AN ABSTRACT OF THE THESIS OF
Samradhni Jha for the degree of Master of Science in Veterinary Science presented on June 8, 2006. Title: Macrophage Infection with Wild-Type Mycobacierium ai'ium or Isogenic Attenuated PPE mutant revealed Differences in Gene Expression and Mycobacterial Vacuole Proteins.
Abstract approved: Redacted for Privacy
Luiz E. Bermudez
Mycobacterium avium is a ubiquitous environmental organism found in water and soil. It can cause disease in patients with pre-existing pulmonary conditions, immunocompromised patients with the most prevalent being AIDS patients, as well as apparently healthy people. Studies have indicated that, upon macrophage uptake, Al. avium prevents phagosome-lysosome fusion, thus avoiding its killing. PPE-PE families of genes in mycobacteria have been suggested to have a role in mycobacterial virulence in vivo. Using anMavium-attenuated PPE transposon mutant, this study seeks to examine the differences in the phagosomal proteins expressed upon macrophage infection with the wild-type and its isogenic PPE mutant. Furthermore, this study aims to investigate the differences in the transcriptional profile of macrophages infected withM avium and the attenuated PPE mutant.
First, the M avium and attenuated PPE mutant phagosome protein expression were determined by mass spectrometry analysis. It was found that wild-type phagosomes express proteins different from isogenic PPE mutant phagosomes at 30mm, 4 h and 24 h.
The proteins identified in the phagosomes of wild-type and the PPE mutant were found to be involved in bacterial uptake, antigen presentation and recognition, Rab and Rab- interacting proteins, cytoskeleton and motor proteins, proteins involved in biosynthetic pathways, transcriptional regulators, signal transduction proteins, ion channels and hypothetical proteins. Fluorescent microscopy studies were carried out to confirm the protein expression in M avium- PPE mutant-infected macrophages.
After performing a DNA microarray on the macrophages infected with M avium and the PPE mutant at 4 h, we observed differences in the gene expression patterns of the wild-type and the PPE mutant infected macrophages.
Finally, real-time PCR was used to confirm the differential expression of three chosen genes. The genes were found to be upregulated similar to that found in the DNA array data.
Through these studies, we have determined several proteins, either previously described or not reported, to be present on the phagosome. Nonetheless, the use of the
PPE mutant established the possibility that one protein may have a key function in modulating the formation of the phagosome. Another interesting aspect of our findings is that there is a possible connection between macrophage genes regulated upon uptake of a bacterium and the downstream effect on vacuole formation. Macrophage Infection with Wild-TypeMycobacterium aviumor Tsogenic Attenuated
PPE Mutant revealed Differences in Gene Expression and Mycobacterial Vacuole
Proteins
by Samradhni Jha
A THESIS
submitted to
Oregon State University
in partial fulfillment of the requirement for the degree of
Master of Science
Presented June 8, 2006 Commencement June 2007 Master of Science thesis of Samradhni Jha presented on June 8. 2006.
APPROVED: Redacted for Privacy
Major Professor, representing Veterinary Science
Redacted for Privacy
Head of the Department of Biomedical Sciences
Redacted for Privacy Dean of the Graduate School
I understand that my thesis will become a part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my thesis to any reader upon request.
Redacted for Privacy
Jha, Author ACKNOWLEDGEMENTS
I would like to offer deep respect to my late father Shri. Dhruva. N. Dharaskar for whatever I am today. He is the building block of my career and was a constant source of motivation, inspiration, guidance and support, both emotionally and financially. No words can express my feelings and sincere gratitude towards him because of whom I stand here today. A sense of satisfaction runs through my heart knowing that I fulfilled his dream.
I am grateful to my major professor, Dr. Luiz E. Bermudez, for providing me with the opportunity to work under his guidance. He has been a true mentor, showing me the right path toward sound knowledge and skills. His timely guidance and suggestions have helped me achieve my goal here at OSU. I am thankful to my thesis committee, Dr.
Manoj Pastey and Dr. Claudia Hase, for their help and support.
I am indebted to Dr. Lia Danelishvili, Dr. Yoshitaka Yamazaki, Dr. Dilip Patel, and Dr. Martha Alonso Hearn for their moral support, technical help and useful scientific discussions. I am thankful to all my lab members, Julie Early, Melanie Harriff, Sanjai
Tripathi, and Dr. Heather Duchow, for keeping up a friendly, pleasant, and cheerful lab atmosphere full of energy. I enjoyed working with these people.
The care and encouragement I have received from my mother Mrs. Asmita. D.
Dharaskar and my in-laws Shri. Dinesh Jha & Mrs. Kiran Jha was invaluable. I appreciate all my family members and friends for their unending help. Last but not the least, I am blessed to have Dr. Shantibhushan Tha as my husband who always stood beside me. I would like to take this opportunity to thank him for all the love and faith he bestowed on me. TABLE OF CONTENTS
Introduction .1
Macrophage infection with wild-type Mycobacterium avium or isogenic attenuated PPE mutant revealed differences in gene expression and mycobacterial vacuole proteins ...... 8
Discussion ...... 50 Bibliography ...... 58 LIST OF FIGURES
Figure Fg
1. Fluorescent microscopy images of isolated phagosomes showing fluorescein-labeled M. avium and 2D6 mutant ...... 22
2.Fluorescent microscopy images of U-937 macrophages infected with MAC 109 or 2D6 mutant for SP-D protein expression ...... 27
3.Fluorescent microscopy images of U-937 macrophages infected with MAC 109 or 2D6 mutant for I-type Ca2+ channel protein expression ...... 28
4. Fluorescent microscopy images of U-937 macrophages infected with complementedMavium 2D6 mutant for SP-D protein expression ...... 30
5.Fluorescent microscopy images of U-937 macrophages infected with complemented M avium 2D6 mutant for T-type Ca2+ channel protein expression ...... 31
6.Upregulation of U-937 macrophage genes upon infection withMavium or 2D6 mutant at 4 h by real-time PCR ...... 36
7.Real-time PCR graph showing upregulation of genes in macrophage upon M avium or 2D6 mutant infection ...... 56 LIST OF TABLES
Table
1. List of phagosoma] proteins identified by MS/MS post-infection with MAC 109 or 2D6 at different time points ...... 23
2.Macrophage genes upregulated inMavium 109 but downregulated in 2D6 mutant 4 h post-infection ...... 33
3.Macrophage genes downregulated inMavium 109 but upregulated in 2D6 mutant 4 h post-infection ...... 34
4.Sense and antisense primers for real-time PCR ...... 55 Dedicated to my parents, in-laws, husband and family members Macrophage Infection with Wild-Type Mycobacterium avium or Isogenic Attenuated PPE Mutant revealed Differences in Gene Expression and Mycobacterial Vacuole Proteins
Introduction
Mycobacteria are a group of gram-positive, acid-fast bacteria capable of inhabiting a wide range of environments. Of over 60 mycobacterial species are currently known. Some of these organisms are pathogens, having the ability to infect humans and animals. There is an increasing evidence of environmental mycobacteria being pathogenic and causing grave diseases in humans especially immunocompromised individuals.
Mycobacteria are widespread throughout the environment. Many different mycobacterial species cause diseases ranging from gastrointestinal infections to skin and soft tissue infections to disseminated infection. Mycobacterium marinum and
Mycobacterium chelonae, responsible for causing skin granulomas are waterborne mycobacterial species. Another species Mycobacterium kansasii is associated with pulmonary diseases. In animals, Mycobacterium avium ssp. paratuberculosis is responsible for substantial economic losses to cattle industry because of the chronic inflammatory condition of the intestinal tract. The same bacterium has been proposed to be the cause of Crohn's disease in humans, but the evidence is still unclear. Probably, the most important environmental species of significance is the Mycobacterium avium complex or MAC.
Mycobacterium avium complex is composed of M. avium ssp. avium and
M. intracellulare. M. avium bacilli are extremely widespread in nature. They are common in surface waters and soils and are frequently isolated from water taps (11). M. 2 avium is an opportunistic pathogen capable of causing diseases in humans and animals.
This complex has been shown to be accountable for most of the cases of non-tuberculosis mycobacterial infections in the developed countries (20). M. avium affects young, adults, patients with immunocompromised body system, pre-existing chronic pulmonary diseases, silicosis, pneumoconiosis, emphysema, bronchiectasis and cystic fibrosis as well as in people who are apparently healthy (1, 10, 23). M. avium is the most common isolate from AIDS patients (14) and can cause disseminated disease as well as pulmonary infections in these individuals (8). M. avium infection is a well-known secondary complication in people suffering from Mycobacterium tuberculosis and Pneumocytis carinii infections (35). M. avium organisms are intrinsically drug resistant, making infections difficult to treat (7).
Mycobacterium avium and the host response
M. avium has predilection for tissue macrophages and blood monocytes. The
bacteria are phagocytosed by host macrophages through complement receptors and CR3
mediated phagocytosis (4). In addition, the integrin fibronectin receptor is also involved
in the internalization of the serum fibronectin bound bacteria (23). Normally, phagocytosis of the bacteria results in a series of intracellular events specifically designed to induce killing of engulfed bacteria and include (i) induction of reactive oxygen and nitrogen intermediates, (ii) gradual acidification of the phagosome due to the activity of proton-ATPase pumps located on the phagosome membrane, (iii) phagosome-lysosome fusion which loads the resulting phagolysosome with acidic proteolytic enzymes and (iv) antigen processing. The resulting lethal environment effectively kills the majority of ingested bacteria. Pathogenic species of mycobacteria have developed strategies to circumvent the major killing mechanisms employed by macrophages. Mycobacteria not only have the ability to adapt to a changing host environment (19, 50) but also actively interfere with the signaling machinery within the host cell to counteract or inhibit parts of the killing apparatus employed by the macrophage. The infected macrophages show impaired antigen processing (32), reduced responsiveness to interferon-y (IFN-y) (26, 42), reduced production of cytokines, and reactive oxygen and nitrogen intermediates (5). The observation that attenuated strains of mycobacteria such as H37Ra and Mycobacterium bovis BCG are significantly more potent inducers of apoptosis than their corresponding virulent strains, H37Rv and wild-type M.bovis, suggest that apoptosis functions as a host defense mechanism which is suppressed by the virulent strains (24).
In case of M. avium, once inside the macrophage, the bacterium is capable of inhibiting the vacuole acidification and thus avoids the phagosome-lysosome fusion leading to its survival in the macrophages. It does so partiy by residing in the vacuoles with limited proteolytic activity, maintaining cathepsin D in an immature form, and remaining accessible to transferrin (45). A study suggested that M. avium requires Rab5 and accessibility to iron in order to arrest the phagosome maturation (25). M. avium vacuoles acquire lysosomal membrane protein LAMP-i but not the vesicular proton- adenosine triphosphatase (ATPase) responsible for phagosomal acidification (46).
Similar studies on M. tuberculosis vacuoles have revealed incomplete lumenal acidification and absence of mature hydrolases leading to inhibition of phagosome- lysosome fusion (48). In addition, Malik and colleagues (28-30) suggested that calcium modulation by M. tuberculosis is one of the factors responsible for phagosome maturation arrest. The maturation block in M. tuberculosis has been shown to be occurring between the stages controlled by RabS which is an early endocytic marker and
Rab7, a late endosome marker (49). Phagosomes containing live virulent M. tuberculosis show the presence of early endosomal markers like the transferrin receptor, MHC class II molecules and the ganglioside GM1 (6, 45) whereas exclude the proton ATPase and late endosomal markers (46), mannose-6-phosphate receptor (51) and lysosomal protease cathepsin D (6). The absence of proton ATPase is thought to account for reduced acidification of mycobacterial phagosomes (46) with pH of 6.2-6.3 as compared to a pH of 5.3-5.4 which is normally associated with the lysosomal compartments. Some studies suggest that macrophages infected with M. tuberculosis show markedly reduced expression of MHC class II molecules (18, 22, 33).
Other bacteria, like Salmonella spp., invade and replicate inside the professional phagocytes and epithelial cells in a membrane bound compartment called the Salmonella- containing vacuole (SCV). Previous studies have established that the SCV transiently interacts with early endosomes but only acquires a subset of late endosomal/lysosomal proteins (43). Studies on SCV revealed transient association of EEA- 1, transferrin receptor (44) and GTPase Rab5 (38) on early SCVs which are rapidly lost followed by accumulation of late endosome/lysosome markers such as Rab7 (31), lysosomal membrane proteins LAMP-i, LAMP-2 and CD63 and vacuolar ATPase (44). SCV selectively acquires lysosomal glycoproteins and lysosomal enzyme without fusing directly with lysosomes (12). Another study by (41) showed that phosphatidylinositol 3- phosphate (PI3P) is transiently accumulated on SCVs and that P13K is involved in the development of SCV but is not essential for intracellular survival and proliferation. SCV 5 biogenesis and maturation in macrophages revealed that SCV acidifies and eventually merge with the lysosomes (2, 34). More recent studies show that the maturation of SCV in HeLa cells and in primary or cultivated macrophages is quite similar (13, 37).
