Hsp90 Regulates the NLRP3 Inflammasome Via the NF-Kb Signaling Pathway

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2020-04-17 Hsp90 Regulates the NLRP3 Inflammasome via the NF-kB Signaling Pathway

Sparksman, Steven

Sparksman, S. (2020). Hsp90 Regulates the NLRP3 Inflammasome via the NF-kB Signaling Pathway (Unpublished master's thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/111814 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Hsp90 Regulates the NLRP3 Inflammasome via the NF-kB Signaling Pathway

Steven William Sparksman

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

GRADUATE PROGRAM IN GASTROINTESTINAL SCIENCES

CALGARY, ALBERTA

APRIL, 2020

Ó Steven William Sparksman 2020 Abstract

An over-reactive inflammatory response can lead to chronic inflammation and auto-immune disorders such as Crohn’s disease, ulcerative colitis or cancer. At the heart of the host’s inflammatory response is an immune cell intracellular sensor protein known as NLRP3 that regulates the cellular response to a wide range of PAMPS/DAMPS. NLRP3 has been characterized primarily as an inflammasome-forming protein in response to infection and injury. The inflammasome regulates IL-1β and IL-18 maturation leading to their subsequent secretion from the immune cell. Secretion of these cytokines recruits other immune cells and factors that leads to the resolution of the initiating infection or injury. Hsp90, with its co-chaperone SGT1, was shown to be required for NLRP3 inflammasome activation via a direct protein-protein interaction. An

Hsp90-SGT1 interaction was suggested to stabilize NLRP3 prior to inflammasome activation allowing the sensing of PAMPS/DAMPS; however, the mechanism, timing and sequence of events of this interaction have yet to be shown experimentally. Thus, the central hypothesis of this thesis is that Hsp90 regulates the activation of the NLRP3 inflammasome by stabilizing

NLRP3 via direct protein-protein interactions. Treatment with DMAG, an Hsp90 inhibitor, blocked canonical NLRP3 function in differentiated THP-1 immune cells. However, we found no evidence that Hsp90-SGT1 was involved in protein-protein interactions with NLRP3. Instead, experiments revealed that DMAG attenuated IL1β gene transcription but did not interfere with translocation of the transcription factor, NF-kB to the nucleus. This suggests Hsp90 regulates the

NLRP3 inflammasome by regulating transcription of NLRP3 inflammasome component genes.

This project has revealed new insights for Hsp90 in the inflammatory response and suggests Hsp90 as a credible target for chronic inflammatory disorders.

ii Acknowledgements

I would like to thank my supervisor, Dr. Paul Beck, for his continual support, guidance, mentorship and generosity. He is truly a treasure and an inspiration to all of us and I was very fortunate to be accepted into his lab. I want to also thank my Beck lab colleagues for their unquestioned support and confidence in me throughout the performance of this work. I want to express my appreciation to Dr. Dan Murvue for enabling my growth and nurturing as a scientist. I attribute my transformation from a science undergrad to my ability to write this thesis almost completely to Dr.

Muruve’s allowing me full access to his lab resources and personnel throughout this journey. In particular, Dr. Arthur Lau and Dr. Jae Chung whom taught me, mentored me, got angry, disappointed, scolded me yet never wavered in lifting me when I was down, steer me when off- track and most importantly never lost their confidence in my ability nor failed to encourage me to keep making forward progress. Thank you, gentlemen. It may be cliché, but completely true in this case, I could not have completed this work without you. I want to thank my wife whom has made many personal sacrifices in her own career and life in order to cater to the demands of staying by my side through all the success and failures. We have been through an incredible amount together in the past 25 years and still have multiple journey’s ahead, together always. I want to thank my family: my Mom, Dad, and sister and my daughter and son: Kristina and Kevin. The faith you place in my abilities, the confidence you have in me is an enormous challenge at times, but it is also the fuel to my flame, the drive that motivates me. I simply am not capable of letting any of you down. I can never fail with all of you standing behind me. Thank you from the bottom of my heart. I dedicate this to you.

iii Table of Contents Abstract ...... ii Acknowledgements ...... iii List of Tables and Figures ...... vii List of Abbreviations ...... ix CHAPTER 1: BACKGROUND ...... 1 1.1 Innate Immunity and Inflammatory Bowel Disease ...... 1 1.2 Pattern Recognition Receptors (PRR) ...... 1 1.2.1 PRR Families ...... 2 1.2.2 Membrane-bound PRRs ...... 3 1.2.3 Soluble PRRs ...... 3 1.3 NOD-Like Receptors (NLRs) ...... 3 1.3.1 NLR Domain Structure ...... 4 1.4 Inflammasomes ...... 6 1.4.1 NLRP3 Inflammasome Activation ...... 8 1.5 Cellular Stressors ...... 11 1.5.1 Heat Shock Proteins ...... 11 1.5.2 Molecular Chaperones ...... 13 1.6 Heat Shock Protein 90 ...... 14 1.6.1 Hsp90 Isoforms ...... 15 1.6.2 Hsp90 Domain Structure ...... 15 1.6.3 Hsp90 ATPase Cycle ...... 17 1.6.4 Hsp90 Regulation ...... 19 1.6.5 Client Proteins ...... 22 1.6.6 Hsp90 Inhibitors...... 23 1.6.7 Drug Inhibitors in Medical Research ...... 24 1.7 Summary ...... 26 1.8 Hypothesis...... 28 1.9 Relevance ...... 28 CHAPTER 2: MATERIALS AND METHODS ...... 30 2.1 Materials ...... 30 2.1.1 Reagents ...... 30 2.1.2 Commercial Kits ...... 32 2.1.3 Buffers, Solutions, and Media Composition ...... 33 2.1.4 Antibodies ...... 35 2.2 Methods...... 36 2.2.1 Cell Culture ...... 36 2.2.2 Experimental Treatments ...... 37 2.2.3 Cell Harvest ...... 38

iv 2.2.4 Immunoblotting...... 39 2.2.5 Enzyme-Linked Immunosorbent Assay (ELISA) ...... 40 2.2.6 Co-Immunoprecipitation ...... 41 2.2.7 Immunocytochemistry/Immunofluorescence ...... 42 2.2.8 Proximity Ligation Assay (PLA) ...... 44 2.2.9 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) ...... 46 2.2.10 Nuclear Fractionation ...... 49 2.2.11 Statistical Analysis ...... 50 CHAPTER 3: RESULTS ...... 51 3.1 Hsp90 Inhibitor, DMAG has an Effect on NLRP3 Function ...... 51 3.1.1 Rationale ...... 51 3.1.2 DMAG Attenuates IL-1b Secretions from THP-1 Macrophages ...... 52 3.1.3 DMAG Attenuates MMP-9 Induction in Tubular Epithelial Cells ...... 60 3.1.4 Summary ...... 62 3.2 NLRP3-Hsp90 Protein Interactions Not Detected in THP-1 Cells ...... 64 3.2.1 Rationale ...... 64 3.2.2 NLRP3-Hsp90 Protein Interactions Not Detected using Co-immunoprecipitation .. 65 3.2.3 NLRP3-SGT1 Protein Interactions Not Detected using Co-immunoprecipitation ... 67 3.2.4 NLRP3-Hsp90 Protein Colocalization Not Detected using Immunofluorescence ... 71 3.2.5 NLRP3-Hsp90 Protein Colocalizations Not Detected using PLA ...... 80 3.2.6 Summary ...... 89 3.3 NLRP3-Hsp90 Protein Colocalizations Detected in Transfected HEK293T cells ...... 92 3.3.1 Rationale ...... 92 3.3.2 Transfected HEK293T Cell Line Stably Expresses NLRP3-GFP ...... 93 3.3.3 NLRP3-Hsp90 Protein Interactions Detected using Immunofluorescence ...... 98 3.3.4 NLRP3-Hsp90 Protein Interactions Not Detected using Co-immunoprecipitation 100 3.3.5 Summary ...... 102 3.4 Hsp90 Inhibitor, DMAG Affects NF-kB-mediated Gene Transcription ...... 105 3.4.1 Rationale ...... 105 3.4.2 DMAG Attenuates Pro-IL-1b Protein Levels ...... 107 3.4.3 DMAG Attenuates Pro-IL-1b mRNA Transcription ...... 111 3.4.4 DMAG has No Effect on NF-kB Translocation ...... 113 3.4.5 DMAG has No Effect on I-kBa Phosphorylation ...... 119 3.4.6 Summary ...... 121 CHAPTER 4: DISCUSSION ...... 124 4.1 NLR Inflammasomes at the Heart of Danger Detection ...... 124 4.2 Heat Shock Protein, Hsp90, Stabilizes Proteins upon Cellular Stress ...... 125 4.3 DMAG Affects NLRP3 Independent of the Inflammasome ...... 126 4.4 No Evidence of Hsp90-NLRP3 Protein Interactions in THP-1 Cells ...... 128 4.5 Hsp90-NLRP3 Protein Colocalization Detected in HEK293T Cells ...... 132 4.6 GFP Tags Known to Cause Steric Hindrance in Binding Interaction Studies ...... 135

v 4.7 Overexpression Systems Require Controls in Binding Interaction Studies ...... 136 4.8 DMAG has an Effect on NF-kB-mediated Protein Levels ...... 138 4.9 DMAG has an Effect on NF-kB-mediated IL1b mRNA Transcript Levels ...... 139 4.10 DMAG has No Effect on Transcription Factor NF-kB’s Nuclear Translocation ...... 139 4.11 DMAG has No Effect Upstream of NF-kB Nuclear Translocation ...... 142 4.12 DMAG affects NF-kB-mediated Transcription in the Nucleus of the Cell ...... 143 4.13 Future Direction ...... 144 4.14 Summary ...... 146 References ...... 147

vi List of Tables and Figures

Table 1.2.1 Five Major Classes of PRRs

Figure 1.3.1 NLR Subfamilies

Figure 1.4 Inflammasome Structure

Figure 1.4.1 NF-κB Signaling Pathway

Table 1.5.1 Protein Groups Upregulated upon Cellular Stress

Table 1.5.2 Molecular Chaperone Protein Families

Figure 1.6.2 Domain Structure of Hsp90

Figure 1.6.3 Schematic Diagram of Hsp90’s ATPase Cycle

Figure 1.6.4.3 Hsp90, SGT1, NLRP3 Domain Interactions

Figure 1.7 Current Model of the Hsp90-NLRP3 Protein Interaction

Table 2.1.1 Reagents

Table 2.1.2 Commercial Kits

Table 2.1.3 Buffers, Solutions and Media Composition

Table 2.1.4 Antibodies

Figure 3.1.2.1 DMAG Attenuates IL-1b Secretions from THP-1 Cells

Figure 3.1.2.2 DMAG Attenuates NLRP3 and Pro-IL-1b Protein Levels in THP-1 Cells

Figure 3.1.2.3 DMAG Attenuates Total IL-1b Secretions from THP-1 Cells

Figure 3.1.2.4 DMAG Attenuates C. diff toxin-mediated Total IL-1b.

Figure 3.1.3. DMAG Attenuates MMP-9 Protein Levels in Tubular Epithelial Cells

Figure 3.2.2 No Evidence NLRP3 Interacts with Hsp90 using Co-IP

Figure 3.2.3.1 No Evidence NLRP3 Interacts with SGT1 or Hsp90 using Co-IP

Figure 3.2.3.2: No Evidence SGT1 Interacts with NLRP3 or Hsp90 using Co-IP

vii Figure 3.2.4.1 NLRP3-ASC Protein Colocalization using IF

Figure 3.2.4.2 No Evidence of NLRP3-Hsp90 Protein Colocalizations using IF

Figure 3.2.4.3 Comparison of NLRP3-ASC and NLRP3-Hsp90 Protein Colocalizations

Figure 3.2.5.1 NLRP3-ASC Protein Colocalization using PLA

Figure 3.2.5.2 No Evidence of NLRP3-Hsp90 Protein Colocalization using PLA

Figure 3.2.5.3 Quantification of NLRP3-Hsp90 Protein Colocalizations

Table 3.3.2 Selection Markers Confirm HEK293 Cell Lines

Figure 3.3.2.1 HEK293T-NLRP3-AcGFP Cell Line Overexpresses NLRP3

Figure 3.3.2.2 Hsp90 and NLRP3 Expressed in HEK293T-NLRP3-AcGFP

Figure 3.3.3 NLRP3-Hsp90 Protein Colocalization Detected in HEK293T

Figure 3.3.4 No Evidence Hsp90/SGT1 Interacts with NLRP3-GFP in HEK293T

Figure 3.4.2.1 DMAG Attenuates NLRP3 and Pro-IL-1b Protein Levels

Figure 3.4.2.2 DMAG Attenuates Total IL-1b using ELISA

Figure 3.4.3 DMAG Attenuates IL-1b mRNA Transcript Levels

Figure 3.4.4 DMAG has No Effect on NF-kB Translocation

Figure 3.4.5 DMAG has No Effect on IkBa Phosphorylation

viii List of Abbreviations

Symbol Definition 17-AAG 17-Allylamino-17-Demethoxygeldanamycin 17-DMAG 17-Dimethylaminoethylamino-17-Demethoxygeldanamycin �-SMA Alpha Smooth Muscle Actin ADP Adenosine Diphosphate AGK2 SIRT2 Inhibitor AIM2 Absent in Melanoma 2 ALR AIM2-Like Receptor AMPs Antimicrobial Peptides ANOVA Analysis of Variance ASC Apoptosis-Associated Speck-Like Protein Containing a CARD ATP Adenosine Triphosphate BME �-Mercaptoethanol BSA Bovine Serum Albumin CAPS Cryopyrin Associated Periodic Syndromes CARD Caspase Activation and Recruitment Domain CCR7 CC (Cysteine-Cysteine) Chemokine Receptor 7 CD Crohn's Disease CD40 Cluster of Differentiation 40 (all CDx) CDAD Clostridium difficile Associated Disease cDNA Complementary Deoxyribonucleic Acid C. diff Clostridium difficle CLR C-type Lectin Receptor Co-IP Co-immunoprecipitation CRISPR Clustered Regularly Interspaced Short Palindromic Repeats DAMP Damage Associated Molecular Pattern DAPI Diamidino-Phenylindole DC Dendritic Cells DMAG 17-DMAG DMEM Dulbecco's® Modified Eagle Media DNA Deoxyribonucleic Acid dNTP Deoxy-Nucleoside Triphosphate DPBS Dulbecco's® Phosphate Buffered Saline E. coli Escherichia coli ECL Electrochemiluminescence ELISA Enzyme-Linked Immunosorbent Assay EMT Epithelial-Mesenchymal Transition

ix FBS Fetal Bovine Serum FDA U.S. Food and Drug Administration FLAG Polypeptide Protein Tag (DYKDDDDK) FRET Fluorescence Resonance Energy Transfer GFP Green Fluorescent Protein GI Gastrointestinal

GI50 Concentration for Growth Inhibition of 50% GRP-94 Glucose Regulated Protein 94kDa (Endoplasmin) GTP Guanosine Triphosphate HEK293 Human Embryonic Kidney 293 HLMVEC Human Lung Microvascular Endothelial Cells HRP Horse Radish Peroxidase Hsc70 Heat Shock Cognate 71 kDa HSF1 Heat Shock Factor 1 Hsp90 Heat Shock Protein 90 kDa (all Hspx) hTEC Human Tubular Epithelial Cells IBD Inflammatory Bowel Disease IC50 Inhibitor Concentration 50% Response IF Immunofluorescence IgG Immunoglobulin G (all IgX) IKK I�B Kinase IL-1� Interleukin 1 Beta (all IL-x) IP Immunoprecipitation Sample IPI-504 17-AAG IRAK4 IL-1 Receptor Associated Kinase 4 IRF3 Interferon Regulatory Factor 3 (all IRFx) I�Ba NF-�B Inhibitor LPS Lipopolysaccharides LRR Leucine-Rich Repeat M-MLV Moloney Murine Leukemia Virus MEEVD Met-Glu-Glu-Val-Asp Motif Mg Magnesium MGB Minor Groove Binder MMP9 Matrix Metallopeptidase 9 (all MMPx) mRNA Messenger Ribonucleic Acid MyD88 Myeloid Differentiation Primary Response 88 NACHT NAIP, CIITA, HET-E and TEPI containing Domain NALP3 NLRP3 NF-�B Nuclear Factor Kappa Light Chain Enhancer in B Cells NK (Cells) Natural Killer Cells

x NLR NOD-Like Receptors NLRA NLR containing Acidic Transcriptional Activation Domain NLRB NLR containing Baculoviral Inhibitor of Apoptosis Repeat Domain NLRC NLR containing CARD Domain NLRP3 NLR containing Pyrin Domain 3 NOD2 Nucleotide Binding Oligomerization Domain Containing 2 NSAID Nonsteroidal Anti-inflammatory Drugs PAMP Pathogen Associated Molecular Pattern PBS Phosphate Buffered Saline PBS-T Phosphate Buffered Saline Tween 20 PCR Polymerase Chain Reaction PFA Paraformaldehyde Pi Inorganic Phosphate PLA Proximity Ligation Assay PMA Phorbol 12-Myristate 13-Acetate PPI Protein Pump Inhibitor PRR Pattern Recognition Receptor PYD Pyrin Domain qRT-PCR Quantitative Reverse Transcription Polymerase Chain Reaction RIG-I Retinoic Acid-Inducible Gene I RIPA Radioimmunoprecipitation Assay Buffer RLR RIG-I-Like Receptor RNA Ribonucleic Acid ROS Reactive Oxygen Species RPMI Roswell Park Memorial Institute rRNA Ribosomal Ribonucleic Acid RT Room Temperature SD Standard Deviation SDS Sodium Dodecyl Sulfate SDS-PAGE Sodium Dodecyl Sulfate - Polyacrylamide Gel Electrophoresis SEM Standard Error of the Mean SGT1 Suppressor of the G2 Allele of Skp1 sHsps Small Heat Shock Proteins SIRT2 Sirtuin 2 Protein TAK1 TGF-� Activated Kinase 1 TcdA/B Clostridium difficle Toxin A and B (all Tcdx) TEC Tubular Epithelial Cells TGF-� Transforming Growth Factor Beta THP-1 Human Monocytic Cell Line TIR Toll-Interleukin 1 Receptor

xi TLR4 Toll-Like Receptor 4 (all TLRx) TMB Tetramethylbenzidine TNF� Tumour Necrosis Factor Alpha TPR Tetratricopeptide Repeat Domain TRAF6 TNF Receptor Associated Factor 6 TRAP1 TNF Receptor Associated Protein 1 TSLP Thymic Stromal Lymphopoietin UC Ulcerative Colitis v/v Volume/Volume w/v Weight/Volume Z-VAD-fmk N-Benzyloxycarbonyl-Val-Ala-Asp(O-Me) Fluoromethyl Ketone ZVAD Z-VAD-fmk

xii CHAPTER 1: BACKGROUND

1.1 Innate Immunity and Inflammatory Bowel Disease

Innate immunity is the initial response from the body to transgressions from molecular patterns of pathogenic origin (PAMPs - pathogen-associated molecular patterns) or from internal cellular damage (DAMPs – damage-associated molecular patterns). The innate immune response is orchestrated by both immune cells (i.e. neutrophils, dendritic cells, and macrophages) and non- immune cells (i.e. epithelial cells). Dysregulation of the immune response in the gastrointestinal tract can lead to chronic inflammatory conditions such as Crohn’s disease and ulcerative colitis, known collectively as Inflammatory Bowel Disease (IBD).

