Exocrine Pancreas Synthesizes and Releases Dopamine

Proc. Natl. Acad. Sci. USA Vol. 93, pp. 10377-10382, September 1996 Medical Sciences

A novel nonneuronal catecholaminergic system: Exocrine pancreas synthesizes and releases dopamine (monoamine transporters/mucosal healing/dopamine receptor) EVA MEZEY*t, GRAEME EISENHOFER*, GYONGYI HARTA*, STEFAN HANSSONt, LYDIA GOULDt, BELA HUNYADYt§, AND BETH J. HOFFMANt *Clinical Neuroscience Branch, National Institute of Neurological Diseases and Stroke, and tLaboratory of Cell Biology, National Institute of Mental Health, Building 36, 3A17, Bethesda, MD 20892 Communicated by Bernhard Witkop, National Institutes ofHealth, Bethesda, MD, June 27, 1996 (received for review May 9, 1996)

ABSTRACT Cells of the exocrine pancreas produce di- presence of dopamine and the pancreas itselffor dopaminergic gestive enzymes potentially harmful to the intestinal mucosa. markers. Dopamine has been reported to protect against mucosal injury. In looking for the source of dopamine in the small intestine, we found that the duodenaljuice contains high levels METHODS of dopamine and that the pancreas itself has a high dopamine Sample Collection. To collect pancreatic/duodenal juice [and dihydroxyphenylalanine (dopa)] content that does not from rats, we ligated the duodenum near the pylorus to change significantly after chemical sympathectomy. Further- eliminate the contribution of dopamine from the stomach and more, we were able to demonstrate tyrosine hydroxylase (TH) ligated the duodenum below the papilla Vateri (the opening of activity in control pancreas as well as in pancreas from rats the pancreatic duct into the duodenum) and the ductus after chemical sympathectomy. Immunostaining and in situ choledochus (where bile enters the pancreatic juice) in anes- hybridization histochemistry confirmed both the presence of thetized rats. After 4 hr, the juice from the pancreas was taken TH, dopamine, and the dopamine transporter, and the and frozen until further processing. Collected from anesthe- mRNAs encoding TH and dopamine transporter, and the tized rats, pancreatic tissue was frozen on dry ice and kept at presence ofboth types ofvesicular monoamine transporters in -80°C until further processing. the exocrine cells of the pancreas. Since there are no cat- Catecholamine Measurements. Concentrations of dopa- echolaminergic enteric ganglia in the pancreas, the above mine, dihydroxyphenylalanine (dopa), and 3,4-dihydroxyphe- results indicate that pancreatic cells have all the character- nylacetic acid (DOPAC) were determined by liquid chroma- istics of dopamine-producing cells. We suggest that the pan- tography with electrochemical detection after alumina extrac- creas is an important source of nonneuronal dopamine in the tion (6). Intraassay coefficients of variation were 8.1% for body, and that this dopamine has a role in protecting the dopamine and 3.9% for DOPAC. intestinal mucosa and suggests that dopamine Dlb receptor Chemical Sympathectomies (CSs). CSs of adult male agonists might be used to help mucosal healing in the gas- Sprague-Dawley rats were performed using 6-hydroxydopa- trointestinal tract. mine (6-OHDA), according to the following schedule. To avoid the initial side effects due to quick depletion of periph- Dopamine protects against both gastric and intestinal mucosal eral norepinephrine terminals, rats were first given 6-OHDA injury. For instance, gastric and duodenal ulcers heal signifi- at a low dose (5 mg/kg) intraperitoneally. After 12 hr, each rat cantly faster after administration of dopamine agonists (1-4). received 15 mg/kg, and then two additional doses of 30 mg/kg However, the possible source of dopamine in the gastrointes- at 24 and 36 hr. Control rats received injections of vehicle on tinal system remained to be determined. the