Cloning of Oligopeptide Transport Carrier Pept1 and Comparative

Published August 30, 2016

Cloning of oligopeptide transport carrier PepT1 and comparative analysis of PepT1 messenger ribonucleic acid expression in response to dietary nitrogen levels in yak (Bos grunniens) and indigenous cattle (Bos taurus) on the Qinghai–Tibetan plateau1

H. C. Wang,*2 F. Y. Shi,*3 M. J. Hou,* X. Y. Fu,* and R. J. Long†

*State Key Laboratory of Pastoral Agricultural Ecosystem, College of Pastoral Agriculture Science and Technology, Lanzhou University, Lanzhou 730000, P.R. China; and †International Centre for Tibetan Plateau Ecosystem Management, Lanzhou University, Lanzhou 730000, P.R. China

ABSTRACT: The gastrointestinal lumen can directly sites (Ser271 and Thr359), and 3 intracellular putative absorb all di- and tripeptide protein degradation prod- protein kinase C sites (Ser252, Ser266, and Ser357). The ucts, and oligopeptide absorption depends on the specific yPepT1 AA sequence was 99, 95, 86, and 83% identical peptide transport carriers, which are located in gastroin- to PepT1 from cattle (B. taurus), sheep (Ovis aries), pigs testinal epithelial cells on the brush border membrane. (Sus scrofa), and humans (Homo sapiens), respectively. Yak (Bos grunniens) use N more efficiently than cattle The relative PepT1 mRNA expression for indigenous do, which implies that yak have a specific mechanism cattle was greater than yak in the rumen, omasum, duo- of nonprotein utilization including a peptide absorption denum, ileum, and liver (P < 0.001); however, it was mechanism. However, this mechanism has not been lower in jejunum tissue (P < 0.01). The relative PepT1 clarified. Our objective was to explore whether yak mRNA expression in response to increasing dietary N possess any adaptive mechanisms of peptide absorp- for both genotypes were linear in the rumen and jeju- tion to survive in the harsh foraging environment of the num (P < 0.10); quadratic or cubic in the reticulum (P < Qinghai–Tibetan plateau. Twelve castrated males of each 0.01); linear or quadratic in the duodenum, ileum, and of 2 genotypes, yak (B. grunniens) and indigenous cattle liver (P ≤ 0.01); and linear, quadratic, or cubic in the (Bos taurus), were fed diets of various N levels. The yak omasum (P < 0.001). Moreover, there were signifi- PepT1 (yPepT1) cDNA was cloned in omasum epitheli- cant interactions between genotype and dietary N in al tissue. Our results showed that the full-length yPepT1 rumen, reticulum, omasum, duodenum, jejunum, ileum, cDNA contains 2,805 bp, and a 2,121-bp open reading and liver tissues. In conclusion, the PepT1 profile and frame encodes a putative protein of 707 AA residues. The expression in gastrointestinal epithelial cells of yak var- yPepT1 AA sequence identified 5 putative extracellular ied from those of cattle, implying that yak have evolved N-glycosylation sites (Asn406, Asn434, Asn438, Asn498, a peptide transport mechanism to adapt the environment and Asn508), 2 putative intracellular protein kinase A of the Qinghai–Tibetan plateau. Key words: cattle, cloning and expression, dietary nitrogen level, PepT1, yak

