Genetic diseases 10/9/2019 10:43 PM

Single nucleotide polymorphisms (SNPs): AAAGCTAAAGCCCCCTAAGA-- 1 AAAGCTAAAGCCCTCTAAGA-- 2

1. DNA sequences of most individuals are almost identical, >99%.

2. Single base pair differences occur about once every 500-1000 bp.

3. In most populations there is a common SNP, and several less common SNPs.

Gentic diseases and tested genes 4. About 3 million SNPs occur in the human genome, and these are becoming popular genetic markers. cattle, horse, sheep, pig,dog, cat Ákos Maróti-Agóts

Single nucleotide polymorphisms (SNPs): RFLP = Restriction site polimorphism

TTTCGGGGG- PRIMER  AAAGCTAAAGCCCCCTAAGA-- 1 How can we find an SNP? AAAGCTAAAGCCCTCTAAGA-- 2 • allele specific PCR TTTCGGGGG- PRIMER  the primer can’t anneal to mutated DNA → PCR give different outcome

•PCR – RFLP 1. multiplying with PCR (the whole questonable part of DNA) 2. digestion with special restriction endonuclease (which cleaving in the mutation) 3. elfo separation of fragments

PCR - RFLP – Easy to find the SNP PCR - RFLP – Easy to find the SNP

Run digested PCR product on gel

Dr. Maróti-Agóts Ákos 1 Genetic diseases 10/9/2019 10:43 PM

How to type SNPs with DNAchip: How to type SNPs with DNAchip: 1. SNPs can be typed by hybridizing a complementary oligonucleotide (e.g., single-base extension assay).

2. If the stringency is high (i.e., temperature), the oligonucleotide will fail to bind to DNAs showing polymorphism.

3. Many hundreds of SNPs can be tested simultaneously using:

DNA microarrays (DNA-chips, Gene-Chips, SNP-chips)  First developed in the early 1990s.  Ordered grid of short, complementary, known sequence oligonucleotides placed at fixed positions on silicon, glass, or nylon substrate.  Oligonucleotides are experimentally determined and are either (1) microspotted or (2) synthesized on the chip.  User defined SNP chips are available commercially, and can contain >400,000 different probes.

Types of microarrays:

-SNP chip • searching of SNPs, • „panels” for species, breeds – checking the wanted and unwated alleles, probes

-Expression RNA chip • mRNA is the detected molecule • Interesting metabolic products, • enzyms

Metabolic pathways of Thirozine in dogs http://www.kegg.jp/kegg- bin/highlight_pathway?scale=1.0&map=cfa00350 &keyword=melanin https://www.youtube.com/watch?v=6ZzFihESjp0

How toSchematic type ofSNPs a SNP chipwith assay DNAchip:

Dr. Maróti-Agóts Ákos 2 Genetic diseases 10/9/2019 10:43 PM

Genome Projects

“The two technologies that will shape the next century are biotechnology and information technology” Bill Gates genetic diseases and tested genes “The two technologies that will have the greatest impact on each other in the new millennium are biotechnology and information technology” Craig Venter – CELERA Corp.

Samples for DNA testing Blood - is the most commonly used source, EDTA tube (purple top). Only white blood cells contain DNA in mammals! Hair Roots -minimum of 10 tail hairs with the roots cattle Semen -from bulls - expensive to collect genetic diseaes and tested genes Meat -usually meat or tissue from animals that are no longer alive, and frozen meat Skin -punch biopsy ear tag

Sample Collection From poor quality samples the testing is more expensive! You should always contact your lab of choice before collecting a sample for DNA testing because different labs are set up to handle particular types of samples.

Bovine leukocyte adhesion deficiency (BLAD) Bovine leukocyte adhesion deficiency (BLAD) in Holstein cattle is an autosomal recessive defect resulting in impaired expression in Holstein cattle is an autosomal recessive defect resulting in impaired of CD18 gene. Lethal in the homozygous form. expression of CD18 gene. Lethal in the homozygous form. Osborndale Ivanhoe Bell,1952 disease: This alteration hinders neutrophil function and affected cattle often die at a young age from mucosal infections of the respiratory and gastrointestinal tract.

