PREDICTION AND PROGNOSIS IN ANAL CANCER:
DEVELOPING MODELS TO IMPROVE PATIENT
OUTCOME
MARIA-PIA BERNARDI
BSc, MBBS, FRACS
Submitted in fulfillment of the requirements of the degree of Doctor of Medical Science
October 2017
Division of Cancer Surgery
Differentiation and Transcription Laboratory
Surgical Oncology Research Laboratory
Peter MacCallum Cancer Centre, Melbourne, Victoria, Australia
The University of Melbourne, Victoria, Australia
Department of Surgery, St Vincent’s Hospital, Melbourne, Victoria, Australia
ORCID iD: 0000-0002-9833-2892
Thesis Abstract
Anal squamous cell carcinoma is a human papilloma virus–related disease for which definitive treatment comprises chemoradiotherapy that has not changed substantially for forty years. Few advances in treatment have been made since then, especially for those patients who develop disease relapse and for whom no surgical options exist. Predicting responses in patients for whom conventional treatment will fail remains elusive and is a significant clinical problem. As anal cancer is reasonably described as a rare cancer, innovative approaches are required to address this pressing clinical issue as large clinical trials are exceptionally challenging and are unlikely to be undertaken. This thesis describes a range of research strategies to identify potential avenues to predict and improve patient responses to existing and novel therapies. It comprises a combination of clinical and translational research.
Using our institutional database I have assessed the utility of post- treatment imaging with FDG-PET as it may serve as a means of early detection of poor response to treatment. I found that a complete metabolic response on post-treatment PET scan was predictive of overall survival and disease-free survival. The database, which spans a thirty year period, was also interrogated to explore patterns of treatment failure, subsequent salvage treatment and outcomes. I found that multiple treatment modalities have been utilised to treat
i patients with persistent or recurrent disease, with satisfactory survival benefit in carefully selected patients.
I also evaluated the literature that investigated the molecular biology of anal cancer finding that no clinically valuable biomarkers have emerged. Some suggestions have been reported that regulators of apoptosis, including survivin, and agents targeting the PI3K/AKT pathway, might offer opportunities for targeted therapy. Additionally, antibody therapy targeting epidermal growth factor receptor may prove efficacious although the safety profile in combination with standard chemoradiotherapy has proven to be suboptimal.
In the laboratory, next generation RNA sequencing was utilised in eleven anal SCC patient samples. Through stratification of the tumours into clinically relevant groups and Bioinformatic analysis, eight genes with differential expression were chosen for further validation. One of these genes was identified as a novel target which could ultimately lead to expanding therapeutic options in anal cancer management.
Due to a lack of pre-clinical models, including cell lines and mouse models for testing new therapies, I developed a new anal cancer model based upon patient-derived tumour xenografts. I used this model in a pilot experiment to assess the novel drug target identified by RNA-seq. The outcomes were promising with stand-alone efficacy of the novel drug observed with statistical significance, while also validating the feasibility of using xenografts for anal SCC.
ii This thesis builds upon the clinical experience of decades of management of patients with anal cancer identifying both clinical and laboratory approaches to advance assessment and identify novel treatment possibilities for this group of patients.
iii Declaration
This is to certify that:
i. The thesis comprises only my original work towards the DMedSc.
ii. Due acknowledgement has been made in the text to all other materials
used. iii. The thesis is fewer than 80 000 words in length, exclusive of tables,
references and appendices.
______
Maria-Pia Bernardi
14th October 2017
iv Preface
(i) I have conducted the majority of the work in this thesis and
collaborated with others in performing experiments.
Acknowledgement is given to Dr Glen Guerra in independently
carrying out the repeated pilot experiment and demonstrating re-
establishment of the cryopreserved tumour tissue from a patient-
derived tumour xenograft in my absence. I estimate my overall
contribution to the thesis to be 90%.
(ii) No part of this thesis has been submitted for the award of any other
qualification or degree.
(iii) A scholarship was received from Covidien which contributed to
funding.
v Acknowledgements
As I embarked upon this journey into the world of scientific research, not really knowing what to expect, I was surrounded by a network of people without whom I would not have arrived at this final coveted end point.
I would like to thank Sandy Heriot, my principal supervisor, who encouraged me over (several!) years to undertake research. I finally conceded and didn’t look back. I am forever indebted to him for his unremitting belief in my capabilities and support in pursuing and ultimately fulfilling my dream of becoming a Colorectal surgeon.
To Rob Ramsay, who welcomed me into his laboratory and immediately made me feel like a valued member of the research team and not like a surgeon impostor, I offer my heartfelt gratitude. His support and guidance, both professionally and personally, was always offered with kindness and understanding. His enthusiastic supervision of my project was contagious and I thank him for allowing me into the exciting research world.
I would also like extend my profound thanks to Wayne Phillips who always made the time to listen, advise and reassure, (even when it needed to be via Skype at terrible hours!). I thank him for imparting his expertise and knowledge, and his help in ‘keeping it real’ and making me see it was in my grasp when I felt out of my depth.
There were several people in the Ramsay laboratory who made my time special, not only for sharing their expertise and willingly giving me their precious time, but who became my friends. In particular, I would like to thank
Shienny Sampurno who never rejected my pleas for help, and Sandra
Carpinteri, who taught me so many skills, and made me laugh when I wanted to cry. To Jennifer Ryan, my fellow surgeon scientist, I thank for all of her support through the ups and downs, and for understanding. I also
vi acknowledge the help and willing guidance of Markus Germann, Jordane
Malaterre, Ryan Cross, Huiling Xu, Megan O’Brien, and Lloyd Pereira.
From the Phillips laboratory, I need to thank Matthew Read who shared his successful PDTX technique with me, hence contributing invaluably to the success of my project. We shared the load of caring for our mice while debriefing and having a lot of laughs. I am also indebted to David Liu who completed my pilot experiment in my absence. Thank you to Nicholas Clemons and Christina Fennell for their help and support.
I acknowledge the advice and expertise received from Dr Carleen
Cullinane from the Translational Research Laboratory regarding the planning of experiments and drug use in PDTXs. I would like to thank Susan Jackson,
Rachel Walker and Kerry Ardley for offering their skills in administering drugs to the mice.
I would also like to thank Owen Prall and Bill Murray for giving their expertise in histopathology assessment, as well as Jason Ellul for his advice with Bioinformatic analysis. Thanks also goes to my friends and colleagues
Stella Sarlos and Eileen Moore who helped me in conquering computers.
I also thank my family, including my sister Francesca and my parents,
Tina and Vince, for always believing me in me and showing me by example that anything is possible through hard work.
Last but not least I thank my husband Martin DeMarte who sacrificed so much to allow me to complete this work. I simply could not have succeeded without his unfaltering support, both through the research process and then throughout my clinical training, which took us overseas and interstate. All the while, he arranged all of the moving as well as stepping up as the primary carer of our two beautiful children, Sebastian and Giulia. For all of the time away from them that I have sacrificed, I hope they grow up with the understanding that all of this was done with them in my heart, and with an appreciation of what it takes for dreams to be realised.
vii Publications
Molecular Biology of Anal Squamous Cell Carcinoma:
Implications for Future Research and Clinical Intervention
Bernardi MP, Ngan SY, Michael M, Lynch AC, Heriot AG, Ramsay RG, Phillips
WA. The Lancet Oncology, Volume 16, Issue 16, e611 - e621, Dec 2015.
For submission:
Patterns of Treatment Failure for Anal Squamous Cell Cancer: Thirty years
Experience in a Single Institution
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Assessment of Response After Definitive Chemoradiotherapy for Anal
Squamous Cell Cancer by FDG-PET
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Current Management of Anal Squamous Cell Carcinoma
Bernardi MP, Guerra GR, Ramsay R, Phillips W, Ngan S, Lynch AC, Warrier S,
Heriot AG
viii Presentations
Identification and Exploration of Novel Therapeutic Targets for Anal Cancer
Bernardi MP, Ramsay R, Phillips W, Ngan S, Lynch AC, Warrier S, Heriot AG
Tripartite Colorectal Meeting
Birmingham, United Kingdom, July 2014
Patterns of Treatment Failure for Anal Squamous Cell Cancer: Thirty years
Experience in a Single Institution
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Tripartite Colorectal Meeting
Birmingham, United Kingdom, July 2014
Identification and Exploration of Novel Therapeutic Targets for Anal Cancer
Bernardi MP, Ramsay R, Phillips W, Ngan S, Lynch AC, Warrier S, Heriot AG
Annual Scientific Congress
Singapore, May 2014
Assessment of Response After Definitive Chemoradiotherapy for Anal
Squamous Cell Cancer by FDG-PET
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Annual Scientific Congress
Singapore, May 2014
ix Posters
Assessment of Response After Definitive Chemoradiotherapy for Anal
Squamous Cell Cancer by FDG-PET
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Tripartite Colorectal Meeting
Birmingham, United Kingdom, July 2014
Patterns of Treatment Failure for Anal Squamous Cell Cancer: Thirty years
Experience in a Single Institution
Bernardi MP, Link E, Tomaszewski JM, Michael M, Ngan S, Lynch AC, Warrier
S, Phillips W, Ramsay R, Heriot AG
Annual Scientific Congress Singapore, May 2014
x Table of Contents
Thesis Abstract ...... i Declaration…...... iv Preface……...... v Acknowledgements ...... vi Publications……… ...... viii Presentations…...... ix Posters………...... x Table of Contents ...... xi List of Tables……...... xv List of Figures ...... xvi List of Abbreviations ...... xviii CHAPTER 1: Introduction ...... 1 1.1 General Introduction ...... 1
1.2 Anal Squamous Cell Carcinoma ...... 4
1.3 Molecular Biology of Anal Squamous Cell Carcinoma ...... 35
1.4 Aims and Hypotheses ...... 63
CHAPTER 2: Materials and Methods ...... 65 2.1 List of reagents ...... 65 2.1.1 General solutions ...... 65 2.1.2 Oligonucleotides ...... 66 2.1.3 Antibodies ...... 67 2.1.4 Cell Culture Reagents ...... 67
2.2 Methods ...... 69 2.2.1 Anal Cancer Database ...... 69 2.2.2 Anal Cancer Tissue Bank ...... 69 2.2.3 RNA extraction and sequencing ...... 70 2.2.3.1 RNA extraction of tissue ...... 70 2.2.3.2 RNA sequencing ...... 70 2.2.4 Bioinformatic analysis ...... 70 2.2.4.1 Comparisons of Gene Expression ...... 71 2.2.5 RNA manipulation techniques ...... 71
xi 2.2.5.1 DNase Treatment ...... 71 2.2.5.2 Reverse Transcription and cDNA synthesis ...... 72 2.2.5.3 Quantitative Real-Time PCR ...... 72 2.2.6 Methods for protein analysis ...... 73 2.2.6.1 Immunohistochemistry ...... 73 2.2.6.1.1 Specimen fixation, embedding and sectioning ...... 73 2.2.6.1.2 Slide processing pre-antibody binding ...... 74 2.2.6.1.3 Primary antibody binding and detection ...... 74 2.2.6.1.4 Detection and visualization of primary antibody using DAB ...... 75 2.2.6.1.5 Immunohistochemistry for BCL-2 ...... 75 2.2.6.1.6 Quantitative Scoring of Immunohistochemistry Slides ...... 75 2.2.6.2 Haemotoxylin and eosin staining ...... 76 2.2.7 Animal husbandry and in vivo analysis ...... 77 2.2.7.1 Mouse maintenance ...... 77 2.2.7.2 Patient-derived tumour xenograft implantation ...... 77 2.2.7.2.1 Tissue Preparation ...... 77 2.2.7.2.2 Preparation of mice ...... 78 2.2.7.2.3 Implantation of tumour tissue ...... 79 2.2.7.2.4 Monitoring and Recovery ...... 80 2.2.7.3 Tissue Processing and Cryopreservation...... 81 2.2.7.4 Methods of Drug Administration ...... 82 2.2.7.4.1 Anaesthetic ...... 82 2.2.7.4.2 5-fluorouracil administration ...... 82 2.2.7.4.3 Mitomycin C administration ...... 82 2.2.7.4.4 PIM kinase inhibitor administration ...... 82 2.2.8 Cell Culture ...... 83 2.2.9 Statistical analyses ...... 84
CHAPTER 3: Assessing Response to Treatment & Patterns of Failure in Anal Squamous Cell Carcinoma ...... 85 3.1 Assessment of Response After Definitive Chemoradiotherapy for Anal SCC by FDG-PET ...... 85 3.2 Patterns of Treatment Failure for Anal Squamous Cell Cancer: Thirty Years Experience in a Single Institution ...... 98
CHAPTER 4: Identification and Selection of Potential Genetic Targets ...... 115 4.1 Introduction ...... 115
4.2 Results ...... 119 4.2.1 Anal Cancer Tissue Bank: Confirmation of Clinical Data ...... 119
xii 4.2.2 Bioinformatic Analysis and Gene Expression ...... 122 4.2.3 Genes of Interest ...... 125 4.2.4 Validation of RNA Sequencing data ...... 127 4.2.4.1 Gene expression ...... 127 4.2.4.2 Protein Expression ...... 129 4.2.4.2.1 PIM1 ...... 130 4.2.4.2.2 GRHL1 ...... 132 4.2.4.2.3 MYB ...... 133 4.2.4.2.4 BCL-2 ...... 134 4.2.5 Validation in Test Set ...... 135
4.3 Discussion ...... 138 4.3.1 Rationale for patient sample stratification ...... 138 4.3.2 Selection of genes of interest ...... 138 4.3.2.1 PIM1 ...... 139 4.3.2.2 IVL ...... 140 4.3.2.3 HES2 and NOTCH2 ...... 140 4.3.2.4 GRHL1 ...... 141 4.3.2.5 MYB, BCL-2 and TOM1 ...... 141 4.3.3 qRT-PCR Validation ...... 142 4.3.4 Lack of differential expression using immunohistochemistry ...... 143 4.3.5 PIM1 – An Actionable Target ...... 144
CHAPTER 5: Pre-clinical Models for Anal SCC: Patient-derived Tumour Xenografts & Cell lines ...... 147 5.1 Introduction ...... 147
5.2 Results ...... 149 5.2.1 Successful implantation ...... 149 5.2.2 Serial Transplantation ...... 149 5.2.3 Validation of PDTX tumour using Immunohistochemistry ...... 152 5.2.4 Re-establishment of PDTXs following cryopreservation ...... 154 5.2.5 Attempts at establishment of Anal SCC cell line ...... 154
5.3 Discussion ...... 156
CHAPTER 6: Pre-clinical Study using Patient-derived Anal Cancer Xenografts ..... 159 6.1 Introduction ...... 159
6.2 Results ...... 160 6.2.1 Dose-tolerability studies ...... 160 6.2.2 Pilot experiment ...... 162
xiii 6.2.3 Repetition of experiment ...... 165
6.3 Discussion ...... 165
CHAPTER 7: General Discussion ...... 169 7.1 Summary and significance of work undertaken in this study...... 169
7.2 Future directions ...... 173
References ...... 177 Appendices ...... 194
xiv List of Tables
Table 1.1 Seventh Edition of the AJCC/UICC TNM Staging for Anal Canal Cancer ...... 11
Table 1.2 Summary of Updated Trials ...... 19
Table 1.3 Summary of randomised controlled trials of different chemoradiotherapy
regimens in anal cancer ...... 22
Table 1.4: Current Clinical Trials ...... 24
Table 1.5 Biomarkers studied in Anal Cancer ...... 45
Table 1.6 Immunotherapy-based trials for treatment of anal SCC and cervical cancer...... 58
Table 2.1 List of reagents ...... 65
Table 2.2 Oligonucleotides ...... 66
Table 2.3 Immunohistochemistry Antibodies ...... 67
Table 2.4 Digestion Media ...... 67
Table 2.5 Culture Media ...... 68
Table 2.6A Scoring for Extent of staining ...... 76
Table 2.6B Scoring for Intensity of staining ...... 76
Table 3.1 Patient and tumour characteristics ...... 88
Table 3.2 Distribution of FDG-PET scans amongst patients ...... 89
Table 3.3 Degree of metabolic response after CRT as assessed by FDG-PET ...... 89
Table 3.4 Numbers of patients with disease relapse ...... 102
Table 3.5 Treatment intent for patients with disease relapse ...... 103
Table 3.6 Subsequent salvage treatment modalities ...... 103
Table 3.7 Inguinal node relapses and salvage treatments ...... 105
Table 3.8 Other forms of salvage treatment for disease relapse...... 106
Table 3.9 Clinical and treatment details of patients with multiple disease relapses ...... 107
Table 4.1 De-identified Data of Anal Cancer Tissue Bank Patients ...... 120
Table 4.2 Stratification of patients according to tumour stage ...... 122
Table 4.3 Stratification of patients according to nodal status ...... 122
Table 4.4 PIM1 IHC scoring in test set of patients ...... 136
Table 5.1 Outcomes of Anal Cancer Patient-derived Tumour Xenografts ...... 151
Table 6.1 Plan of treatment groups for pilot experiment utilizing anal SCC PDTXs ...... 160
xv List of Figures
Figure 1.1 Anatomy of the anal canal ...... 7
Figure 1.2 Large fungating anal SCC (pre-treatment) ...... 9
Figure 1.3 PI3K/AKT pathway ...... 47
Figure 1.4 Pathways of inhibition of apoptosis via HPV-E6 ...... 50
Figure 2.1 Tissue pieces prior to implantation ...... 78
Figure 2.2 Site of incision ...... 79
Figure 2.3 Demonstration of the intramuscular pocket with a suture tenting the
muscle up ...... 80
Figure 2.4 Flowchart demonstrating processing of successfully engrafted xenografts ...... 81
Figure 3.1 Kaplan-Meier curves of overall survival according to FDG-PET response ...... 91
Figure 3.2 Kaplan-Meier curves of disease-free survival according to FDG-PET response ... 92
Figure 3.3 PET scan of very large locally invasive SCC ...... 94
Figure 4.1 Approach to use of Anal Cancer Tissue Bank samples ...... 117
Figure 4.2 Approach to Data Validation ...... 118
Figure 4.3 Sample of Bioinformatic EdgeR analysis results for T-stage...... 124
Figure 4.4 EdgeR Analysis Plots showing significant differential expression of genes
stratified for early and late T-stage ...... 126
Figure 4.5 EdgeR Analysis Plots showing significant differential expression of genes for
nodal status ...... 127
Figure 4.6 Expression of genes of interest for T-stage as analysed by qRT-PCR ...... 128
Figure 4.7 Expression of genes of interest for N-stage as analysed by qRT-PCR ...... 129
Figure 4.8 IHC for PIM1 of 11 anal SCC patient samples stratified by T-stage ...... 131
Figure 4.9 IHC for GRHL1 of 11 anal SCC patient samples stratified by T-stage ...... 132
Figure 4.10 IHC for MYB of 11 anal SCC patient samples stratified by N-stage ...... 133
Figure 4.11 IHC for BCL-2 of 11 anal SCC patient samples stratified by N-stage ...... 134
Figure 4.12 Examples of various extents and intensities of PIM1 IHC staining ...... 137
Figure 4.13 Interaction between three of the selected genes of interest and their potential
targeted therapies ...... 142
Figure 4.14 Pim kinase targets ...... 145
Figure 5.1 Successfully engrafted PDTXs from two patient lines ...... 150
Figure 5.2 Validation of PDTX tumour ...... 153
xvi Figure 6.1 Dose-tolerability study for combined 5FU/MMC in nude mice demonstrating
initial weight loss followed by good recovery ...... 161
Figure 6.2 Pilot experiments using anal SCC PDTXs...... 164
Figure 7.1 Overlapping mechanisms by which PIM and Akt kinases control cell growth .. 175
xvii List of Abbreviations
APR Abdominoperineal resection
β2M Beta-2 Microglobulin cDNA Complementary Deoxyribonucleic acid
CRT Chemoradiotherapy
CT Computed Tomography
CTV Clinical Target Volume dH2O Distilled water
DFS Disease-free survival
DMEM Dulbecco’s modified eagle’s medium
DMSO Dimethylsulphoxide
DNA Deoxyribonucleic acid
EAUS Endoanal Ultrasound
EUA Examination Under Anaesthesia
FCS Fetal calf serum
GAPDH Glyceraldehyde phosphate dehydrogenase
H&E Haematoxylin & Eosin
HIV Human Immunodeficiency Virus
HPV Human Papillomavirus
IHC Immunohistochemistry
IM Intramuscular
xviii IMRT Intensity-Modulated Radiotherapy
MDT Multidisciplinary Team
MMC Mitomycin C
MRI Magnetic Resonance Imaging
MTV Metabolic Tumour Volume
NOD scid Non-Obese Diabetic-Severely Compromised Immune Deficient
NSG NOD-scid interleukin-2 receptor gamma chain knockout
OS Overall Survival
PBS Phosphate-buffered saline
PDTX Patient-derived Tumour Xenograft
PET Positron Emission Tomography qRT-PCR Quantitative Real-Time Polymerase Chain Reaction
RNA Ribonucleic acid
RPMI Roswell Park Memorial Institute medium
RT Radiotherapy
SCC Squamous Cell Carcinoma
SLN Sentinel Lymph Node
TBS Tris-buffered saline
5-FU 5-Fluorouracil
xix
xx Chapter 1: Introduction
1.1 General Introduction
Anal squamous cell carcinoma (SCC) is a human papillomavirus–related disease for which definitive treatment comprises chemoradiotherapy (CRT), as established some forty years ago. Since that time, no substantial advances in treatment have been made, especially for those patients who develop disease relapse and for whom no surgical options exist. These patients for whom conventional treatment will fail are not consistently predictable. Patterns of failure may be locoregional and/or to distant organs. However, due to the relative rarity of this malignancy, obtaining data describing failure rates and outcomes from large cohorts of patients is challenging and limited.
Similarly and arguably of more clinical importance, is early identification of those who experience relapse of their disease, in order to potentially offer a second chance of cure or at least prolong life. Post-treatment imaging such as
FDG-PET may serve as a means of early detection of poor response to treatment, thus prompting appropriate salvage surgery in a timely fashion. The use of PET scanning for this purpose is not routine, in part due to lack of data supporting this purpose.
1 Human papillomavirus (HPV) can evade the immune system and its role in disease progression may be exploited in developing novel immunotherapy platforms. Although several studies have investigated the expression and inactivation (through loss of heterozygosity) of tumour suppressor genes in the pathways to anal cancer, no clinically valuable biomarkers have emerged. Regulators of apoptosis, including survivin, and agents targeting the PI3K/AKT pathway, offer opportunities for targeted therapy, although robust data are scarce. Additionally, antibody therapy targeting epidermal growth factor receptor may prove efficacious although the safety profile in combination with standard CRT has proven to be suboptimal.
Finally, progress in the treatment of anal cancer has remained stagnant, in part due to a lack of pre-clinical models, including cell lines and mouse models for testing new therapies.
The work described in this thesis is a combination of clinical and translational research. A prospective database of anal SCC patients is used to provide data regarding patterns of disease failure and subsequent outcomes in a large cohort of patients spanning thirty years of experience in a single institution. Data was also captured in the use of post-treatment PET scans in anal SCC and its predictive value is analysed.
In the laboratory, next generation RNA sequencing was utilised with the aim of identifying novel genetic targets for prediction and/or prognostication and ultimately to expand therapeutic options in anal cancer management.
2 Furthermore, the absence of pre-clinical anal cancer models is addressed with the establishment of a patient-derived tumour xenograft mouse colony. This aims to provide a resource for both investigating molecular pathways and for testing novel targets in the treatment of anal cancer.
3 1.2 Anal Squamous Cell Carcinoma
Introduction
Anal squamous cell carcinoma represents a very small proportion of lower gastrointestinal tumours. Sexually-transmitted human papilloma virus infection is recognised as the main aetiological agent.1-5 Global incidence ranges from 0.2 to 3.2 per 100,000 in men and 0.2 to 4.4 per 100,000 in women, as per data from 1998 to 2002.6 In Australia, there are approximately 300 new cases per year, with the incidence rising almost 50% from 0.65/100,000 in the 1982-
1987 period to 1.0/100,000 in the 2000-2005 period.7 The incidence is even higher in men who have sex with men (35 per 100,000 in the United States) and in men and women who are HIV-seropositive (75-135 and 30 per 100,000 respectively).8
Precipitants related to immunosuppression, other than HIV infection,9 include therapy after solid organ transplantation, haematologic malignancy, or autoimmune disease (eg: Crohn’s disease, psoriasis, polyarteritis nodosa,
Wegener’s granulomatosis).10 Further risk factors are: a history of receptive anal intercourse; a history of cervical or vulval HPV-related malignancy or pre- malignant changes;11 cigarette smoking;12, 13 and poor socioeconomic status.10
Despite this, the treatment for anal cancer has remained essentially unchanged for almost forty years. In 1974, Nigro et al. first described the neoadjuvant use of combined CRT, using 5-fluorouracil (5FU) and mitomycin
(MMC), prior to abdominoperineal resection (APR).14
4 Their novel suggestion that an APR might be avoided came in 1977 when the results of a series of ten patients was described.15 The proposed sphincter- preserving strategy, using CRT only, has now become the standard of care but continues to serve as a ‘one-size-fits-all’ approach. APR has been relegated to
‘salvage surgery’ when CRT fails.
Local disease relapse is the most common pattern of treatment failure seen while distant metastastic disease occurs in fewer patients.16 Patients with higher T-stage have a disease-free survival (DFS) of 53% at 3 years, or 30% if node-positivity is also present.17 It is these sub-groups of patients who fair badly and in which prognostic markers and therapeutic options are limited at best.
Pathogenesis
Invasive anal SCC is usually preceded by anal intraepithelial neoplasia (AIN), graded I to III. AIN II/III are considered to be precursor lesions to carcinoma and can involve both the perianal skin and anal canal.18 HPV infection is implicated in both AIN and anal SCC with two genotypic forms, HPV-16 and
HPV-18 now well-recognised to confer a high risk for the development of anal
SCC.3, 19 Further details regarding the underlying molecular mechanisms of this association will be discussed in section 1.3.
5 The quadrivalent HPV vaccine against HPV types 6, 11, 16 and 18 has been proven to be a successful preventive strategy against development of cervical dysplasia and hence cervical cancer.20 Due to the parallel aetiology, it may be extrapolated that this vaccine will also affect anal cancer rates by reducing the incidence of AIN,21 although this is yet to be demonstrated. In
Australia, the HPV vaccination program targets school-aged girls and young women, while vaccination of teenage boys commenced in 2013. Although this may eventually lead to a reduced incidence of anal cancer, this would not be evidenced for several decades.
Anatomy
The anal canal refers to the last 3-5cm of the gastrointestinal tract, beginning proximally at the anorectal junction (palpable on digital rectal examination where the puborectalis muscle slings around the rectum at the apex of the sphincter complex) and ends distally at the anal verge, palpable as the lower border of the internal sphincter. The anal margin refers to a radius of 5cm of perianal skin surrounding the anal verge (Figure 1.1).
The most important landmark of the anal canal is the dentate line which represents the junction of the endodermal and ectodermal embryological derivatives; this is visible macroscopically, 2.5 to 3cm proximal to the anal verge.
Proximal to this line, the anal canal is lined by columnar epithelia.
6 At the line itself lie the anal crypts, ducts and glands. The 6-12mm area just proximal to the line is known as the transitional zone. Its mucosa may include cells of many types: unkeratinised squamous; transitional; basal; cuboidal; and columnar cells. This area of histological heterogeneity represents the origin of most anal SCCs 22, 23 although the cell type does not have any apparent impact on management or outcome.24 Distal to the dentate line, the anal canal is lined by stratified squamous epithelia. The anal margin also has this feature but differs in that it contains normal dermal appendages such as hair follicles, sebaceous glands and apocrine sweat glands.25 Cancers arising at the anal margin only are managed differently to those of the anal canal, with local excision usually providing curative treatment.
Figure 1.1 Anatomy of the anal canal
7 The described anatomy is of critical importance in understanding the lymphatic drainage, and hence potential sites for spread of this disease.
Malignancy arising above the dentate line can spread along two pathways as per the dual blood supply to this area. The first is the most proximal, where drainage is into perirectal nodes which drain into the superior rectal vessels and subsequently into the inferior mesenteric system, and then para-aortic nodes.
The second is via lymphatics along the inferior rectal artery and middle rectal artery, and onto the internal and common iliac lymph nodes or obturator nodes.
Distal to the dentate line, the anal canal drains to superficial inguinal lymph nodes, and may also follow this route to travel to femoral or external iliac nodes.
It thus follows that the position of the tumour dictates where it metastasises.
The most common sites of nodal disease are inguinal and iliac lymph nodes, with distant spread via the portal system or systemic circulation less frequent.
Clinical Presentation
The mean age at presentation is 60-70 years in the UK and Europe 26, 27, but up to a decade earlier in the United States 28, 29. The most common symptoms at presentation are: anal pain; bleeding; anal discharge; pruritus; ulceration; and an anal mass (Figure 1.2). In locally aggressive disease with infiltration of the anal sphincters, patients may complain of tenesmus, faecal soiling and incontinence.
8 Other symptoms of locally advanced disease are perianal infection or fistula formation. Occasionally, anal carcinoma is an incidental discovery in surgical specimens after excision of skin tags or haemorrhoidectomy 18, 30.
Figure 1.2 Large fungating anal SCC (pre-treatment)
With further understanding of the association with HPV and HIV infection, additional cases are being identified in clinics who are frequented by these high risk patients and those that carry out surveillance programs for patients with known AIN.30 Thus, it is important to be able to recognise AIN and monitor any changes, due to its potential for malignant transformation.
Skin changes may be fairly innocuous or lesions may be seen which are raised or scaly, contain white plaque, are erythematous, pigmented, fissured, or eczematous.31
9 Condylomata or anal warts are considered a variant of AIN1.21 Patients who have any of the above symptoms or signs should undergo a thorough examination of the perineum as well as digital rectal examination. A high index of suspicion should be maintained for those with the more subtle changes associated with AIN.
Staging & Investigations
Anal SCC is staged prior to definitive treatment with CRT. As there is no surgical specimen upon which to confirm pre-treatment staging, there is reliance upon a combination of clinical and radiologic elements to accurately stage the gross tumour size (T), nodal involvement (N) and the presence of metastatic disease (M). Staging investigations culminate in a TNM stage (Table
1.1).32
10 Table 1.1 Seventh Edition of the AJCC/UICC TNM Staging for Anal Canal
Cancer 32
Primary Tumour (T) Tx Primary tumour cannot be assessed Carcinoma in situ [Bowens disease, high-grade intraepithelial Tis lesion, anal intraepithelial neoplasia II-III] T1 Tumour smaller than 2cm in greatest dimension T2 Tumour between 2cm and 5cm in greatest dimension T3 Tumour larger than 5cm in greatest dimension Tumour invading adjacent organs [vagina, urethra, bladder, T4 sacrum] Regional lymph nodes (N) Nx Regional nodes cannot be assessed N0 No regional lymph node metastasis N1 Metastasis in perirectal nodes N2 Metastasis in unilateral internal iliac and/or inguinal nodes Metastasis in perirectal and/or bilateral internal iliac or N3 inguinal nodes Distant Metastasis (M) M0 No distant metastasis M1 Distant metastasis Anatomic stage / Prognostic groups 0 Tis N0 M0 I T1 N0 M0 II T2 N0 M0 T3 N0 M0 IIIA T1 N1 M0 T2 N1 M0 T3 N1 M0 T4 N0 M0 IIIB T4 N1 M0 Any T N2 M0 IV Any T N3 M0 Any T Any N M1
11 The most pertinent reasons for precise pre-treatment staging are reflected in the following:33
1. Identification of distant metastases renders the patient’s disease non-
curative;
2. Radiotherapy fields and doses (prophylactic versus therapeutic) are
dependent upon the size of the tumour, and the presence of involved
pelvic and/or inguinal nodes;
3. Higher T-stage and node-positive disease influence prognosis by
increasing the risk of local disease relapse and reducing disease-free and
overall survival.
Examination Under Anaesthesia
Local disease staging is predominantly based upon the size of the tumour rather than depth of invasion, and is assessed clinically. Examination under anaesthesia (EUA) facilitates accuracy of tumour staging with regards to the exact site, size and extent, including extension into the posterior vaginal wall.
Computed Tomography
Computed tomography (CT) scan of the chest, abdomen and pelvis remains the first-line staging investigation to detect metastatic disease. Combining positron emission tomography (PET) scanning with CT has become common to aid in correlation with anatomic details. However, due to differences in the imaging
12 protocols of the two types of CT scans, the latest NCCN Guidelines state that a
PET/CT should not replace a diagnostic CT.34
Magnetic Resonance Imaging
Magnetic resonance imaging (MRI) of the pelvis remains the favoured imaging modality to assess locoregional extent of disease.24 It provides more precise anatomic detail with good contrast resolution for assessing nodal disease in the mesorectum and pelvis.35 It is contraindicated in some patients, and is more expensive and time-consuming than endoanal ultrasound (EAUS).36
Endoanal Ultrasound
The use of EAUS in staging of anal cancer is not common at present. EAUS is operator dependent with limited fields of view attainable. Given that EAUS cannot detect N2 or N3 (mesorectal, inguinal and iliac nodes) stages of disease, it seems unlikely it will become a standard staging investigation for most anal cancers.
Sentinel Lymph Node Biopsy
This technique involves peri-tumoural injection preoperatively with radiolabelled agents, which are detected using a gamma probe intraoperatively.
This allows detection of nodal disease which is not clinically evident. The rationale behind the adoption of this procedure in staging is that irradiation of
13 the inguinal region may be avoided in some early T-stage patients who are node-negative. In one institution, inguinal failure rates prior to the routine implementation of elective inguinal irradiation were 1.9% in T1N0 disease and
12.5% in T2N0 disease.16 In another study where T1 and T2 disease were analysed together, the inguinal failure rate was 22.5% without elective inguinal irradiation with 12.5% of these being isolated inguinal metastases.37 Based upon these results, elective inguinal irradiation is the current standard of care with a failure rate of less than 5%.38
The search for more accurate staging has driven the inquiry into sentinel lymph node (SLN) biopsy as a staging adjunct. Those in favour of SLN biopsy purport that radiological staging has a significant false negative rate in the detection of inguinal nodal metastases which may be improved upon by the use of SLN biopsy, and that radiation to this region has significant potential toxicity.37, 39
Two systematic reviews addressing the use of sentinel node mapping were published in 2013 and concluded that this was a feasible and promising staging method.40, 41 However, both reviews suffer from major limitations including a small overall sample size with some included reports of 1 or 2 patients. There was substantial heterogeneity between studies and a true false negative result cannot be derived as no patients underwent the gold standard of inguinal node dissection, resulting in likely underestimation. This is reflected in one of the included studies by De Jong et al. who prospectively reported on
14 21 patients who underwent SLN biopsy with a 24% complication rate.42
Disappointingly, two of the patients with negative SLN biopsies, and hence no radiation to the groin, developed metachronous inguinal disease after one and two years, raising the issue of potential undertreatment in such patients.
Mistrangelo et al. published an update of their data on 63 patients treated over a ten year period and combined their experience with a review of the literature.39 They conclude that approximately 2 out of 3 T3 and T4 tumours have no inguinal nodal involvement, and could therefore be spared radiation treatment of the groin. The combined false negative rate is 3.7%.39 The evidence that the authors present with regards to the toxicities associated with radiation are all from case series dating back to treatment as late as 1997 only.27, 38, 43
Radiation techniques and toxicity rates have improved since that time. Hence the rationale that patients with a negative SLN biopsy may avoid radiation and its potential toxicity is less relevant today. Future debate on this issue must consider the invasiveness of the SLN biopsy technique and that elective radiation of the groin results in metachronous inguinal node metastasis in only
4% of patients.29 This invasive technique also needs to be accurately compared to non-invasive modalities such as PET scan.
SLN biopsy as a staging technique continues to be evaluated and is not currently part of routine practice in most centres. The evidence presented suggests that both radiological staging and SLN biopsy have false-negative rates, and that the safest treatment approach is to implement elective inguinal
15 irradiation. SLN biopsy may have a place in assessing recurrent disease to decide whether radical inguinal lymphadenectomy should be performed at the time of salvage surgery.30
Fluorodeoxyglucose-Positron Emission Tomography/Computed Tomography
The majority of anal carcinomas have proven to be FDG-avid.44, 45 This functional imaging modality can detect regional, non-enlarged involved nodes and distant disease. Its limitation in accurately identifying nodes <8mm in size is shared by the other commonly used staging modalities including MRI and
CT.
Two important factors emerge when assessing whether FDG-PET has utility in staging and changing patient management. The first is the identification of metastatic disease. This will obviously alter the intent of treatment from curative to palliative and may spare a patient the toxicities associated with CRT, which would have been futile in this setting. The second factor is the accurate detection of involved nodes. This allows the radiation oncologists to adjust the radiation field accordingly, in order to include all detectable disease, as well as ‘boosting’ some nodal disease.44 The findings of twelve series examining the role of FDG-PET have been analysed in a systematic review and meta-analysis. Overall, when compared with conventional imaging modalities (CT or MRI), the use of PET resulted in upstaging of nodal disease in 15% and downstaging in 15%, culminating in a
16 change in nodal staging in 28% of patients. The more contemporary studies using PET/CT demonstrated even higher sensitivity than PET alone; nodal upstaging occurred in 21% of patients, downstaging in 17% and the detection of new distant disease in 3% of patients, leading to a change in the TNM stage in
41% of patients. The conclusion from these findings was that PET/CT should be routinely used for pre-treatment staging of anal SCC.46
As yet, no formal evaluation has addressed whether these changes will result in improved outcomes. However, as one of the main alterations is the radiation fields, this should manifest as more precise targeting of disease rather than affecting normal tissue, and hence lead to reduced toxicity.
One study has compared PET/CT to SLN biopsy.47 PET/CT was reported to have a false positive rate of 5% in the detection of inguinal lymph node metastases. The investigators comment this justifies biopsy of PET/CT positive nodes prior to any change in radiation fields. Given the potential morbidity of the procedure, and that false positives would not result in under-treatment, it seems this suggestion may be overstated for common staging practices.
PET/CT is currently not validated for ‘routine use’ in staging and treatment planning.34 However, the evidence provided demonstrates that significant adjustments are made to patients’ treatment that are directly attributable to information gained from FDG-PET/CT. It should therefore increasingly become a standard staging investigation for anal carcinoma as well as guiding radiation fields.
17 Prognostic factors
Most analyses of prognostic factors are based upon retrospective reviews. The randomized controlled trial by the Radiation Therapy Oncology Group (RTOG) provided a 644 patient database for prospective multivariate analysis. The results indicated prognostic value for tumour size and nodal status. Tumours
>5cm had a worse 5-year DFS and overall survival (OS) (47% and 60% respectively) compared to tumours ≤ 5cm (60% and 77% respectively). Node positivity resulted in 35% 5-year DFS and 57% OS. This is in stark contrast to node negative patients who had a 64% 5-year DFS and 78% 5-year OS.17
Male gender is a poor prognostic factor with a hazard ratio (female vs male) of 1.38 for DFS and 1.57 for OS.17 Further studies have confirmed improved outcome for women including reduced rates of relapse (Table 1.2).7, 16,
48 Other prognostic factors which have been evidenced variably include age, radiotherapy dose, and treatment interruptions.49
Two studies have demonstrated a correlation between outcome following CRT and the expression of the tumour suppressor protein, p16(INK4A), a surrogate marker of HPV-positivity. In both studies, patients with p16-negative tumours had higher relapse and poorer overall survival rates.50, 51 This prognostic indicator needs to be placed in context as it is well- established that the majority of anal cancers are HPV-positive13 and hence the proportion of HPV negative tumours in the studies are quite small.
18 Table 1.2 Summary of Updated Trials
Trial name n Design Updated results & Author/Year 5 year LRF: 20.0% (5FU/MMC) vs 26.4% (5FU/Cisplatin); p=0.087 5 year DFS: NACT 67.8% (5FU/MMC) vs 57.8% (5FU/Cisplatin); p=0.006 cisplatin/5FU 5 year CFS: RTOG 98-11 Then 649 71.9% (5FU/MMC) vs 65% (5FU/Cisplatin); p=0.05 Gunderson 201252 5FU/cisplatin/RT 5 year OS: vs 78.3% (5FU/MMC) vs 70.7% (5FU/Cisplatin); p=0.026 5FU/MMC/RT 5 year Distant metastasis: 13.1% (5FU/MMC) vs 18.1% (5FU/Cisplatin); p=0.12 (NS)
Palpable, clinically positive inguinal nodes associated with: LRF (p=0.012) Higher risk of Anal cancer death (p=0.031) ACT I RT alone vs Reduced OS (p=0.006) Glynne-Jones 292 RT/5FU/MMC Worse outcomes associated with males for: 201348 LRF (p=0.036) Anal cancer death (p=0.039) OS (p=0.008)
Abbreviations: CFS, Colostomy-free survival; DFS, Disease-free survival; LRF, Locoregional failure, NACT, Neoadjuvant chemotherapy; NS, Not significant; OS, Overall survival; RT, Radiotherapy; RTOG, Radiation Therapy Oncology Group; RFS, Relapse-free survival; UKCCR ACT, United Kingdom Coordinating Committee on Cancer Research Anal Cancer Trial.
Two studies have investigated the predictive potential of PET. In one
study, those with a complete metabolic response had a 5-year OS of 88%, which
decreased to 69% in those with a partial metabolic response, and 0% in those
with no response.53 The second study examined the specific use of metabolic
tumour volume (MTV), a measurement of hypermetabolic tissue gained from
PET, and its predictive value. Even when adjusting for T-classification, the MTV
remained a significant predictor of progression-free survival and event-free
survival.54
19 Treatment
In the last fifty years, treatment has evolved from surgery, to preoperative CRT and surgery, to definitive CRT. Although the backbone of treatment is combination therapy, several aspects have been refined and improved since
Nigro’s time.
Chemoradiotherapy is superior to Radiotherapy alone
The UKCCCR ACT I trial compared the use of 45 Gray and a 15 Gray boost after 6 weeks, to RT combined with 5FU (1000mg/m2/day on days 1-4 and 29-32) and MMC (12mg/m2 on day 1) in 585 patients. This demonstrated a 46% reduction in the risk of local failure in the combined modality group after 42 months follow-up.55 The same radiotherapy regimen and slightly different chemotherapy doses were used in the EORTC Phase III trial reported in 1997 and showed a 39% risk reduction for local failure.27
Concurrent chemotherapy 5FU and MMC is superior to 5FU alone
A phase III randomized trial involving 291 patients was undertaken by the
RTOG/Eastern Cooperative Oncology Group (ECOG) to investigate the importance of MMC in standard CRT for anal cancer. Lower colostomy rates
(9% v 22%; P = .002), higher colostomy-free survival (71% v 59%; P = .014), and higher disease-free survival (73% v 51%; P = .0003) were seen in the MMC arm.56
20 Concurrent 5FU/Cisplatin is not superior to 5FU/MMC
Since then, several large trials28, 52 have assessed different CRT regimens, with the only addition or change in terms of chemotherapeutic agents being cisplatin instead of MMC, due to the latter’s known toxicities. These have demonstrated comparable efficacy to MMC with a trend towards worse colostomy rates with the use of cisplatin (Tables 1.2 & 1.3).28, 52 Essentially, Nigro’s original chemotherapeutic choice has not been improved upon with regards to outcome or overall toxicities, with MMC and 5FU remaining the standard agents.
Neoadjuvant or adjuvant chemotherapy does not provide additional benefit compared to standard CRT
Three large trials (RTOG-9811,28 UKCCR ACT II,57, 58 UNICANCER
ACCORD03,59 Table 1.3) have evaluated the efficacy of differing neoadjuvant chemotherapy regimens and/or adjuvant chemotherapy. These additions have not yielded any improvement on DFS or OS or local recurrence compared to standard definitive CRT.
21 Table 1.3 Summary of randomised controlled trials of different chemoradiotherapy regimens in anal cancer
Disease-free Trial name Local failure Colostomy rate/ n Design Primary End Point survival/ Relapse- Overall Survival (Years) rate Colostomy-free survival free survival Colostomy rates: 22% with 5FU vs 9% with RTOG 87- DFS 51% with 5FU 71% with 5FU vs 78.1% 291 5FU/RT vs 5FU/MMC; p=0.002 04/ECOG Disease-free survival 16% at 4yrs vs 73% with with 5FU/MMC; 5FU/MMC/RT CFS: (1988-1991) 56 5FU/MMC at 4yrs p=0.31 (NS) 59% with 5FU vs 71% with 5FU/MMC at 4 yrs; p=0.014 25% with DFS 60% with Colostomy rates: 75% with 5FU/MMC vs NACT cisplatin/5FU 5FU/MMC vs RTOG 98-11 5FU/MMC vs 54% 10% with 5FU/MMC vs 19% 70% with 644 Then 5FU/cisplatin/RT vs Disease-free survival 33% with (1998-2005) 28 with 5FU/Cisplatin with 5FU/Cisplatin; p=0.02 at 5FU/Cisplatin; 5FU/MMC/RT 5FU/Cisplatin at 5 yrs; p=0.17 (NS) 5 yrs p=0.1 (NS) at 5 yrs
2x2 factorial 11% with 5FU/MMC vs 5- Colostomy rate same in both UKCCR ACT II Relapse-free survival MMC RFS 75% in both 85% with maintenance at 940 FU/cisplatin CRT & arms (5% with maintenance (2001-2008) 58 13% with arms at 3 yrs 3 yrs vs 84% without (NS) consolidation vs 4% without) cisplatin 5FU/cisplatin vs control Colostomy-free Arm A 28% Tumour-free 2x2 factorial 5yr CFS 5yr specific survival survival Arm B 12% survival NACT (5FU/cisplatin – 2 Arm A 70% Arm A 77% ACCORD-03 Secondary end points: Arm C 16% Arm A 64% 307 cycles) vs No NACT Arm B 82% Arm B 89% (1999-2005) 59 local control, overall Arm D 22% Arm B 78% Standard vs high-dose Arm C 77% Arm C 81% survival, cancer- Overall 19% Arm C 67% boost for responders Arm D 73% Arm D 76% specific survival at 5yrs Arm D 62%
Abbreviations: ACCORD, Action Clinique Coordonees en Cancerologie Digestive; CFS, Colostomy-free survival; DFS, Disease-free survival; ECOG, Eastern Cooperative Oncolgy Group; Gy, Gray; NACT, Neoadjuvant chemotherapy; NS, Not significant; RT, Radiotherapy; RTOG, Radiation Therapy Oncology Group; RFS, Relapse-free survival; UKCCR ACT, United Kingdom Coordinating Committee on Cancer Research Anal Cancer Trial.
Chemotherapeutic/biological agents under investigation
Beyond the three most utilised chemotherapeutic agents (5FU, MMC, cisplatin), other drugs which are being explored include capecitabine60, 61, oxaliplatin60, cetuximab and panitimumab, (both EGFR inhibitors), and immunotherapy
(Table 1.4). Unfortunately, phase I62 and phase II63 trials evaluating the addition of cetuximab to standard CRT reported premature cessation due to unexpected toxicity in the cetuximab arm. A third such trial was completed; 61 patients with stage I-III anal SCC received cetuximab in addition to CRT with cisplatin and 5FU. The end-point of 3-year LRF rate was 21%, a reduction compared to the utilised historical data of 35%. Progression-free survival and overall survival were 68% and 83% respectively which are not markedly different results from standard CRT. However, the considerable Grade 4 toxicity rate of
32% as well as the 5% treatment-associated mortality rate, have rendered the addition of cetuximab an unacceptable option.64 The completion and results of two further studies are awaited (Table 1.4).