© 2016 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2016.94:3431–3440 doi:10.2527/jas2016-0501 1Financial support from the National Youth Natural Science Foundation of China (31302001), Changjiang Scholars and Innovative INTRODUCTION Research Team in University, System Coupling and Management of Grassland Agro-Ecosystem (PCSIRT), and Fundamental There are 14 million yak (Bos grunniens) and fewer Research Funds for the Central Universities (lzujbky-2016-1) indigenous cattle (Bos taurus) and their crossbreeds in are gratefully acknowledged. We appreciate the valuable help the environment of the Qinghai–Tibetan plateau, and from colleagues of the International Centre for Tibetan Plateau they are largely dependent on the native grassland for Ecosystem Management and from Jianwei Zhou, Li Wang, and survival. Yak have evolved some genetic mechanisms Chongliang Zhong for sampling assistance. to adapt to low oxygen and seasonal nutrition stresses 2 Corresponding author: [email protected] (Qiu et al., 2012). Moreover, Long et al. (1999) spec- 3 The author contributes equally to this work with the first author. ulated that yak can efficiently use N under malnutri- Received March 25, 2016. tion conditions, which was later confirmed (Long et Accepted June 1, 2016. 3431 3432 Wanget al. al., 2004, 2005; Wang et al., 2009a, 2011a,b; Guo et al., Table 1. Ingredient and chemical composition of 2012). Previous studies showed that the gastrointestinal experimental diets lumen can directly absorb some di- or tripeptide protein Dietary N, g/kg DM degradation products (Newey and Smyth, 1960; Daniel, Item 10.3 19.5 28.5 37.6 2004; Daniel et al., 2006; Vig et al., 2006), and the oli- Ingredient, % DM gopeptide absorption depends on the peptide transport Naked barley straw 50.0 50.0 50.0 50.0 carrier PepT1, which is located in gastrointestinal epi- Soybean meal 0.0 2.5 5.0 7.5 thelial cells on the brush border membrane (Fei et al., Corn gluten meal 0.0 8.3 16.7 25.0 1994; Pan et al., 2001; Klang et al., 2005). PepT1 mRNA Corn 30.5 20.3 10.2 0.0 Wheat middling 5.0 3.3 1.7 0.0 expression is regulated by many factors, especially the Cottonseed meal 0.0 1.0 3.0 4.5 source and level of dietary N. When fed diets with dif- Corn starch 12.5 11.8 11.0 10.3 ferent N content, peptide concentrations in the gastro- Cottonseed oil 0.5 0.8 1.0 1.3 intestinal tract of calves (Danilson et al., 1987), dairy CaHPO4 0.5 0.5 0.5 0.5 cattle (Chen et al., 1987), and sheep (Jayawardena and Premix1 0.5 0.5 0.5 0.5 Webb, 1999) are different. Dietary N can significantly NaCl 0.5 0.5 0.5 0.5 affect PepT1 mRNA expression in chickens (Chen et Nutrient levels,2 % DM al., 2005), grass carp (Liu et al., 2013), and lactating ME, MJ/kg DM 8.4 8.3 8.3 8.3 goats (Liu et al., 2010). However, there have been no CP3 6.4 12.2 17.8 23.5 reports on the PepT1 profile, expression, and regulation OM 93.8 93.5 93.2 92.9 in yak to explain their more efficient mechanism of N Ash 6.2 6.5 6.8 7.1 utilization. To explore whether yak possess any adaptive NDF 67.6 65.7 64.1 62.4 ADF 25.6 27.5 29.2 30.9 mechanisms of peptide absorption and regulation to sur- 1 vive in the harsh foraging environment, 2 experiments The premix contained (per kg DM) 1,225 mg CuSO4, 3,519 mg ZnSO4, 4,080 mg FeSO , 3,561.6 mg MnSO4, 543.4 mg KI, 82 mg Na SeO , 4.8 were conducted: the full-length yak PepT1 (yPepT1) 4 2 3 mg CoCl2, 6,000 mg monensin, 500,000 IU vitamin A, 200,000 IU vitamin cDNA was cloned, and the differences in PepT1 mRNA D3, and 2,000 IU vitamin E. expression between yak and indigenous cattle were de- 2ME was calculated according to Tables of Feed Composition and termined under diets with different N levels. Nutritive Values in China(Xiong et al., 2013); others were measured values. 3Calculated as N × 6.25. MATERIALS AND METHODS libitum access to water. Following the feeding trial, the The Animal Ethics Committee of Gansu Province, animals were slaughtered and tissues were evaluated. P.R. China, approved the experimental protocols. Animals were slaughtered in our meat lab on the morning of d 31 of the feeding experiment, and all ani- Experiment Design and Sample Collection mals were fasted for 1 d prior to slaughter. All animals were stunned by a captive bolt pistol and killed by ex- Twelve 3-yr-old castrated males of each of 2 geno- sanguination. The samples were collected according to types, yak (198 ± 15 kg average BW) and indigenous the procedure by Chen et al. (1999). All tissue samples cattle (203 ± 5 kg average BW), were selected from the were taken from the same location in each animal. We Wushaoling pasture farm located in the alpine meadow cut open the entire stomach along the dorsal line, emp- grassland of the Tianzhu Autonomous County, Gansu tied the stomach contents, and then removed the fun- province, at 37°12′ N, 102°52′ E, and used as experi- dic region of the rumen, reticulum, and omasum and mental animals. The yak graze year-round, whereas the washed the tissues with ice-cold 0.9% saline. Rumen, indigenous cattle are fed indoors in winter and early reticulum, and omasum epithelial tissues were peeled spring on the Qinghai–Tibetan plateau. Before the feed- from the underlying and connective tissues. The ab- ing experiments, all animals had free access to oat hay omasum and intestinal sections, including the duode- for a 15-d period followed by a feeding trial. Each gen- num, jejunum, ileum, cecum, and colon, were cut along otype was first divided into 4 groups, and 3 animals of the dorsal line, and the contents were emptied. The each genotype were fed 1 of 4 experimental diets with fundic region of these tissues was then removed and different N levels: 10.3, 19.5, 28.5, or 37.6 g N/kg DM washed with ice-cold 0.9% saline, and the epithelium (Table 1). Therefore, the experiment used a 2 × 4 facto- was scraped using a glass slide. The collected duode- rial arrangement of treatments. During the feeding trial num tissue was the first 1 m of the small intestine begin- period, the animals were fed 3 kg of the experimental ning at the pyloric sphincter; the ileum tissue was the diet daily, half at 0800 h and half at 1800 h. All animals distal 1 m portion of the small intestine that ended at the were individually housed in metabolism crates with ad ileocecocolic junction. About 1 m from the middle of Yak PepT1 cloning and expression 3433

the small intestine was taken as the jejunum tissue. The Table 2. Rapid amplification of cDNA ends (RACE) colon and cecum tissues were taken starting from the and real-time quantitative PCR primers ileocecocolic junction. The liver was also sampled. All Primer Sequence 5′– 3′ Purpose the tissues and scrapings were quickly frozen in liquid 5′-GSP2 CCATCATGGTTGAAGTCCGTGAGGTC 5′ RACE N and later stored at −80°C. Part of the yak omasum 5′-GSP1 GGAGAGCGCCACGTGCACAGAA 5′ RACE epithelium sample was used for cloning the full-length 3′-GSP1 CTACCTTGGATTTGGTAGCGCGTTTACC 3′ RACE PepT1 cDNA, and all tissue samples were used for the 3′-GSP2 TTTCGAAGACATCTCCCCCAACACAGT 3′ RACE relative PepT1 mRNA expression analysis. PepT1-sense ATGGCCTTAACCAGAAGCCAGA Real time PepT1-antisense TCACTGGCATTGTGACTGGAGAC Real time 18S-sense CAACACGGGAAACCTCACC Real time Ribonucleic Acid Isolation and 18S-antisense CCCAGACAAATCGCTCCAC Real time First-Strand cDNA Synthesis