TEST: heterozygous healthy carriers can be detected by means of polymerase chain reaction (PCR) and restriction analysis. primers for PCR forward: 5'-CCTGCATCATATCCACAG-3'; reverse: 5'-GTTTCAGGGGAAGATGGAG-3'

Shuster, D.E., Kehrli, M.E., Ackermann, M.R., and Gilbert, R.O., Identification and Prevalence of a Genetic Defect That Causes Leukocyte Adhesion

Deficiency in Holstein Cattle, Proc. Natl. Acad. Sci. USA, 1992, vol. 89, pp. 9225–9229.

Dr. Maróti-Agóts Ákos 3 Genetic diseases 10/9/2019 10:43 PM

Bovine leukocyte adhesion deficiency (BLAD) Bovine leukocyte adhesion deficiency (BLAD)

•58-bp fragment after PCR.

•cleaved with TaqI, in noncarriers, two fragments of 32 and 26 bp

•carriers show all three bands of 58, 32, and 26 bp

BLAD case study -Case I - MAC62057 (AFIP 2458107) Deficiency ofUridine-5’-Monophosphate Syntetase DUMPS or UMPS

History. This 3-year-old Holstein female was homozygous for bovine leukocyte adhesion Uridine monophosphate synthase (UMPS) is the enzyme responsible for deficiency (BLAD). The cow had numerous episodes of diarrhea, pneumonia, and persistent converting orotic acid to uridine monophosphate (UMP), which is an essential lesions of papillomatosis and dermatophytosis but lived until three years of age. component of pyrimidine nucleotides. - quite severe consequences

Gross Pathology. Marked diffuse cutaneous papillomatosis and dermatophytosis. Severe diffuse •embryonic death around 40 days in utero cranioventral bronchopneumonia involving 50% of the lung. Marked hyperplasia of the ileal mucosa. Laboratory Results. Periodic blood samples demonstrated a persistent and progressive •Carriers are phenotypically have only half the normal activity of uridine neutrophilia with >80,000 neutrophils/æl. monophosphate synthase.

Microbiological findings: Lung and small intestine: Large numbers of Pseudomonas aeruginosa. Ileocecal lymph node: Actinomyces pyogenes.

Contributor's Diagnosis and Comments. Severe diffuse chronic-active bronchopneumonia with marked bronchiectasis, and peribronchial and peribronchiolar fibrosis. In some sections the Article01: „PCR Screening for Carriersof BovineLeukocyte Adhesion fibrosis is less pronounced. Deficiency (BLAD) and Uridine MonophosphateSynthase(DUMPS) in ArgentineHolstein Cattle”

Complex Vertebral Malformation (CVM) Coat Color Tests MC1R gén Vörös vagy Fekete CVM as a lethal recessive can increase the rate of embryonic loss and number of stillbirths. A homozigóta feketék azonosítását teszi lehetővé • A stillborn CVM calf will have a shortened neck due to malformed vertebra, fused ribs MGF Deres szín on the right side and contracted fetlocks. TYRP1 or Dexter dun brown homozigóta fekete Dexter marha vagy hordozó barna. • accurate genetic testing can easily distinguish animals that carry the CVM gene from TYR Albisnizmus a Borzderesben those who don't. Albinizmus a borzderes fajtában előfordul a tirozináz mutációja miatt

TYR vagy Fehér Galloway Although there is strong evidence that the White Galloway and White Park patterns are due to the tyrosinase gene, the mutation does not occur in the coding portion of the gene and therefore no DNA test has been developed. This temperature sensitive expression of pigment, like that of the Siamese cat, is inherited as a dominant.

Dr. Maróti-Agóts Ákos 4 Genetic diseases 10/9/2019 10:43 PM

milk production test

Polled versus Horned Polled versus Horned •If we know the whole family, we can make pairs from microsatellites and polledorhorned •Polled is the name for the absence of horns in cattle, informations allele sheep and goats •If we have made pairs from linked alelles of microsatellite allel and polled allele we can •Polled is an autosomal dominant trait in cattle. follow the inheritance of polled gene • The gene causing the absence of horns is at the top of cattle chromosome 1. the exact gene is yet unknown.

