin and PEGylated surfactant27. LNC allow the encapsulation of a wide range of molecules, including both hydrophilic and hydrophobic therapeutics and also fluorescent dyes that allow their tracing. Importantly, LNC inhibit the P-gp, a drug efflux pump preventing accumulation of anti-cancer drugs in tumour cells28. Among the various anticancer agents that have been encapsulated in LNC is paclitaxel (PTX) – a highly hydrophobic molecule with very low solubility in water29. In order to solubilize PTX, in the marketed formulation Taxol are used Cremophor EL (polyoxyethylated castor oil) and Ethanol (50:50) that are associated with serious and dose-limiting toxicities30. Abraxane was designed to address the insolubility problem, encountered with PTX - a solvent-free albumin-bound paclitaxel NP formulation31, approved internationally for use in patients. To date, there are at least 18 companies focused on preclinical and/or clinical development of paclitaxel nano-formulations32. We hypothesised that combining the advantages of Affitins as targeting agents and LNC as carriers may lead to the creation of vehicles, effective for delivering payloads to cancer cells. Thus, in this work we encapsulated PTX and DiD (a fluorescent dye) in LNC. Furthermore, we screened for Aho7c-based Affitins, recognizing EpCAM on cells, in order to use these new molecules as affinity moieties for functionalization. Then we studied the targeting of these complexes in a cellular context.

195

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

II. Materials and Methods

II.1. Library generation

The DNA library was created by saturation mutagenesis of the 10 codons coding for the amino acid residues in positions 9, 10, 22, 23, 25, 32, 34, 41, 43 and 45, which are expected to participate in the interaction between DNA and Aho7c. The protocol has previously been described for Sac7d14,33. Briefly, library L5 was obtained in the ribosome display format by PCR using a combination of four classical (with non-degenerated sequences) and three degenerate oligonucleotides that include NNS or NHK triplets (encoding for 20 and 16 different amino acids, respectively), followed by a final PCR assembly step to complete the construct (primer sequences are shown in Table 1). To construct library L6 which has an extended loop and corresponds to the random mutagenesis of positions 9, 10, 23, 25, 27, 27a, 27b, 27c, 27d, 28, 29, 30, 32, 34, 41, 43 and 45 in Sac7d protein, the same protocol was used but replacing primer AF-Lib5.3 with AF-Lib6.3.

II.2. Selection of Affitins by ribosome display and epitope masking

Four rounds of ribosome display selection of EpCAM-specific Affitins were performed for libraries L5 and L6 as described in Chapter IV. To select Affitins, binding to different epitopes, epitope masking strategy was used34. For this purpose selection rounds three and four on soluble hrEpCAM were carried out in the presence Affitins C7 and A2 (see Chapter IV) at 0.75 µM each.

196

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

II.3. Protein production and purification

Affitins were expressed in E.coli DH5α Iq strain and purified by metal ion affinity chromatography (IMAC) as described in Chapter IV with additional washing step with PBS pH 7.4, containing 0.1% Triton-X114. The proteins were eluted with PBS pH 7.4, containing 500 mM imidazole. Affitins were additionally purified by size-exclusion chromatography on a Superdex 75 gel filtration column (GE Healthcare) with running buffer PBS pH 7.4. Their purity and size were evaluated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) on a 15% gel.

II.4. Surface plasmon resonance

Biacore 3000 instrument was used to determine the affinity of the selected binders towards hrEpCAM by surface plasmon resonance (SPR). 1000 resonance units of the biotinylated target were immobilized on a streptavidin-chip. The monomeric Affitins, purified by IMAC and size exclusion chromatography, were diluted in the running buffer HBSEP pH 7.4 (20 mM HEPES, 150 mM NaCl, and 0,005 % Surfactant P20) at concentrations ranging from 1.56 to 100 nM. Proteins were injected and the association and dissociation times were followed for 3 and 10 min, respectively. Regeneration was performed with 10 mM glycine, pH 1.5. The resulting data were evaluated with BIAevaluation 3.1 and the kinetic parameters kon, koff and KD were calculated. SPR was also used to evaluate if the Affitins, selected after epitope masking bind to a different epitope, compared to the Affitins from Chapter IV (used as competitors) or to the anti-EpCAM mAb MOC31 (Thermo Scientific). Used concentrations were at 5 µM for the competitors

197

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Affitins and 1 µM for MOC31, while the concentrations of the evaluated Affitins varied from 1.56 to 100 nM.

Table 1. Primer sequences.

A. Primers used for the generation on the 5’-flanking region of the ribosome display construct and the randomized positions of the gene encoding Aho7c: T7C 5'-ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTC-3' 5'- SDA_FLAG.1 AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA TATATCTATGGACTACAAAGATGACGATGACAAA-3' AF-Lib5.1.1 5'-CTACAAAGATGACGATGACAAAGGATCCGCGACCAAAGTAAAATTC-3' 5'- AF-Lib5.2 TCCGCGACCAAAGTAAAATTCAAANHKNHKGGTGAGGAAAAAGAGGTGGAT ATTAGCAAGATC-3' 5'- AF-Lib5.3 CTTGCCGTTGTCGTCGTASNNAAASNNGATCATTTTGCCGACACGSNNCACSN NSNNGATCTTGCTAATATCCACCTC-3' 5'- AF-Lib6.3 CTTGCCGTTGTCGTCGTASNNAAASNNGATSNNSNNSNNSNNSNNSNNSNN SNNACGSNNCACSNNTTTGATCTTGCTAATATCCACCTC-3' 5'- AF-Lib5.4 GCAGTTCTTTCGGGGCGTCTTTTTCGGAAACSNNACCSNNGCCSNNCTTGCCG TTGTCGTCGTA-3' 5'- AF-Lib5.5 GAATTCGGCCCCCGAGGCCATATAAAGCTTCAGTTTCTCCAGCAGTTCTTTCGG GGCGTC-3' B. Primers for the amplification of TolA linker encoded by pFP-RDV1: AG1-link-F 5'-AAGCTTTATATGGCCTCGGGGGCCGAATTC-3' TolA kurz 5'-CCGCACACCAGTAAGGTGTGCGGTTTCAGTTGCCGCTTTCTTTCT-3' C. Primers for the final assembly of the 5'-construct and TolA linker: T7B 5'-ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGG-3' TolA kurz 5'-CCGCACACCAGTAAGGTGTGCGGTTTCAGTTGCCGCTTTCTTTCT-3' D. Primers for RT-PCR after selection: RDV2.1-F3 5'-GATGACGATGACAAAGGATCC-3' AG1-link-R 5'-GAATTCGGCCCCCGAGGCCATATAAAGC-3' E. Primers for introducing C-terminal cystein: SC-H5-F 5'-CCATCACGGATCCGCGACCAAAG-3' H5-Cter 5'-TTAATTAAGCTTTCATTAGCAGCCCTTCAGTTTCTCCAGCAGTT-3'

198

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

II.5. Cell cultures

HT29 (human colorectal adenocarcinoma) and CT26 (mouse colon adenocarcinoma) cells were obtained from ATCC (American Type Culture Collection). Caco2 (human colorectal adenocarinoma), C2C12 (mouse myoblasts) and Raji (human lymphoblasts) were kindly provided by Maria Rescigno (University of Milano-Bicocca, Milano, Italy), Marc Francaux (UCLouvain, Brussels, Belgium) and Sebastian Gouard (UMR S-1232, CRCINA, Nantes, France). Raji cells were cultured in RPMI 1640 (Gibco) medium supplemented with 10% heat inactivated Fetal Bovine Serum (FBS, Gibco), 1% penicillin/streptomycin solution (Gibco, 15140-122) and 2mM glutamine (Gibco). All other cell were cultured in DMEM (Gibco, 41965-039), supplemented in the same way. Caco2 cells were grown at 37°C and 10%

CO2, all other cell lines at 37°C and 5% CO2.

II.6. Screening for EpCAM binding on cells

In order to screen for hrEpCAM binders, Affitins were expressed and purified as already described35. Briefly, the selected DNA sequences were sub-cloned in expression vector pFP1001, followed by isolation of single clones and protein production in E.coli DH5α Iq in 24 well-plates (5 mL/well). The Affitins, expressed with His6-tag, were purified on columns in 8-well strip format (Macherey & Nagel), containing 100 µL of Ni-Fast Flow Chelating Sepharose (GE Healthcare) equilibrated with TBS pH 7.4, and containing 10 mM imidazole. After washing the proteins were eluted with 300 µL of PBS, pH 7.4, containing 500 mM imidazole and analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 15% gel).

199

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

BD FACSCalibur flow cytometer (BD Biosciences) was then used for screening for binding to HT29 (EpCAM positive) or Raji (EpCAM negative) cells, allowed to grow for 72h. Raji cells grow in suspension and were directly collected, while the adherent HT29 were first treated with Accutase. Cells were washed 3 times with PBS-EDTA-BSA 0.1% and distributed in V-bottom 96 well plates at 105 cells/well. 100 µL Affitins, diluted 1:2 or 1:4 in PBS- EDTA-BSA 0.1% were incubated with the cells for 1h at 4°C. Anti-EpCAM mAb MOC31 (Thermo Scientific, dilution 1:100) was used as a positive control. Next, cells were washed twice with PBS-EDTA-BSA 0.1% and incubated for 1h at 4°C with 50 µL of anti-His6 antibody coupled with phycoerythrin (Abcam, ab72467, dilution 1:100) for detection of Affitins or goat anti- mouse-IgG (whole molecule) coupled with phycoeryrthrin (Sigma Aldrich, dilution 1:100) for MOC31, respectively. At the end cells were washed once, resuspended in 150 µL PBS-EDTA and transferred to FACS. Data were analysed with FlowJo software.