Total RNA was isolated from the rumen, reticulum, Quantification of mRNA by Real-Time PCR Analysis omasum, abomasum, duodenum, jejunum, ileum, cecum, colon, and liver tissues using an RNA extraction Real-time PCR was determined by Applied kit (Takara, Shiga, Japan). The quantity of RNA was de- Biosystems 7500 quantitative PCR (Applied Biosystems, tected by a NanoDrop 2000 spectrophotometer (Thermo Foster City, CA). 18S RNA was used as an endogenous Scientific, Wilmington,DE) and the purity assessed by control to normalize target gene transcript levels. The the ratio of absorbance value at 260 nm to its at 280nm cDNA was diluted to 50 μg/μL before all real-time PCR (A260/A280 ratio). The RNA integrity was assayed by analyses. The same primer for yak and indigenous cattle 1.5% agarose gel containing 1 pg/mL ethidium bromide. was designed with Primer 5.0 (Table 2). Real-time PCR The first-strand cDNA was synthesized using 3 μg total was completed using SYBR Premix Ex Tap II (Takara) RNA, 1 μL oligo dT, 1 μL deoxyribonucleotide triphos- containing MgCl2, deoxyribonucleotide triphosphates, phate mixture, and water to 10 μL; incubated at 65°C and HotStarTaq polymerase and 1 μL each of the for- for 5 min; and cooled on ice. Then, 4 μL 5x PrimeScript ward and reverse primers, and 12.5 μL SYBR Premix II buffer (Takara), 0.5 μL ribonuclease inhibitor, 1 μL Ex Taq II (Takara) and 2 μL of cDNA template were PrimeScript II RTase (Takara), and water were added to added to a 25-μL total volume; the final concentrations 20 μL and the reaction was extended for 50 min at 42°C, of cDNA and 18S RNA primer were 4 ng/μL and 0.4 inactivated at 95°C for 5 min, and stored at −80°C. μmol/L, respectively. A no-template (sterile distilled water) negative control was added on each plate run to Cloning Full-Length Yak PepT1 cDNA screen for possible contamination and dimer formation and to set background fluorescence for plate normaliza- The primers for the yPepT1 cDNA sequence were de- tion. Real-time PCR was initiated with 30 s of denatur- signed using Primer 5.0 (PREMIER Biosoft International, ation at 95°C followed by 40 cycles of amplification at Palo Alto, CA) based on cattle (NM_001099378) and sheep 95°C for 5 s and 60°C for 30 s. A melting curve was (NM_001009758) PepT1 cDNA sequences. The PCR produced from 60°C to 95°C to confirm the specificity primers were forward 5′-CCCCTTGAGCATCTTCTT-3′ of the amplified product. Each amplification was dupli- and reverse 5′-GGAGTCTAGCTTGGCGTAT-3′. The cated (Cycle threshold [Ct] values ranged from 21.34 yPepT1 cDNA from omasum epithelium tissue was am- to 31.55) and the mean value was calculated using the plified by conventional PCR. The PCR conditions were ΔΔCt method (Livak and Schmittgen, 2001), the relative 94°C for 5 min, 30 cycles of 98°C for 10 s, 54.5°C for 30 s, PepT1 mRNA expression was calculated as R = 2−ΔΔCt, and 72°C for 1 min. The PCR products were separated by and all the relative PepT1 mRNA expression in yak ru- electrophoresis on a 1.5% agarose gel. The DNA products men tissue (10.3 g N/kg DM) was used as calibrator for were cloned into pMD18-T (Takara) and then sequenced. all the other relative PepT1 mRNA expression. After obtaining the central core sequence of yPepT1, the full-length cDNA was isolated using the SMART RACE Bioinformatics Analysis cDNA amplification kit (Clontech Laboratories, Inc., Palo Alto, CA). Specific nested PCR primers were de- The AA sequences were analyzed using the open signed based on the partial sequences (Table 2). For 3′ reading frame finder program from the National Center rapid amplification of cDNA ends (RACE), 2 amplifica- for Biotechnology Information (http://www.ncbi.nlm. tions were performed under the same conditions: 94°C for nih.gov/gorf/gorf.html; accessed September 19, 2015). 30 s, 58°C for 30 s, and 72°C for 1 min for 33 cycles. For Amino acid sequences were aligned with the multiple 5′ RACE, the amplification conditions were 94°C for 30 s, alignment program of the biological analysis soft- 68°C for 30 s, and 72°C for 1 min for 33 cycles. ware DNAman (Lynnon Corporation, Pointe-Claire, 3434 Wanget al.