• Based on this information, several DNA markers near the gene, called "linked" markers, can be used to test for homozygosity of polled in an individual • if suitable family members are also available!

• Five DNA markers seem to be close enough (microsatellites) •Three of these have been designed so that they can be analyzed in a single test, called multiplex PCR.

Milk production – Genetic tests GENETIC CODES in pedigree

Chro·Mo·Probe (CMP) · $50/sample • DP – Deficiency of Uridine Monophosphate Synthase (DUMPS) in Holstein bull, Carlin·M Ivanhoe Bell, two alleles exist for prolactin. One allele, G, has been • TD – Tested free of DUMPS associated with increased milk yield and component values. The other allele, V, does not have • HL – Hairless (recessive) this favorable relationship.GG, GV or VV. • IS – Imperfect Skin • MF – Mule-Foot (recessive) • TM – Tested free of Mule-Foot Kappa·Casein (KCN) · $40/sample • BD – Bulldog (recessive) • BL – Bovine Leukocyte Adhesion Deficiency (BLAD) (recessive) Kappa·Casein is one of four non·whey proteins and has been associated with increased protein • TL – Tested free of BLAD yield and percentage. A or B. • CV – Complex Vertebral Malformation (CVM) (recessive) B gene has been associated with an increase in milk, protein and cheese yield. • TV – Tested free of CVM • DF – Dwarfism • PC – Polled (dominant) Beta·lactoglobulin (BLG) · $40/sample There are two genes that have been associated with • PG – Prolonged Gestation (recessive Beta·lactoglobulin. When a sample is submitted for analysis, the results will be reported AA, AB • PT – Pink Tooth (Porphyria) (recessive) or BB. In this case, AA is considered the most favorable, AB is intermediate and BB is the least • RC – Red hair color (recessive) favorable. • B/R – Black/Red (recessive) • TR – Tested free of red hair color

Dr. Maróti-Agóts Ákos 5 Genetic diseases 10/9/2019 10:43 PM

Lethal white foal syndrome (LWFS)

• TC→AG mutation of the endothelin-B receptor gene changes horse isoleucine to lysine genetic disorders and tested genes • This congenital anomaly is characterized by a white coat color and aganglionosis of the bowels, congenital malformation of the enteric nervous system: Hirschsprung disease

• Foals homozygous carryer, born completely or almost totally white, and die within days of birth from complications due to intestinal abnormalitie

Occurrence: American Paint Horses, American Miniature Horses, Half- Arabians, and some Thoroughbreds

result from mating overo x overo paint horses ("frame" overo).

Lethal white foal syndrome (LWFS)

LWFSFREE GTTCGTGCTGGGCATCATCGGAAACTCCACACT

LWFSCARRY GTTCGTGCTGGGCATCAAGGGAAACTCCACACT

https://www.youtube.com/watch?v=YJ3-9KvoB-g

Dr. Maróti-Agóts Ákos 6 Genetic diseases 10/9/2019 10:43 PM

Lethal whiteLethal whitefoalfoalsyndromesyndrome (LWFS) (LWFS) Lethal white foal syndrome (LWFS)

Digested and undigested DNA bands are indicated by arrows (the third DNA WORD OF CAUTION: band, seen at the top, is the result of Just because a foal is born pure white, heteroduplex DNA from heterozygotes, DO NOT DESTROY IT RIGHT AWAY, ASSUMING IT IS A LETHAL produced in the PCR reaction primed with WHITE!! ps2/hex1) Perfectly healthy, 100% normal and fully-functional Maximum White Sabino and Tovero foals look just like Lethals at birth, and they come from the Overo complex of pinto patterns just as Lethals do, but there is nothing wrong with them. Maximum White Sabino foal

Give a white foal a chance.

Hyper-kalaemic periodic paralysis (HYPP) Hyper-kalaemic periodic paralysis (HYPP)"Impressive syndrome" C→G transversion leads to a phenylalanin to leucin substitution in the 4th transmembrane domain of the sodium channel of the muscle. This leads to an increased sodium permeability accross the skeletal muscle membrane. Affected animals suffer from periodic weakness or paralysis accompanied by increased serum potassium concentrations.