II.7. LNC preparation

LNC were prepared as previously described25 by using a phase- inversion temperature method. Briefly, Solutol HS15 (846 mg, BASF), Lipoïd® (75 mg, Lipoid GmbH), NaCl (89 mg, VWR chemicals), Labrafac® (1.028 g, Gattefosse) and water (2.962 mL) were mixed under magnetic stirring for 5 min at 37°C. Three cycles of heating and cooling between 60°C and 90°C were performed. For fluorescent LNC, 27.5 µL of DiD (1,1’-dioctadecyl- 3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzene-sulfonate; Thermo Fisher Scientific) at 1 mg/mL in absolute ethanol was added at 80°C

200

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

during the cooling of the last cycle. An irreversible shock was induced during the phase-inversion zone of the last step (at 74°C) by the addition of 12.5 mL of cold water, leading to formation of stable LNC. The LNC were filtered with a 0.2 µm filter and stored at 4°C.

II.8. Paclitaxel-loaded LNC

Paclitaxel-loaded LNCs were prepared according to Garcion, E. et al.29. Briefly, 20 mg paclitaxel were solubilized in a solution of 206 mg ethanol and 206 mg dichloromethane. All the components for LNC preparation were added to the paclitaxel solution and the formulation was carried out as described above with evaporation of dichloromethane and ethanol during the process. The encapsulation efficiency was determined in triplicate by High Performance Liquid Chromatography (HPLC Waters2487) as already described36,37. Briefly, paclitaxel-loaded LNCs were filtered by 0.2 µm filter in order to remove insoluble paclitaxel crystals that were not encapsulated. Samples were then prepared by dissolving a determined quantity of LNC formulation in a 96/4 (v/v) methanol/tetrahydrofurane solution (VWR chemicals). The reverse phase column was Hypersyl BDS C18 (Thermo Fisher) and the mobile phase was acetonitrile/water (70/30 v/v). The flowrate was set at 1 mL/min and the detection wavelength at 227 nm. Quantification was achieved by comparing with a calibration curve of paclitaxel from 5 to 100 µg/mL obtained under the same conditions as the samples with the use of blank LNC (LOD = 3 ± 1 µg/mL; LOQ = 9,4 ± 1.2 µg/mL). The encapsulation efficiency was calculated by dividing the measured drug amount by the initial drug amount.

201

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

II.9. Characterization of the particles

The size, zeta potential and polydispersity index (PDI) of the LNC were characterized using a Malvern Zetasizer (Malvern Instruments). For the measurement, LNC were diluted 1:100 (v/v) in water. The amount of Affitins on the surface of the nanoparticles was determined as described elsewhere38. Briefly, LNC were separated from the water phase with Amicon Ultra-0.5 mL 100 kDa cut-off filter (Merck, Millipore) for 30 min at 4000 g. The amount of unbound protein, collected with the flow-through, was measured with Micro BCA Protein Assay Kit (Thermo Fisher Scientific).

II.10. Coupling Affitins to LNC

LNC were functionalized with Affitins following a previously described method39 that uses the conjugation chemistry between a thiol- group from a cysteine and a maleimide (Fig.1). For that purpose, a C-terminal cysteine was introduced into the sequence of EpCAM-binding Affitins on a DNA level and Affitin-Cys were produced in E.coli (primer sequences are shown in Table 1). The Purified Affitins were grafted on to the amphiphilic 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide

(polyethylene glycol) -2000] (DSPE-PEG2000-Mal, Nanocs). For that, DSPE-

PEG2000-Mal was solubilized in PBS pH 7.4 under magnetic stirring for 1h at 60°C. 1 mg purified Affitin molecules were reduced with 10 molar equivalents (eq) tris(2-carboxyethyl)phosphine (TCEP, Thermo Fisher

Scientific) for 1h at room temperature. DSPE-PEG2000-Mal and reduced Affitins were mixed at a molar ratio 5:1 and incubated at room temperature for 4h under gentle stirring in a volume 600 µL . Excess of thiol-reactive DSPE-

202

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

PEG2000-Mal was consumed through the addition of 100 eq of L-Cys (Sigma Aldrich). Coupling efficiency was determined by SDS-PAGE analysis and comparing bands of free and lipid-coupled Affitin molecules. Unreacted

DSPE-PEG2000-Mal and Cys were removed by overnight dialysis at 4°C (3.5 kDa MWCO Spectra/Pro membrane, Spectrum Laboratories Inc.). 300 µL of

LNC formulation (at 115 mg/mL) was added to the 600 µL of DSPE-PEG2000- Affitin molecules and post-insertion was performed for 3h at 45°C. Unbound Affitin molecules were removed via dialysis for 2h (50 kDa MWCO Spectra/Pro membrane, Spectrum Laboratories Inc.).

Figure 1. Coupling Affitins to LNC. A) Schematic representation of LNC. B) Reaction between maleimide (from lipid DSPE-PEG-Mal) and thiol-group (from Affitin with terminal Cys). C) Post-insertion within the LNC shell.

203

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

II.11. Interaction of LNC with cells

II.11.1. FACS analysis

BD FACSVerse flow cytometer (BD Biosciences) was used to assess the association of Affitin-functionalized LNC with different cell lines. 25 000 cells (for HT29, Caco2 and C2C12) or 20 000 cells (CT26) per well were grown on 24-well plates in 500 µL culture medium for 72 h. The medium was then replaced with fresh 500 µL, containing different DiD loaded LNC formulations (LNC, LNC-H4, LNC-C3PO) at a final concentration of 1.65 mg/mL. After an incubation for 1h at 4°C or 37°C, the cells were washed with 200 µL DPBS (Gibco) and detached by incubation with 200 µL Accutase (for HT29, Caco2 and CT26) or Trypsin (C2C12) for 5 min at 37°C. The cells were then collected in their respective tubes, washed once with medium and resuspended after centrifugation in DPBS for analysis by flow cytometry. Expression of EpCAM or its absence on the surface of different cell lines was examined with 5 µL FITC-labelled anti-EpCAM mAb (clone VU-1D9, Molecular probes). All samples were prepared in triplicates. Data were analysed with FlowJo software.

II.11.2. Confocal microscopy

250 μL medium containing 15 000 cells were seeded per well in 1 µ- Slide 8 Well (Ibidi, Germany, 80826) and allowed to attach and grow for 48h. The cells were then washed with 200 µL DPBS and incubated for 1 or 3h with 200 μL of LNC formulation (2 mg/mL). After incubation, cells were washed

204

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

again with buffer and cell membranes were stained using CellMask™ DeepRed (Life Technologies, USA) at 37°C for 3 min. Cells were washed twice again with buffer to remove excess staining and fixed with 4% paraformaldehyde at room temperature for 20 min. Cells were washed twice again with buffer, leaving 250 μL of buffer in each chamber. Pictures were taken with Cell Observer Spinning Disk Microscope (Carl Zeiss) and analyzed with AxioVision software.

III. Results

III.1. Selection of EpCAM-specific Affitins and binding on cells

Two sets of Aho7c DNA libraries were designed: a “flat surface” (L5), where 10 of the residues interacting with DNA were mutated, and an alternative “flat surface & loops” library (L6) where a loop was also artificially extended to expand the potential of binding to different epitopes. We first investigated by flow cytometry the ability of the 25 Affitins from L5, reported in Chapter IV and binding to hrEpCAM in vitro, to recognize EpCAM on the surface of HT29 cells. 5 µM of His6-tagged Affitins, purified by immobilized metal affinity chromatography (IMAC), were incubated with cells. Incubation was performed at 4°C to prevent internalization and allow the detection with an anti-His6-mAb coupled to phycoerythrin. As a control for specificity, binding to EpCAM-negative Raji cells was evaluated. However, no binding on cells was detected for any of the Affitins from Chapter IV. Thus, we continued with direct screening for binding on cells for 100 clones from L5

205

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

and 50 clones from L6 produced in a small scale and purified by IMAC. Among them, only one member of L6, named B1 was able to recognize cell- surface EpCAM. This suggests that the recombinant EpCAM used for selection, presented epitopes that are missing or inaccessible in the cellular context. Affitins that did not bind to native EpCAM on cells were not further evaluated.

To select binders recognizing different epitopes on EpCAM, we used an epitope-masking strategy. In Chapter IV, we showed that the three characterized in vitro binders A2, B10 and C7 share sequence similarity and bind to the same epitope on hrEpCAM. To increase the diversity, the output of selection round two for libraries L5 and L6 was used as a starting material for two more rounds of ribosome display in the presence of A2 and C7 at 0.75 µM each as competitors. The rest of the protocol was carried out as described in Chapter IV, and randomly selected clones were screened for binding on cells. It is worth mentioning that, when screening was performed after the initial selection, purified proteins were not evaluated on SDS-PAGE gels, so the presence of protein in each of the samples could not be guaranteed. To avoid that for the screening after selection with epitope- masking, eluted samples were first evaluated on 15% SDS-PAGE gels and only Affitin-containing eluates were analysed by FACS (Fig.1).

