USOO89692.54B2

(12) United States Patent (10) Patent No.: US 8,969,254 B2 Reinherz et al. (45) Date of Patent: Mar. 3, 2015

(54) OLIGONUCLEOTIDE ARRAY FORTISSUE Avent (2009) "Large-scale blood group genotyping—clinical impli TYPNG cations' British Journal of Haematology 144(1):3-13; published online Nov. 4, 2008.* Saunthararajah et al. (2003) “A simple method to predict response to (75) Inventors: Ellis L. Reinherz, Lincoln, MA (US); immunosuppressive therapy in patients with myelodysplastic syn Vladimir Brusic, Brookline, MA (US); drome” Blood 102(8):3025-3027; published online Jun. 26, 2003.* Guanglan Zhang, Brighton, MA (US); John et al. (2005) “Interactive selective pressures of HLA-restricted Derin Benerci Keskin, Somerville, MA immune responses and antiretroviral drugs on HIV-1' Antiviral (US); David Deluca, Allston, MA (US); Therapy 10(4):551-555; published 2005.* Honghuang Lin, Natick, MA (US) Maksymowych et al. "Association of a Specific ERAP1/ARTS1 Haplotype With Disease Susceptibility in Ankylosing Spondylitis' (2009) Arthristis and Rheumatism 60(5): 1317-1323; published May (73) Assignee: Dana-Farber Cancer Institute, Inc., 2009.* Boston, MA (US) Vidal-Castineira et al. (2010) “Effect of killer immunoglobulin-like receptors in the response to combined treatment in patients with (*) Notice: Subject to any disclaimer, the term of this chronic hepatitis C virus infection” Journal of Virology 84(1):475 patent is extended or adjusted under 35 481. U.S.C. 154(b) by 0 days. Authorized Officer J.H. Choi. International Search Report and Writ ten Opinion in International Application No. PCT/US2011/065624. dated Dec. 3, 2012, 14 pages. (21) Appl. No.: 13/329,161 Ahlenstiel et al., “Distinct KIR/HLA compound genotypes affect the kinetics of human antiviral natural killer cell responses.” J Clin (22) Filed: Dec. 16, 2011 Invest., 2008, 118(3):1017-26. An and Winkler, “Host genes associated with HIV/AIDS: advances (65) Prior Publication Data in gene discovery,” Trends Genet, 2010, 26(3): 119-31. Chen et al., “Activating KIR genes are associated with CMV reacti US 2012/O264627 A1 Oct. 18, 2012 vation and survival after non-T-cell depleted HLA-identical sibling Related U.S. Application Data bone marrow transplantation formalignant disorders. Bone Marrow Transplantation, 2006, 38:437-444. (60) Provisional application No. 61/423,991, filed on Dec. De Petris et al., “Correlation between HLA-A2 gene frequency, lati 16, 2010. tude, ovarian and prostate cancer mortality rates. Medical Oncology, 2004, 21(1):49-52. Geraghty et al., "A human major histocompatibility complex class I (51) Int. Cl. gene that encodes a protein with a shortened cytoplasmic segment.” C4OB 30/04 (2006.01) Proc. Natl. Acad. Sci. USA, 1987, 84:9145-49. CI2O I/68 (2006.01) Gonzalez et al., “Killer cell immunoglobulin-like receptor allele (52) U.S. Cl. discrimination by high-resolution melting.” Hum Immunol., 2009, CPC ...... CI2O I/6881 (2013.01) 70(10):858-63. Gonzalez-Roces et al., “HLA-B27 polymorphism and worldwide USPC ...... 506/9; 435/6.11 Susceptibility to ankylosing spondylitis. Tissue Antigens, 2008, (58) Field of Classification Search 49:116-123. None Guo et al., “Direct fluorescence analysis of of genetic polymorphisms See application file for complete search history. by hybridization with oligonucleotide arrays on glass Supports. Nuc. Acids Res., 1994, 22:54.56-5465. (56) References Cited Khan et al., “Genetics of HLA associated diseases: rheumatoid arthri tis.” Tissue Antigens, 1983, 22:182-185. U.S. PATENT DOCUMENTS Koller et al., “HLA-E. A novel HLA class I gene expressed in resting T lymphocytes.” J. Immunol., 1988, 141:897-904. 4,401,796 A 8, 1983 Itakura Kulkarni et al., “The Yin and Yang of HLA and KIR in human 4,458,066 A 7, 1984 Caruthers et al. disease.” Semin Immunol. 2008, 2006):343-52. 4,500,707 A 2f1985 Caruthers et al. Larsen & Alper, “The genetics of HLA-associated disease.” Current 5,143,854 A 9/1992 Pirrung et al. Opinion in Immunology, 2004, 16:660-667. 5,288,514 A 2f1994 Ellman Lebedeva et al., "Comprehensive approach to high-resolution KIR 5,985,662 A 11/1999 Anderson et al. typing.” Human Immunol. 2007, 68(9):789-96. 6,670,124 B1* 12/2003 Chow et al...... 435/6.12 Lee et al., “HLA-F is a surface marker on activated lymphocytes.” 2003/01 19015 A1 6, 2003 Frazer et al. Eur.I. Immunol., 2010, 40:23.08-18. 2008/024.1823 A1 10, 2008 Gut et al. 2009.0099.035 A1 4/2009 Petersdorf et al. (Continued) 2009,0264307 A1 10, 2009 Gresham et al. 2010/0279889 A1 11, 2010 Mitra et al. Primary Examiner — Tracy Vivlemore FOREIGN PATENT DOCUMENTS Assistant Examiner — Karen S Weiler (74) Attorney, Agent, or Firm — Fish & Richardson P.C. WO WO963.9154 12/1996 WO WO97O3211 1, 1997 (57) ABSTRACT WO WO98,02749 A1 * 1, 1998 ... GO1N 33,576 WO WO 2007/076577 A1 * T 2007 ...... C12O 1/68 Oligonucleotide-based microarrays for tissue typing (e.g., HLA tissue typing) are provided. More particularly, the OTHER PUBLICATIONS microarrays are high resolution arrays useful for diagnostic Gresham et al. (2010) "Optimized detection of sequence variation in evaluations and determining donor/recipient transplant com heterozygous genomes using DNA microarrays with isothermal patibility. melting probes' PNAS 107(4): 1482-1487; published online Jan. 8, 2010.* 77 Claims, 14 Drawing Sheets US 8,969.254 B2 Page 2

(56) References Cited Passweg et al., “HLA and KIR polymorphisms affect NK-cell anti tumor activity.” Trends Immunol. 2007, 28(10):437-41. OTHER PUBLICATIONS Pearson and Regnier, “High-performance anion-exchange chroma Lin et al., “HLA Class II DR-DQ and Increased Risk of Cervical tography of oligonucleotides,” J. Chromo A, 1983, 255:137-149. Cancer among Senegalese Women.” Cancer Epidemiol Biomarkers Poland et al., “Vaccine Immunogenectics bedside to bench to popu Prev., 2001, 10(10): 1037-45. lation.” Vaccine, 2008, 26(49):6183-8. Maiers et al., “High-resloution HLA alleles and haplotypes in the Rammensee, “Chemistry of peptides associated with MHC class I United States population.” Hum Immunol. 2007, 68: 779-88. and Class II molecules.” Curr: Opin. Immunol. 1995, 7:85-96. Marsh et al., “Killer-cell Immunoglobulin-like Receptors (KIR) Robinson et al., “IPD—the Immuno Polymorphism Database.” Nomenclature Report 2002.”J Immunol Methods, 2003, 281:1-8. Nucleic Acids Res., 2010, 38:D863-9. Michallet et al., “The impact of HLA matching on long-term trans Yershov et al., “DNA Analysis and Diagnostics on oligonucleotide plant outcome after allogeneic hematopoietic stem cell transplanta microchips.” Proc. Natl. Acad. Sci. USA, 1996, 93:4913-4918. tion for CLL: a retrospective study from the EBMT registry.” Leu kemia, 2010, 10:1725-31. * cited by examiner U.S. Patent Mar. 3, 2015 Sheet 1 of 14 US 8,969,254 B2

Oligonucleotide probe design STEP 1

Make sure all probes have similar melting temperature (64.3t 0.7) and the length of all probes are not too long Ortoo short (20-60) isolate RNA using Total RNA isolation Mini Kit from frozen PBMC and Cells lines Synthesize fluorescent cRNA probes for hybridization from Total RNA using the Agilent single Color direct labeling kit Perform probe hybridization and scan the chips using an Agilent Microarray scanner Convert the fluorescence intensity into signals using Agilent Feature Extraction program

Original probe signal file STEP 1 Normalize signals so that signals from all arrays have the same average, maximum and minimum Values

Perform statistics for signals at each alignment position: maximum, minimum, mean, median, geometric mean Identify uninformative probes: probes with global high Orlow signals

Perform pair-wise Comparison of signals of representative alleles of each locus STEP 3 Use gap penalty method to Calculate penalty score of each allele Cross Compare the results of gap penalty method and pair-wise Comparison Output the final list candidate alleles FIG. 1

U.S. Patent Mar. 3, 2015 Sheet 3 of 14 US 8,969,254 B2

Ak O2 : 01:01:01 ATGGCCGTCATGGCGCCCCGAACCCTCGTCCT.G. . . P1 ATGGCCGTCATGGCGCCCCGAAC P2 TGGCCGTCATGGCGCCCCGAAC P3 GGCCGTCATGGCGCCCCGAAC P4 GCCGTCATGGCGCCCCGAACC P5 CCGTCATGGCGCCCCGAACCCT P 6 CGTCATGGCGCCCCGAACCCTC P7 GTCATGGCGCCCCGAACCCCGT P8 TCATGGCGCCCCGAACCCTCGTC P9 CATGGCGCCCCGAACCCTCGTC P1 O ATGGCGCCCCGAACCCTCGTCCT. P11. TGGCGCCCCGAACCCTCGTCCT P12 GGCGCCCCGAACCCCGICC P13 GCGCCCCGAACCCTCGTCCTG

FG. 3 U.S. Patent Mar. 3, 2015 Sheet 4 of 14 US 8,969,254 B2

O N.

OO CO

C) O) s Y 3 E C O HairE n E wn e St CD 5 & S4 S - (5 wn o O

CN CO

O CO

CO O C C C C C r (Y) (N V- O efuel uul U.S. Patent Mar. 3, 2015 Sheet 5 of 14 US 8,969,254 B2

HLA + KR + 1/2 AP CHIP HLA + KIR + 1/2 AP CHP NEGATIVE 1/2 AP 42,194 4. (t HLA KR POSITIVE SIZE: 175,735 FIG. 5A FIG. 5B U.S. Patent Mar. 3, 2015 Sheet 6 of 14 US 8,969,254 B2

Probe Length F.G. 6A

45OOO 49000H 35000H 30000H 25000 15OOO2009

5000 64 64, 642 643 644 64.5 646 64.7 64.8 64.9 65 Melting Temperature FIG. 6B U.S. Patent US 8,969,254 B2

U.S. Patent Mar. 3, 2015 Sheet 9 of 14 US 8,969,254 B2

-? I -- |):„WWWWWWW!

00000|| 0000|| U.S. Patent Mar. 3, 2015 Sheet 10 of 14 US 8,969,254 B2

00000|| 0000|| |001 U.S. Patent Mar. 3, 2015 Sheet 11 of 14 US 8,969,254 B2

------~~~~---- U.S. Patent Mar. 3, 2015 Sheet 12 of 14 US 8,969,254 B2

AO1010101 VS. AO2010101; Times of Winning Allele Length Akolololologs A*02010101.098

A"O1010101 vs. AO3010101; Times of winning Allele Length. Elsallao Akolololologs 3 Ag3010101.098 47

AO1010101 VS. A 1 10101; Times of Winning Akololololog8Allele Length. Elsallao4 Allolol (1098 17

A01010101 vs. A 2301: Times of Winning Allele Length. EIslalcao Akolololologs hos A*230 hogs 40

A01010101 VS, A24020101; Times of Winning Allele Length. Elsallao Akolololologg (2

FIG. 1 OB U.S. Patent US 8,969,254 B2

53d S

aqota:

US 8,969,254 B2 1. 2 OLGONUCLEOTDE ARRAY FOR TISSUE tide loading on HLA molecules) in the same assay, and thus TYPING do not efficiently provide a complete picture of an individu al’s HLA tissue type, as needed, e.g., to understand the link RELATED APPLICATIONS age between certain tissue types and disease Susceptibility, and for determining donor/recipient compatibility in tissue The present application claims the benefit of U.S. Provi transplant. sional Patent Application Ser. No. 61/423,991, filed Dec. 16, There therefore exists a need in the art for new and 2010, which is herein incorporated by reference in its entirety. improved methods for not only the identification of all alleles of any HLA molecule, but the ability to identify all alleles of STATEMENT REGARDING FEDERALLY 10 all HLA molecules known at the time of identification, as well SPONSORED RESEARCH ORDEVELOPMENT as certain other polymorphic molecules, in a single assay. This invention addresses these and other needs as described in The research described in this application was Supported in detail below. part by grant (Nos. U19 AI57330 and UO1 AI90043) from the National Institutes of Health. Thus, the government has cer 15 SUMMARY OF THE INVENTION tain rights in the invention. In certain embodiments, the invention provides a method REFERENCE TO SEQUENCE LISTING for human leukocyte antigen (HLA) tissue typing, said method comprising: (a) contacting a cDNA- or cRNA-con Pursuant to 37 C.F.R. 1.821(c), a sequence listing is sub taining sample under hybridization conditions with a plural mitted herewith via EFS-Web as an ASCII compliant text file ity of capture oligonucleotides specific for HLA polypep named “Sequencelisting..txt that was created on Feb. 3, tides, wherein said hybridization conditions facilitate 2012, and has a size of 103.990,947 bytes. The content of the hybridization of a subset of capture oligonucleotides to aforementioned file named “Sequencelisting..txt is hereby complementary sequences present in the cDNA or cRNA; (b) incorporated by reference in its entirety. 25 detecting a hybridization pattern for said cDNA or cRNA; and (c) assigning to the sample, based on the hybridization pat TECHNICAL FIELD tern, an HLA tissue type; wherein the capture oligonucle otides are from about 17 to about 60 nucleotides in length and This invention relates to tissue typing using an oligonucle each capture oligonucleotide with respect to its exact comple otide-based microarray. More particularly, the HLA arrays 30 ment has a melting temperature of about 64 degrees Celsius; are high resolution arrays useful for diagnostic evaluations wherein said capture oligonucleotides comprise Subsets of and determining donor/recipient transplant compatibility. oligonucleotides that collectively target classical HLA polypeptide-encoding nucleic acids (“classical HLA oligo BACKGROUND Subsets”), each classical HLA oligo Subset targeting a differ 35 ent classical HLA polypeptide-encoding nucleic acid; and HLA variation is a crucial determinant of transplant rejec wherein each of said classical HLA oligo Subsets comprises a tion, Susceptibility to a large number of infectious and set of overlapping oligonucleotides that cover every single autoimmune diseases, and cancer. The limiting factor in nucleotide position in the mRNA sequences coding for the large-scale genetic analysis of for example, transplant popu classical HLA polypeptides from 5' to 3' and are sequentially lations has been methodologic and directly involves the tech 40 shifted by 1-5 nucleotides from the 5' end of the preceding nical ability to accurately define the alleles of highly poly overlapping oligonucleotide. In certain embodiments, in step morphic HLA genes in a cost-effective and efficient manner. (a), said cDNA or cRNA was detectably labeled during the Although recent progress in the development of traditional making, and said detecting step (b) comprises detecting said probe hybridization, sequencing and array-based methods detectably labeled cDNA or cRNA. In other embodiments, has allowed alleles to be determined with accuracy, large 45 the detecting step (d) comprises the use of labeled detection scale efforts in genetic analysis of transplant populations are probes. In a specific embodiment, the capture oligonucle hampered by the cost and inefficiency of available methods. otides comprise Subsets of oligonucleotides that collectively In particular, current array-based methods are inefficient, target all known classical HLA polypeptide-encoding nucleic because resolution of ambiguities is not guaranteed, and mul acids. In one embodiment, the capture oligonucleotides are tiple arrays are needed to conduct a complete analysis of all 50 immobilized on a substrate. HLA genes. Exemplary limitations of currently available In one embodiment, said classical HLA polypeptide-en HLA arrays include for example, that they are suitable for coding nucleic acids encode HLA polypeptides selected from low-to-medium density genotyping but not for high-density the group consisting of HLA-A. HLA-B, HLA-C, HLA-DR, genotyping; they do not have a complete set of probes (i.e. HLA-DP, and HLA-DQ. capture oligonucleotides that recognize target HLA encoding 55 In another embodiment, said capture oligonucleotides fur nucleic acids), but ratherhave only a selection of “informative ther comprise a plurality of oligonucleotide Subsets that col probes, thereby making deconvolution of ambiguities diffi lectively targets non-classical HLA polypeptide-encoding cult or impossible; they do not coverall currently known HLA nucleic acids (“non-classical HLA oligo Subsets”), each non alleles from each group; and they do not encode a complete classical HLA oligo Subset targeting a different non-classical set of classical and non-classical HLA loci. Current method 60 HLA polypeptide-encoding nucleic acid; wherein each of ologies, e.g., microarrays, are typically limited to identifying said non-classical HLA oligo Subsets comprises a set of over one or several classical HLA molecules (e.g., HLA-A. lapping oligonucleotides that cover every single nucleotide HLA-B or HLA-C) per assay, and cannot simultaneously position in the mRNA sequences coding for the non-classical determine the haplotype of all classical MHC molecules. Nor HLA polypeptides from 5' to 3' and are sequentially shifted by can current methodologies simultaneously determine the 65 1-5 nucleotides from the 5' end of the preceding overlapping haplotype of non-classical HLA molecules or accessory mol oligonucleotide. In a specific embodiment, the plurality of ecules (e.g., those important in antigen processing and pep oligonucleotide Subsets that collectively targets non-classical US 8,969,254 B2 3 4 HLA polypeptide-encoding nucleic acids collectively target sisting ABO (ABO), Chido Rodgers (CH/RG), Colton (CO), all known non-classical HLA polypeptide-encoding nucleic Cromer (CROM), Diego (DI) (band 3), Dombrock (DO), acids. Duffy (DARC), Gerbich (Ge), Gill (GIL), Globoside and Pk, In another embodiment, said non-classical HLA polypep H(H), I (I), Indian (IN), John Milton Hagen (JMH), Kell tide-encoding nucleic acids encode HLA polypeptides (KEL) and KX (XK), Kidd (JK), Knops (KN), Landsteiner selected from the group consisting of HLA-E, HLA-F, HLA Wiener (LW), Lewis (LE), Lutheran (LU), MNS (MNS, Gly G, DM, DO and MIC. cophorins A, B and E), Ok (OK), Raph (RAPH), Rh(RH) and In certain embodiments, said capture oligonucleotides fur Rh-gp (RHAG), Scianna (SC), T/Tn, Xg (XG), and Yt (YT). ther comprise a plurality of oligonucleotide Subsets that col In certain of the above embodiments, the method further lectively targets nucleic acids encoding accessory molecules 10 comprises the step of deriving from the HLA tissue type important in HLA-linked peptide presentation and/or pro assigned in step (d) donor/recipient transplant compatibility. cessing ('accessory molecule oligo Subsets’), and said In one embodiment, the classical HLA oligo Subsets com method further comprises the step of assigning to the sample, prise the sequences set forth in Table I or the normal (indi based on the hybridization pattern, an accessory molecule cated by “HPN”), extended (indicated by “HPE) and trun phenotype; wherein each of said accessory molecule oligo 15 cated “indicated by HPT) sequences set forth in Table X. In Subsets comprises a set of overlapping oligonucleotides that another embodiment, the non-classical HLA oligo Subsets cover every single nucleotide position in the mRNA comprise the sequences set forth in Table II. In still another sequences coding for the accessory molecules from 5' to 3' embodiment, the accessory molecule oligo Subsets comprise and are sequentially shifted by 1-5 nucleotides from the 5' end the sequences set forth in Table III. In yet another embodi of the preceding overlapping oligonucleotide. In a specific ment, the KIR oligo Subsets comprise the sequences set forth embodiment, said accessory molecules are selected from the in Table IV. In still another embodiment, the blood group group consisting of LMP2, LMP7, LMP10, tripeptidyl pep determining oligo Subsets comprise the sequences set forth in tidase II (TPPII), bleomycin hydrolase (BLMH), leucine ami Table V. nopeptidase 3 (LAP3), transporter associated with antigen In certain of the above embodiments, in each set of over processing (TAP) 1, TAP2, 2-microglobulin, TAP binding 25 lapping oligonucleotides, each oligonucleotide is sequen protein (tapasin), calnexin (CANX), calreticulin (CALR), tially shifted by 1 nucleotide from the 5' end of the preceding protein disulfide isomerase family A member 2 (PDIA2), overlapping oligonucleotide. In another of the above embodi protein disulfide isomerase family A member 3 (PDIA3), ments, in each set of overlapping oligonucleotides, each oli ERp57, endoplasmic reticulum aminopeptidase (ERAP) 1, gonucleotide is sequentially shifted by 2 nucleotides from the ERAP2, proteasome (prosome macropain) Subunit althap 30 5' end of the preceding overlapping oligonucleotide. In cer (PSMA) type I (PSMA1), PSMA2, PSMA3, PSMA4, tain other of the above embodiments, in each set of overlap PSMA5, PSMA6, PSMA7, PSMA8, proteasome (prosome ping oligonucleotides, each oligonucleotide is sequentially macropain) subunit beta (PSMB) type 1 (PSMB1), PSMB2, shifted by 3 nucleotides from the 5' end of the preceding PSMB3, PSMB4, PSMB5, PSMB6, PSMB7, PSMB8, overlapping oligonucleotide. In still other of the above PSMB9, PSMB10, PSMB11, proteasome (prosome macro 35 embodiments, in each set of overlapping oligonucleotides, pain) 26S subunit ATPase (PSMC) 1 (PSMC1); PSMC2, each oligonucleotide is sequentially shifted by 4 nucleotides PSMC3, PSMC4, PSMC5, PSMC6, proteasome (prosome from the 5' end of the preceding overlapping oligonucleotide. macropain) 26S subunit non-ATPase (PSMD) 1 (PSMD1), In certain of the above embodiments, in each set of overlap PSMD2, PSMD3, PSMD4, PSMD5, PSMD6, PSMD7, ping oligonucleotides, each oligonucleotide is sequentially PSMD8, PSMD9, PSMD10, PSMD11, PSMD12, PSMD13, 40 shifted by 5 nucleotides from the 5' end of the preceding and PSMD14. overlapping oligonucleotide. In certain of the above embodiments, said capture oligo In one embodiment, said sample for HLA tissue tying is nucleotides further comprise a plurality of oligonucleotide obtained from a human Subject. In certain embodiments, the Subsets targeting killer-cell immunoglobulin-like receptor method for HLA tissue typing comprises the step of diagnos (KIR) polypeptide-encoding nucleic acids (“KIR oligo sub 45 ing or predicting the likelihood of an HLA-linked genetic sets’), and said method further comprises the step of assign defect, disease, inadequate or undesirable response to a vac ing to the sample, based on the hybridization pattern, a KIR cine, biologic treatment (recombinant protein, biosimilar or polypeptide phenotype; wherein each of said KIRoligo Sub equivalent), or infectious organism, or condition in said Sub sets comprises a set of overlapping oligonucleotides that ject, wherein the step is based on one or more assigned tissue cover every single nucleotide position in the mRNA 50 types or phenotypes selected from the group consisting of a sequences coding for the KIR polypeptides from 5' to 3' and classical HLA tissue type, a non-classical HLA tissue type, an are sequentially shifted by 1-5 nucleotides from the 5' end of accessory molecule phenotype, a KIR polypeptide pheno the preceding overlapping oligonucleotide. type, and a blood group phenotype. In certain of the above embodiments, said capture oligo In certain of the above embodiments, the method for HLA nucleotides further comprise a plurality of oligonucleotide 55 tissue typing further comprises the step of determining the Subsets targeting blood group-determining polypeptide likely response of said Subject to a particular treatment regi encoding nucleic acids (“blood group determining oligo Sub men selected from the group consisting of bone marrow sets’), and said method further comprises the step of assign transplantation, immunosuppressive regimen, antiviral drug ing to the sample, based on the hybridization pattern, a blood regimen, antiviral drug resistance, antiretroviral drug regi group phenotype; wherein each of said blood group determin 60 men, and autoimmunity drug regimen, wherein the step is ing oligo Subsets comprises a set of overlapping oligonucle based on one or more assigned phenotypes selected from the otides that cover every single nucleotide position in the group consisting of a classical HLA tissue type, a non-clas mRNA sequences coding for the blood group-determining sical HLA tissue type, an accessory molecule phenotype, a polypeptides from 5' to 3' and are sequentially shifted by 1-5 KIR polypeptide phenotype, and a blood group phenotype. In nucleotides from the 5' end of the preceding overlapping 65 certain other embodiments, the method for HLA tissue typing oligonucleotide. In a specific embodiment, said blood group further comprises the step of determining whether the subject determining polypeptides are selected from the group con is likely to develop antiretroviral drug resistance or cancer US 8,969,254 B2 5 6 drug regimen resistance, wherein the step is based on one or oligonucleotide sequences shown in FIG. 2 have, from top to more assigned phenotypes selected from the group consisting bottom, SEQID NOs: 428783-428809. of a classical HLA tissue type, a non-classical HLA tissue FIG.3 shows a set of tiling capture oligonucleotides (P1 to type, an accessory molecule phenotype, a KIR polypeptide P13) covering the A*02:01:01:01 sequence. The oligonucle phenotype, and a blood group phenotype. otide sequences shown in FIG. 3 have, from top to bottom, In certain of the above embodiments, said capture oligo SEQID NOs: 4288.10-428823. nucleotides further comprise at least one set of negative con FIG. 4. is a graph demonstrating the relationship between trol oligonucleotides. In certain embodiments, said at least target melting temperature and the capture oligonucleotide one set of negative control nucleotides comprises two or more melting temperature range. of the nucleic acid sequences set forth in at least one of Tables 10 FIG. 5 contains pie graphs demonstrating the portioning of VI-X. capture oligonucleotides with regard to (A) typing targets and In one embodiment, a microarray comprising a substrate (B) negative control oligonucleotides. having disposed thereon capture oligonucleotides comprising FIG. 6 shows histograms of capture oligonucleotide distri the nucleic acid sequences set forth in Table I is provided. In bution according to (A) capture oligonucleotide length and another embodiment, a microarray comprising a substrate 15 (B) melting temperature. having disposed thereon capture oligonucleotides comprising FIG. 7 is a table displaying the maximum, minimum, the nucleic acid sequences set forth in Table I further has mean, median, and geometric mean of the probe signals at disposed thereon capture oligonucleotides comprising the position 31 of alignment of all HLA-A, B, C alleles. nucleic acid sequences set forth in Table II. FIG. 8 is flow diagram showing the approach for combin In another embodiment, a microarray comprising a Sub ing gap penalty method and pair-wise comparison method for strate having disposed thereon capture oligonucleotides com identification of sample HLA alleles. prising the nucleic acid sequences set forth in Table X is FIG. 9 contains graphs showing A*02010101 and provided. In another embodiment, a microarray comprising a A*03010101 probe signals of (A) sample D and (B) sample Substrate having disposed thereon capture oligonucleotides E. The thick, darker lines plot probe signals at each alignment comprising the nucleic acid sequences set forth in Table X 25 position and the thinner, lighter-colored lines plots thresholds and denoted by “HPN,” “HPE” or “HPT is provided. In (cutoffs) at each position. The threshold used here is the 10% another embodiment, a microarray comprising a substrate of the maximum signal at each position. having disposed thereon capture oligonucleotides comprising FIG. 10 shows an example of applying a pairwise compari the nucleic acid sequences set forth in Table II is provided. son method on array E1A1A1 for predicting of HLA-A alle In certain of the embodiments, the microarray having dis 30 les. (A) The input page of pairwise comparison method. A list posed thereon capture oligonucleotides comprising the of representative HLA-A alleles are input in the textbox and nucleic acid sequences set forth in Table I and/or Table II, array E1S1A1 is chosen. (B) Pairwise comparison is per further has disposed thereon capture oligonucleotides com formed between each pair of the input alleles. The times of prising the nucleic acid sequences set forth in one or more of winning of one allele over the other are Summarized in a table. Tables III-X. 35 (C) The detailed signal comparison table of A*02010101 Unless otherwise defined, all technical and scientific terms against A*03010101. Each allele is indicated in the first col used herein have the same meaning as commonly understood umn (on left); the starting nucleic acid position is shown in the by one of ordinary skill in the art to which this invention second column; the oligonucleotide sequences are given in pertains. In case of conflict, the present document, including the third column, labeled “Probe’, and have, numbered from definitions, will control. 40 top to bottom, SEQ ID NOs: 428824-428858; the melting All publications, patent applications, patents, and other temperature (in degrees Celsius) is shown in the fourth col references mentioned herein are incorporated by reference in umn; HLA coverage is shown in the fifth column and the their entirety. The materials, methods, and examples dis numbers represent the number of different alleles; the sixth closed herein are illustrative only and not intended to be column shows the array signal for each oligo; and the seventh limiting. 45 column shows the voting results—"similar” means there was The details of one or more embodiments of the invention no winner and if there was a winner, the winning allele is are set forth in the accompanying drawings and the descrip identified. (D) The final voting table summarizing the voting tion below. Preferred methods and materials are described situation of all the alleles is shown; each individual number below, although methods and materials similar or equivalent describes the difference between number of winning in pair to those described herein can also be used in the practice or 50 wise comparison; for example 106 in the row 3 column 4 testing of the present invention. Other features, objects, and means that A*03010101 won 106 times more than advantages of the invention will be apparent from the descrip A*02010101 in pairwise comparison. The values in the bot tion and drawings, and from the claims. tom row are the averages of all results in each column, indi cating the overall Voting value. The highlighted cells indicate DESCRIPTION OF DRAWINGS 55 the likely winners, which need to be checked for potential masking. FIG. 1 is a flow chart of HLA typing using an oligonucle otide microarray. The whole process can be organized into DETAILED DESCRIPTION three major steps. The first step involves oligonucleotide “probe' design and microarray experiment. The second step 60 Overview covers probe signal (i.e., fluorescent cFNA) preprocessing. Various aspects of the invention are described below. The third step covers the signal analysis programs for identi Provided herein are capture oligonucleotides and methods fication of sample HLA profiles. of their use for determining with high resolution the haplo FIG.2 shows a set of oligonucleotides (P1 to P13) covering types of several families of polymorphic polypeptides. A*02:01:01:01 sequence and their corresponding negative 65 Within a specific embodiment, the polymorphic polypeptides control oligonucleotides (P1N to P13N) generated based on are HLA polypeptides. Within one embodiment, the inven the consensus sequence of HLA class I sequence group. The tion provides an array comprising capture oligonucleotides US 8,969,254 B2 7 8 that target nucleic acids encoding classical HLA polypep For example, within certain embodiments, the arrays and tides. Within another embodiment, the array comprises cap methods of their use described herein are useful for diagnos ture oligonucleotides that target nucleic acids encoding non ing or predicting the likelihood of an HLA-linked genetic classical HLA polypeptides. Within yet another embodiment, defect, disease, inadequate or undesirable response to a vac the array comprises capture oligonucleotides that target cine, biologic treatment (recombinant protein, biosimilar or nucleic acids encoding all known classical and non-classical equivalent), or infectious organism or condition in said Sub HLA polypeptides, and in certain embodiments, the array ject, wherein the step is based on one or more assigned tissue additionally or alternatively comprises capture oligonucle types or phenotypes selected from the group consisting of a otides that target nucleic acids encoding accessory molecules classical HLA tissue type, a non-classical HLA tissue type, an important in HLA-linked peptide presentation and/orantigen 10 accessory molecule phenotype, a KIR polypeptide pheno processing, killer-cell immunoglobulin-like receptor (KIR) type, and a blood group phenotype. polypeptides, and/or blood group determining polypeptides. Within another embodiment, the immunologic application All of these different targets (e.g., classical and non-classical of the arrays provided herein includes the ability to derive HLA polypeptides accessory molecules, KIR polypeptides donor/recipient compatibility for bone marrow/tissue/organ and blood group determining polypeptides) are referred to 15 transplant. collectively herein as “array targets.” Definitions Within certain embodiments, a key feature of the methods As used herein, the term “HLA polypeptide' refers to an and oligonucleotide arrays provided herein is that they pro amino acid sequence encoded by a human leukocyte antigen vide an efficient and accurate method for determining the (“HLA) allele. The term, “HLA haplotype” refers to a com HLA tissue type of a sample using a single assay (e.g., array bination of specificalleles from different HLA loci expressed chip). This feature provides a dramatic improvement over as a combination of HLA genes characteristic for a given currently available “traditional technologies, which are inef individual. ficient because they typically require multiple assays and As used herein, the term “all known in the context of follow up nucleic acid sequencing in order to determine the classical and/or non-classical HLA molecules means all of complete HLA tissue type of a sample. 