same schedule. Four days after the last injection, the rats The exocrine pancreas produces and secretes digestive en- were anesthetized, the pylorus was ligated, and samples were zymes and bicarbonate and releases them into the duodenum, collected as above. Norepinephrine content of the heart was while endocrine cells in the islets of Langerhans synthesize and used to control the completeness of the CS. All treated rats release hormones (such as insulin, glucagon, etc.) and are showed >95% reduction of cardiac noradrenaline levels. embedded in the exocrine pancreas. If dopamine in fact plays Immunohistochemistry. For immunohistochemistry, rats a protective role in the duodenum, then corelease with diges- were anesthetized with pentobarbital sodium (40 mg/kg body tive enzymes from the exocrine pancreas seems reasonable. In weight), then perfused with 4% paraformaldehyde. The pan- the cells that are outside of the central nervous system, crei were removed, cryoprotected in 20% sucrose, frozen on dopamine is generally considered to be a precursor of norepi- dry ice, and cut in a cryostat onto silanized slides in 12-,um- nephrine and epinephrine. Recent studies in swine (5), how- thick sections. To decrease nonspecific staining, the sections ever, suggest that the mesenteric organs produce about half of were pretreated for 30 min at room temperature (RT) in a total body dopamine and that dopamine in the mesenteric solution containing 0.6% Triton X-100, 5% normal serum in organs must not be exclusively a precursor to norepinephrine. lx PBS (pH 7.4). Normal serum was either goat or donkey The source of this dopamine is still unknown. We have recently (depending on the host of the secondary antibody). For discovered that the acid-secreting parietal cells of the stomach monoclonal primary antibodies, the normal serum was re- synthesize and release dopamine into the gastric lumen, where placed with 0.1% bovine serum albumin. Primary antibodies it may act as a paracrine hormone at dopamine receptors on (Table 1) were applied to the sections either for 1 hr at RT or epithelial cells (unpublished results). To determine if a similar mechanism exists in other parts of the digestive system, we Abbreviations: CS, chemical sympathectomy; 6-OHDA, 6-hydroxydo- analyzed both the pancreatic/duodenal secretions for the pamine; DAT, dopamine transporter; TH, tyrosine hydroxylase; VMAT, vesicular monoamine transporter; dopa, dihydroxyphenylalanine. The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" in §On leave from: First Department of Medicine, Medical University of accordance with 18 U.S.C. §1734 solely to indicate this fact. Pecs, Pecs, Hungary. 10377 Downloaded by guest on September 29, 2021 10378 Medical Sciences: Mezey et al. Proc. Natl. Acad. Sci. USA 93 (1996) Table 1. Primary antibodies used in these studies For nonradioactive in situ hybridization histochemistry (21), Antibody Host Dilution Source/Ref. the above riboprobes were labeled with digoxigenin-UTP. After hybridization, the digoxigenin was developed using an TH Rabbit 1:1000 Eugentec (37) anti-digoxigenin antibody conjugated to horseradish peroxi- TH Rabbit 1:1000 8, 9 dase. The signal then was amplified using a tyramine ampli- TH Mouse mc 1:500 Incstar (10) fication method (15) and the TSA kit (New England Nuclear). TH Mouse mc 1:500 Boehringer Mannheim (11) The final marker was fluorescein isothiocyanate-conjugated Dopamine Rabbit 1:2000 12 tyramide. Dopamine Goat 1:5000 12 Western Blots. Tissues were homogenized in 0.2% Triton DAT Rabbit 1:1000 13 X-100 in PBS (pH 7.5), assayed for protein content, and stored Neurofilament Mouse mc 1:4000 Chemicon (14) at -80°C. Either 20 ,g protein of pancreatic tissue or 2 ,ug Insulin Guinea pig 1:2000 Chemicon protein from adrenal gland was size-fractionated by SDS/ TH, tyrosine