Coxiella burnetii, another obligate intracellular bacteria which causes Q fever in humans resides within acidified vacuoles inside the Vero cells with secondary lysosomal characteristics (3). The bacterium inhabits a cholesterol-rich vacuole and requires free access to host cholesterol stores for optimal replication (21).
Legionella pneumophila, an intracellular pathogen replicates inside the eukaryotic cells in a unique vacuole similar to endoplasmic reticulum (ER) and avoids endocytic maturation. Studies have shown that the host vesicles that attach to L. pneumophila- containing vacuole (LCV) are derived from ER based on the presence of resident ER proteins like glucose-6-phosphate, protein disulphide isomerase (PDI) and proteins having the ER-retention signal lysine-aspartic acid-glutamic acid-leucine (KDEL) (39).
Derre and colleagues reported the recruitment of calnexin, Sec22 and Rabi to the vacuole shortly after bacterial uptake (9). They also suggested a potential role of Rabi in ER recruitment process. After ingestion by macrophages, the bacteria inhibit acidification and maturation of its phagosome. As the bacteria replicates exponentially, a significant number of the vacuoles acquire LAMP-i, cathepsin D and the pH of the vacuoles average
5.6 (47). The authors also showed that bacteria are able to survive and replicate within the lysosomal compartments.
Mycobacterial virulence factors
PPE and PE gene families, which encode numerous proteins of unknown function account for 10% of Mycobacterium tuberculosis genome. Mycobacterium avium has genome similar regarding the PPE and PE gene families. Few reports have suggested that these two families might be involved in several roles such as antigen variation, binding to eukaryotic cells, survival within macrophages and persistence in granulomas
(36, 40). Camacho and colleagues identified a PPE gene (Rv3018c) associated with M. tuberculosis virulence in vivo. Another study by Ramakrishnan and colleagues reported that inactivation of PE-PGRS gene in M. marinum resulted in attenuation of virulence of the bacteria in macrophages. Sampson and colleagues identified a PPE protein (Rvl917) that is expressed on the bacterial surface. Li and colleagues (27) suggested a M. avium
PPE gene (similar to Rv1787 in M. tuberculosis) to play a role in the inhibition of acidification and phagosome-lysosome fusion of infected macrophages. The mutation did not alter the ability of the bacterium to enter macrophages but decreased virulence and survival in vitro. In addition, the 2D6 mutant was severely attenuated in mice. The
PPE gene was expressed early only in macrophage and not in broth suggesting its role in the phagosome formation or vacuole maturation as well as in the mechanisms of bacterial adaptation to the intracellular environment. The vacuole containing the attenuated PPE mutant underwent acidification to pH 4.8 16 h after phagocytosis.
The inactivated PPE gene is part of the M. avium genome region with five PPE and PE genes. The organization suggests the existence of three promoters, one upstream of the inactivated PPE gene in the 2D6 mutant, one between the second and third genes and another between the fourth and fifth genes in downstream region. Therefore the phenotype observed could be because of a polar effect of the inactivated PPE gene and that three or all the five genes are responsible for the phenotype. But since the complementation of the inactivated PPE gene reversed the phenotype, it is more likely 7 that only the PPE gene inactivated and probably the downstream gene are responsible for the phenotype.
The vacuoles containing the 2D6 strain were significantly more acidic than the vacuoles with the wild-type bacterium. This suggests that the PPE gene or the complete genome region is able to influence vacuole acidification. Since acidification is secondary to docking of acid pumps to the phagosome, it is plausible to hypothesize that the PPE gene would either influence change in the phagosome membrane thereby preventing the acquisition of acid pump or transporting other molecules to the bacterial surface where they would prevent the binding of proton pump.
An important aspect in the study of M. avium and the PPE gene inactivated mutant phagosomes would be to identify the proteins expressed on the wild-type phagosomes and compare them with those expressed on PPE gene inactivated mutant phagosomes. This study would reveal the differences if any, on both the bacterial phagosomes and would also shed light on the variety of proteins involved in the phagosome biogenesis. Additionally, it would correlate the underlying mechanisms employed by the wild-type bacteria to prevent the phagosome maturation and ultimate fusion with lysosomes. Furthermore, identification of the genes upregulated in the macrophages upon M. avium or 2D6 mutant infection would explore the different pathways triggered upon wild-type or 2D6 mutant invasion in macrophages. Any differences in the macrophage gene expression would help understand the altered trafficking stimulated by the wild-type in comparison with the 2D6 mutant. Differences in Macrophage Transcriptional Profile and Mycobacterial Vacuole Proteins following infection with Mycobacterium avium and Attenuated PPE Mutant
Samradhni JhaLia Danelishvili ',Yong-jun Li2Yoshitaka Yamazaki and Luiz E. Bermudez1*
To be submitted to Cellular Microbiology Abstract
Mycobacterium avium is an environmental opportunistic pathogen which infects and replicates in mononuclear phagocytes. The phagosome-lysosome fusion is an important
step of the host defense pathway, which culminates in bacterial killing and degradation.
Previous study reported an attenuated mutant 2D6 in which a PPE gene (52%
homologous to Rv1787 in M. tuberculosis) was interrupted by a transposon. This
isogenic mutant, in contrast to wild type, was shown to have an impaired ability to
replicate intracellularly and to prevent the fusion of phagosome and lysosome. To study
the gene expression profile of macrophages infected with the wild-type bacterium and
2D6 mutant, we performed a DNA microarray analysis at 4 h post infection. Differences
were observed indicating that the two bacteria interact with mononuclear phagocytes in
unique fashions. We then hypothesized that the wild-type bacterium environment in
macrophages might differ from the mutant 2D6 environment, and compared the
phagosomal proteins expressed in M. avium infected cells and its isogenic mutant at
different time points. M. avium phagosomes expressed a number of proteins different
from those of it's isogenic mutant. Proteins identified belonged to several functional
classes and many of these proteins have not been previously described to be present on the bacterial phagosomes. The expression of some selected proteins on the phagosomes
was confirmed by immunofluorescence microscopy. 10
Introduction
Mycobacterium avium is an environmental pathogen commonly found in soil and
water (11, 21).M.avium causes disseminated disease in immunocompromised people
such as in AIDS patients, and is a known secondary complication in patients suffering
from chronic pulmonary conditions (1).M.avium preferentially infects tissue
macrophages and blood monocytes. Once inside a macrophage, the bacterium has shown
to inhibit the acidification of the phagosome subsequently preventing the fusion between
the phagosome and lysosome (38). Acidification of the vacuole followed by its fusion
with the lysosomal compartment is part of the host cell mechanisms for intracellular
killing of microorganisms (30). Similar toM.tuberculosis (41), Salmonella (4) and
Leishmania (18),M.avium interferes with endosome maturation process which precedes
phagosome-lysosome fusion. The mechanisms thatM.avium uses to survive within
macrophages have been an active area of research. Previous reports have shown thatM.
avium has the ability to modulate the intracellular environment by remaining accessible
to internalized transferrin and limiting the proteolytic activity, maintaining cathepsin D in
an immature form (37). Malik and colleagues have suggested inhibition of calcium
signaling by M. tuberculosisisresponsible for the preventionofphagosome-lysosome
fusion (26). A study carried out by Li and colleagues (2005) involving screening ofM.
avium transposon mutants for clones with decreased ability to replicate intracellularly in human macrophages identified an attenuated 2D6 mutant in which the transposon interrupted a PPE gene (52% homologous to Rv1787 inM.tuberculosis). The 2D6 mutant was significantly attenuated in macrophages in contrast to the wild type bacteria
although both bacteria had comparable ability to enter the phagocytic cells. In addition, 11 vacuoles containing the 2D6 mutant could not prevent the acidification of the phagosomes and fusion with the acidic lysosomes leading to reduced survival in macrophages. The PE and PPE families of genes in mycobacteria are found disperse throughout the genomes ofM.tuberculosis,M.bovis, M. avium andM.paratuberculosis.
It is assumed thatM.avium andM.paratuberculosis lack PE-PGRS proteins (10) although we have recently found a PE-PGRS protein inM.avium (Li, Y and colleagues, submitted for publication). These families of proteins have been associated with virulence of mycobacteria (5, 9, 23).
Early events in the infection are likely to have an influence on the vacuole characteristics and formation. The PPE gene inM.avium homologue to Rv1787 is expressed upon entry in macrophages, and therefore may participate in the development of theM.avium environment. Because the mycobacterial vacuole is probably a consequence of infection ofM.avium and the macrophage from the early moments of binding and uptake, we want to investigate the differences related to the lack of the
Rv1787 homologue gene. DNA microarray and study of the phagosome proteins were performed using macrophages infected with the wild-type bacterium and the 2D6 mutant. 12
Materials and Methods
Bacterial strains and growth conditions
Mycobacterium avium strain 109 (MAC 109), a virulent strain in mice, was cultured from
20% glycerol stock onto Middlebrook 7H1 1 agar supplemented with oleic acid, albumin, dextrose and catalase (OADC; Hardy Diagnostics, Santa Maria, CA) at 37°C for 21 days.
Bacteria were suspended in Hank's buffered salt solution (HBSS) and passed through a
26-gauge needle for 10 times to disperse the clumps. The suspension was then allowed to rest for 5 minutes and the upper half was used for the assays. The bacterial concentration was adjusted to1x109bacteria mY' using a Mc Farland standard. Microscopic observations of the suspensions were carried out to verify whether the inoculums were constituted of dispersed bacteria. Only well dispersed inocula were used in the described experiments. The 2D6 mutant was cultured from 20% glycerol stock on Middlebrook
7H1 1 agar containing 400pg/ml kanamycin. The 2D6 mutant suspension was made as described above. The complemented 2D6 strain (23) was also cultured from 20% glycerol stock and grown on Middlebrook 7H1 1 agar plates containing 200.tg/ml apramycin (23).
Cells and culture conditions
Human monocytic cell line U937 (ATCC CRL-1593.2) was cultured in RPMI- 1640
(Gibco Laboratories) supplemented with 10% heat-inactivated fetal bovine serum (FBS;
Sigma Chemical), 2 mM L-glutamine. U937 cells were used between passages 15 to 20 and concentrations of7x106were seeded in75cm2flasks. The cells were grown to 90-
100% confluency, and allowed to differentiate overnight by incubation with 500ngmY1 phorbol 12-myristate 13-acetate (PMA; Sigma). U-937 and human monocyte-derived 13 macrophages were shown to behave similarly when infected withM.avium and 2D6 mutant (data not shown). The MAC 109 or 2D6 mutant were added to the monolayers at a multiplicity of infection (MOl) of 10, and the infection was allowed to take place for 2 h at 37°C in 5% CO2. The supernatant was then removed and the cell monolayer was washed three times with HBSS. The tissue culture medium was then replenished.
Phagosome Isolation and Microscopy
Phagosomes containing M. avium 109 and 2D6 mutant were isolated according to a protocol described previously (38) with minor modifications. Briefly, infected macrophages were added homogenization buffer and scraped from tissue culture flasks.
The cells were lysed by approximately 30 passages through a tuberculin syringe (at least
90% of the cells were lysed) and the lysate was carefully deposited over a 12% to 15% sucrose gradient. The preparation was then centrifuged at 2000 rpm for 40 minutes at
4°C. After centrifugation, the interface was collected and centrifuged in 10% Ficoll solution at 2500 rpm for 40 minutes at 4°C. A small pellet containing phagosomes was visible at the bottom of the tube. Phagosomes were analyzed for purity visually on glass slides by staining MAC 109 or 2D6 with lOjig/ml N-hydroxysuccinimidyl ester 5-(and-
6)- carboxyfluorescein (NHS-CF; Molecular Probes, Eugene, OR) for 1 h at 37°C.
