1

2

3 ERα promotes murine hematopoietic regeneration through the Ire1α-mediated unfolded

4 protein response

5 6 Richard H. Chapple1, Tianyuan Hu1, Yu-Jung Tseng2, Lu Liu3, Ayumi Kitano1, Victor Luu1, Kevin 7 A. Hoegenauer1, Takao Iwawaki4, Qing Li3, and Daisuke Nakada1,2 8

9 1Department of Molecular & Human Genetics, Baylor College of Medicine, Houston, TX 77030, 10 USA 11 2Graduate Program in Translational Biology and Molecular Medicine, Baylor College of 12 Medicine, Houston, TX 77030, USA 13 3Division of Hematology/Oncology, Department of Medicine, University of Michigan, Ann Arbor, 14 MI 48109, USA 15 4Division of Cell Medicine, Department of Life Science, Medical Research Institute, Kanazawa 16 Medical University, Kahoku, Ishikawa 920-0293, Japan 17 18 19 Correspondence to [email protected]

20

21 Running title: Estrogen induces UPR in HSCs 22 Keywords: HSC, Estrogen, Unfolded protein response, ERα, Ire1α, Xbp1 23

24

25

26

27 28 SUMMARY

29 Activation of the unfolded protein response (UPR) sustains protein homeostasis (proteostasis)

30 and plays a fundamental role in tissue maintenance and longevity of organisms. Long-range

31 control of UPR activation has been demonstrated in invertebrates, but such mechanisms in

32 mammals remain elusive. Here, we show that the female sex hormone estrogen regulates the

33 UPR in hematopoietic stem cells (HSCs). Estrogen treatment increases the capacity of HSCs to

34 regenerate the hematopoietic system upon transplantation and accelerates regeneration after

35 irradiation. We found that estrogen signals through estrogen receptor α (ERα) expressed in

36 hematopoietic cells to activate the protective Ire1α-Xbp1 branch of the UPR. Further, ERα-

37 mediated activation of the Ire1α-Xbp1 pathway confers HSCs with resistance against

38 proteotoxic stress and promotes regeneration. Our findings reveal a systemic mechanism

39 through which HSC function is augmented for hematopoietic regeneration.

40

Chapple et al. Estrogen regulates UPR in HSCs 2 41 INTRODUCTION

42 In order to adapt to changing animal physiology or tissue damage, tissue stem cells must

43 respond to long-range signals emitted from other organs (Nakada et al., 2011). For instance,

44 stem cells in the intestine, central nervous system, hematopoietic system, and germline are

45 regulated by insulin and nutritional status (Chell and Brand, 2010; Cheng et al., 2014; LaFever

46 and Drummond-Barbosa, 2005; Lehtinen et al., 2011; McLeod et al., 2010; O'Brien et al., 2011;

47 Sousa-Nunes et al., 2011; Yilmaz et al., 2012), and the circadian rhythm affects skin and

48 hematopoietic stem cells (Janich et al., 2011; Mendez-Ferrer et al., 2008). Age-related changes

49 in blood-borne factors regulate muscle and neural stem cell aging (Brack et al., 2007; Conboy et

50 al., 2005; Katsimpardi et al., 2014; Sinha et al., 2014; Villeda et al., 2011). However, few long-

51 range signals, such as prostaglandin E2 (North et al., 2007) or those that are modulated by

52 prolonged fasting (Cheng et al., 2014), have been found to augment the ability of tissue stem

53 cells to repair damaged tissues. Understanding how long-range signals regulate tissue stem cell

54 function may pave the way to harness stem cells for regenerative medicine.

55 The hematopoietic system has a remarkable regenerative potential demonstrated by the

56 ability of a single hematopoietic stem cell (HSC) to rebuild the entire hematopoietic system upon

57 transplantation, and to regenerate the tissue upon damage, such as those caused by chemo- or

58 radio-therapies. A network of factors operating cell intrinsically or extrinsically promote

59 regeneration by HSCs (Mendelson and Frenette, 2014). Cell-extrinsic factors produced by the

60 HSC niche, such as the stem cell factor (Zsebo et al., 1992), angiogenin (Goncalves et al.,

61 2016), pleiotrophin (Himburg et al., 2010), EGF (Doan et al., 2013), or Dkk1 (Himburg et al.,

62 2017) have particular therapeutic potential as they may be used as radioprotectors or

63 radiomitigators to accelerate the recovery of the hematopoietic system (Citrin et al., 2010).

64 Despite the extensive interest in augmenting the regenerative potential of HSCs, much remains

Chapple et al. Estrogen regulates UPR in HSCs 3 65 to be investigated regarding the factors that promote hematopoietic regeneration by HSCs, and

66 the mode of action of these factors.

67 The female sex hormone estrogen is an emerging soluble factor involved in specification

68 and self-renewal of HSCs. Estradiol (E2), the most potent endogenous estrogen, is

69 predominantly produced by the granulosa cells of the ovaries and regulates a diverse array of

70 tissues, such as the reproductive organs, bone, breast, brain, and the hematopoietic system

71 (Edwards, 2005). During zebrafish development, maternal E2 stored in the yolk promotes the

72 specification of HSCs (Carroll et al., 2014). In mice, E2 produced by the ovaries stimulates

73 division of HSCs via the estrogen receptor α (ERα). Exogenous E2, when administered at a

74 physiological level similar to the level observed during pregnancy, also promotes division of

75 HSCs in male mice, indicating that the E2-ERα pathway activation is sufficient induce HSC

76 division. A selective estrogen receptor modulator tamoxifen also promoted HSC division similar

77 to E2 (Sanchez-Aguilera et al., 2014). Interestingly, even though E2 significantly increases HSC

78 divisions, unlike infection or interferon responses it does not lead to HSC depletion (Baldridge et

79 al., 2010; Esplin et al., 2011; Essers et al., 2009; Passegue et al., 2005; Sato et al., 2009). This

80 raises a question of whether HSC function is impaired by E2 at the cost of increased division, or

81 whether E2 elicits a protective mechanism to maintain HSCs while stimulating HSC division.

82 The unfolded protein response (UPR) is an evolutionally conserved mechanism that

83 promotes protein homeostasis (proteostasis) upon various stresses by increasing the

84 expression of protein foldases and chaperones (Hetz et al., 2013; Janssens et al., 2014; Wang

85 and Kaufman, 2012). Three pathways — the PERK-eIF2α-CHOP pathway, the ATF6 pathway,

86 and the IRE1-XBP1 pathway — coordinately regulate the UPR in mammals. Gpr78 (also called

87 BiP), a chaperone localized in the endoplasmic reticulum (ER), tethers the three ER stress

88 sensors (PERK, ATF6, and IRE1) in inactive states during homeostasis. Upon ER stress, Gpr78

89 disassociates with PERK, ATF6, and IRE1 to allow them to become activated and induce the

Chapple et al. Estrogen regulates UPR in HSCs 4 90 UPR. The UPR plays essential roles in highly secretary cells, such as plasma cells and

91 pancreatic β-cells that have high protein flux through the ER. In addition, recent evidence

92 established that the UPR is also involved in a wide range of pathological states, since many

93 stress signals impinge upon the ER (Malhotra and Kaufman, 2007). Interestingly, evidence in

94 C.elegans indicates that the UPR can be extrinsically activated, potentially mediated by an as

95 yet unidentified neurotransmitter (Sun et al., 2012; Taylor et al., 2014; Taylor and Dillin, 2013).

96 Whether the UPR in mammalian tissue stem cells is regulated by systemic factors remains

97 elusive.

98 Here we demonstrate that the female sex hormone E2 increases the regenerative

99 capacity of HSCs upon transplantation, and improves bone marrow and peripheral blood

100 recovery after irradiation. ERα, in response to E2 stimulation, activated a protective UPR by

101 inducing the expression of Ire1α in HSCs. The Ire1α-Xbp1 branch of the UPR augmented

102 proteotoxic stress resistance in HSCs and promoted regeneration. Our results reveal that the

103 UPR in HSCs can be modulated by systemic factors, extending the systemic activation of the

104 UPR to tissue stem cell biology.

105

106 RESULTS

107 Estradiol promotes the regenerative capacity of HSCs

108 To address the question of whether E2 stimulation affects HSC function, we first performed

109 colony-forming assays by sorting single HSCs (Figure 1 – figure supplement 1A, for gating

110 strategy) from oil- or E2-treated male mice into methylcellulose media. We used male mice

111 unless otherwise noted since estrogen levels fluctuate in females during the estrus cycle. HSCs

112 from E2-treated animals exhibited a greater proportion of immature colonies containing

113 granulocytes, erythrocytes, macrophages, and megakaryocytes (gemM) compared to HSCs

114 from oil-treated mice (Figure 1A), suggesting that E2 increases the multipotency of HSCs. To

Chapple et al. Estrogen regulates UPR in HSCs 5 115 quantify the effects of E2 in promoting megakaryocytic potential of HSCs we used a collagen-

116 based media that enables outgrowth and enumeration of megakaryocytes. Although freshly

117 isolated HSCs were incapable of forming any colonies in this media, potentially due to the lack

118 of HSC supportive cytokines, HSCs after a brief culture in media containing cytokines exhibited

119 robust megakaryocytic differentiation in this system. We found that HSCs isolated from E2-

120 treated mice not only formed more colonies but they also exhibited a significantly increased

121 capacity to form colonies containing megakaryocytes (Figure 1B). Consistent with the increased

122 megakaryopoiesis by E2, we observed significantly more megakaryocytes in the bone marrow

123 of E2-treated mice than oil-treated mice (Figure 1C-D). These results indicate that E2 treatment

124 enhances the clonogenic potential of HSCs towards myeloid, erythroid, and megakaryocytic

125 lineages.

126 We then tested whether E2 treatment affects multilineage reconstitution of HSCs. To this

127 end, we competitively transplanted 100 purified HSCs isolated from male Ubc-GFP mice that

128 were treated with either oil or E2 for one week. Compared to oil-treated controls, HSCs isolated

129 from E2-treated mice exhibited enhanced reconstitution of Mac-1/Gr-1+ myeloid cells, Ter119+

130 red blood cells, and CD41+ platelets (Figure 1E-H and Figure 1 – figure supplement 1B-C).

131 Interestingly, HSCs from E2-treated mice did not exhibit reduced lymphoid cell reconstitution

132 (Figure 1I-J), indicating that the enhanced myeloid/erythroid/megakaryocytic cell reconstitution

133 by E2 stimulated HSCs was not at the cost of lymphoid cell reconstitution. Next, we ascertained

134 if E2 affects long-term self-renewal capacity by performing secondary transplantation.

135 Reconstituted bone marrow derived from E2-treated HSCs gave rise to stable engraftment

136 across all lineages in secondary recipients (Figure 1 – figure supplement 1D). Therefore,

137 although E2 treatment increases HSC division (Nakada et al., 2014), it does not negatively

138 affect long-term self-renewal capacity of HSCs but rather increases HSC function.

139 To determine whether ERα expressed in hematopoietic cells is responsible for the

140 effects of E2 on HSC function, we treated Mx1-Cre; Esr1fl/fl mice (and control littermates) with

Chapple et al. Estrogen regulates UPR in HSCs 6 141 poly I:C to delete ERα from the hematopoietic system (hereafter described as ERα-deficient

142 mice). ERα-deficient mice and control littermates were then treated with E2 for one week

143 followed by colony assays to examine HSC function. The increased ability of E2-stimulated

144 HSCs to form immature colonies (Figure 1A) and megakaryocytes (Figure 1B) was abolished by

145 deleting ERα, indicating that ERα promotes HSC function upon E2 stimulation.

146 Further, we determined whether the increased capacity of HSCs to reconstitute the

147 hematopoietic system upon transplantation was dependent on ERα. 100 HSCs isolated from

148 ERα-deficient and control littermates treated with either oil or E2 were transplanted along with

149 competitor cells. ERα-deficient HSCs without E2 stimulation exhibited intact long-term

150 multilineage reconstitution (Figure 1E-J), indicating that ERα is dispensable for steady state

151 HSC function, as shown previously (Thurmond et al., 2000). However, ERα-deficient HSCs did

152 not exhibit increased myeloid/erythroid/megakaryocytic cell reconstitution upon E2 treatment as

153 observed in wild-type HSCs (Figure 1F-H). These results establish that the E2-ERα pathway

154 enhances functions within the hematopoietic cells to promote myeloid/erythroid/megakaryocytic

155 reconstitution by HSCs in response to E2.

156

157 Estradiol promotes hematopoietic recovery after irradiation

158 The results presented above demonstrate that E2 promotes hematopoietic regeneration by

159 HSCs in a transplantation model. As another model of hematopoietic regeneration, we

160 examined the effects of E2 on hematopoiesis after injury imposed by total body irradiation (TBI)

161 (Doan et al., 2013; Goncalves et al., 2016; Himburg et al., 2017; Himburg et al., 2010). We

162 treated male mice with oil or E2 for one week, and irradiated them with a sublethal dose of 600

163 cGy (Figure 2 – figure supplement 1 for experimental scheme). Serial sampling of peripheral

164 blood after irradiation revealed that E2 treatment prior to irradiation significantly accelerated the

165 rate at which platelets and white blood cells recover, whereas the effects on red blood cell

166 counts were modest (Figure 2A-C). To determine whether ERα is responsible for the effects of

Chapple et al. Estrogen regulates UPR in HSCs 7 167 E2 on hematopoietic regeneration after irradiation, we administered poly I:C-treated Mx1-Cre;

168 Esr1fl/fl mice with E2 followed by sublethal irradiation. The accelerated recovery of RBC, PLT,

169 and WBC in E2-treated mice was not observed in ERα-deficient mice, indicating that ERα is

170 required for E2 to promote regeneration (Figure 2D-F). These results indicate that E2 treatment

171 promotes hematopoietic recovery after stress, consistent with our prior finding that E2 promotes

172 the reconstitution potential of HSCs.

173 The positive effects of E2 on hematopoietic recovery improved the survival of mice after

174 irradiation. Male mice were treated with oil or E2 for one week, and irradiated with a semi-lethal

175 dose of 800 cGy. Whereas 89% of oil-treated mice died within 28 days after irradiation, E2

176 treatment significantly reduced the fraction (to 29%) of mice succumbing to irradiation-induced

177 lethality (Figure 2G). This increased survival is consistent with an early study that described that

178 female mice are more radioresistant than male mice, which we confirmed here (Figure 2H), and

179 that the estrus cycle affects the radiosensitivity of female mice (Rugh and Clugston, 1955).

180 These results suggest that the positive effect of E2 on hematopoietic regeneration improves the

181 survival of mice after hematopoietic injury.

182

183 Estradiol accelerates hematopoietic progenitor cell regeneration after ionizing radiation

184 Our observation that E2 treatment accelerated the recovery of peripheral blood cells prompted

185 us to examine whether E2 improves hematopoietic stem/progenitor cell (HSPC) function after

186 irradiation. E2 treatment significantly accelerated the recovery of whole bone marrow (WBM)

187 cells at days 5, 7, and 14 after irradiation (Figure 3A), consistent with the accelerated recovery

188 of blood cells. We then examined whether E2 affects HSPC frequency after irradiation.