hydroxylase; DAT, dopamine transporter; mc, mono- PAGE and then electroblotted onto Hybond-Enhanced clonal. Chemiluminesence (ECL) nitrocellulose membrane (Amer- sham) at 30 V for 18 hr in transfer buffer (20% methanol/25 for 12 hr at 4°C. After several rinses in PBS, fluorescent mM Tris/192 mM glycine). Blots were preblocked in 5% secondary antibody was applied for 1 hr at RT in the dark, and nonfat dry milk in Tris-buffered PBS and incubated with the sections were rinsed, coverslipped, and viewed with a Leitz anti-TH antibodies for 1 hr at 22°C. Blots were then incubated Dialux 20 fluorescent microscope. For double-staining, the with horseradish peroxidase-conjugated goat anti-mouse IgG above procedure was used, and then the sections were incu- (1:1000) for 1 hr at 22°C and developed using the ECL kit bated in the second primary antibody and processed as de- (Amersham). Prestained molecular weight markers were used scribed above. The second secondary antibody was conjugated to estimate the molecular weight of immunoreactive species. to a different fluorochrome than the first one. For visualizing Antibody dilutions used (also see Table 1) were: Boehringer the TH immunostaining, a tyramide signal amplification sys- Mannheim, 1:100 and 1:1000; Incstar, 1:2000; Eugentec, tem was used (DuPont/NEN) (15). For dopamine immuno- 1:5000; Thibault et al. (22) 1:1000 staining, strong reducing agents (12) were used in all solutions TH Activity Measurements. For determining TH activity, through the primary antibody incubation to prevent dopamine tissues were homogenized in PBS and centrifuged at 20,000 x oxidation. Negative controls included staining with nonim- g for 10 min; the resulting supernatant was recovered. TH mune rabbit serum, leaving out the primary antibody or the activity in the soluble fraction was determined by a modifica- secondary antibody and using several antibodies when possible tion of the method of Naoi et al. (23) in which NADPH (0.5 to recognize the same antigen (Table 1). In the double mM) and hydropteridine reductase (1 unit per reaction) were immunostaining procedures, extra care was taken to avoid any used as the reducing system (both from Sigma). possible cross-reactivity between the different primary and Southern Blots/PCR Total RNA (5 ,ug) from rat pancreas secondary antibodies so that the second secondary antibody or adrenal was treated with DNase I (amplification grade, did not recognize the first primary antibody. In addition, the GIBCO/BRL) for 15 min at 37°C. First-strand cDNA was double stainings were always repeated reversing the order of synthesized using random primers and 200 units of Moloney the primary antibodies. murine leukemia virus reverse transcriptase (Superscript II, In Situ Hybridization Histochemistry. For all in situ hybrid- GIBCO/BRL) according to manufacturer's instructions. Sub- ization studies, 200 g male rats were decapitated, the pancreata sequently, PCR amplification was performed using 10% of the were removed, rinsed with PBS, and quickly frozen on dry ice. cDNA in the presence of 0.2 ,uM of each dNTP, 8 mM MgSO4, The tissue was kept at -80°C until sectioning. Sections (12 um 1 ,uM primers, and 2.5 units of Pwo polymerase (Boehringer thick) were cut in a cryostat (Reichert Frigocut 2500), Mannheim). Thermocycling conditions were: 1 min at 95°C, 2 mounted onto silanized slides, dried on a hotplate at 37°C, and min at 55°C, and 2 min at 72°C for 35 cycles followed by 7 min then processed for in situ hybridization histochemistry as at 72°C. Amplified products were size-fractionated on a 1.4% described earlier The that were used for agarose gel and blotted to nitrocellulose membranes (Schlei- (16). templates cher & Schuell). Oligonucleotides were labeled using making the RNA probe are listed below. The sense probe used [y-32P]ATP and polynucleotide kinase (New England Biolabs), as a control did not hybridize to the tissue. and were hybridized to Southern blots in 3x SSC/2x Den- Riboprobes were prepared using [35S]UTP and the Maxi- hardt's solution at 55°C for 18 hr. Final washes were performed script (Ambion, Austin, TX) kit. The following templates were in 3x SSC at 55°C. used. For TH, a fragment of the tyrosine hydroxylase (17) For amplification of VMAT cDNAs, the following primers cDNA (a gift of Dona Chikarachi, Duke University Medical were used: For VMAT1, (nucleotides 399-419) CACCTTC- Center, Durham, NC) corresponding to nucleotides 16-1165 CTGTACGCGACAGA (primer 7, sense) and (nucleotides of the coding sequence was used. For dopamine Dlb, a 655-635) CTTCTTCTAAGAACTCTATCC (primer 8, anti- fragment of the cDNA between nucleotide 1-1565 (GenBank sense); for VMAT2, (nucleotides 2161-2181) TTAGGAATT- accession no. M69118) was subcloned into pBluescript KS II+. TACAACTCGTCA (primer 9, sense) and (nucleotides 2661- For transporter mRNAs, specific riboprobes were transcribed 2641) GTGAAACTCATTTCTACATTG (primer 10, anti- from DNA templates generated by PCR using the following sense). Oligonucleotides for probing PCR products: For primers: for DAT (GenBank accession no. M80570; ref. 18) VMAT1, (nucleotides 603-556) GGCTTCAGTGACTG- (nucleotides 1088-1109) TAGAGACGCAATCATCACCA- GAGGAGGGATGGTGCCATTTGTCCAAGTTACACG CC (primer 1, sense) and (nucleotides 1575-1555) CACTG- (oligo 11); for VMAT2, (nucleotides 2300-2347) CATGTT- AATTGCTGGACGCCGT (primer 2, anti-sense); for vesic- TCACCCCTTGTCGGCTTTAGTGACTGCT- ular monoamine transporter 1 (VMAT1) (GenBank accession GCCGATGACATAAC (oligo 12). no. M97380; ref. 19) (nucleotides 1741-1761) ACAGAGAC- CCAGATGTACACA (primer 3, sense) and (nucleotides 2177-2157) GTTAGTCTCTTCTTTCCGTCC (primer 4, an- RESULTS tisense); for VMAT2 (GenBank accession no. L00603; ref. 20) Four hours after ligation of the pylorus, the duodenum, and (nucleotides 1649-1669) GACCCTCTAACGTCGCCAAA- the bile duct, duodenal juice contained a significant amount of TG (primer 5, sense) and (nucleotides 2160-2140) ACACA- dopamine [276 ± 61.8 pg/ml (n = 15)]. Then we used CS to TTGGTAC TAGTTACAA (primer 6, anti-sense). eliminate sympathetic nerve fibers and, thus, rule out neurons Downloaded by guest on September 29, 2021 Medical Sciences: Mezey et aL Proc. Natl. Acad. Sci. USA 93 (1996) 10379 as a source of dopamine. Dopamine content did not change after CS [463 + 287 pg/ml (n = 5)], suggesting local, nonneuronal production of dopamine. In the pancreatic tissue itself, 40% of the dopamine content [32 + 6 (n = 5) versus 84 + 36 (n = 5) pmol/mg tissue] was still present after CS, in agreement with previously published data (24-26) (Fig. 1). We also measured consistently high levels of DOPA in all samples (data not shown). The rate-limiting step in dopamine synthesis is the conver- sion of tyrosine to dopa by TH (27). Therefore, the presence of TH enzyme activity implies the potential for dopamine production. We were able to detect TH activity in the pancreas; the activity was little changed compared with tissue norepinephrine by CS (2.8 + 0.7 versus 1.8 + 0.8 pmol/mg protein per min) (Fig. 1). Using four different antibodies to TH and a signal amplification method (15), we localized TH immunostaining to all exocrine cells of the pancreas (Fig. 24). The insulin-positive pancreatic islet cells are negative for TH (Fig. 2B). In addition to cells in the exocrine pancreas, numerous nerve fibers were also TH positive, but no neuronal cell bodies were observed. All four anti-TH antibodies gave similar results. To corrobo- rate the histological results, we determined that anti-TH antibodies recognize a protein in pancreatic extracts corresponding in apparent molecular weight to adrenal TH (Fig. 3).

