Supplementary Figure S1. Western blot analysis performed with anti NICD and anti

Hsp70 of protein extract from cultures of GBM TICs cells derived from PT2. Cells were treated for the indicated time period with 0.1% (v/v) DMSO (vehicle) or with 7.5 µM DAPT or LLNle. Equal amount of total proteins were loaded in each lane and after blotting the membrane was stained using Ponceau Red to show integrity of total protein pattern and loading before challenging it with specific antibodies.

Supplementary Figure S2. Western blot analysis performed with anti NICD and anti

Hsp70 of protein extract from cultures of GBM TICs cells derived from PT3. Cells were treated for the indicated time period with 0.1% (v/v) DMSO (vehicle) or with 7.5 µM DAPT or LLNle. Equal amount of total proteins were loaded in each lane and after blotting the membrane was stained using Ponceau Red to show integrity of total protein pattern and loading before challenging it with specific antibodies.

Supplementary Figure S3. Flow cytometric analysis of GBM TICs derived from PT2 and

PT3 after 48 hours treatment with 0.1% (v/v) DMSO (vehicle) or with 7.5 µM LLNle. Cells were labeled with Sytox Green, Resorufin and Allophycocyanin (APC)-conjugated Annexin

V.

Supplementary Table S1. Probe sets ID, with relative gene symbols or Ensembl

Transcript ID, significantly regulated in the comparison between the LLNle-treated samples and either DAPT-treated samples or control samples (DMSO), as determined by using SAM

1 software with multi-class analysis. The false discovery rates expressed as q-values, with a

threshold set at 0.02 (2%), were calculated using the two-class, unpaired, option with the

additional requirement of at least a 2-fold change in gene expression.

Supplementary Table S2. Expression values for NOTCH target genes as determined by

microarray experiments for PT1-3 GBM TICs.

Supplementary Table S3. Sequences accession numbers and primers used for Real-Time

validation experiments.

Supplementary Figure S4. Survival curves of GBM TICs cells derived from PT1 are

based on the results of MTT assays after continuous exposure to L-685,458 for 48 hours.

Average values from at least three independent experiments are shown; bars represent s.d.

Concentration (v/v) for DMSO (vehicle), solid line, were: 1) 0.0012%; 2) 0.0062%; 3)

0.0312%; 4) 0.1562%; 5) 0.781%; 6) 3.905%. Concentration for L-685,458, dashed line, were: 1) 0.125 µM; 2) 0.625 µM; 3) 3.125 µM; 4) 15.625 µM; 5) 78,125 µM; 6) 390.5 µM.

Supplementary Figure S5. Western blot analysis performed with anti NICD of protein

extract from cultures of GBM TICs cells derived from PT1. Cells were treated for 48 hours

with L-685,458 at the indicated concentration and with DMSO (vehicle) 0.1563% (v/v),

corresponding to its highest amount present in the highest concentration point of L-685,458

used. Equal amount of total proteins were loaded in each lane and after blotting the

2 membrane was stained using Ponceau Red to show integrity of total protein pattern and loading before challenging it with specific antibodies. Protein standard markers are indicated by arrow heads on the right along with their mass values expressed in kDa.

Supplementary Figure S6. Western blot analysis performed with anti poly- ubiquitinylated proteins of protein extract from cultures of GBM TICs cells derived from

PT1. Cells were treated for 48 hours with lactacystin at the indicated concentration and with

H2O (vehicle) 0.486 % (v/v), corresponding to its highest amount present in the highest concentration point of lactacystin used 145.8 μM (IC50). Equal amount of total proteins were loaded in each lane and after blotting the membrane was stained using Ponceau Red to show integrity of total protein pattern and loading before challenging it with specific antibodies.

Protein standard markers are indicated by arrow heads on the right along with their mass values expressed in kDa.

3 Supplementary Table S1. Probe sets ID, with relative gene symbols or

Ensembl Transcript ID, significantly regulated in the comparison between the LLNle- treated samples and either DAPT-treated samples or control samples (DMSO), as determined by using SAM software with multi-class analysis. The false discovery rates expressed as q-values, with a threshold set at 0.02 (2%), were calculated using the two-class, unpaired, option with the additional requirement of at least a 2-fold change in gene expression.