206

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Figure 2. 15% SDS-PAGE gels for some of the proteins (lines 1 to 13), produced in 24- deep well plates for screening for binding on cells, expressing EpCAM. Line 14 : Precision Plus Protein™ All Blue Prestained Protein Standards (Bio Rad), 10-250 kDa.

Out of 132 single colonies transformed with the output of the selection after two additional rounds with epitope masking, 63 produced proteinswere detected on SDS-PAGE gels. Flow cytometry experiments revea led that 48 of them were binding to HT29, but not to Raji cells (Fig.2).

Figure 3. Example of 4 random clones from the screening on HT29 (on the left) and Raji (on the right). Autofluorescence from the cells is shown in light gray, fluorescence signal from Affitin+anti-His6-PE in dark gray.

207

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Sequencing showed that 44 of them were identical or near identical to B1. However, 4 of them correspond to a new sequence that was named C3PO (Fig.3).

Figure 4. Sequences of the wild type Aho7c, the library with loop and the two Affitins, binding to EpCAM on cells. III.2. Characterisation of selected Affitins

The dissociation constants of the two cell-binding Affitins, B1 and C3PO after purification by IMAC and gel filtration, were determined by SPR to be in the nanomolar range against hrEPCAM (KD = 7.5 and 5 nM, respectively). Furthermore, competition binding assays by SPR revealed that B1 and C3PO, the dominant binders in the epitope-masking selection output, did not compete for binding with C7 and A2, used during the selection (Fig. 4). This indicates that the epitope masking indeed forced the selection towards a different epitope on EpCAM. MOC31 binding was not reduced by the presence of C3PO or B1, suggesting that the antibody does not share the same epitope with the Affitins (same was reported for binders C7, A2 and B10 in Chapter IV). The signal for C3PO binding to EpCAM was decreased only in the presence of B1. Thus, we may speculate, that these two binders, that also recognize EpCAM on cells, share at least partially the same epitope. However, without repeating the experiment we cannot claim it is statistically relevant.

208

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Figure 4. Competition study. The binding of proteins B1 and C3PO (5 µM) and mAb MOC31 (1 µM) to hrEpCAM was monitored by SPR after initial incubation of the target with a competitor Affitin (first injection).

III.3. Introduction of terminal cysteine and protein production

A codon for cysteine was introduced at the 3’-end of the DNA sequences of B1 and C3OP, corresponding to the C-terminal of the proteins. The plasmids, containing the genes for B1-Cter and C3PO-Cter were sequenced and the results revealed that the codon was successfully integrated (Fig.3). Proteins with Cys were produced in the cytoplasm of E.coli. The presence of Cter in the sequence of B1 inhibited almost fully its expression and thus, it could not be used for further experiments. C3PO-Cter retained its binding on cells, as evaluated by FACS. Thus, it was used for the experiments of coupling with LNC. Additionally, different concentrations of

C3PO were evaluated for binding to HT29 and the KD was estimated to be approximately 1.5 µM by FACS (Fig. 5).

209

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

This was not done for C3PO-Cter, as the presence of the terminal Cys would compromise the monomeric interaction. Slight displacement of the signal was observed, when incubating Raji cells with C3PO, but it seemed negligible, when compared to the signal for HT29.

Figure 5. C3PO binding to cells. A) Different concentrations of C3PO binding on HT29 or Raji: 0.37 µM (green), 1.1 µM (yellow), 3.3 µM (orange), 10 µM (red) and 30 µM (magenta). Cells auto-fluorescence is in blue. B) Correlation between C3PO concentration and fluorescence signal for the binding to HT29.

210

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

III.4. LNC preparation and conjugation with Affitns

LNC, LNC-DiD and LNC-PTX were prepared using a phase-inversion solvent free process and characterized with a Malvern Zetasizer (Table 2). The average size of the particles without functionalization was around 50 nm, with a polydispersity index inferior than 0.2, indicating a homogeneous population of particles38. Prepared by this protocol25, the final LNC concentration is 115 mg/mL, with number of particles around 2.5-3.1 x 1015 LNC/mL (calculated as described in40). Different amounts of PTX were encapsulated with drug loading between 0.6 and 1.9 mg/mL depending on the different initial amount of the used drug, with high encapsulation efficiency in all cases (96 ± 3 %). These numbers correspond to the data reported in literature.

Table 2. Physicochemical characteristics of different LNC formulations.

Zeta potential Encapsulation Formulation Size (nm) PDI (mV) rate (%)

LNC 53,38 ± 1,56 0,10 ± 0,03 -6,19 ± 0,62 LNC-DiD 52,08 ± 0,93 0,05 ± 0,01 -6,01 ± 1,04 LNC-DiD-H4 57,37 ± 2,51 0,07 ± 0,02 -6,10 ± 1,04 LNC-DiD-C3PO 62,94 ± 4,58 0,10 ± 0,04 -9,48 ± 0,97 LNC-PTX** 50,10 ± 1,71 0,06 ± 0,03 -5,80 ± 0,82 96 ± 3 LNC-PTX-H4*** 59,10 0,05 -6,90 LNC-PTX-C3PO*** 62,36 0,24 -9,80 **n=6, ***n =1. For the rest n=3. In order to covalently attach Affitins with terminal cysteines to LNC-

DiD, first a reaction between the maleimide DSPE-PEG2000-Mal and the reduced Cys of the Affitins was performed. Then, the DSPE-PEG2000-Affitin complexes were postinserted in the LNC shell at 45°C. Characterizaton of the

211

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

size demonstrated an increase, compared for the initial formulation: 57 nm for the LNC-DiD-H4 (control Affitin) and 63 nm for LNC-DiD-C3PO, compared to 52 nm for the naked LNC-DiD. The polydispersity index was kept under 0.2 (Table 2).

To evaluate the amount of Affitins on the surface of the LNC, a BCA assay was performed after separating the water phase containing the unbound protein via filter centrifugation. The amount of bound proteins was calculated as the difference between the initial proteins, used for conjugation with LNC, and the free proteins remaining after the LNC post- instertion. The concentration of particles in the initial formulation was calculated to be 2.6 x 1015 LNC/mL, using a formula described in Minkov et al., 2005, assuming that their shape is spherical and that the whole amount of Labrafac is incorporated in the capsules. Dividing the number of bound Affitins to the number or LNC in the final formulation lead to the approximation of 28 ± 2 molecules protein per LNC-DiD-H4 and 36 ± 1 per LNC-DiD-C3PO.

III.5. LNC interaction with cells

We evaluated in vitro the capacity of naked LNC-DiD, functionalized with C3PO or with control H4 to target two colorectal cancer cell lines, expressing EpCAM – HT29 and Caco2. Two EpCAM negative cell lines, CT26 and C2C12, were used as negative controls. The presence or lack of EpCAM expression from the cell lines was evaluated on protein level with anti- EpCAM-FITC antibody (VU-1D9, Molecular probes) by FACS (Fig. 6) and on mRNA level by reverse-transcription PCR (data not shown).

212

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

First we evaluated binding to the different cell lines at 37°C. Strong signal for binding was observed for all the cell lines, both EpCAM positive and EpCAM negative. With the exception on C2C12, a lower degree of interaction was detected as well between HT29, Caco2, CT26 and the other two formulations – either naked LNC-DiD or control LNC-DiD-H4 (Fig. 6).

Figure 6. Interaction of LNC-DiD, LNC- DiD-H4 and LNC-DiD-C3PO with different cell lines for 1h at 37°C.

213

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

To discriminate active versus passive mechanism of LNC-interaction with cells, the experiment was also realized at 4°C (Fig. 6B). Lowering temperature decreases the metabolitic activity of the cells, and indeed the signal for LNC-DiD and LNC-DiD-H4 almost fully disappeared.

However, binding was not avoided for LNC-DiD-C3PO and stayed surprisingly high both for HT29 (EpCAM+) and CT26 (EpCAM-). This was indicative for interaction with all the cells, governed by the C3PO moiety on the surface of the LNC (Fig. 7).

Figure 7. Interaction of LNC-DiD, LNC-DiD-H4 and LNC-DiD-C3PO with different cell lines for 1h at 4°C.

214

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Improvement of cell targeting and uptake for all cell lines was also evident when using fluorescent microscopy. After 1 and 3 hours incubation at 37°C, the fluorescent particles LNC-DiD-C3PO were observed to be interacting with all cell lines, whereas no signal was obsered with the control LNC-DiD-H4S even after 3h incubation (Fig.8).

Figure 8. Interaction of LNC-DiD-H4 or LNC-DiD-C3PO (in green) with HT29 cells (in red) for 1 or 3 h at 37°C.

215

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Figure 8. Contunied for Caco2 and CT26 cells.

216

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Figure 8. Contunied for C2C12 cells.

In order to evaluate if multipresentation of C3PO on the surface of LNC led to avidity1 effects and thus to the enhancement of weak non-specific interactions, FACS experiments were performed with four naked Affitins (C3PO, C3PO-Cter, H4 and H4-Cter) and the four cell lines, used in the studies with LNC. 105 cells were incubated with Affitins (concentrations 0.37, 1.1, 3.33 and 10 µM) for 1h at 4°C. In all cases C3PO and C3PO-Cter were interacting with both EpCAM-positive and EpCAM-negative cell lines,

1Avidity is the accumulated strength of multiple affinities summed up from multiple binding interactions and can affect tumour penetration, cellular internalization53

217

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

whereas no signal was detected for H4 and H4-Cter (Fig. 9). Thus, the interaction of C3PO with EpCAM negative cell lines is not a result of its conjugation to LNC.