2^,2500^^ -

CONTROL 21000 - 6OHDA

0 0, - 1

1I1000

z 500 -

0 100 -_ O CONTROL * 6OHDA FIG. 2. Immunohistochemical ocalization of TH, dopamine, and 80 -_ DAT in pancreas. Fluorescent in situ hybridization of VMAT mRNAs. 0, All exocrine pancreatic cells are immunopositive for TH (A), while the 4-E 60 -_ insulin-producing islet cells (asterisks) in the same section (B) are E negative. (A) An arrowhead points at a nerve fiber. (C) Similarly, all =m exocrine cells are immunopositive for dopamine itself in addition to 40 -_ sympathetic nerve fibers that are also immunopositive for dopamine e (arrowheads). (D) DAT is present in the plasma membrane of all pancreatic cells in addition to the epithelium of excreting ducts (large 20 -_ arrow), veins (small arrows), and some connective tissue elements. (D) Arteries are negative (arrowhead). In situ hybridization histochemistry 0 _ demonstrates the VMAT1 (E) and VMAT2 (F) mRNAs in all cells (the perinuclear staining is typical of the localization of an mRNA). 4- = o3 CONTROL (Bar 100 ,um.) * 6OHDA 3.5 - Immunostaining for dopamine itself revealed the presence E 3 - c of dopamine in most exocrine cells (Fig. 2C) in addition to

2 5 sympathetic nerves. We also visualized a few dopamine- positive enterochromaffin cells in the duodenal epithelium. Ce 2 The very scattered distribution and low number of cells make E 1.5- ; it doubtful that these cells produce sufficient amounts of dopamine to account for the dopamine in the pancreatic/ ...... duodenal juice. 0.5 Dopamine neurons express a plasma membrane DAT that transports released dopamine back into the cell but that may also function in reverse to release dopamine (for review, see FIG. 1. (Top and Middle) Norepinephrine (NE) and dopamine ref. an to DAT (13), we found that most (DA) content, respectively, of pancreatic tissue. (Bottom) TH activity 28). Using antibody in the pancreas before and after CSs. Note that there is a significant exocrine and endocrine pancreatic cells and many vascular amount of dopamine still present after CS. More than 70% of TH elements are DAT immunopositive (Fig. 2D). We consistently activity also persists after CS. Number of rats in each group: n = 5. observed a plasma membrane immunostaining in the endo- Downloaded by guest on September 29, 2021 10380 Medical Sciences: Mezey et al. Proc. Natl. Acad. Sci. USA 93 (1996) LA A VMAT1 m C L. CL L. C U e C + LL Vl In < 0 _ C e O LI C 86.0 bp a 21 + +