24 hours treatment LLNle Vs LLNle Vs Probe Set ID Gene Symbol / Ensembl Transcript ID DMSO DAPT q-value (%) 7897449 SPSB1 2.3599067 2.5711584 1.9702636 7901915 ALG6 0.45973688 n.r. 1.9702636 7901951 PGM1 0.49271646 n.r. 1.3689176 7902512 DNAJ B4 6.963524 6.7168655 0 7905789 IL6R 2.1934297 2.123782 1.0811833 7909610 ATF 3 2.2410047 n.r. 1.9493774 7914530 BSDC1 2.203361 2.0631323 0.7932046 7918284 TAF 13 2.6542354 2.6685581 0.49925232 7919645 SV2A 0.44014212 0.46151212 0 7920839 RIT1 2.765849 2.666029 1.0743405 7922610 ABL2 3.0071342 3.1817927 0.9868941 7923516 CYB5R1 2.9558792 2.8654578 1.2542791 7923582 LOC100132728 2.923121 2.901234 0 7926385 STAM n.r. 2.1041925 0 7929750 ENTPD7 2.733607 3.044441 1.8828458 7936937 UROS 0.37995562 n.r. 1.2542791 7940565 F ADS2 0.26633877 0.26495677 0 7940857 STIP1 2.320789 2.505008 0 7945666 CTSD 2.3337076 2.0995255 1.2542791 7948612 F ADS1 0.42801458 0.38323805 0 7950983 CHORDC1 5.2420754 5.3255134 0 7951284 MMP3 4.831592 4.981443 0 7953943 GABARAP L1 5.6269226 4.7897706 0 7954065 GPRC5A 2.5873172 2.1940494 0.6844588 7955361 LARP 4 n.r. 2.0071368 0 7955663 TENC1 0.3412793 n.r. 1.2300419 7957665 ELK3 n.r. 2.64679 1.9702636 7959023 KRTHB5 3.3986974 2.8580022 0 7959102 HSPB8 11.421441 12.595836 0 7960117 P XMP2 0.44971967 n.r. 1.1898069 7964250 PTGES3 n.r. 2.1067293 0 7966462 C12orf30 n.r. 2.2464204 1.1626424 7967412 CDK2AP 1 0.45995197 0.4700012 0 7967544 SCARB1 0.38457364 n.r. 1.9702636 7969677 MBNL2 3.2870789 3.7140756 0 7970864 HSPH1 6.984404 8.027972 0 7974380 PSMC6 2.37864 2.5088804 0 7975976 AHSA1 2.654483 2.528625 0 7976189 PSMC1 2.1484828 2.0836797 0 7980309 C14orf1 0.4788454 n.r. 1.8093058 7987981 UBR1 2.079564 2.200251 0 7995258 ZNF267 2.417372 2.8579855 1.7816828 7995552 C YLD 2.4736326 2.4890623 0 7996954 NF AT5 n.r. 2.0728738 1.0164418 8002760 LOC100132346 2.4993343 2.9461622 0 8006392 PSMD11 n.r. 2.0902035 1.2542791 8006812 PSMB3 n.r. 2.1065855 1.748318 8007154 FKBP10 0.48253986 n.r. 0.67359436 8007228 ATP 6V0A1 2.455061 2.643155 0 8007323 CNTNAP 1 0.4485286 n.r. 1.8791046 8008646 SCPEP1 3.3350995 3.6486382 0 8011968 MED31 2.054176 2.0781279 1.2360129 8015835 DUSP3 2.3585768 2.4166815 1.5088514 8017810 PSMD12 2.4745667 2.6655283 0 8018793 JMJD6 2.757142 2.7445269 0 8019308 MAF G 2.0708797 n.r. 1.0609112 8019357 DCXR 0.42187184 0.39798078 0.71321756 8019796 MAF G 2.2590148 2.1725793 1.0164418 8020508 RIOK3 2.3432322 2.2614775 1.8093058 8022393 PTPN2 0.49801397 n.r. 0.7380251 8022488 ABHD3 2.5483463 2.8713963 1.6773299 8022531 NPC1 2.6242845 2.4850807 1.748318 8024485 GADD45B 2.1888652 2.001788 1.430442 8028756 PSMC4 2.7650094 2.7309692 0.7380251 8034837 DNAJ B1 10.030326 10.589056 0 8035465 I SYNA1 0.45974594 n.r. 1.9702636 8037144 DEDD2 2.6973588 2.5290062 0 8038919 ZNF350 2.249302 n.r. 0.7932046 8039484 IL11 3.4920256 3.9266593 1.1870334 8041015 SLC4A1AP n.r. 2.041502 0.7932046 8042503 MXD1 4.295337 3.354577 1.8828458 8046488 CDCA7 0.22141118 n.r. 1.1241443 8049016 PSMD1 n.r. 2.1443202 0 8050443 SMC6 0.4774068 n.r. 0 8052143 GPR75 2.149353 2.2382255 1.3689176 8052149 PSME4 2.0479486 2.2997785 0 8055426 MCM6 0.32571706 n.r. 0.7932046 8055688 RND3 4.4665866 4.9071813 1.1870334 8057554 CACYBP 2.6457827 2.806481 0 8058127 CLK1 2.1038861 2.0117362 0.6528684 8064438 NSFL1C 2.22234 2.2347486 0 8065738 AHCY 0.39859593 n.r. 1.8828458 8066402 C20orf111 2.5558455 2.2692223 0.7932046 8068168 SOD1 2.0596519 2.1476297 0.6528684 8071301 C22orf25 2.0119674 n.r. 0 8074464 UFD1L 2.95606 3.025243 0.7380251 8080911 KBTBD8 3.104968 3.2594275 1.3689176 8080923 PSMC1 2.1473856 2.0644085 0.94303215 8081256 TBC1D23 2.320772 2.379164 1.6707262 8083656 MFSD1 n.r. 2.0078585 0.7932046 8084423 PSMD2 2.0825644 2.575242 0.7932046 8084955 PIGX 0.48805904 n.r. 1.488998 8085263 TMEM111 2.671254 2.715446 0 8086330 AXUD1 2.2275574 2.757004 1.2211927 8088535 PSMD6 2.577625 2.6388764 0 8089544 CCDC80 0.4739907 n.r. 0 8098500 CDKN2AIP 2.1922426 2.3139832 1.3400983 8103722 LOC727891 2.7276635 3.5694418 0 8108015 HSP A4 n.r. 2.1333327 0 8108447 CXXC5 0.40579826 0.42327693 0.7786504 8109194 SLC26A2 0.47741607 n.r. 1.1626424 8109620 TTC1 2.300015 2.4077237 0.71321756 8114797 SP RY4 0.40599966 n.r. 0.7932046 8115831 DUSP1 7.7577314 7.176966 1.2211927 8117447 BTN2A2 2.0719657 2.0602176 0.9926654 8118310 HSP A1A 12.921239 12.321979 0 8118314 HSP A1B 18.324413 16.703814 0 8119529 UBR2 n.r. 2.1679542 0.6844588 8123137 ACAT2 0.42257196 n.r. 1.2542791 8124385 HIST1H4B 0.26908585 n.r. 1.8828458 8129317 SERINC1 2.0154574 2.0152109 1.2124699 8131265 KIAA0415 n.r. 2.030752 0 8135250 PSMC2 2.171369 2.1398592 1.5717202 8136336 tcag7,1260 3.929482 4.3280168 1.5717202 8137709 ZF AND2A 9.03261 8.518208 0 8141305 ZNF394 2.0206413 2.0377717 1.2360129 8148304 TRIB1 2.2367887 2.5545628 0 8150219 BRF2 4.337961 4.241915 0 8150757 RB1CC1 2.0318356 n.r. 1.430442 8150870 PSMC6 2.4105191 2.705382 0 8154765 DNAJ A1 2.4644337 2.5337884 0 8160805 C9orf25 2.6955245 2.87258 0 8160914 VCP 2.0187764 2.10775 1.430442 8164067 PSMB7 2.161596 2.097462 1.1626424 8167763 TSPYL2 3.1176639 2.851014 1.2542791 8168749 SRP X2 2.7996404 4.0295177 1.488998 8173600 NAP 1L2 4.560374 4.8171887 0 8175177 MBNL3 0.26310703 n.r. 1.8791046 8178086 HSP A1B 18.352137 16.796265 0 8179322 HSP A1A 13.440409 12.869011 0 8179324 HSP A1B 18.352137 16.796265 0