Inheritance: autosomal dominant Occurrence: Quarter Horse (Stallion Impressive) , Paint, Appaloosa.

https://www.youtube.com/watch?v=GSLRhaRxFDU

Signs that you may see during an attack of HYPP SCID - severe combined immune-deficiency disease • Muscle trembling The SCIDS mutation is caused by a 5 base-pair deletion in the genetic sequence necessary for • Prolapse of the third eyelid - this means that you may note the third eyelid flickering the production of the protein kinase that is used in DNA repair. across the eye, or covering more of the eye than normal The absence of protein kinase activity adversely affects the immune system allowing • Generalized weakness infections to consume the body. • Weakness in the hind end - the horse may look as though it is 'dog-sitting' • Complete collapse • Abnormal whinny - this is because the muscles of the voicebox are affected as well as other muscles

HYPP Survival Guide The American Quarter Horse Journal

Dr. Maróti-Agóts Ákos 7 Genetic diseases 10/9/2019 10:43 PM

SCID - severeSCID - severecombinedcombined immuneimmune-deficiency-deficiencydisease disease SCID - severeSCID - severecombinedcombined immuneimmune-deficiency-deficiencydisease disease • In Arabian Horses SCID is an autosomal recessive disease • In Arabian Horses SCID is an autosomal recessive disease • pneumonia or an opportunistic infection • pneumonia or an opportunistic infection • all SCID-affected foals die within several months of birth. • all SCID-affected foals die within several months of birth. • The major and most important implication is that now there is no • The major and most important implication is that now guesswork in avoiding SCID offspring there is no guesswork in avoiding SCID offspring • Test with PCR – RFLP method • Test with PCR – RFLP method

Horse coatCoat ColorcolorDNA inheritancetest for Equine Breeds- genotyping Genotype Coat Color Socrative EEAA Bay/Wild Bay EeAA Bay/Wild Bay Tormay2, passwd: Univet2017 EEAa Bay/Wild Bay EeAa Bay/Wild Bay

eeAA Red (Chestnut/Sorrel)

eeAa Red (Chestnut/Sorrel)

eeaa Red (Chestnut/Sorrel)

EEaa Black Eeaa Black

five minute break! sheep & goat genetic disorders and tested genes

https://www.the-scientist.com/news- opinion/chinas-first-cloned-kitten--garlic-66400

Dr. Maróti-Agóts Ákos 8 Genetic diseases 10/9/2019 10:43 PM

Haemophilia A HEMA (F8C) Chr. Xq24-q33 Spider Lamb Syndrome (SLS) •recessive disorder, hereditary chondrodysplasia •Blood clotting factor VIII (F-VIII) coagulopathy •skeletal deformities in young lambs: lambs are normal at birth but quickly develop limb extensive subcutaneous and intramuscular hematomas especially in the deformities. muscle of the hind legs and in m. psoas minor or m. iliopsoas and spontaneous hemarthrosis, mainly in the weight bearing joints.

Diagnosis: indirect, • Msp I RFLP (restriction fragment length polymorphism) in the F- VIII gene is linked to the syndrome (no recombination events detected).

Booroola Fecundity Gene Test FecB

The single gene inheritance of the high litter size of the Booroola Merino”.

• “B+” or heterozygote while double copy animals are also known as “BB” or homozygote. • A single copy of the Booroola gene increases ovulation rate, on average, by 1.6 ovulations per cycle. • Two copies of the Booroola gene increase average ovulation rate by 3.2 ovulations per cycle.