23 Table 1.4: Current Clinical Trials
Trial name n Title Current status
A Phase II Study of Capecitabine Completed March 2014 (Xeloda)/Oxaliplatin (Eloxatin) With (Last verified March 2014) NCT00093379 20 Concomitant Radiotherapy (XRT), No publication yet (Phase II) XELOX/RT in Squamous Cell Carcinoma of the Anal Canal
Cisplatin, Fluorouracil, Cetuximab, and Completed June 2016 AMC045 Radiation Therapy in Treating Patients (Last verified June 2016) NCT00324415 45 With HIV and Stage I, Stage II or Stage No publication yet (Phase II) III Anal Cancer
Phase I Study of Cetuximab in Ongoing, not recruiting NOAC8 Combination With 5-fluorouracil, Last updated March 2017 NCT01621217 21 Mitomycin C and Radiotherapy in (Last verified September (Phase I) Patients With Anal Cancer Stage T2 2016) (>4cm)-T4 N0-3 M0 or Any T N2-3 M0
Phase I-II on Radiochemotherapy Currently recruiting NCT01581840 Combined With Panitimumab in the Last updated August 2016 45 (Phase I/II) Treatment of Localised Epidermoid (Last verified August 2016) Carcinoma of the Anus
24 Clinical Target for Radiation Therapy
In addition to the primary anal canal tumour and pathologic nodal metastases, the clinical target volume (CTV) includes tissue that may harbour microscopic disease. The whole anal canal and surrounding tissue, mesorectum, obturator nodes, internal and external iliac nodes, common iliac nodes, presacral space and inguinal nodes are included in the CTV. Risk of inguinal nodal metastasis for a clinical T1N0 tumour is low and inguinal nodal irradiation may be omitted. This large CTV leads to toxicity that has now been overcome with modern radiation techniques.65
Radiation dose and treatment interruption
The current treatment paradigm is external beam radiotherapy to a total tumour dose of 50.4 to 54 Gray with lower dose for elective nodal irradiation.16
The intensity of radiation of current treatment does not take into consideration tumour bulk. Intensifying radiation may increase acute cutaneous toxicity leading to treatment interruption. In a RTOG radiation dose escalation study, radiation dose was increased to 59.6 Gy plus chemotherapy delivered over 8 weeks, including a 2-week rest period. Patients treated with this protocol had a higher colostomy rate at 1 year (23% vs. 6%) and at 2 years (30% vs. 7%)66 compared with their previous study (RTOG 87-04).56 Clinical trials are being planned by a UK group to investigate the impact of radiation doses on tumour control among T stages.
25 2D Radiation Therapy, 3D Conformal Radiation Therapy and Intensity
Modulated Radiation Therapy
2-Dimensional (2D) radiation planning with parallel-opposed radiation fields was the standard technique in the times of Nigro. It has been replaced by 3D conformal radiation therapy (3DCRT). Radiation is delivered to the target volume in a more conformed fashion minimizing unnecessary radiation exposure to the surrounding tissue. A highly conformal technique has been developed using intensity modulated radiation therapy (IMRT). The radiation distribution is tailored to the tumour target and also to the surrounding dose- sensitive structures. It is particularly suitable for a target volume that follows the tortuous course of the iliac vessels.65
Elective inguinal nodal irradiation
Elective inguinal nodal irradiation is effective in reducing inguinal failures.
With 2D RT and 3DCRT, short- and long-term toxicity is increased with increased radiation volume. IMRT is particularly useful for this complex volume and can be conformed to the target volume reducing the radiation exposure to hip joints, urinary bladder and intestine.
In a Trans-Tasman Radiation Oncology Group prospective single-arm chemoradiotherapy study, no prophylactic inguinal nodal irradiation was used for T1-2 tumours. The inguinal failure rate was 22.5%, but was isolated in
26 only 12.5%.37 In a French multi-centre retrospective study of 208 patients, the
5-year inguinal failure rates were 12% and 30% for T1-T2 and T3-T4 respectively (p = 0.02) for those with omission of prophylactic inguinal nodal irradiation.
The 5-year cumulative rate of inguinal recurrence was 2% and 16% in the prophylaxis group and no prophylaxis group respectively (p = 0.006). There were no differences in overall survival, disease-specific survival, and disease- free survival between the two groups. No severe toxicity to the lower limbs was observed in the group receiving groin irradiation. The recommendation was that prophylactic inguinal irradiation is safe and should at least be discussed for the management of early stage tumours due to a substantial recurrence rate in this group.67 Note that T1/2 tumours were considered together in this study. In an Australian single centre retrospective study of 284 patients, omission of elective inguinal irradiation resulted in inguinal failure rates of 1.9% and 12.5% in T1N0 and T2N0 patients, respectively.16
Intensity-Modulated Radiation Therapy
IMRT provides a solution for the complex target represented by the pelvis and its contents, including avoidance of organs at risk such as the small intestine, urinary bladder, hip joints and genitalia. Another advantage is that the radiation dose homogeneity is superior to conventional 3DCRT, improving
27 tumour control through minimizing hot and cold radiation spots within the target. Several studies, including a Phase II trial, have demonstrated IMRT to be well tolerated and results in reduced Grade 2+ haematological and Grade 3+ gastrointestinal and dermatologic adverse events compared to standard RT, and less frequent treatment breaks.68-70
The challenge to establish it as the new standard of care is not trivial. The technique is technically complicated and anal cancer is not a common condition.
Accurate contouring of gross disease and clinical target volume is essential.
PET/CT will increase the accuracy of identification of metastatic nodal disease.44
In order to standardize contouring of the CTV, practical planning guidelines and high-resolution atlas have been prepared65 and complement other protocols and guidelines.70-72
Outcomes
Patterns of failure
The most common pattern of treatment failure is locoregional recurrence which usually occurs within the first 3 years after treatment.73 In many papers, this is defined as relapse at the site of the primary tumour and/or inguinal and/or pelvic lymph nodes, usually a minimum of 6 months after CRT. The updated findings of RTOG-9811 (Table 1.2) report the 5-year LRF rate of 20% and distant metastasis rate of 13%.52 The LRF rate is supported by two large retrospective
28 reviews. Wright et al. report 3-year LRF rate of 23%74 while Tomaszewski et al. report an estimated 5-year locoregional control rate of 83% but a slightly lower rate of 85% for distant metastasis.16
In the Position Statement from the Association of Coloproctology of
Great Britain and Ireland (ACPGBI) published in 2011, a recommendation was made that the term ‘local disease relapse’ be adopted when the same tumour is diagnosed after completion of treatment, regardless of the timing.75
Stoma rates
Colostomy free survival (CFS) is a surrogate for the success of CRT. Treatment failure may lead to APR and colostomy. Equally, excessively intensive treatment may lead to anorectal complications that may result in APR and colostomy. In the updated report of RTOG-9811, approximately 28% of patients had a stoma at 5 years.52 This is comparable to the rate seen in a large
Australian retrospective cohort, with estimated 3-year and 5-year colostomy- free survival rates of 79% and 73% respectively. In this study, the most common reasons for a stoma were treatment failure (71%), defunctioning prior to definitive CRT without reversal (16%) and late treatment toxicity (5%).16
29 Follow-up
The main purpose of follow-up is early detection of patients with (a) persistent disease after completion of initial treatment and (b) local disease relapse without distant metastases. In both these situations, salvage surgery may be possible and offers the only chance of cure. While some patients are known to be at higher risk of relapse, no consensus exists on which patients should be followed up, nor on the frequency of clinical review or imaging.
The ACPGBI Position Statement offers some guidelines.76 Clinical follow- up recommendation is based on the protocol from ACT II 57 and includes: 2 monthly review for the first year, 3 monthly in the second year, and 6 monthly for years 3 to 5, with general practitioner review after this. These visits include a thorough history of any new suspicious symptoms, perianal and digital rectal examination, supplemented by proctoscopy or rigid sigmoidoscopy. Routine
EUA is not advocated. Rather, any suspicious lesions should be re-examined in
4-6 weeks and if persistent, EUA and biopsy is recommended.
Imaging post-treatment
The use of routine imaging in follow-up remains contentious. Advocates would argue that imaging may be used soon after completion of CRT to evaluate the response to treatment and identify persistent disease so as to proceed with salvage surgery as soon as practicable. Secondly, the use of surveillance
30 imaging serves to detect relapse at an early stage, with the hope of prompt salvage treatment resulting in a good outcome.
The current NCCN Guidelines only recommend digital rectal examination to assess response to treatment. For surveillance, ‘chest, abdominal and pelvic imaging’ is recommended annually for 3 years (for T3-4 tumours and inguinal node positive) although the specific modality is not described.34
MRI is often used to evaluate the pelvis while CT of the Chest/Abdomen/Pelvis is also commonly utilised. The ACPGBI recommend 6 monthly MRI scans in high risk patients as well as in those with residual disease after CRT. CT scan is suggested at 6 months and then yearly for 3 years for high risk patients only.76
The use of PET/CT is being adopted in some centres to assess treatment response, but this use remains quite controversial and is not mentioned in the most recent NCCN guidelines.34 Jones et al. found that PET scan identified a complete response to definitive CRT in 78% of 266 patients. When the scan was performed 1 month following treatment, the response rate was 64% and increased to 80% when the interval was 4 months. Some of the scans showing residual disease at short intervals after completion of treatment prompted salvage APR with no disease subsequently identified in the operative specimen.
Given that anal SCC can take up to 6 months to fully respond to CRT, PET scan should be delayed following completion of treatment. They concluded that evidence was lacking to support the routine use of PET in assessing treatment response.46
31 This remains an area of extreme interest and should be investigated further, ideally with prospective data collection. In the United Kingdom,
PET/CT is recommended to exclude metastatic disease prior to salvage surgery.76
Salvage surgery
Local disease relapse
Presently, there is no medical therapy option for those patients with local disease relapse and these patients require a salvage APR for a chance at cure.75
In the context of anal carcinoma, this operation carries considerably higher morbidity than the standard surgery for low rectal adenocarcinomas. En bloc resection of adjacent viscera, especially the vagina and uterus, is not uncommon,77 with some patients requiring formal total pelvic exenteration. The previously irradiated perineal skin requires a wider resection with gluteal or transpelvic rectus abdominis myocutaneous flaps routinely utilised to fill the perineal defect. Some patients also require formal inguinal lymphadenectomy.
Multiple case series have reported their outcomes for salvage surgery and are summarized elsewhere. Interpretation of the results is limited by small patient numbers, with large variation in 5 year survival rates ranging from 13% to 69.4%.75, 77, 78 The largest reported cohort of 111 patients underwent APR over a 29 year period. The 2-year and 5-year survival rates were 60% and 24.5% respectively, with a median survival time of 32 months. Factors significantly
32 associated with survival were nodal disease, resection margin, and perineural and/or lymphovascular invasion. For those with negative results of these three variables, 5-year survival was 55%, versus 0.03% for those with positive findings.77 The wide variability in survival rates may represent significant heterogeneity in patient selection for salvage surgery. This highlights the need for a uniform definition in what constitutes local disease relapse, an appropriate protocol-driven surveillance program to detect local disease relapse early, and a dedicated MDT with specialists in the management of relapsed anal cancer. The recommendation is that greater than 60% of patients with relapsed disease should be offered radical salvage surgery with the audit standard for 5-year post-operative survival rate being greater than 40%.75
Inguinal and Distant Metastasis
Salvage options for the few patients with isolated inguinal nodal recurrence include radiation, if prophylactic treatment was not administered, or formal inguinal lymphadenectomy.
The rate of distant metastasis is also low with consideration for curative resection in the presence of isolated liver metastases only more recently being reported.78 Long-term outcomes in this limited patient cohort are unknown.
All patients with relapse, regardless of the site, should be reviewed and discussed in the setting of an experienced MDT, in order to maximize reoperation rates and chance of cure in this small subset of patients.75
33 Conclusion
It is somewhat astounding that in this era of increasing knowledge and understanding of the molecular biology of certain cancers leading to the use of effective targeted therapies, the treatment of anal cancer has remained essentially in stasis for forty years. A significant proportion of patients have a poor outcome after definitive CRT, with DFS as low as 35% at 5 years for node- positive patients.17
While salvage surgery offers a good outcome for a small number of patients, the outlook is generally poor for this group with no effective chemotherapeutic options available. The use of PET/CT for follow-up remains controversial due to small numbers and inconsistent application for this purpose. The identification of predictive and prognostic biomarkers offers hope for the future. Further research in these areas is required if outcomes for these patients are to be improved.
34 1.3 Molecular Biology of Anal Squamous Cell Carcinoma
Introduction
Anal squamous cell carcinoma is the most common histological type of malignant disease of the anal canal, with most tumours arising within the transitional zone, which is histologically heterogeneous. The standard treatment for anal cancer, which consists of definitive chemoradiotherapy with
5-fluorouracil and mitomycin C, has remained essentially unchanged since 1977 when this sphincter-preserving strategy was first proposed.15
Current clinicopathological staging using the Tumour/Node/Metastasis model32 provides relative consistency throughout clinical trials in predicting response to treatment. However it is not perfectly reliable, with some heterogeneity in responses for individual patients in the same stage of cancer.
This suggests that sensitivity to chemoradiation is somewhat heterogeneous.
Presently there is no way of predicting response to standard CRT, whereby some patients derive little benefit or are left with significant late and morbid toxic effects.
Secondly, due to the relative rarity of anal SCC and the reasonable responses to primary CRT, it is difficult to conduct suitable trials for the proportion of patients who experience local disease relapse after surgery or who have metastatic disease. Consequently, there have been few advances in available treatment options for these patient populations. The most recent
35 National Comprehensive Cancer Network guidelines34 for metastatic anal cancer remain ‘broad’, but acknowledge that only cisplatin-based chemotherapy is recommended as a treatment option as no other regimens have demonstrated efficacy.
HPV is recognised as the main aetiological agent in anal SCC with its
DNA being present in 88% of cancers13 and in the majority of the precursor lesions previously known as anal intraepithelial neoplasia.79 This nomenclature has been updated to squamous intraepithelial lesions (SIL) of the anus; low grade (LSIL), analogous to AIN I, or high grade (HSIL), analogous to AIN
II/III.80 Much research has been done to attempt to elucidate the molecular mechanisms by which HPV is involved in the development of AIN with subsequent progression to SCC. It is hoped this knowledge can then be exploited to offer novel therapeutic options. As so much knowledge is lacking, parallels are often drawn from what is known regarding other HPV-related cancers, especially cervical cancer and head and neck SCC.
Most of the translational research in anal SCC has been directed at identifying prognostic and predictive biomarkers in the hope this might lead to the development of tailored individualised therapy and the ability to predict response to treatment, hence improving patient outcomes.
Finally, few pre-clinical models to test novel therapies have been reported for anal SCC. These include a cell line derived from a lymph node metastasis,81 two transgenic mouse models,82, 83 and a xenograft from a single
36 patient.84 The results of these diverse approaches to improving our knowledge and treatment options for patients with anal SCC will be discussed.
Role of the Human Papillomavirus
Human Papillomavirus Genome Structure and Function
The HPV genome is a double-stranded circular DNA which becomes integrated into the host genome of stratified epithelial cells. HPV DNA integration may occur in HSIL with the frequency increasing in malignant lesions, although the latter may contain a mixture of integrated and episomal DNA.85 Its genome encodes for early structural genes (E1, E2, E4, E5, E6 and E7) involved in viral replication and late structural genes (L1-L2). In fact, the L1 capsid protein has been exploited in creating effective vaccines for prevention of infection with
HPV, including a new nonavalent vaccine which protects against nine HPV subtypes.86 More than 150 HPV types have been identified with varying potential for carcinogenesis, the most high-risk being HPV16. This potential is at least partly attributed to the expression of the E6 and E7 oncogenes and their respective oncoproteins. These have been demonstrated to be necessary but not sufficient for immortalisation of cells and attainment of the malignant phenotype.87, 88
The functions of the HPV16-E6 and E7 oncoproteins and their many pathways of action have been summarised elsewhere,85, 87 and only the most
37 pertinent ones are discussed here. Particularly important is their targeting of the products of the tumour suppressor genes (TSG), p53 and retinoblastoma
(RB). Briefly, the E6 oncoprotein binds to and promotes degradation of the p53 protein.89, 90 Consequently, p53’s abilities to induce growth arrest and apoptosis are attenuated.91 It has been purported that this is functionally akin to a p53- inactivating mutation.90
The E7 oncoprotein acts as an efficient cell cycle deregulator. In its quiescent state, pRb (retinoblastoma protein) is hypophosphorylated and associated with E2F transcription factor molecules (in heterodimer complexes), thereby inhibiting their transcriptional activity. Mitogenic signals activate D- type cyclins, which in turn phosphorylate pRb in the mid-G1 phase of the cell cycle. This releases the E2F heterodimer, allowing progression through this restriction point of the cell cycle, and subsequent cell proliferation via the transcription of relevant genes. When E7 forms complexes with pRb, the latter is degraded, ultimately mimicking phosphorylation of pRb and allowing progression into the S phase of the cell cycle.85, 92
It is hypothesised that ultimately a series of epigenetic and genetic changes in the human genome must occur and act in concert with HPV oncogenes to lead to the development of anal SCC.85
38 HPV Pathways to Cancer
The overwhelming prevalence of HPV in AIN and anal carcinoma has been confirmed in a meta-analysis involving 93 studies. HPV was identified in 93.9% of AIN II/III and in 84.3% of anal SCCs.79 Another systematic review found
85.1% of SCCs to be positive for HPV16, and only 7.2% for HPV18, the two most common genotypic forms of HPV which confer a high risk for the development of carcinoma.3, 19 These data suggest that HPV infection, especially with these high-risk subtypes, is an initiating event in the transformation of anal epithelia towards malignancy.
Despite the high prevalence of these HPV subtypes in the precursor lesions, the rate of progression to cancer is relatively low. The natural history of
AIN has been examined by Watson et al. in a cohort of 129 patients. They found a 13% progression of AIN II or III to SCC over 5 years.93 Importantly, progression to invasive cancer has been demonstrated to be much higher in immunocompromised patients, including those who are HIV positive.94
Nevertheless, most patients infected with HPV do not develop cancer.
Why is there such a large discrepancy between the presence of HPV and cancer rates? The answer to this is unresolved. There is a paucity of knowledge specifically addressing this subject in anal cancer; hence what is known has been inferred from literature concerning the most common HPV-mediated disease, cervical cancer and its precursors. A cell-mediated immune response results in an apparent clearance of HPV infection in most immunocompetent
39 patients.95, 96 It has been clearly demonstrated that 50% of infections are reduced to undetectable levels by 6 to12 months, and more than 90% within a few years.
For those with persistent infection, the probability of progression to cervical intraepithelial neoplasia (CIN) and invasive cancer is increased.97 While the precise details of this ability to reduce infection are unknown, the mechanisms for immune evasion have been more clearly described.98
HPV Mechanisms for Immune Evasion
HPV can escape usual surveillance by the immune system via a variety of mechanisms, only some of which are mentioned here.85, 98 The keratinocyte is the target cell of the human papilloma virus. As such, the infectious cycle is tailored to take advantage of the differentiation program of these cells. As the keratinocyte matures towards a terminally differentiated squame, it is programmed for death and desquamation. During this process the virus replicates and is released when the cell dies. As the cell death is from a natural physiological process, there is no accompanying inflammation to warn the immune system that the virus is present, resulting in a persistent, chronic infection.
Consistent with other DNA viruses, the high-risk human papilloma viruses have evolved mechanisms to inhibit Interferon (IFN) synthesis and signalling, which would normally act as a very effective antiviral defense system. This latter action is mediated by the HPV16-E6 and E7 oncoproteins.98
40 It has also been demonstrated that E6 can reduce the levels of E-cadherin on the surface of keratinocytes. Since adhesion to antigen presenting cells is mediated by E-cadherin, this property of E6 further promotes survival of the virus by limiting presentation of viral antigens to the immune system.99, 100 By reducing the expression of transporter associated antigen protein 1 (TAP1), the
E7 oncoprotein interferes with antigen presentation and the response by cytotoxic lymphocytes.85
It is likely that the HPV-related oncoproteins are also involved in the dysregulation of immune checkpoints, which are currently an exciting focus of targeted therapy using checkpoint blockade.101-103
Role of Human Immunodeficiency Virus
The significantly increased risk of HPV-mediated progression to anal SCC in those with human immunodeficiency virus (HIV) has been a matter of great interest. Anal SCC develops up to two decades earlier in HIV-positive men, with persistence of HPV infection considered to be one of the contributing factors.104 More advanced immunosuppression, as evidenced by lower CD4 counts, have been demonstrated to increase the risk of anal SCC within the HIV population.8
The exact mechanisms by which HIV-mediated altered immune status contributes to HPV-mediated progression are not well elucidated, although
41 deficient lymphocyte response to E6 and E7 proteins and changes in antigen- presenting cells are considered contributing factors.104, 105 Nonetheless, this association of immunosuppression and progression from HPV infection to anal
SCC supports the notion of immune targeting in prevention and therapy.
Role of Tumour Suppressor Genes
Loss of Heterozygosity
Expression of the E6 and E7 oncogenes are not sufficient for cancer progression.
Loss of heterozygosity (LOH) is a mechanism of genomic instability, which leads to inactivation of TSGs. A review by Gervaz et al. summarised the findings of the few studies investigating the molecular biology of SCC of the anus, all of them consisting of fewer than 20 patients. The consistent finding amongst a combination of cytogenetic,106 comparative genomic hybridisation107 and polymerase chain reaction/sequencing108, 109 studies was LOH on chromosome 11q. This region has also been highlighted in the molecular biology of cervical intraepithelial neoplasia (CIN) and cervical cancer.110, 111
Further evidence of LOH at this site and/or 18q was found in in vitro studies and was shown to be required for HPV-mediated immortalisation of keratinocytes.112, 113
Other identified sites of LOH in anal cancer include chromosome 17p
(p53 TSG), chromosome 5q (Adenomatous Polyposis Coli TSG) and 18q
42 (Deleted in Colorectal Carcinoma TSG), albeit in one and two small studies respectively.108 Thus it can be concluded that there may be a TSG on chromosome 11 that is important for progression of anal SCC, but that multiple gene mutations are ultimately required for carcinogenesis. This accumulation of genetic alterations takes time, accounting for the lag of up to five decades between the appearance of AIN and invasive anal cancer.104
p53 Tumour Suppressor Gene
In 2010, Lampejo et al. published a systematic review of 29 prognostic biomarkers from 9 functional classes reported in 21 studies of anal cancer between 1991 and 2009 (Table 1.5). Sixteen of the 29 biomarkers demonstrated no prognostic significance in one or more studies. The only biomarkers shown to have prognostic significance in more than one study were p53 and p21.114
The tumour suppressor gene, p53, is involved in cell cycle regulation and apoptosis and is overexpressed in anal carcinomas.115 Of the eight studies investigating p53 expression using immunohistochemistry, one demonstrated a reduced disease-free survival,116 and another, reduced local tumour control, in tumours with higher p53 expression.117 The report from the Radiation Therapy
Oncology Group (RTOG)-8704 randomised trial found a trend towards increased locoregional failure rates in tumours with p53 expression, although this was not statistically significant.118 In 2004, The United Kingdom
Coordinating Committee on Cancer Research Anal Cancer Trial I (UKCCCR
43 ACT I) reported that p53 expression predicted a poorer cause-specific survival in an analysis of 240 patients.119 Five separate studies did not demonstrate any prognostic significance. Lack of p21 expression correlated with reduced overall survival in one study,120 and a higher locoregional failure rate in a second study,121 out of a total of 3 studies between 2001 and 2006.
The issue of p53 mutations in anal SCC has not been comprehensively investigated. Patel et al. reported the largest series of 119 patients of which 5
(4%) had mutations in exon 5 identified by direct sequencing. Using IHC, nuclear accumulation of p53 was identified in 91% of their samples. The authors predict the accumulated protein is wild-type but this remains to be clarified.122
44 Table 1.5 Biomarkers studied in Anal Cancer 114
Prognostic significance
Tumour suppressor gene p53 p53 expression associated with reduced local tumour control 117 and reduced DFS 116, 117 p21 Absent p21 expression associated with reduced OS 120 and increased LRF 121 p27 No prognostic significance p16 No prognostic significance pRb No prognostic significance
EGFR (TK protein)
EGFR/HER-1 HER-1 Highly expressed 123-125, no correlation with DFS HER-2 HER-2 Not expressed
Regulator of apoptosis
NF-kB High expression associated with reduced DFS 125 Bax No prognostic significance Bcl-2 Expression associated with improved local tumour control and DFS 117 Mcl-1 No prognostic significance M30 Expression associated with reduced local tumour control and DFS 117
Cyclins
Cyclin A High expression associated with increased tumour-specific & OS 121 Cyclin D1 No prognostic significance Cyclin E No prognostic significance
Proliferation & Invasion
Ki67/MiB1 Ki67 independent predictor of DFS 125 Ki67/MiB1 index High Ki67/Mib1 index associated with increased CFS 126 PCNA No prognostic significance MCM7 High expression associated with improved RFS and CSS 127 nm23 No prognostic significance Cathepsin D No prognostic significance
Angiogenesis
VEGF No prognostic significance MVD No prognostic significance CD31 No prognostic significance
Tumour-specific markers
SCC Antigen High expression associated with reduced tumour-free survival and OS 128 CEA No prognostic significance
Hedgehog signalling
SHH Overexpression of both associated with reduced DFS 125 Gli-1 Overexpression of both associated with reduced DFS 125
Telomerase hTERT No prognostic significance
Abbreviations: TK, Tyrosine kinase; NF-κB, Nuclear factor-κB; PCNA, Proliferating cell nuclear antigen; MCM7, Minichromosome maintenance protein 7; nm23, non-metastatic protein 23; RFS, relapse-free survival; CSS, cancer- specific survival; VEGF, Vascular endothelial growth factor; MVD, Microvessel density; CD31, Cluster of differentiation 31; CEA, Carcinoembryonic antigen; SHH, Sonic hedgehog; hTERT, Human telomerase reverse transcriptase
45 Role of Oncogenes
Epidermal Growth Factor Receptor
Epidermal growth factor receptor (EGFR) expression has been identified in multiple epithelial cancers, where its activation and/or over-expression can stimulate cell growth (Figure 1.3). Overexpression also correlates with poorer prognosis in several cancers.129 The small G-protein Kirsten-ras (K-ras) acts downstream of EGFR and is required for EGFR signal transduction. Cetuximab, a monoclonal antibody against EGFR, is currently in use as combination therapy for treatment of several cancers, especially squamous cell cancers of the head and neck.130
With this clinical application in mind, the expression of EGFR in anal
SCC has been investigated more than most other biomarkers. Utilizing a combination of IHC and fluorescent in situ hybridization (FISH), EGFR was found to be expressed in 55% to 100% of patient samples across seven studies.50,
123-125, 131-133 Paliga et al. identified EGFR protein expression in 91% of 79 patient samples. This study also tested for EGFR and K-RAS mutations using high resolution melting analysis (HRMA). At the most common sites for EGFR mutations in exons 19 and 21, there were 0 of 89 and 3 of 89, respectively, that were positive. These three samples were found to have the same single nucleotide polymorphism when sequencing was subsequently performed. No
K-RAS mutations were found in the 89 samples.132
46 The presence of only wild-type K-RAS in anal SCC has also been observed in a larger study of 153 patient samples.50 This is encouraging with regards to the potential for the use of anti-EGFR targeted treatments, as it is now well established in colorectal cancer patients that those with mutant K-
RAS have poor response rates to such therapies.134
EGFR
PTE PI3K Cell growth N
Cell cycle control
HPV16-E7 pRb AKT Survival
Proliferation
Abbreviations: PTEN, phosphatase and TENsin homologue; PI3K, phosphatidylinositol 3 kinase; pRb, retinoblastoma; AKT, protein kinase B
Figure 1.3 PI3K/AKT pathway
PI3K/AKT Pathway
The PI3K/AKT pathway is frequently hyperactivated in human cancers and has hence received considerable attention as a potential therapeutic target.135 It is a major downstream target of the tyrosine kinase receptor family, which includes
47 EGFR. Downstream of PI3K, phosphorylation of the serine threonine kinase
AKT leads to its activation with subsequent phosphorylation of its substrates.
This ultimately triggers multiple responses in the cell including cell growth and proliferation136, 137 (Figure 1.3). The tumour suppressor gene PTEN negatively regulates the PI3K/AKT pathway.138
Previous reports of the clinical importance of this pathway include its frequent activation in HPV-related head and neck cancers, its identification as an independent predictor of outcome and its association with resistance to radiation.136 Another study looking at cervical cancer has demonstrated that inactivation of pRb by HPV16-E7 can also upregulate AKT activity.139
Few studies have specifically addressed the role of the PI3K/AKT pathway in anal SCC. In 2007, Patel et al. reported a cohort of 128 anal SCC patients, in which 66% had cellular accumulation of phosphorylated AKT, with significant correlation between HPV infection and activated AKT. They proposed that this activation is an important part of anal SCC carcinogenesis.122
Martin et al. found mutations in PIK3CA, the gene encoding the alpha catalytic subunit of PI3K, in 16% of a cohort of 84 anal SCC patients using sequencing analysis as part of their attempt to characterize the EGFR pathway in this disease. EGFR gene copy number was increased in 34%. The implications of their findings are that although some patients may have elevated EGFR, downstream mutations may confer resistance to targeted EGFR therapy.140
48 In addition, the PIK3CA gene is located on chromosome 3q.
Chromosomal 3q gains have been identified in HPV-positive cervical cancer 141 and anal cancer 142 as well as their associated premalignant lesions.
Given the multiple compounds available that target the PI3K/AKT pathway, some of which are in clinical trials,135 further investigations into this pathway’s role in anal SCC tumorigenesis may identify a place for therapeutic application.
Role of Regulators of Apoptosis
Bcl-2 is one of several members of the Bcl-2 family of proteins which inhibit apoptosis, hence promoting tumour cell survival. While 3 studies have reported on Bcl-2 expression in anal SCC,117, 123, 125 only one identified a significant association with improved local tumour control and disease-free survival, with
58% of 98 patient samples demonstrating biomarker positivity.117 This finding seems counterintuitive. However, a similar correlation with positive outcomes has been found in other solid tumours, namely cervical carcinoma with its similar HPV-associated pathogenesis.143
HPV-E6 has been implicated in activation of nuclear factor-κB (NF-κB) which is a nuclear transcription factor whose target genes include the inhibitors of apoptosis proteins (IAP) such as cIAP-2 (Figure 1.4).144, 145 Only one study has investigated expression of NF-κB in anal SCC using IHC in 30 patient samples.
49 Those with increased expression had a reduced disease-free survival
(P=0.002).125
Similarly survivin, also a member of the IAP family of proteins, is transactivated by HPV-E6, resulting in suppression of apoptosis (Figure 1.4).146
Using IHC staining in the pre-treatment biopsies from 62 anal cancer patients,
Fraunholz et al. found patients with low survivin staining had a statistically significantly higher rate of distant metastases free-survival, with a median follow-up time of 68 months.147 They purport that it may be used as a marker to predict patients at risk of metastatic disease and speculate that for those anal cancer patients with high survivin expression, drugs that target survivin such as LY2181308148, 149 and YM155150, 151 may offer a novel treatment option.147
Induction of transcription of cIAP-2 Activation
of NF-κB
HPV-E6 oncoprotein Transactivation P53 of Survivin promoter
Suppression of Control of cell apoptosis division
Abbreviation: cIAP-2, cellular inhibitor of apoptosis protein-2
Figure 1.4 Pathways of inhibition of apoptosis via HPV-E6
50 Role of Other Factors
Sonic Hedgehog Signalling Pathway
The sonic hedgehog glycoprotein is involved in a complex signal transduction pathway regulated by the Gli-1 transcription factor.152 In anal SCC, overexpression of both SHH and Gli-1 has been shown to be a predictor of reduced disease-free survival,125 on a background of a known association between SHH signalling and resistance to chemoradiation in other cancers.153, 154
Vascular Endothelial Growth Factor
VEGF receptors have been targeted as anti-cancer therapies on the premise that their interaction with VEGF promotes neovascularisation of tumour required for invasion and metastasis.155 However, there was no significant correlation with patient survival in 2 studies investigating VEGF expression in anal SCC.116,
125
Pre-Clinical Models
Perhaps one of the reasons that limited progress has been made in understanding the underlying molecular and cellular mechanisms of carcinogenesis in anal SCC compared to other solid tumours is the lack of appropriate in vitro and in vivo model systems for studying anal SCC. Human tumour cell lines can be used for many purposes including the study of cell
51 growth, differentiation, apoptosis and metastasis. Most importantly from a translational research viewpoint, they can be used to undertake drug susceptibility studies. Grown in vitro, they are an efficient and cost-effective way to investigate the response of tumour cells to drugs. Furthermore, by using the cell lines to grow xenograft tumours in experimental animals, they can be a valuable preclinical tool for the in vivo testing of potential therapeutic compounds.
Patient-derived tumour xenografts (PDTX) are generated from fresh human cancer tissue which is freshly implanted into immunocompromised mice, usually subcutaneously, and allowed to grow. The engrafted tumours can be serially passaged into more mice to create cohorts of mice to be used for in vivo testing of human cancer.
Alternatively, transgenic mice can be genetically engineered to develop disease endogenously thus modelling human tumour development. These three types of models will be discussed in relation to anal SCC.
A Single Cell line
In 2009, Takeda et al. published the first and only report of an anal SCC cell line,
SaTM-1.81 This was derived from primary culture of a lymph node metastasis from a patient undergoing inguinal lymphadenectomy for known anal SCC.
There was no comment with regard to the patient’s HPV status. The SaTM-1 cell line was demonstrated to produce tumours in immunodeficient mice after
52 20 days. The tumours were confirmed as well-differentiated SCC by microscopy and immunohistochemistry staining for p63, an important marker of squamous differentiation.81 Although the SaTM-1 cell line has been deposited in a public cell line bank for use by outside investigators,81 to date, I have not identified any literature in which it has been utilized.
Mouse Models: Transgenic and Patient-derived tumour xenograft models
Two transgenic mouse models have been reported for anal SCC. The first, reported by Stelzer et al. in 2010 82 uses K14-HPV16 transgenic mice described by Arbeit et al.,156 to target E6 and E7 oncogene expression in stratified squamous epithelia, analogous to HPV infection in humans.157, 158
K14-driven E6/E7 transgenic mice did not spontaneously develop anal
SCC. However, with topical application of a known chemical carcinogen, dimethylybenz[a]anthracene (DMBA), to the anus of these HPV16 transgenic mice for 20 weeks, 23% (7 of 31 mice) developed anal cancer as confirmed by histopathologic analysis. A further 29% developed atypia, which the authors state is analogous to AIN in humans.
The HPV16 transgenic mouse model has since been used to investigate the role of the individual oncogenes E6 and E7. Treatment of the mice with
DMBA resulted in anal carcinomas in 85% of mice expressing K14E7, either alone or in combination with K14E6, while only 18% of mice expressing K14E6 alone and 10% of non-transgenic control mice developed frank cancer. They
53 concluded that E7 is the more potent oncogene in HPV-associated anal cancer.159 The same group has also reported the first patient-derived tumour xenograft (PDTX) for anal cancer using fresh tumour biopsy sourced from a
HIV-seropositive male who was treatment naïve. The HPV-positive tumour grew in both Severe Combined Immunodeficiency Disease (SCID) and Nude mouse strains, and retained histopathologic features of poorly differentiated
SCC over subsequent passaging.84 Activation of the PI3K/mTOR pathway in
SCCs from the doubly transgenic K14E6/E7 mice and in the PDTX model was confirmed by IHC staining of pAKT and pS6, two biomarkers commonly used to detect activation of this pathway.84 While treatment with the mTOR inhibitor
Rapamycin appeared to reduce the number of tumours that developed
(including papillomas, atypia and cancers), the reduction was not statistically significant.
Established tumours in the K14E6/E7 mice were also treated with
Rapamycin and, while the incidence of tumours was similar between treated and untreated groups, the rate of tumour growth was significantly slower in the
Rapamycin-treated mice (p=0.01). This growth inhibition was further validated in the PDTX model when intraperitoneal Rapamycin was used to treat the mice.84 These studies provide evidentiary support for further investigation into the use of mTOR inhibitors in anal cancer treatment, particularly in combination with other therapeutic regimens.
54 The second transgenic mouse model has been described by Sun et al. using a Tamoxifen-inducible K14-Cre transgene to generate a combined deletion of the TSGs, transforming growth factor-β receptor I (Tgfbr1) and Pten.
K14-cre-mediated deletion of Tgfbr1 and Pten resulted in anal SCC in 33.3% of these mice. Activation of the PI3K/mTOR pathway was once again demonstrated by immunostaining of pAkt and pS6 biomarkers in the tumours and Rapamycin treatment significantly reduced the incidence and tumour volume compared to the vehicle group. However, the very low incidence of anal tumours in this model, and the concomitant development of head and neck cancers requiring euthanasia at 16 weeks,83 may limit the use of this model for the investigation of anal SCC.
Clinical Intervention
Advances in the management of any tumour fundamentally rely upon an enhanced understanding of its molecular biology. Due to the relative rarity of anal SCC, research has not been as forthcoming as for other more ‘popular’ cancers.
To date, advances in knowledge have been somewhat limited with only small studies in diverse populations feasible. The International Rare Cancers
Initiative has acknowledged relapsed/metastatic anal cancer as one of nine rare cancers worthy of further research.160 However, this era of emerging molecular
55 targeted therapies offers an opportunity for a novel approach to this disease for which no significant treatment improvements have been made in forty years.
Some encouraging findings are coming to light. Our understanding of HPV and its oncogenes has led to the production of a successful vaccine against HPV.
This should begin to impact on the rates of anal cancer over the next two decades.
With regard to specific molecular mechanisms of clinical value, while
Gervaz et al. offer a proposed model of anal carcinogenesis in immunocompetent patients based upon necessary HPV-DNA integration and
LOH at multiple chromosomal sites,104 a potential prognostic marker or therapeutic target has not emerged. On the other hand, by exploiting this HPV- driven disease progression, immunotherapy offers a promising platform.161
A live attenuated Listeria monocytogenes (Lm-)based immunotherapy,
ADXS11-001, is currently being evaluated for treatment of cervical cancer and anal SCC in Phase I/II clinical trials (Table 1.6). Exploiting millennia-old evolution of the human immune system to reject Lm infection, this construct secretes a protein fused to HPV-16 E7, with subsequent stimulation of a cell- mediated immune response. This has been demonstrated to impact on outcomes in pre-clinical models.
In early clinical studies, mild to moderate adverse effects have mostly been consistent with cytokine release indicating immune activation. No listeriosis infections have been noted due to this live vaccine.161, 162 Nonetheless,
56 this vaccine would not be suitable for use in immunocompromised patients, including those with HIV, due to its attenuated nature.
Immune checkpoint modulation immunotherapy has also rapidly evolved with the successful use of immune checkpoint inhibitors in multiple cancers, particularly melanoma. Programmed cell death protein 1 (PD1) is one such immune checkpoint receptor, which, in simplistic terms, dampens the immune response in tissues and tumour. Expression of the PD1 ligand (PDL1) for this receptor corresponds with poorer prognosis in many cancers.101
In anal cancer, only a small study has shown a trend towards a worse recurrence-free survival in tumours expressing PDL1.163 Checkpoint kinase 1
(CHK1) is a further target; a Phase 1 trial of the CHK1 inhibitor LY2606368 as monotherapy was completed in a cohort of 45 patients with advanced solid tumours. However, only three of the patients had anal SCC, with one of them obtaining a partial response and the other 2 patients achieving disease stability.
As the only other partial responder had SCC of the head and neck, and almost half of those with stable disease also had SCC, dose-expansion studies are planned for patients with only SCC.164
57 Table 1.6 Immunotherapy-based trials for treatment of anal SCC and
cervical cancer
Trial name n Title Current status
A Phase I/II Evaluation of Ongoing, not recruiting BrUOG 276 ADXS11-001, Mitomycin, 5- Last updated July 2017 NCT01671488 25 fluorouracil and IMRT for Anal (Last verified July 2017)
Cancer
A Phase II Evaluation of Ongoing, not recruiting ADXS11-001 (NSC 752718) in the Last updated August 2017 GOG-0265 Treatment of Persistent or (Last verified August 2017) NCT01266460 67 Recurrent Squamous or Non- (Phase II) squamous Cell Carcinoma of the Cervix
ADXS11-001 immunotherapy Presented at ASCO 2014: targeting HPV-E7: Final results 36% 12 month survival, (Phase II) 165 110 from a phase 2 study in Indian 28% 18 month survival, and women with recurrent cervical 11% response rate cancer
Lampejo et al. discuss the need for further clarification with regards to p53 and p21 expression in anal SCC, but indicate their potential as future therapeutic targets via examples of targeted treatment trials in oesophageal
SCC and hepatocellular and colorectal cancers.114 Overall there is very much an inconsistency in the data with regards to these two biomarkers in anal SCC which calls into doubt any potential as clinically useful prognostic markers.
There exist two targeted therapies directed at the inhibitor of apoptosis, survivin,148-151 which is expressed in anal SCC. More studies to clarify its role in
58 this disease are required but it may offer a promising target as part of multimodality therapy or for disease relapse.
The addition of cetuximab to standard CRT for anal cancer is actively being investigated. Thus far, the experience with cetuximab has been variable with two studies ceased prematurely due to very high toxicity rates.62, 166 The results of further studies are awaited, including one utilizing Panitumumab, another monoclonal antibody specific to EGFR (Table 1.4).
Only one study has been published reporting the use of cetuximab in seven patients with metastatic anal SCC. The five patients with wild-type K-
RAS tumours had partial or minor remissions, or stable disease in their previously rapidly progressive tumours, while the 2 patients with K-RAS mutations had disease progression whilst on cetuximab. Therefore cetuximab may emerge as a first-line therapy option for those with metastatic disease or after failed standard therapy,167 similar to the experience in management of head and neck SCC.168, 169 Other EGFR inhibitors may emerge with improved safety profiles when combined with standard CRT. There is also hope for this category of drugs for use in relapsed disease or palliation as a single agent or in combination with other novel therapies.
In the meantime, there is increasing understanding regarding the role of the EGFR and PI3K/AKT signalling pathways. There are also multiple PI3K inhibitors currently in clinical trials for other tumours. However, for anal SCC, the details of this pathway’s involvement are only just beginning to be
59 elucidated. Thus far, no predictive or prognostic markers have been identified which are useful in clinical practice.
Next Generation Sequencing and Immune Markers
Biopsies of anal cancers have been utilized to perform gene expression profiling with techniques such as next generation sequencing which can provide critical information regarding multiple genetic factors within both normal and tumour tissue.
Smaglo et al. undertook multiplatform profiling, which consisted of testing 199 anal SCC specimens with a combination of gene sequencing, IHC, and in situ hybridization. Tumour samples included pre-treatment biopsies and recurrent tumours. EGFR expression was identified in 89% of samples, with no mutations, with PIK3CA and p53 mutations found in 33% and 15% of samples respectively.170 Similarly, PIK3CA mutations were also found in 40% of 70 anal cancers using a 236 gene hybrid-capture-based next generation sequencing panel, and a further 14% of tumours had loss of expression of PTEN. Positive
HPV status was seen in 87% of tumours. HPV negative tumours were more likely to have loss of function mutations in p53 and CDKN2A.171
Cacheux et al. utilized 148 anal SCC samples, which included 52 recurrences following definitive CRT. Eight genes were sequenced including
PIK3CA and TP53. Mutations of PIK3CA were identified in 20.3% of tumours.
60 Interestingly, seven recurrent tumours which were predominantly HPV negative harboured TP53 mutations. For those patients who underwent salvage abdominoperineal resection, overall survival was significantly higher in those with PIK3CA mutations (p=0.037).172 Although these more sophisticated techniques of identifying mutations have served to confirm previously reported findings, this study has demonstrated a potential benefit for the adjuvant use of
PIK3CA/Akt/mTOR inhibitors in tumours carrying the PIK3CA mutation.
Furthermore, immune markers have recently been explored for prognostication purposes. Expression of PD1, PD-L1 and CD8+ tumour infiltrating lymphocytes (TILs) was assessed with IHC in 150 patients with anal
SCC. Those tumours with higher HPV16 viral load had stronger staining for immune markers. Statistically significant improved local control and DFS was found in tumours with high frequency of CD8+ TILs and PD1 expression. These findings give further support to ongoing investigation into the use of checkpoint blockade in the context of clinical trials.173
The critical role of the immune system in this disease is again brought to the fore. Despite some advances in identification of novel targets, this review highlights the distinct lack of robust pre-clinical models for anal SCC in the form of cell lines or patient-derived tumour xenografts to test targeted therapies. The limitations of the single cell line available and the current mouse models described have been discussed. Nonetheless, further work to advance this type of modeling, as well as gene profiling, should be at the forefront of
61 research for this disease. The PDTX models may serve a dual role in providing an ongoing source of tumour tissue for molecular and genetic testing while also providing a resource for testing novel therapies.
Conclusion
The role of HPV infection in the development of anal SCC is accepted. The molecular aspects of this malignancy are becoming clearer, particularly with regards to the EGFR and PI3K/AKT signalling pathways. Immunotherapy represents an exciting development with further studies specific for anal SCC required. Further progress is hindered by a lack of reliable pre-clinical models to test these emerging translational opportunities and should be a focus of further research.
62 1.4 Aims and Hypotheses
Despite definitive chemoradiotherapy becoming established therapy for anal
SCC over the last forty years, prediction of patient response remains challenging. The use of FDG-PET is increasingly being utilized in pre-treatment staging although its use in assessing patient response to treatment is not routine practice as its utility is still being investigated. Data to investigate this use in suitably large cohorts of patients is lacking. Similarly, there is a relative scarcity of data describing broad patterns of failure and outcomes in anal SCC, with most data focusing on locoregional recurrence and salvage APR outcomes only.
These issues are addressed with analysis of a retrospective database of patients with anal SCC, treated in a single institution over a thirty year period.
The aims of analysis of this database were:
1. To assess response after definitive chemoradiotherapy for anal SCC by
FDG-PET
2. To describe patterns of treatment failure for anal SCC, subsequent
treatment and outcomes
63 To explore the molecular biology of anal cancer, three research aims were proposed for this study.
1. To identify genes of potential predictive and prognostic significance
which may offer a targeted therapy option.
2. To establish a patient-derived tumour xenograft program to act as a pre-
clinical model for testing potential new therapies
3. To utilise the xenografts as a pre-clinical model to test identified novel
targets.
64 Chapter 2: Materials and Methods
2.1 List of reagents
Table 2.1 List of reagents
Reagents Supplier
ThermoFisher Scientific, Waltham, RNAlater® Massachusetts, USA
Qiagen, DNAse & DNAse buffer & Stop solution Hilden, Germany
Promega, M-MLV Reverse Transcriptase & M-MLV buffer Madison, Wisconsin, USA
Promega, dNTPs Madison, Wisconsin, USA
Applied Biosystems, Foster City, Fast SYBR® Green PCR Master Mix California, USA
2.1.1 General solutions
Chemicals such as sodium chloride, sodium citrate, Tris base, Tween 20, phosphate buffered saline (PBS) and others were of standard analytical grade and purchased from standard commercial suppliers including Medisa, BDH,
Sigma and Amresco.
65 Anal cancer tissue was embedded in BD MatrigelTM basement membrane matrix (BD Biosciences, Franklin Lakes, NJ, USA) prior to implantation into immunocompromised mice for PDTX development. Tissue obtained from anal
SCC PDTXs was cryopreserved in FCS/10%DMSO.
2.1.2 Oligonucleotides
The oligonucleotide sequences (5’-3’) used for this study are shown in Table 2.2.