48 hours treatment LLNle Vs LLNle Vs Probe Set ID Gene Symbol / Ensembl Transcript ID DMSO DAPT q-value (%) 7897449 SPSB1 3.0175314 3.6162255 0 7897801 RNU5E 4.11117 4.9809356 0.823713 7898070 PRDM2 2.382144 n.r. 1.7683381 7898375 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.117358 8.62632 0 7898411 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.117358 8.62632 0 7899018 TMEM57 2.5697846 n.r. 0.44825312 7899173 DHDDS 2.318978 n.r. 0.64825845 7899436 SESN2 4.529123 4.3011856 0.51537126 7900167 CDCA8 0.3772989 0.3323935 0.5736573 7900699 CDC20 0.32391357 0.2672637 1.1249933 7901010 KIF2C 0.20802887 0.17823027 0 7901192 RAD54L 0.45171943 0.3604302 0 7901915 ALG6 0.3861249 0.2730841 0.64825845 7902227 GADD45A 4.727833 5.0411434 0 7902495 NEXN 3.3060086 3.7481413 0 7904452 FAM72B 0.2934984 0.2741978 0 7905789 IL6R 2.108435 2.2949636 0.67394704 7906764 HSP A6 34.624126 39.768913 0 7906775 HSP A6 8.025861 10.285372 0 7906930 NUF2 0.16527432 0.14344811 0 7907466 DARS2 0.49274603 0.4022816 0.44825312 7908409 RGS2 14.263218 n.r. 1.8183854 7909142 NUCKS1 0.32523558 0.22101457 0 7909146 FAM72B 0.32120767 0.29988265 0 7909610 ATF 3 4.423949 5.4950004 0 7909708 CENPF 0.22825882 0.19982383 0 7910997 EXO1 0.32897887 0.27314195 0 7912102 KLHL21 2.2207818 2.0037346 0.4942278 7912800 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.117358 8.62632 0 7912850 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.117358 8.62632 0 7913001 UBR4 2.3549416 n.r. 1.6664165 7914530 BSDC1 2.658801 n.r. 0.51537126 7914851 CLSPN 0.3435422 0.29877675 1.7547164 7915926 STIL n.r. 0.3239522 1.3247343 7916316 TMEM48 0.39862746 0.36148766 1.8282411 7916609 JUN 4.2210784 4.824828 0 7916898 DEPDC1 0.17719041 0.15908657 0 7917151 C1orf118 n.r. 2.3102207 1.5799086 7918300 PSRC1 0.36230534 0.3301056 0 7919151 ENST00000384487 / ENST00000384610 5.842399 5.7073193 1.3247343 7919269 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 8.7344 8.402839 0 7919349 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 8.7344 8.402839 0 7919392 ENST00000384487 / ENST00000384610 5.842399 5.7073193 1.3247343 7919556 ENST00000384476 / ENST00000384241 5.668404 5.671259 0.44825312 7919560 ENST00000384476 / ENST00000384241 5.634383 5.7737193 0.44825312 7919576 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.117358 8.62632 0 7919591 GCUD2 / FAM72D / FAM72A 0.16992176 0.16312817 0 7919642 HIST2H2AB 0.20830737 0.19415487 0 7919645 SV2A 0.4516184 0.3835468 0.823713 7919715 ANP32E 0.33044368 0.30870828 0.51537126 7919747 ENST00000391178 2.5280619 2.5912454 0.64825845 7919749 ENST00000385920 4.5975475 2.9127698 0 7922610 ABL2 5.5830283 4.8606033 0 7923086 ASP M 0.20242138 0.15580975 0.6692668 7923189 KIF14 0.31350484 0.28919175 1.7683381 7923426 UBE2T 0.27826068 0.23068914 0.550711 7923516 CYB5R1 3.4157689 3.082886 0.44825312 7923662 PIK3C2B n.r. 0.4799029 1.8282411 7924450 DUSP10 6.570527 4.7950735 0 7926259 MCM10 0.34528112 0.2939428 0.5876489 7926677 OTUD1 3.3866043 2.5804822 1.8282411 7926896 CKS1B 0.42860538 0.3776424 0 7933638 FLJ31958 n.r. 2.5829823 0 7933707 ZWINT 0.3768034 0.31309456 0.823713 7935746 BLOC1S2 2.3359978 2.1804926 1.6116124 7937020 MKI67 0.17946434 0.14904858 0.44825312 7938291 SNORA3 4.2249513 4.087601 1.1473145 7940565 F ADS2 0.26297462 0.22228256 0 7945014 CHEK1 0.3947944 0.36021072 1.3573862 7945666 CTSD 2.7102387 2.3416572 0.44825312 7945801 SNORA54 2.5692127 2.4140635 1.8070204 7948612 F ADS1 n.r. 0.42862785 0.44825312 7948839 NXF 1 2.6463144 2.1032245 0 7948894 WDR74 5.1711617 n.r. 1.8282411 7949383 SYVN1 2.0119991 n.r. 0.79978776 7951535 KDELC2 0.4099 0.3605678 1.3573862 7951662 CRYAB 36.428436 n.r. 1.6664165 7953351 NCAP D2 0.32854104 0.26880738 0.54448825 7954065 GP RC5A 2.4732466 n.r. 0.79978776 7955063 