QC, Canada). The phylogenetic tree was constructed the sixth and seventh transmembrane domains, and a using MEGA 6.0 (Terova et al., 2009). TMHMM large extracellular loop of 203 residues between the 9th Server2.0 software (http://www.cbs.dtu.dk/services/ and 10th transmembrane domains. It was predicted to TMHMM-2.0; accessed September 19, 2015) was used contain 5 putative extracellular N-glycosylation sites to predict transmembrane domains of PepT1. PROSITE (Asn406, Asn434, Asn438, Asn498, and Asn508), 2 pu- 20.40 computational tools (http://www.expasy.org/ tative intracellular protein kinase A sites (Ser271 and prosite; accessed September 19, 2015) were used to Thr359), and 3 intracellular putative protein kinase C predict the potential N-glycosylation sites, protein ki- sites (Ser252, Ser266, and Ser357; Fig. 1). nase A sites, and protein kinase C sites. The isoelectric point (pI) was determined by Compute pI/Mw (http:// PepT1 Homology Analysis and web.expasy.org/compute_pi; accessed September 19, Construction of Phylogenetic Trees 2015). The protein molecular weight was identified by online analysis software (http://www.bio-soft.net/sms/ Analysis using the biological software DNAman prot_mw.html; accessed September 19, 2015). and MEGA 6.0 showed that the predicted yPepT1 AA sequence similarity with other species ranged from 57 Statistical Analysis to 99%, including mammalian (humans, 83%; cattle, 99%; sheep, 95%; pigs, 86%; rats, 81%; and rabbits, Data were analyzed using the MIXED procedure 79%), avian (chickens, 64%, and turkeys, 64%), and of SAS 9.2 (SAS Inst. Inc., Cary, NC) according to the fish species (carp, 58%; sea bass, 57%; zebrafish, following model: Y = μ + N + G + (N × G) + E, in which 58%; and Atlantic cod, 58%). The established phylo- Y is the dependent variable, μ is the overall mean, N is genetic tree (Fig. 2) shows that yak, cattle, and sheep the effect of dietary N level, G is the effect of cattle belong to artiodactyla, gathered into 1 group, with the genotype, N × G is the interaction between dietary N fish gathered into the other group. level and genotype, and E is the residual error. Dietary N level and genotype were fixed effects. Polynomial Effect of Dietary Nitrogen Level on PepT1 contrasts for the effect of N level as well as for the mRNA Expression in Yak and Indigenous Cattle genotype × N level interactions were used to evalu- ate treatment effects. Comparisons between genotypes As the feeding and slaughter trial described, yak within each level of dietary N were made using t tests and indigenous cattle were fed the 10.3, 19.5, 28.5, and when at least 1 contrast assessing the genotype × dietary 37.6 g N/kg DM diets, and their tissues were then ana- N level interaction was significant. These t tests were lyzed for the relative PepT1 mRNA expression by PCR performed to ensure that interpretations of the contrasts and real-time PCR. As shown in Table 3, there was a were clear. Differences were considered significant at significant difference in the relative PepT1 mRNA ex- P < 0.05, and tendencies were considered at P < 0.10. pression of rumen, omasum, duodenum, jejunum, ileum, and liver tissues between the 2 genotypes (P < RESULTS 0.05). Moreover, as dietary N content increased, the relative PepT1 mRNA expression increased in the rumen (P < 0.001). For the reticulum, omasum, duodenum, il- Molecular Characteristics of PepT1 eum, and liver, the relative PepT1 mRNA expression cDNA and AA Sequence Analysis demonstrated quadratic or cubic responses to dietary N The yPepT1 cDNA was isolated from yak omasum concentration (P < 0.05). epithelium tissue, cloned by reverse transcription PCR, Significant interactions between genotype and di- and sequenced. The full-length yPepT1 cDNA is 2,805 etary N were also detected for the relative PepT1 mRNA bp (GenBank accession code KT725253); it contains a expression in rumen, reticulum, omasum, duodenum, je- 5′-untranslated region (81 bp), a 3′-untranslated region junum, ileum, and liver tissues (linear, quadratic, or cubic (682 bp), and an open reading frame of 2,121 bp en- dietary N × genotype, P < 0.05). Moreover, when the 2 coding a putative protein of 707 AA. At the 3′ end, the genotype animals were fed the 10.3 g N/kg DM diet, the cDNA includes a polyadenylation signal (AATAAA) relative PepT1 mRNA expression was greater in oma- 14 nucleotides preceding the poly A tail. The putative sum (P = 0.02), duodenum (P < 0.01), ileum (P = 0.01), protein has a pI of 7.1 and protein molecular weight and liver (P = 0.01) tissues but lower in jejunum tissue (P of 78.4 kDa. The yPepT1 (B. grunniens) is predicted < 0.01) for indigenous cattle than for yak; when the 19.5 to adopt a putative 12-transmembrane-domain struc- g N/kg DM diet was fed, the relative PepT1 mRNA ex- ture, with intracellular amino and carboxyl termini, an pression was greater in rumen and reticulum (P = 0.02), elongated intracellular loop of 56 residues between omasum, jejunum, and liver (P < 0.01) tissues but lower Yak PepT1 cloning and expression 3435 in ileum tissue (P = 0.04) for indigenous cattle than for coupled, peptide transport carrier (Fei et al., 2000; Van yak (P < 0.05); when the 28.5 g N/kg DM diet was fed, et al., 2005) that is mainly distributed in the brush bor- the relative PepT1 mRNA expression was greater in ru- der membrane of gastrointestinal epithelial cells (Kottra men (P = 0.03), omasum (P < 0.01), duodenum and il- et al., 2002) and depends on the brush border Na+/H+ eum (P = 0.02), and liver (P = 0.01) tissues but lower in exchange system in the cells to transport small peptides reticulum tissue (P = 0.04) for indigenous cattle than for (Fei et al., 1994; Liang et al., 1995; Daniel et al., 2006; yak, and the relative PepT1 mRNA expression was great- Feng et al., 2013). It has been previously reported that er in duodenum and ileum (P < 0.01) tissues but lower in the PepT1 mRNA distribution can differ among species. jejunum tissue (P = 0.04) for indigenous cattle than for For example, it is detected in all gastrointestinal tissues yak fed the 37.6 g N/kg DM diet. for cattle (Li et al., 2008); in the rumen, omasum, and small intestine but not in abomasum, cecum, colon, and DISCUSSION liver tissues for sheep (Pan et al., 2001); in the small intestine for pigs (Klang et al., 2005); in the small intestine and cecum but not in the liver for chickens (Chen et al., The yPepT1 Sequence Profile 2002); and in the small intestine and colon but not in the The present study successfully cloned PepT1 from stomach and cecum for rabbits (Freeman et al., 1995). yak omasum epithelial tissue. The full length of yPepT1 The present study indicated that the PepT1 mRNA was cDNA (2,805 bp) is slightly longer than that of cattle (B. detected in the whole gastrointestinal and liver tissues taurus; 2,742 bp; Zimin et al., 2009); the putative protein for yak and indigenous cattle. Moreover, the results also length (707 AA residues) is the same as that for cattle showed that there was a genotype effect for the relative (B. taurus; Zimin et al., 2009), sheep (Ovis aries; Pan et PepT1 mRNA expression between yak and indigenous al., 2001), and rabbits (Oryctolagus cuniculus; Fei et al., cattle, which implied that there was different genetic po- 1994) but shorter than that for pigs (708 residues; Klang tential for gastrointestinal peptide transport. et al., 2005) and Tibetan pigs (Sus scrofa; 708 residues; Previous work has shown RUP can boost postrumi- Wang et al., 2009b). However, the predicted yPepT1 se- nal supply of protein (Sindt et al., 1993; Zinn and Owens, quence differs from the cattle sequence at 4 AA (B. tau- 1993; Scholljegerdes et al., 2004; Habib et al., 2001). rus; Zimin et al., 2009), that is, Glu258 (yak):Gln258 (cat- Moreover, Wang et al. (2011a) reported the urinary pu- tle), Asp512 (yak):Asn512 (cattle), Gln536 (yak):Pro536 rine derivative N excretion index for yak was greater than (cattle), and Ser544 (yak):Pro544 (cattle). The pI of for indigenous cattle, which implies a greater microbial yPepT1 (7.1) is lower than that of cattle (7.9; Zimin et protein supply for yak. The present data showed that the al., 2009) but greater than that of sheep (6.6; Pan et al., relative PepT1 mRNA expression was greater in rumen, 2001). The topology of the yPepT1 transmembrane do- omasum, duodenum, and ileum tissues of indigenous main (12), except for pigs (S. scrofa; 13; Klang et al., cattle than yak fed the diets in which N level ranged from 2005), is the same as other species (O. cuniculus [Fei 10.3 to 37.6 g N/kg DM. However, it was interesting that et al., 1994], Homo sapiens [Liang et al., 1995], Rattus the relative PepT1 mRNA expression was greater in yak norvegicus [Satio et al., 1995], Mus musculus [Fei et al., jejunum tissue. The reason may be that yak had greater 2000], O. aries [Pan et al., 2001], Gallus gallus [Chen et MP flow to the intestine, with the MP more efficiently ab- al., 2002], and B. taurus [Zimin et al., 2009]). Previous sorbed via jejunum epithelial cells. The genotype effects reports indicated that certain residues of PepT1 play im- on the relative PepT1 mRNA expression confirmed yak portant roles in protein function and structure (Brandsch have adaptive mechanisms of peptide absorption, which et al., 1994; Döring et al., 1996; Ashida et al., 2002). The might aid survival in the alpine environment. present study indicated that the number of transmembrane domains (12) in PepT1 of yak is the same as that of Dietary Nitrogen Level Regulates the cattle (Zimin et al., 2009), but the number of putative ex- Expression of Alpine Ruminant PepT1 tracellular N-glycosylation sites that we identified in yak (5 sites) is different than that reported in cattle (6 sites; Previous study indicated that dietary N is a regula- Zimin et al., 2009), which may reflect the high conserva- tor of peptide transport activity (Ferraris et al., 1988; tion in transmembrane domains but low conservation in Erickson et al., 1995; Chen et al., 2005; Terova et al., the large extracellular loop of PepT1. 2013). The present study also indicated that when yak and indigenous cattle were fed 30.9 to 112.8 g N/d, Genotype Effect on PepT1 mRNA Expression there were significant responses in the relative PepT1 mRNA expression of rumen, reticulum, omasum duo- PepT1 belongs to the SLC15 family of oligopeptide denum, ileum, and liver tissues. Significant interactions transporters and is a low-affinity, high-capacity,+ H - were also detected between genotype and dietary N. 3436 Wanget al.