189 Irradiation caused rapid and prolonged depletion of immature lineage-Sca-1+c-kit+ (LSK) cells for

190 up to two weeks post irradiation (0.17±0.04% before irradiation versus 0.02±0.02% at two

191 weeks after irradiation). Intriguingly, E2 treatment prior to irradiation significantly increased the

192 frequency of LSK cells compared to control oil-treated mice 14 days after TBI (Figure 3B and

Chapple et al. Estrogen regulates UPR in HSCs 8 193 Figure 3 – figure supplement 1A). Combined with the increased numbers of WBM cells in E2-

194 treated irradiated mice, E2 treatment induced a 6.3-fold expansion (p<0.01) of the size of LSK

195 pool at day 14 (Figure 3C), suggesting that E2 treatment prior to TBI promotes LSK

196 regeneration. E2 treatments every other day post-TBI also increased hematopoietic cell

197 numbers after irradiation (Figure 3 – figure supplement 1B-E). In contrast, E2 treatment did not

198 significantly affect the frequency of lineage-Sca-1-c-kit+ committed myeloid progenitors (MP), but

199 did increase the total numbers of these cells (Figure 3 – figure supplement 1F-H). We assessed

200 apoptosis rates in lineage- BM cells shortly after irradiation exposure by Annexin V staining and

201 observed significantly lower numbers of Annexin V+ cells in E2 treated cohorts at both days 3

202 and 5 post-TBI (Figure 3 – figure supplement 1I). These results suggest that the preservation of

203 HSPC numbers by E2 treatment could be a function of enhanced proliferation (Nakada et al.,

204 2014), protection from irradiation-induced apoptosis, or a combination of both. Collectively,

205 these results suggest that E2 not only enhances recuperation of peripheral blood cells after

206 irradiation (Figure 2A-C), but also enhances hematopoietic regeneration by promoting the

207 recovery of immature HSPCs.

208 Next, we examined whether E2 affects HSCs regeneration after irradiation. Since

209 irradiation compromised the expression of several HSC markers (data not shown and (Simonnet

210 et al., 2009), we accessed long-term reconstitution capacity as a surrogate of HSC function by

211 transplanting WBM cells from irradiated animals that had been treated with control oil or E2 into

212 wild-type recipients. Cells from irradiated, oil-treated mice exhibited negligible reconstitution

213 upon transplantation (Figure 3D). Strikingly, we observed that cells from mice that were treated

214 with E2 prior to irradiation demonstrated a preservation of long-term reconstitution potential in

215 the myeloid, erythroid, and platelet lineages — a feature that reflects HSC activity (Oguro et al.,

216 2013; Pietras et al., 2015; Sanjuan-Pla et al., 2013; Yamamoto et al., 2013) — although their

217 lymphoid-reconstitution potential was impaired. These results demonstrate that E2 treatment

Chapple et al. Estrogen regulates UPR in HSCs 9 218 improves the regeneration of the hematopoietic system, augmenting the function of cells with

219 long-term myeloid reconstitution capacity.

220 We then tested whether ERα regulates HSPC regeneration after irradiation. Control and

221 ERα-deficient mice were treated with oil or E2, sublethally irradiated, and analyzed by flow

222 cytometry. We found that deleting ERα abolished the accelerated recovery of bone marrow

223 cellularity after irradiation in response to prior E2 treatment (Figure 3E). Furthermore, whereas

224 E2 treatment promoted the regeneration of LSK cells in the bone marrow after irradiation, it

225 failed to do so in ERα-deficient mice (Figure 3F,G). These results indicate that ERα, which is

226 highly expressed in HSPCs, promotes hematopoietic regeneration in response to E2

227 stimulation.

228

229 Estradiol activates the unfolded protein response (UPR) pathway in HSCs

230 To understand the mechanism through which E2 increases HSC function, we employed RNA-

231 seq to profile the gene expression changes of HSCs upon E2 treatment. Control and ERα-

232 deficient male mice were treated with oil or E2 for one week, and HSCs were isolated for RNA-

233 seq. Unsupervised hierarchical clustering analysis revealed that wild-type HSCs from E2-treated

234 mice clustered separately from other groups, indicating that E2 induces a transcriptional

235 response that is dependent on ERα (Figure 4A). We then performed gene set enrichment

236 analysis (GSEA) to identify gene signatures enriched in HSCs following E2 treatment. The

237 GSEA revealed that Myc and E2F target genes and genes involved in cell cycle regulation were

238 enriched in E2-treated HSCs (Figure 4B and Figure 4 – figure supplement 1A-H), consistent

239 with our finding that E2-treated HSCs are more proliferative (Nakada et al., 2014). Several Myc

240 target genes were induced by E2 treatment in vitro (Figure 4 – figure supplement 1B-H),

241 although c-Myc, N-Myc, and L-Myc were not induced in HSCs by E2 as determined by RNA-seq

242 (data not shown). Additionally, several megakaryocyte lineage genes were increased in E2

243 treated HSCs (Figure 4 – figure supplement 1I). Interestingly, we found that a gene set

Chapple et al. Estrogen regulates UPR in HSCs 10 244 representing the unfolded protein response (UPR) was also upregulated in HSCs in response to

245 E2 (Figure 4B Figure 4 – figure supplement 1J). We focused specifically on the UPR gene set

246 and examined whether the enrichment of the UPR gene set upon E2 treatment depends upon

247 ERα. To this end, we performed GSEA in a pairwise fashion comparing the four HSC datasets

248 with each other. We found that wild-type HSCs from E2-treated mice have significant (p<0.005)

249 enrichment of UPR related genes compared to all other treatment groups, including E2-treated

250 ERα-deficient HSCs (Figure 4C). This analysis indicates that E2 treatment induces the UPR in

251 HSCs in an ERα-dependent manner. Importantly, we found that the expression of Ern1, which

252 encodes a key regulator of the UPR, Ire1α, was significantly increased in E2-treated HSCs

253 (Figure 4A and 4D). The increased expression of Ern1 was also evident in our previously

254 published microarray analysis (GDS4944) (Nakada et al., 2014). Moreover, multiple chaperones

255 were induced in HSCs by E2 (Figure 4 – figure supplement 1K). These results suggested that

256 the UPR was increased in HSCs after E2 exposure.

257 Three branches, governed by the PERK-eIF2α-CHOP, ATF6, and IRE1-XBP1 pathways,

258 regulate the UPR. Each of these pathways controls the expression of multiple UPR target

259 genes, consisting of chaperones and genes involved in metabolism (Hetz et al., 2013). To better

260 understand how E2 activates UPR in HSCs, we performed qRT-PCR on key mediators of the

261 UPR pathway. Consistent with our RNA-seq analysis, we confirmed that the induction of Ern1 in

262 HSCs upon E2 treatment was fully dependent on ERα (Figure 4E). However, the components of

263 the two other UPR branches, such as Ddit3 (encoding CHOP), Eifak3 (encoding PERK), and,

264 Atf6, were unaffected by E2 treatment (Figure 4 – figure supplement 2C), suggesting that the

265 Ire1α pathway is activated upon E2 stimulation. To test whether Ire1α was activated in a

266 lineage-biased subset of HSCs we examined Ire1α expression in CD48-/low LSK cells

267 fractionated based on CD150 expression levels (Figure 4 – figure supplement 2A, B) (Beerman

268 et al., 2010). Ire1α levels were increased consistently across each subset indicating that E2 acts

269 on the entirety of the HSC pool.

Chapple et al. Estrogen regulates UPR in HSCs 11 270 Ire1α is a bifunctional protein with a serine-threonine kinase domain and an RNase

271 domain. In response to ER stress, the RNase activity of Ire1α becomes activated and splices

272 Xbp1 mRNA (Cox and Walter, 1996; Yoshida et al., 2001). This Xbp1 splicing event produces a

273 functional Xbp1s protein that serves as a transcriptional regulator critical for the induction of

274 UPR response genes (Hetz et al., 2013; Janssens et al., 2014). We thus tested whether Xbp1

275 splicing is induced upon E2 treatment in HSCs using a quantitative PCR method that detects

276 both the unspliced and spliced forms of Xbp1. We found that Xbp1 splicing was induced in

277 response to E2 treatment in both HSCs and MPPs, but not in WBM cells, suggesting that

278 immature hematopoietic progenitor cells are more sensitive to E2 treatment to activate Xbp1

279 (Figure 4F). This was confirmed using the ERAI strain, in which Xbp1 splicing can be monitored

280 by Venus fluorescence (Iwawaki et al., 2004). Flow cytometry analysis of cells isolated from

281 ERAI mice treated with oil or E2 revealed that Xbp1 splicing, as determined by Venus

282 fluorescence, was significantly increased by E2 treatment in HSCs and MPPs, but not in

283 lineage- and WBM cells (Figure 4G). Importantly, Xbp1 splicing was entirely dependent upon

284 ERα, consistent with our finding that the E2-ERα pathway induces Ire1α expression (Figure 4F).

285 We also confirmed that the protein levels of Ire1α and Xbp1s were increased upon E2 treatment

286 in both CD48-/low (containing HSCs and MPPs) and CD48+ fractions of the LSK population, but

287 not in WBM cells (Figure 4H). Taken together, these results indicate that the Ire1α-Xbp1 branch

288 of the UPR is activated in E2-treated HSCs. As increased protein synthesis is associated with

289 proliferation and may activate the UPR, we tested whether E2-induced activation of the Ire1α-

290 Xbp1 pathway is a general feature of activated HSCs. Using a protocol adapted from previous

291 reports (Liu et al., 2012; Schmidt et al., 2009; Signer et al., 2014), we tested whether E2

292 treatment affected protein translation rates in HSCs. Consistent with a previous report (Signer et

293 al., 2014), HSCs and MPPs had significantly lower protein translation compared to whole bone

294 marrow cells (Figure 4 – figure supplement 2D). However, the protein synthesis rate of HSCs

295 did not significantly change upon E2 treatment (Figure 4 – figure supplement 2D), consistent

Chapple et al. Estrogen regulates UPR in HSCs 12 296 with a previous report demonstrating that cycling HSCs do not have increased protein

297 translation (Signer et al., 2016). Moreover, inducing HSCs to proliferate (either by G-CSF or

298 poly I:C administration) did not increase Ire1α expression (Figure 4 – figure supplement 2E,F),

299 and these treatment had limited effects on the expression of chaperone genes (Figure 4 – figure

300 supplement 2G) compared to the broad effects E2 had on chaperones (Figure 4 – figure

301 supplement 1K). Thus, activation of the Ire1α-Xbp1 pathway is not a general response used by

302 HSCs upon cell cycle activation.

303

304 Ire1α is a Direct Target of ER in HSPCs

305 Genome wide ERα binding profiles have been extensively studied in other cell types, but ERα

306 binding sites in hematopoietic cells remain elusive. Moreover, profiling the genome wide ERα

307 binding sites in rare HSCs is technically challenging. To begin to understand the changes in

308 transcriptional factor landscapes induced by E2 treatment in purified HSCs, we profiled the

309 chromatin accessibility sites in oil- or E2-treated HSCs using ATAC-seq (Buenrostro et al.,

310 2013). We reasoned that if ERα is indeed a major regulator of E2-induced transcriptional

311 changes, we would observe changes in chromatin accessibility in response to E2 with ERα

312 footprints, which could be discovered by the presence of estrogen response elements (ERE).

313 5,000 HSCs were isolated from oil- or E2-treated mice, and the isolated nuclei were subject to

314 an ATAC-seq protocol. We observed highly concordant ATAC-seq profiles across samples,

315 identifying 51,230 overlapping peaks between all replicates (Figure 5 – figure supplement 1).

316 We identified a subset of peaks that were differentially upregulated in E2-treated cells (Figure

317 5A). Both the de novo and the supervised motif search identified ERE as the most enriched

318 motif found in differentially regulated peaks, consistent with the idea that ERα is the major

319 regulator of the transcriptional changes induced by E2 in HSCs (Figure 5B). Of interest, one of

320 the differential peaks present in E2-treated HSCs was located approximately 2.5kb upstream of

321 the TSS of Ire1α (termed peak 2) (Figure 5C). Further sequence interrogation of this locus

Chapple et al. Estrogen regulates UPR in HSCs 13 322 revealed that this ATAC-seq peak contains a ERE motif with 1 nucleotide mismatch

323 (GGTCAnnnTGACa) from the consensus ERE (Figure 5C, lower panel). Given that ERE motifs

324 found in prototypical ERα target genes, such as Oxytocin and pS2, contain one base mismatch

325 from the consensus (Gruber et al., 2004), we next functionally validated the ERE in this locus.

326 To this end, we first tested whether the DNA sequence of this region have E2- and ERα-

327 responsive transcriptional activity. We cloned the 4kb region of Ern1 into a luciferase reporter

328 plasmid, transfected into 293T cells with or without a plasmid expressing ERα, and treated the

329 cells with E2 or control vehicle and measured luciferase activity. This revealed that the Ern1(-

330 4kb) construct has E2- and ERα-responsive transactivating capacity (Figure 5D). Importantly,

331 this E2- and ERα-responsive transactivating capacity was diminished when the ERE was

332 mutated in the Ern1(-4kb) construct, indicating that the ERE located upstream of Ern1 is

333 functional. To determine if ERα binds to this locus in primary hematopoietic progenitor cells, we

334 performed ChIP-qPCR. c-kit+ HSPCs were isolated from oil- or E2-treated mice and were

335 subject to ChIP. We found that the ERα occupancy at peak 2 increased significantly upon E2

336 treatment (Figure 5E). This result coincides with our finding that this locus becomes more

337 accessible upon E2 treatment and that it contains a functional ERE. These results establish that

338 Ire1α is a direct target of ligand-activated ERα in hematopoietic progenitor cells.

339

340 Estradiol promotes protective unfolded protein response in HSCs

341 The UPR was recently shown to regulate cellular responses in HSPCs upon proteotoxic

342 stresses (Miharada et al., 2014; van Galen et al., 2014). Upon ER stress, human HSCs

343 upregulated the pro-apoptotic PERK branch of the UPR, thus causing cell death, whereas

344 downstream progenitors upregulated the pro-survival IRE1α-XBP1 branch to survive (van Galen

345 et al., 2014). We hypothesized that E2 stimulation upregulates the pro-survival Ire1α-Xbp1

346 branch in HSCs, thus endowing them with resistance to various cellular stressors. To test this

347 theory, we induced ER stress in vitro in freshly isolated LSK cells from oil- or E2-treated mice

Chapple et al. Estrogen regulates UPR in HSCs 14 348 with the drugs tunicamycin and thapsigargin. Cells were then analyzed for viability using

349 Annexin V staining and colony assays. Both tunicamycin and thapsigargin increased the

350 frequencies of Annexin V+ LSK cells (Figure 6 – figure supplement 1A, B) and reduced

351 clonogenicity (Figure 6 – figure supplement 1C). However, in vivo E2 treatment significantly

352 rescued these effects, indicating that HSPCs exposed to E2 are protected from proteotoxic

353 stress. These results establish that the E2-ERα pathway confers resistance against ER stress,

354 paralleling the activation of the protective Ire1α-Xbp1 branch of the UPR.