Phagosomes containing liveM.avium or 2D6 showed green fluorescence/green fluorescein stain when observed under lOOx oil immersion (Leica DMLB Scope, Spot3rd
Party Interface; Diagnostics Instruments Inc.). More than 95% of the phagosomes observed showed bacteria in them. 14
Mass Spectrometry
The phagosome samples were run by ic/ms-ms using a Waters (Miliford, MA)
NanoAcquity HPLC connected to a Waters Q-Tof Ultima Global. 5 ul of a sample was loaded onto a Waters Symmetry C18 trap at 4uLlmin, then the peptides were eluted from the trap onto the 10cm x 75um Waters Atlantis analytical column at 3SOnlJmin. The
HPLC gradient went from 2% to 25% B in 30 minutes, then to 50% B in 35 mins, then
80% B in 40 mins and held there for 5 minutes. Solvent A was 0.1% formic acid in water, and B was 0.1% formic acid in acetonitrile. Peptide "parent ions" were monitored as they eluted from the analytical column with 0.5 seconds survey scans from mlz 400-
2000. Up to 3 parent ions per scan that had sufficient intensity, and had 2, 3, or 4 positive charges were chosen for ms/ms. The ms/ms scans were 2.4 seconds from mlz
50-2000.
The mass spectrometer was calibrated using the ms/ms spectrum from glu-fibrinopeptide.
Masses were corrected over the time the calibration was used (one day or less), using the
Waters MassLynx DXC system.
The raw data was processed with MassLynx 4.0 to produce pkl files, a set of smoothed and centroided parent ion masses with the associated fragment ion masses. The pkl files were searched with Mascot 2.0 (Matrix Science Ltd., London, UK) database searching software, using mass tolerances of 0.2 for the parent and fragment masses. The Swiss
Prot database was used, limiting the searches to human proteins. Peaks Studio
(Bioinformatics Solutions Inc., Ontario, Canada) was also used to search the data, using mass tolerances of 0.1, and the IPI human database. 15
Immunofluorescence Analysis
Because some of the proteins identified in the phagosomes have not been previously described as part of the vacuole membrane, we examined their presence by using immunofluorescence. Primary antibodies against pulmonary surfactant protein D (SP-D) and T-type Caalphall protein were purchased from Santa Cruz Biotechnology, Santa
Cruz, CA. Primary antibodies used were rabbit anti-SP-D and goat anti-T-type Ca alphall. Secondary antibodies were Texas-Red conjugates (TR) and included donkey anti-rabbit IgG-TR (Amersham Biosciences, Piscataway, NJ) and mouse anti-goat IgG-
TR (Santa Cruz Biotechnology, Santa Cruz, CA). The two-well chamber slides from
Nalge Nunc (Rochester, NY) were employed for macrophage monolayer preparation and fluorescent microscopy. The numbers of U937 cells were determined in a hemocytometer before seeding. A total of5x105cells were added in each tissue culture well of the two-chamber slides and were differentiated with 2g/ml of PMA overnight.
The monolayers were then infected with MAC 109 and 2D6 labeled with NHS-CF as described above using a MOI of 10. The cells were incubated for 4 h at 37°C for SP-D protein expression and 24 h for T-type Ca++alphall protein expression. The timepoints were chosen because of the expression results. The chambers were washed three times with sterile phosphate buffer saline (PBS) and treated with 2OOtg/m1 amikacin to kill extracellular bacteria. The cells were subsequently washed and allowed to air dry. Cells were then fixed with 100% methanol at room temperature for 10 minutes, permeabilized in cold 0.1% Triton X-100 (J.T Baker) and 0.1% sodium citrate for 20 minutes on ice.
Next, the monolayers were washed with PBS and blocked with 2% BSA (BSA, Sigma) in
PBS for 20 minutes at room temperature. The 2% BSA was replaced with 1 ml of 16 specific primary antibody and allowed to incubate for 1 h. All the antibodies were prepared in 2% BSA in PBS to prevent non-specific binding. The cells were then washed three times with sterile PBS and reincubated with the appropriate Texas-Red conjugated secondary antibody for an additional 1 h. Macrophages were washed three times with sterile PBS and allowed to air dry before adding Aqua-mount mounting media (Lerner laboratories, Pittsburgh, PA) and cover slips (Corning, Corning, NY). Cell preparations were visualized with a Leica DMLB Microscope. The microscope was operated by Spot
3rdParty Interface Software with a Photoshop C.S version 8.0 on a Macintosh OS
(version 4.0.9) based system.
RNA extraction
For the DNA microarray, the U937 infection assay for MAC 109 and 2D6 mutant followed by RNA isolation was carried out as described previously (28). Briefly, U937 monolayers of approximately 108 cells were infected with MAC1O9 or 2D6 (lx108 concentration) for 4 h. The cells were washed to remove extracellular bacteria and total
RNA was isolated using Atlas pure Total RNA labeling System (Clonetech Laboratories,
Palo Alto, CA) according to the manufacturer's instructions. The resultant RNA was treated with DNase for 30 mm at 37°C followed by phenol-chloroform extraction and precipitation with ethanol. The RNA was run on 1% denaturing agarose gel and quantified by UV spectrometer at 260/280 nm.
To confirm the expression and to determine the relative transcriptional levels of G- protein coupled receptor kinase 4 (GRK-4), diacylglycerol kinase delta (DGKD) and lymphocyte cytosolic protein 2 (LCP2) by real-time PCR, similar U937 infection assay was performed as described above and modifications in the RNA extraction method were 17 made. After 4 h, the monolayers were washed with HBSS and scraped and collected in a
50 ml falcom tube and placed on ice. The cells were centrifuged at 500 rpm for 5 minutes to remove any residual extracellular bacteria. Then, 2 ml of Trizol (Invitrogen,
Carlsbad, CA) was added to the falcom tube. The suspension was then passaged 20 times through 21-gauge needle to lyse the mononuclear cells. The lysate was then centrifuged at max (14,000) rpm at 4°C. The supernatant was then transferred to heavy Lock Gel I
(Eppendorf, NY) and to it chloroform:isoamyl alcohol (24:1) (Sigma) was added and mixed. After centrifugation, the aqueous phase was precipitated in isopropanol followed by 75% ethanol wash to remove isopropanol. DNase treatment of total RNA was carried out before probe synthesis using the protocol described by Atlas Pure Total RNA labeling system (Clonetech, Mountain View, CA). The quality of RNA was verified on a 1% denaturing agarose gel and the concentration was calculated based on the absorbance at
260nm. cDNA was synthesized as per the protocol described by Invitrogen (Carlsbad, CA). Total
RNA (Sjig) witholigo(dT)20and dNTP mix was incubated at 65°C for 5 mm and cooled on ice for 1 mm. For each total RNA sample, 10 i1 cDNA synthesis mix was made: lOx
RT buffer,25mM MgC12, 0.1 M DTT, 40U/ilRNaseOUTand 200U/pJSuperscript III
RT. The samples were mixed gently and collected by brief centrifugation. Then, the samples were incubated in a thermal cycler at 42°C for 50 mm and the reaction was terminated at 70°C for 15 mm and cooled on ice. Finally, the reactions were collected by brief centrifugation and 1.tl of RNase H was added to each sample and incubated for 20 mm at 37°C. The cDNA prepared was used for real time PCR. DNA Micro-Array
Yongjun Li carried out DNA microarray. The protocol is summarized below.
Preparation of 32P-labelled cDNA probes
32P-labelled cDNA probes were prepared using the Atlas pure Total RNA labeling
System (Clonetech Laboratories) as previously described (28). In brief, 5tg of total
RNA was reverse transcribed using the primer mix supplied with each array. The mixture was heated to 65°C for 2 mm in a PCR thermal cycler followed by 50°C for 2 mm. At this time, a master mix containing Sx Reaction buffer, dNTP, dATP. DTT and
MMLV reverse transcriptase was added, mixed and incubated for 25 mmat 50°C.lox termination mix was then added to end the reaction. Unincorporated nucleotides were removed using a Nucleospin Extraction Spin Column (Clonetech Laboratories, Palo Alto,
CA) as per the manufacturer's instructions. Scintillation counting was done to measure the incorporation of radionucleotide into the probe.
Hybridization and Data Analysis
In brief, the Clonetech Human Nylon Filter Arrays (Clonetech Laboratories) were prehybridized in 5 ml of Express-Hyb solution supplemented with 0.5mg salmon testes
DNA at 68°C for 30 mm. The radiolabelled cDNA probe was heated in boiling waterbath for 2 mm followed by keeping 2 mm on ice. Then it was added to the hybridization solution and was allowed to hybridize to the filter array overnight. The membranes were washed in SSC plus 0.1% sodium dodecyl sulphate (SDS) at 68°C for 30 mm and further rinsed in SSC for 5 mm at room temperature. Next, the filters were wrapped in plastic wrap and exposed to phosphor imaging screen for 24 h. Analysis of the phosphor imaging screens was done by using a phosphor imager (Perkin Elmer, Boston, MA) and 19
Atlaslmage 2.0 software. Global normalization method was used to normalize the arrays to the uninfected control array. The following genes were used as housekeeping genes glyceraldehyde 3-phosphate dehydrogenase (GAPDH), tubulin alpha 1 (TUBA 1), hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1), major histocompatibility class 1 C (HLAC), beta-actin (ACTB) and 23-kDa highly basic protein (PRL13A). Only genes that showed differential expression atleast by two-fold were incorporated in the results. The experiment was repeated two times.
Real Time PCR
SYBR technology was used to perform real time PCR. Run protocol for the LightCycler was as follows: denaturation 95°C for 5mm; amplification and quantification repeated for 35 times: 95°C for 30 sec, 59°C for 30 sec and 72°C for 1 mm with one fluorescence measurement followed by 72°C for 5 mm and 4°C.
The threshold cycle (Ct) is defined as the fractional cycle number at which the fluorescence reaches lOx the standard deviation of the baseline and was quantified as described in User Bulletin #2 for ABI PRIIMS 7700 sequence detection system (ABI).
The fold change in gene expression was determined using an amplification-based strategy. For each gene amplification, before calculating the fold change, the Ct values were normalized to the Ct of f3-actin using the following formula:
Fold Change 2-A(ACt) where ACt = Ct,target Ct,3-Actin,A(ACt) = ACt,expressed- ACt,control
Quantitative analysis was performed using iCycler I software (BIORAD, Hercules, CA).
A relative quantification was used in which the expression levels of macrophage target genes were compared to data from a standard curve generated by amplifying several dilutions of a known quantity of amplicons. Real time PCR efficiency was determined using a dilution series of cDNA template with a fixed concentration of the primers.
Slopes calculated by the LightCycler software were used to calculate efficiency using the following formula: E 10(1/slope)These calculations indicated high real time efficiency with a high linearity. Because expression of 13-actin is constant independent of conditions, target genes from both, control and experimental groups were normalized to the expression level of the 13-actin gene. 21
Results
Mass spectrometry analysis of isolated wild-type M. avium and 2D6 phagosomes
To identify the phagosomal membrane proteins expressed at various time points in
MAC 109 and2D6infected U-937 cells, we infected mononuclear cells with the fluorescein-labeled bacteria and at 30 mm,4h and24h after infection, isolated the phagosomes. As shown in Figures 1. A & B, both MAC 109 and2D6showed comparable ability to enter the macrophages and be within phagosomes. MS/MS results of the phagosomes revealed several proteins with function in bacterial uptake, antigen presentation and recognition, Rab-interacting proteins, cytoskeleton and motor proteins, proteins involved in biosynthetic pathways, transcriptional regulation, and signal transduction proteins. Several of the proteins also have function as ion channels. A number of hypothetical proteins were also identified (Table 1). Some proteins identified were unique to MAC 109 or the2D6vacuoles at different time points. In addition, some proteins identified were expressed in MAC1O9 as well as2D6vacuoles at single time point or multiple time points. Together, these results suggest that the wild-type phagosomes express a number of proteins different from the vacuole of the isogenic2D6 mutant.
Immunofluorescence analysis
Many proteins identified in the mass spectrometry data have not previously been described in M. avium phagosomes. To confirm the initial observation, we carried out assays using fluorescent microscopy to establish the presence of some selected proteins.
One of the proteins chosen, pulmonary surfactant proteinD (SP-D)was observed to be selectively expressed in the MAC1O9 phagosomes at4h time point but not in the2D6 22
A.