Figure 1. The cDNA and deduced AA sequences for yPepT1. = initiation and termination codons; = putative 12 transmembrane domain structure; = polyA tail; ––– = intracellular putative protein kinase C sites; === = putative intracellular protein kinase A sites; – ∙ – = putative extracellular N-glycosylation sites; * = termination signal. Yak PepT1 cloning and expression 3437

Figure 2. Neighbor-joining phylogenetic tree of PepT1 proteins. The GenBank protein accession numbers are Bos taurus, NP_001092848; Ovis aries, NP_001009758; Sus scrofa, NP_999512; Tibetan pig, ABY90136; Canis familiaris, NP_001003036; Homo sapiens, NP_005064; Macaca mulatta, AAQ54587; Mus musculus, AF205540_1; Rattus norvegicus, NP_476462; Oryctolagus cuniculus, NP_001075806; Gallus gallus, AGZ02796; Meleagris gallopavo, AAO16604; Xenopus tropicalis, XP_012813171; Ctenopharyngodon idella, AET36827; Cyprinus carpio, AEX13747; Danio rerio, NP_932330; Salmo salar, BAH24102; Gadus morhua, AAY17354; Tetraodon nigroviridis, AGF90973; and Siniperca chuatsi, AHC02458. The numbers on the branches represents 1,000 bootstrap values.

The daily maintenance requirements of ME and di- diets but not by the 37.6 g N/kg DM diet. However, the gestible N for yak are recommended at 0.46 MJ and relative PepT1 mRNA expression was strongly induced 0.97 g per BW0.75, respectively (Xue et al., 1994; Hu et in small intestine (duodenum, jejunum, and ileum) tis- al., 1999), although there are no specific recommenda- sues by the 10.3 and 37.6 g N/kg DM diets. tions for our indigenous cattle. Our experimental diets It has been previously reported that feeding restric- supplied about 0.48 MJ ME/BW0.75 and 0.64, 1.11, tion induces the functional development of protein di- 1.62, and 2.14 g total N/BW0.75 per day. Therefore, digestion enzymes (Susbilla et al., 2003), and the PepT1 etary ME was similar to the recommended values for expression is significantly enhanced in intestinal muco- yak, but the 10.3 g N/kg DM diet was far lower than sa under malnourished conditions (Thamotharan et al., maintenance requirements of digestible N for yak, 2.2- 1999; Ihara et al., 2000). During malnourished states, fold greater for the 37.6 g N/kg DM diet, and 1.1- and peptides would mainly come from body protein deg- 1.7-fold greater for the 19.5 and 28.5 g N/kg DM di- radation of the gastrointestinal tract (Backwell, 1994), ets, respectively. Therefore, we conclude that the 19.5 and the protein released from the small intestine can and 28.5 g N/kg DM diets will provide greater rumen maintain animal growth or meet the needs of low level microbial N to postgastrointestinal lumen than the 10.3 performance (Armentano et al., 1993). Moreover, high- and 37.6 g N/kg DM diets. The relative PepT1 mRNA protein diets improve the gastrointestinal microbial pro- expression was strongly induced in the rumen and re- tein synthesis for dairy goats (Felisberto et al., 2011) ticulum by the 19.5 and 28.5 g N/kg DM diets and in and fish (Ostaszewska et al., 2010). Liu et al. (2014) the omasum by the 10.3, 19.5, and 28.5 g N/kg DM reported that the fish gastrointestinal PepT1 mRNA ex- 3438 Wanget al.

Table 3. Effect of dietary N level and genotype on relative PepT1 mRNA expression in yak vs. indigenous cattle (IC)

2 Dietary, g N/kg DM P-value Item Genotype1 10.3 19.5 28.5 37.6 SEM Genotype N-Lin N-Quad N-Cubic Rumen Yak 1.00 1.28b 1.74b 3.03 0.286 <0.001 <0.001 0.49 0.37 IC 1.05 3.10a 3.72a 3.55 0.373 <0.0013 0.993 Reticulum Yak 2.49 3.75b 4.03a 1.99 0.634 0.77 0.34 <0.01 <0.01 IC 2.20 6.26a 1.43b 3.00 0.713 0.703 <0.0013 Omasum Yak 0.79b 3.74b 1.63b 0.87 0.309 <0.001 <0.001 <0.001 <0.001 IC 2.18a 8.90a 3.35a 1.88 0.033 <0.0013 <0.0013 Abomasum Yak 0.39 0.16 0.13 0.12 0.141 0.35 0.09 0.11 0.49 IC 0.55 0.15 0.21 0.27 0.953 0.543 0.763 Duodenum Yak 4.18b 4.71 3.58b 3.88b 0.537 <0.001 <0.05 <0.01 0.74 IC 10.50a 6.30 6.82a 7.85a 0.133 <0.013 <0.053 Jejunum Yak 16.36a 6.62b 9.39 18.08a 1.279 <0.01 0.07 0.62 0.44 IC 8.38b 17.02a 10.93 2.88b <0.0013 <0.0013 0.023 Ileum Yak 0.50b 15.64a 11.18b 4.13b 1.013 <0.001 <0.001 <0.001 0.54 IC 8.09a 10.80b 17.08a 13.96a 0.023 <0.0013 <0.0013 Cecum Yak 0.05 0.15 0.19 0.36 0.151 0.22 0.30 0.80 0.42 IC 0.30 0.40 0.23 0.37 0.353 0.943 0.703 Colon Yak 0.08 0.09 0.27 0.07 0.132 0.07 0.79 0.06 0.07 IC 0.22 0.28 0.61 0.14 0.953 0.403 0.573 Liver Yak 0.06b 0.06b 0.02b 0.03 0.045 <0.001 <0.001 <0.01 0.23 IC 0.76a 0.23a 0.17a 0.15 <0.0013 <0.013 0.093 a,bWithin a column, means differ between yak and indigenous cattle (P < 0.05). 1Animal replicates were 3 for yak and 3 for indigenous cattle. 2N-Lin = linear effect of dietary N; N-Quad = quadratic effect of dietary N; N-Cubic = cubic effect of dietary N. 3P-value for interaction of dietary N effect with genotype.