1.2 Pattern Recognition Receptors (PRR)

The responsibility for recognizing these molecular patterns lies with a set of immune cell receptors dubbed Pattern Recognition Receptors or PRRs. PRRs are expressed both on and within innate immune cells such as dendritic cells, macrophages and neutrophils. They survey both the extracellular and intracellular space for conserved molecular patterns that serve as indicators of danger (PAMPs/DAMPs). Recognition of PAMPs/DAMPs by PRRs induce a rapid immune response via activation of intracellular signaling pathways culminating in the transcription of a variety of cytokines such as pro-inflammatory interleukins, anti-viral interferons and chemotaxis mediating chemokines. Cytokines are signaling molecules that upon secretion drive the immune response through the modulation of inflammation, immune cell recruitment and the activation of adaptive immunity.

1 1.2.1 PRR Families

Most PRRs can be classified into one of five families based on protein domain homology1 (Table

1.2.1). These five families consist of the Toll-like receptors (TLRs), C-type lectin receptors

(CLRs), nucleotide-binding domain, leucine-rich repeat (LRR)-containing (or NOD-like) receptors (NLRs), RIG-I-like receptors (RLRs), and the AIM2-like receptors (ALRs). These can be further classified as either membrane bound PRRs (TLRs, CLRs) or soluble PRRs (NLRs,

RLRs, ALRs).

Table 1.2.1 Five Major Classes of PRRs. The five classes are the toll-like receptors (TLRs),

C-type lectin receptors (CLRs), nucleotide-binding oligomerization domain (NOD) like receptors

(NLRs), retinoic acid-inducible gene I protein (RIG-I) helicase receptors (RLRs) and absent in melanoma 2 (AIM2) like receptors (ALRs). The most important ligands, the major signaling pathways and the main effector molecule families are identified. Adapted from Innate Immunity:

A Question of Balance1.

Pattern Recognition Localization Ligands Ligand Sources Receptor Family TLR Plasma Membrane Lipoproteins, DNA, RNA, Bacteria, Viruses, Toll-like Receptors Endosomes Endotoxins, DAMPs Parasites, Self CLR Carbohydrate Cell Wall Plasma Membrane Bacteria, Fungi C-type Lectin Receptors Components NLR PAMPs, DAMPS, Bacteria, Viruses, Cytoplasm NOD-like Receptors Environmental Parasites, Self RLR Cytoplasm dsRNA RNA Viruses RIG-1 Helicases ALR Bacteria, Viruses, Cytoplasm dsDNA AIM2-like Receptors Parasites, Self

2 1.2.2 Membrane-bound PRRs

Membrane-bound PRRs are found on the plasma membrane of cells as well as the endocytic membranes of endosomal compartments within the cell. These receptor families provide an extensive array of defense receptors that respond to exogenous molecules and endogenous danger signals. TLRs that are expressed on the plasma membrane detect a variety of lipid- and protein- based ligands that are found in the extracellular milieu2. Some TLRs are important initiators of antivirus responses through their recognition of nucleic acids within the endosomal compartment.

CLRs recognize carbohydrate-based ligands from the cell wall components of bacteria and fungi3.

1.2.3 Soluble PRRs

Soluble PRRs reside in the cytoplasm of innate immune cells and detect a wide variety of infectious agents. RLRs sense double-stranded RNAs from RNA viruses4 and ALRs sense intracellular DNA from microbial sources as well as self5. NLRs sense a wide variety of microbial and damage- associated patterns whose common element remains to be elucidated. ALRs and NLRs have received significant attention from the scientific community due to their ability to form large multimeric protein structures known as inflammasomes.

1.3 NOD-Like Receptors (NLRs)

The NLRs recognize a wide variety of PAMPs (ligands from microbial pathogens) and DAMPs

(ligands from host cell and environmental sources). Some of the ligands from microbial sources include peptidoglycan, flagellin, viral RNA, and fungal hyphae. Ligands from host cell damage include ATP, cholesterol crystals and uric acid. while those from environmental sources include alum, asbestos, silica, alloy particles, UV radiation and skin irritants6. Most NLRs act as PRRs

3 (i.e. recognizing the above ligands and activating inflammatory responses); however, some NLRs have been implicated in additional functions beyond their roles as PRRs. Their roles can be divided into four broad functional categories: inflammasome assembly, signal transduction, transcription activation, and autophagy. NLRs have also been shown to act as key regulators of apoptosis.

1.3.1 NLR Domain Structure

NLRs are divided into four subfamilies based on unique N-terminal domain structures (Figure

1.3.1). The N-terminal domain performs effector functions through protein interactions. The

NLRA subfamily contains an acidic transcriptional activation domain (AD), the NLRB subfamily has a baculoviral inhibitor of apoptosis repeat domain (BIR), the NLRC has a caspase activation and recruitment domain (CARD), and the NLRP subfamily has a pyrin domain. NLR proteins have a common central NACHT domain and with few exceptions, a common C-terminal domain comprised of leucine-rich repeats (LRRs). The NACHT domain consists of seven distinct

conserved motifs, including the ATP/GTPase-specific P-loop, the Mg binding site, and five more- specific motifs. The NACHT domain is involved in dNTPase activity and oligomerization. The C- terminal LRR domain is involved in ligand binding or activator sensing7.

Figure 1.3.1 NLR Subfamilies. The cytosolic NOD-like Receptors are differentiated by their domain structure, mainly their N-terminal effector domains. Over 22 NLRs have been identified in humans. Adapted from NOD-like receptors: Master regulators of inflammation and cancer7.

5 1.4 Inflammasomes

Upon detection of PAMPs/DAMPs, NLRs activate downstream signaling pathways that lead to the effector responses needed to resolve the underlying issue. The different members of the NLR family activate vastly different response pathways. NOD1/NLRC1 and NOD2/NLRC2 are activated by specific components of bacterial peptidoglycan. Their activation triggers signaling pathways that drive the NF-κB/AP-1 dependent expression of pro-inflammatory cytokines and the

IRF3- and/or IRF7-dependent expression of type I interferons8. Other NLRs, including NLRP1,

NLRP3, NLRP6, NLRP7, NLRP12, NLRC4/IPAF, and NLRB/NAIP, oligomerize to form multiprotein inflammasome complexes following their activation by different pathogens or endogenous danger signals (Figure 1.4). Inflammasome oligomerization leads to cleavage and activation of caspase-1, which subsequently promotes the processing and secretion of IL-1b and

IL-18 and induction of an inflammatory form of cell death known as pyroptosis. Inflammasome- mediated secretion of IL-1b and IL-18 is aimed at eliminating the infectious pathogen or injury through the induction of secondary mediators and the recruitment of additional immune cells to the infection site. Inflammasome formation is also aimed at eliminating the infected cells via pyroptosis9. Other members of the NLR family have been suggested to have anti-inflammatory effects due to their abilities to either negatively regulate NF-κB signaling or inhibit caspase-1- mediated IL-1b secretion. Although these proteins have not been as widely investigated, preliminary studies suggest that NLRC3, NLRP2, NLRP4, NLRP7, NLRP10/PYNOD, NLRP12, and NLRX1 may have anti-inflammatory properties10.

Figure 1.4 Inflammasome Structure. The inflammasome consists of a sensor molecule, an adaptor protein and a protease enzyme. The sensor is the NLR pattern recognition receptor with

LRR domain that binds DAMPs/PAMPs ligands. The adapter protein is ASC, which links an inactive pro-caspase protease enzyme to the NLR sensor. Autoproteolytic cleavage of the pro- caspase protease leads to activation and secretion of pro-inflammatory cytokines from the immune cell. Adapted from Inflammasomes and Host Defenses against Bacterial Infections9.

7 1.4.1 NLRP3 Inflammasome Activation

Upon exposure to pathogens, exogenous PAMPs bind membrane bound TLR receptors of immune cells leading to activation of several intracellular signaling pathways11 (Figure 1.4.1). This is considered Signal 1 and is termed a ‘priming’ event. Priming leads to up-regulation of several inflammasome proteins including NLRP3 and cytokine Pro-IL-1β via the NF-κB signaling pathway. Upon activation, the TLR’s cytoplasmic domain known as Toll/IL-1 receptor (TIR) domain associates with a TIR domain-containing adaptor protein, Myeloid differentiation primary response gene 88 (MyD88). MyD88 recruits IL-1 receptor-associated kinase-4 (IRAK4) to the

TLRs through interaction of the death domains of both molecules. TNFR-associated factor 6

(TRAF6) associates with the IRAK4 protein complex leading to the activation of the IKK complex.

The IKK complex includes the scaffolding protein NEMO (IKKγ) along with kinases IKKa and

IKKb and upon activation, phosphorylates the NF-κB inhibitor, IκBa. The transcription factor NF-

κB is held inactive by IκBa until ubiquitination leads to IκBa degradation via the Proteasome 26S.

Free from its inhibitor, NF-κB translocates to the nucleus. NF-κB-mediated transcription upregulates many proteins including NLRP3, IκBa and the proinflammatory cytokines, pro-IL-1β and pro-IL-18.

Figure 1.4.1 NF-κB Signaling Pathway. Activation occurs when a ligand such as LPS or TNF- a binds the TLR4 receptor on the outside surface of the cell. A phosphorylation cascade involving multiple kinase enzymes, including the IKK complex, leads to the ubiquitination and degradation of inhibitor, IκBa. This releases the transcription factor NF-κB dimers, p50-p65 to translocate to the nucleus, bind the DNA and transcribe NF-κB target genes. Adapted from Limiting

Inflammation – The Negative Regulation11.

9 A subsequent stimulus, described as Signal 2, activates the inflammasome by facilitating the oligomerization of monomers of NLRP3 with monomers of apoptosis-associated speck-like protein (ASC) via their common PYD binding domains. Formation of the complex recruits pro- caspase 1, which binds to ASC via CARD domains common to both proteins. The proximity of multiple pro-caspase-1 molecules leads to auto-proteolytic cleavage and the release of active

Caspase-1. The presence of active Caspase-1, an evolutionarily conserved protease, leads to the activation and secretion of IL-1β and IL-18 and cleavage of the pyroptosis inducer, Gasdermin D.

Three models have been proposed to describe the sensing of signal 2 by NLRP3: (1) K+/potassium eﬄux through a purinergic P2X7-dependent pore, which leads to the assembly and activation of the NLRP3 inflammasome. Calcium flux is also involved in this process. (2) PAMPs and DAMPs induce mitochondrial damage and subsequent generation of reactive oxygen species (ROS) that promote the assembly and activation of the NLRP3 inflammasome. (3) Phagocytosed environmental irritants form intracellular crystalline or particulate structures leading to lysosomal rupture and release of lysosomal contents (e.g. cathepsin B). The list of NLRP3 inflammasome agonists is extensive and growing; however, researchers believe a unifying theme exists. It has been postulated that K+ efflux from the cell may be the unifying constant but, this does not account for all possible activators. Structural changes to NLRP3 caused by deviations in ion concentrations away from homeostasis may be the answer, but this has not yet been established. Other factors and mechanisms have been implicated in the assembly and activation of the NLRP3 inflammasome.

For example, the heat shock protein, Hsp90 and its co-chaperone SGT1 have been theorized to stabilize NLRP3, giving it the conformational competence to detect danger signals. This will be discussed at length in the following sections.

10 1.5 Cellular Stressors

Heat and other stressors can be a significant barrier to life. Temperature increases of only a few degrees can challenge survival. This is also true for organisms that live at extreme temperatures.

Just a mild heat shock can induce the heat shock response and with it, the expression of protective, heat shock proteins. Studies have shown that shortly after a mild sub-lethal heat stress, organisms can survive what would normally be considered a lethal treatment. Heat shock protein synthesis contributes to the development of a transient thermotolerance12. Proteins are dynamic and conformationally flexible and have shown to be optimized in a marginally stable state. Just a small increase in temperature can cause protein unfolding, entanglement, and unspecific aggregation.

Studies show there are no built-in cellular thermometers, but instead it is the accumulation of unfolded proteins that triggers the heat shock response. Therefore, other stressors besides temperature shock can activate the heat shock response. Indeed, various forms of stress have been shown to activate the heat shock response including oxidative stress, heavy metal, ethanol, hypoxia, and ischemia13.

1.5.1 Heat Shock Proteins

Depending on the species, approximately 50-200 genes are significantly upregulated during cellular stress. These proteins can be classified into seven groups according to function13 (Table

1.5.1). The most prevalent group and the subject of this paper are the Molecular Chaperones.

11 Table 1.5.1 Protein Groups Upregulated upon Cellular Stress. The proteins upregulated during cellular stress can be grouped into 7 categories according to their function. The Heat Shock

Proteins are known as Molecular Chaperones involved in folding, stabilizing and transporting client proteins. Adapted from Heat Shock Response: Life on the Verge of Death13.

12 1.5.2 Molecular Chaperones

The most prevalent group of heat shock proteins is the molecular chaperones. The molecular chaperones comprise six major and broadly conserved families: Hsp100s, Hsp90s, Hsp70s,

Hsp60s, Hsp40s and small heat shock proteins (sHsps)14 (Table 1.5.2).

Table 1.5.2 Molecular Chaperone Protein Families. Heat shock proteins are considered the molecular chaperones performing various functions, broadly described as protein stabilization.

The protein TRiC/CCT is a type II chaperonin and is considered in most publications, a member of the same family as Hsp60, a type I chaperonin. Adapted from: Molecular Chaperones of

Leishmania: Central Players in Many Stress-Related and Unrelated Physiological Processes14.

Family Name Functions

Hsp100 Unfolding, solubilisation of aggregates, proteolysis

Protein maturation of steroid receptors, protein kinases, and other components Hsp90 of cellular signalling pathways. Organelle-specific variants exist Nascent-protein folding, refolding of denatured proteins, and translocation Hsp70 across membranes. Organelle-specific variants exist Hsp60/ Protein folding and prevention of aggregation chaperonins (bacterial and mitochondrial proteins)

CCT (TRiC) Folding of cytoskeleton components

Hsp40 Hsp70 ATPase activators and intrinsic chaperone activity

Small Hsps Prevention of aggregation, probable role in membrane homeostasis (sHsps)

13 Most heat shock proteins are present at high levels, even under physiological conditions and therefore upon stress they become a major proportion of total cytosolic protein levels. There is a constant need for chaperone assistance during de novo protein folding and refolding of non-native polypeptide chains, as the stability of cellular proteins is low, and aggregation competes with productive folding even at physiological temperatures15. All molecular chaperones interact promiscuously with a broad range of unfolded proteins. The difference between a native protein and a non-native, partially or totally unfolded protein is increased exposure of hydrophobic amino acids. This feature is recognized by molecular chaperones. Binding occurs to hydrophobic patches, specific peptide sequences, or structural elements of the non-native client protein. The role of the molecular chaperone is to prevent unwanted intermolecular interactions as opposed to providing structural information for folding16. This is achieved through controlled binding and release of non-native proteins. This change of affinity of the chaperone for its substrate is controlled by the binding and hydrolysis of ATP in all molecular chaperone families except for sHsps. The latter are optimized for efficient binding of non-native proteins and present an efficient first line of defense.

Commonly referred to as holdases, sHsps are only expressed upon stress while the foldases (e.g.

Hsp70s and Hsp90s) come in both stress-induced and constitutively expressed versions (e.g.

Hsp70 versus Hsc70)17.