TMEM106C 0.39078543 0.35863483 0.62580794 7955663 TENC1 0.49154678 0.4136983 1.8282411 7955736 ESPL1 0.3401641 0.2775255 0.823713 7957260 GLIPR1 6.358689 7.8615756 0 7957737 TMPO 0.24855629 0.20923029 0.44825312 7958174 TXNRD1 3.4574692 3.203157 1.3247343 7958262 TCP11L2 4.880171 3.2015176 0 7958784 ALDH2 3.2904074 2.685175 0.58408743 7959023 KRTHB5 5.1049366 4.663593 0 7959102 HSPB8 7.782653 9.490769 0 7959408 KNTC1 0.3807151 0.30430284 0.5876489 7960340 F OXM1 0.27410182 0.2085537 0.6600988 7963396 KRT75 6.7567544 7.751223 0 7963646 AAAS n.r. 0.45869374 0 7964145 TIMELESS 0.24931704 0.19247976 0 7964271 PRIM1 n.r. 0.26927838 1.6664165 7964460 DDIT3 8.1020155 8.710702 0 7967386 MPHOSPH9 n.r. 0.34428418 1.726109 7968678 FREM2 0.12524387 0.09353653 0 7969243 CKAP 2 0.36984438 0.31590432 0.63824123 7970858 HMGB1 0.45983598 0.37727705 0 7973306 ABHD4 2.8576977 n.r. 1.2633351 7973896 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.088156 8.544353 0 7974902 RHOJ 0.2538221 0.21998706 0 7977732 SNORD8 4.328415 3.803383 0.44825312 7977841 C14orf94 0.45740047 0.38639247 0 7978568 ATG9B / RNU1F1 / RNU1A / RNU1D2 / RNU1C1 / RNU1A3 / RNU1C2 / RNU1G3 9.088156 8.544353 0 7978776 C14orf106 0.2409886 0.20565452 0 7978846 POLE2 0.2850665 0.2354155 0.823713 7979281 WDHD1 n.r. 0.32750538 1.5799086 7979307 DLG7 0.1027792 0.09369274 0 7979984 ZF YVE 1 2.1768262 n.r. 1.6664165 7981333 ENST00000388463 18.716242 22.410828 0.4942278 7982663 BUB1B 0.21511824 0.18555719 0.5876489 7982757 CASC5 0.17953579 0.15237717 0 7982889 NUSAP 1 0.23648359 0.18076432 0 7983228 MAP 1A 3.150729 n.r. 1.8533543 7983969 CCNB2 0.20201902 0.17512561 0.4942278 7984330 ZWILC H 0.3851194 0.3480198 1.2633351 7985829 F ANCI 0.255628 0.21385133 0 7985873 C15orf42 n.r. 0.34280923 1.726109 7986068 BLM 0.33321768 0.26532048 0 7989647 KIAA0101 0.27057904 0.26809728 0.823713 7990080 LARP 6 3.121577 3.0619364 0.5876489 7990971 CPEB1 4.09526 n.r. 1.7547164 7991406 PRC1 0.23594962 0.17762756 0.44825312 7992594 CCNF 0.39297068 0.3245818 0.64825845 7992789 TNFRSF12A 3.2764266 3.9255178 1.3247343 7993776 LOC81691 n.r. 0.43815202 0.44825312 7993798 ENST00000386291 n.r. 0.30761665 0 7993825 RUNDC2B 2.4115126 2.0551465 0.67394704 7994006 LOC595101 2.4331498 2.2224128 0.61778474 7994109 PLK1 0.20158921 0.15426524 0 7994576 RUNDC2C 2.7645478 2.0963457 0 7994620 KIF22 0.33705103 0.29306993 0 7994655 C16orf53 n.r. 0.45348656 1.6664165 7995895 HERPUD1 5.1751566 4.5951924 0 7996954 NF AT5 2.1540272 n.r. 0.7803597 7997740 MAP1LC3B 3.920674 3.9038877 0 7997940 SNORD68 3.5369837 n.r. 1.3573862 7999614 NPIP 2.011517 n.r. 0.550711 8000156 LOC641298 2.6003642 2.2329478 1.6116124 8000167 SLC7A5P1 2.6346235 2.284323 1.3967308 8000217 LOC641298 2.2845788 2.2186 1.2633351 8000638 LOC641298 2.7461617 2.4600277 0 8000651 BOLA2 2.0623903 n.r. 1.4172709 8000823 LOC641298 2.5110335 2.2463202 1.4172709 8000834 LOC595101 2.2670536 2.0786405 0.79978776 8002333 LOC641298 2.3822317 2.1382027 1.6116124 8003503 F ANCA n.r. 0.4690949 1.6116124 8003583 KIF22 0.33478513 0.29043466 0 8004167 FAM64A 0.37998024 0.32430795 1.2633351 8005441 SMCR8 2.3763974 n.r. 1.3573862 8006531 SLFN5 3.7293935 4.7567263 1.8282411 8006779 ARHGAP 23 2.2184134 2.0279236 1.2633351 8007008 THRA n.r. 0.35103583 0.4942278 8007323 CNTNAP 1 0.48676997 0.42225254 1.7683381 8008784 PRR11 0.23193273 0.20830588 0 8008885 MIRN21 5.5238457 6.8359976 0.63824123 8010260 BIRC5 0.305401 0.24976213 0 8011193 C17orf91 2.9754431 3.3142924 0.64825845 8012403 AURKB 0.48260593 0.42837563 0.79978776 8012951 CDRT1 3.2118647 3.2384126 0 8013071 FLCN 2.0984595 n.r. 1.7695869 8013243 SHMT1 0.49010018 0.40989575 0 8013671 SP AG5 0.2936876 0.24911621 0 8014974 TOP 2A 0.12258753 0.09793158 0 8016139 LOC146909 n.r. 0.38701636 1.7695869 8016147 