Figure 1. Fluorescent microscopy images of isolated phagosomes showing fluorescein- labeled M. avium (A) and 2D6 mutant (B). 23
Table 1. List of phagosomal proteins identified by MS/MS post-infection with MAC 109 or 2D6 at different time points. MAC 109 2D6 mutant (h) (h) Protein Accession 0.5 4 24 0.5 4 24 number
Bacterial Uptake Complement clq tumor necrosis factor related protein 5 Q9BXJO x x x Complement receptor 2 P20023 x Macrophage receptor MARCO Q9UEW3 x x x Pulmonary surfactant protein D P35247 x Scavenger receptor with C type Lectin type 1 Q9BYH7 x TNFRSF1A-associated via death domain! TRADD Q15628 x Tumor necrosis factor receptor member 1A ITNFRSF1A 1NCFA x
Antigen Presentation&Recognition Integrin alpha 1 P56199 x Integrin alpha JIb P085 14 x MHC class I Q951D4 x MHC class II 154427 x
Rab Interacting EEA1 Q15075 x Peroxin 5-related protein Q81YB4 x x Rabaptin 5 Q15276 x
Cytoskeletal Proteins & Motors Alpha actin P62736 x Ankyrin 1 Q6S8J3 x Beta actin Q96B34 x x E-MAP-115 Q14244 x Keratin, type II cytoskeletal I P04264 x x KinesinlKIF3 014782 x Kinesin family member 26A Q8TAZ7 x L-plastin P13796 x x Myosin heavy chain non-muscle type A P35579 x Myosin X with ATPase activity Q9HD67 x x RHOC P08134 x TCP- 1 zeta P40227 x Tubulin alpha Q71U36 x x Tubulin alpha 2 Q13748 x Tubulin alpha 3 Q71U36 x Tubulin beta 2 P07437 x x
Proteins in Biosynthetic Pathways ABC transporter 2 Q9BZC7 x ADP-ATP translocase P05141 x Aldoketo- reductase 3 Q9UFE 1 x ALG12 Q9BVJO x ATP synthase P06576 x x Fatty acid synthase P493 27 x x Fatty acid transporter member 1 Q6PCB7 x GAPDH P04406 x Phosphatidyl inositol glycan class T Q92643 x Table 1. continued
MAC 109 2D6 mutant (h) (h) Protein Accession 0.5 4 24 0.5 4 24 number IMP dehydrogenase P 12268 x K-Cl cotransporter T17231 x Mitochondrial dicarboxylate carrier Q9UBX3 x Neutral amino acid transporter Q15758 x NUAK family, SNF1-like kinase 1 060285 x PI4KII Q9BTU6 x Pyruvate kinase PSOO1 10 x x x Ribophorin II Q5JYR7 x Trehalose precursor 043280 x
Transcriptional Regulators Lysine-specific histone demethylase 1 060341 x CRSP complex subunit 2 060244 x CREB binding protein Q75MY6 x DEAH box polypeptide 9 Q08211 x WI 16 Q16666 x Msx2-interacting protein Q96T58 x p-lOO co-activator/SND 1 Q7KZF4 x p-300 /CBP associated factor Q92831 x Zinc finger&BTB domain containing protein 4 Q9P1ZO x Zinc finger protein 588 Q9U115 x Zinc finger protein 43 P 17038 x 60S acidic ribosomal protein P2 P05387 x 60S ribosomal protein L6 Q02878 x x 60S ribosomal protein L9 P32969 x 60S ribosomal protein L14 P50914 x
Proteins Interacting with Signal Proteins cAMP-specific 3',S'- cyclic phospho-diesterase Q08493 x Calcium&lipid binding proteinlNLF2 388125 x Chondroitin sulfate synthase 3 Q86Y52 x CXC3C membrane-associated chemokine P78423 x Doublecortin&CaM kinase like- 3 Q9C098 x Dystrobrevin alpha Q9Y4J8 x Golgin subfamily A member 5 Q8TBA6 x Microtubule associated-Ser/The kinase 3 060307 x Protein kinase A anchoring protein 9 Q99996 x Protein kinase N Q8NF44 x Serine/theonine kinase 16 Q5UOF8 x TER ATPase P55072 x
Ion Channels Amiloride-sensitive cation channel Q96FT7 x Voltage dependent-N-type calcium channel alpha lB subunit Q00975 x Voltage dependent-T-type calcium channel alpha 11 subunit Q9PDX4 x
Other Proteins AFG3 like protein 2 Q9Y4W6 x APBB1 000213 x Astrotactin 2 075129 x 25
Table 1. continued MAC1O9 2D6 mutant (h) (h) Protein Accession 0.5 4 24 0.5 4 24 number Apoptotic chromatin-condensation inducer in the nucleus Q9UKV3 x Clathrin heavy chain 1 Q00610 x EphrinB3 Q15768 x 48kda histamine receptor subunit peptide 4 AAB 34251 x HSP60 P10809 x HSP90 P07900 x Importin alpha 2 P52292 x Interferon regulatory factor 6 014896 x LRCH4/Ligand binding receptor 075427 x NADPH oxidase activator 1 Q2TAM 1 x Protein disulfide- isomerase A6 P07237 x x p-53-associated parkin-like cytoplasmic protein/PARC Q8IWT3 x Serine protease inhibitor Q9NQ38 x Vitrin Q6UX 17 x 14-3-3 protein/Tyrosine 3-monoxygenase P62258 x
Proteins with Unknown Function Hypothetical protein DKFZp434A 128 T34567 x Hypothetical protein LOC 136288 Q8NEG2 x Hypothetical protein K1A1783 Q96JP2 x Hypothetical protein K1AA1783 Q96JP2 x Hypothetical protein FLJ32795 Q96M63 x Hypothetical protein FLJ42875 Q8N6L5 x Hypothetical protein FLJ4549 1 Q6ZSI8 x Hypothetical protein DKFZp434G131 Q9HOH4 x Hypothetical protein FLJ46534 Q6ZR97 x Hypothetical protein FLJ00361 Q8NF4O x 26 phagosomes. The second protein, T-typeCa2channel 11 alpha showed selective expression in 2D6 phagosomes at 24 h time point and not in the MAC1O9 phagosomes.
SP-D is a carbohydrate binding glycoprotein and has been shown to be involved in ligand binding and immune cell recognition (37). To confirm the expression of SP-D on MAC 109 vacuoles at 4 h time point, cells were infected in parallel with fluorescein- labeled bacteria (MAC 109 and 2D6) for 4 h. The SP-D protein was observed to be present in nearly all on the MAC 109 vacuoles (Fig 2. A, B, C) whereas in 2D6-infected as well as in uninfected macrophage control, no SP-D was expressed (Fig 2. D, E, F &
Fig 2. G, H respectively). This finding confirmed our data that SP-D is expressed in
MAC 109 phagosomes but not 2D6 mutant phagosomes at 4 h time point.
T-typeCa2channel is an integral membrane protein, which controls the rapid entry ofCa2into excitable cells, and is activated by CaM-Kinase II (Swissprot database). To verify our initial observation by MS/MS, we carried out parallel infection assays with fluorescein labeled 2D6 and MAC 109 bacteria for 24 h. As shown in Figures
3. A & B, the majority of the cells infected with 2D6 mutant showed T-typeCa2channel protein staining whereas those infected with the wild type MAC 109 and uninfected control U937 cells, all did not show any expression for the protein (Figures 3. C, D & Fig
3. B & F respectively). The finding confirmed that T-typeCa2channel is expressed in mononuclear phagocytes infected with 2D6 attenuated mutant, but not when infected with MAC1O9.
To further investigate whether the complemented M. avium 2D6 mutant phagosomes showed similar protein expression as that of wild type, we infected the cells 27
M.avium 109 SP-D Protein A. Green B. Red C. Merge
2D6 Mutant No SP-D D. Green F. Merge
G. Uninfected Control H. Uninfected Control
Figure 2. Fluorescent microscopy images of U-937 macrophages infected with MAC 109 or 2D6 mutant for SP-D protein expression. T-Type Ca2+ 2D6 Mutant Channel protein A. Green B. Red
M.avium 109 NoT-TypeCa2+ C. Green n
E. Uninfected Control F. Uninfected Control
Figure 3. Fluorescent microscopy images of U-937 macrophages infected with MAC 109 or 2D6 mutant for T-type Ca2+ channel protein expression. with 2D6 complemented bacteria (23) for 4 h with MAC 109 as a positive control. The vacuoles containing the complementedM.avium 2D6 mutant showed expression of SP-D protein (Fig 4. A, B, C) similarly to vacuoles containing the wild type bacterium (Fig 4.
D & E), though the percentage of infected cells showing the expression was less than in macrophages infected with the wild type bacterium. The results showed that the complementation of the strain ofM.avium 2D6 restores the phenotype of the wild-type
MAC 109 to some extent.
To determine whether the complementedM.avium 2D6 mutant phagosomes were deficient in T-typeCa2channel expression similar to the wild-type bacterium, mononuclear cells were infected with complementedM.avium 2D6 bacteria. The 2D6- attenuated mutant was employed as a positive control. As shown in Fig 5. A & B, the complemented bacteria did not show the expression of T-typeCa2channel protein expression similar to wild type whereas the 2D6 mutant showed the protein to be expressed on its phagosomes (Fig 5. C & D). On visual screening of the monolayers, it was observed that as compared to the wild-type bacterium, only a smaller percentage of cells infected withM.avium complemented 2D6 mutant did not express the T-typeCa2 channel protein. Again, this showed that the complemented M. avium 2D6 mutant strain only partially restores the phenotype of wild type bacterium.
Analysis of differential gene expression in U937 cells after infection with MAC1O9 and 2D6 attenuated mutant by DNA microarray
The expression of genes in mononuclear phagocytes infected with MAC 109 and
2D6 was examined at 4 h post-inoculation. This time point was chosen based on previous results (28). The majority of the genes examined did not show any significant 30
Complemented M.avium 2D6 Mutant SP-D Protein A. Green B. Red C. Merge
M.avium 109 Green SP-D Protein D. Positive Control E. Red
Figure 4. Fluorescent microscopy images of U-937 macrophages infected with complemented M. avium 2D6 mutant for SP-D protein expression. 31
Complemented M. avium 2D6 Mutant No T-Type Ca2+ Green Channel Staining I
2D6 Mutant T-Type Ca2+ Green Channel protein C.Positive Control D. Red
Figure 5. Fluorescent microscopy images of U-937 macrophages infected with complemented M. avium 2D6 mutant for T-type Ca2+ channel protein expression 32 difference in expression (2 fold or above) after infection with MAC 109 and 2D6 mutant.
M. avium-infected cells showed low numbers (19) of differentially expressed genes
(Table 2), as compared to 2D6-infected cells which showed greater number (35) of differentially regulated genes (Table 3). The mononuclear cells infected with wild-type or 2D6 mutant showed no similarities in gene expression pattern. The genes upregulated in cells infected with wild-type bacteria consisted mainly of those involved in intracellular signaling such as LCK, PKIA, DGKA, DGKD, INPP1, APBA2 and PDE1C.
Few of the other genes were involved in the metabolic pathways like GPD2 (involved in glycerol-3-phosphate metabolism) and CYP4F2 (involved in leukotriene metabolism).
Other genes that showed upregulation were PPM1G (cell cycle arrest), HIPK3 and
RORC (inhibition of apoptosis), ITK (T-cell proliferation and differentiation), GRK4
(regulation of G-protein coupled receptor protein signaling), NFKB 1 (transcriptional regulator) and others. The genes downregulated in wild-type but upregulated in 2D6 mutant included genes involved in signal transduction (BMX, CCR3, GPR17, GABBR1,
GABBR2, YWHAZ, RAB7, RAB 13, IFNA1, DGKZ and DGKG), apoptosis (BLK,
GZMA), bacterial uptake (ITGB 1, CR1), immune response (IL1ORA, TNFRSF17,
MS4A1, LCP2), metabolic pathways (DDOST, PLTP), and others like bacterial killing
(cathepsin G), negative regulators of G-protein signaling (RGS 12 & RGS 13), potassium channel regulator (CHP), microtubule movement (TUBB, DCTN1, CETN2 & S100A1 1).