1.6 Heat Shock Protein 90

Hsp90 (heat-shock protein 90 kDa) is responsible for managing protein folding and quality control in the crowded environment of the cell. Although Hsp90 is involved in supporting the repair of misfolded proteins in cells under stress, it also plays an important role under physiological conditions regulating the stability and activation state of a range of ‘client’ proteins, many of which are critical for signal transduction18. Hsp90 has a role in the transportation of proteins, both nuclear

14 transport as well as transport across the plasma membrane and endosomal membranes into the cytosol. There is also strong evidence that Hsp90 plays an important role in disease, particularly in cancer, where the chaperoning of mutated and overexpressed oncoproteins is critical19.

Oncoproteins are often unstable triggering the upregulation of Hsp90 and with their exposed hydrophobic surfaces, Hsp90’s high affinity binding. This has driven the development of Hsp90 inhibitors for cancer treatment and, potentially, other diseases.

1.6.1 Hsp90 Isoforms

In humans, 5 genes encode Hsp90 isoforms20. Hsp90-β is the only constitutively expressed, cytosolic protein of the proteins coded by Hsp90 family of genes. Hsp90-a1 and Hsp90-a2 are also cytosolic proteins but are only expressed upon induction of cellular stress. GRP-94 (94 kDa glucose-regulated protein or Endoplasmin) is an Hsp90 isoform localized to the endoplasmic reticulum and TRAP1 (TNF Receptor-Associated Protein 1) is an Hsp90 isoform localized to the mitochondria. There are also 12 pseudogenes that encode Hsp90 isoforms that are not as expressed as proteins in humans21.

1.6.2 Hsp90 Domain Structure

Hsp90 exists as a homodimer with each protomer dimerized at its C-terminus22 (Figure 1.6.2). The structure is flexible allowing multiple conformational states (Figure 1.6.3). Each Hsp90 protomer is composed of an N-terminal ATP-binding domain (N-domain). The ATP binding domain belongs to the family of GHKL ATPases which all share a similar architecture for the ATP binding pocket.

A charged, linker region of variable length follows the N-terminal domain. This leads to the middle domain (M-domain) and its binding sites for client proteins and co-chaperones. The C-terminal

15 dimerization domain (C-domain) consists of a MEEVD motif that anchors co-chaperone proteins that have a tetratricopeptide repeat (TPR) domain. Structural studies reveal that Hsp90 adopts several structurally distinct conformations that are dependent on ATP binding and hydrolysis and that are regulated by post-translational modifications.

Figure 1.6.2 Domain Structure of Hsp90. Each Hsp90 protomer is made up of 3 domains. An

N terminal domain that binds ATP, a Middle or M domain that binds client and co-chaperone proteins and a C terminal domain for protomer dimerization and the anchoring of co-chaperone proteins via MEEVD. Adapted from The Mechanism of Hsp90 ATPase Stimulation by Aha122.

16 1.6.3 Hsp90 ATPase Cycle

Hsp90 undergoes a series of 5 distinct conformational states in performing its function.

Collectively these states are known as the ATPase cycle23 (Figure 1.6.3). In the apo state, Hsp90 adopts predominantly an open V-shaped conformation with 2 protomers dimerized at the C- terminal domains. Binding of ATP to the N-terminal domain triggers repositioning of a lid segment that leads to the formation of the closed lid conformation. With ATP bound, structural changes bring N-terminal domains together leading to dimerization and allowing close association of the substrate bound M-domains. This tightens the Hsp90 molecular clamp and results in a compact

Hsp90 dimer in which the individual protomers twist around each other. This closed (twisted) confirmation is now committed to ATP hydrolysis. After ATP hydrolysis, the N-domains dissociate and release ADP, and Pi. The inactive substrate molecule that had been interacting with the middle domain has now been conformationally activated and Hsp90 returns to its original open conformation. The speed of the ATPase cycle which is dominated by these conformational changes is slow compared to other known ATP-dependent chaperones. Hsp90 from yeast hydrolyzes one

ATP molecule per 1–2 minutes, and the ATP hydrolysis by human Hsp90 is ten-fold slower than that of its yeast homologue24.

Figure 1.6.3 Schematic Diagram of Hsp90’s ATPase Cycle. The Hsp90 homodimer cycles through 5 distinct conformations as ATP is bound and hydrolysed. A complete cycle takes 10 – 20 minutes in humans. The changing conformations release the client protein which exposes client hydrophobic surfaces to the cytosol, thus forcing a client confirmation change (i.e. folding). Hsp90 inhibitors (geldanamycin, radicicol, and purine derivatives) bind to the N-terminus of Hsp90 and compete with ATP for binding in the ATPase binding pocket. Adapted from: The Hsp70/Hsp90

Chaperone Machinery in Neurodegenerative Diseases23.

18 1.6.4 Hsp90 Regulation

Hsp90 is regulated by 4 distinct mechanisms25. 1) The master heat shock regulator HSF1 (heat shock factor 1) is the transcription factor responsible for Hsp90 up regulation during cellular stress and is subject to a complex set of regulatory processes. 2) Hsp90 conformational changes driven by ATP binding and hydrolysis allow progression through a chaperone cycle that enables Hsp90 functionality. 3) Several co-chaperone proteins modulate Hsp90 function by inhibiting or activating its ATPase activity. 4) Transient post-translational modifications ensure fast and efficient responses to extra- and intracellular stimuli and fine-tune Hsp90 function.

1.6.4.1 Post-translational Modifications

Several post-translational modifications affect Hsp90’s chaperone function26. These include phosphorylation, acetylation, and nitrosylation. All of these post-translational modifications have an inhibitory effect on Hsp90, either through reduced promiscuity with client proteins or reduced

ATPase activity. Oxidation, SUMOylation and ubiquitination have also been reported but to a much lesser extent.

19 1.6.4.2 Co-chaperones

Hsp90 functions with the support of numerous co-chaperones. Over 20 co-chaperones are known.

These affect the ATPase rate of Hsp90, recruit client proteins, exhibit chaperone functions on their own or play a role in localization. Attempts have been made to classify co-chaperones, but this remains controversial. Some of these classifications include: TPR domain vs non-TPR domain, client recruitment vs ATPase regulation, remodeling vs client-specific vs late acting27. Despite this, a picture is emerging of a complex co-chaperone cycle involving multiple, transient co- chaperones and client proteins. Hsp90 and co-chaperone proteins interact with each other and client proteins in a sequential, ATP-dependent manner. Individual co-chaperones bind to specific

Hsp90 conformational states and through transient association and dissociation avoid binding site overlap.

1.6.4.3 Co-Chaperone SGT1

The co-chaperone SGT1 (SGT1 homolog, suppressor of G2 allele of skp1) has been reported to recruit client protein NLRP3 to the Hsp90 system for conformational stabilization28. This evolutionarily conserved protein system can also be found in plants supporting client R proteins29.

Like NLRP3’s role in the immune systems of humans, R proteins are part of a plant’s self-defense mechanism30. The study described SGT1, Hsp90 and NLRP3 interacting via multiple domains (see

Figure 1.6.4.3).

Figure 1.6.4.3 Hsp90, SGT1, NLRP3 Domain Interactions. The protein domains of Hsp90,

SGT1 and NLRP3 and their described interaction pattern. All 3 proteins interact with each other.

The N terminal domain of Hsp90 is not involved and is available for ATP binding. NLRP3’s PYD is also not involved and is available for interaction with ASC during inflammasome activation.

21 There is some confusion in the literature describing protein SGT1. A second protein named SGT1 exists and to add to the confusion, has been described as a co-chaperone in the Hsp40-Hsp70 chaperone system. The gene coding this protein has been identified as SGTA on chromosome 19 of the human genome31. The protein has a single TPR domain with no other domains being identified. No known homology has been identified with plant self-defense, and a role has not been identified in the immune system. The SGT1 co-chaperone involved in NLR biology of the immune system is coded from the SUGT1 gene on chromosome 13 of the human genome31, has significant interspecies homology with known self-defense proteins in plants and contains the 3 highly conserved domains identified in Figure 1.6.4.3. Other than the TPR domain, there is no sequence similarities between the proteins.

1.6.5 Client Proteins

Clients are proteins that receive services from Hsp90. These services include interactions that enable correct folding, stabilization, activation, transportation and even degradation32. More than

200 proteins depend on Hsp90. A total of 10% of all proteins are directly or indirectly dependent on Hsp90 for function. Proteome-wide studies suggest the number of Hsp90 clients will increase with time. As with co-chaperones, attempts have been made to classify Hsp90 clients with little success beyond the largest 2 client groups: steroid hormone receptors and kinases. A third group loosely termed “non-signal transduction clients” are involved in innate immunity (NLRs), RNA processing, viral replication and E3 ubiquitin ligase subunits. The interest of this thesis is Hsp90’s role in innate immunity, regulating and stabilizing the NLR sensor, NLRP3. The role of the

Hsp90’s ATPase activity in client activation and maturation as well as how Hsp90 recognizes its clients remains controversial in the literature with most papers acknowledging these remain unanswered questions. However, it is agreed that Hsp90 does not have a single binding pocket nor

22 specific sequence motifs that lead to client interaction. One model suggests client binding relies on distributed hydrophobic contacts across the entire length of the Hsp90 N- and M-domains33.

These hydrophobic interactions are supported by an even distribution of acidic and basic residues giving Hsp90 a net negative charge. This model goes on to describe Hsp90’s ATPase domain as predominantly in an ATP-bound, closed conformation. ATP hydrolysis does not release the client nor alter the hydrophobic binding interface. Instead, the major role of ATPase activity (with support from co-chaperones) is to draw in clients to Hsp90 from Hsp70. Another model suggests all proteins are Hsp90 clients at any given time because Hsp90 recognizes unstable conformations of client proteins rather than their primary sequence34.

1.6.6 Hsp90 Inhibitors

In 1953 and 1970 respectively, natural products radicicol and geldanamycin were isolated and shown to have biological activity. It was not until 1994 that Hsp90 was shown to be the molecular target of first geldanamycin and a few years later radicicol. Researchers showed that these molecules blocked ATP binding and hydrolysis, and this led to degradation of Hsp90 client proteins by the proteasome. With many Hsp90 client proteins playing crucial roles in oncogenic signaling, disabling Hsp90 was thought to be a good way to drive cancer cells into apoptosis and therefore control cancer cell proliferation. Unfortunately, both natural products had poor solubility and proved too toxic for clinical use35. The first drug to progress to clinical trials was geldanamycin analog 17-AAG (tanespimycin). Although there were some positive results, 17-AAG development was abandoned due to patent expiry concerns36. The limited success of the trial was attributed to drug dosage and scheduling issues. A reduced form of 17-AAG, also known as IPI-504

(retaspimycin), achieved improved solubility as a hydrochloride salt. Clinical trials are ongoing with 78% of patients showing at minimum stable disease. A second generation geldanamycin

23 analog, 17-DMAG (alvespimycin) showed improved formulation and pharmacokinetic properties.

This drug was also in clinical trial; however, the trial was abandoned due to an unfavorable toxicity profile. All the geldanamycin-based analogs have a benzoquinone moiety, and this has been shown to account for increased liver enzyme upregulation and increased liver toxicity in a clinical setting.

To avoid this toxicity, small molecular weight inhibitors may be more effective clinical agents37.

Recently, many novel small molecule inhibitors are under development. These synthetic inhibitors are based on a variety scaffolds, including purine, pyrimidines, aminopyridines, azoles, etc. These synthetic compounds are achieving excellent potency against Hsp90. Binding assays regularly

38 score an IC50 of 21 nM and are inhibiting cancer cell proliferation at an average GI50 of 9 nM .

These inhibitors described so far block ATPase activity in the N-Terminal domain of Hsp90. Some labs have found success inhibiting Hsp90 through its C-terminal domain. Novobiocin is one such example although it has not yet started clinical trials. Significant resources have gone into Hsp90 inhibition to treat disease. Unfortunately none have yet to show their predicted level of clinical efficacy, and none have achieved FDA approval.

1.6.7 Drug Inhibitors in Medical Research

Drugs that inhibit enzymatic molecules make up 47% of all current drugs39. The use of small molecule inhibitors in medical research has also been extensive and successful. The ability to cheaply and quickly establish the roles and relationships between proteins has provided enormous advancements in our understanding of cellular functions and signaling pathways. With the advancement of newer, more advanced techniques that provide enhanced specificity and selectivity, the use of inhibitors in biochemical studies is being brought into question. Inhibitors often bind the catalytic site of their enzymatic targets rendering the protein target dysfunctional.

Unfortunately, the structural motif occupied by the drug is often shared by many proteins that have

24 wide-ranging biological functions. The question arises: is the effect being measured a result of inhibiting the targeted protein or is the effect being measured caused by the inhibition of a completely different protein (or proteins) that share a similar catalytic mechanism? Hsp90 inhibitors outcompete the molecule ATP for Hsp90’s ATPase catalytic binding site35. Hsp90’s

ATPase domain is known as the GHKL motif, an enzymatic active site shared by 24 genes in the human genome. While most of these family members have highly specialized roles in very localized parts of the cell (e.g. BCKDK localizes in the mitochondrial matrix breaking down valine, leucine and isoleucine), they cannot be completely ruled out as having the effect being attributed to Hsp90 inhibition. More advanced techniques can be used to mitigate these concerns.

One such technique is CRISPR40 (Clustered Regularly Interspaced Short Palindromic Repeats).

Using an antiviral protective mechanism discovered in prokaryotic species, the targeted protein’s gene is removed from the genome, preventing gene expression. Eliminating any chance for gene expression is the ideal way to inhibit a protein’s activity while removing the risk of off-target effects. However, CRISPR is time consuming and expensive. Significant additional experimentation is required to confirm gene elimination and cell viability. This thesis relies heavily on Hsp90 inhibitor, 17-DMAG to establish Hsp90’s role in NLRP3 biology. However, the use of this inhibitor is a significant limitation in interpreting the study’s findings since off-target effects cannot be ruled out. The use of CRISPR, or other similarly advanced methods, are recommended for any future investigations in this area.

25 1.7 Summary

There has been very little investigation into how the Hsp90 chaperone system, and its extensive list of co-chaperones and their transient nature supports the human innate immune system, in particular the upregulation, stabilization, activation, oligomerization and degradation of the NLR sensor protein, NLRP3. A seminal paper described Hsp90, in complex with the co-chaperone protein SGT1, interacting with NLRP3 and other NLR sensors28. This work was done using a

HEK-293T overexpression cell line. Cells were transfected with genes that produce FLAG-tagged

NLRP3 proteins and polypeptide constructs of individual NLRP3 domains. Interactions were shown or not between these and endogenous Hsp90 proteins using the technique, co- immunoprecipitation. However, other techniques were not used to confirm the interaction and importantly, the interaction failed to be shown with endogenous proteins in THP-1 immune cells.

A subsequent paper was published describing a model for the interaction between Hsp90 and

NLRP341 (Figure 1.7). It described a role for Hsp90 and its co-chaperone SGT1 maintaining

NLRP3’s competence as a danger sensor prior to inflammasome activation. Upon detection of danger the complex releases, allowing NLRP3 to oligomerize and form the NLRP3 inflammasome. Unfortunately, no experimental data were provided to validate this model. Since publication of this model 10 years ago, there have been no papers published investigating this proposed model despite important aspects available for elucidation. Given the profound effects these proteins have on human disease, we are justified in our attempts to further elucidate Hsp90’s role in the pathways involved in NLRP3 inflammasome activation.

Figure 1.7 Current Model of the Hsp90-NLRP3 Protein Interaction. Hsp90 stabilizes

NLRP3 and holds it competent to detect danger signals during physiological conditions of the cell.

Upon NLRP3 sensing danger, Hsp90-SGT1 releases NLRP3 allowing its oligomerization with other NLRP3 molecules. Adapted from Detection of Immune Danger Signals41.

27 1.8 Hypothesis

It is the central hypothesis of this proposal that Hsp90 regulates the activation of the NLRP3 inflammasome by stabilizing NLRP3 via direct protein-protein interactions.

To test this hypothesis, biochemical and molecular biology techniques will be employed to address the following questions:

1) Does DMAG, a small molecular inhibitor of Hsp90, have an effect on NLRP3 function?

2) Is there evidence of a direct protein-protein interaction between Hsp90 and NLRP3?

3) Does DMAG have an effect on NLRP3 inflammasome activation via alternative pathways?

Understanding the underlying mechanism by which innate immune and epithelial cells regulate inflammasomes can provide great insight into how the body regulates and balances the inflammatory response. This knowledge could identify novel approaches to fight diseases caused by both suppressed and/or over-reactive immunity.

1.9 Relevance

A long list of conditions makes up autoimmune disease. At the core of these disorders is a dysregulated immune system. Inflammation is our body’s immune system gathering the tools needed to repair damage and excise infection as well as protect itself, while performing the required repairs. It’s not surprising then that chronic inflammation is one of the hallmarks of many autoimmune disorders. At the heart of inflammation is the ability to sense the damage and/or the presence of pathogens and then activate the inflammatory response through appropriate signaling.

This role is taken up by a large cohort of pattern recognition receptors (PRR) of which NLRP3 arguably detects the largest diversity of signals and at the same time is also one of the most studied.

28 Besides diseases caused by chronic inflammation, genetic mutations in NLRP3 itself are the cause of several disorders under the umbrella term Cryopyrin-Associated Periodic Syndromes (CAPS)42.