25 the HLA alleles for which the nucleic acid sequences are Within certain embodiments, the arrays comprise sets of publically available at the time of assigning an HLA haplo capture oligonucleotides that provide a highly dense coverage type to a sample using the method claimed herein. The of the entire polypeptide-encoding nucleic acid sequence of sequences are preferably, although not necessarily, available each array target using an approach referred to herein as from publically accessible databases, which are constantly “walking. Using the “walking' approach, each oligonucle 30 updated with all known sequences available, such as, e.g., the otide in a capture oligonucleotide set (i.e. a set targeting one HLA database IMGT/HLA, accessible at http://www. specific array target) is sequentially shifted by about 1 to ebi.ac.uk/imgt/hlaf, the KIR database IPD-KIR, accessible at about 5 nucleotides from the 5' end of the preceding overlap http://www.ebi.ac.uk/ipd/kirt, and the blood group antigen ping oligonucleotide. Herein, sequential shifting by 1 nucle database accessible at http://www.ncbi.nlm.nih.gov/projects/ otide is also referred to as “step 1, sequential shifting by 2 35 gV/mhc/XSlcgi.cgi?cmd=bgmut/systems. Allele sequences nucleotides is also referred to as “step 2, and so on. As an for, e.g., accessory molecules and other molecules, are also example of this process, if a first oligonucleotide has the available at GenBank(R) (National Institutes of Health (NIH) sequence, ATGGCCGTCATGGCGCCCCGAAC (SEQ ID genetic sequence database), available at http://www.ncbi.n- NO: 1), the next oligonucleotide in the set, if it is sequentially lm.nih.gov/). shifted by 1 nucleotide (i.e., a “step 1 shift’) will have the 40 The term “tissue typing as used herein refers to determin sequence TGGCCGTCATGGCGCCCCGAAC (SEQ ID ing which of a number of isoforms and alleles of one or more NO: 2), whereas if that oligonucleotide is sequentially shifted families of polymorphic protein molecules are expressed in a by 2 nucleotides, rather than 1, it can have the sequence cell (e.g., tissue). Such families include, for example, classi GGCCGTCATGGCGCCCCGAAC (SEQID NO:3), and so cal HLA polypeptides, non-classical HLA polypeptides, KIR on. This approach produces a set of highly overlapping cap 45 polypeptides, accessory molecule polypeptides, and blood ture oligonucleotides, thereby providing dense coverage of group determining polypeptides. each target sequence, which is important for high resolution The terms “HLA typing and “HLA tissue typing are used typing of highly polymorphic genes Such as HLA. interchangeably herein, and refer to the process that identifies In other embodiments, the arrays comprise capture oligo the specific allele expressed for each gene at one or more of nucleotides that target accessory molecules important in pep 50 the HLA-A. HLA-B, HLA-C, HLA-DR, HLA-DQ, and tide loading on HLA molecules and/or antigen processing, HLA-DP (classical HLA) gene loci in a sample (e.g., cells and/or killer-cell immunoglobulin-like receptor (KIR) such as white blood cells, or cells derived from tissues). The polypeptides, and/or blood group determining polypeptides. process described by these terms can also, but does not nec In a preferred embodiment, the array comprises capture oli essarily, include identifying the specific allele expressed for gonucleotides that target classical HLA molecules and/or 55 each gene at one or more of the HLA-E, HLA-F, HLA-G, non-classical HLA molecules (such arrays being referred to DM, DO, and MIC (non-classical HLA) gene loci. herein in general as “HLA oligonucleotide arrays”), and, in The term “nucleic acid hybridization” refers to the pairing addition, comprises capture oligonucleotides that target of complementary Strands of nucleic acids. The mechanism accessory molecules important in peptide loading on HLA of pairing involves hydrogen bonding, which may be Watson molecules and/or antigen processing, and/or KIR polypep 60 Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, tides, and/or blood group determining polypeptides. The between complementary nucleoside or nucleotide bases inclusion of these additional targets, e.g., certain accessory (nucleobases) of the Strands of nucleic acids. For example, molecules, KIR polypeptides and/or blood group determin adenine and thymine are complementary nucleobases that ing polypeptides, in the HLA oligonucleotide array provides pair through the formation of hydrogen bonds. Hybridization an efficient tool for obtaining a detailed analysis of a patient 65 can occur under varying circumstances. Nucleic acid mol sample relevant for a wide variety of immunologic applica ecules are “hybridizable to each other when at least one tions. Strand of one nucleic acid molecule can form hydrogen bonds US 8,969,254 B2 9 10 with the complementary bases of another nucleic acid mol at least moderately stringent conditions, and preferably, ecule under defined stringency conditions. Stringency of highly stringent conditions, as discussed above. hybridization is determined, e.g., by (i) the temperature at As used herein, the term “complementary sequence when which hybridization and/or washing is performed, and (ii) the referring to a nucleic acid sequence, refers to the nucleic acid ionic strength and (iii) concentration of denaturants such as base sequence that can form a double-stranded structure (du formamide of the hybridization and washing Solutions, as plex) by matching bases to bases in a reference sequence. For well as other parameters. Hybridization requires that the two example, the complementary sequence to the reference Strands contain Substantially complementary sequences. sequence G-T-A-C is C-A-T-G (SEQ ID NOs: 428859 and Depending on the stringency of hybridization, however, some 428860, respectively). Within certain embodiments, a degree of mismatches may be tolerated. Under “low strin 10 complementary sequence can have mismatches at certain gency' conditions, a greater percentage of mismatches are nucleic acid residues with the reference sequence. In contrast, tolerable (i.e., will not prevent formation of an anti-parallel as used herein, the “exact complement of a reference nucleic hybrid). See Molecular Biology of the Cell, Alberts et al., 3rd acid sequence refers to a complementary sequence that con ed., New York and London: Garland Publ., 1994, Ch. 7. tains no base mismatches with the reference sequence. Typically, hybridization of two strands at high Stringency 15 As used herein, the term “hybridization pattern” refers to requires that the sequences exhibit a high degree of comple the raw data of a microarray assay, wherein, for example, the mentarity over an extended portion of their length. Examples detectably labeled nucleic acid sample (e.g., cDNA or of high Stringency conditions include: hybridization to filter cRNA), or detectably labeled detection probes bound to bound DNA in 0.5 MNaHPO4, 7% SDS, 1 mM EDTA at 65° nucleic acids (cDNA or cRNA sample) hybridized to capture C., followed by washing in 0.1xSSC/0.1% SDS (where oligonucleotides on the array, are detected in a specific pat 1xSSC is 0.15 M NaCl, 0.15 M Na citrate) at 68° C. or for tern of detectable signal, the specific pattern being deter oligonucleotide (oligo) inhibitors washing in 6xSSC/0.5% mined by which nucleic acid targets are present in the tested sodium pyrophosphate at about 37° C. (for 14 nucleotide sample. Hybridization patterns of different samples can also long oligos), at about 48°C. (for about 17 nucleotide-long be compared visually, as long as the samples are hybridized to oligos), at about 55° C. (for 20 nucleotide-long oligos), and at 25 microarray slides having capture oligonucleotides spotted on about 60°C. (for 23 nucleotide-long oligos). the slides in identical locations. Hybridization patterns can be Conditions of intermediate or moderate stringency (such determined using, e.g., pattern recognition algorithms. as, for example, an aqueous solution of 2xSSC at 65° C.; As used herein, the term “classical HLA oligo subset' alternatively, for example, hybridization to filter-bound DNA refers to a collection of capture oligonucleotides, the nucleic in 0.5 MNaHPO4, 7% SDS, 1 mM EDTA at 65° C. followed 30 acid sequences of which collectively represent the nucleic by washing in 0.2xSSC/0.1% SDS at 42°C.) and low strin acid sequence encoding a classical HLA polypeptide (e.g., a gency (such as, for example, an aqueous solution of 2XSSC at nucleic acid sequence encoding a specific HLA-A allele (e.g., 55° C.), require correspondingly less overall complementar HLA-A*0101 or HLA-A*0201)). As used herein, the term ity for hybridization to occur between two sequences. Spe “non-classical HLA oligo subset' refers to a collection of cific temperature and salt conditions for any given stringency 35 capture oligonucleotides, the nucleic acid sequences of which hybridization reaction depend on the concentration of the collectively represent the nucleic acid sequence encoding a target DNA or RNA molecule and length and base composi non-classical HLA polypeptide (e.g., a nucleic acid sequence tion of the probe, and are normally determined empirically in encoding a specific HLA-E allele (e.g., HLA-E 01 01 or preliminary experiments, which are routine (see Southern, J. HLA-E* 0103)). Similarly, the term “accessory molecule Mol. Biol. 1975: 98:503; Sambrook et al., Molecular Clon 40 oligo Subset' refers to a collection of capture oligonucle ing: A Laboratory Manual, 2nd ed., vol. 2, ch. 9.50, CSH otides, the nucleic acid sequences of which collectively rep Laboratory Press, 1989; Ausubel et al. (eds.), 1989, Current resent the nucleic acid sequence encoding a target accessory Protocols in Molecular Biology, Vol. I, Green Publishing molecule polypeptide; the term “KIRoligo subset' refers to a Associates, Inc., and John Wiley & Sons, Inc., New York, at p. collection of capture oligonucleotides, the nucleic acid 2.10.3). An extensive guide to the hybridization of nucleic 45 sequences of which collectively represent the nucleic acid acids is found in, e.g., Tijssen (1993) Laboratory Techniques sequence encoding a target KIR polypeptide; and the term in Biochemistry and Molecular Biology Hybridization “blood group determining oligo subset' refers to a collection with Nucleic Acid Probes part I, chapt 2. “Overview of prin of capture oligonucleotides, the nucleic acid sequences of ciples of hybridization and the strategy of nucleic acid probe which collectively represent the nucleic acid sequence encod assays. Elsevier, N.Y. (“Tijssen'). 50 ing a target blood group determining polypeptide. As used herein, the term “standard hybridization condi The term, “collectively target(s) with reference to a set of tions’ refers to hybridization conditions that allow hybridiza capture oligonucleotides, means that, taking the entire set tion of two nucleotide molecules having at least 50% together, the nucleic acid sequences of the set are comple sequence identity. According to a specific embodiment, mentary to the full length nucleic acid sequence of their hybridization conditions of higher stringency may be used to 55 target. allow hybridization of only sequences having at least 75% As used herein, the terms “KIR polypeptide phenotype' sequence identity, at least 80% sequence identity, at least 90% refers to a specific set of KIR alleles expressed by a sample sequence identity, at least 95% sequence identity, or at least (e.g., cell), as determined according to the methods described 99% sequence identity. herein. As used herein, the phrase “under hybridization condi 60 As used herein, the term “blood group phenotype” refers to tions' means conditions under conditions that facilitate spe the specific blood group of a sample (e.g., cell), including cific hybridization of a subset of capture oligonucleotides to ABO (ABO), Chido Rodgers (CH/RG), Colton (CO), complementary sequences present in the cDNA or cRNA. Cromer (CROM), Diego (DI) (band 3), Dombrock (DO), The terms “hybridizing specifically to” and “specific hybrid Duffy (DARC), Gerbich (Ge), Gill (GIL), Globoside and Pk, ization” and “selectively hybridize to.” as used herein refer to 65 H(H), I (I), Indian (IN), John Milton Hagen (JMH), Kell the binding, duplexing, or hybridizing of a nucleic acid mol (KEL) and KX (XK), Kidd (JK), Knops (KN), Landsteiner ecule preferentially to a particular nucleotide sequence under Wiener (LW), Lewis (LE), Lutheran (LU), MNS (MNS) US 8,969,254 B2 11 12 (Glycophorins A, B and E), Ok (OK), Raph (RAPH), Rh(RH) the genome, e.g., one or more clones, an isolated whole and Rh-gp (RHAG), Scianna (SC), T/Tn, Xg (XG), and Yt chromosome or chromosome fragment, or a collection of (YT), as determined according to the methods described polymerase chain reaction (PCR) amplification products. herein. The term can also, but does not necessarily, encom Alternatively, the probes of the present invention are synthe pass a blood group Subtype. Such as Subtype A1 or A2. sized and have sequences corresponding to a source of As used herein, the term "deriving donor/recipient trans nucleic acids. The probes of the present invention correspond plant compatibility’ means determining whether a tissue to or are produced from nucleic acids found in the regions (cell, organ, skin, etc.) from a potential donor is suitable for described herein. The probe or genomic nucleic acid sample transplantation into a recipient. Typically, a suitable donor may be processed in some manner, e.g., by removal of repeti will have an HLA tissue type that is compatible (i.e. the same 10 or highly similar) to that of the transplant recipient. tive nucleic acids or enrichment with unique nucleic acids. “Polypeptide' and “protein’ are used interchangeably and “Probe signal' means the level of fluorescence measured mean any peptide-linked chain of amino acids, regardless of (e.g., by optical scanner) from hybridized oligonucleotides length or post-translational modification. on the array. As used herein, the term “allele' refers to a specific version 15 One of skill will recognize that the precise sequence of the of a nucleotide sequence of a polymorphic gene. particular probes described herein can be modified to a cer As used herein, the term “nucleic acid' or "oligonucle tain degree to produce probes that are “substantially identi otide' refers to a deoxyribonucleotide or ribonucleotide in cal to the disclosed probes, but retain the ability to specifi either single- or double-stranded form. The term also encom cally bind to (i.e., hybridize specifically to) the same targets or passes nucleic-acid-like structures with synthetic backbones. samples as the probe from which they were derived (see DNA backbone analogues provided by the invention include discussion above). Such modifications are specifically cov phosphodiester, phosphorothioate, phosphorodithioate, ered by reference to the individual probes described herein. methylphosphonate, phosphoramidate, alkyl phosphotri The terms “nucleic acid array.” “array' and “microarray'. ester, Sulfamate, 3'-thioacetal, methylene(methylimino), as used herein, refer to a plurality of nucleic acid molecules 3'-N-carbamate, morpholino carbamate, and peptide nucleic 25 (capture oligonucleotides) immobilized on a solid Surface acids (PNAS); see Oligonucleotides and Analogues, a Practi (e.g., nitrocellulose, glass, quartz, fused silica slides and the cal Approach, edited by F. Eckstein, IRL Press at Oxford like) to which sample nucleic acids (e.g., cDNA or cRNA) are University Press (1991); Antisense Strategies, Annals of the hybridized. The nucleic acids may contain sequence from New York Academy of Sciences, Volume 600, Eds. Baserga specific genes or clones, such as the capture oligonucleotides and Denhardt (NYAS1992); Milligan (1993).J. Med. Chem. 30 of the invention, as disclosed herein. Other capture oligo 36:1923-1937; Antisense Research and Applications (1993, nucleotides optionally contain, for instance, reference CRC Press). PNAS contain non-ionic backbones, such as sequences. The capture oligonucleotides of the arrays may be N-(2-aminoethyl)glycine units. Phosphorothioate linkages arranged on the Solid Surface at different densities. The cap are described in WO97/03211; WO 96/39154: Mata (1997) ture oligonucleotides densities will depend upon a number of Toxicol. Appl. Pharmacol. 144:189-197. Other synthetic 35 factors, such as the nature of the label, if any, the Solid Sup backbones encompassed by the term include methyl-phos port, and the like. phonate linkages or alternating methylphosphonate and phos An "isolated nucleic acid molecule' (e.g., isolated cDNA) phodiester linkages (Strauss-Soukup (1997) Biochemistry is either (1) a nucleic acid molecule that contains sequence 36:8692-8698), and benzylphosphonate linkages (Samstag not identical to that of any naturally occurring sequence, or (1996) Antisense Nucleic Acid Drug Dev 6:153-156). The 40 (2), in the context of a nucleic acid molecule with a naturally term nucleic acid is used interchangeably with cDNA, cRNA, occurring sequence (e.g., a cDNA, cRNA or genomic DNA), mRNA, oligonucleotide, probe and amplification product. a nucleic acid molecule free of at least one of the genes that As used herein, the term “capture oligonucleotide' refers flank the gene containing the nucleic acid molecule of interest to a nucleic acid sequence that specifically hybridizes to a in the genome of the organism in which the gene containing target nucleic acid sequence (e.g., cDNA or cRNA). A capture 45 the nucleic acid molecule of interest naturally occurs. The oligonucleotide is intended to be hybridized to a solid support term also includes a separate molecule Such as: a cDNA (e.g., microarray slide) for the detection of the presence of a where the corresponding genomic DNA has introns and particular target sequence (e.g., cDNA or cRNA). One of skill therefore a different sequence; a genomic fragment that lacks will recognize that the precise sequence of the particular at least one of the flanking genes; a fragment of cDNA or capture oligonucleotides described herein can be modified to 50 genomic DNA produced by polymerase chain reaction (PCR) a certain degree to produce capture oligonucleotides that are and that lacks at least one of the flanking genes; a restriction “substantially identical to the disclosed capture oligonucle fragment that lacks at least one of the flanking genes; a otides, but retain the ability to specifically bind to (i.e., nucleic acid molecule encoding a non-naturally occurring hybridize specifically to) the same targets or samples as the protein Such as a fusion protein, mutein, or fragment of a capture oligonucleotide from which they were derived. Such 55 given protein; and a nucleic acid which is a degenerate variant modifications are specifically covered by reference to the of a cDNA or a naturally occurring nucleic acid. In addition, individual capture oligonucleotides described herein. it includes a recombinant nucleotide sequence that is part of a The word “sample' may be used herein to refer not only to hybrid gene, i.e., a gene encoding a non-naturally occurring detected nucleic acids, but to the detectable nucleic acids in fusion protein. It will be apparent from the foregoing that an the form in which they are applied to the target. 60 isolated nucleic acid molecule does not mean a nucleic acid The terms “probe'. “detection probe’, or “nucleic acid molecule present among hundreds to millions of other nucleic probe’, as used herein, are defined to be a collection of one or acid molecule molecules within, for example, cDNA or more nucleic acid fragments whose hybridization to a sample genomic DNA libraries or genomic DNA restriction digests can be detected. The probe may be unlabeled or labeled as in, for example, a restriction digest reaction mixture or an described below so that its binding to the target or sample can 65 electrophoretic gel slice. be detected. The probe is produced from a source of nucleic The term 'subject” means any animal, including mammals acids from one or more particular (preselected) portions of and, in particular, humans. US 8,969,254 B2 13 14 Human Leukocyte Antigen (HLA) Polypeptides limited in the number of peptides (e.g. disease or infection The human major histocompatibility genes are among the related peptides) that it can bind. Thus, an individuals spe most polymorphic genes in the human genome. HLA anti cific combination of different HLA molecules (i.e., “HLA gens are encoded by a series of closely linked genes located at tissue type’), which increases the peptide binding repertoire, the position p21 on chromosome 6. Genes of the HLA region 5 is important for how an individual’s immune system can span approximately 4 million bases of DNA, and are clustered respond to infection. The ability to precisely characterize an into three distinct regions designated class I, class II and class individual’s HLA tissue type can therefore facilitate under III. Genes within the class I and class II regions share struc standing of how an individual’s immune system can respond tural and functional properties and are considered to be part of to a particular infection. A large number of Studies have the immunoglobulin gene Super family. Although distinct in 10 reported correlation with specific HLA profiles and suscep sequence and structure, both class I and class II genes encode tibility to or severity of disease. proteins that are critical in controlling T-cell recognition and Role of HLA in Graft Rejection determining histocompatibility in marrow transplantation Transplant rejection occurs when a transplanted organ or (Rammensee, Curr. Opin. Immunol. 