Macrophage gene expression analysis by quantitative real time PCR
To confirm the changes in macrophage gene expression level upon infection with M. avium or its isogenic 2D6 mutant from the DNA microarray data findings, three genes were selected for real time PCR analysis, GRK4 (G-protein coupled receptor kinase 4), 33
Table 2. Macrophage genes upregulated in M avium 109 but downregulated in 2D6 mutant 4h post infection
Gene Gene Bank ID Name Function Fold induction
APBA2 ABO 14719 Amyloid beta (A4) precursor proteinSignal transduction 10.7 binding CYP4F2 U02388 Cytochrome P450 Inactivation°radation of 2.6 leukotriene B4 DGKA AF064767 Diacylglycerol kinase alpha Intracellular signaling 2.3 DGKD D63479 Diacyiglycerol kinase delta Phosphatidylinositol signaling 6.7 DYNCIHI AB002323 Cytosolic dyenin heavy chain Microtubule reorganization 17.4 GPD2 NM_000408 Glycerol-3-phosphate dehydrogenaseGlycerol-3-phosphate 3.5 2 metabolism GRK4 NM_005307 G-protein coupled receptor kinase 4 Regulation of G-protein coupled 3.5 receptor protein signaling HIPK3 AF004849 Homeodomain interacting protein Inhibition of apoptosis 2.05 kinase 3 ThPPl NM_002 194 Inositol polyphosphate-1- Phosphatidylinositol signaling 2.0 phosphatase ITK D13720 1L2-inducible T-cell kinase T-cell proliferation& 2.4 differentiation LCK M36881 Lymphocyte-specific protein Intracellular signaling 3.5 tyrosine kinase NFKBI M58603 Nuclear factor of kappa light Transcriptional regulator 2.3 polypeptide gene enhancer in B-cells
PDE1C U40371 Calcium/calmodulin-dependant 3', Signal transduction 17.4 5'- cyclic nucleotide phosphodiesterase I C PKIA S76965 Protein kinase (cAmp-dependent) Negative regulation of protein 2.0 inhibitor alpha kinase A PPM1G Yl3936 Serine/threonine protein phosphataseNegative regulator of cell stress 3.2 PP1-gamma I catalytic subunit response/cell cycle arrest PTPN1 1 Dl 3540 Protein tyrosine phosphatase Intracellular signaling, cell 2.4 migration RGS3 AF006610 Regulator of G-protein signaling- 3 Inhibition of G-protein mediated 3.4 signal transduction RORC U16997 RAR-related orphan receptor C Inhibition of Fas ligand and 1L2 3.1 expression ROR1 M97675 Receptor tyrosine kinase-like orphanUnknown 4.0 receptor 1 iI
Table 3. Macrophage genes downregulated in M avium 109 but upregulated in 2D6 mutant 4 h post infection
Gene Bank . Fold Gene Name Function ID induction AMBP X04494 Alpha-1-microglobulin Negative regulation of immune 4.2 response/Protease inhibitor BLK BC004473 B-lymphoid tyrosine kinase Apoptosis 3.3 BMX AF045459 BMX non-receptor tyrosine kinase Intracellular signaling 18.6 CCR3 AF247361 Chemokine receptor 3 Signal transduction 4.1 CD53 BC040693 CD53 molecule Growth regulation 4.1 CETN2 X72964 Centrin, EF-hand protein 2 Microtubule organization center 6.3 CHP NP_009 167 Calcium binding protein P22 Potassium channel 20.8 regulator/Signal transduction CR1 Y00816 Complement receptor I Bacterial uptake 4.3 CTSG NM_001911 Cathepsin G Bacterial killing 2.9 DCTN1 NM_004082 Dynactin I Lysosome and endosome 35.8 movement DDOST D29643 Dolichyl-diphosphooligosaccharide- N-linked glycosylation 3.3 protein glycosyltransferase DGKG AF020945 Diacylglycerol kinase gamma Intracellular signaling 5.3 DGKZ US 1477 Diacylglycerol kinase zeta Intracellular signaling 48.1 EMILIN2 AF270513 Elastin microfibril interfacer 2 Cell adhesion 14.7 FOXC2 Y08223 Forkhead box C2 Transcription factor 5.9 GABBR1 Yl 1044 GABA receptor I Signal transduction 6.1 GABBR2 AF069755 GABA receptor 2 Signal transduction 2.8 GPR17 NM_005291 G-protein coupled receptor 17 Signal transduction 83.2 GZMA NM_006 144 Granzyme A Apoptosis 2.1 IFNA1 NM_024013 Interferon alpha I Intracellular signaling 2.6 ILI0RA U00672 Interleukin 10 receptor alpha Inhibition of proinflammatory 2.3 cytokine synthesis ITGB1 BCO20057 Fibronectin receptor Bacterial uptake 4.6 LCP2 NM_005 565 Lymphocyte cytosolic protein 2 Immune response 37.5 MCAM X68264 Melanoma cell adhesion molecule Cell adhesion 4.7 MS4AI M27394 Membrane-spanning 4-dmains Immune response 9.6 PBX2 NM_0025 86 Pre-R-cell leukemia transcription Transcriptional activator 3.0 factor 2 PLTP NM 006227 Phospholipid transfer protein Lipid metabolism 3.6 RAB7 X93499 RAS related GTP binding protein Vesicular transport regulation 3.4 RABI3 X75593 RAS related GTP binding protein Small GTPase mediated signal 7.5 transduction RGS 12 AFO3 5152 Regulator of G-protein signaling 12 Negative regulation of G-protein 3.0 signaling RGS13 AF030107 Regulator of G-protein signaling 13 Negative regulation of G-protein 2.6 signaling SIOOA11 NM_005620 Calgizzarin Motility, invasion&tubulin 9.6 polymerization TNFRSF17 Z29574 TNF receptor Immune response 2.6 TUBB AB062393 Tubulin beta Microtubule based movement 4.0 YWHAZ NM_003406 Tyrosine 3 -monooxygenase Signal transduction 4.3 35
DGKD (Diacyiglycerol kinase delta), and LCP2 (Lymphocyte cytosolic protein 2). The gene 13-actin was used as a positive control, while the uninfected cells were used as a negative control. The two genes GRK4 and DGKD were found to be upregulated in the wild-type but downregulated in the 2D6 mutant infected macrophages whereas LCP2 was found to be downregulated in wild-type but upregulated in the 2D6 mutant in DNA array data analysis. The two genes GRK4 and DGKD showed significant upregulation upon
M. avium infection of macrophages in contrast to infection by 2D6 mutant (Fig 6). In addition, LCP2 gene showed significant upregulation in macrophages upon infection with
2D6 mutant in contrast to wild-type infected macrophages. None of the three genes showed upregulation in the uninfected negative control cells. These results confirmed our DNA array data. 36
14
12
10
Macrophage Genes
Figure 6. Upregulation of U937 macrophage genes upon infection with M. avium or 2D6 mutant at 4 h as determined by real-time PCR. The data represents the average of 3 independent experiments ± SD. 37
Discussion
M. avium like M. tuberculosis, primarily infect the host mononuclear phagocytes.
Targeting mononuclear phagocytes and being able to survive within them indicate efficient mechanisms evolved by the virulent mycobacteria capable of neutralizing the bactericidal activity of macrophages.
In M. tuberculosis, PE-PGRS and PPE are two glycine-rich protein families which constitute approximately 10% of the M. tuberculosis genome. Recent reports have suggested that these two gene families might be involved in antigen variation, eukaryotic cell binding, survival within macrophages and persistence in granulomas (31, 35).
Richardson and colleagues (2001) showed that a PPE protein (Rv1917) is expressed on the bacterial surface. Using signature-tagged mutagenesis, Camacho and colleagues identified a PPE gene (Rv3018c) associated with M. tuberculosis virulence in vivo (6).
In addition, Ramakrishnan and colleagues observed that inactivation of PE-PGRS gene in
M.marinum resulted in attenuation of bacterial virulence in macrophages.
A study by Yongjun Li and colleagues (2005) has suggested a role of M. avium
PPE protein (Rv1787) in inhibition of acidification and phagosome-lysosome fusion in infected macrophages. They demonstrated the M. avium PPE transposon mutant had comparable ability to enter the mononuclear phagocytes as wild-type but was defective in survival and virulence in vitro as well as in mice. This gene was upregulated following uptake of the wild-type bacteria by macrophages, but not in culture media, indicating a possible role in the early events of the phagosome formation. This observation suggests that this particular PPE gene might play a role in the modulation of the phagosome membrane thereby having an important participation on the dynamics and creation of the vacuole membrane and the vacuole content. This would enable the bacteria to create an environment inside the phagosome suitable for its growth and survival. The fact that the
2D6 mutant vacuole undergoes acidification implies that this PPE gene might play a role in inhibition of acquisition of proton pumps on the wild-type phagosome.
The gene homologue to Rv1787 is part of a M. avium chromosomal region with five PPE and PE genes. The organization of this region suggests the existence of three promoters, one upstream of the PPE gene inactivated in the 2D6 mutant, one between the second and the third genes and another between the fourth and fifth genes in the downstream region (23). Therefore, it is possible that the inactivation of the PPE gene in
2D6 mutant would have a polar effect in three or all the five genes responsible for the observed phenotype. The fact that complementation of the 2D6 mutant significantly reversed (not completely) the phenotype, strongly suggest that only the PPE gene inactivated and the two additional downstream genes are responsible for the phenotype observed.
Normally upon uptake of a bacterium, macrophage undergoes a series of events specifically designed to eliminate the engulfed microorganism, which include (i) induction of reactive oxygen and nitrogen intermediates, (ii) gradual acidification of the phagosome due to the activity of proton-ATPase pumps located on the phagosome membrane, (iii) phagosome-lysosome fusion which loads the resulting phagolysosome with acidic proteolytic enzymes, (iv) antigen processing and (v) antigen presentation.
The resulting lethal environment effectively kills the majority of the ingested bacteria.
Pathogenic mycobacterial phagosomes in contrast, show incomplete lumenal acidification and absence of mature lysosomal hydrolases (41). Recent findings by Malik et a! (25-27) suggested that the bacterial manipulation of calcium is in part responsible for the phagosome maturation arrest. The pathogenic mycobacterial phagosomes have been shown to alter the trafficking of the plasma membrane markers including MHC molecules (7), EEA-1 and LAMP-i (42). Via and colleagues also suggested that the block in phagosome maturation occur between the stages controlled by early endocytic marker RabS and late endocytic marker Rab7, and that Rab5 is accumulated on the mycobacterial phagosome membrane whereas Rab7 is not (42). Altogether, the published data indicate that virulent mycobacterial phagosomes are selective in their fusion with various cytoplasmic organelles and do not mature into a phagosome- lysosome.
Although a good deal of information has been generated about the M. tuberculosis phagosome, relatively little is known about M. avium vacuole. Once inside a macrophage, M. avium resides in compartments secluded from the terminal stages of the endocytic pathway (8, 39). The bacterial vacuoles have less proteolytic activity and maintain some markers like LAMP-i and cathepsin D in an immature form (38, 39). The vacuoles also remain accessible to internalized transferrin (38). The wild-type bacterium requires RabS and not Rab7 as well as acquisition of iron for arresting the phagosome maturation (22). Tn addition, Kelley and colleagues proposed that absence of Rab5 limits the concentration of iron within the M. avium phagosome resulting in its inability to inhibit phagosome maturation as evident by the decreased LAMP-i staining on M. avium phagosomes after addition of ferric citrate in the dominant negative RabS expressing macrophages (22). EI
We have identified several proteins expressed on the phagosomes of macrophages infected with wild-type M. avium and its isogenic 2D6 mutant in which a PPE gene
(homologue to Rv1787) was interrupted by the transposon. An earlier study has shown the impaired ability of 2D6 mutant to replicate inside the mononuclear phagocytes (23).
Mass spectrometry analysis of the phagosomal proteins of 2D6 mutant and the wild-type bacterium yielded several differences in the protein expression in the vacuole membrane.
For example, expression of EEA- 1 and Rab5 effector was seen on 2D6 phagosomes but not on the wild-type phagosomes which is in agreement with the observation reported by
Fratti el al and Via et al (14, 42).
A relatively large amount of published data suggests the role of complement receptors CR1, CR3 and CR4 (36) and mannose receptor (36) in the uptake of M. tuberculosis by macrophages. CR3 has been shown to be one of the main receptors involved in phagocytosis of M. avium by macrophages and monocytes (3, 34). In addition, integrin fibronectin receptor is also involved in the internalization of the bacteria (21). CR2 was identified among various receptors on M. avium phagosomes.
Studies have suggested an important role of CR1/2, CR3 and CR4 in host defense against
Streptococcus pneumoniae infections (32). Functional studies have demonstrated that
CR2 mediates tyrosine phosphorylation of 95 kDa nucleolin and its interaction phosphatidylinositol 3 kinase (2). Though the presence of CR2 on M. avium phagosomes at 24 h time point does not confirm its role in bacterial uptake, it could be possible that it might play a role in the uptake and may not have been recycled. Also, the possibility of its presence on the phagosomal membrane due to just being a membrane protein present on the surface of plasma membrane cannot be ruled out. It is known that M. tuberculosis 41 andM.avium are similar in their invasion strategy of mononuclear phagocytes. But there could be little differences in the receptors involved during the uptake of both bacteria.