All oligonucleotides were synthesized by Integrated DNA Technologies.
Table 2.2 Oligonucleotides
Oligonucleotides for qRT-PCR Forward primer (5’-3’) Reverse primer (5’-3’) Human GAPDH CCTCCTGTTCGACAGTCAGC ACGACCAAATCCGTTGACTCC
β2-microglobulin TGGAGGCTATCCAGCGTACT CGGATGGATGAAACCCAGACA
Myb AGTCAATGTCCCTCAGCCAG TGGTTCTGTGTCTGCTGTCC
Bcl-2 CAGGATAACGGAGGCTGGGATG GACTTCACTTGTGGCCCAGAT
Pim1 CGAGCATGACGAAGAGATCAT TCGAAGGTTGGCCTATCTGA
Grhl1 AGTACGACAACAAACGGCCA CATCATCGCTTTGGTCGCTG
Ivl AGCCTTACTGTGAGTCTGGTTG GGAGGAACAGTCTTGAGGAGC
Hes2 TCACAAGTCCCACATCCTGC AGACATGGGAGCCTTTTCCC
Notch2 CCCTTGCCCCCCATTGTGAC CTGTGCTGTGAAGGGGGTGTG
Tom1 ACAGATGACAAACCCCTTGC ATCTTTGGGACCTTCCTCCGT
66 2.1.3 Antibodies
Table 2.3 Immunohistochemistry Antibodies
Antibody Species Supplier Catalogue #
MYB 1.1 Rabbit Abcam ab45150
GRHL1 Mouse *Made in-house N/A
PIM1 Rabbit Abcam ab75776
BCL-2 Mouse Dako-Agilent M0887
Anti-human mitochondrial Mouse Millipore MAB1273
*Department of Medicine, Monash University, Alfred Hospital, Melbourne
2.1.4 Cell Culture Reagents
Table 2.4 Digestion Media
Name Supplier (Catalogue number)
Collagenase I powder Worthington (LS004196)
Hyaluronidase powder Sigma Aldrich (H3506)
DNase1 Sigma Aldrich (D4263)
Dispase Gibco (17105-041)
Fetal calf serum (FCS) Gibco (16030074)
Accumax Innovative Cell Technologies (AM105)
67 Cell lines were maintained in culture media (Table 2.5) supplemented with
HEPES (prepared by the Media Kitchen at Peter MacCallum Cancer Centre).
Table 2.5 Culture Media
Name Supplier (catalogue number)
DMEM Gibco (11965-092)
RPMI-1640 Gibco (11875-093)
EpiGRO™ Merck (SCMK001)
68 2.2 Methods
2.2.1 Anal Cancer Database
A retrospective review of hospital records was undertaken of patients with localized SCC of the anal canal or margin treated with definitive chemoradiotherapy at the Peter MacCallum Cancer Centre between February
1983 and January 2013. Approval for data collection was obtained from the institutional ethics committee. Tumours were staged according to the AJCC, 7th
Edition (Table 1.1).32 For those who had follow-up and/or subsequent surgery at other institutions or privately, further information and records were obtained from those institutions or medical practitioners as appropriate and for as many patients as possible.
2.2.2 Anal Cancer Tissue Bank
Eleven patient samples were obtained from the Peter MacCallum Anal Cancer
Tissue Bank. This Tissue Bank contains samples of tumour taken directly from patients while under general anaesthesia prior to any treatment. Informed consent was obtained prior to this procedure using the ‘Participant Information and Consent Form’. Patient details and clinical data relating to their tumour were recorded and stored securely by the Clinical Research Co-ordinator. Such data includes HPV status, tumour stage (T-stage) and nodal status (N-stage).
69 Tissue obtained at the time of EUA was processed in two ways; some of the tissue was stored in RNAlater® solution at -80 C, while a separate segment of tissue was processed into a paraffin block (section 2.2.6.2.1).
2.2.3 RNA extraction and sequencing
2.2.3.1 RNA extraction of tissue
The eleven patient samples were initially placed in RNAlater® solution and stored at -80 C until accessed. The Ambion mirVana™ miRNA isolation kit was used to extract RNA. The RNA concentration and quality was checked with the
NanoDrop spectrophometer (Thermo Fisher Scientific, Waltham,
Massachusetts, USA).
2.2.3.2 RNA sequencing
Sequencing of the eleven samples was performed using standard protocols on the HiSeq2000 instrument (at the Australian Genome Research Facility).
Computational resources were provided by the Bioinformatic core facilities at the Peter MacCallum Cancer Centre.
2.2.4 Bioinformatic analysis
Using the clinical data from the Tissue Bank, the eleven patient samples were stratified into groups based upon T-stage and N-stage. Using this clinical grouping and the RNA sequencing data, bioinformatic analysis was undertaken
70 using the program Galaxy to identify differential expression of genes for each group.
2.2.4.1 Comparisons of Gene Expression
Within the Galaxy program, several analyses were undertaken in the following sequence:
Raw reads were aligned to HG19-Human reference genome and Tophat
analysis undertaken resulting in eleven BAM files (one for each patient
sample)174
HTseq-count (SAM/BAM to count matrix) was used to create a count
matrix using the number of the reads from each BAM file175
EdgeR analysis providing normalized gene expression values for each
patient sample (Expression Matrix)176
EdgeR analysis on Expression Matrix resulting in a comparison between
groups (Differential Expression Matrix) expressed as logFoldChange
(logFC).176 This data was transferred to Excel and ranked by p-value.
2.2.5 RNA manipulation techniques
2.2.5.1 DNase Treatment
The concentration of RNA in each patient sample was determined using the
NanoDrop spectrophometer. This was then used to calculate the required volume of RNA to obtain the required 2μg of RNA. Residual DNA was
71 removed from each patient sample of RNA by the addition of distilled H2O, 1μl of DNAse buffer and 1μl/μg of DNAse to a final reaction volume of 10μl.
The reaction mixture for each patient sample was incubated at 37 C for
30 minutes. At the completion of incubation, 1μl of Stop solution was added.
This mixture was then incubated at 65 C for strictly 10 minutes.
2.2.5.2 Reverse Transcription and cDNA synthesis
The DNase-digestion mix (11μl containing 2μg of DNase-treated RNA) was placed on ice. For cDNA synthesis, the following were then added to the mix:
0.5μl random primers (500ng/μl; Promega) and 3μl H2O to make up to 14.5μl.
This was incubated at 70 C for 5 minutes. The mixtures were kept on ice until the addition of 5μl of 5x M-MLV buffer, 2.5μl of dNTPs (5mM) and 1μl M-MLV
Reverse Transcriptase (Promega). This mix was left at room temperature for 10 minutes and then incubated at 55 C for 5 minutes. After centrifuging at
13000rpm, the reaction was terminated by incubating at 70 C for 15 minutes.
The cDNA was stored at -20 C.
2.2.5.3 Quantitative Real-Time PCR
Quantitative real-time PCR (qRT-PCR) was used to quantify RNA expression of genes of interest. All primers utilized were designed using the NIH/NCBI
BLAST® website with standard nucleotide BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Nucleotides&PROGRAM=blast n&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFA
ULTS=on) and are listed in Table 2.2.
72 All reactions were undertaken using a StepOnePlusTM qRT-PCR detection system (Applied Biosystems). Samples were processed in triplicate using Fast SYBR® Green Mix (Applied Biosystems) and qRT-PCR primers
(Table 2.2). The cDNA was then amplified under the following conditions:
Expression of all genes were normalized for total cDNA using housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), except for the PIM1 gene for which the housekeeping gene Beta-2 microglobulin (β2M) was used to determine relative levels of mRNA transcripts.
2.2.6 Methods for protein analysis
2.2.6.1 Immunohistochemistry
2.2.6.1.1 Specimen fixation, embedding and sectioning
Tissue samples were fixed by incubation in 10% neutral buffered formalin for
24 hours before being transferred to 70% ethanol. The tissue was then placed into cassettes and given to the Microscopy and Histology Department at Peter
MacCallum Cancer Centre, which then performed all subsequent processing
73 including paraffin-embedding and microtome cutting. Sections were cut at either 2μm on poly-L-lysine coated slides for haematoxylin and eosin staining or 3μm on Superfrost Plus slides for immunohistochemistry staining. Following sectioning, all slides were incubated at 37 C overnight to bond to the glass.
2.2.6.1.2 Slide processing pre-antibody binding
Paraffin was melted by baking the slides at 60 C for 45 minutes. The slides were then de-waxed and rehydrated. For antigen retrieval, slides were incubated in either EDTA (1mM, pH 8) buffer or citrate (10mM, pH 6) buffer and placed into a Dako pressure cooker at 125 C for 3 minutes, and then allowed to cool to 90 C for 10 seconds. The slides were then cooled for a further 20 minutes prior to washing with MQH2O. The slides were then blocked in 3% (v/v) H2O2 for 10 minutes, followed by rinsing in Tris buffered saline (TBS) (pH 7.6) with 0.05%
(v/v) Tween 20 for 5 minutes in preparation for the addition of primary antibody.
2.2.6.1.3 Primary antibody binding and detection
To detect MYB, Myb antibody at 1:500 dilution was pipetted onto each section.
The slides were incubated for 1 hour at room temperature in a humid chamber.
For the detection of GRHL1 or PIM1, GRHL1 antibody at 1:250 dilution or PIM1 antibody at 1:2000 dilution was pipetted onto each slide which were then incubated as above. To confirm that tissue from the PDTXs was of human origin, anti-human mitochondrial antibody at 1:100 dilution was pipetted onto each section.
74 2.2.6.1.4 Detection and visualization of primary antibody using DAB
Slides were developed using the Dako Liquid DAB + Substrate-Chromogen for varying lengths of time. Slides were then washed in MQH2O then counter- stained with haematoxylin and Scott’s Tapwater. Slides were then dehydrated in increasing concentrations of ethanol before placing in histolene and then mounted with MM24 (Leica Biosystems) and cover slipped.
2.2.6.1.5 Immunohistochemistry for BCL-2
All slide processing for BCL-2 was undertaken by the Histology Department at
Peter MacCallum Cancer Centre. Immunohistochemical staining for BCL-2, 124 clone (Dako-Agilent, 1:50 dilution) was performed using the Ventana
Benchmark Ultra, with high pH epitope retrieval buffer using Ventana CC1 solution for 32 minutes, antibody incubation period for 32 minutes, and detection using the Ventana Optiview Detection kit (DAB based).
2.2.6.1.6 Quantitative Scoring of Immunohistochemistry Slides
Quantitative scoring of IHC slides was carried out according to the scoring shown in Tables 2.6A and B. Each slide was scored for extent and intensity of staining. The scores were then multiplied (Extent x Intensity) to give a score of 0 to 12. A score of 0 to 6 was considered low expression of protein, while a score of 7 to 12 was considered to represent high protein expression. Scoring was performed while blinded to the patient slide identification.
75 Table 2.6A Scoring for Extent of staining
Score 0 1 2 3 4
% Positive cells <10% 10-25% 25-50% 50-75% >75%
Table 2.6B Scoring for Intensity of staining
Score 1 2 3
Intensity of staining Weak Moderate Strong
2.2.6.2 Haemotoxylin and eosin staining
For haematoxylin and eosin (H&E) staining, slides were de-waxed in histolene for 4 minutes, followed by rehydration in decreasing ethanol concentrations
(100% x4, then 70% x2) and then placed into deionized water. The slides were then placed in haematoxylin for 2 minutes for staining and blued in Scott’s tapwater for 30 seconds. Counter staining was then undertaken with eosin, followed by dehydration back through the ethanol series in increasing concentrations. All slides were then rinsed in histolene, mounted with MM24 mounting media and cover slipped.
76 2.2.7 Animal husbandry and in vivo analysis
2.2.7.1 Mouse maintenance
All mice were bred at the Peter MacCallum Cancer Centre and included NOD- scid, NOD-scid interleukin-2 (IL2) receptor gamma chain knockout (NSG) and athymic nude mice. The mice were maintained in a pathogen-free environment with food and water freely available at all times. The growth of tumour xenografts was permitted by the Animal Experimentation Ethics Committee
(AEEC) under Permit Number E466. The investigation of novel therapies using the animal models of anal cancer was undertaken with AEEC approval, Permit
Number E512. All work was carried out in accordance with the National Health and Medical Research Council (NHMRC) Australian Code for the Care and use of Animals for Scientific Purposes (8th edition, 2013).
2.2.7.2 Patient-derived tumour xenograft implantation
2.2.7.2.1 Tissue Preparation
Fresh tissue was obtained directly from patients at the time of their examination under anaesthesia and biopsy of the anal canal tumour. The fresh tissue was placed in normal saline and kept on ice with the aim of transferring the tissue into the mice within one hour of collection.
The tissue was placed in a petri dish and divided into 1-2mm pieces using a scalpel. The tissue pieces were then placed in BD MatrigelTM and kept on ice (Figure 2.1).
77
Figure 2.1 Tissue pieces prior to implantation
(Photo courtesy of Dr Matthew Read)
2.2.7.2.2 Preparation of mice
The required number of mice was determined (approximately 2 tumour pieces per mouse) depending on the amount of tissue available. Each mouse was weighed and using an insulin syringe, 100μL of anaesthetic solution (mixture of
10mg/ml of ketamine and 2mg/ml of Xylazine) per 10grams of body weight was administered intraperitoneally. Each mouse was marked for the purposes of identification. Lacrilube was applied to both eyes.
The mouse was then placed onto a sterile field in the fumehood and the skin prepared with 2% (v/v) chlorhexidine gluconate/70% (v/v) isopropyl alcohol solution.
78 2.2.7.2.3 Implantation of tumour tissue
A small dorsal midline incision was made at the level of the renal angle using
Metzenbaum scissors (Figure 2.2).
Figure 2.2 Site of incision
A stay suture using 3/0 undyed Vicryl was placed in the skin to aid with retraction. On each side of the midline, a superficial suture was placed into the dorsal musculature using 4/0 Vicryl rapide. This allowed tenting up of the muscle fibres (Figure 2.3) and Iris scissors were used to make a small incision into the muscle. This was developed into an intramuscular (IM) pocket using blunt dissection. One to two pieces of tumour tissue coated in Matrigel were
79 then placed into the IM pocket. The muscular defect was closed with a single interrupted suture using 4/0 Vicryl rapide. The procedure was then repeated on the contralateral side. The skin was closed using 3/0 undyed vicryl interrupted sutures. The wound was sprayed with Opsite.
Figure 2.3 Demonstration of the intramuscular pocket with a suture
tenting the muscle up
(Photo courtesy of Dr Matthew Read)
2.2.7.2.4 Monitoring and Recovery
Post-procedure, mice were placed in boxes on a heat pad until the following day. Antibiotic water (Stock solution of 2.5g/L of Neomycin sulphate and 1.3g/L of Polymyxin B sulphate, diluted to 1:100) was administered for 5 days post- procedure. The mice were closely monitored for the first 48 hours for any anaesthetic or procedure-related complications. All mice were formally checked weekly for signs of tumour development.
80 2.2.7.3 Tissue Processing and Cryopreservation
Once successful engraftment of tumour tissue was confirmed, it was permitted to grow until reaching a maximum ethical limit of 1500mm3 as calculated using the formula (length x width2/2). At this point they were culled according to ethical guidelines (including CO2 asphyxiation or cervical dislocation) or earlier if they showed any signs of distress or discomfort. Tumour tissue was harvested and then allocated as per the flow chart in Figure 2.4.
Ongoing Tissue Bank
Serial Cell line Transplantation
Successful Compare with Engraftment of Original Tissue H&E/IHC Thaw Xenograft
Freeze
Cryopreservation Future Testing
Figure 2.4 Flowchart demonstrating processing of successfully
engrafted xenografts
Harvested tissue was carefully debrided of any keratin deposits and tumour tissue was cut into 2mm3 pieces and processed as per the original tissue. For cryopreservation, tumour pieces were washed in PBS, and
81 aliquotted into sterile cryo-tubes (up to 2 pieces in each) with 1ml of freezing solution (FCS with 10% DMSO (v/v)) and frozen to -80 C at a rate of approximately -1 C/min.
2.2.7.4 Methods of Drug Administration
2.2.7.4.1 Anaesthetic
Intraperitoneal injection was used to anaesthetize the mice using 100μl of anaesthetic solution (ketamine 10mg/ml and xylazine 2mg/ml) per 10g of body weight.
2.2.7.4.2 5-fluorouracil administration
5-fluorouracil (DBL Fluorouracil, clinical formulation sourced from Peter
MacCallum Cancer Centre Hospital Pharmacy) was used at a concentration of
10mg/kg, mixed with normal saline and administered via intraperitoneal injection daily x5/week for 3 consecutive weeks.
2.2.7.4.3 Mitomycin C administration
Mitomycin C (clinical formulation sourced from Peter MacCallum Cancer
Centre Hospital Pharmacy) was used at a concentration of 3mg/kg, mixed with normal saline, and administered via intravenous injection on Day 1 of randomization into the experiment.
2.2.7.4.4 PIM kinase inhibitor administration
The PIM kinase inhibitor, TP-3654 (Tolero Pharmaceuticals, Lehi, Utah, USA), was firstly tested for tolerability in non-tumour bearing mice prior to formal
82 experimentation. For the final experiment, it was delivered at a dose of
125mg/kg using Tween 20 as a vehicle, via oral gavage daily x5/week for 3 consecutive weeks.
2.2.8 Cell Culture
Tumour samples were placed on a petri dish with PBS and cut into tiny segments. In a Falcon tube, this was centrifuged and the supernatant discarded.
The digestion mix was added to the pellet and placed in a 37°C water bath.
Digestion mixes utilized included Trypsin and Collagenase I. The latter was made using 9mg of 0.9mg/ml of Collagenase I powder (200U/ml), 1mg of
0.1mg/ml hyaluronidase and 300μl of DNase I (30 U/ml), and 10ml of
EpiGRO™. This was stored at 4°C. When added to the pellet or cells and placed in the water bath as above, it was then vortexed every 20-30 minutes to improve digestion. After 1 hour, some of the digested material was removed and the post-digestion protocol was followed. The remainder was left for a digestion time of 3 hours.
Post-digestion, the digestion material was placed through a 40micron cell strainer. Up to 30ml of DMEM or RPMI was added to the filtered material to stop digestion. This was centrifuged at 1100revs/min for 5 minutes.
83 The supernatant was removed and discarded and the pellet resuspended in
200μl of PBS. In a 12 well plate, 100 μl of digested material was placed per well containing 1ml of pre-added media.
This technique was modified over several attempts at establishing successful cell growth and is described in 5.2.5.
2.2.9 Statistical analyses
All RNA seq and qRT-PCR data was analysed using the unpaired t-test (two- tailed). The p-value was considered significant if less than 0.05. The F-test was used to compare variances. When the variance was highly statistically significant, (p = 0.0001), the Mann-Whitney test was applied.
For the RNA seq analysis, the results are displayed as mean with standard deviation. The results for qRT-PCR are displayed as mean with standard error.
For the pilot experiments, data was analysed using the paired t-test (two- tailed). The p-value was considered significant if less than 0.05.
84 Chapter 3: Assessing Response to Treatment & Patterns of Failure in Anal Squamous Cell Carcinoma
3.1 Assessment of Response After Definitive
Chemoradiotherapy for Anal SCC by FDG-PET
Introduction
Anal squamous cell carcinoma has been treated with definitive chemoradiotherapy since Nigro pioneered this sphincter-preserving approach more than 30 years ago.15, 177 While the fundamentals of treatment have not changed significantly, the approach to staging this disease has progressed with the advent of new technologies. In particular, the role of FDG-PET/CT in initial staging has been subjected to systematic review which concluded it should be recommended for this purpose.46 The European Society for Medical Oncology
(ESMO) clinical practice guidelines state that PET is “optional but often recommended.”178 This is in contrast to the current NCCN guidelines which state that PET/CT should only be considered, the reason being that “routine use… for staging or treatment planning has not been validated.”34
Following definitive treatment, assessment of response still remains a challenge in the management of anal SCC. The use of FDG-PET in this way is
85 not a standard modality to assess response and remains controversial due to the paucity of evidence to support this purpose.46
Over the last thirty years at the Peter MacCallum Cancer Centre, a combination of radiotherapy and 5-fluorouracil/mitomycin C has been the standardized treatment approach to patients with anal SCC. PET scans were performed from 1998 onwards and became a routine part of management. The aim of this study was to determine the role of FDG-PET in assessment of anal cancer response following chemoradiotherapy as well as compare response with patient outcomes.
Methods
Data collection
Our institutional database of all patients with anal SCC, treated with curative intent between February 1983 and January 2012 was used to identify those who had had a PET scan and the timing of that scan, whether it be pre-treatment, post-treatment or both. FDG-PET metabolic response was reported as no response, partial or complete response. PET scans were reported by experienced PET specialists on the day of the scan. All pre-treatment PET images were available for review and comparison during interpretation of the post-treatment scans. FDG-PET metabolic response was reported as no response, partial or complete response. As described by Day et al., a complete metabolic response was defined as “return of visually graded FDG-uptake in all
86 baseline lesions to a level equivalent to or lower that the radioactivity in normal tissues of the involved organ. Partial metabolic response was defined as an improvement in visually graded FDG-uptake at baseline involved sites, but persistent residual abnormality suggesting malignancy.” When there was no change or an increase in FDG-uptake within a baseline lesion, or development of a new site of disease, ‘no response’ was reported.53 Follow up was undertaken using chart review at our institution and other institutions as required.
Statistical Analysis
Patients included in the analysis had either a pre-treatment and post-treatment
PET scan. Patient characteristics were summarised as number and rates (with
95% confidence intervals, as applicable) or mean, standard deviation, median and range, as appropriate. Overall survival was calculated as the number of days from post-treatment PET scan to death from any cause; disease free survival was calculated as the number of days from post-treatment PET scan to disease progression/recurrence or death from any cause. The association between response at the post-treatment PET scan and overall survival or disease free survival was assessed by Kaplan-Meier survival curves and calculation of Cox proportional hazards regression hazard ratios with 95% confidence intervals, in both adjusted (for age at diagnosis and sex) and unadjusted analyses. A p-value less than 0.05 was considered significant.
87 Results
During the defined study period, 382 patients were identified. Patient and tumour characteristics are shown in Table 3.1 and the distribution of scans amongst patients is shown in Table 3.2. As PET scans were performed routinely from 1998 onwards, the 179 patients who did not have a PET scan mostly represent patients prior to 1998. After this time, the majority of patients had both pre-treatment and post-treatment scans. Those who had pre-treatment excisional biopsies and who had no metabolic activity on their pre-treatment
PET scans were only recorded as having a pre-treatment scan, even if they had both, as response could not be assessed if there was no detectable disease prior to treatment.
Table 3.1 Patient and tumour characteristics
Characteristic n (%) or median [range] Sex M 132 F 350
Age at diagnosis (years) 61 [27-91]
Primary tumour site Anal canal 235 Anal margin/verge 61 Both 86 AJCC stage I 81 II 174 IIIA 38 IIIB 86 Missing 3
88 Table 3.2 Distribution of FDG-PET scans amongst patients
-
-
The timing of the post-treatment PET scan in 145 patients varied considerably from 20 to 503 days (2.9 to 71.9 weeks) with the median being 78 days (11.1 weeks). The variation in timing is explained by the fact that some patients had multiple PET scans in which to assess their response if the first scan was inconclusive. In these cases, the best response was documented from a later scan. The median follow-up for 128 patients (17 deaths were recorded over this time period and were excluded) who had post-treatment scans was 3.3 years (0.05 -15.32 years). The degree of response is shown in Table 3.3.
Table 3.3 Degree of metabolic response after CRT as assessed by FDG-PET
Post-treatment PET response n (%)
Complete response 121 (83.4)
Partial response 22 (15.2)
No response 2 (1.4)
Total 145
89 Complete metabolic response on FDG-PET was a significant predictor of overall survival (Figure 3.1). For those who had a partial response versus a complete response, of 143 patients (16 deaths recorded during this time), the
Hazard ratio was 5.9 (2.1-16.7), p=0.0009). Among the entire 145 patients who had post-treatment PET scans, there were 17 deaths. For those who had a partial or no response compared to a complete response, the Hazard ratio for death was 5.9 (2.2-15.9), p=0.0005. Age at diagnosis and gender were not significant individual predictors of overall survival following post-treatment
PET scan. Furthermore, after performing multivariate analysis with adjustment for other variables including age at diagnosis and gender, post-treatment PET response remained a significant predictor of overall survival (Hazard ratio 5.7
(2.1-15.8), p=0.0008).
90
Figure 3.1 Kaplan-Meier curves of overall survival according to FDG-
PET response
Post-treatment PET scan response was also a significant predictor of disease-free survival (Figure 3.2). Among 145 patients who had a post- treatment PET scan, 30 (20.7%) had recurrence, 18 (12.4%) had locoregional (LR) recurrence only, 8 (5.5%) had distant disease and 4 (2.8%) had both LR and distant disease at the time of recurrence. Five patients died without recurrence of their disease due to other causes.
91 For those who had a partial or no response, rather than a complete response, the Hazard ratio for disease progression or death was 8.5 (4.3-16.8), p<0.0001. Seventeen of 22 (77.3%) patients with partial or no response went onto have salvage surgery or palliative treatment.
Figure 3.2 Kaplan-Meier curves of disease-free survival according to
FDG-PET response
92 Discussion
The use of FDG-PET scan in assessing response of anal SCC to definitive CRT remains controversial. In fact, the use of PET-CT in assessing response is not mentioned in the 2016 NCCN guidelines,34 and its use suggested only “as a comparison …., if available” in the most recent European clinical practice guidelines.178 As a significant proportion of patients who do not have a complete response to definitive CRT may be suitable for salvage surgery, usually in the form of APR, it is imperative that these patients are identified early in order to offer them potentially life-saving surgery.
With close monitoring comes the risk of performing surgery prematurely when patients are deemed to have persistent disease. Anal SCC has been shown to take up to 6 months to regress completely, with earlier studies recommending prolonging the time to assess response in order to avoid unnecessary surgery.56, 57, 178 This is supported by the data in this study, with some patients undergoing more than one PET scan following treatment and later scans providing evidence of a complete response, hence avoiding premature surgery. PET scans were performed at a median of 11 weeks after completion of CRT; a period of 8 to 12 weeks following treatment may be recommended as an ideal time to utilize PET scans in assessing response.
93 Although a larger primary tumour has previously been identified as a stratifying variable in increasing the risk of persistent disease,56 even large tumours may have a complete response within this time frame as shown in
Figure 3.3.
Figure 3.3 PET scan of very large locally invasive SCC
Pre-treatment (left image) and PET scan demonstrating complete metabolic response 8 weeks after completion of chemoradiotherapy (right image).
Despite these findings, post-treatment PET scans as a sole determinant of response to CRT should be utilized with caution as premature salvage surgery may still result. This was noted in the study by Nguyen et al., as one of five partial responders had their post-treatment PET scan 13 weeks following therapy and proceeded to salvage APR after this, with no residual disease seen.45 Rather than being used as an exclusive determinant of disease status, ongoing FDG-avidity on PET scan following treatment should prompt ongoing
94 close surveillance. This may include further PET scans, which may subsequently show a complete response and/or examination under anaesthesia with biopsies of any abnormalities.
Two previous studies have reported on the predictive value of treatment response seen on PET scan following definitive CRT. Schwarz et al. found that partial responders had a 2-year progression-free survival of 22% compared to
95% for complete responders.179 Nguyen et al. reported a worse 2-year progression-free survival for the 5 patients in their cohort who had a partial response to CRT compared to 20 complete responders who underwent post- treatment PET. 45 This study includes 145 patients and represents the largest published cohort of patients with anal SCC who have undergone pre- and post- treatment PET scans. The findings support the previous smaller studies in that a complete response on PET scan was predictive of improved overall survival and disease-free survival compared to partial or no response.
This information may help with stratifying patients who are at highest risk of recurrence. Those who had a partial or no response on PET scan, even if they subsequently benefited from salvage surgery, may be kept under closer clinical and radiological surveillance compared to their completely responding counterparts, potentially identifying recurrent disease early enough for further salvage. Even if metastatic disease is detected, earlier recognition could prompt further salvage surgery or admission to trials using novel drug therapies.
95 This endeavour towards more individualized treatment has the potential to improve outcomes compared to a situation when the identification of recurrent or metastatic disease is delayed.
The limitations of this study are consistent with the expected constraints encountered with databases; further data, which would provide valuable information for analysis, is not available. Specifically, the utility of PET-CT in assessing response cannot be compared to conventional methods including clinical examination, anoscopy/proctoscopy and/or CT or MRI with the data available. As some of the data was collected retrospectively, and post-treatment
PET scans were reported in conjunction with clinical information, this data cannot accurately address the issue of frequency with which PET-CT for assessing response to treatment may change management. However, given that
77.3% of patients with a partial response or no response on PET scan proceeded to have salvage surgery or palliative treatment, it is likely that at least some of these may not have had their disease detected by conventional methods in a timely fashion. If this was the case, it is possible that some patients may have missed their opportunity for salvage surgery if the PET scan had not been performed. Others may have had futile salvage surgery if metastatic disease had not been detected by PET scan, thus prompting a palliative approach. This may be only a very small proportion of patients with anal SCC but an important cohort nonetheless. Long-term prospective data collection, including
96 details of post-treatment response assessment, with strict guidelines governing post-treatment PET scan reporting may answer these questions in the future.
Conclusion
FDG-PET has been demonstrated to be effective in evaluating the response to
CRT for patients with anal SCC. In this cohort from our institution, a complete
PET response after definitive treatment was a significant predictor of both overall survival and disease-free survival compared to no response or a partial response.
This predictive ability of PET may have several roles in timely identification of patients for salvage surgery and in stratifying patients who are at risk of recurrence, potentially improving these patients’ outcomes by prompting closer surveillance.
97 3.2 Patterns of Treatment Failure for Anal Squamous Cell
Cancer: Thirty Years Experience in a Single Institution
Introduction
Definitive chemoradiotherapy has become entrenched as definitive treatment for anal squamous cell carcinoma since Nigro et al. recognized the success of this treatment without the need to proceed to surgical intervention with APR.177
Despite the success of this sphincter-preserving approach, a proportion of patients experience relapse of their disease, most commonly as locoregional
(LR) recurrence.75 Five years after treatment, up to 20% of patients have LR failure and 13% have distant disease.52
Surveillance is undertaken routinely in the hope that any disease relapse is identified early as some of these patients are suitable for radical salvage surgery, which offers their only hope of cure. This is usually in the form of a radical APR, which is a more morbid operation than the standard APR for a low rectal cancer. For those who are not suitable for salvage treatment, there are currently no effective treatment options with dismal survival rates.
In our previous report of 284 patients treated over a twenty-five year period, there were 54 locoregional recurrence events and the 5-year LR control rate was 83% (95%CI: 78%-88%).16 In this study, all patients with anal cancer
98 treated radically with chemoradiotherapy in our institution over the last thirty years were analysed.
The aim of this study is to examine patterns of failure after definitive
CRT for anal SCC and assess the outcomes of salvage treatment in a single tertiary referral centre.
Methods
A retrospective review of hospital records was undertaken of patients with localized SCC of the anal canal or margin treated with definitive chemoradiotherapy at the Peter MacCallum Cancer Centre, between February
1983 and January 2013. Approval for data collection was obtained from the institutional ethics committee. Tumours were staged according to the American
Joint Commission on Cancer Staging System, 7th edition.32
Treatment
Since the 1980s, the Peter MacCallum Cancer Centre has treated patients with anal SCC using a combination of radiotherapy and 5-fluorouracil/mitomycin C without a planned treatment break. All patients were treated with a standard regimen, which consisted of radiotherapy to a total dose of 50.4 to 54 Gray using a three-phase technique which has been described in detail previously.16
During the 1980s and early 1990s, elective inguinal irradiation was not
99 routinely used for those with node-negative disease. Since 2011, intensity modulated radiotherapy (IMRT) has become the standard of care. Concurrent chemotherapy consisted of infusional 5FU 1g/m2 for 4 days in Weeks 1 and 5, and MMC 10mg/m2 on Day 1. A protracted infusional 5FU regimen of
300mg/m2 for 96 hours per week (Monday to Friday during radiotherapy days) was used from 1997 onward.
Follow-up
All patients were reviewed on a regular basis after completion of their CRT to assess response to treatment. As well as physical examination (including digital rectal examination and inguinal node palpation) and CT scans, since
1998, post-treatment PET scans became a routine part of assessing response.53
Once a complete response was confirmed, patients were reviewed at 3 monthly intervals for 3 years, 6 monthly intervals for a further 2 years and then yearly thereafter. Clinical or radiological suspicion of disease was excluded or confirmed with biopsy.
The database nomenclature used to describe locoregional disease relapse stratifies patients into those with ‘persistent’ disease (identified less than 6 months after completion of CRT) or ‘recurrent’ (identified greater than 6months after CRT). This included disease within the anus and/or pelvic and/or inguinal nodes.
100 The sites of disease relapse were recorded as locoregional or distant or both. Treatment modalities for relapse were identified and patient survival assessed through chart review. Those patients who developed locoregional disease without evidence of metastatic disease or developed isolated distant metastasis were considered for salvage therapy in the form of surgery and/or chemotherapy and/or radiotherapy.
Statistical analysis
After completion of CRT, those patients with no outcome data were excluded from time-to-event analyses. Time to progression, time to locoregional failure and time to distant control failure, and overall survival from the date of the start of salvage therapy was assessed using the Kaplan-Meier method, where patients with persistent disease were considered to have failed on that day. Cox proportional hazards models assessed the predictive power of various patient demographic and clinical characteristics for time-to-event outcomes.
Results
During the defined study period spanning thirty years (January 1983 to
December 2012), a total of 382 patients were identified. Patient and tumour characteristics are presented in Table 3.1. Follow-up data was available for 376 patients over a median of 5 (range 0 - 19) years. The five-year disease-free
101 control was 78% (95% CI, 73-82). The locoregional control for the same period was 82% (95% CI, 78%-87%) and the distant disease-free rate was 92% (95% CI,
89%-95%).
However, 75 patients (19.9%) had persistent or recurrent disease, or metastatic disease, or both within 5 years. Thirty of these patients (40%) had disease identified within 6 months of completion of their treatment. The remaining 45 had recurrent disease (Table 3.4).
Table 3.4 Numbers of patients with disease relapse
LR Distant Both Total
Persistent 23 3 4 30
Recurrent 29 12 4 45
Total 52 15 8 75
Three patients had more than one episode of disease relapse and will be described in further detail below. Initial T-stage and sex were predictive of disease-free control (in particular locoregional control). T-stage was also predictive of time to progression; each T-stage level higher had a hazard ratio of
1.90 (1.52 - 2.37), p < 0.0001, for time to progression. When adjusted for sex, the
Hazard ratio remained significant at 1.98 (1.58 – 2.48), p < 0.0001.
102 Treatment intent for disease relapse
A total of 44 patients (59%) with disease relapse (including both persistent and recurrent disease) were subsequently treated with some form of salvage therapy. Twenty-four patients were deemed suitable for palliative treatment only while the remaining seven patients had no subsequent treatment (Table
3.5).
Table 3.5 Treatment intent for patients with disease relapse
Salvage Palliative No Treatment
Persistent 19 10 1
Recurrent 25 14 6
Total 44 24 7
Salvage therapies
Table 3.6 Subsequent salvage treatment modalities
103 (a) Surgery
The mainstay of surgical salvage was radical APR in 24 patients. Two patients had a pelvic exenteration (classified as ‘Other’). Two patients underwent an inguinal lymphadenectomy alone (Table 3.6). The first of these was treated in
1991 and was disease-free at last follow-up in 1998. The second of these patients was treated in 2011 and had known inguinal node involvement prior to treatment. This patient then had persistent FDG-avidity on repeated PET scans performed up to 5 months after completion of treatment and proceeded to surgery. The subsequent histopathology demonstrated necrotic material only with no viable tumour.
(b) Radiotherapy only
One patient had external beam radiotherapy to inguinal nodes approximately 2 years after definitive CRT in 1990. This patient was last reviewed in 2010 and was alive and disease free.
(c) Other salvage treatments
Seventeen patients had what was classified as ‘Other’ treatments to describe combinations of chemotherapy and/or radiotherapy or other types of surgery. These are detailed below and they demonstrate that salvage treatment did not include only radical APR.
104 (i) Inguinal node disease relapse: CRT
Six of the 17 relapses in this group were inguinal nodal disease only and were all treated in the late 1980s or 1990s prior to the introduction of routine prophylactic nodal irradiation for those with node-negative disease. Their salvage treatment mainly consisted of combined chemotherapy (often with platinum and 5FU) with inguinal node irradiation (Table 3.7).
Table 3.7 Inguinal node relapses and salvage treatments
Year of Year of Inguinal Last Chemo XRT diagnosis relapse dissection follow-up
1988 1990 ✓ ✓ 1994
1990 1994 ✓ ✓ 2012
1993 1994 ✓ ✓ ✓ 1996
✓ ✓ ✓ 1994 1994 2013 (1994) (1995) (1995)
1994 1996 ✓ ✓ 1999
1995 1999 ✓ ✓ 2002
(ii) Liver metastasis: Surgery
Two patients developed solitary liver metastases and underwent hemihepatectomies. The first of these originally had a T1N0 tumour and the liver lesion was identified approximately 6 months after completing his treatment. He remained well 4 years after liver resection. The second patient
105 had a liver metastasis diagnosed 4 years after treatment of a T2N0 SCC. This patient had multiple episodes of disease relapse and will be detailed further below.
(iii) Pelvic disease relapse: Salvage CRT
The remaining 9 patients underwent either CRT with or without further surgery including two pelvic exenterations for relapsed disease in pelvic nodes with or without relapse at the primary site (Table 3.8). The follow-up for this small number of patients is short; however, some patients had expired or were receiving palliative care at the time of last follow-up.
Table 3.8 Other forms of salvage treatment for disease relapse
Year of Year of Last Salvage treatment diagnosis relapse follow-up
1987 1989 CRT 1991
1998, 1992 1997 Pelvic exenteration Distant mets
1994 1994 CRT 1996
CRT (aim for APR, complete response 1996 07/2013 11/2013 to CRT)
2002 2006 Pelvic exenteration 2008
2002 2006* APR & Chemo 2012 RIP
2003 2007 CRT (pelvic side wall) 2007
CRT (aim for exenteration, pt died 2007 2009 2009 RIP prior)
2012 2013 CRT 2014
*See Table 3.9, Patient 1
106 Multiple disease relapses
Within the study period, three patients experienced multiple episodes of disease recurrence treated with curative intent. The individual features of each case are presented in Table 3.9. All 3 had node negative disease at presentation and variable T-stage. Time to first relapse was 2-4 years. In 2 of the 3 patients, the sites of relapse were locoregional disease while the third was one of the patients described earlier with solitary liver metastasis. Definitive treatment of each relapse resulted in each patient surviving 6 years, 3 years and at least 2 years after their first relapse, respectively.
Table 3.9 Clinical and treatment details of patients with multiple disease
relapses
Survival since Salvage treatment first relapse Patient 1 2002 T1N0, CRT 2006 – Relapse 1, primary site; APR & chemo 2008 – Relapse 2, SCC perineal sinus; CRT/Pelvic exenteration /IORT 6 years 2011 – Relapse 3, pelvic recurrence incl. bone; palliative care RIP 2012 Patient 2 2005 T3N0, CRT 2007 – Relapse 1, primary site; APR 3 years 2008 – Relapse 2, CRT/Pelvic exenteration/IORT 2010 – Relapse 3, Intra-abdominal mets; palliative bypass Patient 3 2007 T2N0, CRT 2011 – Relapse 1, liver met; hemihepatectomy 2 years 2013 – Relapse 2, intraperitoneal & lung mets; asymptomatic last review Abbreviation: IORT, Intra-operative radiotherapy
107 Salvage treatment outcomes
Among the 44 patients receiving salvage therapy, during median follow-up of
2.4 years (range 0.3-17.8 years) 14 patients died: 1 and 5-year survival rates were
87% (95% CI, 78-98) and 69% (95% CI, 54-88), respectively. Considering only the
75 patients with disease relapse, multiple factors were considered as univariate models and in different combinations including age at diagnosis, age over 75 years, female gender, T-stage, N-stage, and tumour site; there were no statistically significant models containing risk factors for death. However, one model was borderline significant (overall p-value: 0.0503). This model contained parameters for T-stage (T1, T2, T3, T4, Tis, Tx), pelvic dose received
(Gy, continuous), tumour site (anal canal vs anal margin/verge and both), gender (male, female), and tumour diameter (>4 cm, <=4 cm), of which T-stage was borderline significant (p-value: 0.0587) and tumour diameter was significant (p-value: 0.009), with Hazard Ratios of 2.41 (95% CI, 0.97-6.0) and
0.09 (95% CI, 0.02-0.55), respectively.
Even after exclusion of the 8 patients who had salvage treatment for isolated inguinal nodal disease, there were still no statistically significant risk factors for death following salvage therapy.
108 Discussion
A significant proportion of patients develop disease relapse following completion of definitive chemoradiotherapy for primary anal SCC. Our database uses the terms ‘persistent’ and ‘recurrent’ disease, depending on whether further disease was identified within or after 6 months of completion of definitive CRT. This includes disease within the anus and/or pelvic and/or inguinal nodes. The recommended nomenclature from the recent ACPGBI
Position statement is to use the term ‘local disease relapse’ without a defined cut-off point as the process of relapse is probably a continuum.75 There were 52 patients who experienced relapse of locoregional disease in this cohort of patients; a 5-year rate of 18% (90% CI:13-22). This is slightly lower than the updated findings of RTOG-9811 which reported a 5-year LRF rate of 20% (95%
CI: 15.6-24.4)52 and lower than another large retrospective review among 180 patients which reported a 3-year LRF rate of 23%.74 Our 3-year LRF rate was only 14% (95% CI: 11-18) and this includes those patients who developed inguinal nodal failure prior to routine irradiation of groin nodes.
Our data demonstrate that 59% of patients (n=44) proceeded to salvage therapy in some form. The audit standards as defined by the ACPGBI recommend that greater than 60% of patients with local disease relapse should be offered radical salvage surgery.75 Our 5-year survival after salvage therapy of
69% (95% CI: 54-88) is above the audit standard of greater than 40% for 5-year
109 post-operative survival,75 but does include non-surgical salvage therapeutical approaches. This variance may be explained by the single-centre nature of this cohort in a dedicated cancer centre with a relatively large anal cancer practice allowing close collaboration between specialties within the experienced multidisciplinary team. However, some of the salvage APRs were performed at other institutions. Aggressive follow-up with PET/CT scans as a matter of routine practice may have also contributed to earlier detection of disease relapse, with subsequent successful salvage treatment. It is acknowledged that these inferences are made in the setting of a retrospective database, which is a limitation of this study.
The omission of prophylactic inguinal nodal irradiation prior to the mid-
1990s is clearly reflected in the pattern of disease relapse. Tomaszewski et al. analysed this same cohort of patients up until February 2008 and identified an inguinal failure rate of 1.9% in those with T1N0 disease and 12.5% in T2N0 patients, all of whom did not receive elective inguinal irradiation. No patients who received prophylactic groin irradiation experienced inguinal failure.16 The
Trans-Tasman Radiation Oncology Group addressed this issue in a prospective single-arm chemoradiotherapy study in which no elective inguinal nodal irradiation was used for T1-2 tumours.
The overall inguinal failure rate was 22.5%. However, 12.5% experienced disease isolated to the inguinal nodes which may have been prevented by prophylactic irradiation. Toxicity and morbidity rates were also deemed
110 relatively low.37 The latter will likely be even lower using IMRT and therefore toxicity should not be deemed a reason to not include the inguinal nodes in the radiation field. It is recommended that most patients receive elective inguinal
RT to a dose of 45 Gray using this technique.65
An important observation with regards to patient selection was that two patients with isolated distant disease were selected for surgical salvage. Liver resection for metastatic SCC has been reported by Pawlik et al. in 27 anal SCC patients with a median disease-free survival of 9.6 months and 5-year OS of
23%.180 Hallemeier et al. described segmental liver resection in 3 patients in the context of concurrent surgical resection of locoregional relapse. No further information is given specifically regarding these 3 patients.78 In this study, one of the patients who underwent hemihepatectomy was disease-free after 4 years and the second experienced disease relapse 2 years after surgery. Although these are only 2 patients, they serve as an example of the potential for lengthening disease-free survival and possible overall survival when treating distant disease.
Due to the relatively small number of patients with metastatic anal SCC, there are no Phase III trials to draw on for guidance in this specific setting. A retrospective case series from MD Anderson Cancer Centre describes the role of combined-modality therapy in oligometastatic anal SCC in 5 patients. All patients received definitive CRT, while 4 also received systemic chemotherapy.
Other modalities included lung or liver surgery as well as radiofrequency
111 ablation to a liver lesion. These 5 patients had disease-free intervals ranging from 14 to 32 months.181 The role of definitive CRT in metastatic disease is also supported by our own series in which several patients with relapse in unirradiated groins were treated with CRT (Table 3.7). The shortest follow-up in this subset is 3 years and the longest is 19 years, suggesting their disease was successfully treated. This is of course testament to the known high radiosensitivity of SCC. This combined modality treatment approach using definitive CRT or stereotactic radiotherapy +/- surgery should perhaps be considered for salvage of distant nodal or visceral disease (outside original CRT fields) in more cases previously deemed ‘unsalvageable’.
The issue arises with the selection of these patients. At this time, our understanding of the molecular biology of anal SCC does not allow accurate prediction of individual tumour behaviour in order to prognosticate precisely and therefore select patients who will benefit from salvage therapy.182 While the prospect of individualized treatment based on molecular biomarkers is not a reality at this time, these patients in whom distant disease or multiple recurrences have been treated with success are examples of individualized treatment based on clinical grounds. Hopefully, more of these types of patients may be identified in the future if clinically useful predictive and prognostic biomarkers become available.
112 To our knowledge, this is the only study describing multi-faceted aspects of disease relapse in anal SCC, as other publications summarise the experience with surgical salvage in the forms of APR +/- exenteration-type procedures or extended resections.75, 77, 78 There are several limitations of this study which should be taken into account. Due to the retrospective nature of the data collection, the potential for selection bias cannot be excluded, particularly with regards to patient selection for surgical salvage. Although this represents a relatively large sample size of anal SCC patients, overall numbers for each form of salvage therapy are small which limits any definitive conclusions being drawn. The patients selected for salvage therapy are likely to have changed over the study period due to advances in diagnostic imaging and therapeutic techniques, leading to heterogeneity in the treated patients and subsequent outcomes.
Conclusion
A proportion of patients with anal SCC require salvage treatment despite definitive therapy. Most relapse occurs locoregionally but those with isolated distant disease can also be considered for salvage treatment. In carefully selected patients, salvage treatment for anal cancer relapse can result in satisfactory medium-to-long-term survival.
113 Presently, selection of suitable patients is predominantly based upon clinical grounds. More reliable predictive and prognostic biomarkers are keenly awaited as an adjunct to clinical assessment as we strive for individualized treatment and improved patient outcomes.
114 Chapter 4: Identification and Selection of Potential Genetic Targets
4.1 Introduction
Predictive genomics using DNA microarray technology has now been utilized since the 1990s in some solid tumour streams. This technology allows for simultaneous measurement of tens of thousands of genes’ expression levels.183,
184 This has formed the basis of commercially available prognostic platforms such as MammaPrint and Oncotype DX, which provide clinically-appropriate prognostic results to guide breast cancer management.183 However, there are several limitations to microarray technology. When transcripts are present in low abundance, the accuracy of expression values may be compromised due to background hybridization. As microarrays rely on pre-designed complement sequence detection probes, only those genes for which the probes are designed can be interrogated.184
These limitations have been addressed by the newer technology of high throughput cDNA sequencing (RNA-seq) in which gene transcript expression can be measured in a single assay. Some of the initial barriers included high cost of the sequencing itself (compared to microarray), issues with data storage
115 and access to complex analysis software.184 These limitations have been addressed to a large extent as costs have already reduced dramatically.