7:85-96 (1995)). tissue is not accepted by the body of the transplant recipient, At least 17 loci including several pseudogenes exist in the 15 typically because the transplanted organ or tissue is recog HLA class I region. Three of these loci encode HLA-A. -B nized by the recipient’s immune system as non-self. Any cell and -C alloantigens that constitute the major class I determi displaying an HLA type not expressed by the recipient is nants. The HLA-A. -B and -C loci show a striking degree of recognized as “non-self, resulting in the rejection of the sequence and structural homology with one another and tissue bearing those cells. Thus, it is imperative that tools and genes at all three loci are highly polymorphic (Bodmer et al., methods for carrying out HLA tissue typing with precision Tissue Antigens 49:297-321 (1997)). Currently, more than and efficiency in order to quickly determine whether a poten 1,193 HLA-A, 1,799 HLA-B and 829 HLA-C alleles have tial donor has an HLA tissue type that is compatible with that been described worldwide, and in the U.S. alone, more than of a recipient. 9.7 million different haplotype combinations have been esti Role of HLA in Autoimmunity mated (Maiers et al., Hum Immunol 2007; 68:779-88). More 25 HLA types are inherited, and some of them are connected recently, three additional class I genes, HLA-E (9 alleles), -F with autoimmune disorders and other diseases. People with (21 alleles) and -G (46 alleles), have been defined (Lee et al., certain HLA tissue types are more likely to develop certain Eur J. Immunol. 40:2308-18. (2010); Geraghty et al., Proc. autoimmune diseases, such as Type I Diabetes, Rheumatoid Natl. Acad. Sci. USA 84:9145-49.54 (1987); Koller et al., J. arthritis, Ankylosing spondylitis, Celiac Disease, SLE (Sys Immunol. 141:897-904 (1988)). 30 temic Lupus Erythematosus), Myasthenia Gravis, inclusion Class II genes are divided into five families, designated body myositis and Sjögren's syndrome. For example, in DR, DQ, DO, DM and DP based on their degree of sequence Celiac disease, HLA tissue typing is the only effective means homology and their location within the HLA-D region. The of discriminating between 1 degree relatives who are at risk HLA class II region is comprised of nine distinct genes: DRA, from those who are not, prior to the appearance of sometimes DRB1, DRB3, DRB4, DRB5, DQA, DQB, DPA and DPB. As 35 irreversible symptoms Such as allergies and secondary with class I genes, class II DR, DQ and DP genes show a autoimmune disease. For HLA typing to lead to some striking degree of polymorphism, with more than 805 alleles improvement and acceleration in the diagnosis of Celiac Dis thus far defined at the DRB1 locus (Marsh SG, Hum Immu ease and Type 1 diabetes, DQ2 typing is necessary. However, nol, (2010)). for DQ2 typing to be useful it requires either high resolution In certain embodiments, the microarrays described herein 40 B1*typing (resolving *0201 from *0202), DQA1*typing, or detect expression of non-classical HLA molecules. Examples DR serotyping. Thus, the arrays provided herein, which pro of non-classical HLA molecules include without limitation, vide high resolution typing of classical HLA polypeptides, CD1 a-c, CD1d, HLA-E, HLA-G, HLA-H, HLA-J, HLA-K, and preferably, all known classical HLA polypeptides, are HLA-L, DM, DOC, DOB, ULBP, EPCR, MR1, FcRn, HFE, useful for diagnosing Such disorders. ZAG, and MIC. Preferably, the non-classical HLA molecules 45 Role of HLA in Cancer detected by the arrays provided herein include at least HLA Some HLA mediated diseases are directly involved in the E. HLA-F, HLA-G, DM, DO and MIC, although a greater or promotion of cancer. For example, gluten sensitive enteropa fewer number of non-classical HLA targets can be included thy is associated with increased prevalence of enteropathy on the arrays. associated T-cell lymphoma, and DR3-DQ2 homozygotes are Role of HLA in Infectious Disease 50 within the highest risk group with close to 80% of gluten When a foreign pathogen enters the body, antigen-present sensitive EATL cases. Thus, the arrays provided herein are ing cells (APCs) engulf the pathogen through a process called useful in diagnosing, e.g., an individual’s risk of developing phagocytosis. Proteins from the pathogen are digested into cancer based on the assigned HLA tissue type of the indi peptides and loaded onto HLA molecules (specifically MHC vidual (see, e.g., Luigi De Petris, et al. Medical Oncology, class II). The peptides are then displayed by the APCs to T 55 Volume 21, Number 1, 49-52, DOI: 10.1385/MO:21:1:49: cells, which then produce a variety of effects to eliminate the Lin P. et al. Cancer Epidemiol Biomarkers Prey. 2001 Octo pathogen. Through a similar process, proteins (both native ber; 10(10): 1037-45; Michallet etal, Leukemia. 10:1725-31, and foreign, Such as the proteins of viruses) produced inside (2010)). most cells are displayed on HLA antigens (specifically MHC Accessory Molecules class I) on the cell Surface. Infected cells can be recognized 60 In certain embodiments, the microarrays described herein and destroyed by components of the immune system (specifi can detect expression of accessory molecules important in cally CD8+ T cells). HLA-linked peptide presentation and/or antigen processing, Peptides, such as, e.g., infection or disease-related peptides including, for example, and without limitation, LMP2, fit into the binding clefts of HLA molecules, and, in these LMP7, LMP10, tripeptidyl peptidase II (TPPII), bleomycin configurations, peptides are presented to T cells. The T cells 65 hydrolase (BLMH), leucine aminopeptidase 3 (LAP3), trans are restricted by the HLA molecules when certain peptides porter associated with antigen processing (TAP) 1, TAP2, are within the binding cleft. Each HLA molecule, however, is B2-microglobulin, TAP binding protein (tapasin), calnexin US 8,969,254 B2 15 16 (CANX), calreticulin (CALR), protein disulfide isomerase molecules are inhibitory, meaning that their recognition of family A member 2 (PDIA2), protein disulfide isomerase MHC suppresses the cytotoxic activity of the NK cell. Only a family A member 3 (PDIA3), ERp57, endoplasmic reticulum limited number of KIRs have the ability to activate cells. KIR aminopeptidase (ERAP) 1, ERAP2, proteasome (prosome genes are highly polymorphic, so that different individuals macropain) subunit althap (PSMA) type I (PSMA1), possess different arrays/repertoires of KIR genes. The poly PSMA2, PSMA3, PSMA4, PSMA5, PSMA6, PSMA7, morphic KIR genes are found in a cluster on chromosome PSMA8, proteasome (prosome macropain) subunit beta 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). (PSMB) type 1 (PSMB1), PSMB2, PSMB3, PSMB4, The gene content of the KIR gene cluster varies among hap PSMB5, PSMB6, PSMB7, PSMB8, PSMB9, PSMB10, lotypes, although several "framework genes are found in all PSMB11, proteasome (prosome macropain) 26S subunit 10 haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). ATPase (PSMC) 1 (PSMC1); PSMC2, PSMC3, PSMC4, The KIR proteins are classified by the number of extracellular PSMC5, PSMC6, proteasome (prosome macropain)26S sub immunoglobulin domains (2D or 3D) and by whether they unit non-ATPase (PSMD) 1 (PSMD1), PSMD2, PSMD3, have a long (L) or short (S) cytoplasmic domain. KIR proteins PSMD4, PSMD5, PSMD6, PSMD7, PSMD8, PSMD9, with the long cytoplasmic domain transduce inhibitory sig PSMD10, PSMD11, PSMD12, PSMD13, and PSMD14. 15 nals upon ligand binding via an immune tyrosine-based These molecules are summarized by the following nomen inhibitory motif (ITIM), while KIR proteins with the short clature: CANX, ERAP1-2, B2M, CALR, PDIA2,3, PSMA 1 cytoplasmic domain lack the ITIM motif and instead associ 8, PSMB1-11, PSMC1-6, PSMD1-14, TAP12, TAPBP ate with the TYRO protein tyrosine kinase binding protein to TPP2, BLMH, and LAP3. transduce activating signals. The ligands for several KIR pro In a preferred embodiment, the arrays provided herein can teins are subsets of HLA class I molecules; thus, KIR proteins simultaneously determine HLA tissue type and an accessory are thought to play an important role in regulation of the molecule phenotype (expression of one or more accessory immune response. molecules important in peptide loading and/or antigen pro KIR involvement in tissue transplant has been reported. cessing) in a single assay (e.g. on a single microarray slide). Specifically, it has been reported that certain combinations of However, in other embodiments, the array specific for detect 25 HLA and KIR haplotypes may affect outcome in T-cell ing expression of such accessory molecules can be carried out depleted haematopoietic stem cell transplantation (HSCT) separately (e.g., on a separate microarray slide and/or in a (Chen, C. et al. Bone Marrow Transplantation (2006) 38. separate assay). Within one embodiment, arrays comprising 437-444). Thus, the determination of the KIR phenotype of an both HLA oligonucleotides (classical and/or non-classical individual can be useful for determining donor/recipient HLA oligonucleotides) and accessory molecule oligonucle 30 transplant compatibility. Examples of KIR molecules, the otides targeting, e.g., the accessory molecules described expression of which can be determined by the assays and above, are useful for determining donor/recipient transplant method provided herein, include without limitation, KIR compatibility. 2DL1, 2DL2, 2DL3, 3DL1, 3DL2, 2DS1, 2DS2, 2DS3, Within other embodiments, such combined HLA/acces 2DS4, 2DS5, and 3DS1. Furthermore, within certain embodi sory molecule arrays are useful for diagnosing or predicting 35 ments, the present arrays provide the ability to simulta the likelihood of an HLA-linked genetic defect, disease, inad neously determine both HLA tissue type and KIR haplotype equate or undesirable response to a vaccine, biologic treat ofa sample on a single array, which provides a highly efficient ment (recombinant protein, biosimilar or equivalent), or and informative assay for determining donor/recipient com infectious organism, or condition in a Subject, wherein the patibility, in addition to other diagnostic uses. For example, step is based on one or more assigned HLA tissue types 40 within certain embodiments, such combined HLA/KIR (including classical and/or non-classical HLA alleles) and an polypeptide arrays are useful for diagnosing or predicting the accessory molecule phenotype. likelihood of an HLA-linked genetic defect, disease, inad Within other embodiments, such combined HLA/acces equate or undesirable response to a vaccine, biologic treat sory molecule arrays are useful for determining the likely ment (recombinant protein, biosimilar or equivalent), or response of a subject to a particular treatment regimen 45 infectious organism, or condition in a Subject, wherein the selected from the group consisting of bone marrow trans step is based on one or more assigned HLA tissue types plantation, immunosuppressive regimen, antiviral drug regi (including classical and/or non-classical HLA alleles) and a men, antiviral drug resistance, antiretroviral drug regimen, KIR phenotype. and autoimmunity drug regimen, wherein the step is based on Within other embodiments, such combined HLA/KIR one or more assigned HLA tissue types (including classical 50 polypeptide arrays are useful for determining the likely and/or non-classical HLA alleles) and an accessory molecule response of a subject to a particular treatment regimen phenotype. selected from the group consisting of bone marrow trans Within other embodiments, such combined HLA/acces plantation, immunosuppressive regimen, antiviral drug regi sory molecule arrays are useful for determining whether the men, antiviral drug resistance, antiretroviral drug regimen, Subject is likely to develop antiretroviral drug resistance or 55 and autoimmunity drug regimen, wherein the step is based on cancer drug regimen resistance, wherein the step is based on one or more assigned HLA tissue types (including classical one or more assigned HLA tissue types (including classical and/or non-classical HLA alleles) and a KIR phenotype. and/or non-classical HLA alleles) and an accessory molecule Within other embodiments, such combined HLA/KIR phenotype. polypeptide arrays are useful for determining whether the Killer-cell Immunoglobulin-Like Receptor (KIR) Molecules 60 Subject is likely to develop antiretroviral drug resistance or Killer-cell immunoglobulin-like receptors (KIR mol cancer drug regimen resistance, wherein the step is based on ecules) are a family of cell Surface proteins found on natural one or more assigned HLA tissue types (including classical killer (NK) cells. KIR molecules regulate the killing function and/or non-classical HLA alleles) and KIR phenotype. of NK cells by interacting with MHC class I molecules, which Blood Group Determining Molecules are expressed on all cell types. This interaction allows them to 65 Distinct molecules called agglutinogens are attached to the detect virally infected cells or tumor cells that have a charac surface of red blood cells. There are two different types of teristic low level of Class I MHC on their Surface. Most KIR agglutinogens, type “A” and type “B”. Each type has different US 8,969,254 B2 17 18 properties. The ABO blood type classification system uses the blood donor and recipient is dependent upon the blood group presence or absence of these molecules to categorize blood factors mentioned above. Compatibility is a clinical necessity into four types: A, B, AB, and O. In each individual, two due to the fatal consequences of blood agglutination which alleles encoding the enzymes responsible for determining can result from incompatibility. By determining these factors blood group antigens are inherited, one from each parent. The of both donor and recipient using the array and methods possible combinations of alleles produce blood types in the herein, compatible donors can be selected. following way: AA, AB, AO, BABB, BO, OA, OB, OO. The Solid Supports A and B antigen molecules on the surface of red blood cells The Solid Supports, e.g., microarray slides, used in the are produced by two different enzymes. These two enzymes present invention may be biological, nonbiological, organic, are encoded by different versions, oralleles, of the same gene: 10 inorganic, or a combination of any of these, existing as par A and B. ticles, strands, precipitates, gels, sheets, tubing, spheres, con The A and Balleles code for enzymes that produce the type tainers, capillaries, pads, slices, films, plates, slides, etc. The A and B antigens respectively. The A allele encodes a glyco solid support is preferably flat but may take on alternative Syltransferase that bonds C.-N-acetylgalactosamine to the Surface configurations. For example, the Solid Support may D-galactose end of the H antigen, producing the A antigen. 15 contain raised or depressed regions on which synthesis takes The Ballele encodes a glycosyltransferase that joins C-D- place. In some embodiments, the Solid Support will be chosen galactose bonded to the D-galactose end of the H antigen, to provide appropriate light-absorbing characteristics. For creating the B antigen. A third version of this gene, the O example, the Support may be a polymerized Langmuir allele, contains a deletion of a single nucleotide (guanine at Blodgett film, functionalized glass, Si, Ge. GaAs, Gap, SiO, position 261 in exon 6), which results in loss of enzymatic SiNa, modified silicon, or any one of a variety of gels or activity of the encoded protein, thereby leading to failure to polymers such as (poly) tetrafluoroethylene, (poly) vinyliden modify the H antigen. difluoride, polystyrene, polycarbonate, or combinations Another level of specificity is added to blood type by thereof. Other suitable solid support materials will be readily examining the presence or absence of the Rh protein. Each apparent to those of skill in the art. Preferably, the surface of blood type is either positive “+” (has the Rh protein) or 25 the solid Support will contain reactive groups, which could be negative '-' (no Rh protein). For example, a person whose carboxyl, amino, hydroxyl, thiol, or the like. More preferably, blood type is “A positive” (A +), has both type A and Rh the surface will be optically transparent and will have surface proteins on the surface of their red blood cells. Si-OH functionalities, such as are found on silica Surfaces. Determining the blood type of a sample, in addition to the Linking Groups HLA tissue type can be useful, e.g., for the determination of 30 Attached to the Solid Support is an optional spacer or link donor/recipient compatibility for e.g., tissue transplant. The ing group. The spacer molecules are preferably of Sufficient arrays provided herein provide an efficient method for simul length to permit the capture oligonucleotides in the com taneously determining both HLA tissue type and blood group pleted array to interact freely with molecules exposed to the in a single assay. In the transplant field, in particular, it is array. The spacer molecules, when present, are typically 6-50 critical that donor/recipient compatibility results be obtained 35 atoms long to provide Sufficient exposure for the attached as quickly and cost-efficiently as possible, and the efficiency probes. The spacer will typically be comprised of a surface of the arrays provided herein address that need. attaching portion and a longer chain portion. The Surface Further, the A, B and Oblood types also contain subgroups. attaching portion is that part of the linking group or spacer For example, there are six common alleles in white individu which is directly attached to the solid support. This portion als of the ABO gene that produce one’s blood type, including 40 can be attached to the solid Support via carbon-carbon bonds A101 (A1), A201 (A2), B101 (B1), O01 (O1), O02 (O1V), using, for example, Supports having (poly)trifluorochloroet and O03 (O2). The different blood groups, and in some cases hylene Surfaces, or preferably, by siloxane bonds (using, for specific Subgroups, can be associated with different diseases, example, glass or silicon oxide as the Solid Support). Siloxane and thus, determining the specific allele of a cell can be bonds with the surface of the support are formed in one important for determining disease Susceptibility. For 45 embodiment via reactions of Surface attaching portions bear example, O group compared to non-Ogroup (A, AB, and B) ing trichlorosilyl or trialkoxysilyl groups. The Surface attach individuals have a 14% reduced risk of squamous cell carci ing groups will also have a site for attachment of the longer noma and 4% reduced risk of basal cell carcinoma. Ogroup is chain portion. For example, groups which are Suitable for also associated with a reduced risk of pancreatic cancer. Fur attachment to a longer chain portion would include amines, ther, the B antigen is linked with increased risk of ovarian 50 hydroxyl, thiol, and carboxyl. Preferred surface attaching cancer, and gastric cancer has been reported to be more com portions include aminoalkylsilanes and hydroxyalkylsilanes. mon in blood group A and least in group O. In particularly preferred embodiments, the Surface attaching Non-limiting examples of blood group determining mol portion of the linking group is eitheraminopropyltriethoxysi ecules that can be determined according to the arrays and lane or aminopropyltrimethoxysilane. methods provided herein include ABO (ABO), Chido Rodg 55 The longer chain portion can be any of a variety of mol ers (CH/RG), Colton (CO), Cromer (CROM), Diego (DI) ecules which are inert to the Subsequent conditions necessary (band 3), Dombrock (DO), Duffy (DARC), Gerbich (Ge), for attaching the oligonucleotide probes, or for hybridization Gill (GIL), Globoside and Pk., H (H), I (I), Indian (IN), John of a sample to the oligonucleotide array. These longer chain Milton Hagen (JMH), Kell (KEL) and Kx (XK), Kidd (JK), portions will typically be ethylene glycol oligomers contain Knops (KN), Landsteiner-Wiener (LW), Lewis (LE), Luth 60 ing 2-14 monomer units, diamines, diacids, amino acids, eran (LU), MNS (MNS, Glycophorins A, B and E), Ok (OK), peptides, or combinations thereof. In some embodiments, the Raph (RAPH), Rh (RH) and Rh-gp (RHAG), Scianna (SC), longer chain portion is a polynucleotide (e.g., a 15-mer of T/Tn, Xg (XG), and Yt (YT). poly dT). Additionally, for use in synthesis of the oligonucle Within certain embodiments, the characterization of blood otide arrays, the linking group will typically have a protecting group determining molecules by the arrays and methods pro 65 group, attached to a functional group (i.e., hydroxyl, amino or vided herein are useful, e.g., in the context of blood transfu carboxylic acid) on the distal or terminal end of the chain sions. Prior to blood transfusion, the compatibility of the portion (opposite the solid Support). After deprotection and US 8,969,254 B2 19 20 coupling, the distal end is covalently bound to a capture these crosslinkers to form a well-defined DNA pattern on the oligonucleotide (e.g., an HLA-A capture oligonucleotide). surface. Spatial resolution of 1 micron per DNA spot is fea Synthesis of Oligonucleotide Arrays on Solid Supports sible using this approach. The attachment of nucleic acids or oligonucleotide mol Three-dimensional immobilization matrices have been ecules to Solid Supports to create highly dense patterns of 5 developed to increase capacity and are contemplated for use diverse capture oligonucleotides on a single Surface has been for the array provided herein. Yershor, et al. (Genetics demonstrated by, for example, Maskos and Southern (Nuc. 93:4913-4918 (1996)), for example, have produced DNA Acids. Res. 20:1679-1684 (1992)), Blanchard and Hood arrays by immobilizing oligonucleotides in acrylamide gel at (Bioelectronics 11:687-690 (1996)), and Fodoretal. (Science a density of 20,000 to 30,000 different capture oligonucle 251:767-773 (1991)). For example, two methodologies that 10 otides per cm, two orders of magnitude higher than the have been used to synthesize oligonucleotide arrays are capacity of two-dimensional Supports, with density increas described by Saiki et al. (Proc. Natl. Acad. Sci. USA. ing as technology advances. The three-dimensional Support 86:6230-6234 (1989)) and Chrisey et al. (Nuc. Acids Res. permits high oligonucleotide loading and enhanced hybrid 24:3040-3047 (1996)). Presynthesized capture oligonucle ization. However, because only short oligonucleotides can otides can be delivered to a solid support by high-speed 15 diffuse into gel matrix, the application of this approach is robotics, and then immobilized on the surface. The resolution limited. of the resulting oligonucleotide array is determined by both b) Spatially Addressable Parallel Chemical Synthesis the spatial resolution of the delivery systems and the physical Solid phase DNA synthesis can be accomplished with a space requirement of the delivered oligonucleotide Solution number of different chemistries. Froehler et al. (Nuc. Acids volume. The surface density of the immobilized capture oli Res. 14:5399-5407 (1986) and McBride and Caruthers (Tet gonucleotides varies greatly with different solid Surface and rahedron Lett. 24:245-248 (1983) have demonstrated solid linkage chemistries (Guo, et al., Nuc. Acids Res. 22:5456 phase DNA synthesis chemistries utilizing H-phosphonate 5465 (1994); Fahy, et al., Nuc. Acids Res. 21:1819-1826 and phosphoramidites, which covalently attach an organic (1993); Wolf, et al., Nuc. Acids Res. 15:2911-2926 (1987); linker molecule to a surface and build the oligonucleotide off and Ghosh, et al., Nuc. Acids Res. 15:5353-5372 (1987)). 