Figure 9. Interaction of C3PO, C3PO-Cter, H4 and H4-Cter at 1.1µM with different cell lines for 1h at 4°C. EpCAM-FITC antibody VU-1D9 was used as a control.

218

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

IV. Discussion

IV.1. Binding EpCAM on cells

EpCAM, widely expressed on solid tumours and tumour-initiating cells, is efficiently internalized and is thus considered a good target for anticancer agents18. In Chapter IV we reported for the first time the use of Aho7c, a member of the archaeal 7kDa DNA-binding family, as a scaffold for generating small (60 amino acids) and stable Affitins8, shorter than the existing ones based on Sac7d (66 amino acids9) or Sso7d (64 amino acids41). Ribosome display was used for the selection of specific and high-affinity Aho7c binders against the recombinant extracellular domain of the human EpCAM in vitro.

Here, we screened for Affitins recognizing EpCAM on cells in order to use them as targeting ligands for functionalizing lipid nanocapsules and create vehicles for the targeted delivery of payloads to cancer cells.

After initial selection, many binders were detected against hrEpCAM used as a target; however only one was able to recognize the native conformation of EpCAM on cells. It is possible that the recombinant extracellular EpCAM protein presented additional epitopes that are not accessible on the cell surface. Indeed, EpCAM is oligomerizing42 and participating in complexes with other molecules on the plasma membrane43. For example, EpCAM is associating with the tight junction protein Claudin-7 and is recruited in tetraspanin-enriched domains, where it builds a complex with tetraspanins and CD44v644. Thus, epitopes that are available on the

219

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

isolated protein can be masked by various interactions when in a cellular context. This hypothesis was evoked by Stefan et al. in 2011, when phage display was used for selection of DARPins using purified extracellular domain of EpCAM as a target45. Six isolated binders showed selective binding to EpCAM on ELISA, but only one was able to bind EpCAM on cells. Another possible explanation is that some of the epitopes presented by the recombinant protein do not exist in EpCAM expressed by cell lines, because of differences with the native protein, such as conformation or post- translational modifications. Although the purchased recombinant EpCAM produced in HEK293 cell was recognised by the control mAb MOC31, the supplier provides no information about its folding and glycosylation. Studies have shown that proteins expressed in HEK or CHO cells, two frequently used mammalian cell lines, have very significant differences in their glycosylation pattern46. We can speculate that hrEpCAM used for selection differs from native molecules presented on cell surfaces, and thus that there are unshared epitopes.

Nevertheless, the use of combinatorial libraries in display selection technics is an efficient approach for obtaining binders with desired specificities. However, some epitopes may have a selective advantage in the panning process arising from a higher affinity, thus leading to a selection of set of binders with preference towards a specific epitope 34. Although high affinity is a desirable attribute, in some cases one needs to obtain binders with different characteristics. A strategy for extending the range of recognized epitopes is the epitope masking-approach that uses binders obtained by an initial selection from the libraries to block the corresponding

220

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

dominant epitope34. This strategy was initially used to successfully clone novel, neutralizing human Ab Fabs directed to a previously undefined conformational epitope on the gp120 surface molecule of human immunodeficiency virus type 1 (HIV-1)47.

Here, the use of the epitope-masking strategy indeed led to an output of binders recognizing an epitope different from the one dominating the initial selection. This may be useful for increasing the repertoire of binders in future selections against various targets.

Furthermore, alternative library designs increase the diversity of the obtained binders and their properties35. Interestingly, in this study, the only obtained binders for EpCAM on cells belonged to the “flat surface & loops” library in which a loop was artificially extended. Indeed, it has been demonstrated that such extended loop in Affitins brings flexibility and a potential to bind clefts14.

Despite the difficulties, combining the epitope-masking strategy with direct screening on cells led to the identification of an Affitin that binds to the EpCAM expressing colorectal cell line HT29 and not to the control cells Raji and that retained this quality after the introduction of a terminal cysteine.

IV.2. Affitin-functionalized LNC Encapsulation of drugs in LNC has been demonstrated to solubilize and protect drugs like paclitaxel from the host biological environment, improving their half-life and preserving their biological activity27. The high efficacy of encapsulation of Paclitaxel in our study (96 ± 3 %) corresponds

221

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

well with the one described in literature29,36,38. LNCs not only eliminates the need to use Chremophor EL and ethanol as solvents (used for the commercial formulation of Taxol), but they also release PTX in a sustained fashion, as reported for release in phosphate buffer, pH 7.4 at 37 °C 29. Preclinical studies on cell cultures and animal models of tumours have been performed, showing promising results.

Affitins are expected to be generated without cysteine, except if a cysteine is selected during the selections. In that case, Affitins containing cysteine are discarded. The possibility to introduce unique cysteine in their sequence subsequently allows site-specific modifications and conjugation with various moieties without interfering with protein folding. In this study, we used for functionalizing 50 nm LNC-DiD a bifunctional polymer

(DSPEG2000-maleimide) that allows insertion in the LNC shell via the lipid component DSPE. On the other side, the maleimide group can participate in covalent coupling by forming a thioether bond with cysteine through reacting with their thiol groups. This strategy has been applied for the functionalization of LNC with thiol-containing peptides and proteins, including mAbs39, their fragments48 or an RGD-peptide49. In our case, it served to prepare LNC-DiD, conjugated either with C3PO – an Affitin, binding to EpCAM on cells, or H4 – a control Affitin, which binds to lysozyme14.

Surprizingly, binding and uptake of LNC-DiD-C3PO was enhanced not only for EpCAM positive cell lines HT29 and Caco2, but also for EpCAM negative CT26 and C2C12, as demonstrated both by FACS and confocal microscopy. Binding to these four cell lines was also detected with naked

222

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

Affitins C3PO and C3PO-Cter by FACS. Thus, we discard the possibilities that there is a weak non-specific binding enhanced by the multipresentation of C3PO on the surface of LNC or that the conjugation process changed the conformation and specificity of C3PO. In 2016, the group of Prof Wittrup reported charge-neutralized variants of Sso7d that maintain high thermal stability, used as scaffolds for affinity molecules52. The main reason that inspired these modifications was the fact that because Sso7d is a DNA- binding protein, it is highly positively charged (pI = 10.25) and thus engages in nonspecific interaction with mammalian cell membranes, as they demonstrated with HeLa cells. It is important, that the pI of Sac7d and Aho7c are identical with the one of Sso7d. The pI of C3PO, C3PO-Cter, H4 and H4- Cter are 9.94, 9.74, 9.56 and 9.16 respectively. However, as already stated above, before epitope masking we had many Aho7c based Affitins that showed no binding to HT29 or Raji cells. For example, Affitins A2, B10 and C7 (pI = 10.05, 9.93 and 10.14 respectively)*2, described in Chapter IV, did not bind non-specifically to cells. Thus, this is not pure physico-chemical effect due to positively charged proteins. Furthermore, the fact that almost no binding was observed with Affitins alone on Raji cells indicates that the interaction with the other cell line was somehow specific.

Probable reason for the difficulties of the generated Affitins to recognize specifically EpCAM on cells could be the quality of purchased hrEpCAM used for the selection of binders. The conformational and/or glycosylation differences between hrEpCAM and native EpCAM exposed on

*2 Results provided by PepCalc.com, Innovagen AB.

223

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

cells could be sufficient to prevent isolation of Affitins with the desired specificity. Also, the fact that hrEpCAM was recognised by the control mAb MOC31 does not discard the possibility that hrEpCAM was co-purified in complex with other molecules. Further experiments should be conducted in order to determine if binders were selected indeed against EpCAM. One possibility is to perform a sandwich ELISA where MOC31 is used as specific capture antibody for hrEpCAM and C3PO as a detection one.

V. Conclusion

In our study, we performed ribosome display selections against recombinant EpCAM to create alternative affinity proteins - Aho7c based Affitins. Furthermore, using a solvent-free process, we prepared lipid nanocapsules and conjugated them with Affitins in order to create vehicles effective for delivering payloads to cancer cells. However, our results showed that selected Affitin C3PO was interacting with both EpCAM-positive and EpCAM-negative cells used for the tests. We discard the possibility that this is pure physico-chemical effect due to the positive charge of the protein, as no unspecific binding was observed with other Affitin molecules (from Chapter IV) or a control Affitin H4. We will pursue our inquiries in the two following directions: first, a more thorough characterization of the interaction between the Affitin and EpCAM needs to be conducted. Second, tumour targeting experiments in mouse models will give more relevant information about the behaviour of Affitin C3PO in vivo.