Ashida, K., T. Katsura, H. Motohashi, H. Saito, and K. I. Inui. 2002. pression is greater under extreme dietary N levels (35.2 Thyroid hormone regulates the activity and expression of the or 67.2 g N/kg DM). The present study showed that the peptide transporter PepT1 in Caco-2 cells. Am. J. Physiol. relative PepT1 mRNA expression in the jejunum for 282:G617–G623. yak was greater than that for indigenous cattle when fed Backwell, F. R. C. 1994. Peptide utilization by tissues: Current status the 10.3 and 37.6 g N/kg DM diets; in contrast, it was and applications of stable isotope procedures. Proc. Nutr. Soc. lower when fed the 19.5 and 28.5 g N/kg DM diets. The 53:457–464. doi:10.1079/PNS19940056 Bikker, P., A. Dirkzwager, J. Fledderus, P. Trevisi, I. le Huerou-Luron, reason may be that yak had greater absorption ability J. P. Lalles, and A. Awati. 2006. The effect of dietary protein and in the jejunum to achieve the maintenance requirement fermentable carbohydrates levels on growth performance and under extreme N level conditions. intestinal characteristics in newly weaned piglets. J. Anim. Sci. Moreover, PepT1 mRNA abundance and activity are 84:3337–3345. doi:10.2527/jas.2006-076 regulated by several factors such as physiological status, Brandsch, M., Y. Miyamoto, V. Ganapathy, and F. H. Leibach. 1994. Expression and protein kinase C-dependent regulation of pep- nutrient level, substrate concentration, gastrointestinal tide/H+ co-transport system in the Caco-2 human colon carcino- morphology, villus height and crypt depth, etc. (Verri et ma cell line. Biochem. J. 299:253–260. doi:10.1042/bj2990253 al., 2003; Daniel, 2004; Bikker et al., 2006; Gilbert et al., Chen, G., J. Russell, and C. Sniffen. 1987. A procedure for measuring 2008; Hu and Guo, 2008; Opapeju et al., 2009; Hu et al., peptides in rumen fluid and evidence that peptide uptake can be 2010; Spanier, 2014). Therefore, these factors may in- a rate-limiting step in ruminal protein degradation. J. Dairy Sci. duce the different PepT1 mRNA expression for yak and 70:1211–1219. doi:10.3168/jds.S0022-0302(87)80133-9 Chen, H., Y. Pan, E. A. Wong, J. R. Bloomquist, and K. E. Webb. indigenous cattle, but these comparative studies have not 2002. Molecular cloning and functional expression of a chicken yet been reported and need further investigation. intestinal peptide transporter (cPepT1) in Xenopus oocytes and Chinese hamster ovary cells. J. Nutr. 132:387–393. LITERATURE CITED Chen, H., Y. Pan, E. A. Wong, and K. E. Webb. 2005. Dietary protein level and stage of development affect expression of an intestinal Armentano, L. E., S. J. Bertics, and J. Riesterer. 1993. Lack of re- peptide transporter (cPepT1) in chickens. J. Nutr. 135:193–198. sponse to addition of degradable protein to a low protein diet Chen, H., E. A. Wong, and K. E. Webb. 1999. Tissue distribution of a fed to midlactation dairy cows. J. Dairy Sci. 76:3755–3762. peptide transporter mRNA in sheep, dairy cows, pigs, and chick- doi:10.3168/jds.S0022-0302(93)77718-8 ens. J. Anim. Sci. 77:1277–1283. Yak PepT1 cloning and expression 3439