Bioinformatics experts have worked to develop “robust, efficient and statistically principled algorithms”,185 culminating in easy online access to open, web-based platforms such as Galaxy.186 This bioinformatics program acts as an interface allowing users to upload data and analyse it; in particular, the amount of mRNA in individual samples can be quantitated and then used to statistically test differential gene expression between groups of samples
(http://vlsci.github.io/lscc_docs/tutorials/rna_seq_dge_basic/rna_seq_basic_bac kground/).
RNA-seq technology was therefore utilized to analyse a small number of anal cancer specimens with the overall approach to the identification of genes with differential expression being summarized in Figure 4.1.
116
Anal Ca Tissue Bank: 11 pt samples
RNA extraction and Confirm clinical data sequencing
Bioinformatics Confirm HPV status Analysis
Stratify pts into Normalised gene groups T1/2 vs T3/4 expression values for N- vs N+ each patient sample
Differential gene expression between clinical groups
Figure 4.1 Approach to use of Anal Cancer Tissue Bank samples
While RNA-seq may be a powerful tool in recognizing genes of potential predictive and prognostic interest in multiple tumour streams, as for microarray, the sheer volume of data generated is staggering. If only genes with the highest differential expression are perused, the list may not be very informative with regards to biologically and clinically significant genes. In microarray analysis, pathway analysis emerged as a helpful tool rather than the interrogation of gene lists alone.183 While formal cancer pathway analyses are not as yet available via existing bioinformatics analysis platforms, this type of
117 approach was used in this work to select genes for further validation from the generated list of differentially expressed genes. Results from the RNA-seq analysis thus necessitates validation using traditional approaches with quantitative real-time PCR and immunohistochemistry (Figure 4.2).
Validation of RNA
sequencing/Bioinformatics data
Immunohistochemistry qRT-PCR (translated protein in (gene expression) tumour sample)
Immunohistochemistry in test set of patients from database
Figure 4.2 Approach to Data Validation
118 4.2 Results
4.2.1 Anal Cancer Tissue Bank: Confirmation of Clinical Data
Eleven patient samples were available from the Anal Cancer Tissue Bank. The patient details for each of these samples were checked and confirmed including clinical data as well as HPV status. None of the patients had metastatic disease at the time of diagnosis. The follow-up for the 11 patients was 2 to 3 years. Each patient was allocated a unique identifier for ongoing use throughout all experiments (Table 4.1). The patients were then stratified into groups with regards to T-stage (where early T1 and T2 staged tumours were grouped together as T1/2 and T3 and T4 late stage tumours were grouped as T3/4) (Table
4.2) and N-stage of their tumours (Table 4.3).
119 Table 4.1 De-identified Data of Anal Cancer Tissue Bank Patients
Table 4.2 Stratification of patients according to tumour stage
T1/2 T3/4 SDAV KZIE JING IBIS HFAL MGUZ SPAR CPRO DNEW TJOH LFER
Table 4.3 Stratification of patients according to nodal status
NODE - NODE + IBIS SDAV CPRO KZIE SPAR JING DNEW MGUZ HFAL
TJOH
LFER
4.2.2 Bioinformatic Analysis and Gene Expression
The program Galaxy was used which is a data integration and analysis platform. Using the RNA sequencing data, a digital expression matrix was obtained of normalized gene expression values for each patient sample.
This was then run through an EdgeR analysis based upon the stratification according to T-stage and N-stage shown in Tables 4.2 and 4.3. This resulted in a list of genes with statistically significant differential expression between the clinical groups. The data obtained from the EdgeR analysis was
122 exported to Excel and combined with a list of gene names that correlate with their Ensembl number. This list of genes was sorted based upon p-value and the genes with the highest statistical significance perused, including the top
100-160 for each group.
Particularly for T-stage, but also for nodal status, there were an enormous number of genes that were highly significantly different between stratified groups (Appendix 2A and 2B) with a sample of the output showing the highest ranked 14 genes for T-stage in Figure 4.3.
123
T3/4-T1/2
logFC p-value
ENSG00000170423 8.429695 3.999564 9.455382 4.72E-07 0.008663 5.250751 ENSG00000170423KRT78 keratin 78 [Source:HGNC Symbol;Acc:28926]
ENSG00000180758 2.704365 4.848054 8.815143 1.02E-06 0.009353 5.780456 ENSG00000180758GPR157 G protein-coupled receptor 157 [Source:HGNC Symbol;Acc:23687] ENSG00000172818 3.326851 5.428283 8.242478 2.10E-06 0.009676 5.175093 ENSG00000172818OVOL1 ovo-like 1(Drosophila) [Source:HGNC Symbol;Acc:8525] ENSG00000088002 5.643059 4.994673 8.18087 2.28E-06 0.009676 4.92506 ENSG00000088002SULT2B1 sulfotransferase family, cytosolic, 2B, member 1 [Source:HGNC Symbol;Acc:11459] ENSG00000113742 2.341767 4.939848 7.977118 2.98E-06 0.009676 4.867677 ENSG00000113742CPEB4 cytoplasmic polyadenylation element binding protein 4 [Source:HGNC Symbol;Acc:21747] ENSG00000188505 5.803181 5.685432 7.779228 3.88E-06 0.009676 4.528391 ENSG00000188505NCCRP1 non-specific cytotoxic cell receptor protein 1 homolog (zebrafish) [Source:HGNC Symbol;Acc:33739] ENSG00000118898 4.305446 8.180804 7.676525 4.46E-06 0.009676 4.546812 ENSG00000118898PPL periplakin [Source:HGNC Symbol;Acc:9273] ENSG00000104881 2.412444 5.667884 7.641172 4.68E-06 0.009676 4.497278 ENSG00000104881PPP1R13L protein phosphatase 1, regulatory subunit 13 like [Source:HGNC Symbol;Acc:18838]
ENSG00000100592 2.218687 5.606286 7.631717 4.74E-06 0.009676 4.486694 ENSG00000100592DAAM1 dishevelled associated activator of morphogenesis 1 [Source:HGNC Symbol;Acc:18142] ENSG00000178726 3.750529 5.402657 7.439148 6.19E-06 0.011084 4.19712 ENSG00000178726THBD thrombomodulin [Source:HGNC Symbol;Acc:11784] ENSG00000124151 1.860903 5.988913 7.307492 7.44E-06 0.011084 4.085697 ENSG00000124151NCOA3 nuclear receptor coactivator 3 [Source:HGNC Symbol;Acc:7670] ENSG00000137193 2.648559 6.613776 7.220669 8.41E-06 0.011084 3.970778 ENSG00000137193PIM1 pim-1 oncogene [Source:HGNC Symbol;Acc:8986] ENSG00000188277 4.441383 2.53108 7.211487 8.52E-06 0.011084 3.441214 ENSG00000188277C15orf62 chromosome 15 open reading frame 62 [Source:HGNC Symbol;Acc:34489] ENSG00000116871 1.798304 6.89843 7.147353 9.34E-06 0.011084 3.879273 ENSG00000116871MAP7D1 MAP7 domain containing 1 [Source:HGNC Symbol;Acc:25514]
Figure 4.3 Sample of Bioinformatic EdgeR analysis results for T-stage.
Following RNA sequencing of 11 anal SCC patient samples, patients were stratified into 2 groups: those with T3/4 tumours (n=6) compared with T1/2
tumours (n=5). Comparison analysis resulted in a list of genes with differential expression between the 2 groups, as ranked by p-value. PIM1 is highlighted as
the twelfth highest ranked gene with higher expression in the T3/4 tumours.
4.2.3 Genes of Interest
From the lists of genes above, eight genes of interest were chosen for further validation. The selection was made based upon gene function, their known association with cancer pathways and for some, due to their potential as actionable targets.
Those selected genes which were differentially expressed between early and late T-stages were: PIM1 (Figure 4.4A), IVL (Figure 4.4B), HES2 (Figure
4.4C), GRHL1 (Figure 4.4D), TOM1 (Figure 4.4E) and NOTCH2 (Figure 4.4F).
PIM1 oncogene was 12th in the list, IVL was 38th, HES2 was 48th, GRHL1 was
59th, TOM1 was 72nd and NOTHCH2 was 157th.
Those for N-stage were MYB (Figure 4.5A) and BCL-2 (Figure 4.5B) with higher expression seen in node negative tumours. BCL-2 was 45th in the list and
MYB was 79th.
125 A B C
D E F
Figure 4.4 EdgeR Analysis Plots showing significant differential expression of genes stratified for early and late T-stage
RNA was extracted from 11 anal SCC patient samples and subjected to RNA-sequencing. Stratification into 2 groups: those with T1/2 tumours (n=5) vs T3/4 (n=6) tumours, followed by Bioinformatic analysis of gene expression levels. From the list of differentially expressed genes, six genes were chosen based upon their known involvement in cancer pathways as well as their potential as novel drug targets: (A) PIM1, (B) IVL, (C) HES2, (D) GRHL1, (E) TOM1 and (F) NOTCH2. Results are demonstrated as mean with standard deviation.
A B
Figure 4.5 EdgeR Analysis Plots showing significant differential
expression of genes for nodal status
RNA was extracted from 11 anal SCC patient samples and subjected to RNA- sequencing. Stratification into 2 groups: those with node negative (n=4) vs node positive (n=7) tumours, followed by Bioinformatic analysis of gene expression levels. From the list of differentially expressed genes, two genes were chosen based upon their known involvement in cancer pathways as well as their potential as novel drug targets: (A) MYB and (B) BCL-2. Results are demonstrated as mean with standard deviation.
4.2.4 Validation of RNA Sequencing data
4.2.4.1 Gene expression
The EdgeR analysis results demonstrating differential mRNA expression
between the T1/2 tumours compared to T3/4 tumours for six of the genes of
interest, and differential expression between node positive versus node
negative disease for the genes MYB and BCL-2, were then subjected to
validation using quantitative real-time PCR (Figures 4.6 and 4.7).
Of eight genes, validation of differential gene expression was successful
for four of the genes, including PIM1, GRHL1, MYB and BCL-2.
127 A B C
D E F
Figure 4.6 Expression of genes of interest for T-stage as analysed by qRT-PCR
The six genes of interest for T-stage identified by RNA-seq (A) PIM1, (B) IVL, (C) HES2, (D) GRHL1, (E) TOM1 and (F) NOTCH2 were subjected to validation using qRT-PCR. Expression of genes was normalised using housekeeping gene GAPDH, except for the PIM1 gene for which β2M was used, to determine relative levels of mRNA transcripts. Results are demonstrated as mean with standard error.
A B
Figure 4.7 Expression of genes of interest for N-stage as analysed by
qRT-PCR
The two genes of interest for N-stage identified by RNA-seq (A) MYB and (B) BCL-2 were subjected to validation using qRT-PCR. Expression of genes was normalised using housekeeping gene GAPDH to determine relative levels of mRNA transcripts. Results are demonstrated as mean with standard error.
4.2.4.2 Protein Expression
Following validation of differential gene expression, immunohistochemistry was carried out on the original tissue samples from the eleven patients to validate whether differential expression was also seen at the protein level. This was done for PIM1, GRHL1, MYB and BCL-2.
129 4.2.4.2.1 PIM1
Immunohistochemistry did not confirm the differential expression of PIM1 identified by RNA sequencing and qRT-PCR (Figure 4.8A). Four high T-stage tumours scored appropriately with PIM protein demonstrating high expression levels. However, four T1/2 tumours also had high IHC scores. Therefore, 8 of 11 tumours demonstrated high PIM1 expression (Figure 4.8B). Samples of normal anal mucosa from three of the eleven sample patients were available and subjected to immunohistochemistry. These were all negative for staining of
PIM1 (Figure 4.8C).
130
A B C
Figure 4.8 IHC for PIM1 of 11 anal SCC patient samples stratified by T-stage
Following qRT-PCR, IHC for PIM1 was carried out on the 11 anal SCC patient samples and stratified by T-stage to determine if differential expression was seen at the PIM1 protein level. (A) Findings of non-differential expression of PIM1 protein in 11 patient samples (p=0.8665) (B) Example of strong IHC staining of PIM1 (x20) in one patient sample (C) Example of negative staining of PIM1 (x20) in normal anal mucosa.
4.2.4.2.2 GRHL1
Eight of the eleven patient slides showed GRHL1 protein expression levels which correlated with the RNA-seq and qRT-PCR results (Figure 4.9A). Three samples from high T-stage tumours had low IHC scores.
A B C
Figure 4.9 IHC for GRHL1 of 11 anal SCC patient samples stratified by T-stage
Following qRT-PCR, IHC for GRHL1 was carried out on the 11 anal SCC patient samples and stratified by T-stage to determine if differential expression was seen at the GRHL1 protein level. (A) Findings of non-differential expression of GRHL1 protein in 11 patient samples (p=0.4151) (B) Example of strong positive staining for GRHL1 protein (x20) in one patient sample (C) Example of weak staining for GRHL1 (x20) in one patient sample.
4.2.4.2.3 MYB
Six of seven node-positive patient tumours demonstrated low MYB protein expression correlating with the RNA-seq and qRT-PCR findings. However, three node-negative tumours also had low IHC scores with only 1 of 4 node-negative tumours demonstrating protein expression scoring consistent with the RNA-seq and qRT-PCR results (Figure 4.10A).
A B C
Figure 4.10 IHC for MYB of 11 anal SCC patient samples stratified by N-stage
Following qRT-PCR, IHC for MYB was carried out on the 11 anal SCC patient samples and stratified by N-stage to determine if differential expression was seen at the MYB protein level. (A) Findings of non-differential expression of MYB protein in 11 patient samples (p=0.6757) (B) Example of strong positive staining for MYB protein (x20) in one patient sample (C) Example of weak staining for MYB (x20) in one patient sample.
4.2.4.2.4 BCL-2
BCL-2 was the only gene for which differential protein expression between the stratified groups was consistent with both the RNA- seq and qRT-PCR results, with all node-positive tumours demonstrating low expression on immunohistochemistry (Figure 4.11A).
A B C
Figure 4.11 IHC for BCL-2 of 11 anal SCC patient samples stratified by N-stage
Following qRT-PCR, IHC for BCL-2 was carried out on the 11 anal SCC patient samples and stratified by N-stage to determine if differential expression was seen at the BCL-2 protein level. (A) Findings of differential expression of BCL-2 protein in 11 patient samples (B) Example of strong positive staining for BCL-2 protein (x20) in node negative tumour (C) Example of weak staining for BCL-2 (x20) in node positive tumour.
4.2.5 Validation in Test Set
Given the lack of immunohistochemical validation of most of the RNA-seq and qRT-PCR results, a decision was made to only perform external validation for
PIM1. Although differential expression of PIM1 was not confirmed, it was of great interest that almost all of the samples had very strong staining for PIM1 and that 3 samples of normal anal mucosa did not stain with PIM1. Also, PIM1 is an actionable target with established use of PIM kinase inhibitors in other tumour streams.
Twenty-seven patients were selected from the Peter MacCallum Cancer
Centre Anal Cancer Database for which paraffin blocks of their pre-treatment anal cancer biopsy could be sourced. Their clinical data was obtained, including
T-stage, and immunohistochemistry was performed testing for expression of
PIM1 protein. All slides were examined by a clinical pathologist. Twenty-six out of 27 patient samples stained positively for PIM1 with 16 of these staining very strongly with scores ranging from 8-12 (Table 4.3 and Figure 4.12 A-C).
135 Table 4.4 PIM1 IHC scoring in test set of patients
Patient Extent Intensity Score specimen 1 4 2 8 2 4 2 8 3 3 1 3 4 4 2 8 5 4 2 8 6 4 1 4 7 4 1 4 8 4 3 12 9 3 3 9 10 3 3 9 11 0 0 0 12 4 3 12 13 4 2 8 14 3 2 6 15 4 3 12 16 2 1 2 17 3 3 9 18 3 2 6 19 3 2 6 20 4 3 12 21 2 2 4 22 3 2 6 23 4 3 12 24 4 3 12 25 4 3 12 26 2 2 4 27 4 3 12
136
A B C
C
Figure 4.12 Examples of various extents and intensities of PIM1 IHC staining
Examples of PIM1 staining (x10) in (A) Patient 13 with a score of 8 (B) Patient 27 with a score of 12 due to high extent and intensity scoring (C)
Patient 11 with a negative score of zero.
4.3 Discussion
4.3.1 Rationale for patient sample stratification
RNA-seq provided data on the normalized gene expression values within each of the 11 anal cancer pre-treatment samples. However, a means to obtain useful data from analysis required stratification of the patient samples into groups for comparison. Higher T-stage and node positivity are both proven prognostic factors associated with increased risk of local disease relapse and reduced rates of disease-free survival.17 Therefore the patient samples were stratified according to these two factors in the hope that comparative gene expression may identify one or more genetic target specific to one of these prognostic tumour-specific features.
4.3.2 Selection of genes of interest
The list of genes that were significantly differentially expressed between early versus late T-stage tumours, as well as node-negative and node-positive tumours, was very long, particularly for T-stage. Most of the listed genes either had no apparent clinical relevance or code for proteins known to be highly expressed in anal cancer. The most obvious example of this was the first gene in the list for T-stage which was KRT78 (keratin 78).
Anal cancer is known to contain high levels of keratin but this does not confer any properties of clinical significance according to stage, nor have any uses as a novel actionable target.
138 The exhaustive list of genes identified by RNA-seq led to the decision to peruse the lists and identify genes that are involved in known cancer pathways and/or were known actionable targets for novel drugs.
4.3.2.1 PIM1
Pim (provirus integration site for Moloney murine leukaemia virus) refers to a family of three highly conserved oncogenic serine/threonine kinases including
PIM1, PIM2 and PIM3. These kinases have been found to have elevated expression in haematological malignancies (including B-cell chronic lymphocytic leukaemia, acute leukaemias and non-Hodgkins’ lymphoma), as well as in a range of solid tumours including prostate cancer, renal cell carcinoma, bladder cancer, pancreatic adenocarcinoma and gastric cancer.
PIM1 acts as a proto-oncogene with multiple functions including: inhibition of apoptosis, promotion of cell proliferation and genomic instability.
In prostate cancer, high levels of expression have been shown to correlate with more advanced tumour stage. It is almost invariably absent in normal tissues.187
Inhibitors of PIM1’s kinase activity have been developed and were identified in the literature as already in use in pre-clinical trials.188
Given PIM1’s very high ranking in the list of differentially expressed genes for T-stage, combined with its known proto-oncogene function and potential role as a prognostic biomarker, it was chosen for further validation.
139 PIM1’s potential as a novel target using existing Pim-kinase inhibitors also added to its appeal as a gene for further evaluation. This will be addressed in further detail below.
4.3.2.2 IVL
The involucrin gene encodes for the protein of the same name, which is a component of human skin and a molecular marker for differentiation. IVL has been studied in the context of head and neck squamous cell carcinoma and cervical carcinoma, both of which are similar to anal SCC in that they are also
HPV-related tumours. Hypoxic cells in these tumours have been shown to express involucrin, which is oxygen-regulated. This may have implications for sensitivity to radiation which is affected by both differentiation status and hypoxic conditions.189
4.3.2.3 HES2 and NOTCH2
Hairy and enhancer of split 2 (HES2) belongs to a family of genes that are transcriptionally activated via activation of the Notch signaling pathway.
NOTCH2 is one of four transmembrane heterodimeric receptors for which binding of its ligand activates a cascade of events, culminating in the activation of multiple downstream effectors. Although complex, the functions of this pathway include determination of cell fate and roles in oncogenic effects when the pathway is deregulated.190
With increasing knowledge, it is now understood that there is extensive cross-talk between the Notch signaling pathway and other pathways. Although
140 Notch inhibitors are being investigated, the complexity of the pathway and its interactions pose a challenge in developing effective targeting of Notch signaling and successful combination regimens.191
4.3.2.4 GRHL1
Grainy head-like is a family of three mammalian transcription factors; the first of these is encoded by the GRHL1 gene. The GRHL proteins are involved in the maintenance of epithelial integrity while GRHL1 is known to be a tumour suppressor in SCC of the skin. However, the GRLH proteins have also been linked to multiple other cancers including breast cancer, gastric cancer, prostate cancer and cervical cancer, to name a few. Their roles in each of these are complex and contradictory in some cases.192
4.3.2.5 MYB, BCL-2 and TOM1
MYB encodes a DNA-binding transcription factor involved with tumourigenesis and has mostly been studied in the contexts of leukaemias, colorectal cancer and breast cancer. B-cell CLL/lymphoma 2 (BCL-2) and target of myb1 (TOM1) are both found downstream of MYB as two of its many targets.193
BCL-2 is well-known for its anti-apoptotic activity.194 There now exist small molecule inhibitors specific for Myb195 and Bcl-2196 and a vaccine against
Myb also exists.197 There is potential for future investigation into these as novel targets (Figure 4.13). PIM1 has also been shown to act downstream of RAS to stimulate Myb transcriptional activity with cotranscriptional factor, p100.198
141
Figure 4.13 Interaction between three of the selected genes of interest
and their potential targeted therapies
4.3.3 qRT-PCR Validation
Only four of the genes of interest selected from the RNA-seq generated lists were successfully validated using qRT-PCR. There are several possible reasons for the lack of validation in four of the genes. The tissue used for RNA-seq and qRT-PCR was a part of a biopsy of a small segment of the tumour at the time of diagnosis.
142 Multiple biopsies are taken at the time and one or more of these are used for histology to confirm the diagnosis of anal SCC. Although the biopsy segments are all likely to represent the tumour, each small piece may be slightly different in its proportions of tumour to stroma, and therefore genetic composition. Theoretically this may impact on the results of the RNA-seq and qRT-PCR. Furthermore, although the RNA-seq findings were highly statistically significant between the stratified groups, the numbers in the groups are small, thus should be noted as a limitation of this work.
4.3.4 Lack of differential expression using immunohistochemistry
The results of the RNA-seq and qRT-PCR for PIM1, GRHL1 and MYB were not validated by IHC staining. However, the lower expression of the BCL-2 gene in node-positive tumours was found to correlate with its protein expression.
This inconsistency in validation may be due to multiple factors. Similar to the discussion above, the biopsy segment used for immunohistochemistry may not be identical to the piece used for RNA-seq and qRT-PCR in its composition to provide satisfactory comparison. Furthermore, RNA-seq utilizes a whole tissue piece including stroma, whereas only protein expression in tumour is examined in IHC.
143 Also, the antibodies used for immunohistochemistry staining may not be optimal, in particular the one for GRHL-1, which was developed in a local laboratory and may not be optimized.
Despite the lack of validation with regards to differential expression for most of the genes and their respective proteins, it was observed that PIM1 protein was highly expressed in almost all of the tumours in the original group, and still present in those tumours with weaker staining. Importantly, the three samples of normal anal canal available were all negative for PIM1. This is consistent with findings in other solid tumours including prostate cancer, pancreatic cancer and head and neck cancers in which it is highly expressed in the majority of tumour tissue but almost undetectable in normal tissue.194 In head and neck cancers, the high frequency of PIM1 protein expression did not correlate with tumour stage,199 consistent with our findings in anal SCC.
4.3.5 PIM1 – An Actionable Target
A striking feature of the Pim kinases is that they are naturally constitutively active due to a lack of regulatory domains. They do not require activation as most other kinases do, and the absolute amount of PIM1 protein present in the cell dictates the level of enzymatic activity. Although classified as a proto- oncogene, its effect is more potent when acting on synergy with other proteins.200
144 These include c-MYC and Bad proteins, which are phosphorylated by
PIM1, the former driving transcription and the latter inhibiting apoptosis. These and further targets of Pim kinases are shown in Figure 4.14.194
Figure 4.14 Pim kinase targets
(As published by Chen 2010194)
Knowledge of PIM1’s role in driving the development of various cancers, combined with findings of high expression levels in tumour tissue compared with normal tissue have spurred the development of PIM kinase inhibitors, with different companies publishing 68 PIM1 patents since 2001, and half of these since 2010.201
145 A first-generation PIM-inhibitor, SGI-1776, demonstrated cardiotoxicity in Phase 1 trials. The second-generation inhibitor, SG-9481 (or TP-3654, Tolero
Pharmaceuticals, Inc.) has been tested and shown efficacy in urothelial carcinoma cell lines and xenografts.202
Based on the findings of PIM1’s high expression in anal SCC, its availability as an actionable target, and partly due to time constraints, the decision was made to focus on PIM1 for further investigation and to pursue the use of PIM kinase inhibitors in anal SCC.
146 Chapter 5: Pre-clinical Models for Anal SCC: Patient-derived Tumour Xenografts & Cell lines
5.1 Introduction
In many other tumour streams, various pre-clinical models have been utilized in order to either better understand the molecular biology of a particular tumour, particularly with regards to cell differentiation and metastasis, or to test efficacy of new therapeutic compounds. These systems include in vitro models such as tumour cell lines, which can be used directly to test drug susceptibility or injected into immune-compromised mice to provide a
‘secondary xenograft’, hence propagating the cells in vivo.
Typically, these types of models have several shortcomings resulting in the inability to translate tumour biological insights into clinical practice. The most problematic finding is that in vitro cell culture alters the gene expression of the specific tumour. This may remain true even when tumour cells are re- established in secondary xenografts. The reasons proposed for this alteration is that the original tumour-stromal interactions are lost during the process of cell culture in growth media; these cells have had to adapt to a new micro- environment which is fundamentally distinct and imposes different genetic
147 stresses on the tumour compared to when it is in its ‘natural’ environment in patients.203
This ‘problem’ has obvious implications for efficacious and reliable testing of drugs. More recently, tumour-specific patient-derived tumour xenografts have been established for multiple tumour types using immune- compromised mice. As opposed to cell lines and secondary xenografts, the
PDTX pre-clinical model remains ‘biologically stable’ in terms of its genetic profile, tumour morphology and response to drugs. It also provides a sustainable model as the original tumour is expanded in several generations while tumours from each of these generations of mice can be preserved for further engraftment and expansion at a later date.204
Anal cancer cell lines are not available for testing, let alone a more reliable pre-clinical model such as a PDTX. Our institution has experience with the establishment of PDTX models with intramuscular transplantation demonstrating significantly higher successful rates of engraftment compared to the traditional subcutaneous route in oesophageal cancer.205 The aim here was to establish an anal SCC patient-derived xenograft colony using anal cancer tissue obtained from patients at the time of their examination under anaesthesia prior to any definitive treatment. Anal cancer tissue obtained from successful
PDTXs was used to attempt development of an anal SCC cell line.
148 5.2 Results
5.2.1 Successful implantation
Anal squamous cell cancer pieces were implanted from five patients as per the method described in Chapter 2. Of the mice that survived, most had successful implantation of tumour in three patient lines, and this occurred between 4-8 weeks following implantation (Table 5.1).
5.2.2 Serial Transplantation
As per the flowchart in Figure 2.4, tumour from the first generation of mice was serially transplanted to create subsequent generations of xenografts. This was successful in three patient lines (Table 5.1). Two examples of the successfully engrafted mice are shown in Figures 5.1A-C.
149
A B C
Figure 5.1 Successfully engrafted PDTXs from two patient lines
First-generation of successfully engrafted intramuscular tumour for patient tumour ANAL2Ab with identifiable tumour growth prior to (A)
and after (B) dissection of overlying skin (C) Successful bilateral engraftment of patient tumour ANAL4F1 in a NSG mouse.
Table 5.1 Outcomes of Anal Cancer Patient-derived Tumour Xenografts
F0 Successful Passage 1 Successful Passage 2 Successful Passage 3 Successful Passage 4 ID (No. of mice) engraftment (No. of mice) engraftment (No. of mice) engraftment (No. of mice) engraftment (No. of mice)
N/A (Culled prior to 2 1 2 ANAL 1 2 1 allowing time for - - - (NSG) (NSG) (NSG) engraftment due to time constraints)
2 (NSG) -
2 - -
2 4 2 (Nudes) (Cryopreserved) ANAL 2A 2 2 36 (NOD scid) (NSG) (Nudes) +15 Nudes for 2 Refer to Ch. 5 N/A For Pilot dose-finding Experiment experiments
1 1 3 4 4 ANAL 2B 2 - - - (NSG) (NOD scid) (NSG) (Cryopreserved)
2 0 ANAL 3 ------(NOD scid) Mice died
2 2 1 1 3 1 4 2 ANAL 4 1 (1 died Day (NSG) (All mice died (NOD scid) (NSG) (1 died day 8) (NSG) (NSG) 29) between Days 1-19)
0 2 ANAL 5 (1 died Day 3, ------(NSG) 1 died Day 95)
5.2.3 Validation of PDTX tumour using Immunohistochemistry
Immunohistochemistry was carried out on both the primary patient tumour sample and the tumour grown on the xenograft for all patient lines.
Firstly H& E staining was carried out; both the primary tumour (Figure 5.2A) and the xenograft tumour (Figure 5.2B) demonstrate the same morphology.
A second stain on the xenograft tumour was undertaken for anti-human mitochondrial antibody. This demonstrated strong staining confirming that the xenograft tumour recapitulates the original patient tumour. (Figure 5.2C).
152
A B C
Figure 5.2 Validation of PDTX tumour
(A) x10 H&E of anal SCC from original patient sample (ANAL2A) (B) x10 H&E of anal SCC from ANAL2AF1 PDTX showing same
morphology as patient’s original tumour (C) x10 Anti-human mitochondrial antibody staining of ANAL2AF1 PDTX with negative staining of
mouse tissue.
5.2.4 Re-establishment of PDTXs following cryopreservation
As described in section 2.2.7.3, some tumour tissue from subsequent generations of anal SCC PDTXs was cryopreserved. Due to time constraints, I was unable to re-implant the cryopreserved tumour to ensure the PDTXs could be re-established.
A colleague who is continuing the research on anal SCC thawed out a cryopreserved 2mm piece of tissue from PDTX ANAL2AF2. This grew slowly over 15 months and was harvested at that time point. It was further processed into an anal SCC cell line as per the focus of the researcher.
5.2.5 Attempts at establishment of Anal SCC cell line
A considerable amount of effort was expended in attempting to establish an anal SCC cell line. As there was no reasonable precedent, the extensive experience with cell culture in the laboratory was drawn upon in developing various digestion protocols and using differing culture media.
There were four attempts made in total. The first was undertaken using tumour tissue from PDTX ANAL4F1 and prepared as described in 2.2.8. These were then plated using three different media (RPMI, DMEM and EpiGRO™).
Over several days, those using RPMI and DMEM media developed heavy growth of fibroblasts and debris and were discarded. There was successful growth of cells in the column in which Collagenase was used in the digestion
154 mix and the digested material was removed after 1 hour and placed in
EpiGRO™. The cells were transferred to a flask.
Several other attempts made use of tumour tissue from PDTXs
ANAL2AF2 and ANAL2BF2 with minor changes to the digestion protocol as previously described and using EpiGRO™ as the media. There were ongoing issues with passaging of cells including difficulty with retrieval of cells for passaging. Over a period of months, the cells that were successfully passaged were examined by a number of scientists and it appeared that some of the cells were changing morphology with a mesenchymal appearance. It was uncertain whether anal cancer cells were growing or a different type of cell.
Despite regular attendance and change of media, the flasks were noted to have become contaminated. Daily washing and changing of media and treatment with fungicide was unsuccessful and the flasks were discarded. In the interests of available time, a decision was made not to pursue cell lines further.
155 5.3 Discussion
Patient-derived tumour xenografts have become increasingly popular in the field of translational research over recent years. Multiple studies have now provided detailed characterization of xenograft-derived tumour proving it recapitulates the original tumour in histological structure, gene expression and molecular profiling. This confers an advantage over traditional cell lines as well as cell line-derived xenografts as discussed previously, thus providing an ideal pre-clinical model for biomarker identification and drug testing.204, 206
In this work, a colony of anal SCC PDTXs was established from three patient tumours. Time to engraftment was more rapid than expected (4-8 weeks) using the intramuscular implantation method developed at our institution, initially with oesophageal tumours. The published study compared subcutaneous and intramuscular implantation methods with successful engraftment in 1 of 6 patient tumours using the subcutaneous method and 13 of
18 using the IM method. This is attributed to the improved vascularity of the muscular transplant bed.205
To the best of our knowledge, this novel implantation technique has not been validated in other tumour types but was very successful for anal SCC.
Tumour samples from two patients were lost due to the premature death of the mice. Two of these were NOD scid and the remaining two were NSG mice (Table 5.1). Their immunodeficient state is well-recognised as a potential
156 drawback as they are prone to premature death prior to the tumour becoming established. Although a thorough comparison of the most efficient recipient strain of mouse has not been conducted, NSG mice have been reported to have the highest ‘take’ rate, as they are deficient in mature natural killer cells and lymphocytes.207 NOD scid mice, which are primarily used in subsequent generations rather than F0204 were used for the other patient sample as at the time the sample became available, there were no NSG mice in stock.
This work highlights a limitation of the use of PDTXs in that it is an expensive resource to establish and maintain, with availability of mice remaining a potential issue. This is especially the case if the mice are not ‘on site’ and need to be ordered, as a patient may have their surgery arranged within a timeframe that is not feasible for obtaining the mice.
An issue which arose specific to the growth of anal SCC PDTXs was the observation that the tumours produced variable amounts of ‘keratin pearls’.
These could be seen as white pearls of tissue on the tumour but with a distinctly different shade of white. This was recognized macroscopically early on.
The findings were assessed histologically by a clinical pathologist. The growth of keratin is considered normal for SCC and is a marker of differentiation. Thus, the tumour forms ‘cysts’ of keratin with a surrounding ‘capsule’ comprising tumour. This was addressed by scraping away the keratin and only using actual tumour tissue for passage into subsequent generations and for cryopreservation.
157 My colleague was successful in re-establishing an anal SCC PDTX from one of the patient lines following cryopreservation. A very tiny piece of tumour was implanted and it is uncertain whether this contributed to the slow growth compared to the original tumour. Nonetheless, the success in re-establishing the
PDTX further validates its utility as a pre-clinical model in the setting of a tumour for which access to tissue is limited. By proving cryopreservation and subsequent re-establishment of anal SCC PDTXs is feasible, the need for considerable resources in maintaining a perpetual PDTX biobank is reduced significantly. Cryopreservation may also allow for simplified sharing of PDTX resources and encourage collaboration between fellow researchers.
Despite the advantages of PDTXs as a pre-clinical model, cell lines remain a relatively inexpensive method for pre-clinical testing. PDTXs provide a perpetual source of tumour tissue for development of cell lines. This is particularly important for anal SCC, which is relatively rare. Nor is it routinely surgically resected pre-treatment, limiting access to tumour samples for establishment of a cell line.
A considerable amount of effort went into attempting to establish a cell line, taking advantage of the anal SCC tissue obtained from the PDTXs. These attempts were ultimately unsuccessful and due to time restrictions, this was not pursued for this body of work, but is being pursued by a colleague.
158 Chapter 6: Pre-clinical Study using Patient-derived Anal Cancer Xenografts
6.1 Introduction
Patient-derived tumour xenografts are currently the best surrogate clinical models available for testing new therapeutic approaches. Having identified
PIM1 as a potential novel target for anal SCC and having established a validated PDTX anal SCC model, a pilot experiment was proposed to test the efficacy of a PIM kinase inhibitor. A search of the literature revealed that Phase
1 clinical trials using a first generation PIM kinase inhibitor were terminated due to cardiotoxicity.
A second generation PIM kinase inhibitor was identified (TP-3654) which has been tested in pre-clinical trials of urothelial carcinoma using in nude mice.202 The pharmaceutical company manufacturing TP-3654 was contacted
(Tolero Pharmaceuticals, Utah) and the experiment plan (Appendix 3) provided to them in order to obtain the required amount of the PIM kinase inhibitor. The experiment plan is summarized below (Table 6.1); four groups were proposed, including a control group that only received the vehicle, a chemotherapy arm receiving the standard regimen for anal SCC of 5-FU and MMC, a molecular
159 therapy arm using TP-3654, and the final group receiving both chemotherapy and the molecular therapy.
The aim was to test the efficacy of the PIM kinase inhibitor TP-3654, both alone and in combination with standard chemotherapy agents, in inhibiting the growth of anal SCC.
Table 6.1 Plan of treatment groups for pilot experiment utilizing anal SCC
PDTXs
A. Control arm (Vehicle only)
B. Chemotherapy arm (5FU+MMC)
C. Molecular therapy arm (TP-3654 + Vehicle)
D. Chemotherapy/Molecular therapy arm (5FU+MMC+TP-3654 (+Vehicle))
6.2 Results
6.2.1 Dose-tolerability studies
Initially MMC was administered intravenously in 2 nude mice at 2mg/kg as used by Phillips et al.208 Mice were monitored closely for 4 days and were tolerating the MMC well with stable weights. Therefore 5FU was added and was administered to the same mice as an intraperitoneal injection at
160 8mg/kg/day over 5 days/week as per Miyake et al.209 Again the mice tolerated the addition of 5-FU well with no weight loss.
The doses were therefore increased to 3mg/kg for MMC and 10mg/kg for
5-FU. There was a 7% reduction in weight with good recovery (Figure 6.1), demonstrating that the maximum tolerated dose for combined therapy had been achieved.
Figure 6.1 Dose-tolerability study for combined 5FU/MMC in nude
mice demonstrating initial weight loss followed by good
recovery
A further study was then designed to test dose-tolerability of combination 5FU, MMC and TP-3654 in nude mice. A starting dose of
200mg/kg of TP-3654 via oral gavage for 5 days was commenced in consultation
161 with Tolero Pharmaceuticals Inc. At this dose, the mice lost a substantial amount of weight over a short period. Other than the weight loss, the drug was tolerated well but there were concerns with regards to maintaining this tolerance over several weeks during the experiment.
A dose-finding experiment at TP-3654 concentrations of 50mg/kg (2 mice), 100mg/kg (3 mice), 125mg/kg (3 mice) and 200mg/kg (2 mice) was then undertaken, still in combination with 5FU and MMC. The mice tolerated the combination of all three drugs well at all of these doses.
The final dose of TP-3654 used after the completion of dose-tolerability studies was 125mg/kg administered via oral gavage on Days 1-5, over three weeks. 5FU (10mg/kg) was administered intraperitoneally on Days 1-5 over three weeks. MMC (3mg/kg) was administered intravenously on Day 1 only.
6.2.2 Pilot experiment
Numbers of mice for each treatment group was based upon prior experience using xenograft models for efficacy studies. The aim was to include 8 to 9 mice in each group, which was deemed sufficient to yield statistically robust results.
Tumour from ANAL2AF2 (therefore the subsequent PDTXs were
ANAL2AF3) was implanted into 36 mice initially. Due to general limitations associated with PDTXs including premature death or lack of tumour growth in all mice, 5 mice were randomly allocated to one of four treatment groups when
162 tumour volume reached between 90 mm3 and 160mm3, except for the
5FU/MMC group, which had 6 mice. Tumour volume was measured twice weekly. The results are displayed in Figure 6.2A with a log2 scale used on the y- axis in order to more clearly demonstrate the modest differences between groups of mice.
Firstly, the 5FU/MMC was effective in reducing tumour growth compared to no treatment (p=0.0091). Although the PIM kinase inhibitor (PIMi) alone was less effective than 5FU/MMC, it did demonstrate stand-alone efficacy in reducing tumour growth compared to no treatment at all (p=0.0016). When used in combination with standard chemotherapy agents (5FU/MMC/PIMi), compared to using just the two drugs (5FU/MMC), there was a small further benefit which reached statistical significance (p=0.0003).
163
A B
Figure 6.2 Pilot experiments using anal SCC PDTXs
Results of pilot experiment (A) using anal SCC PDTXs and repeat experiment (B) comparing untreated mice with the use of standard
chemotherapy agents alone, with the PIM kinase inhibitor TP-3654 alone, and all in combination. Both experiments demonstrated stand-
alone efficacy of the PIMi in inhibiting tumour growth compared to no treatment (p=0.0016 for A and p=0.0006 for B). The addition
of PIMi to 5FU/MMC also demonstrated a modest but significant difference (p=0.0003 for A and p=0.0424 for B).
6.2.3 Repetition of experiment
The pilot experiment was repeated as part of ongoing work on anal SCC in the laboratory. (I was unable to repeat the experiment myself due to time constraints). The experiment was undertaken using the same protocol and with six mice recruited into each treatment group (Figure 6.2B). The PDTXs were derived from a new patient line using the third generation of PDTX.
The results are displayed in Figure 6.2B. The results did not identically replicate the results from the first experiment. Despite this, the PIM kinase inhibitor again demonstrated stand-alone efficacy compared to no treatment
(p=0.0006). Also, the benefit seen in using the combination of all 3 drugs
(5FU/MMC/PIMi) compared to only 5FU/MMC was replicated with statistical significance (p=0.0424). Interestingly, the actual patient from which the PDTX was derived did respond to CRT demonstrating the efficacy of radiotherapy in treating this disease. However, the same patient line has since been developed into a cell line in ongoing work in the laboratory and testing has shown resistance to 5FU/MMC consistent with the xenograft model.
6.3 Discussion
The experiment proposed in Figure 6.2A was executed as a pilot experiment using PDTXs derived from one patient line. The results demonstrated above are promising; not only was there some statistically significant, albeit small benefit
165 in the combination of standard chemotherapy agents with the PIM kinase inhibitor, TP-3654 demonstrated stand-alone efficacy compared to no treatment.
This finding was successfully replicated in the repeat experiment in PDTXs derived from a second patient line. This is a potentially exciting finding in the setting of anal SCC in which treatment options for relapsed or metastatic disease still rarely wander far from 5FU, MMC or cisplatin, other than in clinical trials.
One of the limitations of this study was the consistency in tumour measurements in non-sedated mice. This was partially addressed by having only one person measuring tumours the majority of the time, with a second person also measuring some of the time. Also, until the mice are culled, it is impossible to know how much of the growth on the PDTXs is true tumour and how much is keratin. Nonetheless, as the tumour tends to grow around the keratin as a capsule, enlargement of the mass remains representative of tumour growth.
Definitive treatment of primary anal SCC is radiotherapy with chemotherapy agents 5FU and MMC acting as radiosensitisers. A limitation of this study is that the tumours on the PDTXs were not irradiated. A small animal irradiator does exist and therefore this could be considered for future experiments. However, the validity and utility of this model is not undermined by this fact.
166 In the setting of relapsed and/or metastatic disease, chemotherapeutic drugs are at present the only options. As seen in these experiments, the standard agents are tolerated by the PDTX mice and therefore offer a model for testing and comparing any novel agents that arise in the future.
Further validation of the potential of TP-3654 in anal SCC requires that this experiment is repeated multiple times, and preferably in multiple patient lines to demonstrate that the results can be replicated. Although the results were not identical in the repeated experiment, two important findings from the first experiment were seen once again. Firstly, that the PIM kinase inhibitor had stand-alone efficacy compared to no treatment. Secondly, there was some benefit in adding the PIM kinase inhibitor to 5FU/MMC.
The result in the second experiment, which is somewhat unexpected, is that the 5FU/MMC was not effective in reducing tumour growth compared to no treatment (p=0.3851). It was noted that 2 of 6 mice in the ‘untreated’ group had small tumours (74.4 and 77.3mm3) at the time of recruitment and this may have skewed the data. Although this is not easily explained, it may be considered to add further weight to the stand-alone efficacy of the PIM kinase inhibitor compared to no treatment.
A significant limitation of both of the experiments was the small numbers of mice in each group. Further experiments will need careful planning to ensure tumour is implanted into a sufficient number of mice to allow for a
167 proportion that will not survive or produce tumour, and still contribute enough mice to be recruited into the experiment to provide robust results.
Regardless, at the most basic level, the two experiments conducted have demonstrated the feasibility of the anal SCC PDTX model. Anal SCC PDTXs can be propagated in multiple patient lines, and the standard chemotherapy drugs with the addition of at least one novel therapy are tolerated well. This provides a robust pre-clinical model for propagation of tumour tissue for development of anal SCC cell lines, as well as further experiments targeting novel therapies and/or investigating molecular profiles of anal SCC.
168 Chapter 7: General Discussion
7.1 Summary and significance of work undertaken in this study
Anal squamous cell carcinoma is a relatively rare tumour, which predominantly develops following infection with the human papilloma virus.
The standard of care for the primary tumour is definitive CRT although this is only successful in approximately 47-60% of cases depending on T-stage and nodal status,17 the remainder experiencing disease relapse. This may be localized to the site of primary disease or metastatic. In the former situation, salvage surgery may be possible with its resultant morbidity including a permanent stoma, with the aim of achieving 5-year survival rates of greater than 40%.75 In the setting of local relapse or metastatic disease, chemotherapy options are extremely limited with no significant advances made. In fact, the original regimen for primary treatment has remained essentially unchanged since it was first described by Nigro forty years ago.15
In contrast, the chemotherapy and immunotherapy options for other solid tumours have changed and improved in ‘leaps and bounds’ over the last twenty years, particularly in breast and colorectal cancer, as well as melanoma.
Albeit these tumours are more common than anal carcinoma, they are also more ‘popular’, attracting extensive research, resulting in multiple pre-clinical
169 models including cell lines and PDTXs. This has then allowed novel targets to be effectively progressed from the laboratory to Phase 1 trials and beyond to randomized clinical trials, and finally to routine use in patients.
This pathway thus far has more or less escaped advancement in anal
SCC. While a single cell line has been described,81 it has not, to the best of my knowledge, become available for use outside commercial arrangement with
Pharma. There have been limitations in the use of a transgenic mouse model due to the premature development of head and neck cancers.83
The work I have undertaken comprises a clinical component as well as a translational research approach to investigating anal SCC. From a clinical perspective, a retrospective database of patients with anal SCC treated at a single institution over a thirty year period was scrutinized to address two challenges in the management of this disease: assessment of response to CRT treatment, and patterns of treatment failure and subsequent outcomes.
Patient response to definitive CRT is not always easy to assess and remains for the most part, a clinical judgement based on examination findings, with or without biopsies if suspicion of persistent disease exists. The use of
FDG-PET post-treatment is not routinely used in other centres but has been standard practice at the Peter MacCallum Cancer Centre since 1998. The findings in this single largest reported cohort of 145 patients undergoing pre- and post-treatment PET scans demonstrated that a complete metabolic response on PET scan was predictive of overall survival and disease-free survival
170 compared to a partial or no response. Also, some patients had multiple PET scans following treatment to establish a complete response to CRT with scans being performed at a median of 11 weeks. Based upon this data, a period of 8 to
12 weeks may be suggested as a suitable time to utilize PET scans in assessing treatment response. A balance must be reached between performing scans too early, prompting unnecessary morbid salvage surgery versus detecting persistent disease in a timely fashion in order to offer appropriate and potentially life-saving salvage surgery.
Although data describing locoregional recurrence of anal SCC and salvage APR is available, descriptions of broad patterns of treatment failure are less readily available. The data obtained in the PMCC anal SCC database of 384 patients demonstrated various types of disease relapse including inguinal nodal disease, locoregional disease and distant metastatic disease. Although the overall numbers of patients with disease relapse are small, a variety of salvage treatment modalities are noted, ranging from surgery to radiotherapy and/or chemotherapy. There were three patients with multiple episodes of relapse deemed suitable for salvage treatment on multiple occasions, with periods of disease-free survival ensuing.
Overall, this data demonstrates that salvage treatment does not comprise only surgery and that multi-modality treatment can be effective in prolonging survival in carefully selected patients with either locoregional disease relapse or even isolated distant metastatic disease.