224

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

VI. References: 1. Sawyers, C. Targeted cancer therapy. Nature 432, 294–7 (2004). 2. Holliger, P. & Hudson, P. J. Engineered antibody fragments and the rise of single domains. Nat. Biotechnol 23, 1126–1136 (2008). 3. Sapra, P. & Shor, B. Monoclonal antibody-based therapies in cancer: advances and challenges. Pharmacol Ther 138, 452–69 (2013). 4. Scott, A. M., Wolchok, J. D. & Old, L. J. Antibody therapy of cancer. Nat. Rev. Cancer 12, 278–87 (2012). 5. Skrlec, K., Strukelj, B. & Berlec, A. Non-immunoglobulin scaffold: a focus on their targets. Trends Biotechnol. 33, 408–418 (2015). 6. Owens, B. Faster, deeper, smaller—the rise of antibody-like scaffolds. Nat. Biotechnol 35, 602–603 (2017). 7. Pecorari, F. & Alzari, P. M. OB-fold used as scaffold for engineering new specific binders. Pat. Publ. Nos. PCT/IB2007/004388 (2008). 8. Kalichuk, V. et al. The archaeal extremophilic ‘ 7kDa DNA- binding ’ proteins : overall characterization of an old gifted family. Sci Rep 6, 37274 (2016). 9. Mouratou, B. et al. Remodeling a DNA-binding protein as a specific in vivo inhibitor of bacterial secretin PulD. Proc. Natl. Acad. Sci. U.S.A. 104, 17983–8 (2007). 10. Krehenbrink, M. et al. Artificial Binding Proteins ( Affitins ) as Probes for Conformational Changes in Secretin PulD. J Mol Biol 383, 1058–1068 (2008). 11. Buddelmeijer, N., Krehenbrink, M. & Pugsley, A. P. Type II Secretion System Secretin PulD Localizes in Clusters in the Escherichia coli Outer Membrane. J Bacteriol 191, 161–168 (2009). 12. Cinier, M. et al. Bisphosphonate Adaptors for Specific Protein Binding on Zirconium Phosphonate-based Microarrays. Bioconjug Chem 20, 2270–2277 (2009). 13. Miranda, F. F., Brient-Litzler, E., Zidane, N., Pecorari, F. & Bedouelle, H. Reagentless fluorescent biosensors from artificial families of antigen binding proteins. Biosens Bioelectron 26, 4190 (2011). 14. Correa, A. et al. Potent and specific inhibition of glycosidases by small artificial binding proteins (affitins). PLoS One 9, e97438 (2014). 15. Béhar, G., He, X., Mouratou, B. & Pecorari, F. Affitins as robust tailored reagents for affinity chromatography purification of antibodies and non-immunoglobulin proteins. J Chromatogr 1441, 44–51 (2016). 16. Fernandes, C. S. M. et al. Affitins for protein purification by affinity magnetic fishing. J Chromatogr A 1457, 50–58 (2016). 17. Münz, M., Baeuerle, P. a & Gires, O. The emerging role of EpCAM in cancer and stem

225

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

cell signaling. Cancer Res 69, 5627–9 (2009). 18. Simon, M., Stefan, N., Plückthun, A. & Zangemeister-Wittke, U. Epithelial cell adhesion molecule-targeted drug delivery for cancer therapy. Expert Opin Drug Deliv 10, 451–468 (2013). 19. Schmidt, M. M. & Wittrup, K. D. A modeling analysis of the effects of molecular size and binding affinity on tumor targeting. Mol. Cancer Ther 8, 2861–71 (2009). 20. Zahnd, C. et al. Efficient tumor targeting with high-affinity designed ankyrin repeat proteins: Effects of affinity and molecular size. Cancer Res 70, 1595–1605 (2010). 21. Simon, M., Stefan, N., Borsig, L., Plückthun, A. & Zangemeister-Wittke, U. Increasing the Antitumor Effect of an EpCAM-Targeting Fusion Toxin by Facile Click PEGylation. Mol. Cancer Ther. 13, (2014). 22. Simon, M., Frey, R., Zangemeister-Wittke, U. & Plückthun, A. Orthogonal assembly of a designed ankyrin repeat protein-cytotoxin conjugate with a clickable serum albumin module for half-life extension. Bioconjug. Chem. 24, 1955–66 (2013). 23. Tolmachev, V. et al. Radionuclide therapy of HER2-positive microxenografts using a 177Lu-labeled HER2-specific affibody molecule. Cancer Res. 67, 2773–2782 (2007). 24. Hare, J. I. et al. Challenges and strategies in anti-cancer nanomedicine development: An industry perspective. Adv. Drug Deliv. Rev. 108, 25–38 (2017). 25. Heurtault, B., Saulnier, P., Pech, B., Proust, J. & Benoit, J. A Novel Phase Inversion- Based Process for the Preparation of Lipid Nanocarriers. Pharma Res 19, 875–880 (2002). 26. Carradori, D., Saulnier, P., Preat, V., des Rieux, A. & Eyer, J. NFL-lipid nanocapsules for brain neural stem cell targeting in vitro and in vivo. J. Control. Release 238, 253– 262 (2016). 27. Huynh, N. T., Passirani, C., Saulnier, P. & Benoit, J. P. Lipid nanocapsules: A new platform for nanomedicine. Int J Pharm 379, 201–209 (2009). 28. Roger, E., Lagarce, F., Garcion, E. & Benoit, J. P. Reciprocal competition between lipid nanocapsules and P-gp for paclitaxel transport across Caco-2 cells. Eur. J. Pharm. Sci. 40, 422–429 (2010). 29. Garcion, E. et al. A new generation of anticancer, drug-loaded, colloidal vectors reverses multidrug resistance in glioma and reduces tumor progression in rats. Mol. Cancer Ther. 5, 1710–1722 (2006). 30. Pillai, G. Nanomedicines for Cancer Therapy : An Update of FDA Approved and Those under Various Stages of Development. SOJ Pharm Pharm Sci 1, 1–13 (2014). 31. Damascelli, B. et al. Intraarterial chemotherapy with polyoxyethylated castor oil free paclitaxel, incorporated in albumin nanoparticles (ABI-007): Phase I study of patients with squamous cell carcinoma of the head and neck and anal canal: preliminary evidence of clinical activity. Cancer 92, 2592–602 (2001).

226

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

32. Sofias, A. M., Dunne, M., Storm, G. & Allen, C. The battle of ‘nano’ paclitaxel. Adv Drug Deliv Rev (2017). doi:1 33. Mouratou, B., Béhar, G., Paillard-laurance, L., Colinet, S. & Pecorari, F. Ribosome Display and Related Technologies. Methods Mol. Biol. 805, 315–331 (2012). 34. Ditzel, H. J. in Antibody Phage Display 179–186 (2002). 35. Béhar, G. et al. Tolerance of the archaeal Sac7d scaffold protein to alternative library designs: characterization of anti-immunoglobulin G Affitins. Protein Eng. Des. Sel. 26, 267–75 (2013). 36. Hureaux, J. et al. Toxicological study and efficacy of blank and paclitaxel-loaded lipid nanocapsules after i.v. administration in mice. Pharm. Res 27, 421–430 (2010). 37. Danhier, F. et al. Paclitaxel-loaded PEGylated PLGA-based nanoparticles: in vitro and in vivo evaluation. J Control Release 133, 11–7 (2009). 38. Balzeau, J. et al. The effect of functionalizing lipid nanocapsules with NFL-TBS.40-63 peptide on their uptake by glioblastoma cells. Biomaterials 34, 3381–3389 (2013). 39. Bourseau-Guilmain, E. et al. Development and characterization of immuno- nanocarriers targeting the cancer stem cell marker AC133. Int. J. Pharm. 423, 93– 101 (2012). 40. Minkov, I., Ivanova, T., Panaiotov, I., Proust, J. & Saulnier, P. Reorganization of lipid nanocapsules at air-water interface. Colloids Surf B Biointerfaces 44, 197–203 (2005). 41. Béhar, G., Pacheco, S., Maillasson, M., Mouratou, B. & Pecorari, F. Switching an anti- IgG binding site between archaeal extremophilic proteins results in Affitins with enhanced pH stability. J Biotechnol 192, 123–129 (2014). 42. Pavšič, M., Gunčar, G., Djinović-Carugo, K. & Lenarčič, B. Crystal structure and its bearing towards an understanding of key biological functions of EpCAM. Nat Commun 5, 4764 (2014). 43. Wu, C., Mannan, P., Lu, M. & Udey, M. C. Epithelial Cell Adhesion Molecule ( EpCAM ) Regulates Claudin Dynamics and Tight Junctions. J Biol Chem 288, 12253–12268 (2013). 44. Schnell, U., Cirulli, V. & Giepmans, B. N. G. EpCAM: structure and function in health and disease. Biochim. Biophys. Acta 1828, 1989–2001 (2013). 45. Stefan, N. et al. DARPins recognizing the tumor-associated antigen EpCAM selected by phage and ribosome display and engineered for multivalency. J Mol Biol 413, 826–43 (2011). 46. Croset, A. et al. Differences in the glycosylation of recombinant proteins expressed in HEK and CHO cells. J Biotech 161, 336–348 (2012). 47. Ditzel, H. J. et al. Neutralizing recombinant human antibodies to a conformational

227

Chapter V: Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells

V2- and CD4-binding site-sensitive epitope of HIV-1 gp120 isolated by using an epitope-masking procedure. J Immunol 154, 893–906 (1995). 48. Beduneau, A. et al. Brain targeting using novel lipid nanovectors. J Control Release 126, 44–49 (2008). 49. Hirsjärvi, S., Belloche, C., Hindré, F., Garcion, E. & Benoit, J. P. Tumour targeting of lipid nanocapsules grafted with cRGD peptides. Eur. J. Pharm. Biopharm. 87, 152– 159 (2014). 50. Edmondson, S. P. & Shriver, J. W. [11] DNA-binding proteins Sac7d and Sso7d from Sulfolobus. Methods Enzym. 334, 129–145 (2001). 51. Andrew T. Clark, Bradford S. McCrary, Stephen P. Edmondson, * and & Shriver*, J. W. Thermodynamics of Core Hydrophobicity and Packing in the Hyperthermophile Proteins Sac7d and Sso7d†. Biochemistry 43, 2840–2853 (2004). 52. Traxlmayr, M. W. et al. Strong enrichment of aromatic residues in binding sites from a charge-neutralized hyperthermostable Sso7D scaffold library. J. Biol. Chem. 291, 22496–22508 (2016). 53. Rudnick, S. I. & Adams, G. P. Affinity and avidity in antibody-based tumor targeting. Cancer Biother. Radiopharm. 24, 155–61 (2009).