355 Increased oxidative stress, such as that caused by ionizing irradiation, can cause protein

356 oxidation, leading to accumulation of protein aggregates, which in turn elicits ER stress and

357 activates the UPR (Berlett and Stadtman, 1997; Malhotra and Kaufman, 2007; Squier, 2001).

358 We thus examined whether the total body irradiation we used in the previous experiments

359 affected proteostasis of hematopoietic cells. We quantified protein aggregates using a recently

360 published protocol (Sigurdsson et al., 2016), and observed a dose-dependent increase in the

361 levels of protein aggregates following sublethal doses of irradiation (Figure 6A). Interestingly,

362 E2-treatment significantly reduced the levels of protein aggregates after TBI in LSK cells but not

363 WBM cells, in concordance with the induction of Ire1α and splicing of Xbp1 (Figure 6B).

364 We then tested whether the Ire1α-Xbp1 branch is required for the E2-ERα pathway to

365 endow HSCs with stress resistance. Using our recently described mouse and human HSPC

366 genome editing protocol (Gundry et al., 2016), we designed multiple single-guide RNAs

367 (sgRNAs) against Ire1α, and electroporated them as a ribonucleoprotein (RNP) complex with

368 Cas9 protein into LSK cells. By immunoblotting and sequencing, we identified sgRNAs that

369 efficiently ablated Ire1α (Figure 6C and Figure 6 – figure supplement 1D). These sgRNAs were

370 used in subsequent experiments. We isolated LSK cells from both oil- and E2-treated mice, and

371 electroporated them with Cas9-RNPs with sgRNAs against Ire1α or control Rosa26. Clonal

372 analysis of electroporated LSK cells indicated that about 25% of the clones had deletions

373 between the two sgRNA target sites, while another 50% of the clones had small indels detected

Chapple et al. Estrogen regulates UPR in HSCs 15 374 by TIDE analysis (Figure 6 - supplement 1D). The bulk-modified cells were then plated in media

375 with or without ER stressors. Strikingly, we found that deleting Ire1α abolished the resistance

376 endowed by E2 against ER stressors (Figure 6D). These results demonstrate that E2 promotes

377 ER stress resistance by activating the cytoprotective UPR branch governed by the Ire1α-Xbp1

378 pathway.

379 Finally, we tested whether the induction of the Ire1α-Xbp1 pathway by ERα promotes

380 hematopoietic regeneration. LSK cells were electroporated with Cas9-RNP targeting either

381 Rosa26 or Ire1α and transplanted into lethally irradiated mice. Recipients were treated with

382 control oil or E2 every other day, and peripheral blood was collected at day 14 post-TBI.

383 Consistent with our previous findings (Figure 2D-F), recipients of Rosa26-edited LSK cells

384 demonstrated enhanced hematopoietic recovery when treated with E2, which was largely

385 suppressed when Ire1α was deleted (Figure 6E). We also investigated the regeneration of

386 HSPCs in the bone marrow of these recipient mice. The frequencies of LSK and myeloid

387 progenitor cells were significantly increased in mice receiving E2 treatment after transplantation

388 (Figure 6F-G and Figure 6 – figure supplement 1E-F). However, this effect was abolished in

389 similarly treated recipients of Ire1α-edited LSK cells. Collectively, these results demonstrate that

390 the E2-ERα module activates and at least partly depends on the Ire1α-Xbp1 pathway to

391 promote hematopoietic regeneration.

392

393 Discussion

394 Our results establish that E2 activates the Ire1α-Xbp1 branch of the UPR in HSCs through ERα,

395 thus augmenting hematopoietic regeneration. E2 treatment increased the capacity of HSCs to

396 reconstitute the hematopoietic system upon transplantation and accelerated hematopoietic

397 regeneration after total body irradiation. E2-ERα signaling transcriptionally induced the

398 expression of Ire1α, which then promoted the splicing of Xbp1 mRNA to induce Xbp1s, a

Chapple et al. Estrogen regulates UPR in HSCs 16 399 transcription factor critical for the UPR. The importance of the Ire1α-Xbp1 pathway-mediated

400 UPR is exemplified by our finding that E2 augments hematopoietic recovery after

401 transplantation through Ire1. Thus, E2 is a soluble long-range signal that promotes

402 hematopoietic regeneration at least partly by inducing a cytoprotective UPR in HSCs.

403 Whether activation of the UPR is beneficial or detrimental for HSC function appears to

404 depend on which pathway becomes activated and to what extent it is activated. Uncontrolled

405 activation of the UPR, particularly of the PERK pathway, has been shown to impair HSC

406 function. Deletion of Grp78 (BiP) in mice activates all three branches of the UPR and reduces

407 the HSC pool, causing lymphopenia (Wey et al., 2012). Human HSCs activate the PERK

408 pathway upon proteotoxic stress, rendering them susceptible to apoptosis (van Galen et al.,

409 2014). On the other hand, activation of the Ire1α-Xbp1 branch or the protein folding capacity

410 improves HSC function. While human HSCs activate the PERK pathway upon proteotoxic stress

411 and undergo apoptosis, downstream progenitors activate the Ire1α-Xbp1 pathway to survive

412 (van Galen et al., 2014). Additionally, overexpression of a molecular chaperone ERDJ4

413 (encoded by DNAJB9) protects human HSCs from proteotoxic stress and increases the

414 reconstitution capacity (van Galen et al., 2014). Our results are consistent with the model that

415 activation of the Ire1α-Xbp1 branch by E2 protects HSCs from proteotoxic stress and promotes

416 hematopoietic regeneration, although we cannot formally exclude the possibility that two other

417 UPR branches (PERK and ATF6) are also involved. IRE1 also promotes decay of mRNA

418 localized to the ER, called regulated IRE1-dependent decay of mRNA (RIDD) (Maurel et al.,

419 2014). However, RIDD seems unlikely to be activated in E2-treated HSCs since translation is

420 not attenuated in HSCs after E2 exposure. Furthermore, RIDD is usually associated with

421 apoptotic cell death, which is not observed in E2-treated cells. It is important to note that Xbp1 is

422 largely dispensable for HSC maintenance during homeostasis (Bettigole et al., 2015), indicating

423 that although Xbp1 is not required for the homeostatic maintenance of HSCs, its activation

Chapple et al. Estrogen regulates UPR in HSCs 17 424 provides additional protection against proteotoxic stress. Thus, selective activation of the Ire1α-

425 Xbp1 pathway is key to harnessing the UPR to improve hematopoietic regeneration. How E2

426 preferentially activates the Ire1α-Xbp1 branch without appreciable activation of the PERK and

427 ATF6 pathways remains to be explored.

428 Consistent with our previous finding that E2 promotes division of HSCs (Nakada et al.,

429 2014), we found that E2-treated HSCs had increased expression of genes known as Myc target

430 genes, some of which were induced in vitro after E2 stimulation. It is important to note, though,

431 that although some of the Myc targets were induced, c-Myc, N-Myc, or L-Myc were not induced

432 by E2. Thus, to what extent the global upregulation of Myc-target genes in HSCs after E2

433 treatment reflects Myc-induced responses or an indirect consequence of the activated cell cycle

434 remains unclear. More work is needed to determine the direct target of the E2-ERα module that

435 promotes HSC division.

436 Our findings indicate that E2 promotes hematopoietic regeneration by protecting HSPCs

437 from irradiation-induced stress. An earlier study reported that female mice are more resistant to

438 acute irradiation than male mice, and that the estrus cycle affects radioresistance (Rugh and

439 Clugston, 1955), although careful interpretation is required since strain differences also

440 contribute to radioresistance (Grahn, 1958). Estrogenic compounds such as genistein have also

441 been known to have radioprotective effects (Ha et al., 2013). Additionally, it has been

442 demonstrated that engraftment of human HSPCs is more efficient in female recipient mice than

443 male mice (Notta et al., 2010). The mechanism behind this sexual difference in HSC

444 engraftment remains to be established, but it is tempting to speculate that the female hormonal

445 milieu protects engrafting HSCs from stress. Further investigation on how estrogens, or more

446 broadly hormones, prepare the recipient to accommodate transplanted HSCs, including the

447 involvement of the bone marrow niche, may pave the way to improve the efficacy of bone

448 marrow transplantation. Since estrogens also have detrimental hematopoietic side-effects, such

Chapple et al. Estrogen regulates UPR in HSCs 18 449 as causing thromboembolism (Tchaikovski and Rosing, 2010), future studies should aim to

450 separate the beneficial effects of estrogens on HSC function from other negative effects.

451 In concordance with the effect of E2 on HSPC regeneration, E2 also improved the blood

452 cell counts after irradiation or transplantation, although the effects of E2 on mature cells in the

453 blood were less pronounced than the effects on HSPCs. We postulate that since production of

454 mature cells involves multiple intermediate cell stages during differentiation and that it is also

455 affected by a variety of homeostatic mechanisms (such as thrombopoietin production by the

456 liver and the kidney), the end output in the blood may not be as robust as the effects on HSPCs.

457 More broadly, our data extend the role of systemic UPR activation to regeneration by

458 adult stem cells. Exciting new data have described that the UPR is a key pathway in intercellular

459 and inter-tissue communication regulating tissue homeostasis and aging. Chemical chaperones,

460 such as osmolytes and hydrophobic compounds, aid in cellular protein folding capacity to

461 maintain proteostasis, and have therapeutic potential in treating metabolic and

462 neurodegenerative diseases (Cortez and Sim, 2014). Interestingly, taurocholic acid, a chemical

463 chaperone that is more abundant in the bile acid of fetal liver compared to adult liver, inhibits

464 protein aggregation in fetal liver HSCs to support their rapid expansion during development and

465 in culture (Miharada et al., 2014; Sigurdsson et al., 2016). This illustrates that systemic factor(s)

466 can affect the protein folding capacity of HSCs, although it remains unclear whether bile acid

467 affects the UPR of HSCs in adult animals. In nematodes and fruit flies, impaired proteostasis of

468 a cell type or a tissue can communicate to other cells to coordinate stress responses

469 systemically by upregulating the UPR in the periphery (Berendzen et al., 2016; van Oosten-

470 Hawle and Morimoto, 2014). Additionally, activation of the UPR in neurons by Xbp1s expression

471 extends lifespan of C.elegans, and strikingly, augments the UPR in the intestine through a cell

472 non-autonomous mechanism involving an unknown neurotransmitter (Taylor and Dillin, 2013).

473 The Ire1α-Xbp1s pathway appears to be important for systemic UPR activation in vertebrates as

Chapple et al. Estrogen regulates UPR in HSCs 19 474 well, since Xbp1s expression in murine POMC neurons activates Xbp1s in the liver, paralleling

475 the improved hepatic insulin sensitivity and suppression of glucose production (Williams et al.,

476 2014). Thus, although the secreted systemic factors that activate the UPR in distal tissues

477 remain largely unknown, the UPR is a conserved mechanism that is activated by systemic

478 factors to prepare the perceiving cells against stress by promoting proteostasis. Our work

479 establishes that E2 is a systemic extrinsic regulator of UPR in adult HSCs that endows them

480 with enhanced stress resistance, which is critical during regeneration.

481

482 ACKNOWLEDGEMENTS

483 This work was supported by the National Institutes of Health (CA193235 and DK107413 to DN

484 and HL132392 to QL). RHC was supported by NIH T32 DK060445. Flow-cytometry was

485 partially supported by the NIH (NCRR grant S10RR024574, NIAID AI036211 and NCI

486 P30CA125123) for the BCM Cytometry and Cell Sorting Core. The authors declare no

487 competing financial interests. We thank Dr. Masayuki Miura (University of Tokyo) for providing

488 the ERAI strain, and Catherine Gillespie for critical reading of the manuscript.

489

490 REFERENCES

491 492 Baldridge, M.T., King, K.Y., Boles, N.C., Weksberg, D.C., and Goodell, M.A. (2010). Quiescent 493 haematopoietic stem cells are activated by IFN-gamma in response to chronic infection. Nature 494 465, 793-797.

495 Beerman, I., Bhattacharya, D., Zandi, S., Sigvardsson, M., Weissman, I.L., Bryder, D., and 496 Rossi, D.J. (2010). Functionally distinct hematopoietic stem cells modulate hematopoietic 497 lineage potential during aging by a mechanism of clonal expansion. Proc Natl Acad Sci U S A 498 107, 5465-5470.

499 Berendzen, K.M., Durieux, J., Shao, L.W., Tian, Y., Kim, H.E., Wolff, S., Liu, Y., and Dillin, A. 500 (2016). Neuroendocrine Coordination of Mitochondrial Stress Signaling and Proteostasis. Cell 501 166, 1553-1563 e1510.

Chapple et al. Estrogen regulates UPR in HSCs 20 502 Berlett, B.S., and Stadtman, E.R. (1997). Protein oxidation in aging, disease, and oxidative 503 stress. J Biol Chem 272, 20313-20316.

504 Bettigole, S.E., Lis, R., Adoro, S., Lee, A.H., Spencer, L.A., Weller, P.F., and Glimcher, L.H. 505 (2015). The transcription factor XBP1 is selectively required for eosinophil differentiation. Nat 506 Immunol 16, 829-837.

507 Brack, A.S., Conboy, M.J., Roy, S., Lee, M., Kuo, C.J., Keller, C., and Rando, T.A. (2007). 508 Increased Wnt signaling during aging alters muscle stem cell fate and increases fibrosis. 509 Science (New York, NY 317, 807-810.

510 Brinkman, E.K., Chen, T., Amendola, M., and van Steensel, B. (2014). Easy quantitative 511 assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42, e168.

512 Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013). 513 Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, 514 DNA-binding proteins and nucleosome position. Nat Methods 10, 1213-1218.

515 Carroll, K.J., Esain, V., Garnaas, M.K., Cortes, M., Dovey, M.C., Nissim, S., Frechette, G.M., 516 Liu, S.Y., Kwan, W., Cutting, C.C., et al. (2014). Estrogen defines the dorsal-ventral limit of 517 VEGF regulation to specify the location of the hemogenic endothelial niche. Dev Cell 29, 437- 518 453.

519 Chell, J.M., and Brand, A.H. (2010). Nutrition-responsive glia control exit of neural stem cells 520 from quiescence. Cell 143, 1161-1173.

521 Cheng, C.W., Adams, G.B., Perin, L., Wei, M., Zhou, X., Lam, B.S., Da Sacco, S., Mirisola, M., 522 Quinn, D.I., Dorff, T.B., et al. (2014). Prolonged fasting reduces IGF-1/PKA to promote 523 hematopoietic-stem-cell-based regeneration and reverse immunosuppression. Cell Stem Cell 524 14, 810-823.

525 Citrin, D., Cotrim, A.P., Hyodo, F., Baum, B.J., Krishna, M.C., and Mitchell, J.B. (2010). 526 Radioprotectors and mitigators of radiation-induced normal tissue injury. The oncologist 15, 527 360-371.

528 Conboy, I.M., Conboy, M.J., Wagers, A.J., Girma, E.R., Weissman, I.L., and Rando, T.A. 529 (2005). Rejuvenation of aged progenitor cells by exposure to a young systemic environment. 530 Nature 433, 760-764.