Thus, CR2 could be another receptor involved inM.avium uptake by macrophages besides CR3 and CR4.
Surfactant protein A (SP-A) expressed onM. tuberculosisvacuoles has been shown to be involved in enhancing the uptake of bacteria by macrophages (17, 24, 44).
We identified SP-D protein expression onM.avium phagosomes. Surfactant-associated proteins A and D (SP-D) are pulmonary collectins that bind to bacterial, fungal and viral pathogens and have multiple classes of receptors on pneumocyte and macrophage membrane (12). In addition, they act as chemoattractant to phagocytes.
Among the strategies mycobacteria has evolved to compromise the activation of
T-cells, is the down regulation of the expression of MHC class II, CD1 and co- stimulatory molecules (19, 40, 45). The lack of MHC class II molecule expression inM. avium phagosomes and its presence in the attenuated 2D6 mutant phagosomes in our data is in agreement with the above findings. MHC class I molecules are involved in presentation of the antigens located in the cytoplasm. The fact that MHC class I molecules were found on 2D6 mutant phagosomes at 24 h time point may reflect altered trafficking by the bacteria as its expression at early time points on the phagosome would have suggested that the protein being present on the cell surface, during phagocytosis would have been taken up during vacuole formation. The presence of MHC class I molecules on the 2D6 phagosomes could also be due to the fact that mycobacterium antigens are processed by MHC class 1(13). MHC class I has also been reported to be present on latex bead phagosomes (16). 42
Several proteins not previously shown to be associated with the mycobacterial phagosomes were identified in the phagosomal preparations. Because we cannot rule out the possibility of contamination of the phagosome preparations with other organelles, which indeed is a limiting factor of most subcellular fractionation techniques, we selected two proteins which has not been previously described on vacuole membranes, voltage dependent T-type calcium channel 11 alpha protein (T-type calcium channel), an integral membrane protein unique to neuron cells and, pulmonary surfactant protein D (SP-D) which is a carbohydrate binding protein, to confirm the expression of some of these proteins on the mycobacterial phagosomes. Fluorescent microscopy studies using antibodies specific to these proteins revealed their presence on the bacterial phagosomes.
Recent studies on Legionella and Brucella state that these organisms reside in compartments displaying features of endoplasmic reticulum (ER) (29). In addition, there is an evidence of recruitment of endoplasmic reticulum (ER) to nascent phagosomes containing inert particles or Leishmania and that it makes a major contribution to the phagosomal membrane (15). This explains how antigens of vacuolar pathogens are presented to T lymphocytes via MHC class I machinery located on ER. Considering this information, it would be plausible to find ER particles on mycobacterial phagosomes.
Some of the mitochondrial proteins like ATP synthase and HSP6O found in our preparations have also been shown to be present in latex bead containing phagosomes
(16). This data is in agreement that at least some of the proteins present in our preparations might be genuine constituents of phagosomes.
In the DNA array analysis, upregulation of genes like GZMA (granzyme A), cathepsin G was observed in macrophages infected with 2D6 mutant. GZMA is a serine 43 protease involved in lysis of target cells. Cathepsin G is a protease which participates in the killing and digestion of engulfed pathogens.Upregulation of GZMA and cathepsin
G in the macrophages infected with 2D6 mutant might reflect the impaired ability of 2D6 to survive and thus undergoing killing in macrophages and other mononuclear phagocytes.
Recent report on the elemental analysis of M. avium phagosomes in Balb/c mouse macrophages revealed high concentrations of potassium and chlorine at 24 h timepoint and correlated it to the microbiocidal killing similar to that observed in neutrophils (43).
The upregulation of CHP (potassium channel regulator) in the 2D6 infected macrophage microarray data and the finding of K-Cl transporter on the 2D6 mutant phagosomes at 24 h time point in our mass spectrometry data could represent an evidence at least in part to the above published report as we know that the 2D6 mutant is unable to survive in the macrophages (23). Therefore, there is a possibility that K-Cl transporter and CHP could be involved in the augmentation of the potassium and chlorine concentrations in the phagosome leading to mutant killing.
Studies in mice suggest that RORC (RAR-related orphan receptor C) may inhibit the expression of Fas ligand and 1L2 (NCBI database). The upregulation of RORC in macrophages infected with wild-type bacterium may indicate that this gene plays a role in inhibition of apoptosis induced by the bacterium. HIPK3 (homeodomain interacting protein kinase 3) is a Fas/FADD-interacting serine/threonine kinase that induces FADD phosphorylation and inhibits one of the Fas-mediated apoptosis (33). The upregulation of
HIPK3 in wild-type infected macrophages shows the bacterial ability to inhibit apoptosis by triggering induction of macrophage genes involved in inhibition of apoptosis. As the 2D6 mutant and the wild-type bacterium have comparable ability to enter the macrophages (23), it would be reasonable to expect that the 2D6 mutant uses similar uptake pathway as wild-type. This is evident from the upregulation of various receptors like ITGB1, GPR17, GABBR1, GABBR2, CR1, and CCR3 in the 2D6-infected macrophages. The upregulation of Rab7 on the 2D6-infected macrophages is an evidence that the 2D6 mutant expresses late endosome markers and undergoes phagolysosome fusion (23).
GRK4 (G-protein coupled receptor kinase 4) is normally expressed in cerebellar purkinje cells where it mediates desensitization of GABA receptor 1 (20). The DNA array data showed upregulation of GRK4 in macrophages infected with wild-type bacterium. There is no published data regarding GRK4 expression inM.avium infected macrophages. Real-time PCR confirmed the upregulation of this gene in macrophages infected withM.avium. This suggests that GRK4 is differentially expressed inM.avium infected macrophages. Real-time PCR also confirmed the upregulation of DGKD
(Diacyiglycerol kinase delta) and LCP2 (Lymphocyte cytosolic protein 2) in the wild- type and 2D6-infected macrophages respectively. These results show that the above- mentioned genes are differentially regulated in macrophages when infected with wild- type or 2D6 mutant. The variation in the fold intensity of these genes in the real-time data as compared to the array could be because of the degradation of RNA during handling and cDNA synthesis.
We studied protein expression of the mycobacterial phagosome and compared it to a isogenic mutant. We identified several proteins either previously described or not reported to be present on the phagosomes. Nonetheless, the use of the PPE mutant 45 established possibility that one protein may have key function in modulating the formation of the phagosome. Alternatively, the PPE-PE operon may be part of a complex system influencing or impacting the expression of other bacterial genes. Another interesting aspect of our findings is the possible connection between macrophage genes regulated upon uptake of a bacterium and the downstream effect on vacuole formation.
Future studies will address some of the differences found in this study and possibly would provide insights on the mechanisms of pathogenesis and survival of mycobacteria inside the host.
Acknowledgements
This publication was made possible in part by the Mass Spectrometry Core Facility of the
Environmental Health Sciences Center, Oregon State University, from grant number P30
ESOO21O, National Institute of Environmental Health Sciences, National Institutes of
Health.
We thank Denny Weber for preparing the manuscript. References
Aksamit, T. R. 2002. Mycobacterium avium complex pulmonary disease in patients with pre-existing lung disease. Gun Chest Med 23:643-653.
2. Barel, M., M. Le Romancer, and R. Frade. 2001. Activation of the EBV/C3d receptor (CR2, CD21) on human B lymphocyte surface triggers tyrosine phosphorylation of the 95-kDa nucleolin and its interaction with phosphatidylinositol 3 kinase. J Immunol 166:3167-3173.
Bermudez, L. E., L. S. Young, and H. Enkel. 1991. Interaction of Mycobacterium avium complex with human macrophages: roles of membrane receptors and serum proteins. Infect Immun 59:1697-1702.
4. Beuzon, C. R., S. Meresse, K. E. Unsworth, J. Ruiz-Albert, S. Garvis, S. R. Waterman, T. A. Ryder, E. Boucrot, and D. W. Holden. 2000. Salmonella maintains the integrity of its intracellular vacuole through the action of SifA. Embo J 19:3235-3249.
5. Brennan, M. J., G. Delogu, Y. Chen, S. Bardarov, J. Kriakov, M. Alavi, and W. R. Jacobs, Jr. 2001. Evidence that mycobacterial PE_PGRS proteins are cell surface constituents that influence interactions with other cells. Infect Immun 69:7326-7333.
6. Camacho, L. R., D. Ensergueix, E. Perez, B. Gicquel, and C. Guilhot. 1999. Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Mol Microbiol 34:257-267.
7. Clemens, D. L., and M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 18 1:257-270.
8. de Chastellier, C., T. Lang, and L. Thilo. 1995. Phagocytic processing of the macrophage endoparasite, Mycobacterium avium, in comparison to phagosomes which contain Bacillus subtilis or latex beads. Eur J Cell Biol 68:167-182.
9. Delogu, G., C. Pusceddu, A. Bua, G. Fadda, M. J. Brennan, and S. Zanetti. 2004. Rv 181 8c-encoded PE_PGRS protein of Mycobacterium tuberculosis is surface exposed and influences bacterial cell structure. Mol Microbiol 52:725-733.
10. Dheenadhayalan, V., G. Delogu, M. Sanguinetti, G. Fadda, and M. J. Brennan. 2006. Variable expression patterns of Mycobacterium tuberculosis PE_PGRS genes: evidence that PE_PGRS16 and PE_PGRS26 are inversely regulated in vivo. JBacteriol 188:3721-3725. 11. Falkinham, J. 0., 3rd. 1996. Epidemiology of infection by nontuberculous mycobacteria. Clin Microbiol Rev 9:177-215.
12. Faure, K., R. Leberre, and B. Guery. 2006. [Pseudomonas aeruginosa and Surfactant-associated Proteins A and Di. Med Mal Infect 36:63-7 1.
13. Flynn, J. L., and J. Chan. 2001. Immunology of tuberculosis. Annu Rev Immunol 19:93- 129.
14. Fratti, R. A., J. M. Backer, J. Gruenberg, S. Corvera, and V. Deretic. 2001. Role of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrest. J Cell Biol 154:631-644.
15. Gagnon, E., S. Duclos, C. Rondeau, E. Chevet, P. H. Cameron, 0. Steele- Mortimer, J. Paiement, J. J. Bergeron, and M. Desjardins. 2002. Endoplasmic reticulum-mediated phagocytosis is a mechanism of entry into macrophages. Cell 110:119-13 1.
16. Garin, J., R. Diez, S. Kieffer, J. F. Dermine, S. Duclos, E. Gagnon, R. Sadoul, C. Rondeau, and M. Desjardins. 2001. The phagosome proteome: insight into phagosome functions. J Cell Biol 152:165-180.
17. Gaynor, C. D., F. X. McCormack, D. R. Voelker, S. E. McGowan, and L. S. Schlesinger. 1995. Pulmonary surfactant protein A mediates enhanced phagocytosis of Mycobacterium tuberculosis by a direct interaction with human macrophages. Jlmmunol 155:5343-535 1.
18. Hoim, A., K. Tejle, K. E. Magnusson, A. Descoteaux, and B. Rasmusson. 2001. Leishmania donovani lipophosphoglycan causes periphagosomal actin accumulation: correlation with impaired translocation of PKCalpha and defective phagosome maturation. Cell Microbiol 3:439-447.
19. Hussain, S., B. S. Zwilling, and W. P. Lafuse. 1999. Mycobacterium avium infection of mouse macrophages inhibits IFN-gamma Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-gamma receptor. J Immunol 163:2041-2048.
20. lacovelli, L., L. Salvatore, L. Capobianco, A. Picascia, E. Barletta, M. Storto, S. Mariggio, M. Sallese, A. Porcellini, F. Nicoletti, and A. De Blasi. 2003. Role of G protein-coupled receptor kinase 4 and beta-arrestin 1 in agonist-stimulated metabotropic glutamate receptor 1 internalization and activation of mitogen- activated protein kinases. J Biol Chem 278:12433-12442.
21. Inderlied, C. B., C. A. Kemper, and L. E. Bermudez. 1993. The Mycobacterium avium complex. Clin Microbiol Rev 6:266-310. 22. Kelley, V. A., and J. S. Schorey. 2003. Mycobacteriums arrest of phagosome maturation in macrophages requires Rab5 activity and accessibility to iron. Mol Biol Cell 14:3366-3377.
23. Li, Y., E. Miltner, M. Wu, M. Petrofsky, and L. E. Bermudez. 2005. A Mycobacterium avium PPE gene is associated with the ability of the bacterium to grow in macrophages and virulence in mice. Cell Microbiol 7:539-548.