These include familial cold auto-inflammatory syndrome (FCAS), Muckle Wells syndrome (MW) and neonatal onset multisystem inflammatory disorder (NOMID). Dysregulated inflammation resulting from a malfunctioning NLRP3 inflammasome is also involved in the pathogenesis of numerous wide-spread chronic diseases, such as vascular disease, non-alcoholic fatty liver disease, obesity and type II diabetes43. As described above, Hsp90 plays a large role in cancer. Out of control cell growth, proliferation and metastaticity is a stressful situation for the cell and since buffering cellular stress is a key role for Hsp90 it’s not surprising that Hsp90 is found at the center of cancer proliferation. Positioned at the crossroads of so many signaling pathways Hsp90 has a role in many other diseases from cystic fibrosis, cardiovascular disease to viral infection and neurodegenerative disorders. The biological relationship between NLRP3 and Hsp90 is poorly understood yet the effects of their dysregulation are wide ranging.

29 CHAPTER 2: MATERIALS AND METHODS

2.1 Materials

This section describes the commercial sources for the reagents, kits, media and antibodies used in this project. It also describes the composition of the various buffers, solutions and cell culture media used.

2.1.1 Reagents

Table 2.1.1: Reagents

Catalogue Reagent Manufacturer Number

PMA Sigma P1585

LPS, Ultrapure E. coli 0111:B4 Invivogen tlrl-eblps

Nigericin Tocris 4312

Z-VAD-FMK Tocris 2163

17-DMAG Sigma Aldrich 100069

AGK2 Cedarlane-Enzo ALX-270-484

TGF-β Cedarlane J257.10

IL-1β Cedarlane C-61121

Protein Assay Dye Reagent Bio-Rad 5000006

Sepharose 6B Sigma GE17-0110-01 cOmpleteÒ Mini Protease Inhibitor Roche 4693159001

30 ECL Prime Western Blotting Reagent GE Healthcare RPN2232

ECL Western Blotting Reagent GE Healthcare RPN2109

TMB Substrate Reagent Set BD Biosciences 555214

DNase I Thermo Scientific EN0521

Random Oligonucleotide Primers Qiagen 48190011

IL-1β Fwd/Rev Primers Eurofins 1395759

18s rRNA FAM/MGB probe Applied Biosystems 4333760T

DuolinkÒ Nuclear Stain Sigma Aldritch DUO82064

Immunochemistry HOESCHT nuclear stain 33342 Technologies Dulbecco’sÒ Phosphate Buffered 14190-144 Saline (DPBS) Life Technologies Ò Dulbecco’s Modified Eagle Medium 11320-082 F12 (DMEM) Life Technologies Roswell Park Memorial Institute 11875-093 Medium 1640 (RPMI) Life Technologies

31 2.1.2 Commercial Kits

Table 2.1.2: Commercial Kits

Catalogue Commercial Kit Manufacturer Number

BD OptEIAÒ Human IL-1β ELISA BD Biosciences 557953 RNEasyÒ Mini Kit Qiagen 74104 M-MLV Reverse Transcriptase Invitrogen 28025013 SsoAdvanced SYBRÒ Green BioRad 172-5270 DuolinkÒ Red PLA Starter Kit Sigma Aldrich DUO92101

32 2.1.3 Buffers, Solutions, and Media Composition

Table 2.1.3: Buffers, Solutions, and Media Composition

Buffer/Solution Composition

140 mM NaCl, 10 mM Tris-Cl (pH 8.0), 1 mM EDTA, 0.5mM EGTA, 1% (v/v) Triton X-100, 0.1% (w/v) sodium RIPA Buffer deoxycholate, 0.1% (w/v) SDS, and 1 x tablet cOmplete® Protease Inhibitor Cocktail (Roche) 1% IGEPAL (v/v), 1 M Tris pH 7.5, 150 mM NaCl, 5 mM, NP-40 Lysis Buffer EDTA pH 8.0, 1 mM Na3VO4, and 1 x tablet cOmplete® (1%) Protease Inhibitor Cocktail (Roche)

20mM HEPES pH 7.4, 10mM KCl, 2mM MgCl , 1mM EDTA, Fractionation Buffer 2 1mM EGTA, 1M DTT, 0.1% PMSF

Phosphate Buffered 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM Saline (PBS) (1X) KH2PO4, pH to 7.4

Phosphate Buffered Saline with Tween-20 1X PBS with 0.5% (v/v) Tween-20 (PBS-T) (1X)

Blocking Buffer for 5% (w/v) non-fat milk in PBS-T Immunoblotting

Lower Gel Buffer 1.5 M Tris base and 0.4% SDS, pH to 8.8

Stacking Gel Buffer 0.5 M Tris base and 0.2% SDS, pH to 6.8

Running Buffer (1X) 25 mM Tris base, 192 mM glycine, 1% (w/v) SDS

25 mM Tris base, 192 mM glycine, +/- 1% (w/v) SDS, in 1:4 Transfer Buffer (1X) ratio of 100% ethanol to water.

33 SDS Sample Buffer 37.5% (v/v) stacking gel buffer pH 6.8, 34.4% (v/v) glycerol, (3X) 6% (v/v) SDS, and 0.03% (v/v) phenol red

ELISA Coating Buffer 0.1M sodium carbonate, pH 9.5

ELISA Wash Buffer 0.05% Tween-20 in 1X PBS

ELISA Blocking 10% FBS in 1X PBS, pH 7.0 Buffer

IF Blocking Buffer filtered 3% (w/v) bovine serum albumin (BSA) in 1X PBS

RPMI 1640 media supplemented with 10% (v/v) FBS, 100U/mL THP-1 Media penicillin/streptomycin, 1mM sodium pyruvate, and 0.05mM β- mercaptoethanol

DMEM media supplemented with 10% (v/v) FBS and 100U/mL HEK293T Media penicillin/streptomycin and 1mM sodium pyruvate

DMEM/F12 media supplemented with 10% (v/v) FBS, 1% (v/v) K-1 Media penicillin-streptomycin, 1% (v/v) hormone mix, 25 ng/mL human EGF, 25 mM HEPES to pH 7.4

34 2.1.4 Antibodies

Table 2.1.4: Antibodies

Catalogue Antibody Target Manufacturer Number b-tubulin Sigma-Aldrich T0198 Fibrillarin Abcam ab5821 NLRP3 AdipoGen AG-20B-0014 NLRP3 Cell Signaling cs13158s Hsp90a/b Santa Cruz sc-7947 SGT1 Santa Cruz sc-398625 ProIL1b Cell Signaling cs12242s cleaved IL1b Cell Signaling cs83186s Procaspase 1 Santa Cruz sc-622 ASC AdipoGen AG-25B-0006 NF-kB p65 Santa Cruz sc-372 IkBa Cell Signaling cs9242s Phospho-IkBa (Ser32) Cell Signaling cs2859s MMP9 Sigma HPA001238 GFP Abcam ab1218 mouse IgG, HRP conjugated Jackson ImmunoResearch 115-035-003 rabbit IgG, HRP conjugated Jackson ImmunoResearch 111-035-003 Alexa 568 Thermo Fischer Scientific A-11011 Alexa 488 Thermo Fischer Scientific A-11029

35 2.2 Methods

2.2.1 Cell Culture

The human monocytic leukemia THP-1 cell line was purchased from the American Type Culture

Collection (ATCC, Manassas, Virginia, United States). THP-1 cells were cultured in THP-1 media

(Table 2.1.3). Cells were grown in cell suspension to 70% confluence in a 37 °C, 5% CO2, humidified incubator. Cells were differentiated to adherent macrophages with 100 nM phorbol-

12-myristate-13-acetate (PMA – Table 2.1.1) for 16 hours prior to experiments. The human embryonic kidney HEK-293T cell line was purchased from the American Type Culture Collection

(ATCC, Manassas, Virginia, United States). The stably transfected HEK293T-NLRP3-AcGFP cell line was obtained from Dr. J.A. MacDonald, University of Calgary. HEK293T cells were cultured in HEK293T Media (Table 2.1.3). Cells were grown to 70% confluence in a 37 °C, 5%

CO2, humidified incubator. The human tubular epithelial cell line (hTEC) was obtained from Dr.

D.A. Muruve (University of Calgary). Cells were cultured in K1 media (Table 2.1.3) and plated onto 20 μg/mL collagen IV coated plates and allowed to grow to 70% confluence in a 37 °C, 5%

CO2, humidified incubator.

36 2.2.2 Experimental Treatments

In order to inhibit Hsp90, differentiated THP-1 cells were treated with 1 µM 17- dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG - Table 2.1.1) for 24 hours44 in THP-1 media. In order to activate the NF-κB signaling pathway, differentiated THP-1 cells were treated with 100 ng/mL ultrapure lipopolysaccharide (LPS- Table 2.1.1) for 4 hours45 in serum free THP-1 media. In order to activate the NLRP3 inflammasome, differentiated THP-1 cells were treated with 20 µM nigericin45 in serum free THP-1 media. After 45 minutes, cells were inspected every 5 minutes for visual evidence of pyroptosis (i.e. floating cells). Cells were harvested upon evidence of approximately 50% cell death. As an alternative method to activate the NLRP3 inflammasome, differentiated THP-1 cells were treated with 35 µg/mL Clostridium difficile (C. diff) toxin TcdA/B (acquired from Dr. P.L. Beck, University of Calgary) in serum free THP-1 media for 6 hours46. In order to inhibit caspase 1, differentiated THP-1 cells were treated with 50

µM N-Benzyloxycarbonyl-Val-Ala-Asp(O-Me) fluoromethyl ketone (Z-VAD-FMK – Table

2.1.1) for 1 hour47 in full serum THP-1 media. In order to activate the epithelial-mesenchymal transition (EMT), hTEC cells were treated with 10 ng/mL Transforming Growth Factor - Beta

(TGF-b - Table 2.1.1) for 72 hours48. In order to differentiate between stably transfected

HEK293T-NLRP3-AcGFP cells, HEK293T cells and HEK293 cells, cells were treated with 1 mg/mL neomycin and 1 mg/mL kanamycin47 and monitored for cell death. HEK293 cells are known to have no antimicrobial resistance while HEK293T cells are known to have neomycin resistance. The plasmid used to create the HEK293T cell line stably transfected the SV40 large T antigen and also conferred neomycin resistance. The plasmid used to stably transfect the HEK293T cells with the NLRP3-AcGFP gene also has genes for both neomycin and kanamycin resistance as defined by the plasmid supplier (Addgene Plasmid #54607).

37 2.2.3 Cell Harvest

Supernatants were transferred to 1.5 mL Eppendorf microcentrifuge tubes. Cells were gently washed twice in Dulbecco’sÒ phosphate-buffered saline (DPBS – Table 2.1.3). Cell lysis was achieved by adding Radioimmunoprecipitation Assay Lysis Buffer (RIPA lysis buffer - Table

2.1.3) followed by scraping with a P200 pipet tip. Cell lysates were transferred to 1.5 mL

Eppendorf microcentrifuge tubes followed by agitation on a platform shaker in an ice bucket for

30 minutes. Supernatants were centrifuged for 7 minutes at 15,000 g at 4 °C and transferred to new

1.5 mL Eppendorf microcentrifuge tubes while retaining the pellet. Cell lysates were then transferred to the supernatant pellet followed by agitation on a platform shaker in an ice bucket for

30 minutes. Cell lysates were centrifuged for 7 minutes at 13,000 rpm at 4 °C, and the supernatants were transferred to new 1.5 mL Eppendorf microcentrifuge tubes.

38 2.2.4 Immunoblotting

Cell lysates or supernatants were added to 3X SDS Sample Buffer (Table 2.1.3), vortexed at low rpm and then boiled for 7 minutes. Proteins were separated by 8%, 10%, or 15% SDS-PAGE at

180V until the proteins were separated to the desired resolution depending on protein size.

Separated proteins were transferred onto 0.2 μm pore nitrocellulose membranes (HybondÒ ECL,

Amersham GE Healthcare Life Sciences) at 100V for 1 hr. The membranes were stained with

Ponceau red dye to confirm successful transfer. Non-specific antibody binding was prevented using Blocking Buffer (Table 2.1.3) for 1 hour. Membranes were incubated for 16 hours at 4 °C with primary antibodies (Table 2.1.4) diluted to 1:1000 in Blocking Buffer and supplemented with preservative, 1% (w/v) sodium azide. Following vigorous, 6 times 5-minute washes with PBST

(Table 2.1.3), primary antibody was detected by horseradish peroxidase-conjugated (HRP- conjugated) secondary antibody (Table 2.1.4) diluted 1:2500 in Blocking Buffer for one hour.

Following vigorous, 6 times 5-minute washes with PBST, antibody-bound proteins were visualized with enhanced chemiluminescence (ECL Western Blotting Reagent or ECL Prime

Western Blotting Reagent – Table 2.1.1) and BioRad’s ChemiDocÒ MP Imaging System.

Densitometry analysis was performed using BioRad’s Image LabÒ software version 5.1 build 8.

39 2.2.5 Enzyme-Linked Immunosorbent Assay (ELISA)

The sandwich ELISA was used to immobilize the antigen IL-1b between two primary antibodies, a capture and detection antibody49. A secondary antibody with conjugated-HRP enzyme recognizes and binds to the detection antibody. Detection was achieved by visualizing the product of enzymatic cleavage following treatment with an HRP-specific substrate. OptEIAÒ Human IL-

1β ELISA kit (Table 2.1.2) was used to detect IL-1β secreted into the supernatant by THP-1 cells as per the manufacturer’s instructions. Briefly, 96-well plates were coated with 100 μL per well of the anti-IL-1β capture antibody (1:250) for 16 hours at 4 °C in ELISA Coating Buffer (Table 2.1.3).

Subsequent steps were completed at room temperature. Wells were washed 3X with ELISA Wash

Buffer (Table 2.1.3). Wells were blocked for 1 hour with 200 μL per well ELISA Blocking Buffer

(Table 2.1.3) then washed 3X with ELISA Wash Buffer. Wells were incubated with 100 μL of IL-

1β standard (Table 2.1.1) in triplicate (made at 1000 pg/mL, 500 pg/mL, 250 pg/mL, 125 pg/mL,

62.5 pg/mL, 31.3 pg/mL and 15.6 pg/mL and 7.8 pg/mL concentrations in ELISA Blocking Buffer) or experimental supernatant samples in triplicate (diluted 1:10) for 2 hours then washed 5X with

ELISA Wash Buffer. Wells were then incubated with 100 μL of biotin-conjugated anti-IL-1β detection antibody (1:1000) for 1 hour, followed by 5 washes with ELISA Wash Buffer and then incubation for 30 minutes with 100 μL of horse radish peroxidase (HRP)-conjugated streptavidin

(1:250). Wells were washed 7X with ELISA Wash Buffer then developed with 100 μL OptEIAÒ

TMB Substrate Reagent Set (Table 2.1.1) for 30 minutes in the dark. The reaction was stopped

Ò with 50 μL of 1M H3PO4. Plates were then read at 450 nm in BioRad’s Benchmark Microplate

Reader and analyzed on BioRad’s Microplate Manager 5.0Ò.

40 2.2.6 Co-Immunoprecipitation

Protein G Sepharose beads50 (Table 2.1.1) were washed according to the following procedure.

Using a wide-mouth pipet tip, 500 μL of Protein G Sepharose beads were added to a 1.5 mL

Eppendorf microcentrifuge tube. The beads were centrifuged at 600 g for 60 seconds. The supernatant was removed using a 45° 27-gauge needle with vacuum. Beads were resuspended in

500 μL of 1% (v/v) NP-40 Lysis buffer (Table 2.1.3). This procedure was repeated 7 times.

Experimental cell lysates were pre-cleared to remove non-specific interactions by mixing 500 μL of each cell lysate with 100 μL of washed Protein G Sepharose beads. After mixing, samples were rotated for 2 hours at 4°C after which samples were spun at 20,000 g for one minute in a microcentrifuge and the supernatants transferred to Eppendorf tubes. Master mixes were prepared for the protein of interest and a negative IgG isotype control (Table 2.1.4) by mixing 100 μL pre- washed Protein G Sepharose beads with 50 μg/mL antibody. IP samples were prepared for each experimental sample by mixing 40 μL of each master mix with 200 μL of each pre-cleared cell lysate. IP samples were rotated for 16 hours at 4 °C after which samples were spun at 20,000 g for one minute in a microcentrifuge. IP samples were washed by removing the supernatants using a

45° 27-gauge needle with vacuum. Beads were then resuspended in 500 μL of 1% (v/v) NP-40

Lysis buffer. The wash procedure was repeated 7 times. SDS samples were prepared by removing the supernatant using a 45° 27-gauge needle with vacuum and adding 3X SDS sample buffer followed by vortex at low rpm and boiling at 100 °C for 7 minutes.

41 2.2.7 Immunocytochemistry/Immunofluorescence

Both differentiated wild type THP-1 cells and HEK293T cells transfected with NLRP3-AcGFP vector were grown to 70% confluence on Ibidi 8 well μ-slide chambered coverslips. After experimental treatments, cells were fixed for 15 minutes at 37 °C using 4% (v/v) paraformaldehyde in order to terminate and preserve ongoing biochemical activity51. Fixation effectively freezes cells and their contents in their current metabolic state. Aldehyde-based techniques achieve fixation through crosslinking. Paraformaldehyde (4% PFA) creates covalent bonds between proteins and their surroundings, effectively immobilizing cell contents52. In order to quench autofluorescence,

45 cells were treated 50 mM ammonium chloride (NH4Cl) for 10 minutes . All proteins are naturally fluorescent since several amino acids contain fluorophores as part of their side chains. In addition, paraformaldehyde reacts with amines to form additional fluorophores during the fixation process.