531 Cortez, L., and Sim, V. (2014). The therapeutic potential of chemical chaperones in protein 532 folding diseases. Prion 8.

533 Cox, J.S., and Walter, P. (1996). A novel mechanism for regulating activity of a transcription 534 factor that controls the unfolded protein response. Cell 87, 391-404.

535 Doan, P.L., Himburg, H.A., Helms, K., Russell, J.L., Fixsen, E., Quarmyne, M., Harris, J.R., 536 Deoliviera, D., Sullivan, J.M., Chao, N.J., et al. (2013). Epidermal growth factor regulates 537 hematopoietic regeneration after radiation injury. Nat Med 19, 295-304.

538 Dobin, A., and Gingeras, T.R. (2016). Optimizing RNA-Seq Mapping with STAR. Methods in 539 molecular biology (Clifton, NJ 1415, 245-262.

Chapple et al. Estrogen regulates UPR in HSCs 21 540 Edwards, D.P. (2005). Regulation of signal transduction pathways by estrogen and 541 progesterone. Annu Rev Physiol 67, 335-376.

542 Esplin, B.L., Shimazu, T., Welner, R.S., Garrett, K.P., Nie, L., Zhang, Q., Humphrey, M.B., 543 Yang, Q., Borghesi, L.A., and Kincade, P.W. (2011). Chronic Exposure to a TLR Ligand Injures 544 Hematopoietic Stem Cells. Journal of immunology 186, 5367-5375.

545 Essers, M.A., Offner, S., Blanco-Bose, W.E., Waibler, Z., Kalinke, U., Duchosal, M.A., and 546 Trumpp, A. (2009). IFNalpha activates dormant haematopoietic stem cells in vivo. Nature 458, 547 904-908.

548 Goncalves, K.A., Silberstein, L., Li, S., Severe, N., Hu, M.G., Yang, H., Scadden, D.T., and Hu, 549 G.F. (2016). Angiogenin Promotes Hematopoietic Regeneration by Dichotomously Regulating 550 Quiescence of Stem and Progenitor Cells. Cell 166, 894-906.

551 Grahn, D. (1958). Acute Radiation Response of Mice from a Cross between Radiosensitive and 552 Radioresistant Strains. Genetics 43, 835-843.

553 Gruber, C.J., Gruber, D.M., Gruber, I.M., Wieser, F., and Huber, J.C. (2004). Anatomy of the 554 estrogen response element. Trends in endocrinology and metabolism: TEM 15, 73-78.

555 Gundry, M.C., Brunetti, L., Lin, A., Mayle, A.E., Kitano, A., Wagner, D., Hsu, J.I., Hoegenauer, 556 K.A., Rooney, C.M., Goodell, M.A., et al. (2016). Highly Efficient Genome Editing of Murine and 557 Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell reports 17, 1453-1461.

558 Ha, C.T., Li, X.H., Fu, D., Xiao, M., and Landauer, M.R. (2013). Genistein nanoparticles protect 559 mouse hematopoietic system and prevent proinflammatory factors after gamma irradiation. 560 Radiat Res 180, 316-325.

561 Hetz, C., Chevet, E., and Harding, H.P. (2013). Targeting the unfolded protein response in 562 disease. Nature reviews Drug discovery 12, 703-719.

563 Himburg, H.A., Doan, P.L., Quarmyne, M., Yan, X., Sasine, J., Zhao, L., Hancock, G.V., Kan, J., 564 Pohl, K.A., Tran, E., et al. (2017). Dickkopf-1 promotes hematopoietic regeneration via direct 565 and niche-mediated mechanisms. Nat Med 23, 91-99.

566 Himburg, H.A., Muramoto, G.G., Daher, P., Meadows, S.K., Russell, J.L., Doan, P., Chi, J.T., 567 Salter, A.B., Lento, W.E., Reya, T., et al. (2010). Pleiotrophin regulates the expansion and 568 regeneration of hematopoietic stem cells. Nat Med 16, 475-482.

569 Iwawaki, T., Akai, R., Kohno, K., and Miura, M. (2004). A transgenic mouse model for 570 monitoring endoplasmic reticulum stress. Nat Med 10, 98-102.

571 Janich, P., Pascual, G., Merlos-Suarez, A., Batlle, E., Ripperger, J., Albrecht, U., Cheng, H.Y., 572 Obrietan, K., Di Croce, L., and Benitah, S.A. (2011). The circadian molecular clock creates 573 epidermal stem cell heterogeneity. Nature 480, 209-214.

574 Janssens, S., Pulendran, B., and Lambrecht, B.N. (2014). Emerging functions of the unfolded 575 protein response in immunity. Nat Immunol 15, 910-919.

Chapple et al. Estrogen regulates UPR in HSCs 22 576 Katsimpardi, L., Litterman, N.K., Schein, P.A., Miller, C.M., Loffredo, F.S., Wojtkiewicz, G.R., 577 Chen, J.W., Lee, R.T., Wagers, A.J., and Rubin, L.L. (2014). Vascular and neurogenic 578 rejuvenation of the aging mouse brain by young systemic factors. Science (New York, NY 344, 579 630-634.

580 Kiel, M.J., Yilmaz, O.H., Iwashita, T., Terhorst, C., and Morrison, S.J. (2005). SLAM Family 581 Receptors Distinguish Hematopoietic Stem and Progenitor Cells and Reveal Endothelial Niches 582 for Stem Cells. Cell 121, 1109-1121.

583 Kühn, R., Schwenk, F., Aguet, M., and Rajewsky, K. (1995). Inducible gene targeting in mice. 584 Science (New York, NY 269, 1427-1429.

585 LaFever, L., and Drummond-Barbosa, D. (2005). Direct control of germline stem cell division 586 and cyst growth by neural insulin in Drosophila. Science (New York, NY 309, 1071-1073.

587 Lehtinen, M.K., Zappaterra, M.W., Chen, X., Yang, Y.J., Hill, A.D., Lun, M., Maynard, T., 588 Gonzalez, D., Kim, S., Ye, P., et al. (2011). The cerebrospinal fluid provides a proliferative niche 589 for neural progenitor cells. Neuron 69, 893-905.

590 Liu, J., Xu, Y., Stoleru, D., and Salic, A. (2012). Imaging protein synthesis in cells and tissues 591 with an alkyne analog of puromycin. Proc Natl Acad Sci U S A 109, 413-418.

592 Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and 593 dispersion for RNA-seq data with DESeq2. Genome biology 15, 550.

594 Malhotra, J.D., and Kaufman, R.J. (2007). Endoplasmic reticulum stress and oxidative stress: a 595 vicious cycle or a double-edged sword? Antioxid Redox Signal 9, 2277-2293.

596 Maurel, M., Chevet, E., Tavernier, J., and Gerlo, S. (2014). Getting RIDD of RNA: IRE1 in cell 597 fate regulation. Trends Biochem Sci 39, 245-254.

598 McLeod, C.J., Wang, L., Wong, C., and Jones, D.L. (2010). Stem cell dynamics in response to 599 nutrient availability. Current biology : CB 20, 2100-2105.

600 Mendelson, A., and Frenette, P.S. (2014). Hematopoietic stem cell niche maintenance during 601 homeostasis and regeneration. Nat Med 20, 833-846.

602 Mendez-Ferrer, S., Lucas, D., Battista, M., and Frenette, P.S. (2008). Haematopoietic stem cell 603 release is regulated by circadian oscillations. Nature 452, 442-447.

604 Miharada, K., Sigurdsson, V., and Karlsson, S. (2014). Dppa5 improves hematopoietic stem cell 605 activity by reducing endoplasmic reticulum stress. Cell reports 7, 1381-1392.

606 Nakada, D., Levi, B.P., and Morrison, S.J. (2011). Integrating physiological regulation with stem 607 cell and tissue homeostasis. Neuron 70, 703-718.

608 Nakada, D., Oguro, H., Levi, B.P., Ryan, N., Kitano, A., Saitoh, Y., Takeichi, M., Wendt, G.R., 609 and Morrison, S.J. (2014). Oestrogen increases haematopoietic stem-cell self-renewal in 610 females and during pregnancy. Nature 505, 555-558.

Chapple et al. Estrogen regulates UPR in HSCs 23 611 Nakada, D., Saunders, T.L., and Morrison, S.J. (2010). Lkb1 regulates cell cycle and energy 612 metabolism in haematopoietic stem cells. Nature 468, 653-658.

613 North, T.E., Goessling, W., Walkley, C.R., Lengerke, C., Kopani, K.R., Lord, A.M., Weber, G.J., 614 Bowman, T.V., Jang, I.H., Grosser, T., et al. (2007). Prostaglandin E2 regulates vertebrate 615 haematopoietic stem cell homeostasis. Nature 447, 1007-1011.

616 Notta, F., Doulatov, S., and Dick, J.E. (2010). Engraftment of human hematopoietic stem cells is 617 more efficient in female NOD/SCID/IL-2Rgc-null recipients. Blood 115, 3704-3707.

618 O'Brien, L.E., Soliman, S.S., Li, X., and Bilder, D. (2011). Altered modes of stem cell division 619 drive adaptive intestinal growth. Cell 147, 603-614.

620 Oguro, H., Ding, L., and Morrison, S.J. (2013). SLAM family markers resolve functionally distinct 621 subpopulations of hematopoietic stem cells and multipotent progenitors. Cell Stem Cell 13, 102- 622 116.

623 Passegue, E., Wagers, A.J., Giuriato, S., Anderson, W.C., and Weissman, I.L. (2005). Global 624 analysis of proliferation and cell cycle gene expression in the regulation of hematopoietic stem 625 and progenitor cell fates. The Journal of experimental medicine 202, 1599-1611.

626 Pietras, E.M., Reynaud, D., Kang, Y.A., Carlin, D., Calero-Nieto, F.J., Leavitt, A.D., Stuart, J.M., 627 Gottgens, B., and Passegue, E. (2015). Functionally Distinct Subsets of Lineage-Biased 628 Multipotent Progenitors Control Blood Production in Normal and Regenerative Conditions. Cell 629 Stem Cell 17, 35-46.

630 Rugh, R., and Clugston, H. (1955). Radiosensitivity with respect to the estrous cycle in the 631 mouse. Radiat Res 2, 227-236.

632 Sanchez-Aguilera, A., Arranz, L., Martin-Perez, D., Garcia-Garcia, A., Stavropoulou, V., 633 Kubovcakova, L., Isern, J., Martin-Salamanca, S., Langa, X., Skoda, R.C., et al. (2014). 634 Estrogen signaling selectively induces apoptosis of hematopoietic progenitors and myeloid 635 neoplasms without harming steady-state hematopoiesis. Cell Stem Cell 15, 791-804.

636 Sanjuan-Pla, A., Macaulay, I.C., Jensen, C.T., Woll, P.S., Luis, T.C., Mead, A., Moore, S., 637 Carella, C., Matsuoka, S., Jones, T.B., et al. (2013). Platelet-biased stem cells reside at the 638 apex of the haematopoietic stem-cell hierarchy. Nature 502, 232-236.

639 Sato, T., Onai, N., Yoshihara, H., Arai, F., Suda, T., and Ohteki, T. (2009). Interferon regulatory 640 factor-2 protects quiescent hematopoietic stem cells from type I interferon-dependent 641 exhaustion. Nature medicine 15, 696-700.

642 Schaefer, B.C., Schaefer, M.L., Kappler, J.W., Marrack, P., and Kedl, R.M. (2001). Observation 643 of antigen-dependent CD8+ T-cell/ dendritic cell interactions in vivo. Cellular immunology 214, 644 110-122.

645 Schmidt, E.K., Clavarino, G., Ceppi, M., and Pierre, P. (2009). SUnSET, a nonradioactive 646 method to monitor protein synthesis. Nat Methods 6, 275-277.

Chapple et al. Estrogen regulates UPR in HSCs 24 647 Signer, R.A., Qi, L., Zhao, Z., Thompson, D., Sigova, A.A., Fan, Z.P., DeMartino, G.N., Young, 648 R.A., Sonenberg, N., and Morrison, S.J. (2016). The rate of protein synthesis in hematopoietic 649 stem cells is limited partly by 4E-BPs. Genes Dev 30, 1698-1703.

650 Signer, R.A.J., Magee, J.A., Salic, A., and Morrison, S.J. (2014). Haematopoietic stem cells 651 require a highly regulated protein synthesis rate. Nature advance online publication.

652 Sigurdsson, V., Takei, H., Soboleva, S., Radulovic, V., Galeev, R., Siva, K., Leeb-Lundberg, 653 L.M., Iida, T., Nittono, H., and Miharada, K. (2016). Bile Acids Protect Expanding Hematopoietic 654 Stem Cells from Unfolded Protein Stress in Fetal Liver. Cell Stem Cell 18, 522-532.

655 Simonnet, A.J., Nehme, J., Vaigot, P., Barroca, V., Leboulch, P., and Tronik-Le Roux, D. (2009). 656 Phenotypic and functional changes induced in hematopoietic stem/progenitor cells after 657 gamma-ray radiation exposure. Stem Cells 27, 1400-1409.

658 Singh, S.P., Wolfe, A., Ng, Y., DiVall, S.A., Buggs, C., Levine, J.E., Wondisford, F.E., and 659 Radovick, S. (2009). Impaired estrogen feedback and infertility in female mice with pituitary- 660 specific deletion of estrogen receptor alpha (ESR1). Biology of reproduction 81, 488-496.

661 Sinha, M., Jang, Y.C., Oh, J., Khong, D., Wu, E.Y., Manohar, R., Miller, C., Regalado, S.G., 662 Loffredo, F.S., Pancoast, J.R., et al. (2014). Restoring systemic GDF11 levels reverses age- 663 related dysfunction in mouse skeletal muscle. Science (New York, NY 344, 649-652.

664 Sousa-Nunes, R., Yee, L.L., and Gould, A.P. (2011). Fat cells reactivate quiescent neuroblasts 665 via TOR and glial insulin relays in Drosophila. Nature.

666 Squier, T.C. (2001). Oxidative stress and protein aggregation during biological aging. Exp 667 Gerontol 36, 1539-1550.

668 Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., 669 Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set enrichment 670 analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc 671 Natl Acad Sci U S A 102, 15545-15550.

672 Sun, J., Liu, Y., and Aballay, A. (2012). Organismal regulation of XBP-1-mediated unfolded 673 protein response during development and immune activation. EMBO Rep 13, 855-860.

674 Taylor, R.C., Berendzen, K.M., and Dillin, A. (2014). Systemic stress signalling: understanding 675 the cell non-autonomous control of proteostasis. Nat Rev Mol Cell Biol 15, 211-217.

676 Taylor, R.C., and Dillin, A. (2013). XBP-1 is a cell-nonautonomous regulator of stress resistance 677 and longevity. Cell 153, 1435-1447.

678 Tchaikovski, S.N., and Rosing, J. (2010). Mechanisms of estrogen-induced venous 679 thromboembolism. Thrombosis research 126, 5-11.