171 The patient details within the anal SCC database were also utilized in the translational research component of this work. RNA sequencing was used to analyse gene expression in eleven pre-treatment anal SCC specimens from patients included in the database. Tumour stage and nodal status was used to stratify patients into groups for comparison using the bioinformatics program
Galaxy. From this analysis, lists of genes with statistically significant differences in expression between groups were perused and several genes of interest were selected for further validation based upon their known involvement in cancer pathways and/or potential for targeted therapy.
Of the eight genes selected, the differential expression of four of them was validated using qRT-PCR. Further validation using immunohistochemistry was mostly unsuccessful. However, the most statistically significant gene identified through RNA-seq and qRT-PCR, PIM1 was observed to be strongly expressed in almost all tumour specimens and absent in normal anal canal specimens from corresponding patients. This finding is consistent with existing literature on the expression of the PIM1 oncogene in other solid tumours.
Additionally, PIM kinase inhibitors were found to already be in existence and in use in Phase 1 clinical trials.
In parallel with the RNA-seq analysis, a PDTX mouse model using three patient lines was established for anal SCC and validated. This development allowed this work to travel full-circle in that the PDTXs from two patient lines were utilized as a pre-clinical model in pilot experiments.
172 The second generation PIM kinase inhibitor TP-3654 was obtained with permission from the pharmaceutical company and the PDTXs treated with this novel therapy, comparing it to standard chemotherapy in anal SCC, alone and in combination. These small studies demonstrated a promising result in that there was statistically significant reduction in tumour growth, both alone and in combination with 5FU and MMC.
This finding is exciting as although the PIM kinase inhibitor may not be an improvement on established therapy, it offers a potentially new agent that may be active when disease is resistant or develops resistance to standard therapy. Given the stand-alone efficacy, PIM kinase inhibitors may be considered for recurrent or metastatic disease. The possibility of reducing the standard doses of 5FU/MMC, thus reducing toxicity, may also be considered based upon these findings.
7.2 Future directions
Firstly, the database will continue to be updated and expanded. Ideally this should be undertaken in a prospective fashion in order to provide more robust data. Some of the fields for data entry could be expanded to provide more detailed data. In particular, the ability to demonstrate if and how post- treatment PET scans influenced management decisions and its reliability could
173 be improved upon as this could potentially provide stronger evidence-based recommendations for routine surveillance of this disease.
The results obtained in this work justify further investigation into the efficacy of PIM kinase inhibitors for anal SCC. The intention of further work is to repeat the experiments using firstly the same patient lines and then other patient lines to demonstrate reproducible results with larger numbers of mice in each treatment group.
Most importantly, I have established a successful and robust pre-clinical model for anal SCC. These PDTXs represent a major step forward in the potential for further research. The benefits are two-fold. The obvious utilization is the ability to test other novel targets in a reliable pre-clinical model to evaluate response. Given the most recent knowledge regarding PIK3CA mutations in anal SCC, xenografts derived from tumours with confirmed mutations could be established and used for testing novel therapies targeting the PIK3CA/Akt pathway. Since my work was undertaken, further evidence has emerged that cross-talk exists between the PIM kinases and Akt kinases
(Figure 7.1). This overlap in mechanisms controlling cell growth, proliferation and survival has been demonstrated to be critical in progression and metastatic disease development in multiple types of cancers.210
This finding has been exploited in the laboratory by targeting multiple proteins in common pathways. PIM kinase inhibitors have been seen to act synergistically with Akt inhibitors to reduce growth of prostate cancer in vitro
174 and in vivo.211 Similarly, a synergistic response in triggering apoptosis of prostate cancer cells in vitro and in vivo was seen with the use of combination therapy with a PIM inhibitor and ABT-737, an inhibitor of Bcl-2.212 The anal SCC
PDTXs may be used to further investigate synergism in the use of multiple therapies, both in terms of efficacy and in understanding the molecular mechanisms by which the synergistic responses occur.
There also exists scope for investigation into the use of new drugs targeting some of the other genes that were identified by RNA-seq. In particular, the small molecule inhibitors specific for Myb195 and Bcl-2196 and a vaccine against Myb is currently being tested for use in colorectal cancer.197
Figure 7.1 Overlapping mechanisms by which PIM and Akt kinases
control cell growth
(As published by Warfel and Kraft, 2015 210)
175 Secondly, xenografts also provide a perpetual tissue bank of pre- treatment samples which can be accessed to develop successful cell lines and further elucidate details of molecular mechanisms specific to anal SCC in order to better understand important predictive and prognostic characteristics of this tumour.
The incidence of anal squamous cell carcinoma continues to rise. This work as well as other more recent work using advanced technologies such as next generation sequencing offers the hope of ongoing identification of potential targets and for the first time, the development of reliable pre-clinical models to facilitate testing novel therapies and uncovering the molecular mechanisms underlying this disease.
176 References
1. Humans IWGotEoCRt. Human papillomaviruses. IARC monographs on the evaluation of carcinogenic risks to humans / World Health Organization, International Agency for Research on Cancer. 2007;90:1-636. 2. Beckmann AM, Daling JR, Sherman KJ, Maden C, Miller BA, Coates RJ, et al. Human papillomavirus infection and anal cancer. International Journal of Cancer. 1989 Jun 15;43(6):1042-9. 3. Hoots BE, Palefsky JM, Pimenta JM, Smith JS. Human papillomavirus type distribution in anal cancer and anal intraepithelial lesions. International Journal of Cancer. 2009 May 15;124(10):2375-83. 4. Frisch M, Glimelius B, van den Brule AJ, Wohlfahrt J, Meijer CJ, Walboomers JM, et al. Sexually transmitted infection as a cause of anal cancer. The New England Journal of Medicine. 1997 Nov 6;337(19):1350-8. 5. Parkin DM. The global health burden of infection-associated cancers in the year 2002. International Journal of Cancer. 2006 Jun 15;118(12):3030-44. 6. Cancer WIICoHa. Disease burden estimates: anal cancer, incidence rates by cancer registry. Available from: http://www.hpvcentre.net/parser.php?xml=M2_Anal cancer_Incidence rates&iso=XWX&title=Module 2: Disease burden estimates - Anal cancer - Incidence rates. 7. Jin F, Stein AN, Conway EL, Regan DG, Law M, Brotherton JM, et al. Trends in anal cancer in Australia, 1982-2005. Vaccine. 2011 Mar 9;29(12):2322-7. 8. Silverberg MJ, Lau B, Justice AC, Engels E, Gill MJ, Goedert JJ, et al. Risk of anal cancer in HIV-infected and HIV-uninfected individuals in North America. Clinical Infectious Diseases: an official publication of the Infectious Diseases Society of America. 2012 Apr;54(7):1026-34. 9. Critchlow CW, Hawes SE, Kuypers JM, Goldbaum GM, Holmes KK, Surawicz CM, et al. Effect of HIV infection on the natural history of anal human papillomavirus infection. Aids. 1998 Jul 9;12(10):1177-84. 10. Sunesen KG, Norgaard M, Thorlacius-Ussing O, Laurberg S. Immunosuppressive disorders and risk of anal squamous cell carcinoma: a nationwide cohort study in Denmark, 1978-2005. International Journal of Cancer. 2010 Aug 1;127(3):675-84. 11. Edgren G, Sparen P. Risk of anogenital cancer after diagnosis of cervical intraepithelial neoplasia: a prospective population-based study. The Lancet Oncology. 2007 Apr;8(4):311-6. 12. Daling JR, Sherman KJ, Hislop TG, Maden C, Mandelson MT, Beckmann AM, et al. Cigarette smoking and the risk of anogenital cancer. American Journal of Epidemiology. 1992 Jan 15;135(2):180-9. 13. Daling JR, Madeleine MM, Johnson LG, Schwartz SM, Shera KA, Wurscher MA, et al. Human papillomavirus, smoking, and sexual practices in the etiology of anal cancer. Cancer. 2004 Jul 15;101(2):270-80.
14. Nigro ND, Vaitkevicius VK, Considine B, Jr. Combined therapy for cancer of the anal canal: a preliminary report. Diseases of the Colon and Rectum. 1974 May- Jun;17(3):354-6. 15. Buroker TR, Nigro N, Bradley G, Pelok L, Chomchai C, Considine B, et al. Combined therapy for cancer of the anal canal: a follow-up report. Diseases of the Colon and Rectum. 1977 Nov-Dec;20(8):677-8. 16. Tomaszewski JM, Link E, Leong T, Heriot A, Vazquez M, Chander S, et al. Twenty-five-year experience with radical chemoradiation for anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2012 Jun 1;83(2):552-8. 17. Ajani JA, Winter KA, Gunderson LL, Pedersen J, Benson AB, 3rd, Thomas CR, Jr., et al. Prognostic factors derived from a prospective database dictate clinical biology of anal cancer: the intergroup trial (RTOG 98-11). Cancer. 2010 Sep 1;116(17):4007-13. 18. Simpson JA, Scholefield JH. Diagnosis and management of anal intraepithelial neoplasia and anal cancer. BMJ: British Medical Journal. 2011;343:d6818. 19. Palmer JG, Scholefield JH, Coates PJ, Shepherd NA, Jass JR, Crawford LV, et al. Anal cancer and human papillomaviruses. Diseases of the Colon and Rectum. 1989 Dec;32(12):1016-22. 20. Roden R, Wu TC. How will HPV vaccines affect cervical cancer? Nature reviews Cancer. 2006 Oct;6(10):753-63. 21. Palefsky JM, Giuliano AR, Goldstone S, Moreira ED, Aranda C, Jessen H, et al. HPV vaccine against anal HPV infection and anal intraepithelial neoplasia. The New England Journal of Medicine. 2011 Oct 27;365(17):1576-85. 22. Greenall MJ, Quan SH, DeCosse JJ. Epidermoid cancer of the anus. The British Journal of Surgery. 1985 Sep;72 Suppl:S97-103. 23. Skibber J, Rodriguez-Bigas MA, Gordon PH. Surgical considerations in anal cancer. Surgical Oncology Clinics of North America. 2004 Apr;13(2):321-38. 24. Glynne-Jones R, Northover J, Oliveira J, Group EGW. Anal cancer: ESMO clinical recommendations for diagnosis, treatment and follow-up. Annals of oncology: official journal of the European Society for Medical Oncology / ESMO. 2009 May;20 Suppl 4:57-60. 25. Chawla AK, Willett CG. Squamous cell carcinoma of the anal canal and anal margin. Hematology / Oncology Clinics of North America. 2001 Apr;15(2):321-44. 26. Nilsson PJ, Svensson C, Goldman S, Ljungqvist O, Glimelius B. Epidermoid anal cancer: a review of a population-based series of 308 consecutive patients treated according to prospective protocols. International Journal of Radiation Oncology, Biology, Physics. 2005 Jan 1;61(1):92-102. 27. Bartelink H, Roelofsen F, Eschwege F, Rougier P, Bosset JF, Gonzalez DG, et al. Concomitant radiotherapy and chemotherapy is superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a phase III randomized trial of the European Organization for Research and Treatment of Cancer Radiotherapy and Gastrointestinal Cooperative Groups. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 1997 May;15(5):2040-9.
28. Ajani JA, Winter KA, Gunderson LL, Pedersen J, Benson AB, 3rd, Thomas CR, Jr., et al. Fluorouracil, mitomycin, and radiotherapy vs fluorouracil, cisplatin, and radiotherapy for carcinoma of the anal canal: a randomized controlled trial. JAMA: the Journal of the American Medical Association. 2008 Apr 23;299(16):1914-21. 29. Das P, Cantor SB, Parker CL, Zampieri JB, Baschnagel A, Eng C, et al. Long-term quality of life after radiotherapy for the treatment of anal cancer. Cancer. 2010 Feb 15;116(4):822-9. 30. Glynne-Jones R, Renehan A. Current treatment of anal squamous cell carcinoma. Hematology / Oncology Clinics of North America. 2012 Dec;26(6):1315-50. 31. Zbar AP, Fenger C, Efron J, Beer-Gabel M, Wexner SD. The pathology and molecular biology of anal intraepithelial neoplasia: comparisons with cervical and vulvar intraepithelial carcinoma. International Journal of Colorectal Disease. 2002 Jul;17(4):203-15. 32. Edge SB, Byrd DR, Compton CC, al e. AJCC cancer staging manual. 7th edition ed. New York: Springer; 2009. 33. Renehan AG, O'Dwyer ST. Initial management through the anal cancer multidisciplinary team meeting. Colorectal Disease: the official Journal of the Association of Coloproctology of Great Britain and Ireland. 2011 Feb;13 Suppl 1:21-8. 34. Benson AB, Venook AP, Bekaii-Saab T, al. e. NCCN Clincal Practice Guidelines in Oncology. Anal Carcinoma. Version 2. JNCCN: Journal of the National Comprehensive Cancer Network. 2016. 35. Roach SC, Hulse PA, Moulding FJ, Wilson R, Carrington BM. Magnetic resonance imaging of anal cancer. Clinical Radiology. 2005 Oct;60(10):1111-9. 36. Parikh J, Shaw A, Grant LA, Schizas AM, Datta V, Williams AB, et al. Anal carcinomas: the role of endoanal ultrasound and magnetic resonance imaging in staging, response evaluation and follow-up. European Radiology. 2011 Apr;21(4):776-85. 37. Matthews JH, Burmeister BH, Borg M, Capp AL, Joseph D, Thompson KM, et al. T1-2 anal carcinoma requires elective inguinal radiation treatment--the results of Trans Tasman Radiation Oncology Group study TROG 99.02. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology. 2011 Jan;98(1):93-8. 38. Gerard JP, Chapet O, Samiei F, Morignat E, Isaac S, Paulin C, et al. Management of inguinal lymph node metastases in patients with carcinoma of the anal canal: experience in a series of 270 patients treated in Lyon and review of the literature. Cancer. 2001 Jul 1;92(1):77-84. 39. Mistrangelo DM, Bello M, Cassoni P, Milanesi E, Racca P, Munoz F, et al. Value of staging squamous cell carcinoma of the anal margin and canal using the sentinel lymph node procedure: an update of the series and a review of the literature. British Journal of Cancer. 2013 Feb 19;108(3):527-32. 40. Tehranian S, Treglia G, Krag DN, Dabbagh Kakhki VR, Zakavi SR, Sadeghi R, et al. Sentinel node mapping in anal canal cancer: systematic review and meta- analysis. JGLD: Journal of Gastrointestinal and Liver Diseases. 2013 Sep;22(3):321-8.
41. Noorani A, Rabey N, Durrani A, Walsh SR, Davies RJ. Systematic review of sentinel lymph node biopsy in anal squamous cell carcinoma. International Journal of Surgery. 2013;11(9):762-6. 42. de Jong JS, Beukema JC, van Dam GM, Slart R, Lemstra C, Wiggers T. Limited value of staging squamous cell carcinoma of the anal margin and canal using the sentinel lymph node procedure: a prospective study with long-term follow-up. Annals of Surgical Oncology. 2010 Oct;17(10):2656-62. 43. Myerson RJ, Kong F, Birnbaum EH, Fleshman JW, Kodner IJ, Picus J, et al. Radiation therapy for epidermoid carcinoma of the anal canal, clinical and treatment factors associated with outcome. Radiotherapy and Oncology: Journal of the European Society for Therapeutic Radiology and Oncology. 2001 Oct;61(1):15-22. 44. Winton E, Heriot AG, Ng M, Hicks RJ, Hogg A, Milner A, et al. The impact of 18- fluorodeoxyglucose positron emission tomography on the staging, management and outcome of anal cancer. British Journal of Cancer. 2009 Mar 10;100(5):693- 700. 45. Nguyen BT, Joon DL, Khoo V, Quong G, Chao M, Wada M, et al. Assessing the impact of FDG-PET in the management of anal cancer. Radiotherapy and Oncology: Journal of the European Society for Therapeutic Radiology and Oncology. 2008 Jun;87(3):376-82. 46. Jones M, Hruby G, Solomon M, Rutherford N, Martin J. The Role of FDG-PET in the Initial Staging and Response Assessment of Anal Cancer: A Systematic Review and Meta-analysis. Annals of Surgical Oncology. 2015 Oct;22(11):3574-81. 47. Mistrangelo M, Pelosi E, Bello M, Ricardi U, Milanesi E, Cassoni P, et al. Role of positron emission tomography-computed tomography in the management of anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2012 Sep 1;84(1):66-72. 48. Glynne-Jones R, Sebag-Montefiore D, Adams R, Gollins S, Harrison M, Meadows HM, et al. Prognostic factors for recurrence and survival in anal cancer: generating hypotheses from the mature outcomes of the first United Kingdom Coordinating Committee on Cancer Research Anal Cancer Trial (ACT I). Cancer. 2013 Feb 15;119(4):748-55. 49. Das P, Bhatia S, Eng C, Ajani JA, Skibber JM, Rodriguez-Bigas MA, et al. Predictors and patterns of recurrence after definitive chemoradiation for anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2007 Jul 1;68(3):794-800. 50. Gilbert DC, Williams A, Allan K, Stokoe J, Jackson T, Linsdall S, et al. p16INK4A, p53, EGFR expression and KRAS mutation status in squamous cell cancers of the anus: correlation with outcomes following chemo-radiotherapy. Radiotherapy and Oncology: Journal of the European Society for Therapeutic Radiology and Oncology. 2013 Oct;109(1):146-51. 51. Rodel F, Wieland U, Fraunholz I, Kitz J, Rave-Frank M, Wolff HA, et al. Human papillomavirus DNA load and p16INK4a expression predict for local control in patients with anal squamous cell carcinoma treated with chemoradiotherapy. International Journal of Cancer. 2015 Jan 15;136(2):278-88.
52. Gunderson LL, Winter KA, Ajani JA, Pedersen JE, Moughan J, Benson AB, 3rd, et al. Long-term update of US GI intergroup RTOG 98-11 phase III trial for anal carcinoma: survival, relapse, and colostomy failure with concurrent chemoradiation involving fluorouracil/mitomycin versus fluorouracil/cisplatin. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2012 Dec 10;30(35):4344-51. 53. Day FL, Link E, Ngan S, Leong T, Moodie K, Lynch C, et al. FDG-PET metabolic response predicts outcomes in anal cancer managed with chemoradiotherapy. British Journal of Cancer. 2011 Aug 9;105(4):498-504. 54. Bazan JG, Koong AC, Kapp DS, Quon A, Graves EE, Loo BW, Jr., et al. Metabolic tumor volume predicts disease progression and survival in patients with squamous cell carcinoma of the anal canal. Journal of Nuclear Medicine: official publication, Society of Nuclear Medicine. 2013 Jan;54(1):27-32. 55. Epidermoid anal cancer: results from the UKCCCR randomised trial of radiotherapy alone versus radiotherapy, 5-fluorouracil, and mitomycin. UKCCCR Anal Cancer Trial Working Party. UK Co-ordinating Committee on Cancer Research. Lancet. 1996 Oct 19;348(9034):1049-54. 56. Flam M, John M, Pajak TF, Petrelli N, Myerson R, Doggett S, et al. Role of mitomycin in combination with fluorouracil and radiotherapy, and of salvage chemoradiation in the definitive nonsurgical treatment of epidermoid carcinoma of the anal canal: results of a phase III randomized intergroup study. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 1996 Sep;14(9):2527-39. 57. James RD, Glynne-Jones R, Meadows HM, Cunningham D, Myint AS, Saunders MP, et al. Mitomycin or cisplatin chemoradiation with or without maintenance chemotherapy for treatment of squamous-cell carcinoma of the anus (ACT II): a randomised, phase 3, open-label, 2 x 2 factorial trial. The Lancet Oncology. 2013 May;14(6):516-24. 58. Glynne-Jones R, James R, Meadows H, al. e. Optimum time to assess complete clinical response (CR) following chemoradiation (CRT) using mitomycin C (MMC) or cisplatin (CisP), with or without maintenance CisP/5FU in squamous cell carcinoma of the anus: Results of ACT II. Journal of Clinical Oncology: Journal of the American Society of Clinical Oncology. 2012;30(suppl; abstr 4004). 59. Peiffert D, Tournier-Rangeard L, Gerard JP, Lemanski C, Francois E, Giovannini M, et al. Induction chemotherapy and dose intensification of the radiation boost in locally advanced anal canal carcinoma: final analysis of the randomized UNICANCER ACCORD 03 trial. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2012 Jun 1;30(16):1941-8. 60. Eng C, Chang GJ, Das P, al. e. Phase II study of capecitabine and oxaliplatin with concurrent radiation therapy (XELOX-XRT) for squamous cell carcinoma of the anal canal [abstract 4116]. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2009;27(15S).
61. Glynne-Jones R, Meadows H, Wan S, Gollins S, Leslie M, Levine E, et al. EXTRA- -a multicenter phase II study of chemoradiation using a 5 day per week oral regimen of capecitabine and intravenous mitomycin C in anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2008 Sep 1;72(1):119-26. 62. Olivatto LO, Vieira FM, Pereira BV, Victorino AP, Bezerra M, Araujo CM, et al. Phase 1 study of cetuximab in combination with 5-fluorouracil, cisplatin, and radiotherapy in patients with locally advanced anal canal carcinoma. Cancer. 2013 Aug 15;119(16):2973-80. 63. Deutsch E, Lemanski C, Pignon JP, Levy A, Delarochefordiere A, Martel-Lafay I, et al. Unexpected toxicity of cetuximab combined with conventional chemoradiotherapy in patients with locally advanced anal cancer: results of the UNICANCER ACCORD 16 phase II trial. Annals of Oncology: official Journal of the European Society for Medical Oncology / ESMO. 2013 Nov;24(11):2834-8. 64. Garg MK, Zhao F, Sparano JA, Palefsky J, Whittington R, Mitchell EP, et al. Cetuximab Plus Chemoradiotherapy in Immunocompetent Patients With Anal Carcinoma: A Phase II Eastern Cooperative Oncology Group-American College of Radiology Imaging Network Cancer Research Group Trial (E3205). Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2017 Mar;35(7):718-26. 65. Ng M, Leong T, Chander S, Chu J, Kneebone A, Carroll S, et al. Australasian Gastrointestinal Trials Group (AGITG) contouring atlas and planning guidelines for intensity-modulated radiotherapy in anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2012 Aug 1;83(5):1455-62. 66. John M, Pajak T, Flam M, Hoffman J, Markoe A, Wolkov H, et al. Dose escalation in chemoradiation for anal cancer: preliminary results of RTOG 92-08. The Cancer Journal from Scientific American. 1996 Jul-Aug;2(4):205-11. 67. Ortholan C, Resbeut M, Hannoun-Levi JM, Teissier E, Gerard JP, Ronchin P, et al. Anal canal cancer: management of inguinal nodes and benefit of prophylactic inguinal irradiation (CORS-03 Study). International Journal of Radiation Oncology, Biology, Physics. 2012 Apr 1;82(5):1988-95. 68. Pepek JM, Willett CG, Wu QJ, Yoo S, Clough RW, Czito BG. Intensity-modulated radiation therapy for anal malignancies: a preliminary toxicity and disease outcomes analysis. International Journal of Radiation Oncology, Biology, Physics. 2010 Dec 1;78(5):1413-9. 69. Kachnic LA, Tsai HK, Coen JJ, Blaszkowsky LS, Hartshorn K, Kwak EL, et al. Dose-painted intensity-modulated radiation therapy for anal cancer: a multi- institutional report of acute toxicity and response to therapy. International Journal of Radiation Oncology, Biology, Physics. 2012 Jan 1;82(1):153-8. 70. Kachnic LA, Winter K, Myerson RJ, Goodyear MD, Willins J, Esthappan J, et al. RTOG 0529: a phase 2 evaluation of dose-painted intensity modulated radiation therapy in combination with 5-fluorouracil and mitomycin-C for the reduction of acute morbidity in carcinoma of the anal canal. International Journal of Radiation Oncology, Biology, Physics. 2013 May 1;86(1):27-33.
71. Myerson RJ, Garofalo MC, El Naqa I, Abrams RA, Apte A, Bosch WR, et al. Elective clinical target volumes for conformal therapy in anorectal cancer: a radiation therapy oncology group consensus panel contouring atlas. International Journal of Radiation Oncology, Biology, Physics. 2009 Jul 1;74(3):824-30. 72. Gay HA, Barthold HJ, O'Meara E, Bosch WR, El Naqa I, Al-Lozi R, et al. Pelvic normal tissue contouring guidelines for radiation therapy: a Radiation Therapy Oncology Group consensus panel atlas. International Journal of Radiation Oncology, Biology, Physics. 2012 Jul 1;83(3):e353-62. 73. Renehan AG, Saunders MP, Schofield PF, O'Dwyer ST. Patterns of local disease failure and outcome after salvage surgery in patients with anal cancer. The British Journal of Surgery. 2005 May;92(5):605-14. 74. Wright JL, Patil SM, Temple LK, Minsky BD, Saltz LB, Goodman KA. Squamous cell carcinoma of the anal canal: patterns and predictors of failure and implications for intensity-modulated radiation treatment planning. International Journal of Radiation Oncology, Biology, Physics. 2010 Nov 15;78(4):1064-72. 75. Renehan AG, O'Dwyer ST. Management of local disease relapse. Colorectal Disease: the official Journal of the Association of Coloproctology of Great Britain and Ireland. 2011 Feb;13 Suppl 1:44-52. 76. Myint AS. Follow up. Colorectal Disease: the official Journal of the Association of Coloproctology of Great Britain and Ireland. 2011 Feb;13 Suppl 1:39-43. 77. Correa JH, Castro LS, Kesley R, Dias JA, Jesus JP, Olivatto LO, et al. Salvage abdominoperineal resection for anal cancer following chemoradiation: a proposed scoring system for predicting postoperative survival. Journal of Surgical Oncology. 2013 Apr;107(5):486-92. 78. Hallemeier CL, You YN, Larson DW, Dozois EJ, Nelson H, Klein KA, et al. Multimodality therapy including salvage surgical resection and intraoperative radiotherapy for patients with squamous-cell carcinoma of the anus with residual or recurrent disease after primary chemoradiotherapy. Diseases of the Colon and Rectum. 2014 Apr;57(4):442-8. 79. De Vuyst H, Clifford GM, Nascimento MC, Madeleine MM, Franceschi S. Prevalence and type distribution of human papillomavirus in carcinoma and intraepithelial neoplasia of the vulva, vagina and anus: a meta-analysis. International Journal of Cancer. 2009 Apr 1;124(7):1626-36. 80. Darragh TM, Colgan TJ, Thomas Cox J, Heller DS, Henry MR, Luff RD, et al. The Lower Anogenital Squamous Terminology Standardization project for HPV- associated lesions: background and consensus recommendations from the College of American Pathologists and the American Society for Colposcopy and Cervical Pathology. International Journal of Gynecological Pathology: official Journal of the International Society of Gynecological Pathologists. 2013 Jan;32(1):76-115. 81. Takeda A, Maeda M, Iseki H, Hirooka E, Shinozuka N, Koyama I. Establishment and characterization of the human SaTM-1 anal canal squamous cell carcinoma cell line derived from lymph node metastasis. International Journal of Molecular Medicine. 2009 Oct;24(4):465-72.
82. Stelzer MK, Pitot HC, Liem A, Schweizer J, Mahoney C, Lambert PF. A mouse model for human anal cancer. Cancer Prevention Research. 2010;3(12):1534-41. 83. Sun ZJ, Zhang L, Zhang W, Hall B, Bian Y, Kulkarni AB. Inhibition of mTOR Reduces Anal Carcinogenesis in Transgenic Mouse Model. PloS one. 2013;8(10):e74888. 84. Stelzer MK, Pitot HC, Liem A, Lee D, Kennedy GD, Lambert PF. Rapamycin inhibits anal carcinogenesis in two preclinical animal models. Cancer Prevention Research. 2010 Dec;3(12):1542-51. 85. Ghittoni R, Accardi R, Hasan U, Gheit T, Sylla B, Tommasino M. The biological properties of E6 and E7 oncoproteins from human papillomaviruses. Virus Genes. 2010 Feb;40(1):1-13. 86. Chatterjee A. The next generation of HPV vaccines: nonavalent vaccine V503 on the horizon. Expert review of vaccines. 2014 Nov;13(11):1279-90. 87. zur Hausen H. Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. Journal of the National Cancer Institute. 2000 May 3;92(9):690-8. 88. Schiffman M, Wentzensen N, Wacholder S, Kinney W, Gage JC, Castle PE. Human papillomavirus testing in the prevention of cervical cancer. Journal of the National Cancer Institute. 2011 Mar 2;103(5):368-83. 89. Werness BA, Levine AJ, Howley PM. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science. 1990 Apr 6;248(4951):76-9. 90. Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell. 1990 Dec 21;63(6):1129-36. 91. Thomas M, Pim D, Banks L. The role of the E6-p53 interaction in the molecular pathogenesis of HPV. Oncogene. 1999 Dec 13;18(53):7690-700. 92. Dyson N, Howley PM, Munger K, Harlow E. The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science. 1989 Feb 17;243(4893):934-7. 93. Watson AJ, Smith BB, Whitehead MR, Sykes PH, Frizelle FA. Malignant progression of anal intra-epithelial neoplasia. ANZ Journal of Surgery. 2006 Aug;76(8):715-7. 94. Scholefield JH, Castle MT, Watson NF. Malignant transformation of high-grade anal intraepithelial neoplasia. British Journal of Surgery. 2005 Sep;92(9):1133-6. 95. Evander M, Edlund K, Gustafsson A, Jonsson M, Karlsson R, Rylander E, et al. Human papillomavirus infection is transient in young women: a population- based cohort study. The Journal of Infectious Diseases. 1995 Apr;171(4):1026-30. 96. zur Hausen H. Papillomaviruses in human cancers. Proceedings of the Association of American Physicians. 1999 Nov-Dec;111(6):581-7. 97. Rodriguez AC, Schiffman M, Herrero R, Hildesheim A, Bratti C, Sherman ME, et al. Longitudinal study of human papillomavirus persistence and cervical intraepithelial neoplasia grade 2/3: critical role of duration of infection. Journal of the National Cancer Institute. 2010 Mar 3;102(5):315-24. 98. Stanley M. Immune responses to human papillomavirus. Vaccine. 2006 Mar 30;24 Suppl 1:S16-22.
99. Caberg JH, Hubert PM, Begon DY, Herfs MF, Roncarati PJ, Boniver JJ, et al. Silencing of E7 oncogene restores functional E-cadherin expression in human papillomavirus 16-transformed keratinocytes. Carcinogenesis. 2008 Jul;29(7):1441-7. 100. Hubert P, Caberg JH, Gilles C, Bousarghin L, Franzen-Detrooz E, Boniver J, et al. E-cadherin-dependent adhesion of dendritic and Langerhans cells to keratinocytes is defective in cervical human papillomavirus-associated (pre)neoplastic lesions. The Journal of Pathology. 2005 Jul;206(3):346-55. 101. Pardoll DM. The blockade of immune checkpoints in cancer immunotherapy. Nature Reviews Cancer. 2012 Apr;12(4):252-64. 102. Spardy N, Covella K, Cha E, Hoskins EE, Wells SI, Duensing A, et al. Human papillomavirus 16 E7 oncoprotein attenuates DNA damage checkpoint control by increasing the proteolytic turnover of claspin. Cancer Research. 2009 Sep 1;69(17):7022-9. 103. Bendell JC, Eng C, Moore KN, Burris HA, Meric-Bernstam F, Jones SF, et al. Checkpoint kinase (CHK) 1/2 inhibitor LY2606368 in a phase I, dose-expansion study in patients (pts) with metastatic squamous cell carcinoma (mSCC) of the anus. American Society of Clinical Oncology (ASCO) Chicago, USA: Journal of Clinical Oncology 33 (suppl; abstr 3520); 2015. 104. Gervaz P, Hirschel B, Morel P. Molecular biology of squamous cell carcinoma of the anus. BMJ: British Journal of Surgery. 2006 May;93(5):531-8. 105. Marin-Muller C, Li M, Chen C, Yao Q. Current understanding and potential immunotherapy for HIV-associated squamous cell carcinoma of the anus (SCCA). World Journal of Surgery. 2009 Apr;33(4):653-60. 106. Muleris M, Salmon RJ, Girodet J, Zafrani B, Dutrillaux B. Recurrent deletions of chromosomes 11q and 3p in anal canal carcinoma. International Journal of Cancer. 1987 May 15;39(5):595-8. 107. Heselmeyer K, du Manoir S, Blegen H, Friberg B, Svensson C, Schrock E, et al. A recurrent pattern of chromosomal aberrations and immunophenotypic appearance defines anal squamous cell carcinomas. British Journal of Cancer. 1997;76(10):1271-8. 108. Gervaz P, Hahnloser D, Wolff BG, Anderson SA, Cunningham J, Beart RW, Jr., et al. Molecular biology of squamous cell carcinoma of the anus: a comparison of HIV-positive and HIV-negative patients. Journal of Gastrointestinal Surgery: official Journal of the Society for Surgery of the Alimentary Tract. 2004 Dec;8(8):1024-30; discussion 31. 109. Gervaz P, Efron J, Poza AA, Chun SW, Pham TT, Woodhouse S, et al. Loss of heterozygosity and HIV infection in patients with anal squamous-cell carcinoma. Diseases of the Colon and Rectum. 2001 Oct;44(10):1503-8. 110. Hampton GM, Penny LA, Baergen RN, Larson A, Brewer C, Liao S, et al. Loss of heterozygosity in cervical carcinoma: subchromosomal localization of a putative tumor-suppressor gene to chromosome 11q22-q24. Proceedings of the National Academy of Sciences of the United States of America. 1994 Jul 19;91(15):6953-7. 111. Evans MF, Koreth J, Bakkenist CJ, Herrington CS, McGee JO. Allelic deletion at 11q23.3-q25 is an early event in cervical neoplasia. Oncogene. 1998 May 14;16(19):2557-64.
112. Steenbergen RD, Hermsen MA, Walboomers JM, Meijer GA, Baak JP, Meijer CJ, et al. Non-random allelic losses at 3p, 11p and 13q during HPV-mediated immortalization and concomitant loss of terminal differentiation of human keratinocytes. International Journal of Cancer. 1998 May 4;76(3):412-7. 113. Steenbergen RD, Walboomers JM, Meijer CJ, van der Raaij-Helmer EM, Parker JN, Chow LT, et al. Transition of human papillomavirus type 16 and 18 transfected human foreskin keratinocytes towards immortality: activation of telomerase and allele losses at 3p, 10p, 11q and/or 18q. Oncogene. 1996 Sep 19;13(6):1249-57. 114. Lampejo T, Kavanagh D, Clark J, Goldin R, Osborn M, Ziprin P, et al. Prognostic biomarkers in squamous cell carcinoma of the anus: a systematic review. British Journal of Cancer. 2010 Dec 7;103(12):1858-69. 115. Ogunbiyi OA, Scholefield JH, Smith JH, Polacarz SV, Rogers K, Sharp F. Immunohistochemical analysis of p53 expression in anal squamous neoplasia. Journal of Clinical Pathology. 1993 Jun;46(6):507-12. 116. Wong CS, Tsao MS, Sharma V, Chapman WB, Pintilie M, Cummings BJ. Prognostic role of p53 protein expression in epidermoid carcinoma of the anal canal. International Journal of Radiation Oncology, Biology, Physics. 1999 Sep 1;45(2):309-14. 117. Allal AS, Waelchli L, Brundler MA. Prognostic value of apoptosis-regulating protein expression in anal squamous cell carcinoma. Clinical Cancer Research: an official Journal of the American Association for Cancer Research. 2003 Dec 15;9(17):6489-96. 118. Bonin SR, Pajak TF, Russell AH, Coia LR, Paris KJ, Flam MS, et al. Overexpression of p53 protein and outcome of patients treated with chemoradiation for carcinoma of the anal canal: a report of randomized trial RTOG 87-04. Radiation Therapy Oncology Group. Cancer. 1999 Mar 15;85(6):1226-33. 119. Mawdsley S, Meadows H, James R, editors. The role of biological molecular markers in predictingboth response to treatment and clinical outcome in squamous cell carcinoma of the anus [Abstract 183]. ASCO 2004 Gastrointestinal Cancers Symposium Proceedings; 2004; San Francisco. 120. Holm R, Skovlund E, Skomedal H, Florenes VA, Tanum G. Reduced expression of p21WAF1 is an indicator of malignant behaviour in anal carcinomas. Histopathology. 2001 Jul;39(1):43-9. 121. Nilsson PJ, Lenander C, Rubio C, Auer G, Ljungqvist O, Glimelius B. Prognostic significance of Cyclin A in epidermoid anal cancer. Oncology Reports. 2006 Sep;16(3):443-9. 122. Patel H, Polanco-Echeverry G, Segditsas S, Volikos E, McCart A, Lai C, et al. Activation of AKT and nuclear accumulation of wild type TP53 and MDM2 in anal squamous cell carcinoma. International Journal of Cancer. 2007 Dec 15;121(12):2668-73. 123. Le LH, Chetty R, Moore MJ. Epidermal growth factor receptor expression in anal canal carcinoma. American Journal of Clinical Pathology. 2005 Jul;124(1):20-3.
124. Alvarez G, Perry A, Tan BR, Wang HL. Expression of epidermal growth factor receptor in squamous cell carcinomas of the anal canal is independent of gene amplification. Modern Pathology: an official Journal of the United States and Canadian Academy of Pathology, Inc. 2006 Jul;19(7):942-9. 125. Ajani JA, Wang X, Izzo JG, Crane CH, Eng C, Skibber JM, et al. Molecular biomarkers correlate with disease-free survival in patients with anal canal carcinoma treated with chemoradiation. Digestive Diseases and Sciences. 2010 Apr;55(4):1098-105. 126. Grabenbauer GG, Matzel KE, Schneider IH, Meyer M, Wittekind C, Matsche B, et al. Sphincter preservation with chemoradiation in anal canal carcinoma: abdominoperineal resection in selected cases? Diseases of the Colon and Rectum. 1998 Apr;41(4):441-50. 127. Bruland O, Fluge O, Immervoll H, Balteskard L, Myklebust M, Skarstein A, et al. Gene expression reveals two distinct groups of anal carcinomas with clinical implications. British Journal of Cancer. 2008 Apr 8;98(7):1264-73. 128. Goldman S, Svensson C, Bronnergard M, Glimelius B, Wallin G. Prognostic significance of serum concentration of squamous cell carcinoma antigen in anal epidermoid carcinoma. International Journal of Colorectal Disease. 1993 Jul;8(2):98-102. 129. Nicholson RI, Gee JM, Harper ME. EGFR and cancer prognosis. European Journal of Cancer. 2001 Sep;37 Suppl 4:S9-15. 130. Ciardiello F, Tortora G. EGFR antagonists in cancer treatment. The New England Journal of Medicine. 2008 Mar 13;358(11):1160-74. 131. Van Damme N, Deron P, Van Roy N, Demetter P, Bols A, Van Dorpe J, et al. Epidermal growth factor receptor and K-RAS status in two cohorts of squamous cell carcinomas. BMC Cancer. 2010;10:189. 132. Paliga A, Onerheim R, Gologan A, Chong G, Spatz A, Niazi T, et al. EGFR and K- ras gene mutation status in squamous cell anal carcinoma: a role for concurrent radiation and EGFR inhibitors? British Journal of Cancer. 2012 Nov 20;107(11):1864-8. 133. Zampino MG, Magni E, Sonzogni A, Renne G. K-ras status in squamous cell anal carcinoma (SCC): it's time for target-oriented treatment? Cancer Chemotherapy and Pharmacology. 2009 Dec;65(1):197-9. 134. Bokemeyer C, Bondarenko I, Makhson A, Hartmann JT, Aparicio J, de Braud F, et al. Fluorouracil, leucovorin, and oxaliplatin with and without cetuximab in the first-line treatment of metastatic colorectal cancer. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2009 Feb 10;27(5):663-71. 135. Sheppard K, Kinross KM, Solomon B, Pearson RB, Phillips WA. Targeting PI3 kinase/AKT/mTOR signaling in cancer. Critical Reviews in Oncogenesis. 2012;17(1):69-95. 136. Bussink J, van der Kogel AJ, Kaanders JH. Activation of the PI3-K/AKT pathway and implications for radioresistance mechanisms in head and neck cancer. The Lancet Oncology. 2008 Mar;9(3):288-96.
137. Vanhaesebroeck B, Stephens L, Hawkins P. PI3K signalling: the path to discovery and understanding. Nature Reviews Molecular Cell Biology. 2012 Mar;13(3):195- 203. 138. Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in tumor suppression. Cell. 2000 Feb 18;100(4):387-90. 139. Menges CW, Baglia LA, Lapoint R, McCance DJ. Human papillomavirus type 16 E7 up-regulates AKT activity through the retinoblastoma protein. Cancer Research. 2006 Jun 1;66(11):5555-9. 140. Martin V, Zanellato E, Franzetti-Pellanda A, Molinari F, Movilia A, Paganotti A, et al. EGFR, KRAS, BRAF, and PIK3CA characterization in squamous cell anal cancer. Histology and Histopathology. 2013 Oct 14. 141. Thomas LK, Bermejo JL, Vinokurova S, Jensen K, Bierkens M, Steenbergen R, et al. Chromosomal gains and losses in human papillomavirus-associated neoplasia of the lower genital tract- a systematic review and meta-analysis. European Journal of Cancer. 2014 Jan;50(1):85-98. 142. Ricciardi R, Burks E, Schoetz DJ, Verma Y, Kershnar E, Kilpatrick MW, et al. Is there a gain in chromosome 3q in the pathway to anal cancer? Diseases of the Colon and Rectum. 2014 Oct;57(10):1183-7. 143. Crawford RA, Caldwell C, Iles RK, Lowe D, Shepherd JH, Chard T. Prognostic significance of the bcl-2 apoptotic family of proteins in primary and recurrent cervical cancer. British Journal of Cancer. 1998 Jul;78(2):210-4. 144. Yuan H, Fu F, Zhuo J, Wang W, Nishitani J, An DS, et al. Human papillomavirus type 16 E6 and E7 oncoproteins upregulate c-IAP2 gene expression and confer resistance to apoptosis. Oncogene. 2005 Jul 28;24(32):5069-78. 145. James MA, Lee JH, Klingelhutz AJ. Human papillomavirus type 16 E6 activates NF-kappaB, induces cIAP-2 expression, and protects against apoptosis in a PDZ binding motif-dependent manner. Journal of Virology. 2006 Jun;80(11):5301-7. 146. Borbely AA, Murvai M, Konya J, Beck Z, Gergely L, Li F, et al. Effects of human papillomavirus type 16 oncoproteins on survivin gene expression. The Journal of General Virology. 2006 Feb;87(Pt 2):287-94. 147. Fraunholz I, Rodel C, Distel L, Rave-Frank M, Kohler D, Falk S, et al. High survivin expression as a risk factor in patients with anal carcinoma treated with concurrent chemoradiotherapy. Radiation Oncology. 2012;7:88. 148. Talbot DC, Ranson M, Davies J, Lahn M, Callies S, Andre V, et al. Tumor survivin is downregulated by the antisense oligonucleotide LY2181308: a proof- of-concept, first-in-human dose study. Clinical Cancer Research: an official Journal of the American Association for Cancer Research. 2010 Dec 15;16(24):6150-8. 149. Tanioka M, Nokihara H, Yamamoto N, Yamada Y, Yamada K, Goto Y, et al. Phase I study of LY2181308, an antisense oligonucleotide against survivin, in patients with advanced solid tumors. Cancer Chemotherapy and Pharmacology. 2011 Aug;68(2):505-11. 150. Tolcher AW, Mita A, Lewis LD, Garrett CR, Till E, Daud AI, et al. Phase I and pharmacokinetic study of YM155, a small-molecule inhibitor of survivin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008 Nov 10;26(32):5198-203.
151. Satoh T, Okamoto I, Miyazaki M, Morinaga R, Tsuya A, Hasegawa Y, et al. Phase I study of YM155, a novel survivin suppressant, in patients with advanced solid tumors. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009 Jun 1;15(11):3872-80. 152. Ruiz i Altaba A, Palma V, Dahmane N. Hedgehog-Gli signalling and the growth of the brain. Nature Reviews Neuroscience. 2002 Jan;3(1):24-33. 153. Sims-Mourtada J, Izzo JG, Apisarnthanarax S, Wu TT, Malhotra U, Luthra R, et al. Hedgehog: an attribute to tumor regrowth after chemoradiotherapy and a target to improve radiation response. Clinical Cancer Research: an official Journal of the American Association for Cancer Research. 2006 Nov 1;12(21):6565-72. 154. Chen YJ, Lin CP, Hsu ML, Shieh HR, Chao NK, Chao KS. Sonic hedgehog signaling protects human hepatocellular carcinoma cells against ionizing radiation in an autocrine manner. International Journal of Radiation Oncology, Biology, Physics. 2011 Jul 1;80(3):851-9. 155. Backer MV, Hamby CV, Backer JM. Inhibition of vascular endothelial growth factor receptor signaling in angiogenic tumor vasculature. Advances in Genetics. 2009;67:1-27. 156. Arbeit JM, Munger K, Howley PM, Hanahan D. Progressive squamous epithelial neoplasia in K14-human papillomavirus type 16 transgenic mice. Journal of Virology. 1994 Jul;68(7):4358-68. 157. Song S, Pitot HC, Lambert PF. The human papillomavirus type 16 E6 gene alone is sufficient to induce carcinomas in transgenic animals. Journal of Virology. 1999 Jul;73(7):5887-93. 158. Herber R, Liem A, Pitot H, Lambert PF. Squamous epithelial hyperplasia and carcinoma in mice transgenic for the human papillomavirus type 16 E7 oncogene. Journal of Virology. 1996 Mar;70(3):1873-81. 159. Thomas MK, Pitot HC, Liem A, Lambert PF. Dominant role of HPV16 E7 in anal carcinogenesis. Virology. 2011 Dec 20;421(2):114-8. 160. http://www.irci.info/rarecancertypes/. 161. Wallecha A, French C, Petit R, Singh R, Amin A, Rothman J. Lm-LLO-Based Immunotherapies and HPV-Associated Disease. Journal of Oncology. 2012;2012:542851. 162. Cory L, Chu C. ADXS-HPV: A therapeutic Listeria vaccination targeting cervical cancers expressing the HPV E7 antigen. Human Vaccines & Immunotherapeutics. 2014 Nov 1:0. 163. Gujja S, Williamson SK, Batra A, Saeed AM, Lai K, Fogel BJ, et al. Programmed cell death-Ligand 1 (PD-L1) expression and outcome in patients with squamous cell cancer of anal canal (SCCAC). American Society of Clinical Oncology (ASCO); Chicago USA: Journal of Clinical Oncology 33, 2015 (suppl; abstr 3523); 2015. 164. Hong D, Infante J, Janku F, Jones S, Nguyen LM, Burris H, et al. Phase I Study of LY2606368, a Checkpoint Kinase 1 Inhibitor, in Patients With Advanced Cancer. Journal of Clinical Oncology: official Journal of the American Society of Clinical Oncology. 2016 May 20;34(15):1764-71.