25 the terminus of the linker through Successive coupling and In another approach, capture oligonucleotides are synthe deprotection steps. sized directly onto the solid support, nucleotide by nucle Based on this scheme, two distinct approaches have been otide, through a series of coupling and deprotection steps. developed to construct surface-bound oligonucleotide arrays. Both conventional Solid-phase oligonucleotide synthesis One approach (Fodor, et al., supra (1991)) combines solid methods and light-directed combinatorial synthesis methods 30 phase DNA synthesis with semiconductor-based photoli have been Successfully applied in this in situ fabrication pro thography. The major advantage of this approach is the poten cess (Fodor et al., supra (1991) and Gilham, Biochemistry tial to synthesize very high-density arrays comprised of 50 7:2809-2813 (1968)). High reaction yields in both the cou micron spots or less. However, the major drawback to this pling and the deprotection steps are critical for the Success of approach is the need for a photolithographic mask for each in situ synthesis. The preparation of in situ arrays can be 35 unique array of oligonucleotides. For example, an array of automated and thereby increase the complexity of the array 25-mers would require 100 different masks. The expense of compared to the use of presynthesized oligonucleotides. synthesizing these arrays is proportional to the number of a) Spatially-Resolved Attachment Chemistry unique masks. Preferably, a capture oligonucleotide is immobilized onto a Microfabricated ink-jet pumps, similar to those used in Solid Support through a single covalent bond. Gilham (Bio 40 certain ink-jet printers to deliver synthesis reagents onto the chemistry, 7:2809-2813 (1968)), for example, described the surface of a solid support can also be used. Within this attachment of DNA molecules to paper using carbodiimide method, the Surface is scanned across a set of ink-jet pumps via the 5'-end terminal phosphate group. Suitable supports for using a computer-controlled X-y translation stage. In each covalent immobilization of DNA include glass, acrylamide coupling step, DNA monomers are delivered to the defined gel, latex particles, controlled pore glass, dextran Supports, 45 area at rates of several hundred drops per second. polystyrene matrices and avidin-coated polystyrene beads Each of these in situ approaches permits large numbers of and have been described (Guo, et al., Nuc. Acids Res. arrays of unlimited combinatorial matrices to be made in 22:54.56-5465 (1994); Fahy, et al., Nuc. Acids Res. 21:1819 fairly few steps. 1826 (1993); Wolf, et al., Nuc. Acids Res. 15:2911-2926 It is to be understood that the oligonucleotide arrays (1987); Ghosh, et al., Nuc. Acids Res. 15:5353-5372 (1987); 50 described herein can be prepared according to the above Gingeras et al., Nuc Acids Res. 15:5773-5790 (1987); Ras described methods or according to any other suitable method mussen et al., Anal. Biochem. 198:138-142 (1991); and Lund known in the art. et al., Nuc. Acids Res. 16:10861-10880 (1988)). Several other In one embodiment, oligonucleotide arrays can be pre Solid Supports, such as nitrocellulose and nylon membranes pared by: were employed for oligonucleotide immobilization using 55 (a) contacting a solid Support with an aminoalkyltrialkoxysi UV-activated DNA-surface cross-linking chemistry lane in the vapor phase at reduced pressure to form an (Meinkoth and Wahl, Anal. Biochem. 138:267-284 (1984)). aminoalkylsilane-derivatized solid Support; However, in these cases, DNA molecules were non-co (b) contacting the aminoalkylsilane-derivatized solid Support Valently bound to the Surface at multiple sites, hampering with a linking group to covalently attach the linking group reproducibility and stability. 60 to the aminoalkylsilane-derivatized solid Support to form a Fodor, et al. (supra, (1991)) demonstrated the use of pho linking group-modified Solid Support; and tolithographic technology to synthesize high-density oligo (c) attaching a plurality of capture oligonucleotides to the nucleotide arrays on silicon Substrates. In this process, linking group-modified Solid Support to form the array of crosslinkers are first made by exposing a photochemically covalently-attached oligonucleotide probes. labile organosilane surface to UV light. The resulting pattern 65 The solid supports can be any of those described above is then reacted with heterobifunctional crosslinking mol which are conveniently derivatized with a vapor phase depo ecules. The oligonucleotide molecules are then bound to sition of an aminoalkyltrialkoxysilane. The aminoalkyltri US 8,969,254 B2 21 22 alkoxysilanes useful in this aspect of the invention are any of otides can be any collection of nucleic acids or polymer. those that can be utilized in the vaporphase attemperatures of Preferably, the capture oligonucleotides are those that repre from about ambient temperature to about 150° C. at pressures sent one or more of the groups selected from all known of from about 760 mmHg to about 0.1 mmHg. Typically, the classical HLA polypeptides, all known non-classical HLA aminoalkylportion of the silane will be aminopropyl, amino polypeptides, accessory molecules important in antigen pro ethyl or aminomethyl. The trialkoxysilane portion can be one cessing and presentation, KIR polypeptides, and blood group in which the alkoxy groups are all the same (e.g., trimethox determining polypeptides. The capture oligonucleotides are ysilane, triethoxysilane) or one in which the alkoxy groups typically 17 to 60 nucleotides in length, although shorter or are not all alike (e.g., dimethoxyethoxysilane). Accordingly, longer sequences are also contemplated, so that each has a the aminoalkyltrialkoxysilane will typically be selected from 10 melting temperature (T,) with respect to its exact comple aminopropyltrimethoxysilane, aminopropyltriethoxysilane, ment of about 64°C. (e.g., about 64.0, 64.1, 64.2, 64.3, 64.4, aminopropyldiethoxy-methoxysilane, aminoethyltrimethox 64.5 or 64.6°C.). In a specific embodiment, the preferred Tm ysilane, and the like. More preferably, the aminoalkyltri is about 64.3. Preferred capture oligonucleotides have the alkoxysilane is aminopropyltrimethoxysilane. nucleic acid sequences set forth in Tables I-V, below. The As indicated above, a more uniform coating of amino 15 capture oligonucleotides can be prepared by any conventional groups on the Solid Support can be achieved by applying an methods known to those of skill in the art. Alternatively, the aminoalkyltrialkoxysilane in the vapor phase, typically at oligonucleotides can be constructed on the array using the reduced pressure. This can be accomplished by placing the techniques described above (e.g., photolithography, flow Solid Support into a vacuum chamber, evacuating the cham channel, inkjetspotting, and the like). In preferred embodi ber, and introducing the silane. In some embodiments, the ments, the oligonucleotides are constructed using conven vacuum chamber can be heated to facilitate silane vaporiza tional Solution or solid phase chemistry, and then attached to tion and even coating of the Solid Support. For example, when the array's Solid Support component (e.g., slide). aminopropyltrimethoxysilane is used, the pressure will typi Construction of the present arrays is preferably carried out cally be from about 5 to 35 mmHg and the vacuum chamber in a manner that ensures that the capture oligonucleotides are will be heated to a temperature of from about 60 to about 110° 25 present at a surface density of about 250 to about 450 ang C. After a period of time sufficient for formation of an ami strom/molecule, preferably about 325 to about 375 ang noalkylsilane-derivatized solid Support, the Support is strom/molecule, or higher. Methods of measuring oligo removed from the vacuum chamber and rinsed to remove any nucleotide density are well known to those of skill in the art. unbound spacer. Hybridization The resultant support can then be contacted with a suitable 30 Hybridization of DNA to a solid support has similar ther amount of a linking group to covalently attach the linking modynamic behavior compared to hybridization of DNA in group to the aminoalkylsilane-derivatized solid support. In solution. The stability of the double helix can be character Some embodiments, the aminoalkylsilane-derivatized solid ized by its melting temperature, which is strongly dependent support will first be treated with a reagent capable of facili upon oligonucleotide sequence and composition of the Sol tating linking group attachment to the derivatized support. A 35 vent (Wetmur, Crit. Rev. Biochem. & Mol. Bio. 26:227-259 variety of reagents are useful in this aspect of the invention (1991)). This strong-dependence of the duplex stability on including diisocyanates, diisothiocyanates, dicarboxylic oligonucleotide sequence, especially for short oligonucle acids (and their activated esters), and the like. Particular pre otides, makes it difficult to design adequately stringent con ferred are diisothiocyanates (e.g., 1,4-phenylenediisothiocy ditions for hybridization with oligonucleotide arrays, which anate). 40 usually vary widely in base composition. Thus, a large num Once the solid support has been suitably derivatized, a ber of false positive or negative signals may occur when linking group is attached to provide a spacing between the hybridization is performed on complex oligonucleotide oligonucleotide probe and the Support which is optimized for arrays. Several approaches have been employed to eliminate interactions between the probes and the sample. As provided the sequence-dependence of the stability of duplexes. Utili above, a variety of linking groups can be used in this aspect of 45 zation of tetramethylammonium chloride (TMAC) in the the invention. Preferred groups are those that provide a spac hybridization solution is the most popular approach (Wood, et ing similar to that provided by a 15-mer poly dT spacing al., Proc. Natl. Acad. Sci. USA 82:1585-1588 (1985) and group. Additionally, the linking group will have a reactive Riccelli and Benight, Nuc. Acids Res. 21:3785-3788 (1993)). portion that is selected to be compatible with the amino group TMAC was found to neutralize stability of duplexes imparted of the aminoalkylsilane-derivatized support, or with the func 50 by sequences and allow the stringency of hybridization to be tional group present on the reagent used to facilitate linking controlled as a function of probe length. Similar “isostabili group attachment (e.g., the isothiocyanate portion of 1,4- zation’ function has also been described for other reagents phenylenediisothiocyanate). Accordingly, at the proximal (Rees, et al., Biochemistry 32: 137-144 (1993)). end (that forming an attachment closest to the Support), the The thermodynamic stability of solid-phase hybridization linking group will have a functional group that is reactive with 55 is also affected by differences between the perfectly matched an amino moiety (e.g., a carboxylic acid, anhydride, isothio duplex versus the mismatched duplex, which constitutes the cyanate, and the like) or a functional group that is reactive fundamental limitation to sequence-specific recognition in with an isocyanate, isothiocyanate or carboxylic acid moiety hybridization. The binding of a capture oligonucleotide mis (e.g., an amino group, a hydroxyl group or the like). matched at a single base is compared with that of a perfectly In one embodiment, the support is derivatized first with 60 matched capture oligonucleotide (i.e., its “exact comple aminopropyltrimethoxysilane, followed by attachment of ment); the difference in duplex stability is used to identify 1,4-phenylenediisothiocyanate, followed by attachment of a the target sequence. In many cases, the differences in stability 15-mer oligonucleotide, preferably a 15-mer of poly-dT. of a perfect match and a single-base mismatch are so Small Following constriction of the linking group-modified Solid that discrimination between a perfect match and a single base Support, a plurality of capture oligonucleotides is attached to 65 mismatch cannot be achieved using common hybridization form an array of covalently-attached capture oligonucle washing procedures. Guo et al. described an approach to otides. In this aspect of the invention, the capture oligonucle Substantially increase the discrimination of single-base mis US 8,969,254 B2 23 24 matches by using artificial mismatches (Guo et al., Nature derivatives of fluorescein and rhodamine dyes, which can be Biotech. 15:331-335 (1997)). In this approach, an “artificial” easily attached to the end of a nucleic acid strand. mismatch is intentionally inserted into the capture oligo Biotin is the most commonly used indirect fluorescent nucleotide sequence, and the discrimination compares the label. Biotin can be easily incorporated into nucleic acid stability of two mismatches versus one mismatch. An molecules and detected using avidin or streptavidin by a enhancement of the discrimination, as high as 200% of dif covalently linked reporter group, such as alkaline phos ferential melting temperature, is generally achieved in phatase and horseradish peroxidase (Rees and Kurz, Nuc. hybridization with oligonucleotide arrays. Acids Res. 12:3435-3439 (1984)). The indirect nature of the In vitro data indicate that nucleic acid hybridization in free biotin labeling method limits the applicability for quantitative 10 analysis, but the sensitivity of biotin assays are as high as that Solution and on Surfaces is often a reaction rate-limited pro which can be achieved using radioisotopes. cess. In a study of nitrocellulose membrane arrays, the The fluorescence detection systems require that excess hybridization kinetics was found to be proportional to the label be washed off; furthermore, after hybridization real concentration of immobilized DNA. A mathematical model time monitoring of the hybridization process is not feasible. of hybridization on Solid Supports has been proposed that 15 In order to observe ongoing hybridization events on the Sur hypothesizes two different mechanisms by which nucleic face, surface-related detection methods have been developed. acid targets can hybridize with immobilized oligonucleotide These methods are based on different optical phenomenon on probes: direct hybridization from solution and hybridization the Surface and can detect Subtle changes such as the forma by nucleic acid targets that adsorb nonspecifically on the tion of nucleic acid duplexes on the surface, without interfer Surface and then diffuse to the capture oligonucleotides (Chan ing with the excess nucleic acid in Solution. Duplex electron et al., Biophysical J. 69:2243-2255 (1995)). The hybridiza transfer, optical wave-guide, Surface plasmon resonance and tion rate depends strongly on both the nucleic acid diffusion resonant mirror are a few examples of currently developed constant in Solution and the nucleic acid adsorption/desorp surface-based detection methods (Wood, Microchem. J. tion constant on Surface. 47:330-337 (1993); Stimpson and Gordon, Biomolecular Electric fields can be used to facilitate the diffusion of DNA 25 Engineering 13:73-80 (1996); Wats et al., Biosensor. Anal. targets to the immobilized capture oligonucleotides (Sos Chem. 67:4283-4289 (1995); and Stimpson et al., Proc. Natl. nowski et al., Proc. Natl. Acad. Sci. USA 94:1119-1123 Acad. Sci. USA 92:6379-6380 (1995)). (1997) and Chenget al., Nature Biotech. 16:541-546 (1998)). Oligonucleotide Arrays In this system, oligonucleotide arrays are synthesized on the Within certain embodiments, the present invention pro surface of a silicon electrode. Nucleic acid molecules, which 30 vides an array of capture oligonucleotides specific for nucleic have a large negative charge, can be moved in an electric field acids encoding HLA polypeptides. The array is a useful tool to an area of net positive charge and concentrate significantly for performing HLA tissue typing on a cell or tissue sample to on the electrode surface. The concentrating effect accelerates determine, for example, whetheraparticular donoris Suitable the hybridization of nucleic acid targets. Another advantage for matching in bone marrow, tissue (e.g., skin or organ) of this system is the reversibility of the hybridization in which 35 transplantation. Generally, the array will comprise a series of non-specifically bound nucleic acid target molecules can be capture oligonucleotides which represent at least 80%, pref easily removed from the oligonucleotide arrays by reversing erably at least 90%, more preferably at least 98%, and most the polarity of the field. preferably 100% of all known classical HLA polypeptides. In Detection of Hybridization Events on Solid Supports one embodiment, the array will comprise a series of capture In certain embodiments, the nucleic acid sample (e.g., 40 oligonucleotides which represent at least 80%, preferably at cDNA or cRNA) is directly labeled with a detectable marker. least 90%, more preferably at least 98%, and most preferably For example, cDNA or cRNA can be made from RNA 100% of all known non-classical HLA polypeptides. In one obtained from a sample (e.g. blood or tissue) and fluorescent preferred embodiment, the arrays will represent all known labels (e.g., dyes) can be incorporated into the cDNA or non-classical HLA polypeptides. In another preferred cRNA. In other embodiments, the nucleic acid samples them 45 embodiment, the arrays will represent all known classical selves are not detectably labeled, but labeled detection probes HLA polypeptides and/or all known non-classical HLA are used that bind to target nucleic acids hybridized to capture polypeptides. The capture oligonucleotides are provided on oligonucleotides on the arrays. the array at known or preselected positions to facilitate analy Several methods for the detection of labeled nucleic acids sis. Additionally, the capture oligonucleotides are generally or detection probes are currently available, of which the fluo 50 covalently attached to the solid Support using a linking group rescence-based methods are the most popular. Quantitative that is Sufficient to provide optimum binding of a sample hybridization data available from these methods affords the nucleic acid to the oligonucleotide array. advantages of rapid image analysis, direct comparison and Within certain embodiments, the above-described HLA digital archiving. Both the intensity of the fluorescent signal oligonucleotide arrays (which can comprise capture oligo and the background depend strongly on environmental fac 55 nucleotides specific for either classical HLA polypeptides or tors, such as dryness of the Surface and the Support materials. non-classical HLA polypeptides or specific for both classical The influence of environmental factors on the strength of the and nonclassical HLA polypeptides), further comprise nega signal and background mandates Stringency for conditions tive control oligonucleotides. and often precludes the use of highly fluorescent Supports, Within other embodiments, the arrays provided herein Such as nylon membranes. 60 comprise capture oligonucleotides that target nucleic acids In the analysis of complex genome systems, the use of encoding all known classical and non-classical HLA multiple fluorescent dyes to simultaneously distinguish dif polypeptides, and, additionally or alternatively, comprise ferent nucleic acid molecules is an important methodologic other capture oligonucleotides that target nucleic acids advancement. Nucleic acid targets, including cDNA, cRNA encoding other array targets, including but not limited to and detection probes, in hybridization systems can be fluo 65 accessory molecules important in HLA-linked peptide pre rescently labeled either directly or indirectly. The direct fluo sentation and/or processing, KIR polypeptides, and/or blood rescent label systems for nucleic acid molecules include group determining polypeptides. In any of these arrays, nega