680 Thurmond, T.S., Murante, F.G., Staples, J.E., Silverstone, A.E., Korach, K.S., and Gasiewicz, 681 T.A. (2000). Role of estrogen receptor alpha in hematopoietic stem cell development and B 682 lymphocyte maturation in the male mouse. Endocrinology 141, 2309-2318.

Chapple et al. Estrogen regulates UPR in HSCs 25 683 van Galen, P., Kreso, A., Mbong, N., Kent, D.G., Fitzmaurice, T., Chambers, J.E., Xie, S., 684 Laurenti, E., Hermans, K., Eppert, K., et al. (2014). The unfolded protein response governs 685 integrity of the haematopoietic stem-cell pool during stress. Nature 510, 268-272.

686 van Oosten-Hawle, P., and Morimoto, R.I. (2014). Organismal proteostasis: role of cell- 687 nonautonomous regulation and transcellular chaperone signaling. Genes Dev 28, 1533-1543.

688 Villeda, S.A., Luo, J., Mosher, K.I., Zou, B., Britschgi, M., Bieri, G., Stan, T.M., Fainberg, N., 689 Ding, Z., Eggel, A., et al. (2011). The ageing systemic milieu negatively regulates neurogenesis 690 and cognitive function. Nature 477, 90-94.

691 Wang, S., and Kaufman, R.J. (2012). The impact of the unfolded protein response on human 692 disease. J Cell Biol 197, 857-867.

693 Wey, S., Luo, B., and Lee, A.S. (2012). Acute inducible ablation of GRP78 reveals its role in 694 hematopoietic stem cell survival, lymphogenesis and regulation of stress signaling. PLoS ONE 695 7, e39047.

696 Williams, K.W., Liu, T., Kong, X., Fukuda, M., Deng, Y., Berglund, E.D., Deng, Z., Gao, Y., Liu, 697 T., Sohn, J.W., et al. (2014). Xbp1s in Pomc neurons connects ER stress with energy balance 698 and glucose homeostasis. Cell Metab 20, 471-482.

699 Yamamoto, R., Morita, Y., Ooehara, J., Hamanaka, S., Onodera, M., Rudolph, K.L., Ema, H., 700 and Nakauchi, H. (2013). Clonal analysis unveils self-renewing lineage-restricted progenitors 701 generated directly from hematopoietic stem cells. Cell 154, 1112-1126.

702 Yilmaz, O.H., Katajisto, P., Lamming, D.W., Gultekin, Y., Bauer-Rowe, K.E., Sengupta, S., 703 Birsoy, K., Dursun, A., Yilmaz, V.O., Selig, M., et al. (2012). mTORC1 in the Paneth cell niche 704 couples intestinal stem-cell function to calorie intake. Nature 486, 490-495.

705 Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., and Mori, K. (2001). XBP1 mRNA is induced 706 by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription 707 factor. Cell 107, 881-891.

708 Zsebo, K.M., Smith, K.A., Hartley, C.A., Greenblatt, M., Cooke, K., Rich, W., and McNiece, I.K. 709 (1992). Radioprotection of mice by recombinant rat stem cell factor. Proc Natl Acad Sci U S A 710 89, 9464-9468. 711 712

713 FIGURE LEGENDS 714

715 Figure 1. Estrogen Enhances the Myeloid Potential of HSCs. (A) Colony formation by single

716 HSCs from control or E2 treated Esr1fl/fl (WT) and Mx1-Cre; Esr1fl/fl (Esr1Δ/Δ) mice (96 wells per

717 animal, n=4 assays/group). Colonies were collected, cytospun, and scored after Wright Giemsa

718 staining. gemM: granulocyte, erythroid, monocyte, megakaryocyte; gmM: granulocyte monocyte

Chapple et al. Estrogen regulates UPR in HSCs 26 719 megakaryocyte; gme: granulocyte, monocyte, erythroid; gm: granulocyte, monocyte; M:

720 megakaryocyte; m: monocyte; e: erythroid. Red and green lines indicate significant interaction

721 of treatment and genotype of gemM and gm, respectively (***p<0.001, ANOVA) (B)

722 Megakaryocyte differentiation potential in collagen-based MegaCult assays (n=6, 3 independent

723 experiments, 2 technical replicates per experiment). Meg, colonies containing exclusively

724 megakaryocytes as indicated by cholinesterase staining; Mixed, colonies containing both

725 megakaryocytes and other myeloid cells; Non, colony with no megakaryocytes. * p<0.05, ANOVA.

726 (C) Numbers of CD41+ megakaryocytes as indicated by immunofluorescent staining of bone

727 marrow sections (n=10, 5 fields of view per section). (D) Representative images of CD41

728 stained bone marrow sections from oil- and E2-treated mice. Scale bar represents 50 μm. (E-J)

729 Levels of donor (GFP+) engraftment in recipient mice that were transplanted with 100 GFP+

730 HSCs (oil- or E2-treated Ubc-GFP; Esr1fl/fl (n = 4 donors each, 24 and 26 recipients

731 respectively) or Ubc-GFP; Mx1-Cre; Esr1fl/fl (n = 3 donors each, 14 and 23 recipients

732 respectively) and 2 x 105 competitor GFP- cells. Each panel represents donor chimerisms in (E)

733 overall mononuclear cells, (F) Mac-1/Gr-1+ myeloid cells, (G) CD41+ FSC/SSClow platelets, (H)

734 Ter119+ FSC/SSClow red blood cells, (I) B220+ B-cells, and (J) CD3+ T-cells. All data represent

735 mean ± standard deviation; *, p<0.05; **, p<0.01; and ***, p<0.001 by Student’s t-test unless

736 otherwise noted.

737

738 Figure 1 – figure supplement 1. (A) Gating strategy for the identification of HSCs and MPPs in

739 both oil- and E2-treated mice. (B) Gating strategy for detection of platelets and red blood cells

740 in peripheral blood. Whole blood was stained with CD41 and Ter119 antibodies. (C) Gating

741 strategy for detection of myeloid and lymphoid cells in peripheral blood. Whole blood was

742 treated with ACK buffer, and then stained with the lineage antibody cocktail shown. (D)

743 Secondary transplantation of vehicle and E2 treated HSCs. 2x106 WBM cells from primary

744 recipients of oil- and E2-treated HSC were transplanted into lethally irradiated recipients.

Chapple et al. Estrogen regulates UPR in HSCs 27 745 Reconstitution was monitored by collecting peripheral blood every 4 weeks. Data represent

746 mean±standard deviation; *, p<0.05; **, p<0.01; by Student’s t-test.

747

748

749 Figure 2. Estrogen Promotes Hematopoietic Recovery After Irradiation. (A-C) Mean PB counts

750 of (A) platelets, (B) white blood cells, and (C) red blood cells of oil- and E2-treated mice (black

751 and red lines, respectively. n=4 Oil, n=5 E2, 2 independent experiments). *, p<0.05 by Student’s

752 t-test. (D-F) Mean PB counts of (D) platelets, (E) white blood cells, and (F) red blood cells of

753 control or ERα-deficient mice, treated with either oil or E2. Data were collected 14 days after

754 TBI. ***, p<0.001, ANOVA. (G) Survival curves of C57BL/6 male mice treated with oil or E2 for 1

755 week followed by 800cGy TBI. **, p<0.01 by a log-rank test. (H) Survival curves of C57BL/6

756 male and female mice following 800cGy TBI. *, p<0.05 by a log-rank test. All data represent

757 mean ± standard deviation.

758

759 Figure 2 – figure supplement 1. Experimental design of hematopoietic regeneration following

760 TBI. Male mice were treated with E2 for 7 days before undergoing TBI at day 0. Peripheral

761 blood samples were collected every other day. HSPCs were quantified at days 3, 5, 7, and 14.

762 WBM transplantation was performed with cells isolated at day 14.

763

764 Figure 3. Estrogen Promotes HSPC Regeneration After Irradiation. (A) Bone marrow cellularity

765 (A), LSK frequencies (B), and total numbers of LSK cells (C) were analyzed at 3, 5, 7, and 14

766 days after 600cGy of TBI. E2 treatment significantly accelerated the recovery of bone marrow

767 cellularity, and the frequencies and the total numbers of LSK cells. (B-C) Frequencies (B) and

768 total numbers (C) of LSK cells in the bone marrow drop significantly 14 days after 600cGy of

769 irradiation; this affect is rescued by E2 treatment in wild-type mice but not in ERα-deficient mice

770 (n=7 over 4 independent experiments). (D) Competitive transplantation assays using 5 x 105

Chapple et al. Estrogen regulates UPR in HSCs 28 771 WBM cells from Ubc-GFP+ unirradiated mice (green lines) or sublethally irradiated, oil-treated

772 mice (black lines) or sublethally irradiated E2-treated mice (red lines) along with competitor cells

773 (n=8, 2 donors, 4 recipients per donor). E2 pretreatment significantly rescued the ability of WBM

774 cells to reconstitute the myeloid cells, platelets, and red blood cells after irradiation. (E-G) Bone

775 marrow cellularity (E), LSK frequencies (F), and total numbers of LSK cells (G) in the bone

776 marrow are significantly lower 14 days after 600cGy of irradiation (IR) compared to unirradiated

777 mice (Un). This effect is rescued by E2 treatment in wild-type mice but not in ERα-deficient mice

778 (n=7, 4 independent experiments). All data represent mean ± standard deviation; *, p<0.05; **,

779 p<0.01; and ***, p<0.001 by Student’s t-test in (A-D), and by ANOVA in (E-G).

780

781 Figure 3 – figure supplement 1. Regeneration of HSPCs after irradiation by E2 stimulation.

782 (A) Gating schemes to identify LSK cells and lineage-Sca-1-c-kit+ myeloid progenitor (MP) cells

783 in unirradiated mice and irradiated mice treated with oil or E2. (B) Frequencies of MP cells and

784 (C) LSK cells in unirradiated and irradiated animals, with or without E2 treatment. 3-month old

785 male mice were sublethally irradiated (600cGy) followed by oil or E2 administration every other

786 day. Both MP and LSK frequency are severely reduced following irradiation. Whereas MP

787 frequency is unaffected by E2 treatment, LSK frequency is significantly increased. (D) Depletion

788 of bone marrow cellularity after irradiation was significantly rescued by E2. (E) Total numbers of

789 LSK cells found in the long bones of sublethally irradiated mice given E2 after irradiation. All

790 data represent mean±standard deviation; *, p<0.05; ***, p<0.001, two-way ANOVA. MP

791 frequency (F) and MP numbers (G) were assessed following sublethal TBI. Although MP

792 frequency is unchanged, the total numbers of MPs are increased by E2 treatment at day 14. **,

793 p<0.01, Student’s t test. (H) MP frequency at day 14 post-TBI in Oil and E2 treated WT and

794 ER-deficient mice. **, p<0.01, two-way ANOVA. (I) Apoptosis rates were analyzed after

795 sublethal TBI in lineage- BM cells in Oil and E2 treated WT males. *, p<0.05; **, p<0.01, two-

796 way ANOVA.

Chapple et al. Estrogen regulates UPR in HSCs 29 797

798 Figure 4. Estrogen Activates the Ire1α-Xbp1 Branch of the UPR. (A) Unsupervised hierarchical

799 clustering of genes with log2 fold change larger than 1 identified by RNA-seq. Top 25 genes for

800 each cluster are shown. # indicates Ern1, which encodes Ire1α. (B) GSEA was performed

801 between oil- and E2-treated HSCs. Gene sets significantly enriched in E2-treated HSCs are

802 shown. (C) Pair wise GSEA was performed to test the enrichment of UPR-related genes in wild-

803 type or ERα-deficient HSCs after either oil- or E2-treatment (left). E2-treated wild-type HSCs

804 had enrichment of UPR genes, as indicated by the cumulative enrichment score (right). (D)

805 Fragments per kilobase of exon per million fragments mapped (FPKM) of Ern1 transcript was

806 increased in HSCs upon E2 treatment, and this increase was dependent on ERα. **, p<0.01 by

807 two-way ANOVA. (E) Quantitative PCR assays confirmed that the induction of Ire1α in HSCs, as

808 well as in MPPs, upon E2 treatment was dependent on ERα (n = 3, 2 independent

809 experiments). *, p<0.05 by two-way ANOVA. (F) Xbp1 splicing was determined by a two-color

810 Taqman assay. Xbp1 splicing was induced in HSCs and MPPs upon E2 treatment in an ERα-

811 dependent manner. The ratio between spliced (Xbp1s) to unspliced (Xbp1u) Xbp1 transcript is

812 shown (n = 4, 2 independent experiments). *, p<0.05 by two-way ANOVA. (G) Xbp1 splicing

813 was also determined by flow cytometry using the ERAI strain. Grey histogram represents the

814 background signal from ERAI- HSCs. **, p<0.01; and ***, p<0.001 by Student’s t-test. (H)

815 Immunoblotting was performed using HSC/MPP (CD48-/lowLSK), progenitor cells (CD48+LSK),

816 and WBM cells. Both Ire1α and Xbp1s protein levels were increased by E2 treatment in

817 immature cells. All data represent mean ± standard deviation.

818

819 Figure 4 – figure supplement 1. E2 treatment increases the expression of megakaryocyte-

820 related genes and chaperones in HSCs. (A) Ire1α mRNA expression levels were quantified in

821 LSK cells cultured in vitro with vehicle or varying concentrations of E2. (B-D) We CRISPR-

822 edited LSK cells for Ire1α or control Rosa26, and assessed the relationships between Ire1α and

Chapple et al. Estrogen regulates UPR in HSCs 30 823 Myc targets genes identified in the GSEA (Figure 4B), using the condition described in (A). Myc

824 targets Tipin (B), Tyms (C), and Ccna2 (D) were induced by E2 dependently on Ire1α. Pole3

825 (E), Hmga1 (F), Aimp2 (G), and Cdkn2c (H) were induced in E2 treated cells, but deletion of

826 Ire1α did not significantly affect the expression. *, p<0.05, two-way ANOVA. (I) FPKMs for

827 megakaryocyte-related genes in Oil and E2 treated WT and ER-deficient HSCs. *, p<0.05; **,

828 p<0.01; ***, p<0.001 by two-way ANOVA. (J) Heatmap of RPKMs from RNA Seq data. Genes

829 represented in the heatmap were genes discovered to be enriched in the GSEA Hallmark UPR

830 geneset. Data represents fold change from Oil treated HSCs. (K) Average expression values

831 of genes encoding chaperones or foldases as determined by qPCR. Data represents fold

832 change from Oil treated HSCs.

833

834 Figure 4 – figure supplement 2. Ire1 induction in HSCs is not a function of increased HSC

835 proliferation. (A) Representative plot used to fractionate CD48-/low LSKs based on CD150

836 levels. (B) Ire1α mRNA levels were quantified in CD150HI, LO, and NEG CD48-/low LSKs. Ire1α was

837 potently induced equally amongst all three populations. (C) Expression levels of the UPR

838 constituents CHOP, PERK, and Atf6 were assessed in Oil and E2 treated WT and ERα-deficient

839 HSCs by qPCR. Neither treatment caused significant changes in the expression of CHOP,

840 PERK, and Atf6 (accessed by ANOVA). (D) Puromycin incorporation assay. Male mice were

841 treated with oil or E2 for one week. One hour prior to collection, mice were injected with

842 puromycin and puromycin incorporation into each population was analyzed by flow cytometry.