310 _ ~~~ w_

50.7-. 194 -

'Wolu" FIG. 3. TH immunoreactivity in pancreas and adrenal. Anti-TH .1ilbuiLl, antibody (Incstar, 1:2000) recognized a protein species of the same apparent molecular mass in the pancreas (20 ,ug protein) as in adrenal gland (5 ,ug protein), the positive control. These results were replicated with each of the other three TH antibodies (see refs. 7-9 and 11). Molecular mass markers are indicated in kDa. crine and exocrine cells, in the excreting ducts of the pancreas, and in the venous part of the vasculature. No DAT immuno- B VMAT2 staining was present in the arterial endothelium (Fig. 2D). Using in situ hybridization histochemistry, we were also able to C 0 detect the mRNA encoding DAT in both exocrine and endo- C + C UL dh < < 0 crine cells (data not shown). -i 0 0IV A 2sC 0 In neurons and neuroendocrine cells, VMATs package 6. u~~~c v w monoamines (serotonin, dopamine, norepinephrine, epineph- bp XL 2. X-, rine, and histamine) into storage vesicles. Two VMAT sub- types have been identified: (i) VMAT1 (19) from adrenal 600 - chromaffin cells and (ii) VMAT2 (19, 20) from monoamine neurons, platelets, and mast cells. Our in situ hybridization histochemistry revealed that both VMAT1 and VMAT2 mRNAs are present in the pancreas (Fig. 2 E and F, respec- 310 _ tively). To prove the specificity of hybridization, two different riboprobes were used individually with identical results for each transporter. We confirmed the presence of both VMAT1 and VMAT2 mRNA in pancreas by amplification of specific DNA fragments from pancreatic cDNA (Fig. 4). VMAT1 and VMAT2 may be present in different populations of storage vesicles (19, 28). Finally, we looked for a potential target of the dopamine FIG. 4. Detection of VMAT mRNAs in pancreas by reverse produced by the pancreas using in situ hybridization histo- transcription-PCR. VMAT1 (A) and VMAT2 (B) mRNAs are present chemistry to visualize mRNAs the five known in the pancreas as determined by reverse transcription-PCR. For each encoding dop- set of primers, a DNA fragment of identical size was amplified from amine receptors. In the pancreas, the dopamine Dlb (D5) pancreas, adrenal (mRNA control), and a positive VMAT cDNA receptor (29) mRNA is abundantly and widely expressed, plasmid, and was identified by hybridization to a third oligonucleotide. whereas the other dopamine receptor mRNAs were not de- Ethidium bromide staining is always shown above the Southern blot tectable. Dlb receptor mRNA was also present in all of the analysis. (A) A 256-bp fragment of VMAT1 cDNA was amplified with duodenal epithelial cells as was the case for the stomach primers 7 and 8 and hybridized to oligonucleotide 11. (B) A 500-bp epithelial cells (unpublished results). Cells in the lamina fragment of VMAT2 cDNA was amplified with primers 9 and 10 and propria as well as many smooth muscle cells also make a hybridized to oligonucleotide 12. Lanes: pancreas-no RT, equivalent significant amount of Dlb receptor mRNA (Fig. 5), in addition amount (relative to cDNA) of RNA only, no reverse transcriptase; +ve to some D3 receptor and D4 receptor mRNAs not cDNA + primers, positive cDNA with primers; +ve cDNA - primers, (data positive cDNA without primers; primers only, no cDNA added. DNA shown). size markers are indicated in base pairs (bp). DISCUSSION also demonstrated the mRNA encoding the plasma membrane DAT (data not shown) as well as the presence of DAT itself, The pancreas contains markers usually associated with cat- using immunostaining. echolaminergic and neuroendocrine cells. We have shown here We found both dopamine content and TH activity in the in exocrine pancreatic cells the presence of dopamine itself by normal and in the CS pancreas and a significant amount of immunocytochemistry as well as the presence of tyrosine dopamine present in the duodenal juice even after CS. All the hydroxylase, the enzyme that is responsible for the synthesis of sympathetic fibers are destroyed by CS (as indicated by the dopamine. Another characteristic of catecholaminergic cells is dramatic decrease in norepinephrine content) (Fig. 1) and, in the presence of transporter molecules. We found that both agreement with literature data (30), we did not detect TH- types of the vesicular monoamine transporters (VMAT1 and positive intramural ganglionic neurons in the pancreas. Thus, VMAT2) are present in the pancreas. The presence of both there is no neuronal source for dopamine production observed VMATs in many cells suggests that dopamine, or other after CS. These observations raised the possibility that the monoamines, may be differentially targeted to and costored pancreas itself may be the major source of dopamine in the with specific hormones or enzymes in the pancreas. We have duodenal juice. Downloaded by guest on September 29, 2021 Medical Sciences: Mezey et aL Proc. Natl. Acad. Sci. USA 93 (1996) 10381

A*J o ;h P-

; ~ ~~S "4r . ~44w.

' ,., ; , J ' d'. 't.< r :, .