US 8,969,254 B2 57 58 Table VIII, below. The oligonucleotides in Table VIII are negative control oligonucleotides for KIR molecules. Within Lengthy table referenced here still another specific embodiment, the oligonucleotide array comprises one or more of the negative control oligonucle USO.8969.254-2015.0303-TOOOO5 otides having the nucleic acid sequences set forth in Table IX, 5 Please refer to the end of the specification for access instructions. below. The oligonucleotides in Table IX are negative control oligonucleotides for blood group determining molecules. Within still another specific embodiment, the oligonucleotide array comprises one or more of the negative control oligo nucleotides having the nucleic acid sequences set forth in 10 Lengthy table referenced here Table X and denoted by “HNN' in Table X, below. USO.8969.254-2015.0303-TOOOO6 In Tables I-X, within each of the three columns of sequences, the leftmost column indicates the SEQ ID NO Please refer to the end of the specification for access instructions. (“SIN), the middle column indicates the name of the 15 sequence (e.g., “NO01087 in Table 1) (or in certain Tables, e.g., Tables III-IX, the oligonucleotides names are just num bers), and the rightmost column indicates the nucleic acid sequences (containing A, C, G, and T). In Tables I and II, the Lengthy table referenced here letter “E” at the beginning of an oligonucleotide name indi USO.8969.254-2015.0303-TOOOO7 cates that the oligo is “extended' and “N' indicates “normal' (i.e., not extended). In Table X, oligo names begin with Please refer to the end of the specification for access instructions. “HNN,” “HPN,” “HPE, or “HPT As discussed above, “HNN' indicates that the oligo is a negative control oligo nucleotide, “HPN' indicates a “normal” (unchanged) oligo, 25 “HPT indicates a “truncated” oligo, and “HPE indicates an “extended oligo. The “HPT and “HPE modifications were Lengthy table referenced here made to ensure proper melting temperature. USO.8969.254-2015.0303-TOOOO8 30 Please refer to the end of the specification for access instructions. Lengthy table referenced here