843 (E) Expression levels of Ire1α, PERK, Atf6, and CHOP in G-CSF treated animals were analyzed

844 by qPCR. Male C57BL/6 mice were injected with 4 mg of cyclophosphamide and then with G-

845 CSF (5 μg/day) for 3 or 6 days, and analyzed the following day (n=3). Control mice were

846 injected with PBS. Since the numbers of HSCs in the spleen of control PBS-injected mice are

847 low, gene expression changes in spleen HSCs were compared to bone marrow HSCs of PBS-

Chapple et al. Estrogen regulates UPR in HSCs 31 848 injected mice. Although the expression levels of Atf6 and CHOP were increased in mobilized

849 spleen HSCs at day 6, expression levels of Ire1α did not change. (F) Ire1α expression levels in

850 HSCs and WBM from mice treated with varying doses of poly I:C. Although poly I:C increased

851 Ire1α expression in WBM cells, it did not significantly changes the expression in HSCs (G)

852 Expression levels of chaperones was assessed in activated HSCs. HSCs were collected from

853 G-CSF treated mice (upper panel) and poly I:C treated mice (lower panel) and chaperone

854 mRNA levels were measured via qPCR. Whereas a few chaperones were induced, the global

855 UPR network was not increased as extensively as E2 treatment. *, p<0.05, Students t test.

856

857 Figure 5. ERα Associates with the Ire1α Upstream Locus in HSPCs (A) Metagene analysis

858 indentifying differentially expressed peaks in E2 treated HSPCs. (B) Homer motif analysis. Both

859 de novo (unsupervised) and supervised motif-identifying algorithms classified EREs as the most

860 enriched motif in E2-treated HSPCs. (C) Representative gene track of Ire1α with peaks

861 identified from ATAC-Seq. Three peaks were identified upstream of the Ire1α promoter (denoted

862 Peak 1, 2, and 3). Peak 2 was identified as differentially upregulated in E2 treated cells, and

863 contains a ERE motif (lower panel, purple) with one nucleotide mismatch with the consensus

864 ERE (shown in red). Primers were designed for each peak and are denoted P1, P2, and P3. (D)

865 Luciferase reporter assay. A 4kb genomic sequence of Ire1α regulatory elements containing

866 peaks 1-3 was cloned into pGL2 Basic plasmid. 293T cells were transfected with the reporter

867 plasmids, ERα expressing or an empty vector, and a control renilla luciferase plasmid. Cells

868 were treated with E2 for 20 hours and luciferase activity measured. A significant increase in the

869 luciferase activity was observed with the Ire1α construct in an E2- and ERα-dependent manner,

870 and this response was abolished by mutating the ERE. (n=4 independent experiments, 2

871 technical replicates per condition) ***, p<0.001; *, p<0.05, ANOVA (E) ChIP qPCR was

872 conducted for the 3 peaks identified by ATAC-Seq using primers shown in (C). y-axis represents

Chapple et al. Estrogen regulates UPR in HSCs 32 873 the relative value to percent input in Oil or E2 treated cells. (n = 4; 2 independent experiments, 2

874 biological replicate) **, p<0.01; Student’s t-test.

875

876 Figure 5 – figure supplement 1. Heatmaps of ATAC-seq peaks discovered in two biological

877 replicates of HSC samples isolated from oil- and E2-treated mice.

878

879 Figure 6. Estrogen Mitigates Proteotoxic Stress in HSPCs (A) Representative FACS plots of

880 Proteostat staining in LSK cells from mice subjected to various doses of radiation. (B)

881 Proteostat staining revealed that irradiation induces protein aggregation in all hematopoietic cell

882 types, and E2 reduces aggregation in immature progenitor cells. Mice were treated with oil or

883 E2 for 1 week followed by a single dose of radiation (IR: 400cGy) or unirradiated (ctrl), and

884 analyzed 16 hours later by flow cytometry (n=5, 3 independent experiments). *, p<0.05, two-way

885 ANOVA (C) c-kit+ progenitor cells were electroporated with Cas9 protein with sgRNAs against

886 either Rosa26 (R26) or three different sgRNAs against Ire1α. Cells were collected after 48 hours

887 and analyzed by immunoblotting. (D) Deletion of Ire1α by the CRISPR/Cas9 system sensitized

888 LSK cells to ER stressors. LSK cells from oil- or E2-treated mice were gene edited as in (C),

889 incubated overnight with ER stressors, and plated on semi-solid media for colony formation. (n

890 = 3 independent experiments) *, p<0.05, two-way ANOVA (E) 2,000 gene-edited LSK cells

891 (Rosa26 (n = 14, Oil; n = 14, E2) or Ire1α (n = 14, Oil; n = 11, E2; 4 independent experiments)

892 were transplanted into lethally irradiated recipients, followed by oil or E2 administration every

893 other day. Shown are blood counts 14 days after transplantation. *, p<0.05; ***, p<0.001;

894 Kruskal Willis with Dunn’s multiple comparisons test. (F) LSK and (G) myeloid progenitor (MP)

895 frequencies were measured in recipients of gene-edited LSKs. (n = 5, 2 independent

896 experiments) *, p<0.05, two-way ANOVA. In (E-G), Ire1α sgRNA 2+3 or 1+2+3 was used with

897 similar results. All data represent meanstandard deviation..

Chapple et al. Estrogen regulates UPR in HSCs 33 898

899 Figure 6 – figure supplement 1. Ire1α is Necessary for Hematopoietic Regeneration in E2

900 Treated Mice. (A) Representative Annexin V plots to identify apoptotic cells after exposure to

901 proteotoxic stressors. (B) Annexin V staining of LSK cells subjected to various ER stressors.

902 LSK cells from oil- or E2-treated mice were incubated overnight with either tunicamycin or

903 thapsigargin. Cells were collected and stained with Annexin V (n=5, 3 independent

904 experiments). Both tunicamycin and thapsigargin induced Annexin V, which was suppressed in

905 E2-treated LSK cells. *, p<0.05, Student’s t-Test (C) Colony assays of LSK cells isolated from

906 oil or E2-treated mice. 10,000 LSK cells were incubated overnight with ER stressors before

907 individually plated in 96-well plates. Fraction of cells that formed colonies 12 days later is shown

908 (n=6, Oil; n=5, E2, 4 independent experiments). ER stressors reduced clonogenicity, which was

909 mitigated in E2 treated cells. *, p<0.05; **, p<0.01; Mann Whitney U test. (D) Clonal analysis of

910 CRISPR editing efficiency. LSK cells were edited with dual sgRNAs for Ire1α, and single cells

911 were grown in methylcellulose medium. PCR amplicons from each clone were sequenced by

912 Sanger sequencing and traces were analyzed with the TIDE algorithm. Clones were identified

913 as either possessing deletion of genomic DNA between the predicted cutsites (blue), indels (red

914 = homozygous, orange = heterozygous, yellow = undetermined), or WT alleles (white). (E)

915 Gating strategy to analyze hematopoietic content in recipients of Rosa26- or Ire1α-edited LSKs.

916 (F) Representative FACS plots of Oil or E2 treated recipients of gene-edited LSKs. All data

917 represent mean±standard deviation.

918

919 Supplementary File 1. List of primers used for quantitative real-time PCR, ChIP-seq, and

920 sgRNA systhesis. All primers are listed in the 5’ to 3’ direction.

921

Chapple et al. Estrogen regulates UPR in HSCs 34 922 Materials and Methods

923 Mice: The mouse alleles used in this study were Ubc-GFP (C57BL/6-Tg(UBC-GFP)30Scha/J,

924 JAX Stock #004353) (Schaefer et al., 2001), Mx1-Cre (C.Cg-Tg(Mx1-cre)1Cgn/J, JAX Stock

925 #005673) (Kühn et al., 1995), Esr1fl (Singh et al., 2009), and ERAI (Iwawaki et al., 2004) on a

926 C57BL/6 background. Male mice were used for most experiments unless otherwise noted. Mice

927 were housed in AAALAC-accredited, specific-pathogen-free animal care facilities at Baylor

928 College of Medicine (BCM), or University of Michigan (UM) with 12hr light-dark cycle and

929 received standard chow ad libitum. All procedures were approved by the BCM (protocol #AN-

930 5858) or UM (protocol #PRO00007786) Institutional Animal Care and Use Committees.

931

932 Drug and chemical treatments: Mice were injected subcutaneously with 100 μl of corn oil

933 containing 2 μg estradiol (Sigma, St. Louis, MO) every day for 7 days unless otherwise noted.

934 Oil treated mice and E2 treated mice were caged separately. Poly I:C (Amersham, Piscataway,

935 NJ) was resuspended in PBS at 50 μg/ml, and mice were injected intraperitoneally with 0.5

936 μg/gram of body mass every other day for 6 days. To measure protein translation, mice were

937 injected intraperitoneally with 500 μg of puromycin (ThermoFisher Scientific, Waltham, MA) and

938 sacrified one hour later. To promote HSC activation and mobilization, mice were

939 intraperitoneally injected with 4 mg of cyclophosphamide (Bristol Myers Squibb, NY) on day -1,

940 and then injected subcutaneously on successive days with 5 μg of human G-CSF (Amgen,

941 Thousand Oaks, CA). Mice were sacrificed on day 3 or 6.

942

943 Radiation studies: 10- to 12-week-old male C57BL/6 mice were treated for 7 days with control

944 oil or E2 followed by whole body irradiation at 600 cGy TBI using a cesium-137 irradiator. PB

945 complete blood counts (CBC) were measured using a scil Vet abc Plus+ (scil Animal

946 Care/Henry Schein Animal Health, Gurnee, IL) every other day. For assessment of

947 hematopoietic content, 10- to 12-week-old male C57BL/6 mice were treated for 7 days with

Chapple et al. Estrogen regulates UPR in HSCs 35 948 control oil or E2 followed by whole body irradiation at 600 cGy TBI and were euthanized at one

949 or two weeks post-irradiation. For survival studies, 10- to 12-week-old C57BL/6 mice were

950 irradiated with 800 cGy TBI after E2 regimen. An IACUC-approved protocol (AN-5858) was

951 followed to monitor the survival of irradiated mice.

952

953 Transplantation: 10-12 week-old male C57BL/6 mice were randomly assigned to groups after

954 receiving two doses of radiation (500 cGy) administered at least three hours apart (total 1000

955 cGy). 100 GFP+ HSCs were co-transplanted with 2x105 GFP- WBM cells into each recipient

956 (total volume of 100ul; 1X HBSS, 2% heat-inactivated bovine serum). Injections were

957 administered via retroorbial injection. For secondary transplantation, similarly irradiated

958 recipients were injected with 2 million WBM cells from primary recipients (sacrificed at 16 weeks

959 post-transplantation).

960

961 Flow-cytometry and HSC isolation: Bone marrow cells were either flushed from the long

962 bones (tibias and femurs) or isolated by crushing the long bones (tibias and femurs), pelvic

963 bones, and vertebrae with mortar and pestle in Hank’s buffered salt solution (HBSS) without

964 calcium and magnesium, supplemented with 2% heat-inactivated bovine serum (GIBCO, Grand

965 Island, NY). Cells were triturated and filtered through a nylon screen (100 μm, Sefar America,

966 Kansas City, MO) or a 40μm cell strainer (Fisher Scientific, Pittsburg, PA) to obtain a single-cell

967 suspension. For isolation of CD150+CD48−/lowLineage−Sca-1+c-kit+ HSCs (Kiel et al., 2005;

968 Oguro et al., 2013), bone marrow cells were incubated with PE-Cy5-conjugated anti-CD150

969 (TC15-12F12.2; BioLegend, San Diego, CA), PE-conjugated (HM48-1; BioLegend) or PE-Cy7-

970 conjugated anti-CD48, APC-conjugated anti-Sca-1 (Ly6A/E; E13-6.7), and biotin-conjugated

971 anti-c-kit (2B8) antibody, in addition to antibodies against the following FITC-conjugated lineage

972 markers: CD41 (MWReg30; BD Biosciences, San Jose, CA), Ter119, B220 (6B2), Gr-1 (8C5),

973 CD2 (RM2-5), CD3 (KT31.1), and CD8 (53-6.7). For the isolation of GFP+ HSCs, the FITC

Chapple et al. Estrogen regulates UPR in HSCs 36 974 channel was left open and PE-conjugated lineage markers were used instead. For isolation of

975 CD34-CD16/32−Lineage−Sca-1-c-kit+ MEPs, CD34+CD16/32−Lineage−Sca-1-c-kit+ CMPs, and

976 CD34+CD16/32+Lineage−Sca-1-c-kit+ GMPs, bone marrow cells were incubated with FITC-

977 conjugated anti-CD34 (RAM34; eBiosciences, San Diego, CA), PE-Cy7 conjugated anti-

978 CD16/32 (93; Biolegend), PE-Cy5-conjugated anti-Sca-1 (Ly6A/E; E13-6.7), and biotin-

979 conjugated anti-c-kit (2B8) antibody, in addition to antibodies against the following PE-

980 conjugated lineage markers: Ter119, B220 (6B2), Gr-1 (8C5), Mac-1 (M1/70), CD2 (RM2-5),

981 CD3 (KT31.1), and CD8 (53-6.7). Unless otherwise noted, antibodies were obtained from

982 BioLegend, BD Biosciences, or eBioscience (San Diego, CA). Biotin-conjugated antibodies

983 were visualized using streptavidin-conjugated APC-Cy7. HSCs were sometimes pre-enriched by

984 selecting c-kit+ cells using paramagnetic microbeads and autoMACS (Miltenyi Biotec, Auburn,

985 CA). Nonviable cells were excluded from sorts and analyses using the viability dye 4',6-

986 diamidino-2-phenylindole (DAPI) (1 μg/ml). To analyze hematopoietic lineage composition, bone

987 marrow cells or splenocytes were incubated with PerCPCy5.5-conjugated anti-B220, PE-

988 conjugated anti-Ter119, APC-conjugated anti-CD3, APC-eFluor780-conjugated anti-Mac-1

989 (M1/70), and PE-Cy7-conjugated anti-Gr-1 antibodies. Annexin V staining was performed using

990 Annexin V APC (BD Biosciences). For analysis of aggregated proteins, hematopoietic cells

991 were stained with anti-c-kit, Sca-1, and lineage antibody mix and then fixed in Cytofix/Cytoperm

992 Fixation and Permeabilization Solution (BD Biosciences) for 30 minutes. Fixed cells were then

993 stained with the ProteoStat dye (1:10,000 in permeabilization solution) at 25°C for 30 min (Enzo

994 Life Sciences, Farmingdale, NY). To measure protein translation in HSCs, bone marrow cells

995 were stained for HSC markers, and then fixed/permeabilized using BD Cytofix/Cytoperm

996 solution. Cells were incubated with anti-puromycin antibody (12D10, Millipore, Billerica, MA)

997 diluted in BD Perm/Wash Buffer (BD Biosciences) at 1:200 for one hour at room temperature.