24. Lopez, J. P., E. Clark, and V. L. Shepherd. 2003. Surfactant protein A enhances Mycobacterium avium ingestion but not killing by rat macrophages. J Leukoc Biol 74:523-530.
25. Malik, Z. A., G. M. Denning, and D. J. Kusner. 2000. Inhibition of Ca(2+) signaling by Mycobacterium tuberculosis is associated with reduced phagosome- lysosome fusion and increased survival within human macrophages. J Exp Med 191:287-302.
26. Malik, Z. A., S. S. Iyer, and D. J. Kusner. 2001. Mycobacterium tuberculosis phagosomes exhibit altered calmodulin-dependent signal transduction: contribution to inhibition of phagosome-lysosome fusion and intracellular survival in human macrophages. J Immunol 166:3392-340 1.
27. Malik, Z. A., C. R. Thompson, S. Hashimi, B. Porter, S. S. Iyer, and D. J. Kusner. 2003. Cutting edge: Mycobacterium tuberculosis blocks Ca2+ signaling and phagosome maturation in human macrophages via specific inhibition of sphingosine kinase. J Immunol 170:2811-2815.
28. McGarvey, J. A., D. Wagner, and L. E. Bermudez. 2004. Differential gene expression in mononuclear phagocytes infected with pathogenic and non- pathogenic mycobacteria. Clin Exp Immunol 136:490-500.
29. Meresse, 5., 0. Steele-Mortimer, B. Moreno, M. Desjardins, B. Finlay, and J. P. Gorvel. 1999. Controlling the maturation of pathogen-containing vacuoles: a matter of life and death. Nat Cell Biol 1:E183-188.
30. Oh, Y. K., and R. M. Straubinger. 1996. Intracellular fate of Mycobacterium avium: use of dual-label spectrofluorometry to investigate the influence of bacterial viability and opsonization on phagosomal pH and phagosome-lysosome interaction. Infect Immun 64:319-325.
31. Ramakrishnan, L., N. A. Federspiel, and S. Falkow. 2000. Granuloma-specific expression of Mycobacterium virulence proteins from the glycine-rich PE-PGRS family. Science 288: 1436-1439.
32. Ren, B., M. A. McCrory, C. Pass, D. C. Bullard, C. M. Ballantyne, Y. Xu, D. E. Briles, and A. J. Szalai. 2004. The virulence function of Streptococcus pneumoniae surface protein A involves inhibition of complement activation and impairment of complement receptor-mediated protection. J Immunol 173:7506- 7512.
33. Rochat-Steiner, V., K. Becker, 0. Micheau, P. Schneider, K. Burns, and J. Tschopp. 2000. FIST/HIPK3: a FasIFADD-interacting serine/threonine kinase that induces FADD phosphorylation and inhibits fas-mediated Jun NH(2)- terminal kinase activation. J Exp Med 192:1165-1174.
34. Roecklein, J. A., R. P. Swartz, and H. Yeager, Jr. 1992. Nonopsonic uptake of Mycobacterium avium complex by human monocytes and alveolar macrophages. JLab Clin Med 119:772-781.
35. Sampson, S. L., P. Lukey, R. M. Warren, P. D. van Helden, M. Richardson, and M. J. Everett. 2001. Expression, characterization and subcellular localization of the Mycobacterium tuberculosis PPE gene Rv1917c. Tuberculosis (Edinb) 81:305-317.
36. Schlesinger, L. S. 1993. Macrophage phagocytosis of virulent but not attenuated strains of Mycobacterium tuberculosis is mediated by mannose receptors in addition to complement receptors. J Immunol 150:2920-2930.
37. Shrive, A. K., H. A. Tharia, P. Strong, U. Kishore, I. Burns, P. J. Rizkallah, K. B. Reid, and T. J. Greenhough. 2003. High-resolution structural insights into ligand binding and immune cell recognition by human lung surfactant protein D. J Mol Biol 33 1:509-523.
38. Sturgill-Koszycki, S., U. E. Schaible, and D. G. Russell. 1996. Mycobacterium- containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. Embo J 15:6960-6968.
39. Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakraborty, P. L. Haddix, H. L. Collins, A. K. Fok, R. D. Allen, S. L. Gluck, J. Heuser, and D. G. Russell. 1994. Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase.Science263:678-681.
40. Ting, L. M., A. C. Kim, A. Cattamanchi, and J. D. Ernst. 1999. Mycobacterium tuberculosis inhibits IFN-gamma transcriptional responses without inhibiting activation of STAT 1. J Immunol 163:3898-3906.
41. Vergne, I., J. Chua, S. B. Singh, and V. Deretic. 2004. Cell biology of mycobacterium tuberculosis phagosome. Annu Rev Cell Dev Biol 20:367-394.
42. Via, L. E., D. Deretic, R. J. Ulmer, N. S. Hibler, L. A. Huber, and V. Deretic. 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J Biol Chem 272:13326-1333 1. 50
43. Wagner, D., J. Maser, I. Moric, S. Vogt, W. V. Kern, and L. E. Bermudez. 2006. Elemental analysis of the Mycobacterium avium phagosome in Balb/c mouse macrophages. Biochem Biophys Res Commun 344:1346-1351.
44. Weikert, L. F., J. P. Lopez, R. Abdoirasulnia, Z. C. Chroneos, and V. L. Shepherd. 2000. Surfactant protein A enhances mycobacterial killing by rat macrophages through a nitric oxide-dependent pathway. Am J Physiol Lung Cell Mol Physiol 279:L216-223.
45. Wojciechowski, W., J. DeSanctis, B. Skamene, and D. Radzioch. 1999. Attenuation of MHC class II expression in macrophages infected with Mycobacterium bovis bacillus Calmette-Guerin involves class II transactivator and depends on the Nrampl gene. Jlmmunol 163:2688-2696. 51
Discussion
The macrophage provides the primary defense against microbial infection.
Different intracellular pathogens have evolved to exploit diverse niches within their host
cell. Some escape into the cytoplasm; others are immune to digestion within the
lysosomes; and the third group, which includes pathogenic mycobacterial species,
prevents the normal maturation of their phagosome and fusion with the lysosomes.
Although the lack of fusion of mycobacterial vacuoles with lysosomes was observed35
years ago by Hart and colleagues(15-17),the exact nature of this vacuole and its
relationship to other endocytic vesicles remains elusive. PE-PGRS and PPE gene
families have recently been shown to be involved in mycobacterial virulence in vivo.
Some studies have suggested their role in the phagosome maturation arrest phenomenon.
In this study, we determine the phagosomal membrane proteins expressed on the
macrophage uponM.avium infection and compare it with those expressed on
phagosomes in PPE gene inactivated 2D6 mutant-infected macrophages. The intent in
this study was to detect significant differences in the protein expression of the
phagosomes of wild-typeM.avium and its isogenic 2D6 mutant. Analysis of differential
gene expression in macrophages infected with M. avium and its isogenic 2D6 mutant was
also carried out to determine the differences in the nature of genes upregulated by wild-
type and 2D6-infected macrophages.
In the first part of the study, an array of proteins was identified in the wild-type,
as well as the 2D6 phagosomes. Some of the proteins such as the macrophage receptor
MARCO, complement Clq, pyruvate kinase, etc. were found to be expressed on both bacterial phagosomes; while the majority of the proteins expressed on wild-type 52 phagosomes were different from the 2D6 mutant phagosomes. This indicates that the wild-type bacterium potentially live in an environment quite different from its mutant.
Many proteins identified in the phagosomal preparations have not been previously described to be present on the phagosomes. This could be a result of contamination of the preparation with cytoplasmic contents. To confirm the presence of some of these proteins, fluorescent microscopy experiments were carried out, which revealed that these proteins are actually expressed on the phagosomes. In summary, numerous proteins were identified in theM.avium and its isogenic mutant phagosomes, some of which have not been previously reported. These proteins might unveil the underlying mechanisms used by the bacterium to prevent the phagosome-lysosome fusion.
The second part of the study involved the identification of differential gene expression in macrophages after infection with the wild-type or the 2D6 mutant. The
DNA array carried out to find this piece of information showed a whole range of genes which were differentially regulated uponM.avium or 2D6 mutant infection. The genes expressed in macrophages infected with wild-type was quite different from those expressed in 2D6 mutant-infected macrophages. The genes upregulated in the wild-type infected macrophages were fewer in number, compared to its isogenic mutant, and included a variety of kinases, anti-apoptotic genes, and intracellular signaling molecules; while the 2D6-infected macrophages showed upregulation in genes involved in apoptosis, bacterial uptake, signal transduction and immune response. Some genes which showed upregulation in macrophages have not been previously described to be expressed in macrophages, for example, the G-protein coupled receptor kinase 4 (GRK4). To confirm the expression, real time PCR was employed to validate the expression of GRK4 in 53
macrophages upon M. avium infection. Overall, the results reflect the diverse nature of
genes upregulated in macrophages infected with wild-type or the 2D6 mutant.
The study reveals differences in the vacuolar protein expression and gene
expression in macrophages after infection with either the wild-type or the PPE gene
inactivated mutant. Many proteins from the mass spectrometry data and genes from the
DNA microarray data suggest that the 2D6 mutant undergoes phagosome-lysosome
fusion, and killing inside the macrophage suggests a possible role of PPE gene in
mycobacterial virulence in vivo.
While working on the fluorescent microscopy portion of this project, I dealt with
two problems. First, the background on the slides was very strong and caused problem in
identifying the expression of the protein in infected cells after staining with primary and
secondary antibodies. Following the washing protocol several times did not change the
background issue. After increasing the washing steps, the problem still persisted. Then I
did titration experiment using different dilutions of the primary and secondary antibodies
to figure out the correct concentrations to use. The titration experiment did help
somewhat with the background issue. After determining the correct concentrations of the
antibodies, I tried to improve the washing procedure by washing the slides 2 times,
keeping them on the shaker for ten minutes during the wash process, and then aspirating
the fluid. This helped reduce the background to a great extent.
The main aim of the fluorescent microscopy studies was to clearly identify the
labeled bacteria and the protein expression on the phagosome in the infected
macrophages. When observed under the microscope, nearly all cells were flooded with too many bacteria and it was difficult to detect the protein on a single phagosome. Initially, cells were infected in a 2-chamber slide with 1 ml of bacterial suspension, so I tried to infect the cells with fewer bacteria. This did not produce the desired results. Then a labmate suggested declumping the bacteria by pipetting the bacterial suspension several times and letting it stand for at least 10 minutes before using the superficial layer of the suspension to infect the cells with 100 to 150 t1 of the bacterial suspension. This helped to infect nearly all cells with as less as 3-4 bacteria instead of hundreds per cell. The technique allowed visualizing the expression of the proteins on the phagosome of the infected macrophages very clearly.
RNA extraction of eukaryotic cells is easy if done very carefully. The RNA extracted from the infected U937 cells looked very good on the gels prior to DNase treatment. After DNase treatment, I amount of RNA decreased and also the quality of
RNA was very poor. I quickly learnt not to treat all the good RNA with DNase at a time.
Treating only one sample of RNA with DNase enzyme, instead of all of it, I saved time by not having to extract RNA from the first step again. Finally, good DNase-treated
RNA was produced when I used a new DNase enzyme and changed both the incubation time and place for the RNA. That is, instead of keeping the RNA in the cell culture incubator for 1 h after adding DNAse enzyme, I kept the RNA at room temperature on the bench for 2 h. This yielded a good quality RNA after DNase treatment. The designing of the correct primers that would amplify the genes for the real-time PCR study took 2 months (Table 4 & Fig 7). The difference in the fold induction in the microarray data and the real-time PCR could be due to the degradation of RNA, while handling, and cDNA synthesis. 55
Table4.Sense and antisense primers for real-timePCR
Target Primers PCRproduct (bp)
13-actin 5'TGATGGTGGGCATGGGTCAGA3' 800 5'CCCATGCCAATCTCATCTTGT3'
GRK4 5'AATGTATGCCTGCAAAAAGC3' 235
5'GATTGCCCAGGTTGTAAATG3'
DGKD 5'CTCGGCTTACGGTTATTCCAG3' 656
5'CCATCTCCATCTTCAGCCTCC3'
LCP2 5'CACTGAGGAATGTGCCCTTTC3' 408
5'GTGCCTCTTCCTCCTCATTGG3' 1200
1100
1000
u 900 b 800 v 700 SdU 10
.1 500
400
300
200 U . 100
0
-100
-200 o 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52
Cycle
Figure 7. Real-time PCR graph showing upregulation of genes in macrophage uponM. avium or 2D6 mutant infection. 57
Several useful conclusions and technique improvements were achieved during this study.