228

Chapter VI:

Conclusion and perspectives

Chapter VI: Conclusion and perspectives

230

Chapter VI: Conclusion and perspectives

Conclusion and perspectives

Current chemotherapies for cancer treatment present multiple drawbacks, such as lack of selectivity, limited effectiveness and severe side effects. Thus, there is a need of targeted and controlled delivery systems that can reduce the dose and the duration of the therapy. A strategy to achieve that is to actively deliver drug-loaded nanoparticles to tumour cells. Nanoparticles, such as lipid nanocapsules (LNC), improve the solubility and efficacy of the drugs and lower their toxicity. Attaching to their surface ligands that target cancer biomarkers increases the selectivity and the accumulation in the tumour tissues, and thus the efficacy of the drugs. Such cancer biomarker is the Epithelial Cell Adhesion Molecule (EpCAM) - a 40- kDa transmembrane protein, highly expressed in epithelial tumours, circulating tumour cells and cancer stem cells.

The most used affinity reagents in cancer therapy and in general are monoclonal antibodies and their fragments. Despite their success, they possess limitations, some of which having been addressed with the development of non-antibody affinity scaffolds. Their simple structure, small size and high stability gives them advantages over antibodies. Also, their easy engineering allows continuous improvements of their properties: stability, size, or library design with loops, for instance. One of these protein scaffolds is represented by Affitins, based on Sac7d and Sso7d, members of the archaeal “7 kDa DNA-binding” protein family. Affitins are stable

231

Chapter VI: Conclusion and perspectives

(temperature up to 90°C and pH from 0 to 12), have a simple, cysteine-free structure and are produced in bacteria. They show comparable affinity/specificity as those of antibodies, being twenty times smaller, and have been demonstrated as efficient reagents for multiple biotechnological applications.

Sac7d and Sso7d have been extensively studied for their structure, function and physicochemical properties. Furthermore, Sso7d has been used not only as a basis for the creation of artificial affinity molecules. Its intrinsic high stability and ability to bind any dsDNA sequence have been exploited for improving DNA processing enzymes applied in molecular biology, such as the Phusion DNA polymerase. However, the 7 kDa DNA-binding family contains many members, even putative ones, and if they have similar binding properties or robustness was remaining an open question. Other members could also possess attractive properties for molecular biology applications, but have never been characterized. Therefore, it was important to examine in more detail this archaeal family, which may provide new bases for the generation of Affitins with improved properties. Furthermore, we hypothesised that combining the advantages of Affitins as targeting agents and lipid nanocapsules as carriers may create effective vehicles for delivering payloads to cancer cells.

Thus, the thesis had three main objectives: first, to study the archaeal 7kD DNA-binding family and identify a potential candidate for the generation of novel Affitins; second to validate the chosen affinity scaffold by creating binders against EpCAM and to characterize them; and third to

232

Chapter VI: Conclusion and perspectives

attach the new binders as affinity moieties to LNCs and to assess the tumour targeting of these complexes in vitro.

Main contributions In Chapter III we report the production and characterization of Sac7d, Sso7d and eleven more members of the Sul7d family, eight of which putative proteins. All the proteins produced were shown to be monomeric and stable from pH 0 to 12 and up to temperatures from 85.5°C to 100°C. They were all able to bind dsDNA with a preference for sequences containing G/C bases. Thus, we validated eight proteins of the “7 kDa DNA-binding” family, for which there was no experimental evidence. All studied proteins showed that they behave similarly regarding both their function and their stability among various genera and species. However, some interesting differences between proteins, like aggregation after heating for two of them, could be observed and related to differences in the sequences. We not only confirmed one amino acid position, known to be a determinant for obtaining proteins with higher thermostability, but showed a second one with the same effect, not reported so far. These positions, and probably their neighbouring ones, may represent interesting targets for mutagenesis studies aiming to stabilize proteins from this family.

One of the proteins, Aho7c, showed thermal stability comparable with Sso7d (96.8 °C vs. 96.5°C) and higher than the one of Sac7d (89.6 °C). Moreover, Aho7c is the shortest member of the family (60 amino acids compared to 66 for Sac7d and 64 for Sso7d). Shortening an existing scaffold protein is a challenging task, and thus Aho7c drew our attention. In Chapter

233

Chapter VI: Conclusion and perspectives

IV, as a proof of concept we used Aho7c-based library for selection by ribosome display against the human recombinant EpCAM (hrEpCAM). We obtained binders, that were expressed in soluble form in E. coli, displayed high stability (up to 74°C; pH 0-12) and were shown to be specific for the hrEpCAM extracellular domain with picomolar affinities (KD = 110 pM). Thus, we propose Aho7c as a good candidate for the creation of Affitins with a 10% smaller size than the Sac7d-based ones (60 versus 66 amino acids). This work opens the road to study how this shortening of Affitins has an influence on its full chemical synthesis and on its in vivo properties. Further studies, not part of the presented work, are now ongoing to isolate binders from Aho7c against a larger set of targets, both in vitro and in vivo.

In Chapter V we screened for Aho7c-based Affitins recognizing EpCAM on colorectal cancer cells in order to use these new molecules as affinity moieties for functionalizing LNC that may deliver payloads to cancer tissues. However, none of the Affitins from Chapter IV was able to recognize the native conformation of EpCAM on tested cell lines. More extensive screening for binders on cells after ribosome display selection against hrEpCAM yielded only one sequence able to bind to the human colorectal cell line HT29. A possible explanation for this outcome is that epitopes, which are available on the isolated protein, are masked by various interactions, as EpCAM is participating in complexes with other molecules in the plasma membrane. We can further speculate that hrEpCAM used for selection differs from the native molecules, presented on cell surfaces, and thus that there are unshared epitopes. In order to extend the range of

234

Chapter VI: Conclusion and perspectives

recognized epitopes, we used an epitope masking-approach, in which selection was performed in the presence of binders from Chapter IV as competitors. Indeed, this led to an output of binders, recognizing an epitope different from the one dominating the initial selection. This may be useful for increasing the repertoire of binders in future selections against various targets.

This chapter continues with the use of a bifunctional polymer (DSPE-

PEG2000-maleimide) for functionalizing 50 nm LNC loaded with the fluorescent dye DiD. DSPE-PEG2000-maleimide allowed on one side insertion in the LNC shell via the lipid component DSPE (1,2-distearoyl-sn-glycero-3- phosphoethanolamine), whereas, on the other side, the maleimide group was used for covalent coupling with cysteine, introduced at the C-terminus of Affitins. We prepared LNC-DiD conjugated either with C3PO – an Affitin, binding to EpCAM on cells, or H4 – a control Affitin binding to lysozyme.

Surprisingly, binding and uptake of LNC-DiD-C3PO was enhanced not only for EpCAM-positive cell lines HT29 and Caco2, but also for EpCAM- negative CT26 and C2C12, as demonstrated both by FACS and confocal microscopy. Binding to these four cell lines was also detected with naked Affitins C3PO and C3PO-Cter by FACS. Thus, we discard the possibilities that there is a weak non-specific binding enhanced by the multipresentation of C3PO on the surface of LNC or that the conjugation process changed the conformation and specificity of C3PO. We assume that it is not a physicochemical effect due to the positive charge of the protein, as no unspecific binding was observed with other Affitin molecules (from Chapter IV or

235

Chapter VI: Conclusion and perspectives

control Affitin H4). A plausible explanation is that purchased rhEpCAM used for selection possesses conformational and/or glycosylation patterns sufficiently different from the native EpCAM to prevent isolation of Affitins with the desired specificity. Furthermore, co-purification of hrEpCAM and other contaminant proteins could lead to generation of Affitins with unexpected specificities.

Perspectives In the close future, we will pursue our inquiries from Chapter V in the following directions: first, we will conduct a more thorough characterization of the interaction between Affitin C3PO and EpCAM. A possible experiment to determine if binders were selected against EpCAM is to perform a sandwich ELISA. MOC31 will serve as a specific capture antibody of EpCAM and C3PO will be used for detection. In parallel, we will pay more attention on purchased targets. Additionally, it would be interesting to conduct competition experiments, in which positive and negative cell lines are mixed together to mimic more closely the situation in vivo. This should help to evaluate if some of our LNC-Affitin formulations deliver payloads preferentially to EpCAM-positive cell lines in a heterogeneous environment. Finally, tumour-targeting experiments in mouse models will give more relevant information about the behaviour of Affitin C3PO in vivo.

Despite the open question of the specificity of the created functionalized vehicles, this study brought insights on the selection of Affitins and screening for binders on cells. We also demonstrated that we can use them for functionalizing LNC, and that this functionalisation strongly

236

Chapter VI: Conclusion and perspectives

influences payload delivery, although further optimizations are needed. Comparison of the biodistribution and blood clearance of Affitins alone with the ones of functionalized LNC and even blank LNC should shed more light on the potential use of the formulations for therapy.