998 Cells were washed once and incubated with Alexa Fluor 633-conjugated anti-mouse IgG2a

999 antibody (ThermoFisher Scientific, Waltham, MA) for 30 minutes at room temperature, washed

Chapple et al. Estrogen regulates UPR in HSCs 37 1000 once, and stained with DAPI before analyzing by flow cytometry. Flow cytometry was performed

1001 with FACSAria II, FACSCanto II, LSR II, or LSRFortessa flow-cytometers (BD Biosciences).

1002

1003 Quantitative real-time (reverse transcription) PCR: HSCs and other hematopoietic cells were

1004 sorted into Trizol (Life Technologies, Carlsbad, CA) and RNA was isolated according to the

1005 manufacturer's instructions. cDNA was made with random primers and SuperScript III reverse

1006 transcriptase (ThermoFisher Scientific, Waltham, MA). Quantitative PCR was performed using a

1007 ViiA7 Real-Time PCR System (ThermoFisher Scientific, Waltham, MA). Each sample was

1008 normalized to β-actin. Data were analyzed using the 2-ΔΔct method. Primers to quantify cDNA

1009 levels are listed in Supplementary File 1. Analysis of spliced:unspliced XBP1 ratios were

1010 conducted with the Taqman probes spliced XBP1 5’ 6-

1011 FAM/TGCTGAGTC/ZEN/CGCAGCAGGTGCA/IABkFQ-3’ and unspliced XBP1 5’-

1012 HEX/CGCAGCACT/ZEN/CAGACTATGTGCACC/IABkFQ-3’. As an endogenous control, the

1013 Gapdh primer and probe assay (Applied Biosystems, ID no. Mm99999915_g1) was used.

1014 cDNA was amplified using TaqMan Universal PCR Master Mix Kit (ThermoFisher Scientific,

1015 Waltham, MA) according to the manufacturer’s instructions.

1016

1017 RNA-seq: HSCs were sorted into Trizol and RNA purified according to the manufacturer's

1018 instructions. DNase I treated RNA samples were amplified using the NuGEN Ovation RNA-Seq

1019 System (NuGEN, San Carlos, CA), and cDNA fragmented using a Covaris Ultrasonicator

1020 (Covaris, Woburn, MA). Fragmented cDNA was assembled into a sequencing library using

1021 KAPA Library Preparation Kit for Ion Torrent (KAPA Biosystems, Wilmington, MA) and

1022 sequenced on an Ion Proton Sequencer (ThermoFisher Scientific, Waltham, MA). Reads

1023 obtained from Ion Torrent sequencing were mapped to mm10 using STAR (version 2.5.2b

1024 (Dobin and Gingeras, 2016)), which was followed by differential expression analysis using

1025 DESeq2 (version 1.12.4 (Love et al., 2014)). Pairwise GSEA (GSEA, version 2.2.1

Chapple et al. Estrogen regulates UPR in HSCs 38 1026 (Subramanian et al., 2005)) was performed, combinatorially, on the lists of differentially

1027 expressed genes derived from each comparison.

1028

1029 ATAC-seq: ATAC-seq library was performed essentially as described in Buenrostro et al.

1030 Nature Methods 2013, with some modifications. 5000 HSCs were sorted and incubated in

1031 100ul lysis buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.1% NP-40) for 3

1032 min on ice. Immediately after lysis, the lysis buffer was removed by spinning at 500 x g for 5

1033 min with 4oC table-top centrifuge. The nuclei pellet was then resuspended in 10ul of

1034 transposase reaction mix (2ul 5xTAPS buffer (50mM TAPS-NaOH, 25mM MgCl2 (pH8.5)),

1035 0.5ul home-made Tn5 (0.885 mg/mL), 7.5ul of nuclear free water). The transposase

1036 reaction was incubated at 37oC for 30 min, and then stopped by adding 5ul of 0.2% SDS for

1037 5 min at room temperature. The whole transposase reaction was then purified by the

1038 application of ZYMO DNA purification kit. Tagmentated DNA was eluted in 10ul nuclease

1039 free water, and a half of the elution volume was then used for PCR enrichment reaction with

1040 NEBNext® Q5® Hot Start HiFi PCR Master Mix (NEB M0543S). The library amplification

1041 reaction included 25ul of 2x Q5 master mix, 5 ul of tagmentated DNA template, 2.5ul of

1042 25uM PCR primer 1 (final conc. 1.25uM), 2.5ul of 25uM barcoded PCR primer (final conc.

1043 1.25uM) (all primers from SIGMA), 15ul of nuclear free water. PCR protocol was 5 min at

1044 72oC, 30 sec at 98oC, and then n cycles of 10 sec at 98oC, 30 sec at 63oC, 1 min at 72oC,

1045 where “n” was determined by qPCR with SYBRGreen to reduce GC and size bias. After

1046 that, the library was purified using SPRI beads and eluted in 20ul of nuclear free water (the

1047 final concentration ~ 30nM). Libraries were sequenced on the Illumina HiSeq 2000

1048 platform. Reads were mapped to mm10 using Bowtie2 (Version: 2.2.6), and peaks were

1049 called on each sample individually using MACS2 (Version: 2.1.0.20151222). Differential

1050 peaks were obtained on overlapping peaks using PePr (Version: 1.1.18). Heatmaps were

1051 generated using deepTools computeMatrix algorithm whereby the center each location

Chapple et al. Estrogen regulates UPR in HSCs 39 1052 (from BED file) was used as the reference point and was extended ± 5kb from the center

1053 point.

1054

1055 HSC culture and differentiation assays: For CFU assays, single freshly isolated HSCs from

1056 control and E2-treated Esrfl/fl and Esrfl/fl; Mx1-Cre mice were plated into 96-well plates containing

1057 M3434 MethoCult methylcellulose media (StemCell Technologies, Cambridge, MA). Colonies

1058 were collected, washed, and cytospun onto glass slides followed by Wright-Giemsa staining.

1059 For megakaryocyte differentiation assays 24 single HSCs were sorted directly into serum free,

1060 phenol red free medium (X-Vivo 15, Lonza, Allendale, NJ) supplemented with 50 ng/ml of SCF

1061 and TPO, and 10 ng/mL IL-3 and IL-6 (all from Peprotech, Rocky Hill, NJ), and cultured for three

1062 days. Following brief culture, the contents of all wells were combined and plated on collagen-

1063 based MegaCult media (StemCell Technologies, Cambridge, MA) in duplicate. 10 days after

1064 plating, collagen slides were dehydrated and stained for cholinesterase activity per the

1065 manufacturer’s instructions. Analysis of chemically-induced UPR was performed by sorting

1066 freshly isolated LSK cells (1 x 104) into X-Vivo 15 supplemented with 1% FBS, 50ng/mL SCF

1067 and TPO, and 10ng/mL IL-3 and IL-6. Cells were incubated for 16 hours in 5% CO2 with

1068 combinations of vehicle (ethanol, final concentration 0.1%), E2 (200 μM), DMSO (final

1069 concentration 0.001%), tunicamycin (0.6 μg/ml in DMSO), and thapsigargin (4 nM in DMSO).

1070 Cells were collected, washed, and plated on methylcellulose media for CFU assays.

1071

1072 Immunohistochemistry: Femurs from control and E2-treated mice were fixed overnight in 4%

1073 paraformaldehyde and then decalcified in 10% EDTA for 3-4 days, embedded in 8% gelatin to

1074 prepare 6 μm sections. Slides were incubated with rat anti-CD41 antibody (eBioscience, San

1075 Diego, CA) diluted 1:500 in blocking buffer (4% goat serum, 0.4% BSA, 0.1% NP-40 in PBS)

1076 overnight at 4 °C. Slides were rinsed and incubated with Alexa Fluor 488-conjugated goat anti-

Chapple et al. Estrogen regulates UPR in HSCs 40 1077 rat antibody (ThermoFisher Scientific, Waltham, MA) at 1:500 dilution in blocking buffer

1078 containing DAPI. Images were obtained using a Leica DMI 6000B microscope.

1079

1080 Immunoblotting: Immunoblotting was performed as described previously (Nakada et al., 2010).

1081 Briefly, the same number of cells (20,000-30,000) from each test population were sorted into

1082 Trichloroacetic acid (TCA) and adjusted to a final concentration of 10% TCA. Extracts were

1083 incubated on ice for 15 minutes and spun down for 10 minutes at 13,000 rpm at 4°C. The

1084 supernatant was removed and the pellets were washed with acetone twice then dried. The

1085 protein pellets were solubilized with Solubilization buffer (9 M Urea, 2% Triton X-100, 1% DTT)

1086 before adding LDS loading buffer (Invitrogen, Carlsbad, CA). Proteins were separated on a Bis-

1087 Tris polyacrylamide gel (ThermoFisher Scientific, Waltham, MA) and transferred to a PVDF

1088 membrane (Millipore, Billerica, MA). Antibodies were anti-Ire1α (Cell Signaling Technology,

1089 3294), anti-Xbp1s (Biolegend, Poly6195), and anti-ß-actin (A1978, Sigma).

1090

1091 Cell lines: 293T cells were obtained from ATCC (CRL-3216) and were tested negative for

1092 mycoplasma contamination.

1093

1094 Luciferase assay: Approximately 4kb upstream of the Ire1α TSS was cloned into pGL2 Basic.

1095 ERα was expressed from pcDNA-HA-ER WT (Addgene #49498). 293T cells were transfected

1096 with the indicated combination of the plasmids in OptiMEM (Invitrogen, Carlsbad, CA). 6 hours

1097 after transfection, the media was replaced with phenol red free X-vivo15 media supplemented

1098 with 10% charcoal-stripped FBS (Invitrogen, Carlsbad, CA). Cells were treated with or without

1099 10-7M of E2 dissolved in ethanol for 20 hours before cells were harvested for luciferase activity

1100 measurement performed according to the manufacturer’s instruction (Promega, Madison, WI).

1101

Chapple et al. Estrogen regulates UPR in HSCs 41 1102 ChIP assay: Cells were fixed with 1% paraformaldehyde for 10 minutes at room temperature.

1103 125 mM glycine was then added and incubated at room temperature for 5 minutes. Cells were

1104 collected at 500 x g for 10 minutes at 4°C and washed twice with PBS. The pellet was lysed in

1105 Nuclear Lysis Buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1% SDS, 1x protease inhibitors

1106 (Roche) for 20 minutes on ice. Samples were then diluted with PBS to bring SDS concentration

1107 to 0.25% and sonicated in a Bioruptor for 23 minutes (settings: High, 30 seconds on and 30

1108 seconds off). Lysates were diluted 1:1.5X with equilibration buffer (10mM Tris, 233 mM NaCl,

1109 1.66 % TritonX-100, 0.166 % sodium deoxycholate, 1 mM EDTA, inhibitors) and centrifuged at

1110 14,000 x g, 4°C for 10 minutes. Supernatant was transferred to a new tube (10% of the sample

1111 was saved as input). ERa (ab32063, Abcam, Cambridge, MA) and IgG antibodies were added

1112 to the lysate and incubated at 4°C overnight. Protein A/G Dynabeads (ThermoFisher Scientific)

1113 were added to the chromatin and incubated for 2 hours at 4°C. Beads were washed

1114 subsequently with RIPA-LS (10 mM Tris-HCl/pH 8.0, 140 mM NaCl, 0.1% SDS, 1% Triton X-

1115 100, 1 mM EDTA, 0.1% sodium deoxycholate) for 3 times, RIPA-HS (10 mM Tris-HCl/pH 8.0,

1116 500 mM NaCl, 0.1% SDS, 1% Triton X-100, 1 mM EDTA, 0.1% sodium deoxycholate) for 3

1117 times, RIPA-LiCl (10 mM Tris-HCl/pH 8.0, 1 mM EDTA, LiCl 250mM, 0.5% NP-40, 0.5% sodium

1118 deoxycholate) for 3 times, and 10 mM Tris-HCl, pH 8.0 for 3 times, after of which samples were

1119 transferred to a new tube. Beads were then incubated with 50 μl elution buffer (0.5% SDS, 300

1120 mM NaCl, 5 mM EDTA, 10 mM Tris HCl pH 8.0) containing 2 μl of 10 mg/ml Proteinase K for 1

1121 hour at 55°C and 8 hours at 65°C to reverse crosslink, and supernatant was transferred to a

1122 new tube. Another 20 μl of elution buffer and 1 μl of Proteinase K were added to the beads and

1123 incubated for 1h at 55°C, and the supernatants were combined. Finally, DNA was purified with

1124 SPRI beads and used for qPCR with primers listed in Supplementary File 1.

1125

1126 CRISPR/Cas9-mediated genome editing: Genome editing was performed essentially as

1127 described previously (Gundry et al., 2016). Briefly, protospacer sequences for each target gene

Chapple et al. Estrogen regulates UPR in HSCs 42 1128 were identified using the CRISPRscan algorithm (www.crisprscan.org). DNA templates for

1129 sgRNAs were made in a PCR reaction using a forward primer containing a T7 promoter, a

1130 reverse primer specific for the 3’ end of the improved scaffold, and pKLV-U6gRNA-EF(BbsI)-

1131 PGKpuro2ABFP plasmid (Addgene # 62348). c-kit+ or LSK cells were isolated by MACS or

1132 FACS, respectively, and cultured in X-Vivo 15 (Lonza, Allendale, NJ) supplemented with 50

1133 ng/ml of SCF and TPO, and 10 ng/mL IL-3 and IL-6 (all from Peprotech, Rocky Hill, NJ) for 1

1134 hour. 1x104 to 1x105 c-kit+ cells or 5x104 LSK cells were resuspended into 10 μl of Buffer T

1135 (Invitrogen), mixed with 1 μg sgRNA and 1 μg Cas9 protein (PNA Bio), and electroporated using

1136 a Neon transfection system (ThermoFisher Scientific) using the following parameters; 1700V,

1137 20ms, 1 pulse. After overnight culture in X-Vivo media, live cells were sorted and used for

1138 subsequent experiments. For clonal analysis of editing efficiency, single LSK cells were sorted

1139 into M3434 MethoCult methylcellulose media (StemCell Technologies, Cambridge, MA) after

1140 electroporation. Colonies were collected 12 days later, and purified genomic DNA was

1141 sequenced via Sanger sequencing. Indels were quantified using the TIDE deconstruction

1142 algorithm (Brinkman et al., 2014). See Supplementary File 1 for oligo sequence.

1143

1144 Quantification and Statistical Analysis: Statistical analyses were performed using GraphPad

1145 Prism 5.0c (GraphPad Software Inc., San Diego, CA). To ensure the reproducibility of our

1146 findings, all data were derived from multiple independent experiments performed on different

1147 days. Sample sizes were chosen based on observed effect sizes and standard errors from

1148 previous experiments, and data was checked for normality and similar variance between

1149 groups. Only males were used in these studies, and all experimental units were age-matched.