USO.8969.254-2015.0303-TOOOO1 35 Lengthy table referenced here Please refer to the end of the specification for access instructions. USO.8969.254-2015.0303-TOOOO9 Please refer to the end of the specification for access instructions. 40

Lengthy table referenced here Lengthy table referenced here USO.8969.254-2015.0303-TOOOO2 45 USO.8969.254-2015.0303-TOOO 10 Please refer to the end of the specification for access instructions. Please refer to the end of the specification for access instructions.

50 It is to be understood that an oligonucleotide array as described herein can comprise the capture oligonucleotides set forth in any one or more of Tables I-X, above. Further, an Lengthy table referenced here oligonucleotide array preferably comprises all of the oligo nucleotide sequences set forth in at least one of Tables I-V and USO.8969.254-2015.0303-TOOOO3 55 the non-negative controls in Table X (oligos with names start ing with “HPN”, “HPE” or “HPT, but not “HNN), but Please refer to the end of the specification for access instructions. within certain embodiments can include fewer oligonucle otides, such as, e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90%. 95% or 98% of the sequences set forth in any 60 of Tables I-V. In other embodiments, an oligonucleotide array can comprise nearly all or all (e.g., 70%, 75%, 80%, 85%, Lengthy table referenced here 90%. 95%, 98%, 99%, or 100%) of the sequences set forth in one of Tables I-V and fewer than all or nearly all of the USO.8969.254-2015.0303-TOOOO4 sequences set forth in one of the other of Tables I-IX, e.g., 0%. Please refer to the end of the specification for access instructions. 65 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the oligonucleotides set forth in one or more other of US 8,969,254 B2 59 60 Tables I-IX. By way of example, and without limitation, an which appropriate reagents flow or in which appropriate oligonucleotide array can comprise all of the capture oligo reagents are placed. For example, assume a monomer 'A' is nucleotides set forth in Table I, 50% of the capture oligo to be bound to the Substrate in a first group of selected regions. nucleotides set forth in Table II, and 10% of the capture If necessary, all or part of the surface of the substrate in all or oligonucleotides set forth in Table III, and optionally, one or a part of the selected regions is activated for binding by, for more of the oligonucleotides having a sequence set forth in example, flowing appropriate reagents through all or Some of any one or more of Tables VI-IX or the oligos with names the channels, or by washing the entire Substrate with appro starting with “HNN' in Table X. priate reagents. After placement of a channel block on the Solution or Solid Phase Methods for Oligonucleotide Syn Surface of the Substrate, a reagent having the monomer A thesis 10 Detailed descriptions of the procedures for solution and flows through or is placed in all or some of the channel(s). The Solid phase synthesis of nucleic acids by phosphite-triester, channels provide fluid contact to the first selected regions, phosphotriester, and H-phosphonate chemistries are widely thereby binding the monomer A on the substrate directly or available. For example, the solid phase phosphoramidite tri indirectly (via a spacer) in the first selected regions. ester method of Beaticage and Carruthers using an automated 15 Thereafter, a monomer B is coupled to second selected synthesizer is described in, e.g., Itakura, U.S. Pat. No. 4,401, regions. Some of which may be included among the first 796; Carruthers, U.S. Pat. Nos. 4,458,066 and 4,500,707. See selected regions. The second selected regions will be in fluid also Needham-VanDevanter, Nucleic Acids Res. 12:6159 contact with a second flow channel(s) through translation, 6168 (1984); Beigelman Nucleic Acids Res 23:3989-3994 rotation, or replacement of the channel block on the surface of (1995); Oligonucleotide Synthesis: A Practical Approach, the Substrate; through opening or closing a selected valve; or Gait (ed.), IRL Press, Washington D.C. (1984), see Jones, through deposition of a layer of chemical or photoresist. If chapt 2, Atkinson, chapter 3, and Sproat, chapert 4: Froehler, necessary, a step is performed for activating at least the sec Tetrahedron Lett. 27:469-472 (1986): Froehler, Nucleic ond regions. Thereafter, the monomer B is flowed through or Acids Res. 14:5399-5407 (1986). Methods to purify oligo placed in the second flow channel(s), binding monomer Bat nucleotides include native acrylamide gel electrophoresis, 25 the second selected locations. In this particular example, the anion-exchange HPLC, as described in Pearson J. Chrom. resulting sequences bound to the Substrate at this stage of 255:137-149 (1983). The sequence of the synthetic oligo processing will be, for example, A, B, and AB. The process is nucleotide can be verified using any chemical degradation repeated to form an array of sequences of desired length at method, e.g., see Maxam (1980) Methods in Enzymology known locations on the Substrate. 65:499-560, Xiao Antisense Nucleic Acid Drug Dev 6:247 30 258 (1996), or for solid-phase chemical degradation proce After the substrate is activated, monomer A can be flowed dures, Rosenthal, Nucleic Acids Symp. Ser. 18:249-252 through some of the channels, monomer B can be flowed (1987). through other channels, a monomer C can be flowed through Solid-Support Based Oligonucleotide Synthesis still other channels, etc. In this manner, many or all of the Anarray of capture oligonucleotides at known locations on 35 reaction regions are reacted with a monomer before the chan a single Substrate Surface can be formed using a variety of nel block must be moved or the substrate must be washed techniques known to those skilled in the art of polymer Syn and/or reactivated. By making use of many or all of the thesis on solid supports. For example, “light directed meth available reaction regions simultaneously, the number of ods (which are one technique in a family of methods known as washing and activation steps can be minimized. VLSIPSTM methods) are described in U.S. Pat. No. 5,143, 40 One of skill in the art will recognize that there are alterna 854. The light directed methods discussed in the 854 patent tive methods of forming channels or otherwise protecting a involve activating predefined regions of a Substrate or Solid portion of the Surface of the Substrate. For example, according Support and then contacting the Substrate with a preselected to Some embodiments, a protective coating Such as a hydro monomer Solution. The predefined regions can be activated philic or hydrophobic coating (depending upon the nature of with a light source shown through a mask (much in the man 45 the solvent) is utilized over portions of the substrate to be ner of photolithography techniques used in integrated circuit protected, sometimes in combination with materials that fabrication). Other regions of the substrate remain inactive facilitate wetting by the reactant solution in other regions. In because they are blocked by the mask from illumination and this manner, the flowing solutions are further prevented from remain chemically protected. Thus, a light pattern defines passing outside of their designated flow paths. which regions of the Substrate react with a given monomer. 50 The 'spotting methods of preparing compounds and By repeatedly activating different sets of predefined regions libraries of the present invention can be implemented in much and contacting different monomer Solutions with the Sub the same manner as the flow channel methods. For example, strate, a diverse array of polymers is produced on the Sub a monomer A can be delivered to and coupled with a first strate. Of course, other steps such as washing unreacted group of reaction regions which have been appropriately acti monomer Solution from the Substrate can be used as neces 55 vated. Thereafter, a monomer B can be delivered to and Sary. reacted with a second group of activated reaction regions. Other useful techniques include mechanical techniques Unlike the flow channel embodiments described above, reac (e.g., flow channel, spotting or pin-based methods). In each of tants are delivered by directly depositing (rather than flowing) the “flow channel or “spotting methods, certain activated relatively small quantities of them in selected regions. In regions of the Substrate are mechanically separated from 60 Some steps, of course, the entire Substrate Surface can be other regions when the monomer Solutions are delivered to sprayed or otherwise coated with a solution. In preferred the various reaction sites. embodiments, a dispenser moves from region to region, A typical “flow channel method applied to the compounds depositing only as much monomeras necessary at each stop. and libraries of the present invention can generally be Typical dispensers include a micropipette to deliver the described as follows. Diverse probe sequences are synthe 65 monomer Solution to the Substrate and a robotic system to sized at selected regions of a Substrate or Solid Support by control the position of the micropipette with respect to the forming flow channels on a Surface of the Substrate through Substrate. In other embodiments, the dispenser includes a US 8,969,254 B2 61 62 series of tubes, a manifold, an array of pipettes, or the like so said capture oligonucleotides comprise Subsets of oligo that various reagents can be delivered to the reaction regions nucleotides that collectively target a panel of reference clas simultaneously. sical HLA polypeptide-encoding nucleic acids, wherein the Another method which is useful for the preparation of an panel comprises nucleic acids encoding all reference classical array of diverse oligonucleotides on a single Substrate 5 HLA polypeptides to which it is desired to test the HLA involves “pin based synthesis.” This method is described in cDNA or cRNA in the sample for hybridization potential detail in U.S. Pat. No. 5,288,514. The method utilizes a sub ("classical HLA oligo subsets’), each classical HLA oligo strate having a plurality of pins or other extensions. The pins Subset targeting a different classical HLA polypeptide-en are each inserted simultaneously into individual reagent con coding nucleic acid; and wherein each of said classical HLA tainers in a tray. In a common embodiment, an array of 96 10 oligo Subsets comprises a set of overlapping oligonucleotides pins/containers is utilized. that cover every single nucleotide position in the mRNA Each tray is filled with a particular reagent for coupling in sequences coding for the classical HLA polypeptides from 5' a particular chemical reaction on an individual pin. Accord to 3' and are sequentially shifted by 1-5 nucleotides from the ingly, the trays will often contain different reagents. Since the 5' end of the preceding overlapping oligonucleotide. chemistry used is such that relatively similar reaction condi 15 Within certain embodiments of the above-describe method tions may be utilized to perform each of the reactions, mul for HLA tissue typing, in the step (a), the cDNA or cRNA was tiple chemical coupling steps can be conducted simulta detectably labeled during the making, and the detecting step neously. In the first step of the process, a Substrate on which (c) comprises detecting the detectably labeled cDNA or the chemical coupling steps are conducted is provided. The cRNA. Within other embodiments, the detecting step (b) Substrate is optionally provided with a spacer (e.g., 15-mer of comprises the use of labeled detection probes. poly-dT) having active sites on which the capture oligonucle Within another embodiment, the capture oligonucleotides otides are attached or constructed. in the above-described method for HLA tissue typing further Methods for HLA Tissue Typing Using Oligonucleotide comprise a plurality of oligonucleotide Subsets that collec Arrays tively targets non-classical HLA polypeptide-encoding Within one embodiment, a method for human leukocyte 25 nucleic acids (“non-classical HLA oligo Subsets”), each non antigen (HLA) tissue typing is provided, wherein said method classical HLA oligo Subset targeting a different non-classical comprises: (a) contacting a cDNA- or cRNA-containing HLA polypeptide-encoding nucleic acid; wherein each of sample under hybridization conditions with a plurality of said non-classical HLA oligo Subsets comprises a set of over capture oligonucleotides specific for HLA polypeptides, lapping oligonucleotides that cover every single nucleotide wherein said hybridization conditions facilitate hybridization 30 position in the mRNA sequences coding for the non-classical of a Subset of the capture oligonucleotides to complementary HLA polypeptides from 5' to 3' and are sequentially shifted by sequences present in the cDNA or cRNA; (b) detecting a 1-5 nucleotides from the 5' end of the preceding overlapping hybridization pattern for said cDNA or cRNA; and (c) assign oligonucleotide. In a specific embodiment, the plurality of ing to the sample, based on the hybridization pattern, an HLA oligonucleotide Subsets that collectively targets non-classical tissue type; wherein the capture oligonucleotides are from 35 HLA polypeptide-encoding nucleic acids collectively target about 17 to about 60 nucleotides in length and each capture all known non-classical HLA polypeptide-encoding nucleic oligonucleotide with respect to its exact complement has a acids. In one embodiment, the capture oligonucleotides are melting temperature of about 64 degrees Celsius; wherein immobilized on a Substrate (e.g., a microarray). In another said capture oligonucleotides comprise Subsets of oligo embodiment, said capture oligonucleotides comprise Subsets nucleotides that collectively target classical HLA polypep 40 of oligonucleotides that collectively target a panel of refer tide-encoding nucleic acids ("classical HLA oligo Subsets’), ence non-classical HLA polypeptide-encoding nucleic acids, each classical HLA oligo Subset targeting a different classical wherein the panel comprises nucleic acids encoding all ref HLA polypeptide-encoding nucleic acid; and wherein each of erence non-classical HLA polypeptides to which it is desired said classical HLA oligo Subsets comprises a set of overlap to test the HLA cDNA or cRNA in the sample for hybridiza ping oligonucleotides that cover every single nucleotideposi 45 tion potential (“non-classical HLA oligo Subsets’), each clas tion in the mRNA sequences coding for the classical HLA sical HLA oligo Subset targeting a different non-classical polypeptides from 5' to 3' and are sequentially shifted by 1-5 HLA polypeptide-encoding nucleic acid. nucleotides from the 5' end of the preceding overlapping Within another embodiment, the capture oligonucleotides oligonucleotide. In a specific embodiment, the capture oligo in the above-described method for HLA tissue typing further nucleotides comprise Subsets of oligonucleotides that collec 50 comprise a plurality of oligonucleotide Subsets that collec tively target all known classical HLA polypeptide-encoding tively targets nucleic acids encoding accessory molecules nucleic acids. In one embodiment, the capture oligonucle ("accessory molecule oligo Subsets’), and said method fur otides are immobilized on a Substrate (e.g., a microarray). ther comprises the step of assigning to the cell, based on the In another embodiment, a method for human leukocyte hybridization pattern, an accessory molecule phenotype; antigen (HLA) tissue typing is provided, wherein said method 55 wherein each of said accessory molecule oligo Subsets com comprises: (a) contacting a cDNA- or cRNA-containing prises a set of overlapping oligonucleotides that cover every sample under hybridization conditions with a plurality of single nucleotide position in the mRNA sequences coding for capture oligonucleotides specific for HLA polypeptides, the accessory molecules from 5' to 3' and are sequentially wherein said hybridization conditions facilitate hybridization shifted by 1-5 nucleotides from the 5' end of the preceding of a Subset of the capture oligonucleotides to complementary 60 overlapping oligonucleotide. sequences present in the cDNA or cRNA; (b) detecting a Within still another embodiment, the capture oligonucle hybridization pattern for said cDNA or cRNA; and (c) assign otides in the above-described method for HLA tissue typing ing to the sample, based on the hybridization pattern, an HLA further comprise a plurality of oligonucleotide Subsets target tissue type; wherein the capture oligonucleotides are from ing killer-cell immunoglobulin-like receptor (KIR) polypep about 17 to about 60 nucleotides in length and each capture 65 tide-encoding nucleic acids (“KIR oligo Subsets’), and said oligonucleotide with respect to its exact complement has a method further comprises the step of assigning to the cell, melting temperature of about 64 degrees Celsius; wherein based on the hybridization pattern, a KIR polypeptide phe US 8,969,254 B2 63 64 notype; wherein each of said KIR oligo Subsets comprises a Those of skill in the art will understand that the above set of overlapping oligonucleotides that cover every single described detection probe sequences are exemplary, and that nucleotide position in the mRNA sequences coding for the other probes having other nucleic acid sequences can also be KIR polypeptides from 5' to 3' and are sequentially shifted by used, alternatively, or in addition, to detect the microarray 1-5 nucleotides from the 5' end of the preceding overlapping targets described herein. Further, the sequences of such detec oligonucleotide. tion probes can be determined according to routine methods Within yet another embodiment, the capture oligonucle known in the art. otides in the above-described method for HLA tissue typing In the above methods, the probe signal (of either the further comprise a plurality of oligonucleotide Subsets target directly labeled cDNA or cRNA sample or of the detection 10 probes) can be analyzed using pattern recognition software. A ing blood group-determining polypeptide encoding nucleic specific approach for analyzing the probe signal (and hybrid acids (“blood group determining oligo Subsets’), and said ization pattern) is described in detail in Example 2, below. method further comprises the step of assigning to the cell, Based on the analysis of the microarray data, the HLA based on the hybridization pattern, a blood group phenotype; tissue type is assigned based on the specific combination of wherein each of said blood group determining oligo Subsets 15 HLA alleles present in the sample. comprises a set of overlapping oligonucleotides that cover Diagnostic Methods. Using Oligonucleotide Arrays every single nucleotide position in the mRNA sequences Within a specific embodiment, methods for deriving coding for the blood group-determining polypeptides from 5' donor/recipient compatibility in tissue transplants are pro to 3' and are sequentially shifted by 1-5 nucleotides from the vided. Tissue transplants can include, e.g., both solid organs 5' end of the preceding overlapping oligonucleotide. and cells (e.g., bone marrow). In order to determine donor/ In any of the above-described embodiments, the array can recipient compatibility in tissue transplants, the practitioner further comprise negative control oligonucleotides. Such as, should compare the HLA tissue type of both the potential e.g., one or more of those having the nucleic acid sequences donor and the recipient. The HLA tissue type of each is set forth in Tables VI-IX, or the oligos with names starting assigned according to the methods described above. with “HNN' in Table X, above. 25 Once the HLA tissue types of the patient and potential In any of the above-described embodiments, cDNA or donor are determined, donor/recipient compatibility is cRNA can be made from an mRNA-containing sample derived according to the following criteria: donor and recipi according to any suitable method in the art (e.g., PCR). Fur ent are considered fully matched when their HLA are pheno ther, the sample can be obtained from any suitable source, typically identical across HLA-A. HLA-B, HLA-C, HLA Such as, e.g., a cell or cells. A cell or cells can be obtained 30 DRA, HLADRB1, HLA-DRB14.5, HLA-DQA1 HLA from any Suitable source of cells, such as, e.g., cells from a DQB1, HLA-DPA1, HLA-DPB1. In the case that a matched tissue from e.g., a Subject (e.g., a donor or recipient or donor cannot be found, a mismatch must be accepted at the patient), cells obtained from blood or other bodily fluid, or discretion of the physician conducting the donor search. cell line. Within other embodiments, methods for diagnosing or pre Within certain embodiments, the microarray can comprise 35 dicting the likelihood of an HLA-linked genetic defect, dis any suitable Substrate, e.g., Solid Support, such as those ease, inadequate or undesirable response to a vaccine, bio described herein. The fidelity of the hybridization assay is logic treatment (recombinant protein, biosimilar or governed by the stability differences between perfectly equivalent), or infectious organism or condition in said Sub matched and mismatched duplexes. Preferably, a single set of ject, wherein the step is based on one or more assigned tissue hybridization conditions that can provide a clear discrimina 40 types or phenotypes selected from the group consisting of a tion between matches and mismatches for all polymorphisms classical HLA tissue type, a non-classical HLA tissue type, an in each target gene (e.g., HLA polypeptide-encoding gene) accessory molecule phenotype, a KIR polypeptide pheno should be used. type, and a blood group phenotype. HLA associated diseases Within one embodiment, the cDNA samples were hybrid include, for example, and without limitation, type 1 diabetes ized to custom oligonucleotide slides at 64° C. for 16 h, 45 mellitus (see, Larsen, C. E. & Alper, C. A. Current Opinion in however, other hybridization conditions are also possible, can Immunology 16, 660-667 (2004)); rheumatoid arthritis (see, be determined by one of ordinary skill in the art. Khan et al. (1983), Tissue Antigens, 22: 182-185), and anky The detecting step (b) in the above method can be carried losing spondylitis (Gonzalez-Roces, S., et al. Tissue Anti out according to any suitable methods. For example, in one gens, 49: 116-123). embodiment, the cDNA or cRNA hay have been directly 50 Within other embodiments, methods for diagnosing or pre labeled (e.g., with fluorescent dye). In another embodiment, dicting the likelihood of an HLA-linked genetic defect, dis labeled detection probes (e.g., fluorescent detection probes) ease, inadequate or undesirable response to a vaccine, bio can be used. For example, in a certain embodiments, when the logic treatment (recombinant protein, biosimilar or capture oligonucleotides are immobilized on a solid Support, equivalent), or infectious organism or condition in said Sub Such as, not limited to a microarray, the labeled detection 55 ject, wherein the step is based on one or more assigned HLA probes can be hybridized to the microarray according to Suit tissue types or phenotypes selected from the group consisting able methods known in the art. Such detection probes are of a classical HLA tissue type, a non-classical HLA tissue designed with specific nucleic acids sequences to target the type, an accessory molecule phenotype, a KIR polypeptide nucleic acids hybridized to the capture oligonucleotides phenotype, and a blood group phenotype. attached to the array substrate (e.g., slide). Method for 60 Within still other embodiments, methods for determining designing Such detection probes are known in the art. Briefly, the likely response of a subject to a particular treatment regi the probe sequences are assembled computationally based men are provided, wherein the treatment regimen is selected upon nucleotide sequence databases of the target loci. The from the group consisting of bone marrow transplantation, detection probes are labeled and are detected using a suitable immunosuppressive regimen, antiviral drug regimen, antivi detector (e.g., in the case of fluorescent dyes, a fluorescent 65 ral drug resistance, antiretroviral drug regimen, and autoim scanner may be used to detect and quantify the intensity of the munity drug regimen, and wherein the method is based on signal. determining according to the method described herein one or US 8,969,254 B2 65 66 more assigned HLA tissue types or phenotypes selected from size, e.g., sequential shifting by 1 or 2 nucleotides), target the group consisting of a classical HLA tissue type, a non melting temperature (each capture oligonucleotide is classical HLA tissue type, an accessory molecule phenotype, designed to have the closest possible melting temperature to a KIR polypeptide phenotype, and a blood group phenotype. the target melting temperature); and negative control replace Within yet other embodiments, methods for determining ment interval (this is the interval at which replacements are whether a subject is likely to develop antiretroviral drug resis made in a consensus sequence of a sequence group to create tance or cancer drug regimen resistance are provided, capture oligonucleotides that do not occur in the target genes wherein the method is based on determining according to the and alleles). method described herein one or more assigned HLA tissue Negative Control types or phenotypes selected from the group consisting of a 10 For each sequence group, an artificial negative control classical HLA tissue type, a non-classical HLA tissue type, an sequence is generated. The sequences in this group are accessory molecule phenotype, a KIR polypeptide pheno aligned and a consensus sequence is determined. Alternate type, and a blood group phenotype. nucleotides are chosen at specific intervals (10 nt) within the The following examples are meant to illustrate, not limit, consensus sequence and replaced by nucleotides not repre the invention. 15 sented in the sequence alignment at the given position. If the nucleotide at a selected position is not fully conserved, the EXAMPLES nearest fully conserved residue is selected for nucleotide replacement. Example 1 To preserve target melting temperature the following replacements can be done: A to TT to A, C to G, and G to C. Design of Oligonucleotide Microarray The nucleotide on the left (e.g., the A in A to T) represents a conserved one from the sequences, and the nucleotide on the This Example demonstrates the design of a microarray for right (e.g., the T in A to T) represents those present in the rapid and economical identification of HLA profiles of indi negative control probes. See, FIG. 2, which demonstrates a viduals and characterization of the HLA genotypes and poly 25 set of probes (P1 to P13) covering A*02:01:01:01 sequence morphisms in antigen processing and presentation machin and their corresponding negative control probes (P1N to P ery. The set of HLA capture oligonucleotide spotted on the 13N) generated based on the consensus sequence of HLA array comprised 3821 classical HLA-I class I sequences class I sequence group. (1193 HLA-A, 1799 HLA-B and 829 HLA-C), 1249 HLA-II Sequence Alignments class II sequences (901 HLA-DR, 169 HLA-DP, 147 HLA 30 A sequence alignment is generated containing all the DQ, 11 HLA-DM, 21 HLA-DO), and 188 other HLA region sequences from within a sequence group as well as the cor sequences (i.e., non-classical HLA) (9 HLA-E, 21-F, 46-G, responding negative control sequence for that group. The 101 MIC, and 11 TAP), 504 KIR and 68 antigen presentation aligned sequences are used in the remaining steps. and processing genes (accessory molecules), a total of 5830 Tiling coding sequences. The array also contained 65 negative con 35 Capture oligonucleotide sequences are Subsequences of trol sequences for all probes for all coding sequences. The the alignment generated by stepping through each sequence total number of probes covering the complete set of HLA loci at a specific interval called the step size. The step size will and accessory molecules on each array was 178.857 provid determine whether a capture oligonucleotide is created for ing a dense tiling coverage (the overlapping probes are each position (e.g. step size=1) or a Subset of positions (e.g. sequentially shifted by 1-2 nucleotides (i.e., step 1 or step 2 40 step size 2, for every second position). The following capture shifts) of all HLA polypeptides. The flow chart shown in FIG. oligonucleotide selection process is applied for each position: 1 describes the processing steps in HLA typing using A capture oligonucleotide sequence is a Subsequence in the microarray. Each of the steps is described in detail, below. alignment determined by a start position and an end position. Capture Oligonucleotide Design For a given start position, the end position giving the clos The primary data necessary to design the capture oligo 45 est melting temperature to a target melting temperature is nucleotides consists of gene and allele identifiers and the identified. associated nucleotide sequences. The sequences are orga Length restrictions: capture oligonucleotides shorter than nized into sequence groups of sufficient homology to produce 20 nucleotides are extended to 20 by appending thymines to an accurate alignment. Sequence groups can consist of all the sequence. Capture oligonucleotides longer than 60 nucle alleles of a locus, or of multiple loci when they are highly 50 otides are truncated to 60. homologous. Sequence groups include: HLA class I (HLA The capture oligonucleotide sequence becomes part of the A-B, -C,-E,-F, and -G), HLA-DRB (DRB1, DRB3, DRB4, final set of capture oligonucleotides under the condition that and DRB5), HLA-DRA, HLA-DQA, HLA-DQB, HLA the sequence is not already represented in the final set of DPA, HLA-DPB, HLA-DMA, HLA-DMB, HLA-DOA capture oligonucleotides. HLA-DOB, TAP1, TAP2, MICA, MICB, KIR, endoplasmic 55 FIG.3 shows a set of tiling capture oligonucleotides (P1 to reticulum genes (B2M, tapasin, CANX, CALR, PDIA2, P13) covering A*02:01:01:01 sequence. PDIA3, ERAP1), aminopeptidase genes (TPP2, BLMH, Computational Capture Oligonucleotide Generation LAP3), proteasome (PSMA1, PSMA2, PSMA3, PSMA4, Determination of Optimal Target Melting Temperature PSMA5, PSMA6, PSMA7, PSMA8, PSMB1, PSMB2, The optimal melting temperature was defined using a sys PSMB3, PSMB4, PSMB5, PSMB6, PSMB7, PSMB8, 60 tematic analysis. This analysis identified that the targeted PSMB9, PSMB10, PSMB11, PSMC1, PSMC2, PSMC3, melting temperature is 64.3°C. providing the minimal devia PSMC4, PSMC5, PSMC6, PSMD1, PSMD2, PSMD3, tion from the target temperature of all capture oligonucle PSMD4, PSMD5, PSMD6, PSMD7, PSMD8, PSMD9, otides. See FIG. 4, which demonstrates the relationship PSMD10, PSMD11, PSMD12, PSMD13, and PSMD14). between target melting temperature and the capture oligo Specific parameters of this method are selected to produce the 65 nucleotide melting temperature range. best results for the sets of genes and alleles that are targeted The steps listed above were executed to create a tiled for typing. These parameters include the tiling interval (step microarray of a given target melting temperature. The actual US 8,969,254 B2 67 68 melting temperatures of capture oligonucleotides (with Probe Signal Preprocessing respect to their exact complements) in the array will span a Global Scaling of signals was performed, so that all arrays range specific to that chip. In general, an optimal target melt had the same minimum, maximum, and average signal. Nor ing temperature is chosen which will minimize the range of malization that mapped signals to a scale of 1-20,000 was the melting temperatures of the generated capture oligonucle 5 performed where minimum was set to 1, maximum to 20,000, otides. This is done computationally by performing the steps and the array-wide average to 1,000. The detailed steps of the previous section iteratively over a range of target melt involved in signal preparation is shown below: ing temperatures. The final capture oligonucleotides are those Signal Preparation generated using the optimal target melting temperature giving 1. Signal extraction the narrowest melting temperature range. 10 a. If a capture oligonucleotide is found on the chip mul Melting Temperature tiple times, then only one instance is considered. Melting temperature was calculated for the nucleotide 2. Scaling sequences according to the following formula: Tm=64.9+41* a. 4,000 probes with minimum=1 (N+N-16.4)/(N+N+N+N), where N,NN, and N, 15 b. Maximum=20,000 are the number of the bases A.T.G.C in the sequence, respec c. Mean=1,000 tively. 3. Elimination of bad (incorrect) signals The method of capture oligonucleotide generation outlined a. Remove from further analysis probes with global high above was applied to the HLA, KIR, and accessory molecules signals (the probe signals are equal to or larger than (antigen presentation) systems with the intent of generating 10000 for every array) no more than 180,000 probes. This can be achieved by using b. The elimination is applied to all variants of algorithms a step size of 2 for the set of accessory molecules. The pie This transformation produced comparable signals for all charts in FIG. 5A and FIG. 5B demonstrate that this method microarrays. The data from 32 array experiments showed results in the majority of capture oligonucleotide detecting high reproducibility of array-wide signals. The correlation (i.e., targeting nucleic acids encoding) HLA alleles, followed 25 coefficients were always re-0.97 for samples from the same by accessory molecules and KIR molecules. The strategy of individual, while for samples from different individuals were targeting the optimal melting temperature results in a wide 0.8100 (class I): 20 below the low probe signal percentage (see point 2): (class II); 5. Average signal threshold (Default value: 2.5): 3. Elimination strategy—after all pairs have been com a. The allele must have a score, 10/average signal, less pared, an allele will be eliminated from the list of can than this cutoff 15 didates if: b. The average signal is inverted in order to make this a. The winning allele is not a partial sequence; and score inversely proportional to the allele's probability i. The loosing allele has 1 or less votes and the differ of being present (to fit with the other gap length and ence in votes >=4; or gap penalty). ii. the losing votes are >1 and the difference >=20; Pairwise Comparison Method 20 4. Ranking strategy (alternative to elimination): Given two alleles present in a multiple sequence align- a. Difference in votes is calculated for each allele pair; ment, the pairwise comparison method identifies the capture b. The average of all difference for an allele is calculated. oligonucleotides containing sequence variations between the two alleles, compares the signals of each capture oligonucle- ck otide pair, and votes on winning based on the signals. The 25 detailed steps involved in the gap penalty method are shown Patents, patent applications, publications, product descrip below and in FIGS. 10A-C: tions, and protocols are cited throughout this application, the Pairwise Comparison disclosures of which are incorporated herein by reference in 1. This is a triple layer method: their entireties for all purposes. a. Probes (oligonucleotides) from a pair of alleles are 30 A number of embodiments of the invention have been compared and voting is performed; described. Nevertheless, it will be understood that various b. The winner of the two alleles is accessed: modifications may be made without departing from the spirit c. The winner of all the alleles over all the comparisons and scope of the invention. It is further to be understood that is assessed; all values are approximate, and are provided for description. 2. Rules for ignoring a position when comparing two alle- Accordingly, other embodiments are within the scope of the les: following claims.