As mentioned in the introduction, EpCAM is present on circulating tumour cells (CTCs) – invasive cancer cells, which are responsible for the development of metastasis and whose detection is essential for diagnosis and thepary1. The first and only clinically validated, FDA-cleared blood test for enumerating CTC in whole blood is CELLSEARCH® CTC test2. It uses ferrofluid nanoparticles coated an EpCAM antibody to capture CTCs, which are subsequently visualized by staining with a cocktail of antibodies against the cytoplasmic epithelial cytokeratins3. However, a potential concern with this method is the impurity of leukocytes, leading to a high false-positive rate1. Different alternative CTC isolation techniques by using nanomaterials and micro-nanostructured surfaces functionalized with antibody against EpCAM have been reported4–6. The use of an EpCAM-binding peptide coupled to magnetic nanoparticles has been proposed as an alternative for anti-EpCAM antibodies because of the possible higher stability of peptides and their mass production by chemical synthesis7. With their small size and robustness, Affitins present another valuable option. Indeed, Affitins have been successfully immobilized on agarose matrix and magnetic nanoparticles and used for protein purification. Thus, they have demonstrated their potential as capture agents and as an alternative to traditional chromatographic systems. In the future, Affitin-functionalized

237

Chapter VI: Conclusion and perspectives

nanoparticles such as LNC may be used both for detection of target proteins (if a fluorophore is encapsulated) or for therapy (if a drug is encapsulated). Affitin conjugation to different types of nanoparticles will expand the range of possible biotechnological and biomedical applications.

An interesting area to investigate is the creation of nanoparticles functionalized in parallel with Affitins against different tumour-associated targets. Such complexes will be not only multi-valent, but as well multi- specific, which should promote the selective binding to cancer cells.

High stability is not only essential for long shelf life but also for tolerating modification and applying protocols that require harsh conditions. Affitins are plastic enough to tolerate different tags (hexahistidine tag or phosphorylable tag), fusion with other proteins (GFP, PhoA etc.), labelling with fluorophores and immobilization on different surfaces. Because of their robustness, small size and fast clearance Affitns are also attractive candidates for creation of nuclear medicine tools for molecular imaging and for targeted alpha-particle therapy with short-lived radioisotopes.

238

Chapter VI: Conclusion and perspectives

References

1. Wang, X. et al. Detection of circulating tumor cells in human peripheral blood using surface-enhanced raman scattering nanoparticles. Cancer Res. 71, 1526– 1532 (2011).

2. CELLSEARCH® CTC. What is the CELLSEARCH® Circulating Tumor Cell (CTC) Test? | CELLSEARCH®. (2017). Available at: https://www.cellsearchctc.com/about- cellsearch/what-is-cellsearch-ctc-test. (Accessed: 19th September 2017)

3. Riethdorf, S. et al. Detection of Circulating Tumor Cells in Peripheral Blood of Patients with Metastatic Breast Cancer: A Validation Study of the CellSearch System. Clin. Cancer Res. 13, 920–928 (2007).

4. Zhang, N. et al. Electrospun TiO 2 nanofiber-based cell capture assay for detecting circulating tumor cells from colorectal and gastric cancer patients. Adv. Mater. 24, 2756–2760 (2012).

5. He, R. et al. Biocompatible TiO2 nanoparticle-based cell immunoassay for circulating tumor cells capture and identification from cancer patients. Biomed. Microdevices 15, 617–626 (2013).

6. Yu, M., Stott, S., Toner, M., Maheswaran, S. & Haber, D. A. Circulating tumor cells: Approaches to isolation and characterization. J. Cell Biol. 192, 373–382 (2011).

7. Bai, L. et al. Peptide-based isolation of circulating tumor cells by magnetic nanoparticles. J. Mater. Chem. B 2, 4080–4088 (2014).

239

Chapter VI: Conclusion and perspectives

240

List of scientific communications

Accepted publications 1. Kalichuk V., Béhar G., Renodon-Cornière A., Danovski G., Obal G., Barbet J., Mouratou B., Pecorari F. (2016) The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family. Sci. Rep. 6, 37274 2. Teze D., Dumitru-Claudiu S., Kalichuk V., Barbet J., Deniaud D., Galland N., Maurice R., Montavon G. (2017) Targeted radionuclide therapy with astatine-211: Oxidative dehalogenation of astatobenzoate conjugates. Sci. Rep. 7, 2579

Submitted publications 1. Kalichuk V., Renodon-Cornière A., Béhar G., Carrión F., Obal G., Maillasson M., Mouratou B.1, Préat V., Pecorari F. A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM. Revised for Biotechnol. Bioeng.

Publications in preparation 1. Kalichuk V., Béhar G., Mouratou B., Pecorari F. Applications of archaeal DNA-binding proteins and their designed derivatives. Review. 2. Kalichuk V., Béhar G., Renodon-Cornière A., Danhier F., Vanvarenberg K., Pecorari F., Préat V. Affitin-functionalized lipid nanocapsules for targeting colorectal cancer cells.

Oral communications 1. Kalichuk V., Béhar G., Mouratou B., Preat V., Pecorari F. Use of Affitins for the development of functionalized nanoparticles to deliver payloads to targeted colorectal tumor cells. 2nd NanoFar Autumn School, Santiago de Compostela, Spain, 25.10.2013.

241

2. Kalichuk V., Danhier F., Renodon-Cornière A., Behar G., Mouratou B., Préat V., Pecorari F. A novel generation of Affitins as targeting reagents for delivering lipid nanocapsules to colorectal tumours. New chemical and biological tools for targeting in cancer imaging and therapy, Le Bono, France, 22.9.2016. 3. Kalichuk V., Danhier F., Renodon-Cornière A., Behar G., Danovski G., Mouratou B., Pecorari F., Preat V. A novel generation of Affitins as targeting moieties for delivering lipid nanocapsules to colorectal tumours. LDRI PhD students’ day, Brusses, Belgium, 23.5.2017. 4. Kalichuk V., Renodon-Corniere A., Behar G., Danovski G., Carrion F., Obal G., Maillasson M., Danhier F., Mouratou B., Preat V., Pecorari F. A shorter scaffold for improved Affitins : Showcase with specific binders for the cancer biomarker EpCAM. Affinity2017, Paris, France, 28.6.2017.

Posters 1. Kalichuk V., Béhar G., Mouratou B., Preat V., Pecorari F. Affitin- functionalized nanoparticles for active targeting. 3rd NanoFar Autumn School, Brussels, Belgium, 21-22.10.2014. 2. Kalichuk V., Béhar G., Mouratou B., Preat V., Pecorari F. Affitin- functionalized nanoparticles for targeted delivery to colorectal tumors. Journees Scientific de l'ecole Doctorale Biologie-Sante, 09-10.12.2014. 3. Kalichuk V., Béhar G., Mouratou B., Preat V., Pecorari F, Selection and characterization of Affitins for delivering nanoparticles to colorectal cancer, 4th NanoFar Autumn School, Nantes, France, 28.10.2015. 4. Kalichuk V., Danhier F., Bianco J., Renodon-Cornière A., Behar G., Mouratou B., Pecorari F., Préat V., Affitins as targeting reagents for delivering lipid nanocapsules to colorectal tumours, EDT-Cancérologie Expérimental: mini-symposium annuel , Brussels, Belgium, 09.09.2016.

242

Europass Curriculum Vitae

Personal information First name(s) / Surname(s) Valentina Valentinova Kalichuk Address(es) 22 rue Alfred Giron, Ixelles, Belgium Telephone(s) Mobile: +33781852568 E-mail valentina.kalichu [email protected] Nationality Bulgarian Date of birth 20/05/1988 Gender Female

Education and training

Dates October 2013 – September 2017 Title of qualification NanoFar, Erasmus Mundus Joint Doctorate in nanomedicine and pharmaceutical innovation Principal subjects/occupational skills • Development of artificial affinity proteins (Affitins) covered • Gene and protein engineering (construction of large DNA libraries, selection by ribosome display) • Bacterial and cell culture • HPLC, ELISA, FACS, Confocal microscopy etc. • Molecular biology • Lipid nanocapsules formulation and characterization

Name and type of organisation Health Research Inst itute of the University of Nantes, Group : providing education and training Nuclear Oncology Research (Université de Nantes, France) and Louvain Drug Research Institute, Group : Advanced Drug Delivery and Biomaterials (Université catholique de Louvain, Belgium)

Level in national or international classification PhD

Page 1/4 Curriculum vitae of Kalichuk Valentina

Dates November 2015 – December 2015 Title of qualification Internship Principal subjects/occupational skills • Genetic manipulations covered • Production and purification of DARPins • Yeast expression systems Name and type of organisation providing education and training Plückthun's laboratory, Department of Biochemistry, University of Zürich, Switzerland

Dates October 2011 - July 2013 Title of qualification awarded Molecular biologist – Master in Biochemistry Principal subjects/occupational skills • Molecular cloning covered • Basic bioinformatics • Managing skills in educational and research projects Name and type of organisation Sofia University "St. Kliment Ohridski”, Bulgaria providing education and training Level in national or international Master classification Rank: 1 from 9 Grade: 6.00 from 6.00