1150 In the case of investigating ERα deletion, untreated floxed littermates were used as controls.

1151 Animal studies were performed without blinding. To test statistical significance of the means of

1152 two samples, two-tailed Student’s t tests or Mann Whitney U Tests were performed. Statistical

1153 significance of multiple groups was evaluated with a two-way ANOVA or repeated measures

Chapple et al. Estrogen regulates UPR in HSCs 43 1154 ANOVA followed by Bonferroni’s test for multiple comparisons. Analysis of three or more

1155 groups with unequal sample sizes was conducted using the Kruskal-Wallis H Test followed by

1156 Dunn’s multiple comparisons test. Survival curves were tested for statistical significance with a

1157 log-rank test. A p-value of less than 0.05 was considered significant. Values are reported as

1158 mean ± SD unless stated otherwise.

1159

1160 Data and Software Availability: The accession number for the RNA sequencing data reported

1161 in this paper is GSE99120. The accession number for the ATAC-seq data is PRJNA429672.

1162

1163

1164

Chapple et al. Estrogen regulates UPR in HSCs 44 C B A J I H E D

Reconstitution (%) 100 Colony Formation (%)

Reconstitution (%) 100 100 20 40 60 80 50 20 40 60 80 0 0 0 Oil i 2OlE2 Oil E2 Oil 12 8 4 12 8 4 WT Oil(ER E2(ER E2 Oil *** *** Red bloodcells α α Overall Weeks Weeks Δ/Δ Δ/Δ ) ) ER CD41 DAPI α * Δ/Δ † Oil 16 16 e m M gm gme gmM gemM * G F 100 100 20 40 60 80 20 40 60 80 0 0

Total colonies 100 12 8 4 12 8 4 50 0 i 2OlE2 Oil E2 Oil Myeloid cells WT * Weeks Weeks -el T-cells B-cells * E2 * ER α Δ/Δ 16 16 * Meg Mixed Non 100 100 20 40 60 80 20 40 60 80 0 0

+ 2 12 8 4 12 8 4 CD41 cells/mm 120 40 80 0 E2 *** Platelets i E2 Oil Weeks Weeks Figure 1 *** *** *** 16 16 A D

SSC Overall Myeloid 100 ** 100 * * * * 80 80 * FSC DAPI 60 60 LSK Oil c-Kit

CD48 40 40 Lineage

Reconstitution (%) Oil 20 20 MPP HSC E2 c-Kit Sca-1 CD150 0 0 E2 4 8 12 16 4 8 12 16

c-Kit Weeks Weeks CD48 Lineage Platelets Red blood cells 100 100 c-Kit Sca-1 CD150 * * B 80 80

CSS PFG

911reT RBC 60 60

40 40

FSC CD41 Ter119 20 20

911reT PFG 0 0 Platelet 4 8 12 16 4 8 12 16 Weeks Weeks B-cells T-cells CD41 CD41 100 * 100

C 80 80

1rG 022B CSS * B Cell Myeloid 60 60

T Cell 40 40 FSC DAPI Mac1 CD3 **

CSS Myeloid B Cell T Cell 20 20

0 0 4 8 12 16 4 8 12 16 Weeks Weeks

GFP Figure 1 - figure supplement 1 ABCPlatelet WBC RBC 1500 20 15 Oil E2

* * * *

3 3 * 15 3 1000 * m 10

* m/

/mm /mm 3 3 10

* * 6

01 10 500 * 10 * 5 5 * * * 0 0 0 0 4 8 12 16 20 24 0 4 8 12 16 20 24 0 4 8 12 16 20 24 Days Post TBI Days Post TBI Days Post TBI

DEFPlatelet WBC RBC

*** ***

1000 3

3 4 8

m

3

m/

/mm

6

3 /mm 500 01

3 2 4

10 10

0 0 0 Oil E2 Oil E2 Oil E2 Oil E2 Oil E2 Oil E2 wild-type ERα Δ/Δ wild-type ERα Δ/Δ wild-type ERα Δ/Δ GH 100 100

** E2 (n=7) 50 50 * Female (n=9) Survival (%) Survival (%) Oil (n=9) Male (n=10) 0 0 0 10 20 30 0 10 20 30 Days Days

Figure 2 Ubc-GFP

Peripheral Blood Sampling - CBC Vehicle -or- E2 Day -7 0 14 24 600 cGy WBM Transplant HSPC Quantification

Figure 2 - figure supplement 1 ABCBM Cellularity LSK Frequency Total LSKs 8 107 ** 0.20 40 **

* * Oil 4 107 0.10 20 E2 * Cell counts Cell counts (x1000) 0 % of live cells in BM 0.00 0 3 5 7 14 3 5 7 14 3 5 7 14 Days Post TBI Days Post TBI Days Post TBI

D Unirradiated Oil+IR E2+IR 60 Overall60 Myeloid cells60 Platelets

40 40 40

* ** * 20 20 20 * * * * Reconstitution (%) * *

0 0 0 4 8 12 16 4 8 12 16 4 8 12 16 Weeks Weeks Weeks

60 Red blood cells60 B-cells60 T-cells

40 40 40

** 20 * * 20 20 Reconstitution (%)

0 0 0 4 8 12 16 4 8 12 16 4 8 12 16 Weeks Weeks Weeks EFG*** 15 0.2 1000 ** *** ) 7

10 * 100 ** ** 0.1 5 10 LSK frequency (%) BM cellularity (x10 LSK numbers (x1000) 0 0 1 OilE2 Oil E2 Oil E2 OilE2 Oil E2 Oil E2 OilE2 Oil E2 Oil E2 WTWT ERα Δ/Δ WTWT ERα Δ/Δ WTWT ERα Δ/Δ Un IR Un IR Un IR Figure 3 A F G MP Frequency Total MPs

)0001x( stnuoc lleC stnuoc )0001x( 150

SSC-A 0.6

Lineage ** Oil Oil 0.4 E2 100 E2 FSC-A Sca-1 Unirradiated Oil E2 0.2 50 MP LSK c-Kit % of live cells in BM 0.0 0 3 5 7 14 3 5 7 14 Days Post TBI Days Post TBI Sca-1 H ** MP Frequency LSK Frequency 0.4 BCns *** *** * 1.0 0.25 0.3

0.8 0.20 Oil 0.2 0.6 E2 0.15

0.4 0.10 0.1

0.2 0.05 Myeloid progenitor freq. (%)

% of live cells in BM % of live cells in BM 0 0.0 0.00 Oil E2 Oil E2 Oil E2 ctrl IR ctrl IR WTctrl WT IR ERα Δ/Δ IR I D E BM Cellularity Total LSK Numbers 10 ** * 1.5 *** * *** * * 8 ) 8 300 1.0 6 200 Oil 4 E2 0.5 20 2 Cell counts (x10 10 Cell counts (x1000)

0.0 0 AnnexinV Positive Percentage 0 ctrl IR ctrl IR ctrl Day 3 Day 5 Post TBI Post TBI Figure 3 - figure supplement 1 AB NES 0 1 2 3 4 5 3 Myc targets (p<0.001) E2F targets (p<0.001) G2M checkpoint (p<0.001) # 0 OXPHOS (p<0.001) Unfolded Protein Response (p=0.017) Adipogenesis (p=0.025) -2 Glycolysis (p=0.022) mTORC1 signaling (p=0.043)

C Cumulative ES WT Oil WT E2 WT KO Oil KO E2 -6 0 6 WT Oil

WT E2

KO Oil WT_E2_1 WT_E2_2 KO_E2_1 WT_Oil_1 KO_Oil_1 WT_Oil_2 KO_E2_2 KO_Oil_2

Hallmark: UPR KO E2

-1.5 1.5 DE F ** 2 0.8 40 Oil * Oil * E2 * E2 * 30 0.6 Ern1 20 1 0.4

Fold change 0.2

FPKM of 10 Xbp1s:Xbp1u ratio 0 0 0 Oil E2 Oil E2 WT KO WT KO WT KO WT KO WT KO WT KO wild-type ERα Δ/Δ WBM MPP HSC WBM MPP HSC G H HSC 100 neg Oil ERAI *** E2 HSC/MPP HPC WBM Oil 16 E2 Oil E2 Oil E2 Oil E2 ** Ire1α

8 Xbp1s % of Max

β-actin 0 0 + -

Fold change in ERAI signal Lin Lin MPP HSC ERAI Figure 4 A Ire1a BDTipinC Tyms Ccna2 ** 3 ** 1.5 * * 1.5 * * 2.0 * *

2 1.5 1.0 1.0 1 1.0 Fold Change 0 0.5 0.5 0.5 EtOH 100uM 250uM a a a E2 E2 sgRosa26 sgIre1 sgRosa26 sgIre1 sgRosa26 sgIre1 E Pole3F Hmga1GH Aimp2 Cdkn2c * * * * * * 1.5 1.5 1.5 1.5

1.0 1.0 1.0 1.0 Fold Change 0.5 0.5 0.5 0.5 sgRosa26 sgIre1a sgRosa26 sgIre1a sgRosa26 sgIre1a sgRosa26 sgIre1a

I Thbs1 Selp J Ern1 20 20 *** Oil * Slc7a5 E2 Npm1 Iars 10 10 Spcs3 FPKM Cks1b 0 0 Asns WT KO WT KO Eif2s1 Gp9 Sec11a Rhag Exoc2 60 **8 * Cxxc1 Ifit1 40 Hspa9 4 Banf1

FPKM 20 Edem1 0 0 Serp1 WT KO WT KO Atp6v0d1 Spcs1 Xpot K Hspa9 Khsrp Hspa1b 7 Vegfa Vegfa Lsm1 Pdia5 Aldh18a1 Hsp90aa1 Eif4a1 Dnaja1 Eef2 4.5 Hspa8 0.8 Pdia5 Ern1 Edc4 Ifit1 Slc7a5 Nop56 Exosc9 Exosc10 -0.75 Lsm1 H2afx Dnajc18 Exosc9 Spcs1 Psat1 Sec11a Oil E2 Oil E2 Figure 4 - figure supplement 1 A CD48-/low LSKs B Ire1a Expression ** ** ** NEG LO HI 2 Oil 1 E2 # cells Fold Change 0 CD150 HI LO NEG C F Ire1a Levels 3 CHOP PERK Atf6 4 ** Oil HSC ** E2 2 WBM ns ns 3 ns 1 2 Fold change

0 Fold Change WT KO WT KO WT KO 1

D Puro Incorporation 0 *** *** PBS 100µg 200 µg PBS 100 µg 200µg 6 3 G 3 2 ns G-CSF PBS HSC * * G-CSF BM HSC 1 2 G-CSF SP HSC

Fold Change (MFI) 0 Normalized to Oil HSC

WBM MPP HSC 1

E 6 Ire1a 6 PERK Abundance Relative PBS 4 4 0 G-CSF 2 2 4 Poly(I:C) PBS 0 0 * * 100µg Poly(I:C) Atf6 CHOP 3 *** *** 200µg Poly(I:C) 6 6 2 * 4 4 Fold Change from WT BM Fold Change from WT 2 2 1 Relative Abundance Relative

0 0 0

WBM WBM Hspa9 Hspa8 Dnaj1 Hspa1b Dnajc18 Hsp90aa1 BM HSC SP- Day HSCSP 3 -HSC Day -3 Day 6 BM HSC SP- Day HSCSP 3 -HSC Day -3 Day 6 Figure 4 - figure supplement 2 A B Differentially Regulated ATAC-Seq Peaks Motif p value % Targets 40 ERα T 1e-11 14.6% Oil GC T A CG TA GCT A CG T AGCT A CG AGC T A CG TA GC T A CG T A E2 30 A G 1e-9 33.3% CT Hic1 G de novo C CT G A T G C T A C A GA G C T A C T A T A GGTTACAGTCGC Myf6 A A 1e-8 8.3% 20 CG T ACG T ACG T ACG T AGCT A CG T GC T A CG T CG T A CG T A CG T A CG T A A CG C CG α A GTC ER G T A A 1e-3 18.8% GT C CA T T AAT AATT T T G C GCC C A C GCT G AG GA CG G T T C AAT 10 G A TG C C Runx GA G 1e-3 27.1% A A A Supervised T T TCG GCT GC T AGCT A CG T A GC T ACG T A CG T AC 0 CA AAC ATA GTA Runx2 G G TCT 1e-2 29.2% CCC

T AG T A G T A CG T G T A CG T Peak Center GTG -5kb +5kb T CCACACGG C 4kb Ern1

8 Oil 0 8 E2 0

D Luciferase Reporter Assay E ChIP qPCR *** 2.0 * 10 ** Oil Vehicle 8 1.5 E2 E2 6 P1 P2 P3 1.0

% input ns 4 ns 0.5 2

TTACAGGGTCACTGTGACATTTGAA Relative Luciferase Intensity 0.0 0 Neg Control Ern1(-4kb) Ern1(mut) GGTCAnnnTGACC P1 P2 P3 ERα - - + + - - + + - - + + Figure 5 Oil E2 -5kbpeak +5kb center

Figure 5 - figure supplement 1 AB 3 100 LSK Oil E2 0 Gy 2 Gy * * * 4 Gy 2

% of Max 1

0 0 ctrl IR ctrl IR ctrl IR Proteostat WBM MP LSK Fold change in Proteostat signal C D 80 Oil E2 Ire1α * * sgRNAR26 1 2 3 2+3 1+2+3 R26 60

Ire1α 40

β-actin 20 Colony formation (%)

0 R26 Ire1α R26 Ire1α R26 Ire1α DMSO Tunicamycin Thapsigargin

E WBC RBC Platelets * * *** * * 8 10 600

6 8 3 3 3 400 6 /mm /mm /mm

4 3 3 6

4 10 10 10 200 2 2

0 0 0 Oil E2 Oil E2 Oil E2 Oil E2 Oil E2 Oil E2 sgR26 sgIre1α sgR26 sgIre1α sgR26 sgIre1α F G 0.08 LSK 0.20 MP * * 0.06 0.15

0.04 0.10

0.02 0.05 % of Live BM Cells % of Live BM Cells 0.00 0.00 Oil E2 Oil E2 Oil E2 Oil E2 sgR26 sgIre1α sgR26 sgIre1α Figure 6 C A SSC-A FSC-A E E2 Oil Colony formation (%) 20 40 60 80

0 SSC S- AIFSC-A DAPI SSC-A MOTncmcnThapsigargin Tunicamycin DMSO GFP 0.1 . . 0.9 0.6 0.4 i 2OlE i E2 Oil E2 Oil E2 Oil FSC MOTncmcnThapsigargin Tunicamycin DMSO

Lineage ** SSC AnnexinV ** . 2.7 1.9 0.0 c-Kit Unstained *

c-Kit FSC-H MP Unirradiated Control LSK * Sca-1 D B

Figure 6-figure supplement 1 Annexin V+ (%) 0 2 4 6 8 Rosa26 F sgRNA sgRNA Ire1 i 2OlE i E2 Oil E2 Oil E2 Oil E2 Oil MOTncmcnThapsigargin Tunicamycin DMSO

α sgRNA2

sgRNA3 * C5 C2 C1 C6 C7 C23 C3 C14 C17 C4 C13 C16 C22 C20 C10 C11 C9 C12 C8 C15 C19 C18 C21 C24 Oil * * Indel (Hom) Indel (Het) Indel (Un) Deletion WT * E2