165. Basu P, Mehta AO, al. e. ADXS11-001 immunotherapy targeting HPV-E7: Final results from a phase 2 study in Indian women with recurrent cervical cancer. American Society of Clinical Oncology (ASCO); May 30 - June 3, 2014; Chicago, Illinois, USA: Journal of Clinical Oncology. 2014;32:5s (suppl; abstr 5610). 166. Levy A, Azria D, Pignon JP, Delarochefordiere A, Martel-Lafay I, Rio E, et al. Low response rate after cetuximab combined with conventional chemoradiotherapy in patients with locally advanced anal cancer: long-term results of the UNICANCER ACCORD 16 phase II trial. Radiotherapy and Oncology: Journal of the European Society for Therapeutic Radiology and Oncology. 2015 Mar;114(3):415-6. 167. Lukan N, Strobel P, Willer A, Kripp M, Dinter D, Mai S, et al. Cetuximab-based treatment of metastatic anal cancer: correlation of response with KRAS mutational status. Oncology. 2009;77(5):293-9. 168. Bonner JA, Harari PM, Giralt J, Azarnia N, Shin DM, Cohen RB, et al. Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck. The New England Journal of Medicine. 2006 Feb 9;354(6):567-78. 169. Vermorken JB, Mesia R, Rivera F, Remenar E, Kawecki A, Rottey S, et al. Platinum-based chemotherapy plus cetuximab in head and neck cancer. The New England Journal of Medicine. 2008 Sep 11;359(11):1116-27. 170. Smaglo BG, Tesfaye A, Halfdanarson TR, Meyer JE, Wang J, Gatalica Z, et al. Comprehensive multiplatform biomarker analysis of 199 anal squamous cell carcinomas. Oncotarget. 2015 Dec 22;6(41):43594-604. 171. Chung JH, Sanford E, Johnson A, Klempner SJ, Schrock AB, Palma NA, et al. Comprehensive genomic profiling of anal squamous cell carcinoma reveals distinct genomically defined classes. Annals of Oncology: official Journal of the European Society for Medical Oncology / ESMO. 2016 Jul;27(7):1336-41. 172. Cacheux W, Rouleau E, Briaux A, Tsantoulis P, Mariani P, Richard-Molard M, et al. Mutational analysis of anal cancers demonstrates frequent PIK3CA mutations associated with poor outcome after salvage abdominoperineal resection. British Journal of Cancer. 2016 Jun 14;114(12):1387-94. 173. Balermpas P, Martin D, Wieland U, Rave-Frank M, Strebhardt K, Rodel C, et al. Human papilloma virus load and PD-1/PD-L1, CD8+ and FOXP3 in anal cancer patients treated with chemoradiotherapy: Rationale for immunotherapy. Oncoimmunology. 2017;6(3):e1288331. 174. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology. 2013 Apr 25;14(4):R36. 175. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high- throughput sequencing data. Bioinformatics. 2015 Jan 15;31(2):166-9. 176. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010 Jan 01;26(1):139-40. 177. Nigro ND, Seydel HG, Considine B, Vaitkevicius VK, Leichman L, Kinzie JJ. Combined preoperative radiation and chemotherapy for squamous cell carcinoma of the anal canal. Cancer. 1983 May 15;51(10):1826-9.
178. Glynne-Jones R, Nilsson PJ, Aschele C, Goh V, Peiffert D, Cervantes A, et al. Anal cancer: ESMO-ESSO-ESTRO clinical practice guidelines for diagnosis, treatment and follow-up. Radiotherapy and Oncology: Journal of the European Society for Therapeutic Radiology and Oncology. 2014 Jun;111(3):330-9. 179. Schwarz JK, Siegel BA, Dehdashti F, Myerson RJ, Fleshman JW, Grigsby PW. Tumor response and survival predicted by post-therapy FDG-PET/CT in anal cancer. International Journal of Radiation Oncology, Biology, Physics. 2008 May 1;71(1):180-6. 180. Pawlik TM, Gleisner AL, Bauer TW, Adams RB, Reddy SK, Clary BM, et al. Liver-directed surgery for metastatic squamous cell carcinoma to the liver: results of a multi-center analysis. Annals of Surgical Oncology. 2007 Oct;14(10):2807-16. 181. Rogers JE, Crane CH, Das P, Delclos M, Gould MS, Jr., Ohinata A, et al. Definitive chemoradiation in oligometastatic squamous cell carcinoma of the anal canal. Gastrointestinal Cancer Research : GCR. 2014 Mar;7(2):65-8. 182. Bernardi MP, Ngan SY, Michael M, Lynch AC, Heriot AG, Ramsay RG, et al. Molecular biology of anal squamous cell carcinoma: implications for future research and clinical intervention. The Lancet Oncology. 2015 Dec;16(16):e611-21. 183. Brettingham-Moore KH, Duong CP, Heriot AG, Thomas RJ, Phillips WA. Using gene expression profiling to predict response and prognosis in gastrointestinal cancers-the promise and the perils. Annals of Surgical Oncology. 2011 May;18(5):1484-91. 184. Zhao S, Fung-Leung WP, Bittner A, Ngo K, Liu X. Comparison of RNA-Seq and microarray in transcriptome profiling of activated T cells. PloS one. 2014;9(1):e78644. 185. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature Protocols. 2012 Mar 01;7(3):562-78. 186. Goecks J, Nekrutenko A, Taylor J, Galaxy T. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biology. 2010;11(8):R86. 187. Valdman A, Fang X, Pang ST, Ekman P, Egevad L. Pim-1 expression in prostatic intraepithelial neoplasia and human prostate cancer. The Prostate. 2004 Sep 01;60(4):367-71. 188. Chen LS, Redkar S, Bearss D, Wierda WG, Gandhi V. Pim kinase inhibitor, SGI- 1776, induces apoptosis in chronic lymphocytic leukemia cells. Blood. 2009 Nov 05;114(19):4150-7. 189. Chou SC, Azuma Y, Varia MA, Raleigh JA. Evidence that involucrin, a marker for differentiation, is oxygen regulated in human squamous cell carcinomas. British Journal of Cancer. 2004 Feb 09;90(3):728-35. 190. Shih Ie M, Wang TL. Notch signaling, gamma-secretase inhibitors, and cancer therapy. Cancer Research. 2007 Mar 01;67(5):1879-82. 191. Rizzo P, Osipo C, Foreman K, Golde T, Osborne B, Miele L. Rational targeting of Notch signaling in cancer. Oncogene. 2008 Sep 01;27(38):5124-31.
192. Mlacki M, Kikulska A, Krzywinska E, Pawlak M, Wilanowski T. Recent discoveries concerning the involvement of transcription factors from the Grainyhead-like family in cancer. Experimental Biology and Medicine. 2015 Nov;240(11):1396-401. 193. Drabsch Y, Robert RG, Gonda TJ. MYB suppresses differentiation and apoptosis of human breast cancer cells. Breast cancer research : BCR. 2010;12(4):R55. 194. Chen LS, Balakrishnan K, Gandhi V. Inflammation and survival pathways: chronic lymphocytic leukemia as a model system. Biochemical Pharmacology. 2010 Dec 15;80(12):1936-45. 195. Uttarkar S, Frampton J, Klempnauer KH. Targeting the transcription factor Myb by small-molecule inhibitors. Experimental Hematology. 2017 Mar;47:31-5. 196. Cang S, Iragavarapu C, Savooji J, Song Y, Liu D. ABT-199 (venetoclax) and BCL-2 inhibitors in clinical development. Journal of Hematology & Oncology. 2015 Nov 20;8:129. 197. Cross RS, Malaterre J, Davenport AJ, Carpinteri S, Anderson RL, Darcy PK, et al. Therapeutic DNA vaccination against colorectal cancer by targeting the MYB oncoprotein. Clinical & Translational Immunology. 2015 Jan;4(1):e30. 198. Leverson JD, Koskinen PJ, Orrico FC, Rainio EM, Jalkanen KJ, Dash AB, et al. Pim-1 kinase and p100 cooperate to enhance c-Myb activity. Molecular Cell. 1998 Oct;2(4):417-25. 199. Beier UH, Weise JB, Laudien M, Sauerwein H, Gorogh T. Overexpression of Pim- 1 in head and neck squamous cell carcinomas. International Journal of Oncology. 2007 Jun;30(6):1381-7. 200. Magnuson NS, Wang Z, Ding G, Reeves R. Why target PIM1 for cancer diagnosis and treatment? Future Oncology. 2010 Sep;6(9):1461-78. 201. Arunesh GM, Shanthi E, Krishna MH, Sooriya Kumar J, Viswanadhan VN. Small molecule inhibitors of PIM1 kinase: July 2009 to February 2013 patent update. Expert opinion on therapeutic patents. 2014 Jan;24(1):5-17. 202. Foulks JM, Carpenter KJ, Luo B, Xu Y, Senina A, Nix R, et al. A small-molecule inhibitor of PIM kinases as a potential treatment for urothelial carcinomas. Neoplasia. 2014 May;16(5):403-12. 203. Daniel VC, Marchionni L, Hierman JS, Rhodes JT, Devereux WL, Rudin CM, et al. A primary xenograft model of small-cell lung cancer reveals irreversible changes in gene expression imposed by culture in vitro. Cancer Research. 2009 Apr 15;69(8):3364-73. 204. Tentler JJ, Tan AC, Weekes CD, Jimeno A, Leong S, Pitts TM, et al. Patient- derived tumour xenografts as models for oncology drug development. Nature Reviews Clinical Oncology. 2012 Jun;9(6):338-50. 205. Read M, Liu D, Duong CP, Cullinane C, Murray WK, Fennell CM, et al. Intramuscular Transplantation Improves Engraftment Rates for Esophageal Patient-Derived Tumor Xenografts. Annals of Surgical Oncology. 2016 Jan;23(1):305-11. 206. Pompili L, Porru M, Caruso C, Biroccio A, Leonetti C. Patient-derived xenografts: a relevant preclinical model for drug development. Journal of Experimental & Clinical Cancer Research. 2016 Dec 05;35(1):189.
207. Shultz LD, Lyons BL, Burzenski LM, Gott B, Chen X, Chaleff S, et al. Human lymphoid and myeloid cell development in NOD/LtSz-scid IL2R gamma null mice engrafted with mobilized human hemopoietic stem cells. Journal of Immunology. 2005 May 15;174(10):6477-89. 208. Phillips RM, Burger AM, Loadman PM, Jarrett CM, Swaine DJ, Fiebig HH. Predicting tumor responses to mitomycin C on the basis of DT-diaphorase activity or drug metabolism by tumor homogenates: implications for enzyme- directed bioreductive drug development. Cancer Research. 2000 Nov 15;60(22):6384-90. 209. Miyake M, Anai S, Fujimoto K, Ohnishi S, Kuwada M, Nakai Y, et al. 5- fluorouracil enhances the antitumor effect of sorafenib and sunitinib in a xenograft model of human renal cell carcinoma. Oncology Letters. 2012 Jun;3(6):1195-202. 210. Warfel NA, Kraft AS. PIM kinase (and Akt) biology and signaling in tumors. Pharmacology & Therapeutics. 2015 Jul;151:41-9. 211. Cen B, Mahajan S, Wang W, Kraft AS. Elevation of receptor tyrosine kinases by small molecule AKT inhibitors in prostate cancer is mediated by Pim-1. Cancer Research. 2013 Jun 01;73(11):3402-11. 212. Song JH, Kraft AS. Pim kinase inhibitors sensitize prostate cancer cells to apoptosis triggered by Bcl-2 family inhibitor ABT-737. Cancer Research. 2012 Jan 01;72(1):294-303.
Appendices
Appendix 1
Molecular Biology of Anal Squamous Cell Carcinoma:
Implications for Future Research and Clinical Intervention
Bernardi MP, Ngan SY, Michael M, Lynch AC, Heriot AG, Ramsay RG, Phillips
WA. The Lancet Oncology, Volume 16, Issue 16, e611 - e621, Dec 2015.
Review
Molecular biology of anal squamous cell carcinoma: implications for future research and clinical intervention
Maria-Pia Bernardi, Samuel Y Ngan, Michael Michael, A Craig Lynch, Alexander G Heriot, Robert G Ramsay, Wayne A Phillips
Anal squamous cell carcinoma is a human papillomavirus-related disease, in which no substantial advances in Lancet Oncol 2015; 16: e611–21 treatment have been made in over 40 years, especially for those patients who develop disease relapse and for whom Division of Cancer Surgery no surgical options exist. HPV can evade the immune system and its role in disease progression can be exploited in (M-P Bernardi FRACS, novel immunotherapy platforms. Although several studies have investigated the expression and inactivation (through A C Lynch FRACS, Prof A G Heriot MD, loss of heterozygosity) of tumour suppressor genes in the pathways to cancer, no clinically valuable biomarkers have Prof W A Phillips PhD), Surgical emerged. Regulators of apoptosis, including survivin, and agents targeting the PI3K/AKT pathway, off er opportunities Oncology Laboratory for targeted therapy, although robust data are scarce. Additionally, antibody therapy targeting EGFR may prove (Prof W A Phillips), eff ective, although its safety profi le in combination with standard chemoradiotherapy has proven to be suboptimal. Differentiation and Transcription Laboratory Finally, progress in the treatment of anal cancer has remained stagnant due to a lack of preclinical models, including (Prof R G Ramsay PhD), cell lines and mouse models. In this Review, we discuss the molecular biology of anal squamous cell carcinoma, Department of Radiation clinical trials in progress, and implications for novel therapeutic targets. Future work should focus on preclinical Oncology (S Y Ngan FRANZCR), models to provide a resource for investigation of new molecular pathways and for testing novel targets. and Division of Cancer Medicine (M Michael FRACP), Peter MacCallum Cancer Introduction recurrence is the most common type of relapse for Centre, Melbourne, Victoria, Anal squamous cell carcinoma is the most common patients with anal cancer, with the only chance of cure Australia; and Sir Peter histological type of malignant disease of the anal canal. being salvage surgery in the form of a radical MacCallum Department of Oncology (Prof R Ramsay, Anatomically, the anal canal is defi ned as the last 3–5 cm abdominoperineal resection, resulting in a permanent Prof W A Phillips), Department of the gastrointestinal tract between the anorectal colostomy, and with 5-year survival rates ranging from of Pathology (Prof R Ramsay), junction and the anal verge. The region proximal to the 40% to 60%. This surgery is very morbid, and results in and Department of Surgery, dentate line, which is visible macroscopically, is lined by further local relapse in 40–50% of patients.15 At present, St Vincent’s Hospital (M-P Bernardi, Prof A G Heriot, columnar epithelia, and the region distal to the dentate patients with anal squamous cell carcinoma who either Prof W A Phillips), University of line is lined by stratifi ed squamous epithelia. At the are not eligible for salvage surgery, have relapse after Melbourne, Victoria, Australia junction between the columnar and squamous epithelia surgery, or have metastatic disease, are considered for a Correspondence to: is a 6–12 mm transitional zone containing cells of varying systemic chemotherapy regimen, but with 5-year survival Dr M-P Bernardi, Division of types including unkeratinised squamous, transitional, rates of 15%.12 Cancer Surgery, Peter MacCallum Cancer Centre, Melbourne, basal, cuboidal, and columnar cells. This heterogeneous These approaches to treatment and their respective Victoria 3002, Australia histological zone gives rise to most anal squamous cell outcomes highlight several important aspects in the [email protected] carcinomas,1,2 although the specifi c cell of origin has no management of patients with anal cancer. First, although apparent eff ect on treatment or outcome.3 clinicopathological staging using the TNM model12 The incidence of anal squamous cell carcinoma is provides relative consistency throughout clinical trials in 0·2–4·4 per 100 000 people per year with a female predicting patients’ response to treatment, it is not predominance.4 The incidence has risen around the perfectly reliable as there is some heterogeneity in world over the past three decades,5–7 particularly in men responses for individual patients in the same stage of who have sex with men (35 per 100 000 per year) and cancer, which suggests that sensitivity to chemoradiation those with HIV (75–135 per 100 000 per year).8 is somewhat heterogeneous. There is no way of Nevertheless, the standard treatment for anal cancer, predicting response to standard chemoradiotherapy, which consists of chemoradiotherapy with fl uorouracil where some patients derive little benefi t or are left with and mitomycin C, has remained essentially unchanged substantial late and morbid toxic eff ects. since this sphincter-preserving strategy was fi rst Due to the relative rarity of anal squamous cell proposed.9 The main advances since that time have been carcinoma and the reasonable responses to primary in the use of intensity-modulated radiation therapy that chemoradiotherapy, it is diffi cult to undertake suitable tailors radiation distribution to the tumour target,10 and trials for the proportion of patients who have local in the use of cisplatin, which has shown similar effi cacy disease relapse after surgery or who have metastatic to fl uorouracil and mitomycin C in a large randomised disease. Consequently, there have been few advances in trial.11 For non-metastatic disease, 5-year survival rates available treatment options for these patient populations. range from 39·6% to 69·5% depending on overall stage.12 The most recent National Comprehensive Cancer 3-year progression-free survival is only 62–67% for those Network guidelines16 for metastatic anal cancer remain patients with a high disease stage (T3–4), and 68% in broad, but acknowledge that only cisplatin-based those with node-positive disease.13 Up to 25% of patients chemotherapy is recommended as a treatment option relapse, mainly within the fi rst 3 years of completing for patients with anal cancer, as no other regimens have chemoradiotherapy.14 Locoregional persistence or shown effi cacy. www.thelancet.com/oncology Vol 16 December 2015 e611 Review
The DNA of human papillomavirus (HPV) is present in discussed in this Review. Particularly important is their 88% of cancers and in most anal precursor lesions, and is ability to target the products of the tumour suppressor recognised as the main cause of anal squamous cell genes TP53 and pRb. Briefl y, the E6 oncoprotein binds to carcinoma.17,18 This nomenclature has been updated to and promotes degradation of the P53 protein.28,29 As a squamous intraepithelial lesions of the anus: low-grade result, the ability of TP53 to induce growth arrest and squamous intraepithelial lesions, analogous to anal apoptosis is attenuated.30 It has been suggested that this intraepithelial neoplasia I, or high-grade squamous ability of the E6 oncoprotein is functionally akin to a intraepithelial lesions, analogous to anal intraepithelial TP53-inactivating mutation.29 The E7 oncoprotein acts as neoplasia II/III.19 Much research has been done to attempt an effi cient cell-cycle deregulator. In its quiescent state, to elucidate the molecular mechanisms by which HPV is pRb is hypophosphorylated and associated with E2F associated with the development of anal intraepithelial transcription factor molecules (in heterodimer neoplasia with subsequent progression to squamous cell complexes), thereby inhibiting their transcriptional carcinoma. This knowledge can hopefully then be activity. Mitogenic signals activate D-type cyclins which exploited to off er novel therapeutic options. As knowledge in turn phosphorylate pRb in the mid-G1 phase of the on the molecular biology of anal cancer is scarce, parallels cell cycle. The phosphorylation of pRb releases the E2F are often drawn from what is known regarding other heterodimer, allowing progression through the HPV-related cancers, especially cervical cancer and head restriction point of the cell cycle, and subsequent cell and neck squamous cell carcinoma. Most of the proliferation via the transcription of relevant genes. translational research in anal squamous cell carcinoma When the E7 oncoprotein forms complexes with pRb, has been directed at identifying prognostic and predictive pRb is degraded, ultimately mimicking phosphorylation biomarkers in the hope they might lead to the of pRb and allowing progression into the S phase of the development of tailored individualised therapy, and the cell cycle.24,31 It is postulated that a series of epigenetic ability to predict response to treatment, and hence and genetic changes in the human genome have to occur improve patient outcomes. and act in concert with HPV oncogenes to lead to the Few preclinical models to test novel therapies have development of anal squamous cell carcinoma.24 been reported for anal squamous cell carcinoma. These include a cell line derived from a lymph node metastasis,20 Pathways to cancer two transgenic mouse models,21,22 and a xenograft from a The overwhelming prevalence of HPV in anal single patient.23 In this Review, we discuss the results of intraepithelial neoplasia and anal carcinoma has been these diverse approaches in improving our knowledge substantiated by a meta-analysis of 93 studies.18 HPV was and treatment options for patients with anal squamous identifi ed in 93·9% of anal intraepithelial neoplasia cell carcinoma. II/III and in 84·3% of anal squamous cell carcinomas. Another systematic review identifi ed 85·1% of squamous HPV: genome structure and function cell carcinomas as positive for HPV16, and only 7·2% for The HPV genome is a double-stranded circular DNA that HPV18, the two most common genotypes of HPV that becomes integrated into the host genome of stratifi ed confer a high risk for cancer.32,33 These data suggest that epithelial cells. HPV DNA integration might occur in HPV infection, especially with these high-risk subtypes, high-grade squamous intraepithelial lesions, with higher is an initiating event in the transformation of anal frequency in malignant lesions, although these might epithelia towards malignancy. contain a mixture of integrated and episomal DNA.24 The Despite the high prevalence of these HPV subtypes in HPV genome encodes for early structural genes (E1, E2, the precursor lesions, progression to cancer is relatively E4, E5, E6, and E7) implicated in viral replication, and low. The natural history of anal intraepithelial neoplasia late structural genes (L1–L2). In fact, the L1 capsid protein has been examined by Watson and colleagues34 in a has been exploited in creating eff ective vaccines for the cohort of 129 patients. The investigators reported that prevention of infection with HPV, including a new 13% of patients had progression of anal intraepithelial nonavalent vaccine that protects against nine HPV neoplasia II or III to squamous cell carcinoma over subtypes.25 More than 150 HPV types with varying 5 years. Importantly, progression to invasive cancer has potential for carcinogenesis have been identifi ed, with been shown to be much higher in immunocompromised HPV16 being the highest risk. This potential for patients, including those who are HIV positive.35 carcinogenesis is at least partly attributed to the Nevertheless, most patients infected with HPV do not expression of the E6 and E7 oncogenes and their develop cancer. respective oncoproteins. These have been shown to be Why is there such a large discrepancy between the necessary but not suffi cient for the immortalisation of presence of HPV and the prevalence of cancer? The answer cells and attainment of the malignant phenotype.26,27 is unresolved. There is a paucity of knowledge specifi cally The functions of the HPV16 E6 and E7 oncoproteins addressing this subject in anal cancer; what is known has and their many pathways of action have been summarised been inferred from published work about the most elsewhere,24,26 and only the most pertinent ones are common HPV-mediated disease—cervical cancer—and its e612 www.thelancet.com/oncology Vol 16 December 2015 Review
precursors. A cell-mediated immune response results in an proteins, and changes in antigen-presenting cells are apparent clearance of HPV infection in most contributing factors.45,46 The association of immuno- immunocompetent patients.36,37 It has been clearly shown suppression and progression from HPV infection to anal that 50% of HPV infections are reduced to undetectable squamous cell carcinoma supports the notion of immune proportions by 6–12 months, and more than 90% within a targeting in prevention and therapy. few years. For those with persistent HPV infection, the probability of progression to cervical intraepithelial Tumour suppressor genes and loss of neoplasia and invasive cancer is increased.38 Although heterozygosity details on how infection is reduced are unknown, the Expression of the E6 and E7 oncogenes are not suffi cient mechanisms for immune evasion have been more clearly for cancer progression. Loss of heterozygosity is a described.39 mechanism of genomic instability that leads to the inactivation of tumour suppressor genes. A review by Mechanisms for immune evasion Gervaz and colleagues45 summarised the fi ndings of a HPV can escape usual surveillance by the immune few studies investigating the molecular biology of system through various mechanisms, only some of squamous cell carcinoma of the anus, all of which which are described in this Review.24,39 The keratinocyte consisted of fewer than 20 patients. The consistent is the target cell of HPV, and the infectious cycle is fi nding in cytogenetic,47 comparative genomic tailored to take advantage of the diff erentiation hybridisation48 and polymerase chain reaction and programme of these cells. As the keratinocyte matures sequencing49,50 studies was loss of heterozygosity on towards a terminally diff erentiated squame, it is chromosome 11q. This region has been highlighted in programmed for death and desquamation. During this the molecular biology of cervical intraepithelial neoplasia process the virus replicates and is released when the and cervical cancer.51,52 Further evidence of loss of cell dies. As the cell death is from a natural physiological heterozygosity at this site and 18q was seen in two in- process, there is no accompanying infl ammation to vitro studies and was shown to be needed for HPV- warn the immune system that the virus is present, mediated immortalisation of keratinocytes.53,54 Other resulting in a persistent, chronic infection. Consistent identifi ed sites of loss of heterozygosity in anal cancer with other DNA viruses, the high-risk HPVs have include chromosome 17p (TP53 tumour suppressor evolved mechanisms to inhibit interferon synthesis and gene), chromosome 5q (adenomatous polyposis coli signalling, which would usually act as a very eff ective tumour suppressor gene), and 18q (deleted in colorectal antiviral defence system. This action is mediated by the carcinoma tumour suppressor gene), albeit in one and HPV16 E6 and E7 oncoproteins.39 E6 has been shown to two small studies, respectively.49 It can be concluded that reduce the amount of E-cadherin on the surface of there could be a tumour suppressor gene on chromosome keratinocytes. Because adhesion to antigen-presenting 11 that is important for progression of anal squamous cells is mediated by E-cadherin, this property of E6 cell carcinoma, but that many gene mutations are further promotes survival of the virus by limiting ultimately needed for carcinogenesis. This accumulation presentation of viral antigens to the immune system.40,41 of genetic changes takes time, and could account for the By reducing the expression of transporter-associated lag of up to fi ve decades between the appearance of anal antigen protein 1, the E7 oncoprotein interferes with intraepithelial neoplasia and invasive anal cancer.45 antigen presentation and the response by cytotoxic lymphocytes.24 It is likely that HPV-related oncoproteins TP53 are associated with the dysregulation of immune In 2010, Lampejo and colleagues55 published a systematic checkpoints, which are a focus of targeted therapy review on 29 prognostic biomarkers from nine functional using checkpoint inhibitors.42–44 classes reported in 21 studies of anal cancer between 1991 and 2009 (table 1). Sixteen of the 29 biomarkers showed Role of HIV no prognostic signifi cance in one or more studies. The The much higher risk of HPV-mediated progression to only biomarkers shown to have prognostic signifi cance anal squamous cell carcinoma in people with HIV is a in more than one study were TP53 and p21.55 matter of great interest. Anal squamous cell carcinoma The tumour suppressor gene TP53 is associated with develops up to two decades earlier in men with HIV, with cell-cycle regulation and apoptosis and is overexpressed persistence of HPV infection being one of the contributing in anal carcinomas.64 Of the eight studies investigating factors.45 More advanced immunosuppression, as TP53 expression using immunohistochemistry, one evidenced by lower CD4 counts, has been shown to study showed reduced disease-free survival,57 and another increase the risk of anal squamous cell carcinoma in study showed reduced local tumour control in tumours patients with HIV.8 The exact mechanisms by which HIV- with high TP53 expression.56 The report from the mediated altered immune status contributes to Radiation Therapy Oncology Group (RTOG)-8704 HPV-mediated progression are not well elucidated, randomised trial65 identifi ed a trend towards higher although defi cient lymphocyte response to E6 and E7 locoregional failure in tumours with TP53 expression, www.thelancet.com/oncology Vol 16 December 2015 e613 Review
Prognostic signifi cance EGFR Cell growth Tumour suppressor gene
56 TP53 TP53 expression associated with reduced local tumour control and reduced disease-free Cell cycle control survival56,57 PTEN PI3K p21 Absent p21 expression associated with reduced overall survival58 and increased Survival locoregional failure59 p27 No prognostic signifi cance HPV16–E7 pRb AKT Proliferation p16 No prognostic signifi cance Rb No prognostic signifi cance Figure 1: PI3K/AKT pathway EGFR (TK protein) HPV=human papillomavirus. pRb=retinoblastoma protein. HER1 HER1 highly expressed, no correlation with disease-free survival60–62 HER2 HER2 not expressed locoregional failure in a second study,59 out of only three Regulator of apoptosis studies between 2001 and 2006. 62 NF-κB High expression associated with reduced disease-free survival The issue of TP53 mutations in anal squamous cell Bax No prognostic signifi cance carcinoma has not been comprehensively investigated. 56 Bcl-2 Expression associated with improved local tumour control and disease-free survival Patel and colleagues66 reported the largest series of Mcl-1 No prognostic signifi cance patients of which fi ve (4%) of 119 patients had mutations 56 M30 Expression associated with reduced local tumour control and disease-free survival in exon 5, identifi ed by direct sequencing. Using Cyclin immunohistochemistry, nuclear accumulation of P53 Cyclin A High expression associated with increased tumour-specifi c and overall survival63 was identifi ed in 91% of samples. The investigators Cyclin D1 No prognostic signifi cance predicted that the accumulated protein is wild-type, but Cyclin E No prognostic signifi cance this remains to be clarifi ed.66 Proliferation and invasion Ki-67–MiB1 Ki-67 independent predictor of disease-free survival62 EGFR Ki-67–MiB1 High Ki-67–Mib1 index associated with increased colostomy-free survival55 EGFR has been identifi ed in many epithelial cancers, index where its activation or overexpression can stimulate cell PCNA No prognostic signifi cance growth (fi gure 1). Overexpression is associated with poor MCM7 High expression associated with improved relapse-free survival and cancer-specifi c prognosis in several cancers.67 The small GTPase protein survival KRAS acts downstream of EGFR and is needed for EGFR nm23 No prognostic signifi cance signal transduction. Cetuximab, a monoclonal antibody Cathepsin D No prognostic signifi cance against EGFR, is used as combination therapy for Angiogenesis treatment of several cancers, especially squamous cell VEGF No prognostic signifi cance cancers of the head and neck.68 MVD No prognostic signifi cance With this clinical application in mind, the expression of CD31 No prognostic signifi cance EGFR in anal squamous cell carcinoma has been Tumour-specifi c marker investigated more than most other biomarkers. Utilising SCC antigen High expression associated with reduced tumour-free survival and overall survival a combination of immmunohistochemistry and CEA No prognostic signifi cance fl uorescence in situ hybridisation (FISH), EGFR was Hedgehog signalling seen to be expressed in 55–100% of patient samples SHH Overexpression associated with reduced disease-free survival62 across seven studies.60–62,69–72 Paliga and colleagues70 Gli-1 Overexpression associated with reduced disease-free survival62 identifi ed EGFR expression in 91% of 79 patient samples. Telomerase The study also tested for EGFR and KRAS mutations hTERT No prognostic signifi cance using high-resolution melting analysis. At the most
Data from Lampejo et al55 common sites for EGFR mutations, zero of 89 samples were positive for mutations in exon 19, and three of Table 1: Prognostic signifi cance of functional classes and biomarkers in anal cancer 89 samples were positive for mutations at exon 21. These three samples were seen to have the same single although this was not statistically signifi cant. In 2004, the nucleotide polymorphism when sequencing was done. UK Coordinating Committee on Cancer Research Anal No KRAS mutations were identifi ed in the 89 samples,70 Cancer Trial I (UKCCCR ACT I)58 reported that patients and the presence of only wild-type KRAS mutations in who expressed TP53 predicted a poorer cause-specifi c anal squamous cell carcinoma was reported in a larger survival than patients who did not express the tumour study of 153 patient samples.72 This is encouraging for suppressor gene in an analysis of 240 patients. Results the potential use of anti-EGFR targeted treatments, as it from fi ve separate studies did not report any prognostic has now been well established that patients with signifi cance. Absence of p21 expression was associated colorectal cancer with KRAS mutations have poor with reduced overall survival in one study,63 and higher responses to such therapies.73 e614 www.thelancet.com/oncology Vol 16 December 2015 Review
PI3K/AKT pathway The PI3K/AKT pathway is frequently hyperactivated in Activation of NF-κB Induction of transcription of cIAP-2 human cancers and has hence received much attention HPV-E6 oncoprotein as a potential therapeutic target.74 It is a major downstream target of the tyrosine kinase receptor family, TP53 Transactivation of survivin promoter which includes EGFR. Downstream of phosphatidylinositol 3-kinase (PI3K), phosphorylation of the serine threonine kinase protein kinase B (AKT) leads to its activation with subsequent phosphorylation of its Suppression of apoptosis Control of cell division substrates. This process ultimately triggers various responses in the cell including cell growth and Figure 2: Pathways of inhibition of apoptosis via HPV E6 proliferation75,76 (fi gure 1). The tumour suppressor gene PTEN negatively regulates the PI3K/AKT pathway.77 positivity.56 This fi nding seems counterintuitive. Previous reports of the clinical importance of this However, a similar association with positive outcomes pathway include its frequent activation in HPV-related has been seen in other solid tumours, namely cervical head and neck cancers, its identifi cation as an carcinoma with similar pathogenesis.82 independent predictor of outcome, and its association HPV E6 has been implicated in the activation of NF-κB, with resistance to radiation.75 Another study looking at which is a nuclear transcription factor whose target cervical cancer78 has shown that inactivation of pRb by genes include the inhibitors of apoptosis proteins such HPV16 E7 can upregulate AKT activity. as cIAP-2 (fi gure 2).83,84 Only one study has investigated Few studies have specifi cally addressed the role of the the expression of NF-κB in anal squamous cell carcinoma PI3K/AKT pathway in anal squamous cell carcinoma. using immunohistochemistry in 30 patient samples. In 2007, Patel and colleagues66 reported a cohort Those with high NF-κB expression had a reduced disease- of patients with anal squamous cell carcinoma in which free survival (p=0·002).62 82 (66%) of 125 patients had cellular accumulation of Survivin, another member of the inhibitors of apoptosis phosphorylated AKT, with statistically signifi cant family of proteins, is transactivated by HPV E6, resulting correlation between HPV infection and activated AKT. in suppression of apoptosis (fi gure 2).85 Using They proposed that this activation plays an important immunohistochemical staining in pre-treatment biopsies role in the carcinogenesis of anal squamous cell from 62 patients with anal cancer, Fraunholz and carcinoma. colleagues86 reported that patients with low survivin had Using sequencing analysis to characterise the EGFR a statistically signifi cant higher probability of distant pathway in the disease, Martin and colleagues79 noted metastases-free survival than those patients with high mutations in the gene encoding the α catalytic subunit survivin, with median follow-up of 68 months. They of PI3K, PIK3CA, in 13 (16%) of 84 patients with anal suggest that survivin might be used as a marker to squamous cell carcinoma. EGFR gene copy number was predict patients at risk of metastatic disease and speculate high in 28 (34%) of patients. The implications of their that for those patients with anal cancer who have high fi ndings are that, although some patients might have survivin expression, drugs such as LY218130887,88 and high levels of EGFR, downstream mutations might YM15589,90 that target survivin might become part of a confer resistance to targeted EGFR therapy.79 Moreover, novel treatment option.86 the PIK3CA gene is located on chromosome 3q. Chromosomal 3q gains have been identifi ed in HPV- Sonic hedgehog signalling pathway positive cervical cancer80 and anal cancer,81 and their The sonic hedgehog (SHH) glycoprotein is associated associated premalignant lesions. with a complex signal transduction pathway regulated by In view of the many compounds available that target the Gli-1 transcription factor.91 In anal squamous cell the PI3K–AKT pathway, some of which are in clinical carcinoma, overexpression of both SHH and Gli-1 has trials,74 further investigations into this pathway’s role in been shown to be a predictor of reduced disease-free anal squamous cell carcinoma tumorigenesis could survival,62 on a background of a known association identify a target for therapeutic application. between SHH signalling and resistance to chemoradiation in other cancers.92,93 Regulators of apoptosis BCL-2 is one of several members of the BCL-2 family of VEGF proteins that inhibit apoptosis, promoting tumour cell VEGF receptors have been targeted as anticancer therapies survival. Although three studies have reported on BCL-2 on the premise that their interaction with VEGF promotes expression in anal squamous cell carcinoma,56,60,62 only neovascularisation of the tumour that is needed for one study identifi ed a signifi cant association with invasion and metastasis.94 However, there was no signifi cant improved local tumour control and disease-free survival association with patient survival in two studies investigating with 41 (42%) of 98 patient samples showing biomarker VEGF expression in anal squamous cell carcinoma.57,62 www.thelancet.com/oncology Vol 16 December 2015 e615 Review
Preclinical models transgenic mice for 20 weeks, seven (23%) of 31 mice Perhaps one of the reasons that little progress has been developed anal cancer as confi rmed by histopathologic made in understanding the underlying molecular and analysis. A further nine (29%) of 31 mice developed cellular mechanisms of carcinogenesis in anal atypia, which the investigators state is analogous to anal squamous cell carcinoma compared with other solid intraepithelial neoplasia in human beings. tumours is the paucity of appropriate in-vitro and in- This transgenic mouse model has since been used to vivo model systems for investigating anal squamous cell investigate the role of the individual oncogenes E6 and carcinoma. Human tumour cell lines can be used for E7. Treatment of the mice with dimethylbenz[a]- many purposes including the study of cell growth, anthracene resulted in anal carcinomas in 85% of mice diff erentiation, and metastasis. Most importantly from expressing K14E7, either alone or in combination with a translational research viewpoint, they can be used to K14E6, but only 18% of mice expressing K14E6 alone and undertake drug susceptibility studies. Grown in vitro, 10% of non-transgenic control mice developed cancer. they are an effi cient and cost-eff ective way to investigate The investigators concluded that E7 is the more potent the response of tumour cells to drugs. Furthermore, by oncogene in HPV-associated anal cancer.98 The same using the cell lines to grow xenograft tumours in group reported the fi rst patient-derived tumour xenograft animals, they can be a valuable preclinical method for for anal cancer using fresh tumour biopsy samples in-vivo testing of potential therapeutic compounds. sourced from an HIV-seropositive man who was Patient-derived tumour xenografts are generated from treatment naive. The HPV-positive tumour grew in both human cancer tissues that are freshly implanted into severe combined immunodefi ciency disease and nude immunocompromised mice, usually subcutaneously, mouse strains, and retained histopathologic features of and allowed to grow. The engrafted tumours can be poorly diff erentiated squamous cell carcinoma over serially passaged into more mice to create cohorts of subsequent passaging.23 Activation of the PI3K/mTOR mice to be used for in-vivo testing of human cancer. pathway in squamous cell carcinomas from the doubly Alternatively, transgenic mice can be genetically transgenic K14 E6–E7 mice and in the patient-derived engineered to develop disease endogenously, modelling tumour xenograft model was confi rmed by human tumour development. immunohistochemical staining of pAkt and pS6, two biomarkers widely used to detect activation of the Single cell line PI3K/mTOR pathway.23 Although treatment with the In 2009, Takeda and colleagues20 published the fi rst and mTOR inhibitor rapamycin reduced the number of only report of an anal squamous cell carcinoma cell line, tumours (including papillomas, atypia, and cancers), the SaTM-1. This cell line was derived from a primary culture reduction was not statistically signifi cant. Established of a lymph node metastasis from a patient undergoing tumours in the K14 E6–E7 mice were given rapamycin inguinal lymphadenectomy for known anal squamous and, although the incidence of tumours was similar cell carcinoma. There was no comment with regard to between treated and untreated groups, tumour growth the patient’s HPV status. The SaTM-1 cell line was shown was signifi cantly slower in the mice given rapamycin to produce tumours in immunodefi cient mice after (p=0·01). This growth inhibition was further validated in 20 days. The tumours were confi rmed as well the patient-derived tumour xenograft model when diff erentiated squamous cell carcinoma by microscopy intraperitoneal rapamycin was used to treat the mice.23 and immunohistochemistry staining for p63, an These studies provide evidentiary support for further important marker of squamous diff erentiation.20 investigation into the use of mTOR inhibitors in anal Although the SaTM-1 cell line has been deposited in a cancer treatment, particularly in combination with other public cell line bank for use by outside investigators,20 no therapeutic regimens. published work in which it has been used has yet been The second transgenic mouse model was described by identifi ed. Sun and colleagues22 using a tamoxifen inducible K14-Cre transgene to generate a combined deletion of the tumour Mouse models: transgenic and patient-derived tumour suppressor genes Tgfbr1 and PTEN. K14-Cre-mediated xenograft models deletion of Tgfbr1 and PTEN resulted in anal squamous Two transgenic mouse models have been reported for cell carcinoma in 39 (33%) of 117 mice. By anal squamous cell carcinoma. The fi rst study reported by immunostaining the pAkt and pS6 biomarkers in the Stelzer and colleagues21 used K14 HPV16 transgenic mice tumours, activation of the PI3K/mTOR pathway was described by Arbeit and colleagues,95 to target E6 and E7 shown, and rapamycin treatment signifi cantly reduced oncogene expression in stratifi ed squamous epithelia, the incidence and tumour volume compared with the analogous to HPV infection in human beings.96,97 K14- vehicle group. However, the very low incidence of anal driven E6 and E7 transgenic mice did not spontaneously tumours in this model, and the concomitant development develop anal squamous cell carcinoma. However, with of head and neck cancers requiring euthanasia at topical application of a known chemical carcinogen, 16 weeks, could limit the use of this model for the dimethylbenz[a]anthracene, to the anus of these HPV16 investigation of anal squamous cell carcinoma therapy.22 e616 www.thelancet.com/oncology Vol 16 December 2015 Review
Clinical intervention N Title Status To advance the management of any tumour relies on an enhanced understanding of its molecular biology. NCT01671488 25 A phase 1/2 evaluation of ADXS11–001, Aug, 2014: currently recruiting mitomycin, 5-fl uorouracil, and IMRT for Because of the relative rarity of anal squamous cell anal cancer carcinoma, research has not been as forthcoming as for NCT01266460 67 A phase 2 evaluation of ADXS11-001 Dec, 2014: closed (ongoing, not other more common cancers. Advances in knowledge (NSC 752718) in the treatment of recruiting) have been scarce, with only small studies in diverse persistent or recurrent squamous or non- populations feasible. The International Rare Cancers squamous cell carcinoma of the cervix 44 Initiative has acknowledged relapsed or metastatic anal NCT01115790 150 A phase 1 study of LY2606368 in July, 2015: poster at ASCO 2015 (multiple patients with advanced cancer with results of 26 anal SCC patients cancer as one of nine rare cancers needing further types of investigation,99 and the era of emerging molecular cancer) targeted therapies off ers an opportunity for a novel Phase 2 trial 110 ADXS11–001 immunotherapy targeting June, 2014: presented at approach to anal cancer. Some encouraging fi ndings are (no registration HPV E7: fi nal results from a phase 2 study ASCO 2014: 36% (39/110) available) in Indian women with recurrent cervical 12-month survival, 28% (31/110) coming to light. Understanding of HPV and its cancer 18-month survival, 11% patients oncogenes has led to the production of a successful achieved a response vaccine against HPV, which should begin to aff ect the incidences of anal cancer over the next two decades. N=number of patients. IMRT=intensity-modulated radiation therapy. With regard to specifi c molecular mechanisms of Table 2: Immunotherapy-based trials for treatment of anal squamous cell carcinoma and cervical cancer clinical value, although Gervaz and colleagues45 off er a proposed model of anal carcinogenesis in immuno- N Title Status competent patients based on necessary HPV–DNA integration and loss of heterozygosity at many NCT00316888 62 Cetuximab, cisplatin, fl uorouracil, and July, 2012: recruiting (stage III 45 (phase 2) radiation therapy in treating patients patients only, closed to chromosomal sites, a potential prognostic marker or with stage I, stage II, or stage III anal accrual for stage I and II therapeutic target has not emerged. On the other hand, cancer patients March 11, 2008) by exploiting this HPV-driven disease progression, NCT00324415 (phase 2) 45 Cisplatin, fl uorouracil, cetuximab, and Aug, 2014: active, not immunotherapy off ers a promising platform.100 radiation therapy in treating patients recruiting A live attenuated Listeria monocytogenes-based with HIV and stage I, stage II, or stage III anal cancer immunotherapy, ADXS11–001, is being assessed for NCT01621217 (phase 1) 21 Phase 1 study of cetuximab in Nov, 2014: recruiting treatment of cervical cancer and anal squamous cell combination with fl uorouracil, carcinoma in phase 1–2 clinical trials (table 2). mitomycin C, and radiotherapy in Exploiting the evolution of the human immune system patients with anal cancer stage T2 (>4 cm)–T4 N0–3 M0 or any to reject L monocytogenes infection, this construct T N2–3 M0 secretes a protein fused to HPV16 E7, with subsequent No registration available 14 Phase 1 study of cetuximab in Prematurely ended due to stimulation of a cell-mediated immune response. This (phase 1)103 combination with fl uorouracil, cisplatin, high frequency of toxic response has been shown to aff ect outcomes in and radiotherapy in patients with locally eff ects preclinical models. In early clinical studies, mild to advanced anal canal carcinoma moderate adverse eff ects have mostly been consistent NCT00955240 16 Radiation therapy, cisplatin, fl uorouracil, Prematurely ended due to (phase 2)104 and cetuximab in treating patients with unacceptable toxic eff ects with cytokine release, suggesting immune activation. locally advanced anal cancer (15 serious adverse events in No listeriosis infections have been noted because of 14 of 16 patients) this live vaccine.100,101 Nonetheless, the vaccine would not NCT01581840 45 Phase 1–2 on radiochemotherapy April, 2012: recruiting be suitable for use in immunocompromised patients, (phase 1/2) combined with panitumumab in the treatment of localised epidermoid including those patients with HIV, because of its carcinoma of the anus attenuated nature. Immune checkpoint modulation immunotherapy N=number of patients. has evolved rapidly, with the successful use of immune Table 3: Clinical trials using EGFR inhibitors for the treatment of anal cancer checkpoint inhibitors in several cancers, particularly melanoma. PD-1 is one such immune checkpoint receptor. Expression of PD-L1 for this receptor Lampejo and colleagues55 discuss the need for further corresponds with poor prognosis in many cancers.42 In clarifi cation with regard to TP53 and p21 expression in anal cancer, only a small study has shown a trend anal squamous cell carcinoma, and suggest their potential towards a worse recurrence-free survival in tumours as future therapeutic targets via examples of targeted expressing PD-L1.102 Checkpoint kinase-1 is a further treatment trials in oesophageal squamous cell carcinoma target, with a phase 1 trial of an inihibitor underway and hepatocellular and colorectal cancers. Overall, there (table 2). Primary outcomes in 26 patients with is an inconsistency in the data with regard to these two metastatic anal squamous cell carcinoma showed 58% biomarkers in anal squamous cell carcinoma, which calls of patients achieving disease control and a reasonable into doubt any potential use that these biomarkers may safety profi le.44 have as clinically useful prognostic markers. www.thelancet.com/oncology Vol 16 December 2015 e617 Review
work to advance this type of modelling, in addition to gene Search strategy and selection criteria profi ling, should be at the forefront of research for this A search of the literature was done on PubMed using the disease. The patient-derived tumour xenograft models keywords “anal squamous cell carcinoma”, “anal cancer”, could have a dual role in the provision of a source of “anal intraepithelial carcinoma”, paired with important tumour tissue for molecular and genetic testing, and a markers involved in the cell cycle or cell proliferation (eg, resource for testing new therapies. “p53” and “epidermal growth factor receptor”), “apoptosis”, “angiogenesis”, and “human papilloma virus”. Only English Conclusion language studies were considered. Further studies were The role of HPV infection in the development of anal identifi ed by searching manually and cross-referencing the squamous cell carcinoma is accepted. The molecular bibliographies of relevant reports. aspects of this malignant disease are becoming clearer, particularly with regard to the EGFR and PI3K/AKT signalling pathways. Immunotherapy represents an Two targeted therapies can be directed at the inhibitor of exciting development with further studies specifi c for apoptosis, survivin,87–90 which is expressed in anal squamous anal squamous cell carcinoma needed. Further progress cell carcinoma. More studies to clarify its role in this disease is hindered by a paucity of reliable preclinical models to are needed but it could off er a promising target as part of test these emerging translational opportunities and multimodality therapy or for disease relapse. should be the focus of further research. The addition of cetuximab to standard chemo- Contributors radiotherapy for anal cancer is actively being investigated. M-PB was responsible for the entire manuscript. WAP provided Thus far, the experience with cetuximab has been variable, substantial assistance with major aspects of drafting and revisions. with two studies stopping prematurely due to very high RR and AGH provided further advice. All other authors reviewed the manuscript and are in agreement with regard to the contents. numbers of toxic eff ects.103,104 The results of two further Declaration of interests phase 2 studies (AMC045, ECOG E3205), using cisplatin, The authors declare no confl icts of interest. and another (NOAC8) using fl uorouracil and mitomycin C, References are awaited (table 3). Only one study has reported the use of 1 Greenall MJ, Quan SH, DeCosse JJ. Epidermoid cancer of the anus. cetuximab in seven patients with metastatic anal squamous Br J Surg 1985; 72 (suppl): S97–103. cell carcinoma. The fi ve patients with wild-type KRAS 2 Skibber J, Rodriguez-Bigas MA, Gordon PH. Surgical considerations tumours had partial or minor remissions, or stable disease in anal cancer. Surg Oncol Clin N Am 2004; 13: 321–38. 3 Glynne-Jones R, Northover J, Oliveira J, ESMO Guidelines Working in their previously rapidly progressive tumours, and two Group. Anal cancer: ESMO clinical recommendations for diagnosis, patients with KRAS mutations had disease progression treatment and follow-up. Ann Oncol 2009; 20 (suppl 4): 57–60. with cetuximab. Therefore, cetuximab could emerge as a 4 Cancer WIICoHa. Disease burden estimates: Anal cancer, Incidence rates by cancer registry. http://www.hpvcentre.net/parser. fi rst-line therapy option for those with metastatic disease or php?xml=M2_Anal%20cancer_Incidence%20 after failed standard therapy,105 similar to the experience in rates&iso=XWX&title=Module%202:%20Disease%20burden%20 the management of patients with head and neck squamous estimates%20-%20Anal%20cancer%20-%20Incidence%20rates (accessed Oct 18, 2013). 106,107 cell carcinoma. Other EGFR inhibitors might emerge 5 Frisch M, Melbye M, Møller H. Trends in incidence of anal cancer with improved safety profi les when combined with in Denmark. BMJ 1993; 306: 419–22. standard chemoradiotherapy. There is hope for this class of 6 Jin F, Stein AN, Conway EL, et al. Trends in anal cancer in Australia, 1982–2005. Vaccine 2011; 29: 2322–27. drugs for use in relapsed disease or palliation as a single 7 Brewster DH, Bhatti LA. Increasing incidence of squamous cell agent or in combination with other novel therapies. carcinoma of the anus in Scotland, 1975–2002. Br J Cancer 2006; In the meantime, there is a greater understanding 95: 87–90. regarding the role of the EGFR and PI3K/AKT signalling 8 Silverberg MJ, Lau B, Justice AC, et al. Risk of anal cancer in HIV-infected and HIV-uninfected individuals in North America. pathways. Several PI3K inhibitors are in clinical trials for Clin Infect Dis 2012; 54: 1026–34. other tumours. However, the details of this pathway’s 9 Buroker TR, Nigro N, Bradley G, et al. Combined therapy for cancer of association with anal squamous cell carcinoma are only the anal canal: a follow-up report. Dis Colon Rectum 1977; 20: 677–78. 10 Ng M, Leong T, Chander S, et al. Australasian Gastrointestinal just becoming clear. Thus far, no predictive or prognostic Trials Group (AGITG) contouring atlas and planning guidelines for markers have been identifi ed that are useful in clinical intensity-modulated radiotherapy in anal cancer. practice. Int J Radiat Oncol Biol Phys 2012; 83: 1455–62. 11 Gunderson LL, Winter KA, Ajani JA, et al. Long-term update of US A glaring omission from the available information is GI intergroup RTOG 98-11 phase III trial for anal carcinoma: that of studies using biopsies of anal cancers to perform survival, relapse, and colostomy failure with concurrent gene expression profi ling with techniques such as next- chemoradiation involving fl uorouracil/mitomycin versus fl uorouracil/cisplatin. J Clin Oncol 2012; 30: 4344–51. generation sequencing, which can provide crucial 12 Edge SB, Byrd DR, Compton CC, et al. AJCC cancer staging information regarding many genetic factors within healthy manual, 7th edn. New York: Springer; 2009. and tumour tissue. This Review highlights the absence of 13 James RD, Glynne-Jones R, Meadows HM, et al. Mitomycin or robust preclinical models for anal squamous cell cisplatin chemoradiation with or without maintenance chemotherapy for treatment of squamous-cell carcinoma of the carcinoma, and discusses the limitations of the single cell anus (ACT II): a randomised, phase 3, open-label, 2 × 2 factorial line available and the mouse models. Nonetheless, further trial. Lancet Oncol 2013; 14: 516–24. e618 www.thelancet.com/oncology Vol 16 December 2015 Review
14 Renehan AG, Saunders MP, Schofi eld PF, O’Dwyer ST. Patterns of 37 zur Hausen H. Papillomaviruses in human cancers. local disease failure and outcome after salvage surgery in patients Proc Assoc Am Physicians 1999; 111: 581–87. with anal cancer. Br J Surg 2005; 92: 605–14. 38 Rodríguez AC, Schiff man M, Herrero R, et al. Longitudinal study of 15 Renehan AG, O’Dwyer ST. Management of local disease relapse. human papillomavirus persistence and cervical intraepithelial Colorectal Dis 2011; 13 (suppl 1): 44–52. neoplasia grade 2/3: critical role of duration of infection. 16 Benson AB, Bekaii-Saab T, Chan E, et al. National Comprehensive J Natl Cancer Inst 2010; 102: 315–24. Cancer Network Clinical Practice Guidelines in Oncology: Anal 39 Stanley M. Immune responses to human papillomavirus. Carcinoma. 2013. http://www.jnccn.org/content/10/4/449.full Vaccine 2006; 24 (suppl 1): S16–22. (accessed June 10, 2013). 40 Caberg JH, Hubert PM, Begon DY, et al. Silencing of E7 oncogene 17 Daling JR, Madeleine MM, Johnson LG, et al. Human restores functional E-cadherin expression in human papillomavirus papillomavirus, smoking, and sexual practices in the etiology of 16-transformed keratinocytes. Carcinogenesis 2008; 29: 1441–47. anal cancer. Cancer 2004; 101: 270–80. 41 Hubert P, Caberg JH, Gilles C, et al. E-cadherin-dependent 18 De Vuyst H, Cliff ord GM, Nascimento MC, Madeleine MM, adhesion of dendritic and Langerhans cells to keratinocytes is Franceschi S. Prevalence and type distribution of human defective in cervical human papillomavirus-associated (pre) papillomavirus in carcinoma and intraepithelial neoplasia of the neoplastic lesions. J Pathol 2005; 206: 346–55. vulva, vagina and anus: a meta-analysis. Int J Cancer 2009; 42 Pardoll DM. The blockade of immune checkpoints in cancer 124: 1626–36. immunotherapy. Nat Rev Cancer 2012; 12: 252–64. 19 Darragh TM, Colgan TJ, Thomas Cox J, et al. The Lower Anogenital 43 Spardy N, Covella K, Cha E, et al. Human papillomavirus 16 E7 Squamous Terminology Standardization project for HPV-associated oncoprotein attenuates DNA damage checkpoint control by lesions: background and consensus recommendations from the increasing the proteolytic turnover of claspin. Cancer Res 2009; College of American Pathologists and the American Society for 69: 7022–29. Colposcopy and Cervical Pathology. Arch Pathol Lab Med 2012; 44 Bendell JC, Eng C, Moore KN, et al. Checkpoint kinase (CHK) 1/2 136: 1266–97. inhibitor LY2606368 in a phase I, dose-expansion study in patients 20 Takeda A, Maeda M, Iseki H, Hirooka E, Shinozuka N, Koyama I. (pts) with metastatic squamous cell carcinoma (mSCC) of the anus. Establishment and characterization of the human SaTM-1 anal Proc Am Soc Clin Oncol 2015; 33 (suppl): abstr 3520. canal squamous cell carcinoma cell line derived from lymph node 45 Gervaz P, Hirschel B, Morel P. Molecular biology of squamous cell metastasis. Int J Mol Med 2009; 24: 465–72. carcinoma of the anus. Br J Surg 2006; 93: 531–38. 21 Stelzer MK, Pitot HC, Liem A, Schweizer J, Mahoney C, 46 Marin-Muller C, Li M, Chen C, Yao Q. Current understanding and Lambert PF. A mouse model for human anal cancer. potential immunotherapy for HIV-associated squamous cell Cancer Prev Res (Phila) 2010; 3: 1534–41. carcinoma of the anus (SCCA). World J Surg 2009; 33: 653–60. 22 Sun ZJ, Zhang L, Zhang W, Hall B, Bian Y, Kulkarni AB. Inhibition 47 Muleris M, Salmon RJ, Girodet J, Zafrani B, Dutrillaux B. Recurrent of mTOR reduces anal carcinogenesis in transgenic mouse model. deletions of chromosomes 11q and 3p in anal canal carcinoma. PLoS One 2013; 8: e74888. Int J Cancer 1987; 39: 595–98. 23 Stelzer MK, Pitot HC, Liem A, Lee D, Kennedy GD, Lambert PF. 48 Heselmeyer K, du Manoir S, Blegen H, et al. A recurrent pattern of Rapamycin inhibits anal carcinogenesis in two preclinical animal chromosomal aberrations and immunophenotypic appearance models. Cancer Prev Res (Phila) 2010; 3: 1542–51. defi nes anal squamous cell carcinomas. Br J Cancer 1997; 24 Ghittoni R, Accardi R, Hasan U, Gheit T, Sylla B, Tommasino M. 76: 1271–78. The biological properties of E6 and E7 oncoproteins from human 49 Gervaz P, Hahnloser D, Wolff BG, et al. Molecular biology of papillomaviruses. Virus Genes 2010; 40: 1–13. squamous cell carcinoma of the anus: a comparison of HIV-positive 25 Chatterjee A. The next generation of HPV vaccines: nonavalent and HIV-negative patients. J Gastrointest Surg 2004; 8: 1024–30. vaccine V503 on the horizon. Expert Rev Vaccines 2014; 50 Gervaz P, Efron J, Poza AA, et al. Loss of heterozygosity and HIV 13: 1279–90. infection in patients with anal squamous-cell carcinoma. 26 zur Hausen H. Papillomaviruses causing cancer: evasion from host- Dis Colon Rectum 2001; 44: 1503–08. cell control in early events in carcinogenesis. J Natl Cancer Inst 51 Hampton GM, Penny LA, Baergen RN, et al. Loss of heterozygosity 2000; 92: 690–98. in cervical carcinoma: subchromosomal localization of a putative 27 Schiff man M, Wentzensen N, Wacholder S, Kinney W, Gage JC, tumor-suppressor gene to chromosome 11q22-q24. Castle PE. Human papillomavirus testing in the prevention of Proc Natl Acad Sci USA 1994; 91: 6953–57. cervical cancer. J Natl Cancer Inst 2011; 103: 368–83. 52 Evans MF, Koreth J, Bakkenist CJ, Herrington CS, McGee JO. 28 Werness BA, Levine AJ, Howley PM. Association of human Allelic deletion at 11q23.3-q25 is an early event in cervical neoplasia. papillomavirus types 16 and 18 E6 proteins with p53. Science 1990; Oncogene 1998; 16: 2557–64. 248: 76–79. 53 Steenbergen RD, Hermsen MA, Walboomers JM, et al. Non- 29 Scheff ner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM. random allelic losses at 3p, 11p and 13q during HPV-mediated The E6 oncoprotein encoded by human papillomavirus types 16 and immortalization and concomitant loss of terminal diff erentiation of 18 promotes the degradation of p53. Cell 1990; 63: 1129–36. human keratinocytes. Int J Cancer 1998; 76: 412–17. 30 Thomas M, Pim D, Banks L. The role of the E6-p53 interaction in 54 Steenbergen RD, Walboomers JM, Meijer CJ, et al. Transition of the molecular pathogenesis of HPV. Oncogene 1999; 18: 7690–700. human papillomavirus type 16 and 18 transfected human foreskin 31 Dyson N, Howley PM, Münger K, Harlow E. The human papilloma keratinocytes towards immortality: activation of telomerase and virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene allele losses at 3p, 10p, 11q and/or 18q. Oncogene 1996; 13: 1249–57. product. Science 1989; 243: 934–37. 55 Lampejo T, Kavanagh D, Clark J, et al. Prognostic biomarkers in 32 Hoots BE, Palefsky JM, Pimenta JM, Smith JS. Human squamous cell carcinoma of the anus: a systematic review. papillomavirus type distribution in anal cancer and anal Br J Cancer 2010; 103: 1858–69. intraepithelial lesions. Int J Cancer 2009; 124: 2375–83. 56 Allal AS, Waelchli L, Bründler MA. Prognostic value of 33 Palmer JG, Scholefi eld JH, Coates PJ, et al. Anal cancer and human apoptosis-regulating protein expression in anal squamous cell papillomaviruses. Dis Colon Rectum 1989; 32: 1016–22. carcinoma. Clin Cancer Res 2003; 9: 6489–96. 34 Watson AJ, Smith BB, Whitehead MR, Sykes PH, Frizelle FA. 57 Wong CS, Tsao MS, Sharma V, Chapman WB, Pintilie M, Malignant progression of anal intra-epithelial neoplasia. ANZ J Surg Cummings BJ. Prognostic role of p53 protein expression in 2006; 76: 715–17. epidermoid carcinoma of the anal canal. Int J Radiat Oncol Biol Phys 35 Scholefi eld JH, Castle MT, Watson NF. Malignant transformation of 1999; 45: 309–14. high-grade anal intraepithelial neoplasia. Br J Surg 2005; 58 Mawdsley S, Meadows H, James R, eds. The role of biological 92: 1133–36. molecular markers in predicting both response to treatment and 36 Evander M, Edlund K, Gustafsson A, et al. Human papillomavirus clinical outcome in squamous cell carcinoma of the anus infection is transient in young women: a population-based cohort [Abstract 183]. ASCO 2004 Gastrointestinal Cancers Symposium study. J Infect Dis 1995; 171: 1026–30. Proceedings; 2004; San Francisco.