f ih me

sl _ d o -. '1 I

FIG. 5. Dopamine Dlb receptor mRNA in duodenal and pancreatic cells. Brightfield (A and C) and are the corresponding darkfield (B and D) images of the same sections. (A and B) In a cross section through the pancreas (P) and the duodenal wall (D), most pancreatic cells as well as smooth muscle cells in the duodenum are positive for the Dlb receptor mRNA. A few enteric ganglionic cells (arrowhead) are also positive. (C and D) A transverse section of the duodenum shows a very strong labeling of all epithelial as well as many lamina propria cells (*) with the dopamine Dlb receptor mRNA probe. Arrows indicate epithelium of two villi. (Bar = 100 ,um.) The immunostaining showed a lack of DAT in the endo- Our results define a novel catecholaminergic system in the thelial cells of arteries, while it is rather abundant in excreting pancreas and duodenum and suggest a paracrine hormonal ducts and veins. This distribution might be consistent with local role for dopamine outside of the central nervous system. production and usage of dopamine. Since the pancreas is a Along with acid-secreting parietal cells in the stomach, large organ, the dopamine produced here could get into the pancreatic exocrine cells that produce the digestive enzymes general circulation and result in high dopamine levels in the synthesize and release dopamine into the duodenum. The blood. This might have harmful cardiovascular effects. One pancreatic cells also produce large amounts of dopa, which can imagine that the presence of DAT in the veins (and not in may serve only as the precursor for dopamine. The possibility the arteries) serves to reuptake the dopamine from the pan- that dopa may have a role of its own should be considered, creas and metabolize it before it could leak into the general however. circulation. This suggests that the dopamine made here is Dopamine appears to have a beneficial effect in acute intended exclusively for local use. pancreatitis (37-39). Since we found a similar nonneuronal In looking for a target site of this locally produced dopa- catecholamine system in the gastric epithelium, it appears that mine, we demonstrated the presence of mRNA encoding the the production and release of dopamine in concert with dopamine Dlb receptor in all epithelial cells of the duodenum potentially harmful agents (digestive enzymes) may be a and the pancreas itself. While the dopamine Dlb receptors general mechanism of self-defense in the gastrointestinal found in abundance in gastrointestinal epithelial cells seem to system. Our results suggest the potential efficacy of specific be the target of intraluminal dopamine, the pancreatic dopa- dopamine receptor agonists in the treatment of gastrointesti- mine receptors might mediate an autocrine feedback effect. nal diseases. Future studies should focus on the mechanism The effects of dopamine on exocrine pancreatic secretion have whereby dopamine protects the pancreas and duodenum and been studied in several animal species (31, 32). While a strong changes in dopamine secretion in pathological states. stimulatory effect on secretion was found in dogs (33-35), the effect was less pronounced in other species and is unclear in We acknowledge Drs. Michael Brownstein and Miklos Palkovits for humans (36). critical reading of the manuscript; Drs. H. Steinbusch and R. A. Downloaded by guest on September 29, 2021 10382 Medical Sciences: Mezey et al. Proc. Natl. Acad. Sci. USA 93 (1996) Vaughan for supplying antibodies for dopamine and DAT; Dr. Sey- 22. Thibault, J., Vidal, D. & Gros, F. (1981) Biochem. Biophys. Res. mour Kaufman for his valuable advice on the TH assays; and Ricardo Commun. 99, 960-968. Dreyfuss for expert photography. 23. Naoi, M., Takahashi, T. & Nagatsu, T. (1988)J. Chromatogr. 427, 229-238. 