BB or Double copy B+ or Single copy ++ or Non-carrier

https://www.youtube.com/watch?v=b8tkOPAY56g

Callipyge CLPG Chr. 18 Scrapie Resistance Calli = beautiful, pyge = buttocks. Transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative diseases in sheep and goats (scrapie), cattle (bovine spongiform encephalopathy [BSE]), and humans Muscular hypertrophy is associated with extensive muscling of the loin and hindquarters. (Creutzfeldt-Jakob disease [CJD]). Affected muscles: m. longisimus dorsi, m semiten-dinosus, m. gluteus medius. SCRAPIE, in its experimental and natural forms, is closely •Mode of inheritance: polar overdominace and paternally imprinted. Associated with both the PrP protein and its encoding gene. • Only heterozygous animals which inherited the CPLG allele from the father express the The protein forms abnormal and characteristic deposits in callipyge phenotype. These animals overexpress DLK1 and PEG11 (cis, paternally the brains of affected animals and, before the disease is expressed). Expression of GTL2, MEG8 (maternally expressed). manifest, is, in its polymorphic or variant forms, associated with the incidence of both experimental and natural scrapie. Polimorphic sites of PrP protein: 136 alanin(A, GTC)/valin(V, GCC) 154 arginin(R, CGT)/hisztidin(H, CAT), 171 arginin(R, CGG)/glutamin(Q, CAG)/ hisztidin(H, CAT)

Dr. Maróti-Agóts Ákos 9 Genetic diseases 10/9/2019 10:43 PM

Percentage of genotypes found in each breed from the sheep tested under the Rare Breeds Genotype Survey and Ram Genotyping Schemes. (2003) pig genetic diseaes and tested genes

56

Malignant hyperthermia, stress myopathy Malignant hyperthermia, stress myopathy Chr. 6 q11-q21 Chr. 6 q11-q21 •The halothane-sensitive variant of this gene causes porcine stress syndrome (PSS) and pale soft exudative (PSE) meat, as well as malignant hyperthermia on exposure to the gas halothane. • mutated form of "ryanodine receptor calcium release channel" (Ry1). normal 5GTTCCCTGTGTGTGTGCAATGGTGTGGCCGTGCGCTCCAACCAAGATCTCATTACTGAGAACTTGCTGCCTGGC3 • It also gives higher lean percent. forward • Test PCR-RFLP 5’-GTTCCCTGTGTGGCAATGGTG- 3’ 5GTTCCCTGTGTGTGTGCAATGGTGTGGCCGTGTGCTCCAACCAAGATCTCATTACTGAGAACTTGCTGCCTGGC3 and reverse 5’-ATCTCTAGAGCCAGGGAGCAAGTTCTCAGTAAT-3 mutant

57 58

Congenital progressive ataxia (CPA) Chr 3 Oedema disease, post-weaning diarrhoea FUT1 Chr. 6q11 Neuropathic disorder with unknown etiology characterized by A 307 G→ A transition in the Fut1 gene leads to an amino acid spastic gait, incoordination and rapidly progressive ataxia in the substitution at position 103 (Ala→Thr). hind limbs. As a consequence the fucosyl-transferase 1 is less active and receptors mediating the binding to the E. coli fimbriae Diagnosis: indirect by F18, are not expressed in the small intestine (resistant microsatellites Sw902 (189 bp- animals). allele, 0% recombination) Occurrence: various Landrace breeds, Large White, and Sw1066 (5%). Hampshire, Piétrain, Duroc

Occurrence: Large White.

59 60

Dr. Maróti-Agóts Ákos 10 Genetic diseases 10/9/2019 10:43 PM

Vitamin C deficiency GULO Chr. 14 Myogenin (MYOG)

Deletion of exon 8 (77 bp) of the L-gulono-gamma-lactone oxidase gene • thinner fat and lower fat content leads to a frame shift after 236 amino acids followed by 120 altered amino acids. • higher meat deposition in loin, ham and carcass TEST: PCR -RFLP •Test: PCR-RFLP The peptide is truncated and inactive. Homozygote animals suffer from scurvy, if they are not supplemented with 30 mg vitamin C /kg of body weight. Occurrence: Danish Landrace-Yorkshire crossbreed, Duroc

61 62

estrogen receptor (ESR) gene polymorphism

•located at the end of the first chromosome •the gene in homosygous form increase the size of a litter dog genetic diseases and tested genes Test: PCR - RFLP forward primer 5′-CCT GTT TTT ACA GTG ACT TTT ACA GAG-3’ reverse primer 5′-CAC TTC GAG GGT CAG TCC AAT TAG-3′.