LENGTHY TABLES The patent contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US08969254B2). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

SEQUENCE LISTING The patent contains a lengthy “Sequence Listing section. A copy of the “Sequence Listing is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US08969254B2). An electronic copy of the “Sequence Listing will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR1.19(b)(3).

What is claimed is: 60 at least a portion of the plurality of capture oligonucle 1. A method for human leukocyte antigen (HLA) tissue otides to complementary sequences present in the cDNA typing, said method comprising: or cRNA; (a) contacting a cDNA-or cRNA-containing sample under (b) detecting a hybridization pattern for said cDNA or hybridization conditions with a plurality of capture oli 65 cRNA; and gonucleotides specific for HLA polypeptides, wherein (c) assigning to the sample, based on the hybridization said hybridization conditions facilitate hybridization of pattern, an HLA tissue type; US 8,969,254 B2 71 72 wherein the capture oligonucleotides are from about 17 to PSMA8, proteasome (prosome macropain) subunit beta about 60 nucleotides in length and each capture oligo (PSMB) type 1 (PSMB1), PSMB2, PSMB3, PSMB4, nucleotide with respect to its exact complement has a PSMB5, PSMB6, PSMB7, PSMB8, PSMB9, PSMB10, melting temperature of about 64 degrees Celsius; PSMB11, proteasome (prosome macropain) 26S subunit wherein said capture oligonucleotides comprise Subsets of 5 ATPase (PSMC) 1 (PSMC1); PSMC2, PSMC3, PSMC4, oligonucleotides that collectively target classical HLA PSMC5, PSMC6, proteasome (prosome macropain)26S sub polypeptide-encoding nucleic acids (“classical HLA unit non-ATPase (PSMD) 1 (PSMD1), PSMD2, PSMD3, oligo Subsets), each classical HLA oligo Subset target PSMD4, PSMD5, PSMD6, PSMD7, PSMD8, PSMD9, ing a different classical HLA polypeptide-encoding PSMD10, PSMD11, PSMD12, PSMD13, and PSMD14. nucleic acid; 10 7. The method of claim 1, wherein said capture oligonucle wherein each of said classical HLA oligo Subsets com otides further comprise a plurality of oligonucleotide Subsets prises a set of overlapping oligonucleotides that cover targeting killer-cell immunoglobulin-like receptor (KIR) every single nucleotide position in each of the full polypeptide-encoding nucleic acids (“KIR oligo Subsets’), length coding regions of mRNA sequences coding for and said method further comprises the step of assigning to the the classical HLA polypeptides from 5' to 3' and are 15 sample, based on the hybridization pattern, a KIR polypep sequentially shifted by 1-5 nucleotides from the 5' end of tide phenotype; wherein each of said KIRoligo subsets com the preceding overlapping oligonucleotide, and prises a set of overlapping oligonucleotides that cover every wherein said classical HLA oligo Subsets comprise the single nucleotide position in the mRNA sequences coding for sequences set forth in Table I or the normal (indicated by the KIR polypeptides from 5' to 3' and are sequentially shifted “HPN”), extended (indicated by “HPE) and truncated by 1-5 nucleotides from the 5' end of the preceding overlap (indicated by “HPT) sequences set forth in Table X. ping oligonucleotide. 2. The method of claim 1, wherein said classical HLA 8. The method of claim 1, wherein said capture oligonucle polypeptide-encoding nucleic acids encode HLA polypep otides further comprise a plurality of oligonucleotide Subsets tides selected from the group consisting of HLA-A. HLA-B, targeting blood group-determining polypeptide encoding HLA-C, HLA-DR, HLA-DP, and HLA-DQ. 25 nucleic acids ("blood group determining oligo Subsets’), and 3. The method of claim 1, wherein said capture oligonucle said method further comprises the step of assigning to the otides further comprise a plurality of oligonucleotide Subsets sample, based on the hybridization pattern, a blood group that collectively targets non-classical HLA polypeptide-en phenotype; coding nucleic acids (“non-classical HLA oligo Subsets’), wherein each of said blood group determining oligo Sub each non-classical HLA oligo Subset targeting a different 30 sets comprises a set of overlapping oligonucleotides that non-classical HLA polypeptide-encoding nucleic acid; cover every single nucleotide position in the mRNA wherein each of said non-classical HLA oligo Subsets com sequences coding for the blood group-determining prises a set of overlapping oligonucleotides that cover polypeptides from 5' to 3' and are sequentially shifted by every single nucleotideposition in the mRNA sequences 1-5 nucleotides from the 5' end of the preceding over coding for the non-classical HLA polypeptides from 5' 35 lapping oligonucleotide. to 3' and are sequentially shifted by 1-5 nucleotides from 9. The method of claim 8, wherein said blood group deter the 5' end of the preceding overlapping oligonucleotide. mining polypeptides are selected from the group consisting 4. The method of claim3, wherein said non-classical HLA ABO (ABO), Chido Rodgers (CH/RG), Colton (CO), polypeptide-encoding nucleic acids encode HLA polypep Cromer (CROM), Diego (DI) (band 3), Dombrock (DO), tides selected from the group consisting of HLA-E, HLA-F. 40 Duffy (DARC), Gerbich (Ge), Gill (GIL), Globoside and Pk, HLA-G, DM, DO and MIC. H (H), I (I), Indian (IN), John Milton Hagen (JMH), Kell 5. The method of claim 1, wherein said capture oligonucle (KEL) and KXCXK), Kidd (JK), Knops (KN), Landsteiner otides further comprise a plurality of oligonucleotide Subsets Wiener (LW), Lewis (LE), Lutheran (LU), MNS (MNS, Gly that collectively targets nucleic acids encoding accessory cophorins A, B and E), Ok (OK), Raph (RAPH), Rh(RH) and molecules important in HLA-linked peptide presentation 45 Rh-gp (RHAG), Scianna (SC), T/Tn, Xg (XG), and Yt (YT). and/or processing (“accessory molecule oligo Subsets’), and 10. The method of claim 1, further comprising the step of said method further comprises the step of assigning to the deriving from the HLA tissue type assigned in step (c) donor/ sample, based on the hybridization pattern, an accessory mol recipient transplant compatibility. ecule phenotype; 11. The method of claim 3, wherein said non-classical wherein each of said accessory molecule oligo Subsets 50 HLA oligo subsets comprise the sequences set forth in Table comprises a set of overlapping oligonucleotides that II. cover every single nucleotide position in the mRNA 12. The method of claim 5, wherein said accessory mol sequences coding for the accessory molecules from 5' to ecule oligo Subsets comprise the sequences set forth in Table 3' and are sequentially shifted by 1-5 nucleotides from III. the 5' end of the preceding overlapping oligonucleotide. 55 13. The method of claim 7, wherein said KIRoligo subsets 6. The method of claim 5, wherein said accessory mol comprise the sequences set forth in Table IV. ecules are selected from the group consisting of LMP2, 14. The method of claim 8, wherein said blood group LMP7, LMP10, tripeptidyl peptidase II (TPPII), bleomycin determining oligo Subsets comprise the sequences set forth in hydrolase (BLMH), leucineaminopeptidase 3 (LAP3), trans Table V. porter associated with antigen processing (TAP) 1, TAP2. B2 60 15. The method of claim 1, wherein the cDNA or cRNA in microglobulin, TAP binding protein (tapasin), calnexin said sample was detectably labeled during its synthesis, and (CANX), calreticulin (CALR), protein disulfide isomerase said detecting step (b) comprises detecting the detectably family A member 2 (PDIA2), protein disulfide isomerase labeled cDNA or cRNA. family A member 3 (PDIA3), ERp57, endoplasmic reticulum 16. The method of claim 1, wherein said cDNA or cRNA aminopeptidase (ERAP) 1, ERAP2, proteasome (prosome 65 containing sample is obtained from a human Subject. macropain) subunit althap (PSMA) type I (PSMA1), 17. The method of claim 16, further comprising the step of PSMA2, PSMA3, PSMA4, PSMA5, PSMA6, PSMA7, diagnosing or predicting the likelihood of an HLA-linked US 8,969,254 B2 73 74 genetic defect, disease, inadequate or undesirable response to (b) detecting a hybridization pattern for said cDNA or a vaccine, biologic treatment (recombinant protein, biosimi CRNA; and lar or equivalent), or infectious organism, or condition in said (c) assigning to the sample, based on the hybridization subject, wherein the step is based on at least the classical HLA pattern, an HLA tissue type; tissue type assigned in step (c). wherein the capture oligonucleotides are from about 17 to 18. The method of claim 16, further comprising the step of about 60 nucleotides in length and each capture oligo determining the likely response of said subject to a particular nucleotide with respect to its exact complement has a treatment regimen selected from the group consisting of melting temperature of about 64 degrees Celsius; bone marrow transplantation, immunosuppressive regimen, wherein said capture oligonucleotides comprise Subsets of 10 oligonucleotides that collectively target classical HLA antiviral drug regimen, antiviral drug resistance, antiretrovi polypeptide-encoding nucleic acids (“classical HLA ral drug regimen, and autoimmunity drug regimen, wherein oligo Subsets), each classical HLA oligo Subset target the step is based on at least the classical HLA tissue type ing a different classical HLA polypeptide-encoding assigned in step (c). nucleic acid; and 19. The method of claim 16, further comprising the step of 15 wherein each of said classical HLA oligo Subsets com determining whether the subject is likely to develop antiret prises a set of overlapping oligonucleotides that cover roviral drug resistance or cancer drug regimen resistance, every single nucleotide position in each of the full wherein the step is based on at least the classical HLA tissue length coding regions of mRNA sequences coding for type assigned in step (c). the classical HLA polypeptides from 5' to 3' and are 20. The method of claim 1, wherein said capture oligo sequentially shifted by 1-5 nucleotides from the 5' end of nucleotides further comprise at least one set of negative con the preceding overlapping oligonucleotide; trol oligonucleotides. wherein said clNA or cRNA-containing sample is 21. The method of claim 20, wherein said at least one set of obtained from a human Subject; negative control oligonucleotides comprises two or more of wherein the method further comprising the step of deter the nucleic acid sequences set forth in at least one of Tables 25 mining whether the human subject is likely to develop VI-IX and Table X. antiretroviral drug resistance or cancer drug regimen 22. The method of claim 1, wherein said classical HLA resistance, the step being based on at least the classical oligo Subsets collectively target all known classical HLA HLA tissue type assigned in step (c); and polypeptide-encoding nucleic acids. wherein the step of determining whether the subject is 23. The method of claim 3, wherein said non-classical 30 likely to develop antiretroviral drug resistance or cancer HLA oligo Subsets collectively target all known non-classical drug regimen resistance is further based on one or more HLA polypeptide-encoding nucleic acids. of a non-classical HLA tissue type, an accessory mol 24. The method of claim 1, wherein said capture oligo ecule phenotype, a KIR polypeptide phenotype, and a nucleotides are immobilized on a Substrate. blood group phenotype. 25. The method of claim 1, wherein the detecting step (b) 35 29. The method of claim 28, wherein said classical HLA comprises the use of labeled detection probes, wherein the polypeptide-encoding nucleic acids encode HLA polypep labeled detection probes hybridize to the cDNA or cRNA that tides selected from the group consisting of HLA-A. HLA-B, has hybridized to the at least a portion of the plurality of HLA-C, HLA-DR, HLA-DP, and HLA-DQ. capture oligonucleotides and are detectable Such that the 30. The method of claim 28, wherein said classical HLA hybridization pattern of said cDNA or cRNA can be deter 40 oligo Subsets comprise the sequences set forth in Table I or the mined. normal (indicated by “HPN”), extended (indicated by 26. The method of claim 17, wherein the step of diagnosing “HPE) and truncated (indicated by “HPT) sequences set or predicting the likelihood of an HLA-linked genetic defect, forth in Table X. disease, inadequate or undesirable response to a vaccine, 31. The method of claim 28, wherein said capture oligo biologic treatment (recombinant protein, biosimilar or 45 nucleotides further comprise a plurality of oligonucleotide equivalent), or infectious organism, or condition in said Sub Subsets that collectively targets non-classical HLA polypep ject, is further based on one or more of a non-classical HLA tide-encoding nucleic acids (“non-classical HLA oligo Sub tissue type, an accessory molecule phenotype, a KIR sets), each non-classical HLA oligo Subset targeting a dif polypeptide phenotype, and a blood group phenotype. ferent non-classical HLA polypeptide-encoding nucleic acid; 27. The method of claim 18, wherein the step of determin 50 wherein each of said non-classical HLA oligo Subsets com ing the likely response of said Subject to a particular treatment prises a set of overlapping oligonucleotides that cover regimen selected from the group consisting of bone marrow every single nucleotideposition in the mRNA sequences transplantation, immunosuppressive regimen, antiviral drug coding for the non-classical HLA polypeptides from 5' regimen, antiviral drug resistance, antiretroviral drug regi to 3' and are sequentially shifted by 1-5 nucleotides from men, and autoimmunity drug regimen is further based on one 55 the 5' end of the preceding overlapping oligonucleotide. or more of a non-classical HLA tissue type, an accessory 32. The method of claim 31, wherein said non-classical molecule phenotype, a KIR polypeptide phenotype, and a HLA polypeptide-encoding nucleic acids encode HLA blood group phenotype. polypeptides selected from the group consisting of HLA-E, 28. A method for human leukocyte antigen (HLA) tissue HLA-F, HLA-G, DM, DO and MIC. typing, said method comprising: 60 33. The method of claim 28, wherein said capture oligo (a) contacting a cDNA- or cRNA-containing sample under nucleotides further comprise a plurality of oligonucleotide hybridization conditions with a plurality of capture oli Subsets that collectively targets nucleic acids encoding acces gonucleotides specific for HLA polypeptides, wherein sory molecules important in HLA-linked peptide presenta said hybridization conditions facilitate hybridization of tion and/or processing (“accessory molecule oligo Subsets’), at least a portion of the plurality of capture oligonucle 65 and said method further comprises the step of assigning to the otides to complementary sequences present in the cDNA sample, based on the hybridization pattern, an accessory mol or CRNA; ecule phenotype; US 8,969,254 B2 75 76 wherein each of said accessory molecule oligo Subsets 39. The method of claim 31, wherein said non-classical comprises a set of overlapping oligonucleotides that HLA oligo subsets comprise the sequences set forth in Table cover every single nucleotide position in the mRNA II. sequences coding for the accessory molecules from 5' to 40. The method of claim 33, wherein said accessory mol 3' and are sequentially shifted by 1-5 nucleotides from ecule oligo Subsets comprise the sequences set forth in Table the 5' end of the preceding overlapping oligonucleotide. III. 34. The method of claim 33, wherein said accessory mol 41. The method of claim 35, wherein said KIR oligo sub ecules are selected from the group consisting of LMP2, sets comprise the sequences set forth in Table IV. LMP7, LMP10, tripeptidyl peptidase II (TPPII), bleomycin 42. The method of claim 36, wherein said blood group 10 determining oligo Subsets comprise the sequences set forth in hydrolase (BLMH), leucineaminopeptidase 3 (LAP3), trans Table V. porter associated with antigen processing (TAP) 1, TAP2. B2 43. The method of claim 28, wherein the cDNA or cRNA in microglobulin, TAP binding protein (tapasin), calnexin said sample was detectably labeled during its synthesis, and (CANX), calreticulin (CALR), protein disulfide isomerase said detecting step (b) comprises detecting the detectably family A member 2 (PDIA2), protein disulfide isomerase 15 labeled cDNA or cRNA. family A member 3 (PDIA3), ERp57, endoplasmic reticulum 44. The method of claim 28, further comprising the step of aminopeptidase (ERAP) 1, ERAP2, proteasome (prosome diagnosing or predicting the likelihood of an HLA-linked macropain) subunit althap (PSMA) type I (PSMA1), genetic defect, disease, inadequate or undesirable response to PSMA2, PSMA3, PSMA4, PSMA5, PSMA6, PSMA7, a vaccine, biologic treatment (recombinant protein, biosimi PSMA8, proteasome (prosome macropain) subunit beta lar or equivalent), or infectious organism, or condition in said (PSMB) type 1 (PSMB1), PSMB2, PSMB3, PSMB4, subject, wherein the step is based on at least the classical HLA PSMB5, PSMB6, PSMB7, PSMB8, PSMB9, PSMB10, tissue type assigned in step (c). PSMB11, proteasome (prosome macropain) 26S subunit 45. The method of claim 28, further comprising the step of ATPase (PSMC) 1 (PSMC1); PSMC2, PSMC3, PSMC4, determining the likely response of said subject to a particular PSMC5, PSMC6, proteasome (prosome macropain)26S sub 25 treatment regimen selected from the group consisting of unit non-ATPase (PSMD) 1 (PSMD1), PSMD2, PSMD3, bone marrow transplantation, immunosuppressive regimen, PSMD4, PSMD5, PSMD6, PSMD7, PSMD8, PSMD9, antiviral drug regimen, antiviral drug resistance, antiretrovi PSMD10, PSMD11, PSMD12, PSMD13, and PSMD14. ral drug regimen, and autoimmunity drug regimen, wherein 35. The method of claim 28, wherein said capture oligo the step is based on at least the classical HLA tissue type nucleotides further comprise a plurality of oligonucleotide 30 assigned in step (c). Subsets targeting killer-cell immunoglobulin-like receptor 46. The method of claim 28, wherein said capture oligo (KIR) polypeptide-encoding nucleic acids (“KIR oligo Sub nucleotides further comprise at least one set of negative con sets’), and said method further comprises the step of assign trol oligonucleotides. ing to the sample, based on the hybridization pattern, a KIR 47. The method of claim 46, wherein said at least one set of polypeptide phenotype; wherein each of said KIRoligo Sub 35 negative control oligonucleotides comprises two or more of sets comprises a set of overlapping oligonucleotides that the nucleic acid sequences set forth in at least one of Tables cover every single nucleotide position in the mRNA VI-IX and Table X. sequences coding for the KIR polypeptides from 5' to 3' and 48. The method of claim 28, wherein said classical HLA are sequentially shifted by 1-5 nucleotides from the 5' end of oligo Subsets collectively target all known classical HLA the preceding overlapping oligonucleotide. 40 polypeptide-encoding nucleic acids. 36. The method of claim 28, wherein said capture oligo 49. The method of claim 31, wherein said non-classical nucleotides further comprise a plurality of oligonucleotide HLA oligo Subsets collectively target all known non-classical Subsets targeting blood group-determining polypeptide HLA polypeptide-encoding nucleic acids. encoding nucleic acids (“blood group determining oligo Sub 50. The method of claim 28, wherein said capture oligo sets’), and said method further comprises the step of assign 45 nucleotides are immobilized on a Substrate. ing to the sample, based on the hybridization pattern, a blood 51. The method of claim 28, wherein the detecting step (b) group phenotype; comprises the use of labeled detection probes, wherein the wherein each of said blood group determining oligo Sub labeled detection probes hybridize to the cDNA or cRNA that sets comprises a set of overlapping oligonucleotides that has hybridized to the at least a portion of the plurality of cover every single nucleotide position in the mRNA 50 capture oligonucleotides and are detectable Such that the sequences coding for the blood group-determining hybridization pattern of said cDNA or cRNA can be deter polypeptides from 5' to 3' and are sequentially shifted by mined. 1-5 nucleotides from the 5' end of the preceding over 52. The method of claim 44, wherein the step of diagnosing lapping oligonucleotide. or predicting the likelihood of an HLA-linked genetic defect, 37. The method of claim 36, wherein said blood group 55 disease, inadequate or undesirable response to a vaccine, determining polypeptides are selected from the group con biologic treatment (recombinant protein, biosimilar or sisting ABO (ABO), Chido Rodgers (CH/RG), Colton (CO), equivalent), or infectious organism, or condition in said Sub Cromer (CROM), Diego (DI) (band 3), Dombrock (DO), ject, is further based on one or more of a non-classical HLA Duffy (DARC), Gerbich (Ge), Gill (GIL), Globoside and Pk, tissue type, an accessory molecule phenotype, a KIR H (H), I (I), Indian (IN), John Milton Hagen (JMH), Kell 60 polypeptide phenotype, and a blood group phenotype. (KEL) and KXCXK), Kidd (JK), Knops (KN), Landsteiner 53. The method of claim 52, wherein the step of determin Wiener (LW), Lewis (LE), Lutheran (LU), MNS (MNS, Gly ing the likely response of said subject to aparticular treatment cophorins A, B and E). Ok (OK), Raph (RAPH), Rh(RH) and regimen selected from the group consisting of Rh-gp (RHAG), Scianna (SC), T/Tn, Xg (XG), and Yt (YT). bone marrow transplantation, immunosuppressive regi 38. The method of claim 28, further comprising the step of 65 men, antiviral drug regimen, antiviral drug resistance, deriving from the HLA tissue type assigned in step (c) donor/ antiretroviral drug regimen, and autoimmunity drug recipient transplant compatibility. regimen is further based on one or more of a non-clas US 8,969,254 B2 77 78 sical HLA tissue type, an accessory molecule pheno 3' and are sequentially shifted by 1-5 nucleotides from type, a KIR polypeptide phenotype, and a blood group the 5' end of the preceding overlapping oligonucleotide. phenotype. 58. The method of claim 57, wherein said accessory mol 54. A method for human leukocyte antigen (HLA) tissue ecules are selected from the group consisting of LMP2, typing, said method comprising: LMP7, LMP10, tripeptidyl peptidase II (TPPII), bleomycin (a) contacting a cDNA- or cRNA-containing sample under hydrolase (BLMH), leucine aminopeptidase 3 (LAP3), trans hybridization conditions with a plurality of capture oli porter associated with antigen processing (TAP) 1, TAP2, B2 gonucleotides specific for HLA polypeptides, wherein microglobulin, TAP binding protein (tapasin), calnexin said hybridization conditions facilitate hybridization of (CANX), calreticulin (CALR), protein disulfide isomerase at least a portion of the plurality of capture oligonucle 10 otides to complementary sequences present in the cDNA family A member 2 (PDIA2), protein disulfide isomerase or cRNA; family A member 3 (PDIA3), ERp57, endoplasmic reticulum (b) detecting a hybridization pattern for said cloNA or aminopeptidase (ERAP) 1, ERAP2, proteasome (prosome cRNA; and macropain) subunit althap (PSMA) type I (PSMA1), (c) assigning to the sample, based on the hybridization 15 PSMA2, PSMA3, PSMA4, PSMA5, PSMA6, PSMA7, pattern, an HLA tissue type; PSMA8, proteasome (prosome macropain) subunit beta wherein the capture oligonucleotides are from about 17 to (PSMB) type 1 (PSMB1), PSMB2, PSMB3, PSMB4, about 60 nucleotides in length and each capture oligo PSMB5, PSMB6, PSMB7, PSMB8, PSMB9, PSMB10, nucleotide with respect to its exact complement has a PSMB11, proteasome (prosome macropain) 26S subunit melting temperature of about 64 degrees Celsius; ATPase (PSMC) 1 (PSMC1); PSMC2, PSMC3, PSMC4, wherein said capture oligonucleotides comprise Subsets of PSMC5, PSMC6, proteasome (prosome macropain)26S sub oligonucleotides that collectively target classical HLA unit non-ATPase (PSMD) 1 (PSMD1), PSMD2, PSMD3, polypeptide-encoding nucleic acids (“classical HLA PSMD4, PSMD5, PSMD6, PSMD7, PSMD8, PSMD9, oligo Subsets), each classical HLA oligo Subset target PSMD10, PSMD11, PSMD12, PSMD13, and PSMD14. ing a different classical HLA polypeptide-encoding 25 59. The method of claim 54, wherein said capture oligo nucleic acid; nucleotides further comprise a plurality of oligonucleotide wherein each of said classical HLA oligo Subsets com Subsets targeting killer-cell immunoglobulin-like receptor prises a set of overlapping oligonucleotides that cover (KIR) polypeptide-encoding nucleic acids (“KIR oligo sub every single nucleotide position in each of the full sets’), and said method further comprises the step of assign length coding regions of mRNA sequences coding for 30 ing to the sample, based on the hybridization pattern, a KIR the classical HLA polypeptides from 5' to 3' and are sequentially shifted by 1-5 nucleotides from the 5' end of polypeptide phenotype; wherein each of said KIR oligo Sub the preceding overlapping oligonucleotide; sets comprises a set of overlapping oligonucleotides that wherein said capture oligonucleotides further comprise at cover every single nucleotide position in the mRNA least one set of negative control oligonucleotides; and 35 sequences coding for the KIR polypeptides from 5' to 3' and wherein said at least one set of negative control oligonucle are sequentially shifted by 1-5 nucleotides from the 5' end of otides comprises two or more of the nucleic acid the preceding overlapping oligonucleotide. sequences set forth in at least one of Tables VI-IX and 60. The method of claim 54, wherein said capture oligo Table X. nucleotides further comprise a plurality of oligonucleotide 55. The method of claim 54, wherein said capture oligo 40 Subsets targeting blood group-determining polypeptide nucleotides further comprise a plurality of oligonucleotide encoding nucleic acids (“blood group determining oligo Sub Subsets that collectively targets non-classical HLA polypep sets’), and said method further comprises the step of assign tide-encoding nucleic acids (“non-classical HLA oligo Sub ing to the sample, based on the hybridization pattern, a blood sets), each non-classical HLA oligo Subset targeting a dif group phenotype; ferent non-classical HLA polypeptide-encoding nucleic acid; 45 wherein each of said blood group determining oligo Sub wherein each of said non-classical HLA oligo Subsets com sets comprises a set of overlapping oligonucleotides that prises a set of overlapping oligonucleotides that cover cover every single nucleotide position in the mRNA every single nucleotideposition in the mRNA sequences sequences coding for the blood group-determining coding for the non-classical HLA polypeptides from 5' polypeptides from 5' to 3' and are sequentially shifted by to 3' and are sequentially shifted by 1-5 nucleotides from 50 1-5 nucleotides from the 5' end of the preceding over the 5' end of the preceding overlapping oligonucleotide. lapping oligonucleotide. 56. The method of claim 55, wherein said non-classical 61. The method of claim 60, wherein said blood group HLA polypeptide-encoding nucleic acids encode HLA determining polypeptides are selected from the group con polypeptides selected from the group consisting of HLA-E, sisting ABO (ABO), Chido Rodgers (CH/RG), Colton (CO), HLA-F, HLA-G, DM, DO and MIC. 55 Cromer (CROM), Diego (DI) (band 3), Dombrock (DO), 57. The method of claim 54, wherein said capture oligo Duffy (DARC), Gerbich (Ge), Gill (GIL), Globoside and Pk, nucleotides further comprise a plurality of oligonucleotide H (H), I (I), Indian (IN), John Milton Hagen (JMH), Kell Subsets that collectively targets nucleic acids encoding acces (KEL) and KXCXK), Kidd (JK), Knops (KN), Landsteiner sory molecules important in HLA-linked peptide presenta Wiener (LW), Lewis (LE), Lutheran (LU), MNS (MNS, Gly tion and/or processing (“accessory molecule oligo Subsets’), 60 cophorins A, B and E), Ok (OK), Raph (RAPH), Rh(RH) and and said method further comprises the step of assigning to the Rh-gp (RHAG), Scianna (SC), T/Tn, Xg (XG), and Yt (YT). sample, based on the hybridization pattern, an accessory mol 62. The method of claim 54, further comprising the step of ecule phenotype; deriving from the HLA tissue type assigned in step (c) donor/ wherein each of said accessory molecule oligo Subsets recipient transplant compatibility. comprises a set of overlapping oligonucleotides that 65 63. The method of claim 55, wherein said non-classical cover every single nucleotide position in the mRNA HLA oligo subsets comprise the sequences set forth in Table sequences coding for the accessory molecules from 5' to II. US 8,969,254 B2 79 80 64. The method of claim 57, wherein said accessory mol 72. The method of claim 54, wherein the detecting step (b) ecule oligo subsets comprise the sequences set forth in Table comprises the use of labeled detection probes, wherein the III. labeled detection probes hybridize to the cDNA or cRNA that 65. The method of claim 59, wherein said KIRoligo sub has hybridized to the at least a portion of the plurality of sets comprise the sequences set forth in Table IV. 5 capture oligonucleotides and are detectable such that the 66. The method of claim 60, wherein said blood group hybridization pattern of said cloNA or cRNA can be deter determining oligo subsets comprise the sequences set forth in mined. Table V. 73. The method of claim 54, wherein said classical HLA 67. The method of claim 54, wherein the cDNA or cRNA in oligo Subsets collectively target all known classical HLA said sample was detectably labeled during its synthesis, and 10 polypeptide-encoding nucleic acids. said detecting step (b) comprises detecting the detectably 74. The method of claim 55, wherein said non-classical labeled cDNA or cRNA. HLA oligo Subsets collectively target all known non-classical 68. The method of claim 54, wherein said cDNA or cRNA HLA polypeptide-encoding nucleic acids. containing sample is obtained from a human subject. 75. The method of claim 54, wherein said capture oligo 69. The method of claim 68, further comprising the step of 15 nucleotides are immobilized on a substrate. diagnosing or predicting the likelihood of an HLA-linked 76. The method of claim 69, wherein the step of diagnosing genetic defect, disease, inadequate or undesirable response to or predicting the likelihood of an HLA-linked genetic defect, a vaccine, biologic treatment (recombinant protein, biosimi disease, inadequate or undesirable response to a vaccine, lar or equivalent), or infectious organism, or condition in said biologic treatment (recombinant protein, biosimilar or Subject, wherein the step is based on at least the classical HLA equivalent), or infectious organism, or condition in said sub tissue type assigned in step (c). ject, is further based on one or more of a non-classical HLA 70. The method of claim 69, further comprising the step of tissue type, an accessory molecule phenotype, a KIR determining the likely response of said subject to a particular polypeptide phenotype, and a blood group phenotype. treatment regimen selected from the group consisting of: 77. The method of claim 76, wherein the step of determin bone marrow transplantation, immunosuppressive regimen, 25 ing the likely response of said subject to a particular treatment antiviral drug regimen, antiviral drug resistance, antiretrovi regimen selected from the group consisting of: ral drug regimen, and autoimmunity drug regimen, wherein bone marrow transplantation, immunosuppressive regi the step is based on at least the classical HLA tissue type men, antiviral drug regimen, antiviral drug resistance, assigned in step (c). antiretroviral drug regimen, and autoimmunity drug 71. The method of claim 69, further comprising the step of 30 regimen is further based on one or more of a non-clas determining whether the subject is likely to develop antiret sical HLA tissue type, an accessory molecule pheno roviral drug resistance or cancer drug regimen resistance, type, a KIR polypeptide phenotype, and a blood group wherein the step is based on at least the classical HLA tissue phenotype. type assigned in step (c). UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION

PATENT NO. : 8,969,254 B2 Page 1 of 1 APPLICATION NO. 13/32916.1 DATED : March 3, 2015 INVENTOR(S) : Ellis L. Reinherz et al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:

In the specification In Column 1, delete lines 13-16, and insert the following new paragraph: -- This invention was made with government support under grant numbers U19 AIO57330 and U01 AIO90043 awarded by The National Institutes of Health. The government has certain rights in the invention. --

Signed and Sealed this Twenty-fifth Day of October, 2016 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office