LOC146909 0.43385053 0.40344396 1.8415495 8016239 PLEKHM1 2.7624996 n.r. 1.5799086 8017675 PLEKHM1 2.6339176 2.236802 1.8533543 8018793 JMJD6 2.7721388 2.5761185 0 8018902 DNAH17 6.9993553 7.495098 0.4942278 8019798 MAF G n.r. 2.1225607 0.6468082 8019842 TYMS 0.27022526 0.23354192 1.726109 8019857 NDC80 0.24829853 0.20592526 0 8020508 RIOK3 2.6704807 n.r. 1.726109 8022640 DHFR 0.28066656 0.2433612 0.64825845 8024485 GADD45B 5.739694 7.3008566 0 8026007 ZNF791 2.5561094 n.r. 0.64825845 8026051 RNASEH2A 0.4905079 0.42315662 0.4942278 8028004 LIN37 2.1997087 2.063769 0 8028117 ENST00000363186 n.r. 2.659957 1.433077 8028119 WDR62 n.r. 0.4969959 0.44825312 8028756 PSMC4 2.6885757 2.4453988 1.6664165 8029437 P VR 2.0749617 n.r. 1.2633351 8030128 PPP1R15A 10.491503 10.060698 0 8030171 FTL 4.469893 3.3254004 0 8031570 RFPL4A 20.108238 22.56092 0 8031573 RFPL4A 18.25362 20.841991 0 8032392 MKNK2 2.4710107 2.4136527 1.726109 8032718 DAP K3 2.881941 2.7652144 0 8032863 C19orf10 2.370734 2.3271642 0 8034122 SPC24 0.40926015 0.33320406 0.5876489 8034837 DNAJ B1 8.742958 7.8687706 0 8037144 DEDD2 2.2902749 2.1912534 0.550711 8037991 LIG1 0.47758415 0.4268263 0 8039484 IL11 9.593795 10.047431 0 8039928 FAM72B 0.312987 0.29585418 0 8040712 CENP A 0.35554072 0.32181373 0.44825312 8041206 LBH 4.8871274 5.3682895 0.79978776 8042503 MXD1 3.5153825 3.4210002 1.4172709 8043036 LOC1720 0.25539574 0.2394686 1.3573862 8043602 NCAP H 0.23458001 0.19972534 0 8045768 ARL6IP6 0.3979113 0.36522162 1.3967308 8046488 CDCA7 0.20002078 0.15924515 0 8047288 SGOL2 0.2256779 0.20913996 0 8047300 AOX1 2.0961087 2.2002168 0.4942278 8049657 ASB1 2.3470688 n.r. 1.3573862 8051993 PIGF 0.3085238 0.2435503 0 8054580 BUB1 0.21436338 0.20072317 0 8054611 C2orf59 2.9642186 3.3267112 1.8282411 8054804 CCDC93 2.0280917 n.r. 1.8533543 8055426 MCM6 0.30242687 0.24884374 0.63404226 8055688 RND3 7.5507674 7.131374 0 8056572 SPC25 0.19514854 0.1593462 0 8056728 ENST00000314189 0.47835627 n.r. 0 8057689 OSGEPL1 n.r. 0.34760737 0.67394704 8059838 HJURP 0.36746 0.34794387 1.8533543 8061129 C20orf72 n.r. 0.45723847 1.726109 8061471 GINS1 0.26781312 0.25017703 1.4120795 8061579 TPX2 0.2568507 0.20449379 1.8183854 8064375 SRXN1 3.627204 n.r. 1.8282411 8067167 AURKA 0.23066548 0.23728946 1.6116124 8069676 ADAMTS1 6.1711555 6.5750165 0.5876489 8070876 POFUT2 2.019814 n.r. 1.2633351 8071301 C22orf25 2.2599056 2.3817632 0.51537126 8071559 SDF2L1 n.r. 2.3058336 1.7158651 8073007 MAFF 2.4433382 2.40072 0 8073858 GTSE1 n.r. 0.28314048 1.7683381 8075164 CHEK2 0.43703848 0.31837007 0 8075310 LIF 4.1191306 4.630114 0.550711 8077731 F ANCD2 0.3141234 0.25544107 1.1473145 8079237 KIF15 n.r. 0.19371967 0.823713 8081081 EP HA3 0.3380452 0.24355286 0.51537126 8081818 ENST00000386459 2.5824504 4.002851 1.7695869 8082523 IFT122 n.r. 0.4114835 1.1249933 8083324 TSC22D2 2.993086 2.6620357 0.79978776 8083941 ECT2 0.27209073 0.22434063 1.1249933 8084630 ENST00000306399 4.320188 5.3584466 0 8084694 EIF4A2 2.1812127 2.1012697 0.54448825 8084955 P IGX 0.43519342 0.37285095 1.8282411 8085754 SGOL1 0.25898698 0.23062637 0 8085867 NEK10 3.32045 3.605013 0 8086330 AXUD1 2.8802478 3.1781032 0 8088958 GBE1 3.140836 2.6808646 1.3247343 8090565 SNORA7B 3.0318096 2.4049466 0.51537126 8092640 RFC4 0.4287313 0.42336577 0.7803597 8093500 TACC3 0.314366 0.2512967 0.51537126 8094278 NCAP G 0.26009652 0.2414376 0.6468082 8094778 UCHL1 2.5811 2.3763154 1.600904 8095221 P AICS 0.3025394 0.2651568 1.1473145 8097356 PLK4 0.29909566 0.26194295 1.1249933 8097857 MND1 0.26406008 0.25391954 0.823713 8098500 CDKN2AIP 3.0485206 2.6034713 0 8102076 CENPE 0.22352104 0.197904 0.51537126 8102214 PAPSS1 0.3993814 0.3410819 0.823713 8102643 CCNA2 0.17867586 0.15038624 0 8102787 ENST00000384592 8.528313 7.0746255 