PvuII restriction

The above process produced one band on agarose gel at the level of 120 bp, i.e. ESR/PvuII AA genotype or three bands of 120, 65 and 55 bp E strogen receptor ESR/PvuII AB polymorphism in Landrace genotype, respectively as compared with pigs and its association the pUC19/ Mspl molecular marker (Figure 1). with litter size performance 63 64 Noguera2003

Inherited Diseaes in Dogs database Copper toxicosis in Bedlington Terrier

•Comments: Article04: GUIDE TO CONGENITAL AND HERITABLE DISORDERS IN Copper accumulation in liver hepatocytes throughout life. DOGS.pdf Inflamation and degeneration in area of Cu accumulation. Breed dispositions: Can be controlled by restricting Cu intake. Basenji: 27, 56, 59, 66, 124c, 146, 166, 171, 172, 192, 194, 245, 256,263, 268, 270, 312, Presentation may be progressive or acute after stress (dogs die 318 Basset hound: 5, 9, 9a, 15, 24a, 27, 31, 61a, 70, 94, 103, 105, 109, 114, 120, 121, 131, 135, after 2-4 day illness). 136, 140, 146, 147, 157, 159a, 160b, 166,168, 169, 170, 171, 173, 174, 186, 190, 192, 193, 196, 221, 221a, 222,226, 231, 235, 245, 249, 250, 256, 273a, 274, 291, 299, 311, 312, 318, •Diagnosis: DNA testing 330, 332 •Inheritance Beagle: 10, 11, 21, 34, 37, 42, 43, 54, 55, 65, 72, 80, 88, 94a, 109, 114, 120, 121, 135, 136, 146, 147, 150, 157, 166, 168, 173, 182, 188a, 192, 193a, 202, 204, 212, 220, 227, 242, 245, Autosomal recessive. Mutation is at CFA 10q26 256, 260, 267, 270, 275, 280, 310, 312, 327, 330 Although the splice site alteration appears to be a normal variant, it is Bearded collie: 9a, 16a, 27, 42, 65, 146, 152, 159a, 166, 192, 239, 245, 256, 269, 270, 286, reported in two affected dogs, which do not carry homozygous deletions 303, 311a, 312 of COMMD1. Bedlington terrier: 2, 23, 32a, 42, 52a, 64, 88, 94, 184, 199, 210, 223, 256, 265, 266, 269, •DNA test: Vetgen; Animal Health Trust; VetDNAcenter 270 Belgian malinois: 109, 152, 166, 256 References Hardy RM, Stevens JB, Stowe CM (1975). Chronic progressive hepatitis in Bedlington Terriers associated with elevated liver copper concentrations. 65 Minnesota Veterinarian 15: 13-24. 66 Johnson GF, Sternlieb I, Twedt DC, Grushoff PS, Scheinberg I. (1980) Inheritance of copper toxicosis in Bedlington terriers. Am J Vet Res. 41(11):1865-6. ; online abstract

Dr. Maróti-Agóts Ákos 11 Genetic diseases 10/9/2019 10:43 PM

Urate urolithiasis •Breed: Dalmatian

•Comments Defective purine metabolism results in elevated urate in serum and hyperuricosuria. The prevalence of the disease was 34% (24.99-43.70%) among male Dalmatians over 6 years old in one survey. There is a much greater risk in males (OR >13). Uricase is functional. Defect in liver not kidney. •Therapy: Correctable by hepatocyte transplantation. •Inheritance 17:57 Defective purine metabolism is an autosomal recessive trait shared by all Pedigree Dogs Exposed Three Years on. Dalmatians. However only a proportion show disease.The heritability for clinical manifestation of urate calculi within the breed has been estimated to be .87 (.75-.96). Hyperuricouria itself has been mapped in a dalmatian pointer backcross. Maps to CFA03 -confidence interval: REN153P03 - 67 FH2858.