Daniel, H. 2004. Molecular and integrative physiology of intestinal Hu, X. F., Y. M. Guo, B. Y. Huang, S. Bun, L. B. Zhang, J. H. Li, D. Liu, peptide transport. Annu. Rev. Physiol. 66:361–384. doi:10.1146/ F. Y. Long, X. Yang, and P. Jiao. 2010. The effect of glucagon- annurev.physiol.66.032102.144149 like peptide 2 injection on performance, small intestinal mor- Daniel, H., B. Spanier, G. Kottra, and D. Weitz. 2006. From bacte- phology, and nutrient transporter expression of stressed broiler ria to man: Archaic proton-dependent peptide transporters at chickens. Poult. Sci. 89:1967–1974. doi:10.3382/ps.2009-00547 work. Physiology (Bethesda) 21:93–102. doi:10.1152/physi- Ihara, T., T. Tsujikawa, Y. Fujiyama, and T. Bamba. 2000. Regulation ol.00054.2005 of PepT1 peptide transporter expression in the rat small in- Danilson, D., K. Webb, and J. Herbein. 1987. Transport and hindlimb testine under malnourished conditions. Digestion 61:59–67. exchange of peptide and serum protein amino acids in calves fed doi:10.1159/000007736 soy- or urea-based purified diets. J. Anim. Sci. 64:1852–1857. Jayawardena, V., and K. Webb. 1999. Observations on ruminal pro- Döring, F., D. Dorn, U. Bachfischer, S. Amasheh, M. Herget, and H. tein degradation products following in vitro incubation of some Daniel. 1996. Functional analysis of a chimeric mammalian pep- concentrate feeds. Trop. Agric. Res. 2:199–210. tide transporter derived from the intestinal and renal isoforms. J. Klang, J., L. Burnworth, Y. Pan, K. Webb, and E. Wong. 2005. Physiol. 497:773–779. doi:10.1113/jphysiol.1996.sp021808 Functional characterization of a cloned pig intestinal peptide Erickson, R. H., J. R. Gum, M. M. Lindstrom, D. McKean, and Y. transporter (pPepT1). J. Anim. Sci. 83:172–181. S. Kim. 1995. Regional expression and dietary regulation of Kottra, G., A. Stamfort, and H. Daniel. 2002. PepT1 as a paradigm for rat small intestinal peptide and amino acid transporter mRNAs. membrane carriers that mediate electrogenic bidirectional trans- Biochem. Biophys. Res. Commun. 216:249–257. doi:10.1006/ port of anionic, cationic, and neutral substrates. J. Biol. Chem. bbrc.1995.2617 277:32683–32691. doi:10.1074/jbc.M204192200 Fei, Y. J., Y. Kanai, S. Nussberger, V. Ganapathy, F. H. Leibach, M. Li, Y., X. Y. Lin, Y. L. Jiang, P. C. Su, and Z. H. Wang. 2008. A study F. Romero, S. K. Singh, W. F. Boron, and M. A. Hediger. 1994. on the relative expression of peptide transporter 1 mRNA in dif- Expression cloning of a mammalian proton-coupled oligopep- ferent parts of bovine gastrointestinal tract by RT-PCR. Chin. J. tide transporter. Nature 368:563–566. doi:10.1038/368563a0 Anim. Nutr. 20:183–190. Fei, Y. J., M. Sugawara, J. C. Liu, H. W. Li, V. Ganapathy, M. E. Liang, R., Y. J. Fei, P. D. Prasad, S. Ramamoorthy, H. Han, T. L. Ganapathy, and F. H. Leibach. 2000. cDNA structure, genomic Yang-Feng, M. A. Hediger, V. Ganapathy, and F. H. Leibach. organization, and promoter analysis of the mouse intestinal pep- 1995. Human intestinal H+/peptide cotransporter cloning, func- tide transporter PepT1. Biochim. Biophys. Acta, Gene Struct. tional expression, and chromosomal localization. J. Biol. Chem. Expression 1492:145–154. doi:10.1016/S0167-4781(00)00101-9 270:6456–6463. Felisberto, N. R., M. T. Rodrigues, M. A. Bomfim, R. D. Matos, A. Liu, H., L. Wang, Z. J. Cao, S. L. Li, and L. B. Wang. 2010. Responses G. Cordeiro, and M. M. Silva. 2011. Effects of different sources of mRNA expression of pept1 in small intestine to graded duo- of protein on digestive characteristics, microbial efficiency, and denal soybean small peptides infusion in lactating goats. Afr. J. nutrient flow in dairy goats. Rev. Bras. Zootec. 40:2228–2234. Biotechnol. 8:1973–1978. doi:10.1590/S1516-35982011001000024 Liu, Z., Y. Zhou, J. C. Feng, S. Q. Lu, Q. Zhao, and J. S. Zhang. Feng, J., Z. Liu, L. U. Shuangqing, G. Nie, L. Zhou, and L. Sun. 2013. 2013. Characterization of oligopeptide transporter (PepT1) Cloning of the PepT1 gene and analysis of its expression in in grass carp (Ctenopharyngodon idella). Comp. Biochem. Ctenopharyngodon idellus tissues. J. Fish. Sci. China 20:276– Physiol. B Biochem. Mol. Biol. 164:194–200. doi:10.1016/j. 285. doi:10.3724/SP.J.1118.2013.00276 cbpb.2012.11.008 Ferraris, R. P., J. Diamond, and W. W. Kwan. 1988. Dietary regulation Liu, Z., Y. Zhou, S. J. Liu, Q. Zhao, J. C. Feng, S. Q. Lu, G. Xiong, of intestinal transport of the dipeptide carnosine. Am. J. Physiol. D. Z. Xie, J. S. Zhang, and Y. Liu. 2014. Characterization and 255:143–150. dietary regulation of oligopeptide transporter (PepT1) in dif- Freeman, T., B. Bentsen, D. Thwaites, and N. Simmons. 1995. H+/di- ferent ploidy fishes. Peptides 52:149–156. doi:10.1016/j.pep- tripeptide transporter (PepT1) expression in the rabbit intestine. tides.2013.12.017 Pflugers Arch. 430:394–400. doi:10.1007/BF00373915 Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene ex- Gilbert, E. R., E. A. Wong, and K. E. Webb Jr. 2008. Board-invited re- pression data using real-time quantitative PCR and the 2−ΔΔCt view: Peptide absorption and utilization: Implications for animal method. Methods 25:402–408. doi:10.1006/meth.2001.1262 nutrition and health. J. Anim. Sci. 86:2135–2155. doi:10.2527/ Long, R., S. Dong, X. Chen, E. Ørskov, and Z. Hu. 1999. Preliminary jas.2007-0826 studies on urinary excretion of purine derivatives and cre- Guo, X. S., Y. Zhang, J. W. Zhou, R. J. Long, G. S. Xin, B. Qi, L. atinine in yaks. J. Agric. Sci. 133:427–431. doi:10.1017/ M. Ding, and H. C. Wang. 2012. Nitrogen metabolism and re- S0021859699007169 cycling in yaks (Bos grunniens) offered a forage-concentrate Long, R., S. Dong, Z. Hu, J. Shi, Q. Dong, and X. Han. 2004. diet differing in N concentration. Anim. Prod. Sci. 52:287–296. Digestibility, nutrient balance and urinary purine deriva- doi:10.1071/AN11208. tive excretion in dry yak cows fed oat hay at different levels Habib, G., M. M. Siddiqui, F. H. Mian, J. Jabbar, and F. Khan. 2001. of intake. Livest. Prod. Sci. 88:27–32. doi:10.1016/j.livprod- Effect of protein supplements of varying degradability on growth sci.2003.11.004 rate, wool yield and wool quality in grazing lambs. Small Rumin. Long, R., S. Dong, X. Wei, and X. Pu. 2005. The effect of supple- Res. 41:247–256. doi:10.1016/S0921-4488(01)00219-X mentary feeds on the bodyweight of yaks in cold season. Livest. Hu, L. H., A. Y. Xie, S. J. Liu, W. B. Wang, B. Xue, S. T. Chai, and X. Prod. Sci. 93:197–204. doi:10.1016/j.livprodsci.2004.08.016 T. Han. 1999. Study on nitrogen metabolism and nitrogen sup- Newey, H., and D. Smyth. 1960. Intracellular hydrolysis of dipep- plementary techniques in growing yaks. Acta Zoonutr. Sinica tides during intestinal absorption. J. Physiol. 152:367–380. 11:208–216. doi:10.1113/jphysiol.1960.sp006493 Hu, X. F., and Y. M. Guo. 2008. Corticosterone administration alters Opapeju, F. O., M. Rademacher, and C. M. Nyachoti. 2009. Effect small intestinal morphology and function of broiler chickens. of dietary crude protein level on jejunal brush border enzyme Asian-Australas. J. Anim. Sci. 21:1773–1778. doi:10.5713/ activities in weaned pigs. Arch. Anim. Nutr. 63:455–466. ajas.2008.80167 doi:10.1080/17450390903299133 3440 Wanget al.