www.thelancet.com/oncology Vol 16 December 2015 e619 Review
59 Nilsson PJ, Lenander C, Rubio C, Auer G, Ljungqvist O, 82 Crawford RA, Caldwell C, Iles RK, Lowe D, Shepherd JH, Glimelius B. Prognostic signifi cance of Cyclin A in epidermoid Chard T. Prognostic signifi cance of the bcl-2 apoptotic family of anal cancer. Oncol Rep 2006; 16: 443–49. proteins in primary and recurrent cervical cancer. Br J Cancer 1998; 60 Lê LH, Chetty R, Moore MJ. Epidermal growth factor receptor 78: 210–14. expression in anal canal carcinoma. Am J Clin Pathol 2005; 83 Yuan H, Fu F, Zhuo J, et al. Human papillomavirus type 16 E6 and 124: 20–23. E7 oncoproteins upregulate c-IAP2 gene expression and confer 61 Alvarez G, Perry A, Tan BR, Wang HL. Expression of epidermal resistance to apoptosis. Oncogene 2005; 24: 5069–78. growth factor receptor in squamous cell carcinomas of the anal 84 James MA, Lee JH, Klingelhutz AJ. Human papillomavirus type 16 canal is independent of gene amplifi cation. Mod Pathol 2006; E6 activates NF-kappaB, induces cIAP-2 expression, and protects 19: 942–49. against apoptosis in a PDZ binding motif-dependent manner. 62 Ajani JA, Wang X, Izzo JG, et al. Molecular biomarkers correlate J Virol 2006; 80: 5301–07. with disease-free survival in patients with anal canal carcinoma 85 Borbély AA, Murvai M, Kónya J, et al. Eff ects of human treated with chemoradiation. Dig Dis Sci 2010; 55: 1098–105. papillomavirus type 16 oncoproteins on survivin gene expression. 63 Holm R, Skovlund E, Skomedal H, Flørenes VA, Tanum G. J Gen Virol 2006; 87: 287–94. Reduced expression of p21WAF1 is an indicator of malignant 86 Fraunholz I, Rödel C, Distel L, et al. High survivin expression as a behaviour in anal carcinomas. Histopathology 2001; 39: 43–49. risk factor in patients with anal carcinoma treated with concurrent 64 Ogunbiyi OA, Scholefi eld JH, Smith JH, Polacarz SV, Rogers K, chemoradiotherapy. Radiat Oncol 2012; 7: 88. Sharp F. Immunohistochemical analysis of p53 expression in anal 87 Talbot DC, Ranson M, Davies J, et al. Tumor survivin is squamous neoplasia. J Clin Pathol 1993; 46: 507–12. downregulated by the antisense oligonucleotide LY2181308: 65 Bonin SR, Pajak TF, Russell AH, et al, and the Radiation Therapy a proof-of-concept, fi rst-in-human dose study. Clin Cancer Res 2010; Oncology Group. Overexpression of p53 protein and outcome of 16: 6150–58. patients treated with chemoradiation for carcinoma of the anal 88 Tanioka M, Nokihara H, Yamamoto N, et al. Phase I study of canal: a report of randomized trial RTOG 87-04. Cancer 1999; LY2181308, an antisense oligonucleotide against survivin, in 85: 1226–33. patients with advanced solid tumors. Cancer Chemother Pharmacol 66 Patel H, Polanco-Echeverry G, Segditsas S, et al. Activation of 2011; 68: 505–11. AKT and nuclear accumulation of wild type TP53 and MDM2 in 89 Tolcher AW, Mita A, Lewis LD, et al. Phase I and pharmacokinetic anal squamous cell carcinoma. Int J Cancer 2007; 121: 2668–73. study of YM155, a small-molecule inhibitor of survivin. 67 Nicholson RI, Gee JM, Harper ME. EGFR and cancer prognosis. J Clin Oncol 2008; 26: 5198–203. Eur J Cancer 2001; 37 (suppl 4): S9–15. 90 Satoh T, Okamoto I, Miyazaki M, et al. Phase I study of YM155, a 68 Ciardiello F, Tortora G. EGFR antagonists in cancer treatment. novel survivin suppressant, in patients with advanced solid tumors. N Engl J Med 2008; 358: 1160–74. Clin Cancer Res 2009; 15: 3872–80. 69 Van Damme N, Deron P, Van Roy N, et al. Epidermal growth 91 Ruiz i Altaba A, Palma V, Dahmane N. Hedgehog-Gli signalling and factor receptor and K-RAS status in two cohorts of squamous cell the growth of the brain. Nat Rev Neurosci 2002; 3: 24–33. carcinomas. BMC Cancer 2010; 10: 189. 92 Sims-Mourtada J, Izzo JG, Apisarnthanarax S, et al. Hedgehog: 70 Paliga A, Onerheim R, Gologan A, et al. EGFR and K-ras gene an attribute to tumor regrowth after chemoradiotherapy and a target mutation status in squamous cell anal carcinoma: a role for to improve radiation response. Clin Cancer Res 2006; 12: 6565–72. concurrent radiation and EGFR inhibitors? Br J Cancer 2012; 93 Chen YJ, Lin CP, Hsu ML, Shieh HR, Chao NK, Chao KS. Sonic 107: 1864–68. hedgehog signaling protects human hepatocellular carcinoma cells 71 Zampino MG, Magni E, Sonzogni A, Renne G. K-ras status in against ionizing radiation in an autocrine manner. squamous cell anal carcinoma (SCC): it’s time for target-oriented Int J Radiat Oncol Biol Phys 2011; 80: 851–59. treatment? Cancer Chemother Pharmacol 2009; 65: 197–99. 94 Backer MV, Hamby CV, Backer JM. Inhibition of vascular 72 Gilbert DC, Williams A, Allan K, et al. p16INK4A, p53, EGFR endothelial growth factor receptor signaling in angiogenic tumor expression and KRAS mutation status in squamous cell cancers of vasculature. Adv Genet 2009; 67: 1–27. the anus: correlation with outcomes following chemo- 95 Arbeit JM, Münger K, Howley PM, Hanahan D. Progressive radiotherapy. Radiother Oncol 2013; 109: 146–51. squamous epithelial neoplasia in K14-human papillomavirus type 73 Bokemeyer C, Bondarenko I, Makhson A, et al. Fluorouracil, 16 transgenic mice. J Virol 1994; 68: 4358–68. leucovorin, and oxaliplatin with and without cetuximab in the 96 Song S, Pitot HC, Lambert PF. The human papillomavirus type 16 fi rst-line treatment of metastatic colorectal cancer. J Clin Oncol E6 gene alone is suffi cient to induce carcinomas in transgenic 2009; 27: 663–71. animals. J Virol 1999; 73: 5887–93. 74 Sheppard K, Kinross KM, Solomon B, Pearson RB, Phillips WA. 97 Herber R, Liem A, Pitot H, Lambert PF. Squamous epithelial Targeting PI3 kinase/AKT/mTOR signaling in cancer. hyperplasia and carcinoma in mice transgenic for the human Crit Rev Oncog 2012; 17: 69–95. papillomavirus type 16 E7 oncogene. J Virol 1996; 70: 1873–81. 75 Bussink J, van der Kogel AJ, Kaanders JH. Activation of the 98 Thomas MK, Pitot HC, Liem A, Lambert PF. Dominant role of PI3-K/AKT pathway and implications for radioresistance HPV16 E7 in anal carcinogenesis. Virology 2011; 421: 114–18. mechanisms in head and neck cancer. Lancet Oncol 2008; 99 International Rare Cancers Initiative. Rare cancer types. 9: 288–96. http://www.irci.info/?page_id=28 (accessed Aug 4, 2015). 76 Vanhaesebroeck B, Stephens L, Hawkins P. PI3K signalling: the 100 Wallecha A, French C, Petit R, Singh R, Amin A, Rothman J. path to discovery and understanding. Nat Rev Mol Cell Biol 2012; Lm-LLO-based immunotherapies and HPV-associated disease. 13: 195–203. J Oncol 2012; 2012: 542851. 77 Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in 101 Cory L, Chu C. ADXS-HPV: a therapeutic Listeria vaccination tumor suppression. Cell 2000; 100: 387–90. targeting cervical cancers expressing the HPV E7 antigen. 78 Menges CW, Baglia LA, Lapoint R, McCance DJ. Human Hum Vaccin Immunother 2014; 10: 3190–95. papillomavirus type 16 E7 up-regulates AKT activity through the 102 Gujja S, Williamson SK, Batra A, et al. Programmed cell death- retinoblastoma protein. Cancer Res 2006; 66: 5555–59. ligand 1 (PD-L1) expression and outcome in patients with squamous 79 Martin V, Zanellato E, Franzetti-Pellanda A, et al. EGFR, KRAS, cell cancer of anal canal (SCCAC). Proc Am Soc Clin Oncol 2015; BRAF, and PIK3CA characterization in squamous cell anal 33 (suppl): abstr 3523. cancer. Histol Histopathol 2014; 29: 513–21. 103 Olivatto LO, Vieira FM, Pereira BV, et al. Phase 1 study of cetuximab 80 Thomas LK, Bermejo JL, Vinokurova S, et al. Chromosomal gains in combination with 5-fl uorouracil, cisplatin, and radiotherapy in and losses in human papillomavirus-associated neoplasia of the patients with locally advanced anal canal carcinoma. Cancer 2013; lower genital tract–a systematic review and meta-analysis. 119: 2973–80. Eur J Cancer 2014; 50: 85–98. 104 Levy A, Azria D, Pignon JP, et al. Low response rate after cetuximab 81 Ricciardi R, Burks E, Schoetz DJ, et al. Is there a gain in combined with conventional chemoradiotherapy in patients with chromosome 3q in the pathway to anal cancer? locally advanced anal cancer: long-term results of the UNICANCER Dis Colon Rectum 2014; 57: 1183–87. ACCORD 16 phase II trial. Radiother Oncol 2015; 114: 415–16.
e620 www.thelancet.com/oncology Vol 16 December 2015 Review
105 Lukan N, Ströbel P, Willer A, et al. Cetuximab-based treatment of 107 Vermorken JB, Mesia R, Rivera F, et al. Platinum-based metastatic anal cancer: correlation of response with KRAS chemotherapy plus cetuximab in head and neck cancer. mutational status. Oncology 2009; 77: 293–99. N Engl J Med 2008; 359: 1116–27. 106 Bonner JA, Harari PM, Giralt J, et al. Radiotherapy plus cetuximab for squamous-cell carcinoma of the head and neck. N Engl J Med 2006; 354: 567–78.
www.thelancet.com/oncology Vol 16 December 2015 e621 Appendix 2A
EdgeR output comparing T3/4 tumours versus T1/2 tumours
keratin 78 [Source:HGNC ENSG00000170423 8.429694923 3.999563514 9.455381568 4.72E-07 0.008662828 5.250751086 ENSG00000170423 KRT78 Symbol;Acc:28926]
G protein-coupled receptor 157 ENSG00000180758 2.704364698 4.848053839 8.815142729 1.02E-06 0.009352716 5.780456499 ENSG00000180758 GPR157 [Source:HGNC Symbol;Acc:23687]
ovo-like 1(Drosophila) [Source:HGNC ENSG00000172818 3.326851052 5.428282597 8.24247828 2.10E-06 0.009676293 5.175093311 ENSG00000172818 OVOL1 Symbol;Acc:8525]
sulfotransferase family, cytosolic, 2B, ENSG00000088002 5.643058516 4.994673398 8.180869658 2.28E-06 0.009676293 4.925060298 ENSG00000088002 SULT2B1 member 1 [Source:HGNC Symbol;Acc:11459]
cytoplasmic polyadenylation element ENSG00000113742 2.341766936 4.939847659 7.97711791 2.98E-06 0.009676293 4.867676613 ENSG00000113742 CPEB4 binding protein 4 [Source:HGNC Symbol;Acc:21747]
non-specific cytotoxic cell receptor protein ENSG00000188505 5.803180565 5.685432376 7.779227743 3.88E-06 0.009676293 4.528391415 ENSG00000188505 NCCRP1 1 homolog (zebrafish) [Source:HGNC Symbol;Acc:33739]
periplakin [Source:HGNC ENSG00000118898 4.305445753 8.180803579 7.676525148 4.46E-06 0.009676293 4.54681164 ENSG00000118898 PPL Symbol;Acc:9273]
protein phosphatase 1, regulatory subunit ENSG00000104881 2.412443629 5.667883825 7.641172215 4.68E-06 0.009676293 4.497278006 ENSG00000104881 PPP1R13L 13 like [Source:HGNC Symbol;Acc:18838]
dishevelled associated activator of ENSG00000100592 2.218687376 5.60628588 7.631717267 4.74E-06 0.009676293 4.486693992 ENSG00000100592 DAAM1 morphogenesis 1 [Source:HGNC Symbol;Acc:18142]
thrombomodulin [Source:HGNC ENSG00000178726 3.750529488 5.402656887 7.43914763 6.19E-06 0.011083638 4.197119997 ENSG00000178726 THBD Symbol;Acc:11784]
nuclear receptor coactivator 3 ENSG00000124151 1.860903429 5.988912625 7.307492253 7.44E-06 0.011083638 4.085697335 ENSG00000124151 NCOA3 [Source:HGNC Symbol;Acc:7670]
pim-1 oncogene [Source:HGNC ENSG00000137193 2.648558747 6.613776477 7.22066871 8.41E-06 0.011083638 3.970777604 ENSG00000137193 PIM1 Symbol;Acc:8986]
chromosome 15 open reading frame 62 ENSG00000188277 4.441382584 2.531080413 7.211487393 8.52E-06 0.011083638 3.441213882 ENSG00000188277 C15orf62 [Source:HGNC Symbol;Acc:34489]
MAP7 domain containing 1 ENSG00000116871 1.798304152 6.898429716 7.147353359 9.34E-06 0.011083638 3.879273313 ENSG00000116871 MAP7D1 [Source:HGNC Symbol;Acc:25514]
serpin peptidase inhibitor, clade B ENSG00000197632 6.681964925 4.203898712 7.103355607 9.94E-06 0.011083638 3.478076639 ENSG00000197632 SERPINB2 (ovalbumin), member 2 [Source:HGNC Symbol;Acc:8584]
AHNAK nucleoprotein 2 [Source:HGNC ENSG00000185567 4.062366321 6.832036852 7.022778224 1.12E-05 0.011083638 3.696702347 ENSG00000185567 AHNAK2 Symbol;Acc:20125]
coiled-coil domain containing 120 ENSG00000147144 2.492343686 4.381093302 7.00564765 1.14E-05 0.011083638 3.616399404 ENSG00000147144 CCDC120 [Source:HGNC Symbol;Acc:28910]
spinster homolog 2 (Drosophila) ENSG00000183018 4.669326974 4.719087264 7.002360018 1.15E-05 0.011083638 3.563622828 ENSG00000183018 SPNS2 [Source:HGNC Symbol;Acc:26992]
keratin 10 [Source:HGNC ENSG00000186395 6.580953921 9.314770423 6.993547005 1.16E-05 0.011083638 3.64493017 ENSG00000186395 KRT10 Symbol;Acc:6413]
protease, serine 27 [Source:HGNC ENSG00000172382 5.302866907 4.435230227 6.9495153 1.24E-05 0.011083638 3.4503892 ENSG00000172382 PRSS27 Symbol;Acc:15475]
family with sequence similarity 83, ENSG00000188522 2.342055967 6.802226624 6.935059899 1.27E-05 0.011083638 3.589998198 ENSG00000188522 FAM83G member G [Source:HGNC Symbol;Acc:32554]
placenta-specific 2 (non-protein coding) ENSG00000223573 2.934430755 5.034955944 6.839696093 1.46E-05 0.011490073 3.421834185 ENSG00000223573 PLAC2 [Source:HGNC Symbol;Acc:14607]
prominin 2 [Source:HGNC ENSG00000155066 2.139399293 6.758785442 6.828689935 1.48E-05 0.011490073 3.444421319 ENSG00000155066 PROM2 Symbol;Acc:20685]
SRY (sex determining region Y)-box 7 ENSG00000171056 3.717265563 4.219432557 6.798927566 1.55E-05 0.011490073 3.299548363 ENSG00000171056 SOX7 [Source:HGNC Symbol;Acc:18196]
family with sequence similarity 46, ENSG00000158246 3.514877722 5.238854973 6.776589676 1.60E-05 0.011490073 3.335032069 ENSG00000158246 FAM46B member B [Source:HGNC Symbol;Acc:28273]
ring finger protein 39 [Source:HGNC ENSG00000204618 3.944062592 4.019753264 6.764881435 1.63E-05 0.011490073 3.230455328 ENSG00000204618 RNF39 Symbol;Acc:18064]
forkhead box N3 [Source:HGNC ENSG00000053254 1.987588888 5.693239489 6.712582189 1.76E-05 0.011672677 3.277318852 ENSG00000053254 FOXN3 Symbol;Acc:1928]
envoplakin [Source:HGNC ENSG00000167880 3.567004694 6.620463948 6.689111252 1.82E-05 0.011672677 3.242123439 ENSG00000167880 EVPL Symbol;Acc:3503]
BCL2/adenovirus E1B 19kD interacting ENSG00000163141 5.226958388 3.955207026 6.680638943 1.84E-05 0.011672677 3.057894212 ENSG00000163141 BNIPL protein like [Source:HGNC Symbol;Acc:16976]
mitogen-activated protein kinase kinase ENSG00000006432 2.751155748 4.704712721 6.552363818 2.23E-05 0.013497306 3.019536889 ENSG00000006432 MAP3K9 kinase 9 [Source:HGNC Symbol;Acc:6861]
cellular retinoic acid binding protein 2 ENSG00000143320 3.867495174 7.124995661 6.522842012 2.34E-05 0.013497306 3.010095611 ENSG00000143320 CRABP2 [Source:HGNC Symbol;Acc:2339]
cornifelin [Source:HGNC ENSG00000105427 5.535046832 6.562814207 6.51817488 2.35E-05 0.013497306 2.981989192 ENSG00000105427 CNFN Symbol;Acc:30183]
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine- ENSG00000092295 6.029673238 6.361350206 6.385967068 2.88E-05 0.01581143 2.780138816 ENSG00000092295 TGM1 gamma-glutamyltransferase) [Source:HGNC Symbol;Acc:11777]
kallikrein-related peptidase 10 ENSG00000129451 6.144093046 6.601037015 6.324126246 3.16E-05 0.01581143 2.701318817 ENSG00000129451 KLK10 [Source:HGNC Symbol;Acc:6358]
G protein-coupled receptor 115 ENSG00000153294 3.336872228 4.373422904 6.319376988 3.19E-05 0.01581143 2.675539745 ENSG00000153294 GPR115 [Source:HGNC Symbol;Acc:19011]
glycolipid transfer protein [Source:HGNC ENSG00000139433 2.437862401 7.849700007 6.300335242 3.28E-05 0.01581143 2.691326479 ENSG00000139433 GLTP Symbol;Acc:24867]
coiled-coil domain containing 85C ENSG00000205476 1.808173442 5.598228631 6.297185892 3.30E-05 0.01581143 2.685456194 ENSG00000205476 CCDC85C [Source:HGNC Symbol;Acc:35459]
involucrin [Source:HGNC ENSG00000163207 6.234972646 6.241458827 6.286645372 3.35E-05 0.01581143 2.635716224 ENSG00000163207 IVL Symbol;Acc:6187]
prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and ENSG00000095303 3.54240606 4.753608189 6.284941911 3.36E-05 0.01581143 2.636033813 ENSG00000095303 PTGS1 cyclooxygenase) [Source:HGNC Symbol;Acc:9604]
leucine rich repeat containing 8 family, ENSG00000171492 -1.510347627 5.026646617 -6.263054237 3.47E-05 0.015946063 2.634399399 ENSG00000171492 LRRC8D member D [Source:HGNC Symbol;Acc:16992]
zinc finger, CCHC domain containing 6 ENSG00000083223 1.654934341 6.016610909 6.243442097 3.58E-05 0.016036354 2.607927069 ENSG00000083223 ZCCHC6 [Source:HGNC Symbol;Acc:25817]
intermediate filament family orphan 2 ENSG00000169991 3.502369082 6.733345169 6.211485143 3.76E-05 0.016449744 2.55963915 ENSG00000169991 IFFO2 [Source:HGNC Symbol;Acc:27006]
solute carrier family 10 (sodium/bile acid ENSG00000145283 4.45625634 2.256646902 6.163545266 4.05E-05 0.016962603 2.149199424 ENSG00000145283 SLC10A6 cotransporter family), member 6 [Source:HGNC Symbol;Acc:30603]
ATP-binding cassette, sub-family A ENSG00000144452 5.50757815 5.323397965 6.136983009 4.23E-05 0.016962603 2.404990761 ENSG00000144452 ABCA12 (ABC1), member 12 [Source:HGNC Symbol;Acc:14637]
SAM and SH3 domain containing 1 ENSG00000111961 2.479029083 5.273725687 6.124905805 4.31E-05 0.016962603 2.428563166 ENSG00000111961 SASH1 [Source:HGNC Symbol;Acc:19182]
chromosome 1 open reading frame 116 ENSG00000182795 3.045158225 5.955866064 6.1208057 4.33E-05 0.016962603 2.424879383 ENSG00000182795 C1orf116 [Source:HGNC Symbol;Acc:28667]
peptidoglycan recognition protein 3 ENSG00000159527 5.153276265 3.335396948 6.119647042 4.34E-05 0.016962603 2.24704609 ENSG00000159527 PGLYRP3 [Source:HGNC Symbol;Acc:30014]
hairy and enhancer of split 2 (Drosophila) ENSG00000069812 1.914657519 5.479839826 6.048373033 4.86E-05 0.018576208 2.317772657 ENSG00000069812 HES2 [Source:HGNC Symbol;Acc:16005]
keratin 80 [Source:HGNC ENSG00000167767 5.233603098 6.342833562 6.013608205 5.13E-05 0.019223062 2.25728638 ENSG00000167767 KRT80 Symbol;Acc:27056]
ring finger protein 223 [Source:HGNC ENSG00000237330 4.281443344 1.308344159 5.974464554 5.46E-05 0.020042723 1.647675662 ENSG00000237330 RNF223 Symbol;Acc:40020]
chromosome 9 open reading frame 169 ENSG00000197191 5.530213717 3.816917404 5.950626862 5.67E-05 0.020407437 2.069905321 ENSG00000197191 C9orf169 [Source:HGNC Symbol;Acc:30529]
UDP-glucose ceramide glucosyltransferase ENSG00000148154 1.735891032 6.741246127 5.915079069 6.00E-05 0.021083362 2.114800003 ENSG00000148154 UGCG [Source:HGNC Symbol;Acc:12524]
ENSG00000167768 8.187736073 8.563199581 5.903333579 6.11E-05 0.021083362 2.092217345 ENSG00000167768 KRT1 keratin 1 [Source:HGNC Symbol;Acc:6412]
Ras association (RalGDS/AF-6) domain ENSG00000136653 1.774950813 5.292764595 5.894284625 6.20E-05 0.021083362 2.085740329 ENSG00000136653 RASSF5 family member 5 [Source:HGNC Symbol;Acc:17609]
FERM domain containing 8 ENSG00000126391 1.689635135 6.30334072 5.879563126 6.35E-05 0.021192702 2.060865335 ENSG00000126391 FRMD8 [Source:HGNC Symbol;Acc:25462]
transmembrane protein 154 ENSG00000170006 4.109040431 5.254838908 5.84078859 6.76E-05 0.02214777 1.997000846 ENSG00000170006 TMEM154 [Source:HGNC Symbol;Acc:26489]
kallikrein-related peptidase 13 ENSG00000167759 8.539325331 4.897353909 5.774161367 7.52E-05 0.023884339 1.788792865 ENSG00000167759 KLK13 [Source:HGNC Symbol;Acc:6361]
transmembrane protein 184A ENSG00000164855 3.667463797 4.096978419 5.772066339 7.55E-05 0.023884339 1.872702695 ENSG00000164855 TMEM184A [Source:HGNC Symbol;Acc:28797]
grainyhead-like 1 (Drosophila) ENSG00000134317 2.66901613 7.095000387 5.733468212 8.03E-05 0.02499123 1.836370579 ENSG00000134317 GRHL1 [Source:HGNC Symbol;Acc:17923]
receptor-interacting serine-threonine ENSG00000183421 1.731934809 5.83924894 5.673580307 8.85E-05 0.026819078 1.743891251 ENSG00000183421 RIPK4 kinase 4 [Source:HGNC Symbol;Acc:496]
nudE nuclear distribution E homolog (A. ENSG00000166579 1.648072369 6.0950397 5.669465464 8.91E-05 0.026819078 1.736037938 ENSG00000166579 NDEL1 nidulans)-like 1 [Source:HGNC Symbol;Acc:17620]
pleckstrin homology-like domain, family ENSG00000176531 1.926697947 4.009297644 5.650054645 9.20E-05 0.027234511 1.706043295 ENSG00000176531 PHLDB3 B, member 3 [Source:HGNC Symbol;Acc:30499]
zinc finger protein 750 [Source:HGNC ENSG00000141579 4.39294533 5.933331008 5.6399472 9.35E-05 0.027247907 1.696855991 ENSG00000141579 ZNF750 Symbol;Acc:25843]
polo-like kinase 3 [Source:HGNC ENSG00000173846 2.487287651 4.195877229 5.61161597 9.79E-05 0.027917573 1.648211891 ENSG00000173846 PLK3 Symbol;Acc:2154]
ENSG00000136155 5.390295178 5.373196257 5.60009743 9.98E-05 0.027917573 1.627241884 ENSG00000136155 SCEL sciellin [Source:HGNC Symbol;Acc:10573]
POU class 2 homeobox 3 [Source:HGNC ENSG00000137709 4.32104071 2.744686385 5.596655796 0.000100368 0.027917573 1.511715356 ENSG00000137709 POU2F3 Symbol;Acc:19864]
CD320 molecule [Source:HGNC ENSG00000167775 -1.881136557 4.178559008 -5.571482027 0.000104599 0.028660188 1.591094071 ENSG00000167775 CD320 Symbol;Acc:16692]
dedicator of cytokinesis 9 [Source:HGNC ENSG00000088387 2.310620592 6.377102867 5.551179755 0.000108148 0.028700376 1.551406819 ENSG00000088387 DOCK9 Symbol;Acc:14132]
kallikrein-related peptidase 7 ENSG00000169035 7.622560417 4.733448809 5.536982872 0.000110705 0.028700376 1.46417077 ENSG00000169035 KLK7 [Source:HGNC Symbol;Acc:6368]
Rho guanine nucleotide exchange factor ENSG00000136002 2.76142849 5.863054943 5.530811618 0.000111836 0.028700376 1.524155332 ENSG00000136002 ARHGEF4 (GEF) 4 [Source:HGNC Symbol;Acc:684]
dermokine [Source:HGNC ENSG00000161249 6.014417985 7.304306718 5.52814526 0.000112328 0.028700376 1.52409657 ENSG00000161249 DMKN Symbol;Acc:25063]
target of myb1 (chicken) [Source:HGNC ENSG00000100284 1.614430248 6.301380493 5.526880358 0.000112563 0.028700376 1.510401673 ENSG00000100284 TOM1 Symbol;Acc:11982]
v-maf musculoaponeurotic fibrosarcoma ENSG00000204103 2.406118486 6.090517625 5.489562066 0.000119715 0.030105979 1.455290894 ENSG00000204103 MAFB oncogene homolog B (avian) [Source:HGNC Symbol;Acc:6408]
pleckstrin homology domain containing, ENSG00000187583 3.959797757 2.391169685 5.455911059 0.000126575 0.031187156 1.279618228 ENSG00000187583 PLEKHN1 family N member 1 [Source:HGNC Symbol;Acc:25284]
retinitis pigmentosa 1-like 1 ENSG00000183638 5.329925081 -0.950180764 5.45193671 0.000127412 0.031187156 -0.208805467 ENSG00000183638 RP1L1 [Source:HGNC Symbol;Acc:15946]
junction plakoglobin [Source:HGNC ENSG00000173801 2.218050373 9.809734636 5.440165726 0.000129926 0.031383921 1.383310589 ENSG00000173801 JUP Symbol;Acc:6207]
retinoic acid receptor, gamma ENSG00000172819 1.673749517 7.077241411 5.420905161 0.000134151 0.031983792 1.34047321 ENSG00000172819 RARG [Source:HGNC Symbol;Acc:9866]
aldehyde dehydrogenase 3 family, ENSG00000132746 4.186696775 6.219450366 5.388835785 0.000141511 0.032910485 1.30400007 ENSG00000132746 ALDH3B2 member B2 [Source:HGNC Symbol;Acc:411]
lemur tyrosine kinase 3 [Source:HGNC ENSG00000142235 2.866700304 2.267758777 5.388356599 0.000141624 0.032910485 1.215408465 ENSG00000142235 LMTK3 Symbol;Acc:19295]
ATPase, class V, type 10D [Source:HGNC ENSG00000145246 1.771315714 5.248766904 5.375303706 0.000144742 0.033214668 1.278185236 ENSG00000145246 ATP10D Symbol;Acc:13549]
phospholipase A2, group IVE ENSG00000188089 6.365412742 4.271056941 5.351234256 0.000150683 0.033879487 1.205010943 ENSG00000188089 PLA2G4E [Source:HGNC Symbol;Acc:24791]
alpha-2-macroglobulin-like 1 ENSG00000166535 4.329467025 7.300863491 5.331906359 0.000155638 0.033879487 1.20723894 ENSG00000166535 A2ML1 [Source:HGNC Symbol;Acc:23336]
kallikrein-related peptidase 6 ENSG00000167755 6.521319858 5.211960755 5.32433333 0.000157626 0.033879487 1.191775794 ENSG00000167755 KLK6 [Source:HGNC Symbol;Acc:6367]
LY6/PLAUR domain containing 3 ENSG00000124466 4.23518898 8.285978162 5.321083953 0.000158487 0.033879487 1.188263515 ENSG00000124466 LYPD3 [Source:HGNC Symbol;Acc:24880]
kallikrein-related peptidase 11 ENSG00000167757 6.362657567 5.143828062 5.315823087 0.000159892 0.033879487 1.182477458 ENSG00000167757 KLK11 [Source:HGNC Symbol;Acc:6359]
receptor accessory protein 4 ENSG00000168476 1.340534573 5.82912259 5.312352122 0.000160826 0.033879487 1.168131006 ENSG00000168476 REEP4 [Source:HGNC Symbol;Acc:26176]
family with sequence similarity 59, ENSG00000141441 1.89579797 4.811150527 5.310634702 0.00016129 0.033879487 1.180711395 ENSG00000141441 FAM59A member A [Source:HGNC Symbol;Acc:26136]
EPS8-like 1 [Source:HGNC ENSG00000131037 3.502336846 5.398432179 5.306022855 0.000162544 0.033879487 1.175167799 ENSG00000131037 EPS8L1 Symbol;Acc:21295]
glucose-fructose oxidoreductase domain ENSG00000145990 1.670730391 4.061637503 5.299810646 0.000164249 0.033879487 1.167307321 ENSG00000145990 GFOD1 containing 1 [Source:HGNC Symbol;Acc:21096]
pleckstrin homology domain containing, ENSG00000068137 1.50571595 5.57320912 5.286540984 0.000167953 0.034258716 1.129979212 ENSG00000068137 PLEKHH3 family H (with MyTH4 domain) member 3 [Source:HGNC Symbol;Acc:26105]
protocadherin gamma subfamily C, 3 ENSG00000240184 5.603150955 1.483668944 5.265578338 0.000173985 0.034488984 0.579287618 ENSG00000240184 PCDHGC3 [Source:HGNC Symbol;Acc:8716]
Rho guanine nucleotide exchange factor ENSG00000183111 1.961339819 5.580521902 5.26199299 0.00017504 0.034488984 1.093245204 ENSG00000183111 ARHGEF37 (GEF) 37 [Source:HGNC Symbol;Acc:34430]
GTF2I repeat domain containing 1 ENSG00000006704 1.416795946 5.203130708 5.256993891 0.000176521 0.034488984 1.086605826 ENSG00000006704 GTF2IRD1 [Source:HGNC Symbol;Acc:4661]
chromosome 6 open reading frame 132 ENSG00000188112 1.968289044 6.207205368 5.256738036 0.000176597 0.034488984 1.078159639 ENSG00000188112 C6orf132 [Source:HGNC Symbol;Acc:21288]
nucleotide-binding oligomerization ENSG00000167207 3.798701583 4.163360316 5.234428159 0.000183372 0.034968465 1.060335875 ENSG00000167207 NOD2 domain containing 2 [Source:HGNC Symbol;Acc:5331]
transmembrane protein 79 [Source:HGNC ENSG00000163472 2.845251989 6.147962607 5.231305232 0.000184342 0.034968465 1.043177938 ENSG00000163472 TMEM79 Symbol;Acc:28196]
ENSG00000243491 5.093914273 0.095934215 5.224850237 0.000186364 0.034968465 0.158252861 ENSG00000243491 ENSG00000241181 4.185253848 2.736205682 5.221531745 0.000187412 0.034968465 0.966643522 ENSG00000241181
family with sequence similarity 110, ENSG00000184731 2.066432176 5.42782752 5.217538038 0.000188682 0.034968465 1.023241874 ENSG00000184731 FAM110C member C [Source:HGNC Symbol;Acc:33340]
peroxisome proliferator-activated receptor ENSG00000112033 2.361789848 6.190182611 5.211930137 0.000190481 0.034968465 1.008333382 ENSG00000112033 PPARD delta [Source:HGNC Symbol;Acc:9235]
peptidase inhibitor 3, skin-derived ENSG00000124102 6.08537387 9.053373729 5.198053833 0.000195009 0.035073885 0.996319392 ENSG00000124102 PI3 [Source:HGNC Symbol;Acc:8947]
transmembrane protease, serine 11F ENSG00000198092 5.20198942 2.336766814 5.185131491 0.000199327 0.035073885 0.832207867 ENSG00000198092 TMPRSS11F [Source:HGNC Symbol;Acc:29994]
ENSG00000159166 1.60253515 8.617816577 5.185085126 0.000199343 0.035073885 0.966212839 ENSG00000159166 LAD1 ladinin 1 [Source:HGNC Symbol;Acc:6472]
LY6/PLAUR domain containing 5 ENSG00000159871 3.448308509 5.312860743 5.183481831 0.000199886 0.035073885 0.979122506 ENSG00000159871 LYPD5 [Source:HGNC Symbol;Acc:26397]
RAN binding protein 9 [Source:HGNC ENSG00000010017 1.408862616 6.158151754 5.181355883 0.000200608 0.035073885 0.952504103 ENSG00000010017 RANBP9 Symbol;Acc:13727]
coiled-coil domain containing 69 ENSG00000198624 2.611396338 4.369584232 5.172910607 0.000203503 0.03524449 0.966403021 ENSG00000198624 CCDC69 [Source:HGNC Symbol;Acc:24487]
V-set and immunoglobulin domain ENSG00000186806 4.655665545 4.166321467 5.152643331 0.000210633 0.036138253 0.927254578 ENSG00000186806 VSIG10L containing 10 like [Source:HGNC Symbol;Acc:27111]
N-deacetylase/N-sulfotransferase (heparan ENSG00000070614 1.797042956 6.984058146 5.13193196 0.000218189 0.036485688 0.870612804 ENSG00000070614 NDST1 glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
adenylate cyclase 7 [Source:HGNC ENSG00000121281 2.716538014 3.240083859 5.131065061 0.000218511 0.036485688 0.890242376 ENSG00000121281 ADCY7 Symbol;Acc:238]
v-akt murine thymoma viral oncogene ENSG00000105221 1.139518757 6.647239236 5.130772801 0.00021862 0.036485688 0.866548085 ENSG00000105221 AKT2 homolog 2 [Source:HGNC Symbol;Acc:392]
prolyl 4-hydroxylase, alpha polypeptide I ENSG00000122884 -1.9594293 5.258632145 -5.120394511 0.000222521 0.036654804 0.863301475 ENSG00000122884 P4HA1 [Source:HGNC Symbol;Acc:8546]
grainyhead-like 3 (Drosophila) ENSG00000158055 4.880960997 5.7443146 5.117486523 0.000223627 0.036654804 0.877188154 ENSG00000158055 GRHL3 [Source:HGNC Symbol;Acc:25839]
caspase recruitment domain family, ENSG00000141527 3.522813832 3.325479499 5.105362873 0.0002283 0.03708966 0.846298027 ENSG00000141527 CARD14 member 14 [Source:HGNC Symbol;Acc:16446]
ENSG00000049283 2.157963255 5.536973369 5.088651551 0.00023491 0.03733593 0.812318052 ENSG00000049283 EPN3 epsin 3 [Source:HGNC Symbol;Acc:18235]
zinc finger and BTB domain containing 7B ENSG00000160685 1.891050969 7.236732753 5.08789168 0.000235215 0.03733593 0.798567753 ENSG00000160685 ZBTB7B [Source:HGNC Symbol;Acc:18668]
ATPase, H+ transporting, lysosomal ENSG00000147416 1.513497055 7.031626381 5.081714024 0.000237713 0.03733593 0.786821521 ENSG00000147416 ATP6V1B2 56/58kDa, V1 subunit B2 [Source:HGNC Symbol;Acc:854]
HECT domain containing E3 ubiquitin ENSG00000092148 1.510974231 7.340319763 5.081128294 0.000237951 0.03733593 0.786893703 ENSG00000092148 HECTD1 protein ligase 1 [Source:HGNC Symbol;Acc:20157]
transmembrane protein 63C ENSG00000165548 2.751849154 1.135614042 5.072670305 0.000241419 0.037559058 0.6111136 ENSG00000165548 TMEM63C [Source:HGNC Symbol;Acc:23787]
T-cell lymphoma invasion and metastasis ENSG00000156299 2.565852863 5.843664423 5.067348754 0.000243628 0.037584222 0.777155471 ENSG00000156299 TIAM1 1 [Source:HGNC Symbol;Acc:11805]
metal-regulatory transcription factor 1 ENSG00000188786 2.173350669 3.595623737 5.045038625 0.000253122 0.038723444 0.762774361 ENSG00000188786 MTF1 [Source:HGNC Symbol;Acc:7428]
inositol 1,3,4,5,6-pentakisphosphate 2- ENSG00000127080 2.410587744 4.135541774 5.037096331 0.000256595 0.038930272 0.749796955 ENSG00000127080 IPPK kinase [Source:HGNC Symbol;Acc:14645]
ENSG00000168140 3.536908434 3.367326089 5.028852403 0.000260252 0.039161494 0.726871364 ENSG00000168140 VASN vasorin [Source:HGNC Symbol;Acc:18517]
potassium channel, subfamily K, member ENSG00000099337 2.712309602 4.787157312 5.014957261 0.00026654 0.039317899 0.708294129 ENSG00000099337 KCNK6 6 [Source:HGNC Symbol;Acc:6281]
MYC binding protein 2, E3 ubiquitin ENSG00000005810 2.019087461 7.057146156 5.004668915 0.000271298 0.039317899 0.660500638 ENSG00000005810 MYCBP2 protein ligase [Source:HGNC Symbol;Acc:23386]
chromosome 2 open reading frame 54 ENSG00000172478 4.105756067 4.260321301 4.99931692 0.000273808 0.039317899 0.689627595 ENSG00000172478 C2orf54 [Source:HGNC Symbol;Acc:26216]
absent in melanoma 1-like [Source:HGNC ENSG00000176092 2.76303386 5.131274777 4.994317276 0.000276175 0.039317899 0.669369053 ENSG00000176092 AIM1L Symbol;Acc:17295]
suprabasin [Source:HGNC ENSG00000189001 6.38423504 7.971238509 4.993506125 0.000276561 0.039317899 0.665791336 ENSG00000189001 SBSN Symbol;Acc:24950]
RAB27B, member RAS oncogene family ENSG00000041353 2.139905024 6.107520458 4.993349673 0.000276636 0.039317899 0.646527069 ENSG00000041353 RAB27B [Source:HGNC Symbol;Acc:9767]
BTB and CNC homology 1, basic leucine ENSG00000156273 1.442807892 6.048832109 4.993322705 0.000276649 0.039317899 0.642622586 ENSG00000156273 BACH1 zipper transcription factor 1 [Source:HGNC Symbol;Acc:935]
NDRG family member 4 [Source:HGNC ENSG00000103034 4.397727828 5.13942157 4.989606837 0.000278425 0.039317899 0.672860522 ENSG00000103034 NDRG4 Symbol;Acc:14466]