Sensorineural deafness Waardenburg Canine Stress Syndrome – Canine Malignant Hyperthermia

Breed: Dalmatian Breed: Greyhounds, Labrador Retriever, Golden Retriever

Comments SNP C→G Cochleo-saccular degeneration. Hearing loss starts at 4 • Like the PSE in swine weeks (normal development before this). Higher frequencies in blue eyed dogs and in individuals • Test: sequencing without dark ear patches.

Inheritance • “extreme white piebald” wW/sW. Piebald alleles sP and sW are associated with deafness This recessive major gene segregates in dogs of both blue and brown eye colour, and with and without pigmented coat patches.

References Lurie, M.H. (1948). The membranous labyrinth in the congenitally deaf Collie and 69 70 Dalmatian dog. Laryngoscope 58: 279-287

Canine Canine Leukocite Adhesion Deficiency Canine Leukocite Adhesion Deficiency • SNP • Like the BLAD in cattle • test: sequencing • Breed: Irish Setter

71 A Missense Mutation in the b-2 Integrin Gene (ITGB2) Causes 72 Canine Leukocyte Adhesion Deficiency

Dr. Maróti-Agóts Ákos 12 Genetic diseases 10/9/2019 10:43 PM

Progressive Retinal Atrophy Dobermannok narkolepsziája idegrendszeri megbetegedés, amely a napközben, jellemzően • autosomal recessive aktivitások közben jelentkező alvás rohamokban nyilvánul meg • irreversible, inherited blinding disease, has several forms •Autoszómális-rezesszív • rod-cone dysplasia 1, or rcd1. •Pups begin showing signs of night-blindness by 6 weeks of age, and •Das Tier leidet unter Schlafattacken, Kataplexie und Schlaf- by 1-2 years of age most affected dogs are completely blind. lähmung, welche teilweise dem REM-Schlaf ähnelt. BREED TYPE OF PRD AGE OF ONSET •Mutation in dem Gen für den Hypocretin (Orexin) Rezeptor 2. Collie rod-cone dysplasia under a year Irish Setter rod-cone dysplasia under a year Cairn Terrier rod-cone dysplasia under a year Miniature LH rod-cone dysplasia under a year Dachshund Norwegian Elkhound rod dysplasia, cone degeneration 2 to 3 years Samoyed rod-cone degeneration 3 years Cocker Spaniel rod-cone degeneration 2 to 7 years Miniature Poodle rod-cone degeneration 6 mo. to 5 years Miniature Schnauzer rod-cone degeneration 3 to 6 years 73 74 Akita rod-cone degeneration 3 to 6 years

Homologue genetic disease

https://www.youtube.com/watch?v=uh8o57-okRQ http://omia.org/results/?query=narcolepsy&search_type=simple

Canine Leukocyte Adhesion Irish Setter, Irish Red and White Setter Optigen Deficiency (CLAD) Negative aspects of current breeding practices

Cone Degeneration German Shorthaired Pointer Optigen Congenital Stationary Night „Peripheral traits have now become important. Breeders often devote more energy to refining Briard Optigen Blindness (CSNB) the quality and colour of their dogs' coats than to caring for the health of the wearers. Selecting for colour has resulted in some changes that can be extremely unweleome. For example, there appears Copper Toxicosis Bedlington Terrier VetGen to be an association between coat colour and aggression in selfcoloured Cocker Spaniels Cystinuria Newfoundland PennGen, Optigen, Veterinary Diagnostics Center, VetGen, Healthgene (Podberscek & Serpell 1996); and there is definitely an association between pigmentation and Dr. David Wenger Dept of Neurology Cairn Terrier, West Highland White Terrier Jefferson Medical College neurological defects, eg deafness and eye disorders in merle dogs, in which both homozygotes and Globoid Cell Leukodystrophy 1020 Locust St, 394 Philadelphia, PA 19107 heterozygotes are affected (Klinckmann et al 1986). Breeding for hypo-pigmentation is a Narcolepsy Dachshund, Doberman Pinscher, Labrador Retriever Optigen questionable strategy. Phosphofructokinase Deficiency American Cocker Spaniel, English Springer Spaniel, Mixed Breeds Optigen, VetGen, PennGen, Healthgene, Veterinary Diagnostics Center