1. Sikiric, P., Rotkvic, I., Mise, S., Petek, M., Rucman, R., Seiwerth, 24. Graffner, H., Ekelund, M., Hakanson, R. & Rosengren, E. (1985) S., Zjacic-Rotkvic, V., Duvnjak, M., Jagic, V., Suchanek, E., Scand. J. Gastroenterol. 20, 1276-1280. Grabarevic, Z., Anic, T., Brkic, T., Djermanovic, Z., Dodig, N., 25. Orloff, L. A., Orloff, M. S., Bunnett, N. W. & Walsh, J. H. (1985) Marovic, A. & Hernandez, D. E. (1991) Dig. Dis. Sci. 36,905-910. Life Sci. 36, 1625-1631. 2. Glavin, G. & Szab6, S. (1990) Dig. Dis. Sci. 35, 1153-1161. 26. Quansah, F. A., Klatt, C. & Feldman, J. M. (1981) Metabolism 30, 3. Glavin, G. & Dugani, A. (1987) Life Sci. 41, 1397-1408. 242-247. 4. MacNaughton, W. K. & Wallace, J. L. (1989) Gastroenterology 27. Nagatsu, T., Levitt, M. & Underfriend, S. (1964) J. Biol. Chem. 96, 972-980. 239, 2910-2917. 5. Eisenhofer, G., Aneman, A., Hooper, D., Holmes, C., Goldstein, 28. Borowsky, B. & Hoffman, B. J. (1995) in International Review of D. & Friberg, P. (1995) Am. J. Physiol. 268, G641-G649. Neurobiology, eds. Bradley, R. J. & Harris, R. A. (Academic, San 6. Eisenhofer, G., Goldstein, D., Stull, R., Keiser, H., Sunderland, Diego), pp. 139-199. T., Murphy, D. & Kopin, I. (1986) Clin. Chem. 32, 2030-2033. 29. Tiberi, M., Jarvie, K. R., Silvia, C., Falardeau, P., Gingrich, 7. Ziller, C., Mirabel, M. A., Vandenbunder, B. & Fauquet, M. J. A., Godinot, N., Bertrand, L., Yang-Feng, T. L., Fremeau, (1994) Anat. Embryol. 189, 307-315. R. T. J. & Caron, M. G. (1991) Proc. Natl. Acad. Sci. USA 88, 8. Arluison, M., Dietl, M. & Thibault, J. (1984) Brain Res. Bull. 13, 7491-7495. 269-285. 30. Oomori, Y., luchi, H., Ishikawa, K., Satoh, Y. & Ono, K. (1994) 9. Dietl, M., Arluison, M., Mouchet, P., Feuerstein, C., Manier, M. Histochemistry 101, 313-323. & Thibault, J. (1985) Histochemistry 82, 385-389. 31. Furuta, Y., Hashimoto, K. & Washizaki, M. (1978) Br. J. Phar- 10. Chiodo, L. A. & Kapatos, G. (1992) Synapse 11, 294-309. macol. 62, 25-29. 11. Rohrer, H., Acheson, A. L., Thibault, J. & Thoenen, H. (1986) 32. Hashimoto, K., Oguro, K. & Furuta, Y. (1977) Arch. Histol. Jpn. J. Neurosci. 6, 2616-2624. 40, Suppl., 129-132. 12. Steinbusch, H. W., Wouterlood, F. G., de Vente, J., Bol, J. G. & 33. Iijima, F., Iwatsuki, K. & Chiba, S. (1983) Eur. J. Pharmacol. 92, Berkenbosch, F. (1988) Acta Histochem. Suppl. 35, 86-106. 191-197. 13. Vaughan, R. A. (1995) Mol. Pharmacol. 47, 956-964. 34. Takeuchi, S., Okamura, T., Shonai, K. & Imamura, S. (1990) 14. Harris, J., Ayyub, C. & Shaw, G. (1991) J. Neurosci. Res. 30, 47-62. Nippon Ika Daigaku Zasshi 57, 119-126. 15. Berghorn, K. A., Bonnett, J. H. & Hoffman, G. E. (1994) J. His- 35. Hashimoto, K., Sato, S. & Takeuchi, 0. (1971) Br. J. Pharmacol. tochem. Cytochem. 42, 1635-1642. 43, 739-746. 16. Bradley, D. J., Towle, H. C. & Young, W. S. (1992) J. Neurosci. 36. Valenzuela, J. E., Defilippi, C., Diaz, G., Navia, E. & Merino, Y. 12, 2288-2302. (1979) Gastroenterology 76, 323-326. 17. Grima, B., Lamouroux, A., Blanot, F., Biguet, N. F. & Mallet, J. 37. Shen, J., Huang, M. K. & Wu, F. L. (1990) Chin. Med. J. (Engl. (1985) Proc. Natl. Acad. Sci. USA 82, 617-621. Ed.) 103, 201-207. 18. Kilty, J. E., Lorang, D. & Amara, S. G. (1991) Science 254,578-579. 38. Sikiric, P., Rotkvic, I., Mise, S., Krizanac, S., Gjuris, V., Jagic, V., 19. Liu, Y., Peter, D., Roghani, A., Schuldiner, S., Prive, G. G., Eisen- Suchanek, E., Petek, M., Udovicic, I., Geber, J., Tucan-Foretic, berg, D., Brecha, N. & Edwards, R. H. (1992) Cell 70, 539-551. M., Cvitanovic, B., Ivanovic, D. & Marovic, A. (1988) Eur. 20. Erickson, J. D., Eiden, L. E. & Hoffman, B. J. (1992) Proc. Natl. J. Pharmacol. 147, 321-326. Acad. Sci. USA 89, 10993-10997. 39. Nishiwaki, H., Koh, I., Kanazawa, G., Hiura, A., Satake, K. & 21. Young, W. S. I. (1989) Neuropeptides 13, 271-275. Umeyama, K. (1988) Nippon Geka Gakkai Zasshi 89, 1990-1996. Downloaded by guest on September 29, 2021