0 8104234 TRIP13 0.33518866 0.31957495 1.4852222 8104912 SKP2 0.28711328 0.2340392 1.7695869 8105828 CCNB1 0.20169075 0.1517919 1.3573862 8105842 CENPH 0.3139577 0.27215904 0 8107100 RGMB 3.0024784 2.575716 0.7803597 8107706 LMNB1 0.20876186 0.17700142 0 8108301 KIF20A 0.15239401 0.11868563 0.4942278 8109333 GP X3 2.2533567 2.511683 1.6664165 8109484 KIF4B 0.2730906 0.26852185 0 8109712 HMMR 0.19587886 0.19537699 0 8110569 SQSTM1 6.5127273 4.968238 0 8112260 DEPDC1B 0.23847929 0.19288178 0 8112327 CKS1B 0.4195307 0.36328468 0 8112902 DHFR 0.28356114 0.24308819 1.2633351 8112940 SSBP2 n.r. 0.37621412 1.6664165 8113050 CETN3 0.43549874 0.37040105 1.3967308 8113214 GLRX 4.136132 4.1321287 1.7683381 8113790 MARCH3 3.1857736 3.4440956 0.44825312 8114363 ENST00000363010 5.842395 5.782208 0.44825312 8114425 CDC25C n.r. 0.3637727 1.8070204 8114572 HBEGF 5.341515 7.074331 0.67394704 8115831 DUSP1 18.380592 14.167379 0 8116532 SNORD95 3.7532678 n.r. 1.6664165 8116534 TRIM52 2.2180607 n.r. 1.8533543 8116952 ENST00000383975 4.304297 5.212044 1.726109 8117395 HIST1H2BF 0.18818629 0.14815874 0.6600988 8118259 MSH5 0.4363395 0.32375622 0 8118310 HSP A1A 16.07996 13.229242 0 8118314 HSP A1B 19.402597 16.048002 0 8122807 AKAP 12 4.0884075 4.3014946 0.6556083 8122816 ENST00000364667 2.0198846 2.5587544 0.64825845 8123137 ACAT2 0.28084245 0.27482468 0.823713 8124385 HIST1H4B 0.37639907 0.35321614 1.6116124 8124406 HIST1H2BC 0.22933951 0.20380051 0 8124416 HIST1H3D 0.35326642 0.28466675 1.7695869 8124527 HIST1H1B 0.17206173 0.09977343 0.44825312 8127743 HMGN3 n.r. 0.36813855 1.726109 8129677 SGK1 9.076629 9.044402 0 8129937 CITED2 6.868978 5.880768 0.44825312 8130578 SNORA20 7.481375 4.6136956 0 8131091 MAF K 2.6002944 2.768049 1.7683381 8131265 KIAA0415 2.588021 2.4255643 0 8131996 CREB5 3.1380353 2.9109282 0 8132725 UPP1 3.2294464 3.7958698 1.7695869 8132964 SUMF2 n.r. 0.36139813 1.7547164 8133360 CLDN4 2.249273 2.5747168 0.5876489 8133688 SNORA14A 4.0101824 n.r. 1.7158651 8135069 SERPINE1 6.0522685 10.28052 0 8135480 DNAJ B9 2.2352502 2.265474 0.61778474 8136336 tcag7,1260 2.6162086 3.268577 0.7803597 8137709 ZF AND2A 9.805646 10.095892 0 8138091 DAGLB 2.7079482 n.r. 1.6116124 8138489 CDCA7L n.r. 0.26457572 1.7695869 8139482 SNORA5A 2.4560578 n.r. 0 8139484 SNORA5C 2.0879834 2.02071 1.3573862 8140814 SLC25A40 0.30640697 0.25748557 0 8141305 ZNF394 2.510664 2.036054 0.5876489 8141648 ACHE 2.4091828 2.5589428 0.5736573 8144036 XRCC2 0.4636085 0.42820024 1.600904 8144153 NCAP G2 0.2921751 0.24099486 0 8145570 ESCO2 n.r. 0.21673493 1.8533543 8146934 LY96 2.9883268 n.r. 1.8282411 8148304 TRIB1 2.9446292 3.2229013 0 8149927 CLU 4.115308 3.8678782 0 8149955 PBK 0.15749525 0.14117852 0.44825312 8151824 RAD54B 0.49000278 0.41556808 1.6664165 8151871 CCNE2 0.41598973 0.3220019 1.2633351 8152582 DCC1 0.29471374 0.24588431 0.62580794 8154381 C9orf150 3.1953382 3.9280195 0 8160981 KIAA1539 2.1515503 2.1340861 1.3247343 8161147 HINT2 n.r. 0.48941302 1.8282411 8162276 NFIL3 3.7140067 3.239835 1.433077 8164165 HSP A5 5.820242 5.459529 0 8167763 TSPYL2 5.415056 4.2157164 0 8168146 KIF 4A 0.1742753 0.14029449 0 8168794 CENPI 0.27300733 0.23402257 0.51537126 8169634 ENST00000384446 7.5067577 7.1591425 0 8170249 SP ANXA2 7.0264864 6.848646 0 8170468 HMGB3 0.4467462 0.41935724 0 8173506 ERCC6L 0.43019992 0.3110368 0 8173600 NAP1L2 3.759866 n.r. 1.5799086 8175177 MBNL3 0.30777392 0.2166388 0 8175543 SP ANXC 6.6143026 6.2726345 0 8175550 SP ANXA2 7.0264864 6.848646 0 8178086 HSP A1B 19.7452 16.251368 0 8178399 NRM 0.49232864 0.44484648 1.8183854 8179322 HSP A1A 16.98961 14.07623 0 8179324 HSP A1B 19.7452 16.251368 0 8179683 NRM 0.49232864 0.44484648 1.8183854 8180337 ENST00000364667 3.0848668 2.717507 0.44825312 n.r. = not regulated