spectrin, beta, non-erythrocytic 2 ENSG00000173898 3.059972472 6.155530957 4.978432043 0.000283839 0.039500734 0.631324013 ENSG00000173898 SPTBN2 [Source:HGNC Symbol;Acc:11276]
adenosine monophosphate deaminase 3 ENSG00000133805 1.253869843 4.459686832 4.977452708 0.000284319 0.039500734 0.643288052 ENSG00000133805 AMPD3 [Source:HGNC Symbol;Acc:470]
ENSG00000205488 2.323714897 3.169241374 4.9684691 0.000288758 0.039500734 0.636895532 ENSG00000205488
ATPase, H+ transporting, lysosomal ENSG00000114573 1.171353831 6.249930264 4.967566063 0.000289209 0.039500734 0.596622191 ENSG00000114573 ATP6V1A 70kDa, V1 subunit A [Source:HGNC Symbol;Acc:851]
cytochrome P450, family 4, subfamily F, ENSG00000186529 3.585933277 2.572828135 4.9618563 0.000292073 0.039500734 0.595403279 ENSG00000186529 CYP4F3 polypeptide 3 [Source:HGNC Symbol;Acc:2646]
eukaryotic translation initiation factor 4H ENSG00000106682 1.284332903 7.683217957 4.960752759 0.00029263 0.039500734 0.588333817 ENSG00000106682 EIF4H [Source:HGNC Symbol;Acc:12741]
retinoic acid early transcript 1E ENSG00000164520 5.142723527 3.592987268 4.949754074 0.000298242 0.039896429 0.593199569 ENSG00000164520 RAET1E [Source:HGNC Symbol;Acc:16793]
chloride intracellular channel 3 ENSG00000169583 4.695325867 3.648645954 4.946531502 0.000299908 0.039896429 0.595775482 ENSG00000169583 CLIC3 [Source:HGNC Symbol;Acc:2064]
KIAA1609 [Source:HGNC ENSG00000140950 1.913080965 5.209648705 4.927634306 0.000309873 0.040419396 0.549438433 ENSG00000140950 KIAA1609 Symbol;Acc:29325]
RAN binding protein 10 [Source:HGNC ENSG00000141084 1.531102841 5.005123841 4.926302352 0.000310588 0.040419396 0.549183488 ENSG00000141084 RANBP10 Symbol;Acc:29285]
zinc finger and BTB domain containing 7C ENSG00000184828 2.238616427 5.589019105 4.924087857 0.000311781 0.040419396 0.539975964 ENSG00000184828 ZBTB7C [Source:HGNC Symbol;Acc:31700]
MICAL-like 1 [Source:HGNC ENSG00000100139 1.871913178 6.748828953 4.922487596 0.000312646 0.040419396 0.522675511 ENSG00000100139 MICALL1 Symbol;Acc:29804]
acid phosphatase, prostate [Source:HGNC ENSG00000014257 3.374166761 4.607533145 4.905918124 0.000321752 0.041305795 0.53677658 ENSG00000014257 ACPP Symbol;Acc:125]
chromosome 1 open reading frame 170 ENSG00000187642 3.891537155 0.7538632 4.900921328 0.000324553 0.041375938 0.185540603 ENSG00000187642 C1orf170 [Source:HGNC Symbol;Acc:28208]
chemokine (C-C motif) receptor 10 ENSG00000184451 -3.469757545 -1.083822394 -4.894416806 0.000328236 0.041556923 -0.170291207 ENSG00000184451 CCR10 [Source:HGNC Symbol;Acc:4474]
WAP four-disulfide core domain 5 ENSG00000175121 5.593981208 4.028872608 4.889560693 0.000331014 0.041621634 0.505234627 ENSG00000175121 WFDC5 [Source:HGNC Symbol;Acc:20477]
toll interacting protein [Source:HGNC ENSG00000078902 1.787710344 6.317400394 4.869949558 0.000342487 0.042267655 0.4357408 ENSG00000078902 TOLLIP Symbol;Acc:16476]
potassium channel tetramerisation domain ENSG00000213859 1.906570473 5.751448496 4.865660114 0.000345051 0.042267655 0.436686508 ENSG00000213859 KCTD11 containing 11 [Source:HGNC Symbol;Acc:21302]
heparanase [Source:HGNC ENSG00000173083 2.539191661 4.772162832 4.862118732 0.000347183 0.042267655 0.455889817 ENSG00000173083 HPSE Symbol;Acc:5164]
RAS protein activator like 1 (GAP1 like) ENSG00000111344 2.011986307 4.388339718 4.861403056 0.000347615 0.042267655 0.459124745 ENSG00000111344 RASAL1 [Source:HGNC Symbol;Acc:9873]
solute carrier family 16, member 7 ENSG00000118596 3.81292634 0.885712805 4.859421062 0.000348816 0.042267655 0.154933545 ENSG00000118596 SLC16A7 (monocarboxylic acid transporter 2) [Source:HGNC Symbol;Acc:10928]
Kruppel-like factor 10 [Source:HGNC ENSG00000155090 1.134705221 6.243297133 4.857529413 0.000349966 0.042267655 0.411507566 ENSG00000155090 KLF10 Symbol;Acc:11810]
ENSG00000243479 -6.004952434 -2.617314212 -4.825675777 0.00036994 0.043796534 -1.106477712 ENSG00000243479
dehydrogenase/reductase (SDR family) X- ENSG00000169084 -1.684229223 3.904461845 -4.823990173 0.000371029 0.043796534 0.399842397 ENSG00000169084 DHRSX linked [Source:HGNC Symbol;Acc:18399]
ENSG00000255120 4.790423916 -1.787127257 4.822876886 0.00037175 0.043796534 -0.956064279 ENSG00000255120
kinesin light chain 3 [Source:HGNC ENSG00000104892 2.889131744 3.874729274 4.822233699 0.000372168 0.043796534 0.405078751 ENSG00000104892 KLC3 Symbol;Acc:20717]
ENSG00000134250 2.345619059 6.92366809 4.817976013 0.000374944 0.04384215 0.349032762 ENSG00000134250 NOTCH2 notch 2 [Source:HGNC Symbol;Acc:7882]
S100 calcium binding protein A7A ENSG00000184330 6.314449616 5.931426198 4.800854449 0.000386326 0.044370393 0.36913421 ENSG00000184330 S100A7A [Source:HGNC Symbol;Acc:21657]
ribosomal modification protein rimK-like ENSG00000177181 -5.147756172 -1.330404931 -4.800500934 0.000386565 0.044370393 -0.551418669 ENSG00000177181 RIMKLA family member A [Source:HGNC Symbol;Acc:28725]
potassium channel tetramerisation domain ENSG00000188997 1.818724294 3.054081393 4.800282938 0.000386712 0.044370393 0.369452178 ENSG00000188997 KCTD21 containing 21 [Source:HGNC Symbol;Acc:27452]
Appendix 2B
EdgeR output comparing node negative versus node positive tumours
ATP-binding cassette, sub-family A (ABC1), ENSG00000167972 -2.756614421 2.395498628 -4.813893738 0.000387097 0.999336003 -4.451193025 ENSG00000167972 ABCA3 member 3 [Source:HGNC Symbol;Acc:33]
nuclear factor (erythroid-derived 2)-like 3 ENSG00000050344 -1.883264251 5.556202723 -4.662185097 0.000504495 0.999336003 -4.373901037 ENSG00000050344 NFE2L3 [Source:HGNC Symbol;Acc:7783]
gamma-aminobutyric acid (GABA) A ENSG00000166206 -6.264403422 -2.239178739 -4.452753538 0.000730748 0.999336003 -4.572181513 ENSG00000166206 GABRB3 receptor, beta 3 [Source:HGNC Symbol;Acc:4083]
transmembrane protease, serine 11A ENSG00000187054 6.982519545 5.201331908 4.431352649 0.000759178 0.999336003 -4.485295347 ENSG00000187054 TMPRSS11A [Source:HGNC Symbol;Acc:27954]
chromosome 16 open reading frame 74 ENSG00000154102 2.553087841 2.803970987 4.403567558 0.000797812 0.999336003 -4.486153999 ENSG00000154102 C16orf74 [Source:HGNC Symbol;Acc:23362]
brain-specific angiogenesis inhibitor 1 ENSG00000181790 -4.776911638 0.136932522 -4.328713084 0.000912378 0.999336003 -4.538759978 ENSG00000181790 BAI1 [Source:HGNC Symbol;Acc:943]
peroxisome proliferator-activated receptor ENSG00000109819 -5.833583671 -0.240852949 -4.318832148 0.000928728 0.999336003 -4.550070548 ENSG00000109819 PPARGC1A gamma, coactivator 1 alpha [Source:HGNC Symbol;Acc:9237]
plasminogen activator, urokinase ENSG00000122861 2.497024909 6.092220246 4.297198646 0.000965594 0.999336003 -4.393866419 ENSG00000122861 PLAU [Source:HGNC Symbol;Acc:9052]
family with sequence similarity 213, ENSG00000122378 1.917456537 6.671151422 4.248672042 0.001053904 0.999336003 -4.384694036 ENSG00000122378 FAM213A member A [Source:HGNC Symbol;Acc:28651]
zinc finger protein 813 [Source:HGNC ENSG00000198346 -3.279392713 0.841619686 -4.223020137 0.001103923 0.999336003 -4.517379084 ENSG00000198346 ZNF813 Symbol;Acc:33257]
chemokine (C-X-C motif) ligand 17 ENSG00000189377 5.526335072 4.267841098 4.182737729 0.001187481 0.999336003 -4.491876018 ENSG00000189377 CXCL17 [Source:HGNC Symbol;Acc:19232]
potassium channel, subfamily K, member 2 ENSG00000082482 -4.423423407 -2.148727866 -4.163473668 0.001229725 0.999336003 -4.569998455 ENSG00000082482 KCNK2 [Source:HGNC Symbol;Acc:6277]
DnaJ (Hsp40) homolog, subfamily C, ENSG00000116675 -2.831885363 -0.543663062 -4.058066069 0.001489982 0.999336003 -4.548368756 ENSG00000116675 DNAJC6 member 6 [Source:HGNC Symbol;Acc:15469]
carnitine palmitoyltransferase 1C ENSG00000169169 -2.618385743 1.444564451 -3.994221499 0.001674641 0.999336003 -4.502790144 ENSG00000169169 CPT1C [Source:HGNC Symbol;Acc:18540]
reprimo, TP53 dependent G2 arrest ENSG00000177519 -5.585388782 -0.863656285 -3.930054487 0.001884058 0.999336003 -4.560784091 ENSG00000177519 RPRM mediator candidate [Source:HGNC Symbol;Acc:24201]
PYD (pyrin domain) containing 1 ENSG00000169900 -5.99751132 -0.316171505 -3.834472633 0.002247134 0.999336003 -4.556552141 ENSG00000169900 PYDC1 [Source:HGNC Symbol;Acc:30261]
glycerol-3-phosphate acyltransferase 2, ENSG00000186281 -2.19808952 -0.000592731 -3.825224148 0.002285879 0.999336003 -4.541015208 ENSG00000186281 GPAT2 mitochondrial [Source:HGNC Symbol;Acc:27168]
membrane-associated ring finger (C3HC4) ENSG00000173926 -2.52689579 3.084096173 -3.791504207 0.002433038 0.999336003 -4.462288787 ENSG00000173926 Mar-03 3, E3 ubiquitin protein ligase [Source:HGNC Symbol;Acc:28728]
basonuclin 1 [Source:HGNC ENSG00000169594 3.935901348 4.670784527 3.724790985 0.002753445 0.999336003 -4.474912258 ENSG00000169594 BNC1 Symbol;Acc:1081]
Morf4 family associated protein 1-like 1 ENSG00000178988 -0.898664579 5.980679916 -3.698823352 0.002889554 0.999336003 -4.412461265 ENSG00000178988 MRFAP1L1 [Source:HGNC Symbol;Acc:28796]
zinc finger protein 711 [Source:HGNC ENSG00000147180 -1.422604705 3.999446053 -3.68119613 0.002985847 0.999336003 -4.443296796 ENSG00000147180 ZNF711 Symbol;Acc:13128]
myotubularin related protein 7 ENSG00000003987 -2.33356006 -0.233882825 -3.680581167 0.002989264 0.999336003 -4.547571793 ENSG00000003987 MTMR7 [Source:HGNC Symbol;Acc:7454]
ENSG00000140022 1.495592163 4.383472577 3.678609792 0.003000248 0.999336003 -4.451379514 ENSG00000140022 STON2 stonin 2 [Source:HGNC Symbol;Acc:30652]
protein phosphatase 1, regulatory (inhibitor) ENSG00000173457 1.197876976 5.855625517 3.67824996 0.003002258 0.999336003 -4.415474605 ENSG00000173457 PPP1R14B subunit 14B [Source:HGNC Symbol;Acc:9057]
anoctamin 9 [Source:HGNC ENSG00000185101 -1.892616014 4.647767574 -3.675026634 0.003020318 0.999336003 -4.431203013 ENSG00000185101 ANO9 Symbol;Acc:20679]
connector enhancer of kinase suppressor of ENSG00000149970 -2.990993721 -0.794607475 -3.66153442 0.003097128 0.999336003 -4.557294793 ENSG00000149970 CNKSR2 Ras 2 [Source:HGNC Symbol;Acc:19701]
microtubule-associated protein 1 light chain ENSG00000101460 -1.92557403 4.263985771 -3.638506753 0.003232858 0.999336003 -4.440402797 ENSG00000101460 MAP1LC3A 3 alpha [Source:HGNC Symbol;Acc:6838]
solute carrier family 45, member 1 ENSG00000162426 -3.080261078 -1.951454767 -3.585695078 0.003567525 0.999336003 -4.570983071 ENSG00000162426 SLC45A1 [Source:HGNC Symbol;Acc:17939]
small proline-rich protein 3 [Source:HGNC ENSG00000163209 6.35821247 6.82810112 3.577717577 0.003621064 0.999336003 -4.468980534 ENSG00000163209 SPRR3 Symbol;Acc:11268]
junctophilin 2 [Source:HGNC ENSG00000149596 -3.697375788 -2.246417425 -3.55759535 0.003759774 0.999336003 -4.573964049 ENSG00000149596 JPH2 Symbol;Acc:14202]
Proline-rich nuclear receptor coactivator 2 ENSG00000215700 3.643404861 0.478325389 3.52531966 0.003993651 0.999336003 -4.563656232 ENSG00000215700 [Source:UniProtKB/Swiss-Prot;Acc:Q9NPJ4]
zinc finger, RAN-binding domain ENSG00000132485 -0.908464714 6.654906901 -3.487374499 0.004287616 0.999336003 -4.426076875 ENSG00000132485 ZRANB2 containing 2 [Source:HGNC Symbol;Acc:13058]
slit homolog 3 (Drosophila) [Source:HGNC ENSG00000184347 -3.726294905 1.731738301 -3.480677288 0.004341739 0.999336003 -4.510370154 ENSG00000184347 SLIT3 Symbol;Acc:11087]
SRY (sex determining region Y)-box 15 ENSG00000129194 2.748105722 3.772604703 3.477544614 0.004367293 0.999336003 -4.490374715 ENSG00000129194 SOX15 [Source:HGNC Symbol;Acc:11196]
BTB (POZ) domain containing 3 ENSG00000132640 -1.089004196 5.034287999 -3.457324691 0.004535945 0.999336003 -4.433656595 ENSG00000132640 BTBD3 [Source:HGNC Symbol;Acc:15854]
ATPase, H+ transporting, lysosomal ENSG00000205464 -1.852746576 0.166239208 -3.440197916 0.004683959 0.999336003 -4.543855777 ENSG00000205464 ATP6AP1L accessory protein 1-like [Source:HGNC Symbol;Acc:28091]
S100 calcium binding protein A2 ENSG00000196754 3.732915886 9.563994696 3.427345394 0.004798243 0.999336003 -4.443483111 ENSG00000196754 S100A2 [Source:HGNC Symbol;Acc:10492]
cytochrome P450, family 26, subfamily A, ENSG00000095596 -6.115533747 -2.467821312 -3.426705607 0.004804005 0.999336003 -4.578702587 ENSG00000095596 CYP26A1 polypeptide 1 [Source:HGNC Symbol;Acc:2603]
androgen-dependent TFPI-regulating ENSG00000111863 -3.201658347 3.31117806 -3.415603905 0.004905117 0.999336003 -4.474161017 ENSG00000111863 ADTRP protein [Source:HGNC Symbol;Acc:21214]
microtubule-associated protein, RP/EB ENSG00000166974 -1.241901529 4.285218641 -3.409635224 0.004960367 0.999336003 -4.449970047 ENSG00000166974 MAPRE2 family, member 2 [Source:HGNC Symbol;Acc:6891]
collagen, type XXIII, alpha 1 [Source:HGNC ENSG00000050767 -2.396386426 0.48925895 -3.391819106 0.005129063 0.999336003 -4.539620052 ENSG00000050767 COL23A1 Symbol;Acc:22990]
leucine rich repeat containing 4 ENSG00000128594 3.235703135 2.37354626 3.380785883 0.005236434 0.999336003 -4.529324378 ENSG00000128594 LRRC4 [Source:HGNC Symbol;Acc:15586]
ENSG00000230487 -1.893449371 1.189551658 -3.38000928 0.005244077 0.999336003 -4.524491253 ENSG00000230487
amylase, alpha 2B (pancreatic) ENSG00000240038 -1.660962763 0.999756908 -3.37916603 0.005252388 0.999336003 -4.528650896 ENSG00000240038 AMY2B [Source:HGNC Symbol;Acc:478]
cathepsin C [Source:HGNC ENSG00000109861 1.412015084 7.410852982 3.374696602 0.005296664 0.999336003 -4.432550119 ENSG00000109861 CTSC Symbol;Acc:2528]
sema domain, seven thrombospondin repeats (type 1 and type 1-like), ENSG00000112902 -2.017645182 3.547361617 -3.36906929 0.005352947 0.999336003 -4.469094272 ENSG00000112902 SEMA5A transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A [Source:HGNC Symbol;Acc:10736]
ENSG00000260196 -2.415342372 -0.110357471 -3.355332935 0.00549289 0.999336003 -4.550799417 ENSG00000260196
adenosine A2b receptor [Source:HGNC ENSG00000170425 1.258089316 4.444025841 3.352323492 0.00552404 0.999336003 -4.46243211 ENSG00000170425 ADORA2B Symbol;Acc:264]
chromosome 10 open reading frame 55 ENSG00000222047 1.962588523 0.562205619 3.337475717 0.005680361 0.999336003 -4.553868696 ENSG00000222047 C10orf55 [Source:HGNC Symbol;Acc:31008]
sclerostin domain containing 1 ENSG00000171243 -5.013599171 1.357869193 -3.306288845 0.006023414 0.999336003 -4.529948186 ENSG00000171243 SOSTDC1 [Source:HGNC Symbol;Acc:21748]
coiled-coil domain containing 28B ENSG00000160050 -1.81357667 2.156639968 -3.297326172 0.006125819 0.999336003 -4.504830358 ENSG00000160050 CCDC28B [Source:HGNC Symbol;Acc:28163]
retinoic acid early transcript 1L ENSG00000155918 2.977067971 2.384877362 3.293257351 0.006172886 0.999336003 -4.527445188 ENSG00000155918 RAET1L [Source:HGNC Symbol;Acc:16798]
small nuclear RNA activating complex, ENSG00000023608 1.303250917 3.514168584 3.269652834 0.006453224 0.999336003 -4.491597576 ENSG00000023608 SNAPC1 polypeptide 1, 43kDa [Source:HGNC Symbol;Acc:11134]
solute carrier family 25, member 28 ENSG00000155287 0.964872606 5.796485202 3.268540185 0.006466751 0.999336003 -4.43895039 ENSG00000155287 SLC25A28 [Source:HGNC Symbol;Acc:23472]
ENSG00000101577 -1.492098485 4.724431083 -3.265147791 0.00650817 0.999336003 -4.450586726 ENSG00000101577 LPIN2 lipin 2 [Source:HGNC Symbol;Acc:14450] ENSG00000170846 -1.053978039 3.767727738 -3.264707772 0.006513562 0.999336003 -4.469477264 ENSG00000170846
myomesin 1, 185kDa [Source:HGNC ENSG00000101605 -1.610278674 0.143373308 -3.262539832 0.006540193 0.999336003 -4.547379783 ENSG00000101605 MYOM1 Symbol;Acc:7613]
transmembrane protease, serine 11D ENSG00000153802 5.551371559 6.526874053 3.239034784 0.006836068 0.999336003 -4.47759261 ENSG00000153802 TMPRSS11D [Source:HGNC Symbol;Acc:24059]
zinc finger protein 662 [Source:HGNC ENSG00000182983 -3.634089409 1.425650353 -3.233325867 0.006909943 0.999336003 -4.525154859 ENSG00000182983 ZNF662 Symbol;Acc:31930]
FBJ murine osteosarcoma viral oncogene ENSG00000170345 2.257064531 7.382744289 3.225565476 0.007011654 0.999336003 -4.442189619 ENSG00000170345 FOS homolog [Source:HGNC Symbol;Acc:3796]
zinc finger protein 812 [Source:HGNC ENSG00000224689 4.46906755 2.665648255 3.223059454 0.007044819 0.999336003 -4.539265639 ENSG00000224689 ZNF812 Symbol;Acc:33242]
ankyrin repeat and BTB (POZ) domain ENSG00000166016 -2.433762694 3.351938971 -3.214044315 0.00716544 0.999336003 -4.48092574 ENSG00000166016 ABTB2 containing 2 [Source:HGNC Symbol;Acc:23842]
zinc finger, AN1-type domain 6 ENSG00000086666 -1.120270765 6.353351181 -3.211413978 0.007201024 0.999336003 -4.442593274 ENSG00000086666 ZFAND6 [Source:HGNC Symbol;Acc:30164]
hydroxyprostaglandin dehydrogenase 15- ENSG00000164120 -3.108763966 5.365414358 -3.210621353 0.007211781 0.999336003 -4.455474362 ENSG00000164120 HPGD (NAD) [Source:HGNC Symbol;Acc:5154]
transgelin 3 [Source:HGNC ENSG00000144834 -4.533895789 -1.126102056 -3.203158953 0.007313856 0.999336003 -4.568751477 ENSG00000144834 TAGLN3 Symbol;Acc:29868]
leucine rich repeat containing 49 ENSG00000137821 -1.63714864 1.814496795 -3.202093438 0.007328549 0.999336003 -4.51615787 ENSG00000137821 LRRC49 [Source:HGNC Symbol;Acc:25965]
amyloid beta (A4) precursor protein- ENSG00000166313 -1.760601468 2.66486509 -3.199082315 0.007370231 0.999336003 -4.496918571 ENSG00000166313 APBB1 binding, family B, member 1 (Fe65) [Source:HGNC Symbol;Acc:581]
hyaluronan synthase 3 [Source:HGNC ENSG00000103044 3.276982824 6.257477647 3.194083646 0.007439953 0.999336003 -4.456546462 ENSG00000103044 HAS3 Symbol;Acc:4820]
membrane-spanning 4-domains, subfamily ENSG00000166928 2.862432937 -0.353692059 3.191004102 0.007483236 0.999336003 -4.571501969 ENSG00000166928 MS4A14 A, member 14 [Source:HGNC Symbol;Acc:30706]
chemokine (C-C motif) receptor 1 ENSG00000163823 1.305942682 2.638168288 3.178023133 0.007668484 0.999336003 -4.513888253 ENSG00000163823 CCR1 [Source:HGNC Symbol;Acc:1602]
zinc finger protein 350 [Source:HGNC ENSG00000256683 -2.195474624 1.736177465 -3.175312598 0.007707743 0.999336003 -4.51793568 ENSG00000256683 ZNF350 Symbol;Acc:16656]
netrin G1 [Source:HGNC ENSG00000162631 -3.492049121 -2.00051973 -3.167978446 0.007814984 0.999336003 -4.574861712 ENSG00000162631 NTNG1 Symbol;Acc:23319]
SH3 domain containing ring finger 1 ENSG00000154447 -1.738243301 3.657992081 -3.137123904 0.008282795 0.999336003 -4.4779129 ENSG00000154447 SH3RF1 [Source:HGNC Symbol;Acc:17650]
zinc finger protein 793 [Source:HGNC ENSG00000188227 -3.539510015 0.096821569 -3.131974463 0.008363561 0.999336003 -4.553198399 ENSG00000188227 ZNF793 Symbol;Acc:33115]
integrin, alpha 7 [Source:HGNC ENSG00000135424 -2.593305507 1.760286107 -3.131959706 0.008363793 0.999336003 -4.518583251 ENSG00000135424 ITGA7 Symbol;Acc:6143]
SMAD family member 9 [Source:HGNC ENSG00000120693 -1.984463275 0.828772349 -3.125680917 0.008463344 0.999336003 -4.538422712 ENSG00000120693 SMAD9 Symbol;Acc:6774]
zinc finger protein 681 [Source:HGNC ENSG00000196172 -3.214159585 0.705482148 -3.12518269 0.008471294 0.999336003 -4.542467426 ENSG00000196172 ZNF681 Symbol;Acc:26457]
Uncharacterized protein; cDNA FLJ26472 ENSG00000205873 -1.793856465 1.467530176 -3.116981292 0.008603243 0.999336003 -4.52593614 ENSG00000205873 fis, clone KDN04506 [Source:UniProtKB/TrEMBL;Acc:Q6ZP57]
thrombospondin 4 [Source:HGNC ENSG00000113296 -3.578760464 -1.122762931 -3.113044666 0.008667307 0.999336003 -4.568224833 ENSG00000113296 THBS4 Symbol;Acc:11788]
zinc finger protein, multitype 2 ENSG00000169946 -3.085386446 -0.713474875 -3.112834512 0.008670741 0.999336003 -4.563730387 ENSG00000169946 ZFPM2 [Source:HGNC Symbol;Acc:16700]
lipase, endothelial [Source:HGNC ENSG00000101670 -2.479398848 1.44841928 -3.108744824 0.008737828 0.999336003 -4.526395432 ENSG00000101670 LIPG Symbol;Acc:6623]
ADAM metallopeptidase domain 22 ENSG00000008277 -1.967708153 1.95876459 -3.103292697 0.008828075 0.999336003 -4.515614073 ENSG00000008277 ADAM22 [Source:HGNC Symbol;Acc:201]
choline dehydrogenase [Source:HGNC ENSG00000016391 -2.579267712 2.557013438 -3.099840902 0.008885693 0.999336003 -4.501861581 ENSG00000016391 CHDH Symbol;Acc:24288]
tubulin tyrosine ligase [Source:HGNC ENSG00000114999 0.866141375 5.173578032 3.098009185 0.008916421 0.999336003 -4.456713381 ENSG00000114999 TTL Symbol;Acc:21586]
pleckstrin homology domain containing, ENSG00000241839 1.220251513 4.111149357 3.095458198 0.008959392 0.999336003 -4.483235625 ENSG00000241839 PLEKHO2 family O member 2 [Source:HGNC Symbol;Acc:30026]
adaptor-related protein complex 2, mu 1 ENSG00000161203 1.370128707 8.599431385 3.087662924 0.009091992 0.999336003 -4.458780738 ENSG00000161203 AP2M1 subunit [Source:HGNC Symbol;Acc:564]
spermatogenesis associated 6 ENSG00000132122 -1.834461997 1.341902755 -3.086056216 0.009119566 0.999336003 -4.529388325 ENSG00000132122 SPATA6 [Source:HGNC Symbol;Acc:18309]
uveal autoantigen with coiled-coil domains ENSG00000137831 -1.049100321 5.528739412 -3.081517682 0.009197908 0.999336003 -4.451865584 ENSG00000137831 UACA and ankyrin repeats [Source:HGNC Symbol;Acc:15947]
lysosomal-associated membrane protein 3 ENSG00000078081 1.96338235 5.363677105 3.080647534 0.009213004 0.999336003 -4.463775305 ENSG00000078081 LAMP3 [Source:HGNC Symbol;Acc:14582]
solute carrier family 19, member 3 ENSG00000135917 -4.508744384 -0.92423206 -3.075669161 0.009299855 0.999336003 -4.568416174 ENSG00000135917 SLC19A3 [Source:HGNC Symbol;Acc:16266]
N-myristoyltransferase 2 [Source:HGNC ENSG00000152465 -1.066161518 3.501754764 -3.071800808 0.009367906 0.999336003 -4.485423252 ENSG00000152465 NMT2 Symbol;Acc:7858]
zinc finger protein 470 [Source:HGNC ENSG00000197016 -2.5655521 0.67481463 -3.071181043 0.009378855 0.999336003 -4.543011455 ENSG00000197016 ZNF470 Symbol;Acc:22220]
zinc finger protein 28 homolog (mouse) ENSG00000196867 -2.593630165 0.381664656 -3.068354672 0.009428948 0.999336003 -4.548187495 ENSG00000196867 ZFP28 [Source:HGNC Symbol;Acc:17801]
solute carrier family 2 (facilitated ENSG00000142583 2.282846316 2.402578719 3.0679525 0.009436098 0.999336003 -4.528007229 ENSG00000142583 SLC2A5 glucose/fructose transporter), member 5 [Source:HGNC Symbol;Acc:11010]
phosphodiesterase 4D interacting protein ENSG00000178104 -1.102946774 5.432559978 -3.065067892 0.009487538 0.999336003 -4.453688058 ENSG00000178104 PDE4DIP [Source:HGNC Symbol;Acc:15580]
stathmin-like 3 [Source:HGNC ENSG00000197457 -1.573686193 3.644703085 -3.063442251 0.009516651 0.999336003 -4.481970024 ENSG00000197457 STMN3 Symbol;Acc:15926]
B-cell CLL/lymphoma 2 [Source:HGNC ENSG00000171791 -2.758203117 3.906174315 -3.056250573 0.009646519 0.999336003 -4.480411023 ENSG00000171791 BCL2 Symbol;Acc:990]
progestin and adipoQ receptor family ENSG00000160781 -1.768823041 1.097466468 -3.047848604 0.009800487 0.999336003 -4.53524975 ENSG00000160781 PAQR6 member VI [Source:HGNC Symbol;Acc:30132]
transmembrane protein 139 [Source:HGNC ENSG00000178826 -3.057616516 -0.756311252 -3.046860581 0.009818753 0.999336003 -4.56470568 ENSG00000178826 TMEM139 Symbol;Acc:22058]
paired related homeobox 2 [Source:HGNC ENSG00000167157 2.284188003 3.754260181 3.044346398 0.009865389 0.999336003 -4.503412285 ENSG00000167157 PRRX2 Symbol;Acc:21338]
adenylate cyclase 2 (brain) [Source:HGNC ENSG00000078295 -3.415406763 0.323895543 -3.039300725 0.009959648 0.999336003 -4.551716445 ENSG00000078295 ADCY2 Symbol;Acc:233]
consortin, connexin sorting protein ENSG00000162852 -1.16991769 4.674671108 -3.034010935 0.010059434 0.999336003 -4.464105569 ENSG00000162852 CNST [Source:HGNC Symbol;Acc:26486]
CD164 sialomucin-like 2 [Source:HGNC ENSG00000174950 -1.751879967 2.155184626 -3.033617941 0.010066887 0.999336003 -4.514712212 ENSG00000174950 CD164L2 Symbol;Acc:32043]
adenosine deaminase [Source:HGNC ENSG00000196839 2.21688835 4.089604215 3.032982626 0.010078947 0.999336003 -4.496943004 ENSG00000196839 ADA Symbol;Acc:186]
TATA box binding protein (TBP)-associated ENSG00000115750 0.907857933 4.261413595 3.015736618 0.010411897 0.999336003 -4.480897901 ENSG00000115750 TAF1B factor, RNA polymerase I, B, 63kDa [Source:HGNC Symbol;Acc:11533]
pentraxin 3, long [Source:HGNC ENSG00000163661 -4.066830457 -0.413601793 -3.013435837 0.010457138 0.999336003 -4.56349438 ENSG00000163661 PTX3 Symbol;Acc:9692]
ATP-binding cassette, sub-family C ENSG00000114770 1.725451113 6.835084093 3.011302013 0.010499271 0.999336003 -4.454307216 ENSG00000114770 ABCC5 (CFTR/MRP), member 5 [Source:HGNC Symbol;Acc:56]
ENSG00000246089 -1.221852309 1.396464301 -3.006342476 0.010597853 0.999336003 -4.531423137 ENSG00000246089
kinase suppressor of ras 2 [Source:HGNC ENSG00000171435 -3.273112388 -2.188502921 -2.994658782 0.010833755 0.999336003 -4.577685062 ENSG00000171435 KSR2 Symbol;Acc:18610]
UDP-N-acetyl-alpha-D- galactosamine:polypeptide N- ENSG00000158089 1.684476611 3.696389812 2.990623878 0.010916432 0.999336003 -4.502590899 ENSG00000158089 GALNT14 acetylgalactosaminyltransferase 14 (GalNAc-T14) [Source:HGNC Symbol;Acc:22946]
S100 calcium binding protein A11 ENSG00000163191 1.535895126 9.600853351 2.985729179 0.011017571 0.999336003 -4.472384308 ENSG00000163191 S100A11 [Source:HGNC Symbol;Acc:10488]
doublecortin-like kinase 1 [Source:HGNC ENSG00000133083 -3.184978683 -0.259027184 -2.981938487 0.011096539 0.999336003 -4.560217904 ENSG00000133083 DCLK1 Symbol;Acc:2700]
zinc finger protein 347 [Source:HGNC ENSG00000197937 -2.550741804 0.726063855 -2.981306982 0.01110975 0.999336003 -4.544296621 ENSG00000197937 ZNF347 Symbol;Acc:16447]
component of oligomeric golgi complex 3 ENSG00000136152 -0.93750958 5.143424102 -2.96910613 0.01136807 0.999336003 -4.461878388 ENSG00000136152 COG3 [Source:HGNC Symbol;Acc:18619]
PX domain containing 1 [Source:HGNC ENSG00000168994 1.480198385 4.6697399 2.9656262 0.011442838 0.999336003 -4.479393115 ENSG00000168994 PXDC1 Symbol;Acc:21361]
integrin, alpha M (complement component ENSG00000169896 -1.902345236 2.934537339 -2.962767736 0.011504619 0.999336003 -4.500986003 ENSG00000169896 ITGAM 3 receptor 3 subunit) [Source:HGNC Symbol;Acc:6149]
MCF.2 cell line derived transforming ENSG00000126217 -1.805095426 4.19795833 -2.956257152 0.011646577 0.999336003 -4.477741857 ENSG00000126217 MCF2L sequence-like [Source:HGNC Symbol;Acc:14576]
poly (ADP-ribose) polymerase family, ENSG00000138496 1.019714709 6.872545781 2.955293612 0.011667734 0.999336003 -4.457338728 ENSG00000138496 PARP9 member 9 [Source:HGNC Symbol;Acc:24118]
ankyrin repeat domain 18B [Source:HGNC ENSG00000230453 3.915693659 -0.765165881 2.954542312 0.011684256 0.999336003 -4.579739496 ENSG00000230453 ANKRD18B Symbol;Acc:23644]
heat shock 27kDa protein 1 pseudogene 2 ENSG00000230216 1.844349739 5.595003147 2.946540504 0.011861686 0.999336003 -4.466807782 ENSG00000230216 HSPB1P2 [Source:HGNC Symbol;Acc:5252]
lymphocyte cytosolic protein 2 (SH2 domain ENSG00000043462 1.134917481 3.824906576 2.943633012 0.011926818 0.999336003 -4.496969984 ENSG00000043462 LCP2 containing leukocyte protein of 76kDa) [Source:HGNC Symbol;Acc:6529]
SH3 and cysteine rich domain 2 ENSG00000141750 -4.480515803 -3.418522951 -2.943286091 0.011934613 0.999336003 -4.584131312 ENSG00000141750 STAC2 [Source:HGNC Symbol;Acc:23990]
furry homolog (Drosophila) [Source:HGNC ENSG00000073910 -1.859285942 2.662436074 -2.940236889 0.012003345 0.999336003 -4.507635978 ENSG00000073910 FRY Symbol;Acc:20367]
ENSG00000227285 -1.719123477 -1.038882503 -2.932281208 0.012184532 0.999336003 -4.568852209 ENSG00000227285
DDHD domain containing 1 [Source:HGNC ENSG00000100523 -1.228998803 3.057233675 -2.928081979 0.01228126 0.999336003 -4.501741066 ENSG00000100523 DDHD1 Symbol;Acc:19714]
distal-less homeobox 2 [Source:HGNC ENSG00000115844 -4.012281764 -2.060922969 -2.921877947 0.012425566 0.999336003 -4.577739086 ENSG00000115844 DLX2 Symbol;Acc:2915]
gap junction protein, gamma 2, 47kDa ENSG00000198835 1.677698731 0.034829496 2.915767371 0.012569344 0.999336003 -4.565843976 ENSG00000198835 GJC2 [Source:HGNC Symbol;Acc:17494]
neuromedin U [Source:HGNC ENSG00000109255 2.923829018 4.243472729 2.914418246 0.01260131 0.999336003 -4.504566281 ENSG00000109255 NMU Symbol;Acc:7859]
chemokine (C-X-C motif) ligand 12 ENSG00000107562 -2.312092669 2.550919112 -2.89996236 0.01294893 0.999336003 -4.510748974 ENSG00000107562 CXCL12 [Source:HGNC Symbol;Acc:10672]
leucine-rich repeat LGI family, member 3 ENSG00000168481 4.304462866 0.419769677 2.898806489 0.012977132 0.999336003 -4.574027239 ENSG00000168481 LGI3 [Source:HGNC Symbol;Acc:18711]
v-myb myeloblastosis viral oncogene ENSG00000118513 -2.600592191 3.817621752 -2.896059471 0.013044402 0.999336003 -4.489339844 ENSG00000118513 MYB homolog (avian) [Source:HGNC Symbol;Acc:7545]
carbonyl reductase 4 [Source:HGNC ENSG00000145439 -0.877605078 4.512322428 -2.892406823 0.013134385 0.999336003 -4.475079127 ENSG00000145439 CBR4 Symbol;Acc:25891]
NACHT and WD repeat domain containing ENSG00000188039 -1.986957369 0.425173201 -2.891778512 0.013149925 0.999336003 -4.551069886 ENSG00000188039 NWD1 1 [Source:HGNC Symbol;Acc:27619]
metallothionein 1X [Source:HGNC ENSG00000187193 1.958498408 5.547159892 2.887163357 0.013264634 0.999336003 -4.472458683 ENSG00000187193 MT1X Symbol;Acc:7405]
granzyme B (granzyme 2, cytotoxic T- ENSG00000100453 2.017095798 2.717986717 2.88713593 0.013265319 0.999336003 -4.526785325 ENSG00000100453 GZMB lymphocyte-associated serine esterase 1) [Source:HGNC Symbol;Acc:4709]
ENSG00000260563 -1.243830523 0.198726498 -2.878709735 0.013477326 0.999336003 -4.554138578 ENSG00000260563
zinc finger protein 488 [Source:HGNC ENSG00000165388 -1.799192069 1.617245362 -2.877055872 0.013519331 0.999336003 -4.530516698 ENSG00000165388 ZNF488 Symbol;Acc:23535]
tropomyosin 4 [Source:HGNC ENSG00000167460 0.889017458 9.110906825 2.876558517 0.013531988 0.999336003 -4.47647687 ENSG00000167460 TPM4 Symbol;Acc:12013]
leucine-rich repeats and immunoglobulin- ENSG00000144749 -1.947168676 4.734938919 -2.875203289 0.013566536 0.999336003 -4.475618141 ENSG00000144749 LRIG1 like domains 1 [Source:HGNC Symbol;Acc:17360]
DnaJ (Hsp40) homolog, subfamily B, ENSG00000132002 1.005913671 8.498992353 2.875042481 0.013570642 0.999336003 -4.471978594 ENSG00000132002 DNAJB1 member 1 [Source:HGNC Symbol;Acc:5270]
Appendix 3 Experiment plan for the use of PIM kinase inhibitor (TP-3654) in anal cancer PDTX model
Plan for each patient line:
No. of
nude mice A. Control arm (Vehicle only) 10 B. Chemotherapy arm (5FU+MMC) 10 C. Molecular therapy arm (TP-3654 + Vehicle) 10 D. Chemotherapy/Molecular therapy arm (5FU+MMC+TP-3654 10 (+Vehicle)) Overall total 40
Assumptions:
200mg/kg/day for 5 days/wk for 3 weeks
(Based upon maximum dose used in urothelial cancer xenograft models as per Tolero
Pharmaceuticals 200mg/kg orally)
Mouse weight 30grams
2mg/10g -> 6mg for 30g mouse
Amount of compound required per experiment:
6mg/mouse/day x 5 days x 3 weeks x 10 mice/group x 2 groups = 1800mg
Plan for 3 experiments (one per patient line) = 1.8g x 3 = 5.4g
Dose-tolerability studies:
6mg/mouse/day x 5days x 3 weeks x 5 mice = 360mg
Total compound required:
5.4 + 0.36 = 5.76g
Minerva Access is the Institutional Repository of The University of Melbourne
Author/s: Bernardi, Maria-Pia
Title: Prediction and prognosis in anal cancer: developing models to improve patient outcome
Date: 2017
Persistent Link: http://hdl.handle.net/11343/198358
File Description: Prediction and prognosis in anal cancer: developing models to improve patient outcome
Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.