NH4Cl reacts with free aldehydes to quench any non-specific fluorescence. To allow antibodies access to the cellular interior, cells were permeabilized with 0.1% Triton X-100 for 5 minutes45.

Detergents disrupt the lipid bilayer that makes up the cell’s plasma membrane leading to openings in the membrane that allow antibody access to target proteins. To prevent antibodies binding non- specifically, cells were treated with IF Blocking Buffer (Table 2.1.3) for one hour. Cells were then slowly agitated for 16 hours at 4°C with primary antibodies for each target protein diluted in IF

Blocking Buffer to a final concentration of 5 μg/mL. The NLRP3 antibody (Adipogen AG-20B-

0014) was a monoclonal antibody, isotype mouse IgG2b. The ASC antibody (Adipogen AG-25B-

0006) was a polyclonal antibody, isotype rabbit IgG. The Hsp90 antibody (Santa Cruz sc-7947) was a polyclonal antibody, isotype rabbit IgG. After three consecutive washes at high rocker speed with 1X PBS for 5 minutes each, cells were slowly agitated for 1 hour at room temperature with species specific secondary antibodies conjugated with fluorescent dyes (Table 2.1.4) diluted 1:600

42 in IF Blocking Buffer. The secondary antibodies incorporate different fluorescent tags to allow each target protein to be distinguished53. After three consecutive washes at high rocker speed with

1X PBS for 5 minutes each, cells were slowly agitated for 10 minutes at room temperature with the DNA marker, Hoechst Nuclear Stain (Table 2.1.1) diluted in 1X PBS to a final concentration of 5 μg/mL. Cells were then washed at high rocker speed 3 consecutive times in 1X PBS for 5 minutes each. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-ElementsÒ software for acquisition, image processing and analysis. NLRP3 was visualized with an Alexa 488 tagged secondary antibody and its’ immunofluorescence was identified by monitoring the emission spectrum at 520 nm following excitation by a 488 nm laser. Hsp90 and ASC were visualized with an Alexa 568 tagged secondary antibody and its’ immunofluorescence was identified by monitoring the emission spectrum at 603 nm following excitation by a 561 nm laser. The nuclear compartment was visualized by staining

DNA with a HOESCHT fluorescent stain and was identified by monitoring the emission spectrum at 520 nm following excitation by ultraviolet light at 350 nm.

43 2.2.8 Proximity Ligation Assay (PLA)

The procedure for the Proximity Ligation Assay54 (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) is the same as Immunocytochemistry/Immunofluorescence (Section 2.2.7) up to and including application of primary antibodies. Following primary antibody incubation, the antibody solution was removed, and cells underwent three consecutive washes at high rocker speed using 1X Wash

Buffer A (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) for 5 minutes each wash. Plus and Minus

PLA probes (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) were diluted 1:5 in Antibody Diluent

(DuolinkÒ Red PLA Starter Kit - Table 2.1.2) and then applied to cells for 1 hour at 37°C. PLA probes are species-specific secondary antibodies with bound oligonucleotides of a specific length.

Following PLA probe incubation, the probe solution was removed, and cells underwent three consecutive washes at high rocker speed using 1X Wash Buffer A for 5 minutes each wash. Ligase enzymes with connector oligonucleotides (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) were diluted 1:40 in Ligation Buffer (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) and then applied to cells for 30 minutes at 37°C. If the target proteins are within 40 nm, the ligase enzymes will successfully connect the PLA probes using the connector oligonucleotides resulting in a closed, circular DNA template. Following ligation, the Ligation Buffer was removed, and cells underwent three consecutive washes at high rocker speed using 1X Wash Buffer A for 5 minutes each wash.

DNA polymerase enzymes (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) and fluorophore-labeled oligonucleotides (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) were diluted 1:80 in Amplification

Buffer (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) and then applied to cells for 100 minutes at

37°C. DNA polymerase uses the closed, circular DNA template to perform rolling-circle amplification resulting in a 1000-fold amplicon with hybridized fluorophore-labeled

44 oligonucleotides tethered to the PLA probes. Following amplification, the Amplification buffer solution was removed, and cells underwent two consecutive washes at high rocker speed using 1X

Wash Buffer B (DuolinkÒ Red PLA Starter Kit - Table 2.1.2) for 10 minutes each wash, followed by one wash at high rocker speed using 0.01X Wash Buffer B for one minute. DAPI Nuclear

Staining Buffer and Antifade Buffer (DuolinkÒ Nuclear Stain - Table 2.1.1) were diluted 1:10 in ddH2O and then applied to cells for 15 minutes at room temperature followed by three consecutive washes at high rocker speed using 1X PBS for 5 minutes each wash. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-ElementsÒ software for acquisition, image processing and analysis.

45 2.2.9 Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

2.2.9.1 RNA Isolation

THP-1 monocytes were differentiated into THP-1 macrophages using PMA and then treated or not using Hsp90 inhibitor, DMAG. Lipopolysaccharide (LPS) treatment for 4 hours was used or not to activate the NF-kB signaling pathway and therefore upregulate the NF-kB signaling pathway or not. Total RNA was isolated from harvested cell lysates with the RNeasyÒ Mini Kit (Table

2.1.2) as per the manufacturer's instructions47. Briefly, 400 μL of the manufacturer’s buffer (RLT buffer) with added b-mercaptoethanol (1:100) and 400 μL 70% ethanol were mixed with cell pellets harvested from 1X107 cells. b-mercaptoethanol disabled RNases while ethanol provided the conditions necessary for RNA binding to the spin column. Total RNA was bound to the spin column by adding 700 μL of the mixture to the supplied spin column followed by 15 seconds of centrifugation at 8,000 g. Contaminants were washed away by performing centrifugation for 15 sec at 8000 g using 700 μL of manufacturer buffer RWI followed by centrifugation for 15 sec at

8000 g using 500 μL of manufacturer buffer RPE. DNase I (Table 2.1.1) was added (1:10) to digest

DNase enzymes for 15 minutes prior to the RPE wash buffer step. To elute the RNA from the spin column 50 μL of elution buffer (RNase free H2O) is added to the spin column followed by 1 min centrifugation at 8,000 g. Thermo Scientific’s NanoDropÒ 2000c Spectrophotometer was used to determine the concentration of RNA extracted for each experimental sample. The concentration of each experimental sample is determined. This allowed all samples to be equalized to 2 µg RNA in 10 µL in RNase free H2O prior to cDNA synthesis. The quality of purified RNA was determined by measuring the ratio of absorbance at 260 nm and 280 nm. An A260/A280 ratio between 1.8 and

2.0 is acceptable.

46 2.2.9.2 cDNA Synthesis

Reverse transcription polymerase chain reaction (RT-PCR) was used to synthesize cDNA from 2

μg of isolated RNA using Invitrogen’s Moloney Murine Leukemia Virus Reverse Transcriptase

(M-MLV RT) kit47 (Table 2.1.2) per manufacturer’s instruction. Briefly, a 20 μL reaction volume containing 2 μg of total RNA was prepared. The 20 μl reaction volume was made of up of 8 μL master mix and 12 μL of RNA (2 μg total RNA diluted to 12 μL in RNase free H2O). The master mix contains random primers (Table 2.1.1), 0.1 M DTT, 10 mM dNTP mix and 200 U/ μL M-

MLV RT. Samples were incubated at 37°C for 50 minutes followed by 15 minutes at 70°C to inactivate the reaction.

2.2.9.3 Quantitative PCR

Dye-based real-time polymerase chain reaction (qPCR) was used to quantify the amount of IL-1b mRNA produced in each experimental treatment using BioRad’s SsoAdvancedÒ Universal

SYBRÒ Green Supermix47 (Table 2.1.2). Briefly, a 20 μl reaction volume containing 8 μl diluted cDNA and 12 μl of SYBRÒ Green master mix was prepared. The diluted cDNA was prepared by

Ò mixing 1 μl cDNA template (previously diluted 1:3) with 7 μl ddH2O. The SYBR Green master mix contained 10 μl 2X SsoAdvancedÒ Universal SYBRÒ Green SupermixÒ and 2 μl primers. The

Ò supermix contains the Sso7d-fusion polymerase, dNTPs, MgCl2, and SYBR Green I dye. The primers contain either 900 nM forward and reverse IL-1b primers (Table 2.1.1) or the endogenous control, the 20x 18s rRNA FAM/MGB probe (Table 2.1.1). Endogenous ribosomal RNA 18S primers were used as a housekeeping control. 18S rRNA is uniformly expressed regardless of experimental treatment. The forward primer sequence used for human IL-1b was

47 CTCTCTCCTTTCAGGGCCAA and the reverse primer sequence used for human IL-1b was

GCGGTTGCTCATCAGAATGT. Both primers are exon spanning to prevent binding to genomic

DNA. The primers were designed and verified using online tools: NCBI’s protein database FASTA

(IL-1b gene DNA sequence), Genscript Real Time PCR Primer Design (IL-1b forward and reverse primer sequence), NCBI’s BlastÒ database (confirm primer’s IL-1b gene specificity) and

Northwestern University’s OligocalcÒ (confirm primer design’s performance properties).

Following primer design confirmation, forward and reverse primers were ordered from Eurofins

Scientific. Amplification was performed in 96-well reaction plates using the CFX96 Touch™

Real-Time PCR Detection System (BioRad) and results were analyzed using the CFX ManagerÒ software. The results were expressed as fold change (2-ΔΔCt) in gene expression of IL-1b mRNA vs. 18s rRNA control for each experimental treatment.

48 2.2.10 Nuclear Fractionation

Following experimental treatments, supernatants were removed, and cells were washed twice in

DPBS (Table 2.1.1). Cells were harvested using 500 μL of Fractionation Buffer55 (Table 2.1.3) followed by scraping with a P200 pipet tip. Cell lysates were transferred to 1.5mL Eppendorf microcentrifuge tubes followed by agitation on a platform shaker in an ice bucket for 20 minutes.

Cell were lysed physically using needle stroke (minimum 10X up and down stroke of a 1 mL syringe with 27-gauge needle). After a further 20 minutes of agitation on a platform shaker in an ice bucket, 100 μL was transferred to a new 1.5 mL Eppendorf microcentrifuge tube (homogenate).

The remaining cell lysate was centrifuged at 720 g for 5 minutes to separate the cytosolic fraction from the nuclear fraction. The supernatant was transferred to a new 1.5 mL Eppendorf microcentrifuge tube and centrifuged at 13,000 rpm for 7 minutes at 4°C. This process was repeated and then the supernatant was transferred to a new 1.5 mL Eppendorf microcentrifuge tube

(cytosolic fraction). The remaining pellet was resuspended in 500 μL Fractionation Buffer and then centrifuged at 720 g for 5 minutes. The supernatant was discarded. This procedure was repeated and then the pellet was resuspended in 100 μL of RIPA Lysis Buffer (Table 2.1.3). After agitation on a platform shaker in an ice bucket for 10 minutes the nuclear membrane was lysed physically using needle stroke. The nuclear lysate was transferred to a QIA-shredder homogenizer and then centrifuged at 16,000 g for 2 minutes. The supernatant was transferred to a new 1.5 mL

Eppendorf microcentrifuge tube (nuclear fraction).

49 2.2.11 Statistical Analysis

All statistical analyses were performed using GraphPad PrismÒ 7.0 (GraphPad Software, La Jolla,

CA). Parametric data with three or more groups were analyzed using two-way analysis of variance

(ANOVA). Parametric data with less than three groups were analyzed using unpaired Student’s t- tests. Values are expressed as mean ± standard deviation (SD). Results with P values of p≤0.05 were considered statistically significant.

50 CHAPTER 3: RESULTS

3.1 Hsp90 Inhibitor, DMAG has an Effect on NLRP3 Function

3.1.1 Rationale

Hsp90 was described as being required for NLRP3’s canonical function namely, detecting danger signals (PAMPs/DAMPs) that lead to inflammasome activation and cytokine secretions in human immune cells28. The authors speculated that Hsp90, via its co-chaperone SGT1, maintains

NLRP3’s conformational competence allowing the NLR sensor to detect danger41. If this model is correct, then Hsp90’s role supporting NLRP3 is upstream and independent of inflammasome assembly and function. In our lab, NLRP3 was shown to be involved in an inflammasome- independent role in epithelial cells48. During TGF-b-mediated EMT, NLRP3 was required for the induction of Matrix metallopeptidase 9 (MMP-9) and a-smooth muscle actin (a-SMA) in renal tubular epithelial cells. A role for Hsp90 in support of this non-canonical NLRP3 function has not been described. We sought to first, confirm a role for Hsp90 in NLRP3’s canonical function of inflammasome activation in immune cells. We then sought to find evidence that Hsp90’s support for NLRP3 was upstream and independent of inflammasome activation by showing a role for

Hsp90 supporting NLRP3 in a known inflammasome-independent function in renal tubular epithelial cells.

51 3.1.2 DMAG Attenuates IL-1b Secretions from THP-1 Macrophages

In the current literature28,41, Hsp90 was shown to be required for secretion of active IL-1b from primary human monocytes. The monocytes were first treated with or without geldanamycin, a known Hsp90 inhibitor, followed by treatments with NLRP3 inflammasome agonists including monosodium urate, peptidoglycan and ATP. Secretions from the monocytes were then probed for active IL-1b. In cells with Hsp90 inhibited, IL-1b secretions were abrogated (Figure 4b from A

Crucial Function of SGT1 and Hsp90 in Inflammasome Activity28). In an attempt to reproduce these findings, THP-1 cells, a monocyte-like cell line derived from the peripheral blood of a human leukemia patient were used. THP-1 monocytes were differentiated into THP-1 macrophages using diacylglycerol-analog, PMA and then treated using an Hsp90 inhibitor, the geldanamycin analog,

DMAG. Nigericin, a microbial toxin and pore-forming ionophore that causes the potassium efflux detected by NLRP3, was used as an agonist for the NLRP3 inflammasome From Figure 3.1.2.1, without nigericin treatment the NLRP3 inflammasome is not activated and therefore IL-1b secretions were not present. Upon nigericin treatment alone, significant IL-1b secretions were present as shown by increased levels of cleaved IL-1b protein levels in the supernatant, confirming

NLRP3 inflammasome activation by the agonist, nigericin. The pan-caspase inhibitor ZVAD was used as a control for NLRP3 inflammasome inhibition. ZVAD blocks the protease Caspase 1’s ability to activate Pro-IL-1b by binding to the protease’s catalytic site, limiting activated IL-1b secretions from immune cells (Figure 3.1.2.1). Interestingly, DMAG was found to abrogate IL-1b secretions from differentiated THP-1 macrophages in the presence of NLRP3 inflammasome agonist, nigericin (Figure 3.1.2.1).

Figure 3.1.2.1: DMAG Attenuates IL-1b Secretions from THP-1 Cells. PMA-primed (100 nM,

16 hr) THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90 or

ZVAD (50 μM, 1 hr) to inhibit caspase 1. Nigericin (20 μM, 50 min) was used as an agonist of the

NLRP3 inflammasome. Supernatants were collected and used for immunoblotting to detect secreted IL-1b. (A) is a representative blot (B) Densitometry mean ± SD, over 3 independent experiments (n = 3). Fold change indicates cleaved IL-1b level following treatment compared to no treatment after normalizing to the loading control b-tubulin. Statistics defined as #, p < 0.05 comparing positive control (nigericin alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) treatment to positive control (nigericin alone), two-way

ANOVA with Tukey’s multiple comparisons test.

53 Following confirmation that DMAG treatment has an effect on IL-1b secretions from NLRP3 inflammasome-activated THP-1 immune cells, cell lysates were evaluated for effects of DMAG treatment on protein levels for other relevant proteins (Figure 3.1.2.2). The molecular chaperones

Hsp90 and SGT1 were found to be constitutively expressed and none of the treatments had any effect on their protein levels. Likewise, NLRP3 inflammasome components ASC and Caspase 1 proteins were constitutively expressed and protein levels were unaffected by DMAG treatments.

Interestingly, both NLRP3 and IL-1b precursor, Pro-IL-1b protein levels were abrogated. Both proteins are products of the NF-�B signaling pathway, activated during Signal 1 (or Priming) of

NLRP3 inflammasome activation. This suggests DMAG may have an effect on the NF-�B signaling pathway and not NLRP3 inflammasome activation. The protein NF-�B was found to be constitutively expressed, and none of the treatments had any effect on protein levels.

Figure 3.1.2.2: DMAG Attenuates NLRP3 and Pro-IL-1b Protein Levels in THP-1 Cells.

PMA-primed (100 nM, 16 hr) THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90 or ZVAD (50 μM, 1 hr) to inhibit caspase 1. Nigericin (20 μM, 50 min) was used as an agonist of the NLRP3 inflammasome. Cell lysates were collected and used for immunoblotting to detect secreted IL-1b. The figure is a representative blot, n=3.

55 In order to test the finding that DMAG had an impact of on IL-1b secretions from differentiated

THP-1 cells in the face of NLRP3 inflammasome agonist, nigericin, an alternative technique was used. Enzyme-linked immunosorbent assay (ELISA) was used to measure total IL-1b levels (both precursor Pro-IL-1b and activated IL-1b) secreted from differentiated THP-1 cells following nigericin stimulation. Nigericin was used as an agonist for the NLRP3 inflammasome. From Figure

3.1.2.3, without nigericin treatment, the NLRP3 inflammasome is not activated and therefore limited total IL-1b protein level was detected. Upon nigericin treatment alone, significantly higher total IL-1b protein level was detected, confirming NLRP3 inflammasome activation by the agonist, nigericin. With the NLRP3 inflammasome activated the positive control ZVAD limited total IL-1b protein levels; however, DMAG was found to significantly attenuate total IL-1b protein levels secreted from THP-1 immune cells using the ELISA technique (Figure 3.1.2.3).