Ostaszewska, T., K. Dabrowski, M. Kamaszewski, P. Grochowski, T. Thamotharan, M., S. Z. Bawani, X. Zhou, and S. A. Adibi. 1999. Verri, M. Rzepkowska, and J. Wolnicki. 2010. The effect of plant Functional and molecular expression of intestinal oligopeptide protein-based diet supplemented with dipeptide or free amino ac- transporter (PepT1) after a brief fast. Metabolism 48:681–684. ids on digestive tract morphology and PepT1 and PepT2 expres- doi:10.1016/S0026-0495(99)90164-6 sions in common carp (Cyprinus carpio L.). Comp. Biochem. Van, L., Y. X. Pan, K. E. Webb, and E. A. Wong. 2005. Developmental Physiol. A 157:158–169. doi:10.1016/j.cbpa.2010.06.162 regulation of a turkey intestinal peptide transporter (PepT1). Pan, Y., E. A. Wong, J. R. Bloomquist, and K. E. Webb. 2001. Poult. Sci. 84:75–82. doi:10.1093/ps/84.1.75 Expression of a cloned ovine gastrointestinal peptide transporter Verri, T., G. Kottra, A. Romano, N. Tiso, M. Peric, M. Maffia, M. Boll, (oPepT1) in Xenopus oocytes induces uptake of oligopeptides in F. Argenton, H. Daniel, and C. Storelli. 2003. Molecular and vitro. J. Nutr. 131:1264–1270. functional characterisation of the zebrafish (Danio rerio) PepT1- Qiu, Q., G. Zhang, T. Ma, W. Qian, J. Wang, Z. Ye, C. Cao, Q. Hu, J. type peptide transporter. FEBS Lett. 549:115–122. doi:10.1016/ Kim, D. Larkin, L. Auvil, B. Capitanu, J. Ma, H. Lewin, X. Qian, S0014-5793(03)00759-2 Y. Lang, R. Zhou, L. Wang, K. Wang, J. Xia, S. Liao, S. Pan, X. Vig, B. S., T. R. Stouch, J. K. Timoszyk, Y. Quan, D. A. Wall, R. L. Lu, H. Hou, Y. Wang, X. Zang, Y. Yin, H. Ma, J. Zhang, Z. Wang, Smith, and T. N. Faria. 2006. Human PepT1 pharmacophore Y. Zhang, D. Zhang, T. Yonezawa, M. Hasegawa, Y. Zhong, W. distinguishes between dipeptide transport and binding. J. Med. Liu, Y. Zhang, Z. Huang, S. Zhang, R. Long, H. Yang, J. Wang, Chem. 49:3636–3644. doi:10.1021/jm0511029 J. Lenstra, D. Cooper, Y. Wu, J. Wang, P. Shi, J. Wang, and J. Liu. Wang, H. C., R. J. Long, J. B. Liang, X. S. Guo, L. M. Ding, and Z. H. 2012. The yak genome and adaptation to life at high altitude. Nat. Shang. 2011a. Comparison of nitrogen metabolism in yak (Bos Genet. 44:946–949. doi:10.1038/ng.2343 grunniens) and indigenous cattle (Bos taurus) on the Qinghai- Satio, H., M. Okuda, T. Terada, S. Sasaki, and K. I. Inui. 1995. Tibetan plateau. Asian-Australas. J. Anim. Sci. 24:766–773. Cloning and characterization of a rat H+/peptide cotransporter doi:10.5713/ajas.2011.10350 mediating absorption of β-lactam antibiotics in the intestine and Wang, H. C., R. J. Long, Z. H. Shang, and G. X. Cui. 2011b. kidney. J. Pharmacol. Exp. Ther. 275:1631–1637. Preliminary comparative study on antioxidant capacities of yak. Scholljegerdes, E. J., P. A. Ludden, and B. W. Hess. 2004. Site and J. Agric. Sci. Technol. A 1:1333–1335. extent of digestion and amino acid flow to the small intestine in Wang, H., R. Long, W. Zhou, X. Li, J. Zhou, and X. Guo. 2009a. A beef cattle consuming limited amounts of forage. J. Anim. Sci. comparative study on urinary purine derivative excretion of yak 82:1146–1156. (Bos grunniens), cattle (Bos taurus), and crossbred (Bos taurus Sindt, M. H., R. A. Stock, T. J. Klopfenstein, and D. H. Shain. 1993. × Bos grunniens) in the Qinghai-Tibetan plateau, China. J. Anim. Effect of protein source and grain type on finishing calf perfor- Sci. 87:2355–2362. doi:10.2527/jas.2008-1544 mance and metabolism. J. Anim. Sci. 71:1047–1056. Wang, W., C. Shi, J. Zhang, W. Gu, T. Li, M. Gen, W. Chu, R. Huang, Spanier, B. 2014. Transcriptional and functional regulation of the Y. Liu, and Y. Hou. 2009b. Molecular cloning, distribution and intestinal peptide transporter PepT1. J. Physiol. 592:871–879. ontogenetic expression of the oligopeptide transporter PepT1 doi:10.1113/jphysiol.2013.258889 mRNA in Tibetan suckling piglets. Amino Acids 37:593–601. Susbilla, J. P., I. Tarvid, C. B. Gow, and T. L. Frankel. 2003. doi:10.1007/s00726-008-0178-7 Quantitative feed restriction or meal-feeding of broiler chicks al- Xiong, B. H., Z. H. Pang and Q. Y. Luo. 2013. Tables of feed composi- ter functional development of enzymes for protein digestion. Br. tion and nutritive values in China (2013 Twenty fourth edition). Poult. Sci. 44:698–709. doi:10.1080/00071660310001643679 China feed. 22: 38–42. Terova, G., S. Corà, T. Verri, S. Rimoldi, G. Bernardini, and M. Xue, B., S. T. Cai, S. J. Liu, W. B. Wang, A. Y. Xie, L. H. Hu, X. W. Saroglia. 2009. Impact of feed availability on PepT1 mRNA ex- Zhang, and Y. P. Zhao. 1994. Study on the protein requirement of pression levels in sea bass (Dicentrarchus labrax). Aquaculture growing yak. Chinese Qinghai J. Anim. Vet. Sci. 24:1–6. 294:288–299. doi:10.1016/j.aquaculture.2009.06.014 Zimin, A. V., A. L. Delcher, L. Florea, D. R. Kelley, M. C. Schatz, Terova, G., L. Robaina, M. Izquierdo, A. Cattaneo, S. Molinari, G. D. Puiu, F. Hanrahan, G. Pertea, C. P. Tassell, T. S. Sonstegard, Bernardini, and M. Saroglia. 2013. PepT1 mRNA expression G. Marcais, M. Roberts, P. Subramanian, J. A. Yorke, and S. L. levels in sea bream (Sparus aurata) fed different plant protein Salzberg. 2009. A whole-genome assembly of the domestic cow, sources. SpringerPlus 2:17. doi:10.1186/2193-1801-2-17 Bos taurus. Genome Biol. 10:R42. doi:10.1186/gb-2009-10-4-r42 Zinn, R. A., and F. N. Owens. 1993. Ruminal escape protein for light- weight feedlot calves. J. Anim. Sci. 71:1677–1687.