Most importantly, we have provided an insight into the array of proteins expressed on the mycobacterial phagosome at different time points, along with proteins which have not been previously been described to be present on the phagosomes. Furthermore, we have studied the gene expression profile of the macrophages upon M. avium infection and generated a useful amount of data reflecting the pattern of gene regulation in macrophages. A few genes, not previously been shown to be regulated in macrophages, were observed in our data. Future research will address some of the differences observed in this study and will provide a detailed view of the pathogenesis and survival mechanisms of mycobacteria inside the host. References
1. Aksamit, T. R. 2002. Mycobacterium aviuin complex pulmonary disease in patients with pre-existing lung disease. Clin Chest Med 23:643-653.
2. Alpuche Aranda, C. M., J. A. Swanson, W. P. Loomis, and S. I. Miller. 1992. Salmonella tvphimurium activates virulence gene transcription within acidified macrophage phagosomes. Proc Nati Acad Sci U S A 89:10079-10083.
3. Andreoli, W. K., N. N. Taniwaki, and R. A. Mortara. 2006. Survival of Trypanosoma cruzi metacyclic trypomastigotes within Coxiella burnetii vacuoles: differentiation and replication within an acidic milieu. Microbes Infect 8:172-182. 4. Bermudez, L. E., L. S. Young, and H. Enkel. 1991. Interaction of Mvcobacterium avium complex with human macrophages: roles of membrane receptors and serum proteins. Infect Immun 59:1697-1702. Chan, J., X. D. Fan, S. W. Hunter, P. J. Brennan, and B. R. Bloom. 1991. Lipoarabinomannan, a possible virulence factor involved in persistence of Mycobacterium tuberculosis within macrophages. Infect Immun 59:1755-1761.
6. Clemens, D. L., and M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 181:257-270. 7. Cosma, C. L., D. R. Sherman, and L. Ramakrishnan. 2003. The secret lives of the pathogenic mycobacteria. Annu Rev Microbiol 57:641-676.
8. Crowle, A. J., E. R. Ross, D. L. Cohn, J. Gilden, and M. H. May. 1992. Comparison of the abilities of Mycobacterium avium and Mvcobacterium intracellulare to infect and multiply in cultured human macrophages from normal and human immunodeficiency virus-infected subjects. Infect Immun 60:3697- 3703. 9. Derre, I., and R. R. Isberg. 2004. Legionella pneumophila replication vacuole formation involves rapid recruitment of proteins of the early secretory system. Infect Immun 72:3048-3053. 10. Falkinham, J. 0., 3rd. 2002. Nontuberculous mycobacteria in the environment. Clin Chest Med 23:529-55 1. 11. Falkinham, J. 0., 3rd, C. D. Norton, and M. W. LeChevallier. 2001. Factors influencing numbers of Mycobacterium avium, Mycobacterium intracellulare, and other Mycobacteria in drinking water distribution systems. Appl Environ Microbiol 67:1225-123 1. 12. Garcia-del Portillo, F., and B. B. Finlay. 1995. Targeting of Salmonella lyphimurium to vesicles containing lysosomal membrane glycoproteins bypasses compartments with mannose 6-phosphate receptors. J Cell Biol 129:81-97.
13. Gorvel, J. P., and S. Meresse. 2001. Maturation steps of the Sahnonella- containing vacuole. Microbes Infect 3:1299-1303. 59
14. Guthertz, L. S., B. Damsker, E. J. Bottone, E. G. Ford, T. F. Midura, and J. M. Janda. 1989. Mycobacterium avium and Mycobacterium intracellulare infections in patients with and without AIDS. J Infect Dis 160:1037-1041.
15. Hart, P. D., and J. A. Armstrong. 1974. Strain virulence and the lysosomal response in macrophages infected with Mycobacterium tuberculosis. Infect Immun 10:742-746. 16. Hart, P. D., J. A. Armstrong, C. A. Brown, and P. Draper. 1972. Ultrastructural study of the behavior of macrophages toward parasitic mycobacteria. Infect Immun 5:803-807. 17. Hart, P. D., M. R. Young, A. H. Gordon, and K. H. Sullivan. 1987. hhibition of phagosome-lysosome fusion in macrophages by certain mycobacteria can be explained by inhibition of lysosomal movements observed after phagocytosis. J Exp Med 166:933-946. 18. Hmama, Z., R. Gabathuler, W. A. Jefferies, G. de Jong, and N. E. Reiner. 1998. Attenuation of HLA-DR expression by mononuclear phagocytes infected with Mvcobacteriurn tuberculosis is related to intracellular sequestration of immature class II heterodimers. J [mmunol 161:4882-4893. 19. Honer zu Bentrup, K., and D. G. Russell. 2001. Mycobacterial persistence: adaptation to a changing environment. Trends Microbiol 9:597-605. 20. Horsburgh, C. R., Jr. 1996. Epidemiology of disease caused by nontuberculous mycobacteria. Semin Respir Infect 11:244-251. 21. Howe, D., and R. A. Heinzen. 2006. Coxiella burnetii inhabits a cholesterol-rich vacuole and influences cellular cholesterol metabolism. Cell Microbiol 8:496- 507. 22. Hussain, S., B. S. Zwilling, and W. P. Lafuse. 1999. Mycobacterium avium infection of mouse macrophages inhibits IFN-gamma Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-gamma receptor. J Immunol 163:2041-2048. 23. Inderlied, C. B., C. A. Kemper, and L. E. Bermudez. 1993. The Mycobacterium avium complex. Clin Microbiol Rev 6:266-310. 24. Keane, J., H. G. Remold, and H. Kornfeld. 2000. Virulent Mycobacterium tuberculosis strains evade apoptosis of infected alveolar macrophages. J Immunol 164:2016-2020. 25. Kelley, V. A., and J. S. Schorey. 2003. Mycobacterium's arrest of phagosome maturation in macrophages requires RabS activity and accessibility to iron. Mo! Biol Cell 14:3366-3377. 26. Kincaid, E. Z., and J. D. Ernst. 2003. Mycobacteriurn tuberculosis exerts gene- selective inhibition of transcriptional responses to IFN-gamma without inhibiting STAT1 function. J Immunol 171:2042-2049. 27. Li, Y., E. Miltner, M. Wu, M. Petrofsky, and L. E. Bermudez. 2005. A Mycobacterium avium PPE gene is associated with the ability of the bacterium to grow in macrophages and virulence in mice. Cell Microbiol 7:539-548. 28. Malik, Z. A., G. M. Denning, and D. J. Kusner. 2000. Inhibition of Ca(2+) signaling by Mycobacterium tuberculosis is associated with reduced phagosome- lysosome fusion and increased survival within human macrophages. J Exp Med 191:287-302. 29. Malik, Z. A., S. S. Iyer, and D. J. Kusner. 2001. Mycobacterium tuberculosis phagosomes exhibit altered calmodulin-dependent signal transduction: contribution to inhibition of phagosome-lysosome fusion and intracellular survival in human macrophages. J Immunol 166:3392-3401. 30. Malik, Z. A., C. R. Thompson, S. Hashimi, B. Porter, S. S. Iyer, and D. J. Kusner. 2003. Cutting edge: Mycobacterium tuberculosis blocks Ca2+ signaling and phagosome maturation in human macrophages via specific inhibition of sphingosine kinase. J Immunol 170:2811-2815. 31. Meresse, S., 0. Steele-Mortimer, B. B. Finlay, and J. P. Gorvel. 1999. The rab7 GTPase controls the maturation of Salmonella typhimurium-contai fling vacuoles in HeLa cells. Embo J 18:4394-4403. 32. Moreno, C., A. Mehiert, and J. Lamb. 1988. The inhibitory effects of mycobacterial lipoarabinomannan and polysaccharides upon polyclonal and monoclonal human T cell proliferation. Clin Exp Immunol 74:206-210. 33. Noss, E. H., R. K. Pai, T. J. Sellati, J. D. Radoif, J. Belisle, D. T. Golenbock, W. H. Boom, and C. V. Harding. 2001. Toll-like receptor 2-dependent inhibition of macrophage class II MHC expression and antigen processing by 19- kDa lipoprotein of Mycobacterium tuberculosis. J Immunol 167:910-918. 34. Oh, Y. K., C. Alpuche-Aranda, E. Berthiaume, T. Jinks, S. I. Miller, and J. A. Swanson. 1996. Rapid and complete fusion of macrophage lysosomes with phagosomes containing Salmonella typhimurium. Infect Immun 64:3877-3883. 35. Raju, B., and N. W. Schluger. 2000. Significance of respiratory isolates of Mycobacterium avium complex in HIV-positive and HI V-negative patients. mt j Infect Dis 4:134-139. 36. Ramakrishnan, L., N. A. Federspiel, and S. Faikow. 2000. Granuloma-specific expression of Mycobacterium virulence proteins from the glycine-rich PE-PGRS family. Science 288: 1436-1439. 37. Rathman, M., L. P. Barker, and S. Falkow. 1997. The unique trafficking pattern of Salmonella typhimurium-containing phagosomes in murine macrophages is independent of the mechanism of bacterial entry. Infect Immun 65:1475-1485. 38. Roberts, R. L., M. A. Barbieri, J. Ulirich, and P. D. Stahl. 2000. Dynamics of rab5 activation in endocytosis and phagocytosis. J Leukoc Biol 68:627-632. 61
39. Robinson, C. G., and C. R. Roy. 2006. Attachment and fusion of endoplasmic reticulum with vacuoles containing Legionella pneuinophila. Cell Microbiol 8:793-805. 40. Sampson, S. L., P. Lukey, R. M. Warren, P. D. van Helden, M. Richardson, and M. J. Everett. 2001. Expression, characterization and subcellular localization of the Mycobacteriurn tuberculosis PPE gene Rv1917c. Tuberculosis (Edinb) 81:305-3 17. 41. Scott, C. C., P. Cuellar-Mata, T. Matsuo, H. W. Davidson, and S. Grinstein. 2002. Role of 3-phosphoinositides in the maturation of Salmone/la-containing vacuoles within host cells. J Biol Chem 277:12770-12776. 42. Sibley, L. D., S. W. Hunter, P. J. Brennan, and J. L. Krahenbuhl. 1988. Mycobacterial lipoarabinomannan inhibits gamma interferon-mediated activation of macrophages. Infect Immun 56:1232-1236. 43. Smith, A. C., J. T. Cirulis, J. E. Casanova, M. A. Scidmore, and J. H. Brumell. 2005. Interaction of the Salmonella-containing vacuole with the endocytic recycling system. J Biol Chem 280:24634-2464 1. 44. Steele-Mortimer, 0., 5. Meresse, J. P. Gorvel, B. H. Toh, and B. B. Finlay. 1999. Biogenesis of Salmonella iyphimurium-containing vacuoles in epithelial cells involves interactions with the early endocytic pathway. Cell Microbiol 1:33- 49. 45. Sturgill-Koszycki, S., U. E. Schaible, and D. G. Russell. 1996. Mycobacterium- containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. Embo J 15:6960-6968. 46. Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakraborty, P. L. Haddix, H. L. Collins, A. K. Fok, R. D. Allen, S. L. Gluck, J. Heuser, and D. G. Russell. 1994. Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science 263:678-681. 47. Sturgill-Koszycki, S., and M. S. Swanson. 2000. Legionella pneumophila replication vacuoles mature into acidic, endocytic organelles. J Exp Med 192:1261-1272. 48. Vergne, I., J. Chua, S. B. Singh, and V. Deretic. 2004. Cell biology of mycobacterium tuberculosis phagosome. Annu Rev Cell Dev Biol 20:367-394. 49. Via, L. E., D. Deretic, R. J. Ulmer, N. S. Hibler, L. A. Huber, and V. Deretic. 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J Biol Chem 272: 13326-1333 1. 50. Wagner, D., J. Maser, B. Lai, Z. Cai, C. E. Barry, 3rd, K. loner Zu Bentrup, D. G. Russell, and L. E. Bermudez. 2005. Elemental analysis of Mycobacterium avium-, Mycobacteriuin tuberculosis-, and Mycobacterium smnegrnatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell's endosomal system. J Immunol 174:1491-1500. 62
51. Xu, S., A. Cooper, S. Sturgill-Koszycki, T. van Heyningen, D. Chatterjee, I. Orme, P. Allen, and D. G. Russell. 1994. Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol 153:2568-2578.