Figure 3.1.2.3: DMAG Attenuates Total IL-1b Secretions from THP-1 Cells. PMA-primed

(100 nM, 16 hr) THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit

Hsp90 or ZVAD (50 μM, 1 hr) to inhibit caspase 1. Nigericin (20 μM, 50 min) was used as an agonist of the NLRP3 inflammasome. Supernatants were collected and used for ELISA to detect total IL-1b. The figure shows total IL-1b concentration mean ± SD, over 3 independent experiments (n = 3). Statistics defined as #, p < 0.05 comparing positive control (nigericin alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) treatment to positive control (nigericin alone), two-way ANOVA with Tukey’s multiple comparisons test.

57 Clostridium difficile–associated disease (CDAD) is a leading cause of nosocomial diarrhea.

Clostridium difficile (C. diff) toxins TcdA and TcdB were found to breach the intestinal barrier and trigger mucosal inflammation and intestinal damage. In our lab, C. diff toxins TcdA/B were shown to trigger IL-1b release by activating multiple NLR’s including the NLRP3 inflammasome in macrophages46. The pyrin inflammasome has also been implicated48. To provide additional evidence for Hsp90’s role in supporting NLRP3 function, C. diff toxins TcdA/B were used as an agonist for the NLRP3 inflammasome in differentiated THP-1 cells. A time course treatment of C. diff toxin TcdA/B was used. Treatment with C. diff toxin TcdA/B for one hour and six hours led to increasing levels of total IL-1b secretions from differentiated THP-1 cells. Following DMAG treatment, total IL-1b protein levels in response to six-hours of C. diff toxin TcdA/B treatment were significantly attenuated (Figure 3.1.2.4).

Figure 3.1.2.4: DMAG Attenuates C. diff toxin-mediated Total IL-1b. PMA-primed (100 nM,

16 hr) THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90. C. diff toxin TcdA/B (35 μg/mL, 1 hour and 6 hours) was used as an agonist of the NLRP3 inflammasome. Supernatants were collected and used for ELISA to detect total IL-1b. The figure shows IL-1b concentration mean ± SD, over 3 independent experiments (n = 3). Statistics defined as #, p < 0.05 comparing positive control (C. diff toxin TcdA/B alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) treatment to positive control (C. diff toxin TcdA/B alone), two-way ANOVA with Tukey’s multiple comparisons test.

59 3.1.3 DMAG Attenuates MMP-9 Induction in Tubular Epithelial Cells

The role of Hsp90 supporting NLRP3 occurs prior to and therefore upstream of NLRP3 inflammasome activation in immune cells. Hsp90 along with its co-chaperone SGT1 were described as dissociating from NLRP3 allowing inflammasome activation41. Therefore, Hsp90’s interaction with NLRP3 can be considered to be inflammasome-independent and not involved in inflammasome assembly. In order to determine if Hsp90’s role is independent of NLRP3 inflammasome assembly, we sought an inflammasome-independent role for NLRP3 in order to show that DMAG affects NLRP3 upstream of inflammasome activation. An inflammasome- independent role for NLRP3 has been described in renal tubular epithelial cells (TECs)48. NLRP3 was shown to be required for TGF-b signaling during the process of epithelial-mesenchymal transition (EMT). EMT induction leads to the increased expression of phenotype-modifying proteins such as MMP-9, MMP-2, and a-SMA. Following TGF-b stimulation, NLRP3-/- TECs showed reduced MMP9 protein levels compared to wild type TECs (Figure 2b from

Inflammasome-independent NLRP3 Augments TGF-b Signaling48). Does DMAG affect this

NLRP3 inflammasome-independent role during EMT in TECs? To test this, primary human TECs were cultured on collagen-coated plates to 80-90% confluency using K1 media. Hsp90 was inhibited using DMAG treatment. EMT was induced using TGF-b treatment. TGF-b activates the

TGF-b receptor complex leading to the dissociation of receptor-activated SMADs and the accumulation of a trimeric SMAD complex in the nucleus. The SMAD complex modulates the transcription of several target genes including MMP-9. Similar to the knock-out of NLRP3,

DMAG treatment was found to abrogate MMP-9 protein levels in primary TECs (Figure 3.1.3) suggesting Hsp90’s support for NLRP3 is inflammasome-independent and upstream of inflammasome assembly and function.

Figure 3.1.3: DMAG Attenuates MMP-9 Protein Levels in Tubular Epithelial Cells. TECs were cultured on 20 μg/mL collagen IV-coated plates to 80-90% confluence and then preincubated with and without DMAG (1 μM and 10 μM, for 72hrs) to inhibit Hsp90. TGF-b (10 ng/mL, 72hrs) was used to activate EMT. Cell lysates were collected and used for immunoblotting to detect secreted MMP-9. (A) is a representative blot (B) Densitometry mean ± SD, over 3 independent experiments (n = 3). Fold change indicates MMP-9 level following treatment compared to no treatment after normalizing to the loading control b-tubulin. Statistics defined as #, p < 0.05 comparing positive control (TGF-b alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) treatment to positive control (TGF-b alone), two-way

ANOVA with Tukey’s multiple comparisons test.

61 3.1.4 Summary

The results in this section demonstrate that treatment with Hsp90 inhibitor, DMAG, affects NLRP3 inflammasome-independent functions. NLRP3 inflammasome-mediated IL-1b secretions from differentiated monocyte-like THP-1 cells were significantly attenuated upon treatment with

DMAG. The bacterial toxin nigericin, known to promote NLRP3 inflammasome assembly was administered to THP-1 macrophages with and without DMAG treatment. Cleaved IL-1b protein levels secreted from the THP-1 cells were measured via western blot and densitometry. The result was replicated using total IL-1b ELISA experiments to measure both cleaved IL-1b secreted from

THP-1 cells and the precursor Pro-IL-1b, released as a result of pyroptosis. Further verification was demonstrated using a different known NLRP3 inflammasome agonist, C. diff toxin TcdA and

TcdB. IL-1b ELISA experiments using C. diff toxin TcdA/B as an agonist for inflammasome activation showed significantly reduced total IL-1b levels when comparing DMAG treated THP-

1 macrophages to untreated THP-1 macrophages. These results were consistent with the limited literature available that describes the Hsp90 and NLRP3 relationship. The literature describes

NLRP3 function dependent on Hsp90. This dependency is inflammasome-independent, occurring prior to inflammasome activation. In order to test this, the effects of DMAG treatment on NLRP3 function in a known inflammasome-independent role was tested. NLRP3-mediated MMP-9 protein expression from TGF-b-stimulated TECs during EMT was measured. MMP-9 protein levels were measured in DMAG treated TECs and untreated TECs and was found to be significantly attenuated in DMAG treated TECs. These results demonstrate that Hsp90 inhibitor,

DMAG has an effect on NLRP3 function in an inflammasome-independent manner consistent with the model described in the current literature. It needs to be recognized that DMAG has many

62 protein targets in the cell, not only Hsp90. DMAG inhibits all proteins with ATPase domains that contain the GHKL motif22,35. Many such proteins have been identified. Therefore, this lack of specificity for Hsp90 means we cannot conclusively say the effects seen in these experiments were attributed to Hsp90 alone. In order to mitigate this significant limitation, experiments should be repeated using more advanced techniques such as CRISPR. With CRISPR, the Hsp90 gene is knocked out, and therefore there is no Hsp90 protein in the cell. Still, there are significant challenges with this approach given that there are several Hsp90 isoforms in the cell and as has been reported, cell viability requires the Hsp90b isoform.

63 3.2 NLRP3-Hsp90 Protein Interactions Not Detected in THP-1 Cells

3.2.1 Rationale

The current literature with respect to NLRP3-Hsp90 protein-protein interactions is minimal. The sole paper containing experimental data describes multiple NLR proteins interacting with Hsp90 and its co-chaperone SGT128. However, all reported interactions involved co-immunoprecipitation studies using the protein overexpression cell line, HEK293T. HEK293T cells overexpressing

FLAG-tagged NLR proteins were found to interact with endogenous Hsp90 in complex with

SGT1. Using FLAG-tagged constructs of the individual domains of NLRP3, endogenous Hsp90 was found to interact via NLRP3’s LRR and NACHT domains while SGT1 was found to interact via NLRP3’s LRR domain. Neither protein interacted with NLRP3’s PYD domain. Interestingly however, when using the immune cell line THP-1, protein-protein interactions between endogenous Hsp90 and endogenous NLRP3 were not shown28. Following this work, the authors published a second paper describing a proposed model of NLRP3-Hsp90 interaction41. Hsp90 was described as holding NLRP3 functionally competent during homeostatic conditions, allowing

NLRP3 to perform its’ main role as a sensor protein detecting danger signals (DAMPs/PAMPs).

The paper goes on to describe Hsp90 releasing NLRP3 allowing oligomerization and NLRP3 inflammasome formation. However, in this paper no experimental data were provided supporting this model of interaction. We sought to test this model of interaction by detecting a protein-protein interaction between endogenous NLRP3 and endogenous Hsp90 using the THP-1 immune cell line.

64 3.2.2 NLRP3-Hsp90 Protein Interactions Not Detected using Co-immunoprecipitation

The immune cell line THP1 was used to test the current literature’s description of a protein-protein interaction between NLRP3-Hsp90 upstream of NLRP3 inflammasome activation28,41. The technique co-immunoprecipitation (Co-IP) was used to ‘pull-down’ endogenous NLRP3 from whole cell lysates using NLRP3 primary antibodies bound to Protein G-coated Sepharose beads.

Following protein separation via SDS-PAGE, western blot analysis was used to detect Hsp90.

Prior to Co-IP, THP1 monocytes were first differentiated to THP1 macrophages using PMA treatment. Some cells were then treated with nigericin to activate the NLRP3 inflammasome while the remaining cells were left untreated. An IgG isotype control primary antibody bound to protein

G-coated Sepharose beads was used as a negative control. As a positive control, whole cell lysates were blotted to test the presence of both target proteins prior to co-immunoprecipitation. While the positive control showed the presence of both NLRP3 and Hsp90 proteins in the whole cell lysates and the negative control Co-IP samples were absent of proteins as expected, the presence of Hsp90 was not detected in Co-IP samples either before or after NLRP3 inflammasome activation despite successfully ‘pulling down’ NLRP3 protein (Figure 3.2.2). Protein levels were lower in Nigericin treated cell lysates due to the loss of protein from pyroptosis following inflammasome activation.

Figure 3.2.2: No Evidence NLRP3 Interacts with Hsp90 using Co-IP. PMA-primed (100 nM,

16 hr) THP-1 cells were treated with or without NLRP3 inflammasome agonist Nigericin (20 μM,

50 min). Cell lysates were collected and used for immunoblotting to detect NLRP3 and Hsp90

(input). Cell lysates were also mixed with G protein coated Sepharose beads with or without

NLRP3 antibodies (Table 2.1.4) to capture endogenous NLRP3 protein and other proteins with binding interactions with NLRP3. After washing to remove contaminants and non-specific interactions, samples were used for immunoblotting. Primary antibodies were used to detect

NLRP3 and Hsp90 protein and HRP-conjugated secondary antibodies were used to visualize the proteins (Table 2.1.4). The figure is a representative blot, n = 3.

66 3.2.3 NLRP3-SGT1 Protein Interactions Not Detected using Co-immunoprecipitation

NLRP3-Hsp90 protein-protein interactions with Hsp90’s co-chaperone SGT1 were also explored.

The current literature showed NLRP3 interaction with SGT1 in complex with Hsp90 in a

HEK293T overexpression system. We sought to identify this interaction in the THP-1 immune cell line. Co-IP was again used to ‘pull-down’ endogenous NLRP3 from whole cell lysates using

NLRP3 primary antibodies bound to Protein G-coated Sepharose beads. While the positive control showed the expression of NLRP3, Hsp90 and SGT1 in the whole cell lysates and the negative control samples were absent of proteins as expected, neither the presence of SGT1 nor Hsp90 was detected before or after NLRP3 inflammasome activation despite successfully ‘pulling down’

NLRP3 protein (Figure 3.2.3.1). Protein levels were lower in Nigericin treated cell lysates due to the loss of protein from pyroptosis following inflammasome activation.

Figure 3.2.3.1: No Evidence NLRP3 Interacts with SGT1 or Hsp90 using Co-IP. PMA-primed

(100 nM, 16 hr) THP1 cells were treated with or without NLRP3 inflammasome agonist Nigericin

(20 μM, 50 min). Cell lysates were collected and used for immunoblotting to detect NLRP3, SGT1 and Hsp90 (input). Cell lysates were also mixed with G protein coated Sepharose beads with or without NLRP3 antibodies (Table 2.1.4) to capture endogenous NLRP3 protein and other proteins with binding interactions with NLRP3. After washing to remove contaminants and non-specific interactions, samples were used for immunoblotting. Primary antibodies were used to detect

NLRP3, SGT1 and Hsp90 protein and HRP-conjugated secondary antibodies were used to visualize the proteins (Table 2.1.4). The figure is a representative blot, n = 3.

68 A further Co-IP experiment was conducted that reversed the target ‘bait’ protein (Figure 3.2.3.2).

In this experiment, endogenous SGT1 was ‘pulled-down’ from whole cell lysates using SGT1 primary antibodies bound to Protein G-coated Sepharose beads. Again, neither the presence of

NLRP3 nor Hsp90 was not detected before or after NLRP3 inflammasome activation despite successfully ‘pulling down’ SGT1 protein.

Figure 3.2.3.2: No Evidence SGT1 Interacts with NLRP3 or Hsp90 using Co-IP. PMA-primed

(100 nM, 16 hr) THP1 cells were treated with or without NLRP3 inflammasome agonist Nigericin

(20 μM, 50 min). Cell lysates were collected and used for immunoblotting to detect NLRP3 and

Hsp90 (input). Cell lysates were also mixed with G protein coated Sepharose beads with or without

SGT1 antibodies (Table 2.1.4) to capture endogenous SGT1 protein and other proteins with binding interactions with SGT1. After washing to remove contaminants and non-specific interactions, samples were used for immunoblotting. Primary antibodies were used to detect

NLRP3, SGT1 and Hsp90 protein and HRP-conjugated secondary antibodies were used to visualize the proteins (Table 2.1.4). The figure is a representative blot, n = 3.

70 3.2.4 NLRP3-Hsp90 Protein Colocalization Not Detected using Immunofluorescence

The technique Co-IP is inexpensive and useful but often fails to detect weak protein interactions.

If the interaction is transient in nature or a weak electrostatic interaction, the physical processing of the assay may be enough to disrupt the protein-protein interaction. Immunofluorescence (IF) can be used to mitigate these concerns56. Immunofluorescence based techniques detect protein colocalizations as opposed to direct binding interactions. Target proteins were labelled with fluorescent tags, and when used in conjunction with confocal microscopy, can be visualized at the emission spectrum for each of the fluorescent dyes upon excitation. If the target proteins were in close proximity, such as would be the case for proteins with binding interactions, the two distinct emission spectrums can blend together and a third emission spectrum emerges57. The emergence of a third emission spectrum can be evidence of a protein-protein interaction. A control experiment was conducted to determine the difference between the presence of protein-protein interactions and the absence of protein-protein interactions. The proteins NLRP3 and ASC were chosen as target proteins. These proteins are known to interact via inflammasomes upon activation58.

Nigericin was the chosen activator. In the no treatment panel (Figure 3.2.4.1), both target protein’s expected emission spectrums appear as distinct patches with very little overlap. There was no evidence of a third emission spectrum in this image and therefore the negative control images labeled “No Treatment” were a positive indication of the absence of protein colocalization. The appearance changes considerably upon Nigericin treatment. Firstly, only the nuclear compartment of a number of cells was detected. This indicates ongoing pyroptosis as expected. Secondly, for a number of cells both NLRP3 and ASC oligomers were forming as seen by the large, distinct immunofluorescence signals at the individual emission spectrum expected for each fluorescent dye. Thirdly, these oligomers appeared to be associating since there are several examples of large,

71 distinct immunofluorescence signals in close proximity. Finally, there is evidence of several cells with merged immunofluorescence signals at a distinctive third emission spectrum, indicative of protein colocalization. Along with the evidence presented in the current literature characterizing

NLRP3 inflammasomes, the images in Figure 3.2.4.1 labeled “60 min. Nigericin” are a valid positive control for protein colocalization.

Figure 3.2.4.1: NLRP3-ASC Protein Colocalization using IF. PMA-primed (100 nM, 16 hr)

THP-1 cells were treated with or without NLRP3 inflammasome agonist Nigericin (20 μM, 60 min). Cell lysates were then fixed with 4% PFA for 15 minutes, followed by auto-fluorescence quenching with 50mM NH4Cl for 10 minutes. Cell were permeabilized with 0.1% Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours

73 incubation at 4°C with 5 μg/mL NLRP3 primary antibody raised in mice and 5 μg/mL ASC primary antibody raised in rabbits. Following washes, cells were incubated for one hour at room temperature with 1:600 dilution mouse secondary antibody tagged with Alexa 488 dye and 1:600 dilution rabbit secondary antibody tagged with Alexa 568 dye. Cells were incubated with DNA marker, 5 μg/mL Hoechst dye for 10 minutes at RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figures are representative images, n = 3.