Progressive Retinal Atrophy Irish Setter Optigen, VetGen, Healthgene As far as behaviour is concerned, motor patterns that are favoured can sometimes be overselected. American Eskimo Dog, Australian Cattle Dog, Bullmastiff, Cardigan Welsh This can give rise to compulsive tendencies, eg Border Collies have been selected to 'show eye' Corgi, Chesapeake Bay Retriever, English Cocker Spaniel, Entlebucher Mountain Dog, Irish Red and White Setter, Irish Setter, Labrador Retriever, (stare) and many now demonstrate a fixed stare at blank walls. While self-nareotization (Dodman et Optigen Progressive Retinal Atrophy Mastiff, Miniature Poodle, Miniature Schnauzer, Nova Scotia Duck Tolling al 1998) may mask the true extent of a welfare problem, such repetitive behaviours (sometimes Retriever, Portuguese Water Dog, Toy Poodle, Samoyed, Siberian Husky, Sloughi termed stereotypies) can interfere with the animal's normal behavioural repertoire and, in extreme

Pyruvate Kinase Deficiency Basenji, West Highland White Terrier Optigen, VetGen, PennGen, Healthgene, Veterinary Diagnostics Center cases, prompt euthanasia (Overall 1997).”

Renal Dysplasia Lhasa Apso, Shih Tzu, Soft Coated Wheaten Terrier VetGen Bernese Mountain Dog, Doberman Pinscher, Kerry Blue Terrier, Manchester Von Willebrand's Disease Terrier, Papillon, Pembroke Welsh Corgi, Poodle, Scottish Terrier, Shetland VetGen Sheepdog Artice06: „Some practical solutioms to Wellfare Problems in dog breeding” 77 solutionbreeding.pdf 78

Dr. Maróti-Agóts Ákos 13 Genetic diseases 10/9/2019 10:43 PM

Manx - taillessness Manx The gene for taillessness (M) is a dominant mutation of the m gene which cat stands for "normal tail„ genetic disorders and tested genes • homozygous for taillessness (MM) are born dead (lethal factor). There are three types of Manx cats: •the rumpy, which has absolutely no tail, M •the riser (or rumpyriser) which has a few vertebrates that can be seen or felt as an upright projection,M and •the stumpy, which has an extremely short, often kinked tail, also seen in the Japanese Bobtail. mm

„Need a test for genotyping the manx gene or not?”

79 80 stumpy

PKD - Polycystic Kidney Disease Polycystic Kidney Disease •Autosomal Dominant Polycystic Kidney Disease (PKD) is a progressive, inherited disease which causes multiple fluid filled cysts on the kidneys of Persians/Exotic cats & breeds •Cysts are present from birth •Cysts can range from very small to several centimetres in diameter - causing kidney failure. •Ultrasound: Ultrasound diagnosis is 98% accurate after approximately 10 months of age. •DNA test

normal PKD

81 https://www.youtube.com/watch?v=FWuQ_OMI3j4

Familial Hypertrophic Cardiomyopathy in Hypotrichosis (hairlessness) Maine Coon • dominant and recessive forms exist 1. Hypertrophic Cardiomyopathy • Breeds: Sphynx, Donskoy, Peterbald and others autosomal dominant Hairless cats generally have a fine down that may be lost as the animal ages. 2. After identifying a reduction in the cMyBP-C protein in affected cats, we identified a mutation in the feline gene Cats in Canada (Sphynx), France and England each had different recessive that is predicted to alter the protein mutations. conformation of this gene and results in A form noted in Hawaii also lacks hair follicles. sarcomeric disruption. Some Rex cats are prone to temporary hairlessness, termed "baldness" myosin binding protein C (MYBPC3) to differentiate it from true hairlessness, during moulting. gene

83 84 AdamG_TDK.pdf

Dr. Maróti-Agóts Ákos 14 Genetic diseases 10/9/2019 10:43 PM

Patients affected by genetically diseases should not Socrative be used for breeding! Tormay2, passwd: Univet2017

86 Give a chance for the next, healthy generation!

Thanks for your attention! Jacob sheep – four horn

Dr. Maróti-Agóts Ákos 15