Supplementary Table S2. Expression values for NOTCH target genes as determined by microarray experiments for PT1-3 GBM TICs

PT1 PT2 PT3 Gene Symbol mRNA Accession 24h Probe Set ID LLNLe DAPT DMSO LLNle DAPT DMSO LLNLe DAPT DMSO 8151457 143,35 133,81 217,01 292,63 461,87 696,88 239,85 91,20 198,69 HEY1 NM_012258 8084880 308,55 256,91 446,08 231,10 129,74 256,26 175,47 251,51 344,36 HES1 NM_005524 7912031 73,02 80,37 65,64 70,37 95,56 103,90 81,76 62,50 75,95 HES2 NM_019089 8064978 524,89 606,46 713,76 1548,55 529,27 813,55 1207,76 829,45 1324,74 JAG1 NM_000214 8121850 32,46 36,37 28,46 134,09 764,88 1107,94 69,48 103,37 139,26 HEY2 NM_012259 48h Probe Set ID LLNLe DAPT DMSO LLNle DAPT DMSO LLNLe DAPT DMSO 8151457 202,56 107,50 183,31 370,40 372,57 818,86 264,20 60,03 174,53 HEY1 NM_012258 8084880 676,01 341,88 632,45 941,47 113,83 352,48 207,68 220,43 300,48 HES1 NM_005524 7912031 78,66 85,11 62,08 132,49 59,35 92,46 70,79 72,53 85,07 HES2 NM_019089 8064978 721,68 464,90 462,60 550,17 350,74 393,50 1083,62 493,90 609,52 JAG1 NM_000214 8121850 56,21 32,27 32,13 103,54 584,47 573,74 57,88 100,86 88,43 HEY2 NM_012259

Supplementary Table S3. Sequences accession numbers and primers used for Real-Time validation experiments.

Gene Accession Forward (5'-3') Reverse (5'-3')

number

BUB1B NM_001211 TGCAAATTGCTTCCGAGTCTC CCAAATGTTCTCCGCAAGTGA

CCNB1 NM_031966 CAGGTTGTTGCAGGAGACCAT GTGACACCAACCAGCTGCAG

CDC20 NM_001255 GCCATGGCTTTGCACAGAA CAGACTCAGGACCCGGGAT

DUSP1 NM_004417 GGACAACCACAAGGCAGACA GGACAAACACCCTTCCTCCA

LRPAP1 NM_002337 ACCCCAGGCTGGAAAAGCT CCAGTTCTTCGCCGGAGAA

NEXN NM_144573 CAGCCCAAGACCACATAGAGC CCCTTGCCAAGTTTTGGTACA

PSMD6 NM_014814 TGGCAAAGGCCGAGTACCT TGTCTTGCGAAAGGCTGTCA

UBR1 NM_174916 TGCATTTTTCACGCACTTCAC CAGGACCACTCGGCATTCTC