74 Following a positive result for the immunofluorescence control experiment, NLRP3-Hsp90 protein colocalizations were investigated (Figure 3.2.4.2). The identical procedure was followed with the exception of using an Hsp90 primary antibody raised in rabbits instead of the ASC primary antibody raised in rabbits. The same secondary antibody, rabbit IgG tagged with Alexa 568 dye was used. As reported in the current literature, NLRP3-Hsp90 protein-protein interactions occur prior to NLRP3 inflammasome activation and therefore protein colocalizations should be detected in the “No Treatment” condition. As a control, NLRP3-Hsp90 protein-protein interactions were also evaluated following NLRP3 inflammasome activation using nigericin (Figure 3.2.4.2). The image shows distinct NLRP3 oligomers appearing as large, distinct immunofluorescence signals, the signature of NLRP3 inflammasome formation.

Figure 3.2.4.2: No Evidence of NLRP3-Hsp90 Protein Colocalizations using IF. PMA-primed

(100 nM, 16 hr) THP1 cells were treated with or without NLRP3 inflammasome agonist Nigericin

(20 μM, 50 min). Cell lysates were then fixed with 4% PFA for 15 minutes, followed by auto- fluorescence quenching with 50mM NH4Cl for 10 minutes. Cell were permeabilized with 0.1%

Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours incubation at 4°C with 5 μg/mL NLRP3 primary antibody raised in mice and 5 μg/mL Hsp90 primary antibody raised in rabbits. Following washes, cells were incubated for one hour at room

76 temperature with 1:600 dilution mouse secondary antibody tagged with Alexa 488 dye and 1:600 dilution rabbit secondary antibody tagged with Alexa 568 dye. Cells were incubated with DNA marker, 5 μg/mL Hoechst dye for 10 minutes at RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figures are representative images, n = 3.

77 When comparing the NLRP3-Hsp90 image to the negative control NLRP3-ASC image (Figure

3.2.4.3), the images were very similar despite the fact that Hsp90 appears to localize more towards the plasma membrane while ASC appears to localize more towards the nucleus. Both target protein’s expected emission spectrums appear as distinct patches with very little overlap and no evidence of a third emission spectrum detected. To summarize, following these results, we conclude that using the technique immunofluorescence, there was no evidence for NLRP3-Hsp90 protein colocalization and therefore NLRP3-Hsp90 protein-protein interactions in THP-1 immune cells upstream of NLRP3 inflammasome activation were not detected.

Figure 3.2.4.3: Comparison of NLRP3-ASC and NLRP3-Hsp90 Protein Colocalizations. No

Treatment conditions from Figure 3.2.4.1 and Figure 3.2.4.2 are repeated. The portion of the image highlighted in the white square has been magnified for clarity.

3.2.5 NLRP3-Hsp90 Protein Colocalizations Not Detected using PLA

Following failure to detect endogenous NLRP3-Hsp90 protein-protein interactions in THP-1 immune cells using either co-immunoprecipitation or immunofluorescence, a third technique, proximity ligation assay (PLA) was deployed. Proximity ligation assay is similar to immunofluorescence in that it is an imaging technique used to detect protein colocalizations; however, there are also significant differences. The results of a PLA assay are both sensitive and quantifiable54. Protein colocalizations within 40 nm are detected and are visualized as immunofluorescence signals at a specified emission spectrum. These signals can be counted both before and after treatments and the results statistically analyzed. The experimental plan deployed was similar to immunofluorescence. A control experiment was conducted using proteins known to form binding interactions in the presence of an activator. As before, NLRP3 and ASC were chosen.

These proteins were known to form binding interactions within NLRP3 inflammasome structures upon treatment with known agonists, such as nigericin. The PLA assay was performed both prior to and after NLRP3 inflammasome in order to establish a negative control image and a positive control image (Figure 3.2.5.1). In the “No Treatment” images prior to inflammasome activation,

DAPI stained cellular nuclei were visible along with several immunofluorescence signals at the expected emission spectrum. The signals were the readout from the PLA assay confirming that a protein colocalization has been detected. In this case, the signals represent random NLRP3-ASC colocalizations as well as non-specific binding of the PLA probes. The number and density of the dots in the negative control readout can be tuned by (1) incubation times, (2) antibody concentration levels and (3) number of wash steps. It is important to have greater than zero PLA signals in the negative control in order to have a reference level to compare both experimental

80 samples and the positive control against (i.e. avoid dividing by zero). The positive control image shows the PLA signals following nigericin-mediated NLRP3 inflammasome activation. As can be seen, the image has changed considerably. There were a significantly higher number of PLA signals per cell nucleus. This shows clearly which cells have active inflammasome structures.

Figure 3.2.5.1: NLRP3-ASC Protein Colocalization using PLA. PMA-primed (100 nM, 16 hr)

THP-1 cells were treated with or without Nigericin (20 μM, 60 min). Cell lysates were then fixed with 4% PFA for 15 minutes, followed by auto-fluorescence quenching with 50 mM NH4Cl for

10 minutes. Cell were permeabilized with 0.1% Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours incubation at 4°C with 5 μg/mL NLRP3 primary antibody raised in mice and ASC primary antibody raised in rabbits. Cells were incubated for one hour at 37°C with Plus and Minus PLA Probes, one hour at 37°C with ligase enzymes and connector oligonucleotides, 100 minutes at 37°C with DNA Polymerase enzymes, followed by incubation with detection oligonucleotides. Cells were incubated with DNA marker, Duolink®

Nuclear Stain diluted 1:10 for 15 minutes at RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figures are representative images, n = 3. The portion of the image highlighted in the white square has been magnified for clarity.

83 Following a positive result for the PLA control experiment, NLRP3-Hsp90 protein colocalizations were investigated. The identical procedure was followed with the exception of using

Hsp90 primary antibodies instead of ASC primary antibodies. As shown in Figure 3.2.5.2, the

NLRP3-Hsp90 No Treatment image shows a very similar pattern of PLA signal detection as the negative control, NLRP3-ASC No Treatment image. Both the NLRP3-Hsp90 and NLRP3-ASC

No Treatment images show the low quantity and low density of PLA signals expected of random protein colocalizations and non-specific antibody binding. As a control, NLRP3-Hsp90 protein colocalizations were also evaluated following NLRP3 inflammasome activation using nigericin.

As shown in Figure 3.2.5.2, the image captured following nigericin treatment also shows a very similar pattern of PLA signal detection as the negative control NLRP3-ASC No Treatment image.

Following the use of the PLA technique, there was no evidence for NLRP3-Hsp90 protein colocalizations in THP-1 immune cells upstream of NLRP3 inflammasome activation.

Figure 3.2.5.2: No Evidence of NLRP3-Hsp90 Protein Colocalization using PLA. PMA- primed (100 nM, 16 hr) THP-1 cells were treated with or without Nigericin (20 μM, 60 min). Cell lysates were then fixed with 4% PFA for 15 minutes, followed by auto-fluorescence quenching with 50 mM NH4Cl for 10 minutes. Cell were permeabilized with 0.1% Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours incubation at 4°C with

5 μg/mL NLRP3 primary antibody raised in mice and Hsp90 primary antibody raised in rabbits.

Cells were incubated for one hour at 37°C with Plus and Minus PLA Probes, one hour at 37°C with ligase enzymes and connector oligonucleotides, 100 minutes at 37°C with DNA Polymerase enzymes, followed by incubation with detection oligonucleotides. Cells were incubated with DNA marker, Duolink® Nuclear Stain diluted 1:10 for 15 minutes at RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figures are representative images, n = 3. The portion of the image highlighted in the white square has been magnified for clarity.

86 A key benefit of the proximity ligation assay is the ability to quantify the results by simply counting the PLA signals. As described in other publications using PLA, the signal to cell ratio was evaluated59. The signal to cell ratio was evaluated for both the negative and positive control images for NLRP3-ASC prior to and after NLRP3 inflammasome activation, and the images for NLRP3-

Hsp90 prior to and after NLRP3 inflammasome activation (Figure 3.2.5.3). The results show a statistically important 4-fold increase in the signal to cell ratio for NLRP3-ASC protein colocalization upon NLRP3 inflammasome activation. This shows the assay has accurately detected the two known conditions for NLRP3-ASC protein colocalizations: (1) the two proteins have no binding interactions prior to NLRP3 inflammasome activation, and (2) the two proteins oligomerize and interact by forming inflammasome structures after NLRP3 inflammasome activation. Comparing the NLRP3-Hsp90 results to the controls, there is no significant change from the NLRP3-ASC negative control indicating that there is no evidence for NLRP3-Hsp90 protein colocalization both prior to and after NLRP3 inflammasome activation.

Figure 3.2.5.3: Quantification of NLRP3-Hsp90 Protein Colocalizations. PMA-primed (100 nM, 16 hr) THP-1 cells were treated with or without Nigericin (50 μM, 60 min) in order to activate the NLRP3 inflammasome. Following treatments, cells were fixed (4% PFA), quenched (50mM

NH4Cl), and permeabilized (0.1% Triton X-100). Non-specific binding interaction with antibodies were blocked (3% filtered BSA) followed by 16 hours incubation with NLRP3 and Hsp90 primary antibodies. The proximity ligation assay (PLA) was used to detect protein co-localizations. PLA signals were detected using confocal microscopy allowing quantification and analysis. Data shown are mean count ± SD, over 4 independent experiments (n = 4). Fold change indicates NLRP3-

Hsp90 protein colocalizations compared to NLRP3-ASC protein colocalizations for both no treatment and after nigericin treatment after normalizing to NLRP3-ASC no treatment. Statistics defined as p < 0.05 comparing to positive control (nigericin) and not significant (n.s.) compared to negative control (no treatment), two-way ANOVA with Tukey’s multiple comparisons test.

88 3.2.6 Summary

The results described in this chapter indicate a discrepancy with the current literature. Using THP-

1 immune cells, no evidence of a protein-protein interaction between NLRP3 and Hsp90 was detected. Using the current literature as a guide, we performed co-immunoprecipitation experiments. NLRP3 antibodies were used as bait to pulldown NLRP3 from whole cell lysates both prior to and after inflammasome activation. In neither case was Hsp90 detected. Co- immunoprecipitation studies were then carried out to investigate protein-protein interactions between NLRP3 and SGT1. NLRP3 antibodies were used to pulldown NLRP3 from whole cell lysates both prior to and after inflammasome activation. In neither case was SGT1 or Hsp90 detected. SGT1 antibodies were then used to pulldown SGT1 from whole cell lysates both prior to and after inflammasome activation. In neither case was NLRP3 or Hsp90 detected. Co- immunoprecipitation is known for its failure to detect protein-protein interaction when those interactions are weak binding interactions or intermittent and temporary in nature. The processing of IP samples can be chemically or physically harsh disrupting non-covalent interaction. To address this concern, additional biochemical techniques were deployed. Immunofluorescence confocal microscopy and Proximity Ligation Assay both reveal protein colocalizations through the visualization of the emission spectrums of bound fluorophores. Using IF, a control experiment was performed to evaluate a known protein-protein interaction and a known absence of protein-protein interaction. NLRP3 is known to associate with ASC following the formation of inflammasomes and is known to not associate with ASC prior to inflammasome formation. IF experiments were then conducted to evaluate protein co-localization between NLRP3 and Hsp90 both prior to and after inflammasome activation. According to the current literature, NLRP3 and Hsp90 should be colocalizing prior to NLRP3 inflammasome formation; however, the results closely approximated

89 the negative control experiment indicating the absence of close proximity between NLRP3 and

Hsp90. Colocalization of NLRP3 and Hsp90 was not detected using the technique IF. PLA was then performed as a third technique attempting to detect protein colocalizations between NLRP3 and Hsp90. PLA detects colocalizations between proteins of < 40 nm and using fluorescence, indicates a positive result as an immunofluorescence signal at a predetermined emission spectrum.

This allows quantification and statistical analysis of the results by simply counting the signals.

Like IF, control experiments were performed to give an indication of a known protein-protein interaction and a known absence of protein-protein interaction. NLRP3 and ASC protein colocalizations were examined both prior to and after inflammasome activation in THP-1 immune cells using the technique PLA and the results were quantified. The results show a statistically important increase in detected protein colocalization between NLRP3 and ASC after activation of the NLRP3 inflammasome compared to prior to activation of the NLRP3 inflammasome.

Following a positive result for the control experiments, protein colocalizations were examined between NLRP3 and Hsp90 using PLA. The results showed a statistically important difference between NLRP3-Hsp90 protein colocalizations both prior to and after NLRP3 inflammasome activation and the positive control, NLRP3-ASC protein colocalization following NLRP3 inflammasome formation. There was no statistically important difference between NLRP3-Hsp90 protein colocalizations and NLRP3-ASC protein colocalization prior to NLRP3 inflammasome formation. Therefore, using the technique proximity ligation assay, there is an absence of protein colocalizations within 40 nm between proteins NLRP3 and Hsp90 using THP-1 immune cells.

Even though the positive control experiments confirmed the known literature description that

NLRP3-ASC interact following inflammasome activation, some consideration should be given to limitations of the PLA assay. All types of chemical bonds, from covalent bonds to Vander Waals,

90 have bond lengths known to be under 1 nm60. Therefore, protein-protein interactions should place two proteins within 1 nm of each other. The PLA assay only detects protein colocalizations within

40 nm. Given this limitation, it is important to understand that a positive signal from the PLA assay does not imply that a protein-protein interaction has been detected. The determination of a protein- protein interaction requires the positive confirmation from multiple techniques. To summarize the results described in this chapter, using three separate techniques namely, co-immunoprecipitation, immunofluorescence and proximity ligation assay, there is no evidence of protein-protein interactions between endogenous NLRP3 and endogenous Hsp90 in THP-1 immune cells.

91 3.3 NLRP3-Hsp90 Protein Colocalizations Detected in Transfected HEK293T cells

3.3.1 Rationale

The sole publication with experimental data describing NLRP3-Hsp90 protein-protein interactions used the HEK293T cell line to show the interactions28. These cells were transfected with plasmid

DNA containing genes for: (1) full-sized proteins with FLAG-tags and (2) polypeptide constructs representing the individual domains of proteins with FLAG-tags. While this type of experimental system can be useful to study the activity of proteins and the activity of individual domains of proteins, protein expression can be excessive compared to natural cell lines unless it is specifically controlled. Interestingly, the paper does have one figure showing the results of a co- immunoprecipitation experiment using the THP-1 cell line expressing natural protein levels and not the HEK293T protein overexpression cell line. Using the THP-1 cell line, the researchers used

NLRP3 antibodies to pull down endogenous NLRP3 protein and failed to show Hsp90 interacting with NLRP3 (Figure 1e from A Crucial Function of SGT1 and Hsp90 in Inflammasome

Activity28). Although they don’t describe this absence of Hsp90 interacting with NLRP3, they would have undoubtedly shown the interaction if it had been detected, since NLRP3-Hsp90 protein interactions are the basis of their paper. The experiments described in section 3.2 sought to detect

NLRP3-Hsp90 protein-protein interactions between endogenous, un-tagged proteins, at natural expression levels in THP-1 immune cells. NLRP3-Hsp90 protein-protein interactions failed to be detected in this environment using multiple techniques. In this section, a HEK293T protein overexpression cell line that was stably expressing GFP-tagged NLRP3 was acquired, characterized and then evaluated.

92 3.3.2 Transfected HEK293T Cell Line Stably Expresses NLRP3-GFP

Prior to experiments, a test using selective media was performed to test the identity of the experimental cell lines. As shown in Table 3.3.2 wild type HEK293 cells have no antimicrobial resistance, wild type HEK293T cells are resistant to neomycin and the transfected cell line

HEK293T-NLRP3-AcGFP have both neomycin and kanamycin resistance. These results are as expected for the respective cell lines.

Table 3.3.2: Selection Markers Confirm HEK293 Cell Lines. Cells were grown in media supplemented with antibiotics neomycin and kanamycin at 1 mg/mL according to the table above.

Successful cell proliferation is indicated by the symbol ‘✓’ while cell death is indicated by ‘X’.

93 To further characterize the cells, a protein inventory assay was performed. Cells were treated or not with lipopolysaccharide (LPS) for 4 hours in order to activate the NF-kB signaling pathway.

A western blot was then performed, and nitrocellulose membranes were probed for a variety of relevant proteins. (Figure 3.3.2.1). THP-1 cells were used as a positive control to show the normal immunofluorescence for the relevant proteins for comparison purposes. Wild-type HEK293T cells, known to not express any of the NLRP3 inflammasome component proteins (e.g. NLRP3,

Pro-IL-1b, Caspase 1, ASC), were used as a negative control. The results show that THP-1 cells express NLRP3 at a nominal level and LPS treatment upregulates NLRP3 modestly. Wild-type

HEK293T cells do not express NLRP3. While the transfected HEK293T-NLRP3-AcGFP cell line significantly overexpresses NLRP3 protein as compared to the THP-1 cell line. Only the

HEK293T-NLRP3-AcGFP cell line expresses the GFP tag, while both the THP-1 and Wild-type

HEK293T cells do not, confirming the presence of the GFP-tagged gene. All cell types express

Hsp90 and the loading control marker b-tubulin. Only THP-1 cells express the NLRP3 inflammasome component proteins Caspase 1, ASC and Pro-IL-1b.