Dates September 2012 – March 2013 Title of qualification Erasmus Intership Principal subjects/occupational skills • Chemical synthesis covered • Development of detection methods • Biochemical tests • Creation, production and use of mutant enzymes • Engineering of glycoside donors and acceptors for the regioselective synthesis of oligosaccharides and glycoconjugates Name and type of organisation UFIP, Universi ty of Nantes, France providing education and training

Dates October 2007 - July 2011 Title of qualification awarded Bachelor in Molecular biology Principal subjects/occupational skills • Different types of molecular biology techniques (such as covered isolation and purification of DNA, RNA and proteins, various types of electrophoresis of proteins and nucleic acids)

Name and type of organisation Sofia University "St. Kliment Ohridsk i”, Bulgaria providing education and training

Level in national or international Bachelor classification Rank: 2 from 65 Grade: 5.96 from 6.00

Page 2/4 Curriculum vitae of Kalichuk Valentina

Dates 2008 – 2012 Title of qualification Internship student • Working skills with handling bacteria • Isolation and characterisation of bacteriocins • Gene engineering

• PCR

Name and type of organisation Laboratory of Molecular Genetics and Gene Cloning, Sofia University providing education and training "St. Kliment Ohridski”, Bulgaria

Dates 2003-2007 Name and type of organisation German high sch ool – Goethe -Gymnasium, Burgas, Bulgaria providing education and training

Personal skills and competences

Mother tongue(s) Bulgarian Other language(s) Self -assessment Understanding Speaking Writing European level (*) Listening Reading Spoken Spo ken interaction production English C2 C2 C2 C2 C2 Russian C2 C2 C2 C2 B2 German B1 B1 B1 B1 B1 French B1 B1 B1 B1 B1 (*) Common European Framew ork of Reference for Languages

• Social skills and competences • Experience in working in different scientific teams • Good ability to adapt to multicultural environments, gained through experience abroad • Good communication skills and team spirit

Technical skills and competences Working skills with specialized scientific equipment

Computer skills and competences Microsoft Office™ tools (Word™, Excel™ and PowerPoint™), FlowJo ®

Other skills and competences • Qualification in Animal experimentation (Level 1 diploma from Nantes Atlantic National College of Veterinary Medicine, Food Science and Engineering) • Supervision of internship students (4 Master’s and 3 Bachelo’s students) • Competence in Russian – Golden medal in the X International Olympiad of Russian language, 2001, Mosow, Russia.

Page 3/4 Curriculum vitae of Kalichuk Valentina

Additional information Contact persons:

1. Prof. Veronique Préat, Louvain Drug Research Institude, Université Catholique de Louvain, tel. +32 2 764 73 09 / +32 2 764 73 20, e- mail: [email protected]

2. Dr Frédéric Pecorari, Institut de Recherche en Santé de l'Université de Nantes, INSERM U1232 - CNRS 6299 – CRCINA, tel. +33 2 40 41 28 51 , e-mail: [email protected] 3. Dr Svetoslav Dimov, Sofia University "St. Kliment Ohridski", Faculty of Biology, Dept. of Genetics, tel. +359 895 80 24 62, e-mail: [email protected] Annexes Scientific papers (excluding conference participations): 1. Kalichuk, V., Béhar, G., Renodon-Cornière, A., Danovski, G., Obal, G., Barbet, J., Mouratou, B., Pecorari, F. (2016) The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family. Sci. Rep. 6, 37274 2. Kalichuk V., Renodon-Cornière A., Béhar G., Carrión F., Obal G., Maillasson M., Mouratou B.1, Préat V., Pecorari F. A novel, smaller scaffold for Affitins: Showcase with binders specific for EpCAM. Provisionally accepted in Biotechnol. Bioeng. 3. Teze, D., Dumitru-Claudiu S., Kalichuk, V., Barbet, J., Deniaud, D., Galland, N., Maurice, R., Montavon, G. (2017) Targeted radionuclide therapy with astatine-211: Oxidative dehalogenation of astatobenzoate conjugates. Sci. Rep . 7, 2579 4. Chikov, G., Kalichuk, V ., Kirilov, N. and Dimov, S.G. (2010) Characteristic of two bacteriocin-producing Enterococcus strains. Biotechnol. Biotechnol. Eq . 24(2), Special Edition/on-line:594-597 5. Raykova, D., Kalichuk, V ., Chikov, G. and Dimov, S.G. (2009) Detection and preliminary characterization of a BLIS produced by Enterococcus strain isolated from cheese starter. Biotechnol. Biotechnol. Eq. 23(2), Special Edition/on-line:529-532 Oral communications: 1. Kalichuk V, Béhar G, Mouratou B, Preat V, Pecorari F. Use of Affitins for the development of functionalized nanoparticles to deliver payloads to targeted colorectal tumor cells. 2nd NanoFar Autumn School , Santiago de Compostela, Spain, 25.10.2013. 2. Kalichuk V, Danhier F, Renodon-Cornière A, Behar G, Mouratou B, Préat V, Pecorari F. A novel generation of Affitins as targeting reagents for delivering lipid nanocapsules to colorectal tumours. New chemical and biological tools for targeting in cancer imaging and therapy , Le Bono, France, 22.9.2016. 3. Kalichuk V, Danhier F, Renodon-Cornière A, Behar G, Danovski G, Mouratou B, Pecorari F, Preat V. A novel generation of Affitins as targeting moieties for delivering lipid nanocapsules to colorectal tumours. LDRI PhD students’ day , Brusses, Belgium, 23.5.2017. 4. Kalichuk V, Renodon-Corniere A, Behar G, Danovski G, Carrion F, Obal G, Maillasson M, Danhier F, Mouratou B, Preat V, Pecorari F. A shorter scaffold for improved Affitins : Showcase with specific binders for the cancer biomarker EpCAM. Affinity2017 , Paris, France, 28.6.2017.

Page 4/4 Curriculum vitae of Kalichuk Valentina

Valentina KALICHUK A novel generation of Affitins for targeting cancer cells with drug- loaded lipid nanocapsules Nouvelle génération d'Affitins pour le ciblage de cellules cancéreuses avec des nanocapsules lipidiques

Résumé Ab stract

Une approche prometteuse contre le cancer est le A progressive strategy against cancer is the targeting of ciblage d’antigènes associés aux tumeurs par des tumour-associated antigens by specific ligands coupled ligands spécifiques couplés à des nanoparticules to nanoparticles, carrying therapeutic or imaging agents. transportant des agents thérapeutiques ou d’imagerie. Antibodies are the most widely used targeting Les anticorps sont les molécules de ciblage les plus molecules, but they possess lim itations as high utilisées, mais présentent des limitations en termes de production costs, complex structure and limited stability. coûts de production élevés, de complexité structurale et Affitins are highly stable engineered affinity proteins, de stabilité limitée. Les Affitins sont des protéines derived originally from Sac7d, an archaeal polypeptide d'affinité hautement stables, dérivées à l'origine de from the 7 kDa DNA-binding famil y (also known as Sac7d, un polypeptide d’archée de la famille de liaison à Sul7d family). Thes e binders show comparable affinity l'ADN de 7 kDa (Sul7d). Les A ffitins montrent une and specificity to those of antibodies, while being affinité et une spécificité comparables à celles des thermally and chemically more stable , cheaper to anticorps, tout en étant thermiquement et chimiquement produce, easier to engineer and present a simpler plus stable, moins coûteuses à produire, plus faciles à structure and 20-fold smaller size. Lipid nanocapsules remodeler avec une taille 20 fois plus petite. Les (LNCs), prepared by solvent free process, p ossess nanocapsules lipidiques (LNC) possèdent une grande great stability and high efficiency for lipophilic drugs stabilité et une efficacité élevée pour l'encapsulation des encapsulation and protect the drug from rapid médicaments lipophiles et les protègent de la degradation. Targeting drug-LNC to cancer cells can dégradation rapide. Le ciblage de cellules cancéreuses further decrease drug concentration in normal tissues par des LNC peut réduire de plus la concentration de and lower th e toxicity. The aim of the project is to médicament dans les tissus normaux et réduire la combine the advantages of Affitins as targeting agents toxicité. Le but du projet est de combiner les avantag es and LNCs as carriers in order to create vehicles for des Affitins et des LNC pour amene r les médicaments delivering payloads to cancer cells. The first goal of this anticancéreux vers les cellules cancéreuses. Le premier work was to identify and characterize a shorter member, objectif a été d'identifier et de caractériser un mem bre but still very stable, of the Sul7d family in order to further plus court, mais toujours très stable, de la famille Sul7d improve the affinity scaffold, and then to use it for the pour encore améliorer la base moléculaire des Affitins, generation of Affitins, recognizing the tumour-associated puis de générer des Affitins qui reconnaissant le Epithelial Cell Adhesion Molecule. The last goal wa s to biomarqueur EpCAM associé aux cellules tumorales. Le attach the n ew binders as affinity moieties to LNCs and deuxième objectif a été d'attacher les nouvelles Affitins to assess the tumour targeting of these complexes. comme ligands d'affinité aux LNC et d'évaluer le ciblage de la tumeur par ces complexes. Key words: Family Sul7d, protein engineering, Affitins, antibody alternatives, lipid nanocapsules, Mots clés : Famille Sul7d, ingénierie des protéines, targeting, EpCAM, cancer Affitins, alternatives d’anticorps, nanocapsules lipidiques, ciblage, EpCAM, cancer