Figure 3.3.2.1: HEK293T-NLRP3-AcGFP Cell Line Overexpresses NLRP3. PMA-primed

(100 nM, 16 hr) THP1 cells and seeded HEK293T and HEK293T-NLRP3-AcGFP cells were treated or not with lipopolysaccharide (LPS) (100 ng/mL for 4 hours) as an agonist for the NF-kB signaling pathway. Cell lysates were collected and used for immunoblotting to detect the protein expression indicated. NT = no treatment. Two exposures for NLRP3 are shown. One optimized for THP-1 cells, the other optimized for HEK293T-NLRP3-AcGFP cells. The figure is a representative blot, n = 3.

95 Immunofluorescence was used as an alternative technique to characterize the cells by verifying the fluorescence of the GFP tag covalently bound to NLRP3. A control experiment was conducted to compare wild-type HEK293T cells and HEK293T-NLRP3-AcGFP cells (Figure 3.3.2.2). An

Alexa 488 tagged secondary antibody was used in an attempt to visualize NLRP3 in the wild-type

HEK293T cells while no secondary antibody was needed for the HEK293T-NLRP3-AcGFP cells since the GFP-tag’s immunofluorescence was detected. An Alexa 568 tagged secondary antibody was used to test Hsp90 expression in the HEK293T cell line. The nuclear compartment was detected by staining DNA with a HOESCHT fluorescent stain. Using wild-type HEK293T only, the nuclear compartment was visualized as expected. When treating wild-type HEK293T with both

Alexa 488 tagged and Alexa 568 tagged secondary antibodies, only the Alex 568 tagged Hsp90 was detected as expected. The nuclear compartment was also detected. Using HEK293T-NLRP3-

AcGFP without secondary antibodies, NLRP’s GFP fluorescent tag was detected as well as the

HOESCHT stained nuclear compartment. This experiment confirms the previous western blot results (Figure 3.3.2.1) that showed the wild-type HEK293T cells do not express NLRP3 but do express Hsp90 and the stably transfected HEK293T-NLRP3-AcGFP cells express NLRP3.

Figure 3.3.2.2: Hsp90 and NLRP3 Expressed in HEK293T-NLRP3-AcGFP Cells. After cell seeding, cells were fixed with 4% PFA for 15 minutes, followed by auto-fluorescence quenching with 50 mM NH4Cl for 10 minutes. Cell were permeabilized with 0.1% Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours incubation at 4°C or not with 5 μg/mL NLRP3 primary antibody raised in mice and 5 μg/mL Hsp90 primary antibody raised in rabbits. Following washes, cells were incubated for one hour at room temperature or not with 1:600 dilution mouse secondary antibody tagged with Alexa 488 dye and 1:600 dilution rabbit secondary antibody tagged with Alexa 568 dye. Cells were incubated with DNA marker, 5 μg/mL

Hoechst dye for 10 minutes at RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figure shows individual cells from representative images, n = 3.

97 3.3.3 NLRP3-Hsp90 Protein Interactions Detected using Immunofluorescence

Immunofluorescence was employed in an attempt to detect protein colocalization between NLRP3 and Hsp90 in the HEK293T-NLRP3-AcGFP cell line. Like the control experiment described earlier, Alexa 568 tagged secondary antibodies were bound to Hsp90 primary antibodies in order to visualize Hsp90’s localization while the GFP fluorophore covalently bound to NLRP3 allowed detection of NLRP3 localization. The cellular nuclear compartment was stained using Hoechst dye. The experiment was conducted under no treatment conditions since the current literature describes Hsp90 stabilizing NLRP3 during the homeostatic conditions of the cell41. As can be seen in Figure 3.3.3, a merger of the individual emission spectrums is detected in those cells expressing the GFP fluorophore. This indicates potential protein colocalization between NLRP3-GFP and

Hsp90 in HEK293T-NLRP3-AcGFP cells under no treatment condition using immunofluorescence.

Figure 3.3.3: NLRP3-Hsp90 Protein Colocalization Detected in HEK293T. After cell seeding, cells were fixed with 4% PFA for 15 minutes, followed by auto-fluorescence quenching with

50mM NH4Cl for 10 minutes. Cell were permeabilized with 0.1% Triton X-100 for 5 minutes followed by blocking with 3% filtered BSA for one hour and then 16 hours incubation at 4°C with

5 μg/mL Hsp90 primary antibody raised in rabbits. Following washes, cells were incubated for one hour at room temperature or not with 1:600 dilution rabbit secondary antibody tagged with

Alexa 568 dye. Cells were incubated with DNA marker, 5 μg/mL Hoechst dye for 10 minutes at

RT. Confocal microscopy was then performed using a Nikon A1R laser scanning confocal microscope running NIS-Elements software for acquisition, image processing and analysis. The figures are representative images, n = 3.

99 3.3.4 NLRP3-Hsp90 Protein Interactions Not Detected using Co-immunoprecipitation

The HEK293T-NLRP3-AcGFP cell line was used in an attempt to detect a protein-protein interaction between NLRP3-Hsp90 using the same technique as described in the current literature, namely co-immunoprecipitation. However, since the cells acquired for experiments incorporated a NLRP3-GFP construct, the GFP-tag was used as bait instead of using the FLAG-tag described in the current literature28. While the positive control showed the expression of NLRP3, GFP,

Hsp90 and SGT1 in the whole cell lysates and the negative control IP samples was absent of proteins, the presence of Hsp90 and SGT1 was not detected in the experimental IP samples despite successfully ‘pulling down’ both NLRP3 and GFP protein (Figure 3.3.4).

100

Figure 3.3.4: No Evidence Hsp90/SGT1 Interacts with NLRP3-GFP in HEK293T Cells. Cell lysates from HEK293T-NLRP3-AcGFP cells were collected and used for immunoblotting to detect NLRP3, GFP, Hsp90 and SGT1 (input). Cell lysates were also mixed with G protein coated

Sepharose beads bound with GFP antibodies to capture NLRP3-GFP protein and any other proteins with binding interactions with NLRP3. After washing to remove non-specific interactions, samples were used for immunoblotting to detect NLRP3-GFP, Hsp90 and SGT1. IgG isotype control antibodies were used as a negative control. A long exposure time of 5 minutes was performed in an attempt to detect Hsp90 and SGT1. The figure is a representative blot, n = 3.

101 3.3.5 Summary

After multiple failed attempts to detect NLRP3 and Hsp90 protein-protein interactions between endogenous proteins at natural expression levels in THP1 immune cells, this section focused on trying to replicate the findings described in the current literature. The current literature uses the

HEK293T cell line, transfected with an NLRP3 gene, to allow overexpression of NLRP3 protein.

Using this system, the literature describes a protein-protein interaction between FLAG-tagged

NLRP3 and endogenous Hsp90 protein using the technique co-immunoprecipitation. We also used the HEK293T cell line, transfected with a NLRP3 gene, to allow overexpression of NLRP3 protein. However, an important difference remained. The HEK293T cell line we acquired incorporated an NLRP3 gene with a GFP-tag for both co-immunoprecipitation and immunofluorescence experiments. In order to characterize our HEK293T cell line, we challenged the cells using selection media. Wild type HEK293 cells and wild type HEK293T cells were used as controls. Wild type HEK293 cells have no antibiotic resistance and did not survive either neomycin or kanamycin treatment. HEK293T have neomycin resistance and therefore cells survived neomycin treatment but did not survive kanamycin treatment. Only HEK293T cells transfected with the AcGFP1-C1 plasmid (Addgene Plasmid #54607) have both neomycin and kanamycin resistance and therefore cells survived both neomycin and kanamycin treatment.

Additional cell identity experiments were performed to test the expression levels of relevant proteins. Using a western blot, wild type HEK293T cells, and HEK293T-NLRP3-AcGFP cells were compared to THP-1 cells. Protein quantity was carefully managed to ensure equal protein levels across cell lines using the loading controls, Hsp90 and b-tubulin. The results showed that wild type HEK293T cells did not express NLRP3 while HEK293T-NLRP3-AcGFP cells express high levels of NLRP3. HEK293T-NLRP3-AcGFP cells were the only cells to express GFP protein.

102 Since the molecular weight of GFP protein was approximately 22 kDa and the molecular weight of NLRP3 protein was approximately 116 kDa, the western blot readout of 135 kDa for both proteins indicates NLRP3 protein was GFP-tagged as expected. Finally, only the THP-1 cells express NLRP3 inflammasome components Caspase 1, ASC and Pro-IL1b and therefore neither

HEK293T cell line was capable of forming NLRP3 inflammasomes. Finally, immunofluorescence was used to further verify the identity of the cell lines. Wild type HEK293T cells were used as controls. Only the nuclear compartment could be identified when immunofluorescence was performed on wild type HEK293T cells in the absence of primary antibodies. This indicates GFP protein was not expressed in wild type HEK293T cells. When immunofluorescence was performed on wild type HEK293T cells in the presence of both Hsp90 and NLRP3 primary antibodies, only

Hsp90 and the nuclear compartment could be identified confirming the fact that wild type

HEK293T cells do not express NLRP3. Finally, when immunofluorescence was performed on

HEK293T-NLRP3-AcGFP cells in the absence of primary antibodies, both GFP-tagged NLRP3 and the nuclear compartment could be identified. Following the completion of selection via antibiotic media, protein inventory assay via western blot and immunofluorescence controls, the identity of the HEK293T-NLRP3-AcGFP cell line was confirmed and used to attempt to detect

NLRP3-Hsp90 protein-protein interactions. The HEK293T-NLRP3-AcGFP cell line was used in a co-immunoprecipitation experiment. GFP antibodies bound to G protein coated Sepharose beads was used as bait to ‘pull-down’ GFP-tagged NLRP3 protein. A western blot was performed to identify whether Hsp90 and/or SGT1 were associating with NLRP3. Hsp90, SGT1, and NLRP3-

GFP were confirmed to be present in the whole cell lysate, and no protein was present in the negative control, IgG isotype control samples. The IP samples showed NLRP3-GFP protein present indicating a successful co-immunoprecipitation experiment; however, neither Hsp90 nor

103 SGT1 were detected. An alternative technique was used to test this finding. The HEK293T-

NLRP3-AcGFP cell line was used in an immunofluorescence experiment. In this experiment

Hoescht dye was used to stain the nuclear compartment, Hsp90 primary antibodies and secondary antibodies with bound Alexa 568 fluorophore were used to detect an immunofluorescence signal from Hsp90, while the GFP tag was used to detect an immunofluorescence signal from NLRP3.

When two proteins tagged with fluorescent markers are colocalizing the emission spectrums merge creating a third immunofluorescence signal. In Figure 3.3.3, this third immunofluorescence signal was present. The immunofluorescence results provide evidence of NLRP3-Hsp90 colocalizations and therefore potential protein-protein interactions. Interpreting positive protein colocalizations using fluorescent protein tags such as GFP can be problematic. The fluorescent protein tag itself is a large 22 kDa protein and when combined with the high levels of protein generated by an overexpression system, a positive signal can be detected simply because of the ubiquity of the proteins involved and nothing to do with biological activity driving colocalization. While the co- immunoprecipitation and immunofluorescence results using the HEK293T-NLRP3-AcGFP cell line were not consistent, there was evidence that an NLRP3-Hsp90 immunofluorescence colocalization can be detected when using a cell line that enables significant overexpression of

NLRP3. This result is consistent with the current literature.

104 3.4 Hsp90 Inhibitor, DMAG Affects NF-kB-mediated Gene Transcription

3.4.1 Rationale

In section 3.1 we established that Hsp90 inhibitor, DMAG has an effect on NLRP3-dependent IL-

1b maturation. The literature describing an interaction between these proteins, found the same phenomena. In two publications the authors described NLRP3 and Hsp90 directly interacting with each other, and that this interaction was the basis for Hsp90’s regulation of NLRP3 function41,28.

In section 3.2 we attempted to test this relationship with endogenous proteins using a THP1 cell line at natural expression levels but failed in our attempts. Finally, we were able to detect evidence of the literature findings, but only in a HEK293T cell line as described in section 3.3. The inability to detect this relationship in an immune cell line led us to consider other mechanisms for Hsp90 role regulating NLRP3 function. One of these proposed mechanisms was identified in Figure

3.1.2.2. When comparing the Hsp90 inhibitor (i.e. DMAG) and pan-caspase inhibitor (i.e. ZVAD) treatments there was a clear and discernible difference. While both treatments affect NLRP3 function by attenuating IL-1b secretions, DMAG also attenuates NLRP3 and Pro-IL-1b protein levels and the ZVAD does not affect NLRP3 and Pro-IL-1b protein levels. ZVAD binds in the active site of the protease caspase 1 (and presumably other proteases) blocking its enzymatic function (i.e. block the activation of Pro-IL-1b and the subsequent secretion of activated IL-1b from the immune cell)61. The result indicated that ZVAD appeared to block NLRP3 function via the NLRP3 inflammasome pathway. DMAG also affected NLRP3 function as seen by the attenuation of IL-1b secretions from the cell. However, DMAG appeared to limit NLRP3 function by attenuating the protein level of key components of the NLRP3 inflammasome namely, NLRP3 and Pro-IL-1b protein levels. Without them, NLRP3 inflammasome formation cannot take place

105 and Pro-IL-1b maturation cannot take place. As described earlier, NLRP3 inflammasome activation requires two distinct events. The so-called Signal 1 or Priming event whereby a ligand binds TLR4 receptors (Toll-Like Receptor 4) on the outside surface of the cell. This leads to internal activation of the NF-kB signaling pathway and upregulation of various proteins, including

NLRP3 inflammasome components: NLRP3 and Pro-IL-1b. The so-called Signal 2 or Activation event begins with the detection of intracellular potassium efflux from the cell, the rupture of lysosomal membranes or the generation of intracellular ROS. These are sensed by the NLR sensor

NLRP3, leading to oligomerization of NLRP3 proteins and ASC speck formation. Pro-caspase 1 proteins have a strong affinity for the interaction of NLRP3 and ASC protein complexes leading to the formation of what is known as the NLRP3 inflammasome. With a number of Pro-caspase 1 protease enzymes in close proximity, autoproteolytic cleavage of Pro-caspase 1 leads to activation and release of the active form: caspase 1, cleavage and activation of Pro-IL-1b, and the secretion of the active form of IL-1b from the cell. The results shown in Figure 3.4.1 strongly suggests that

DMAG was having an effect on the priming of the NF-kB signaling pathway (i.e. Signal 1) and not NLRP3 inflammasome formation and activation (i.e. Signal 2) as described in the current literature. In this section we investigate DMAG effects on the NF-kB signaling pathway.

106 3.4.2 DMAG Attenuates Pro-IL-1b Protein Levels

In order to study the NF-kB signaling pathway, activation of the NF-kB signaling pathway needed to be separated from activation of the NLRP3 inflammasome. To do so, THP-1 immune cells were treated with LPS instead of nigericin. LPS is an endotoxin found in the outer membrane of gram- negative bacteria. LPS binds to the TLR4 receptor of many types of immune cells. Low dosage

LPS activated the NF-kB signaling pathway driving upregulation of NLRP3, Pro-IL-1b and other proteins62; however, NLRP3 inflammasome formation was not activated in the absence of Signal

2. Using this technique, the impact of DMAG on NF-kB signaling can be studied without activating the NLRP3 inflammasome. THP-1 monocytes were differentiated into THP-1 macrophages using PMA and then treated using DMAG. LPS was used as an agonist for activation of the NF-kB signaling pathway. A time course of 1 hour and 4 hours LPS treatment was used to verify previous studies that showed NF-kB-dependent protein expression was minimal at 1 hour and peaked at 4 hours. NLRP3 was constitutively expressed in THP-1 immune cells and LPS stimulation marginally upregulated NLRP3 protein levels in an NF-kB-dependent manner as shown in Figure 3.4.2.1. However, DMAG was found to attenuate NLRP3 protein levels regardless of LPS treatment or not. Pro-IL-1b protein was upregulated in an NF-kB-dependent manner by

LPS stimulation as shown in Figure 3.4.2.1. However, DMAG was found to significantly attenuate

LPS-stimulated Pro-IL-1b protein levels. Following multiple experiments, statistical analysis showed the attenuation of LPS stimulated Pro-IL-1b protein levels by Hsp90 inhibitor, DMAG was significant as shown in Figure 3.4.2.1 Panel B.

107

Figure 3.4.2.1: DMAG Attenuates NLRP3 and Pro-IL-1b Protein Levels. PMA-primed (100 nM, 16 hr) THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90.

LPS (100 ng/mL, 1 hour and 4 hour) was used as an agonist for the NF-kB signaling pathway. Cell lysates were collected and used for immunoblotting to detect NLRP3 and Pro-IL-1b protein. (A) is a representative blot (B) Pro-IL-1b densitometry mean ± SD, over 6 independent experiments

(n = 6). Fold change indicates Pro-IL-1b protein level following treatment compared to no treatment after normalizing to the loading control b-tubulin. Statistics defined as #, p < 0.05 comparing positive control (LPS 4 hour alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) and LPS 4-hour treatment to positive control (LPS 4 hour alone), two-way ANOVA with Tukey’s multiple comparisons test.

108 In order to test the finding that DMAG had an impact of on Pro-IL-1b protein levels in THP-1 cells, Enzyme-linked immunosorbent assay (ELISA) was used. Total IL-1b levels (both Pro-IL-

1b and active IL-1b) were measured in whole cell lysates of THP-1 cells following LPS stimulation (Figure 3.4.2.2). The sandwich ELISA was used to immobilize the antigen IL-1b between two primary antibodies, a capture and detection antibody. A secondary antibody with conjugated-HRP enzyme recognizes and binds the detection antibody. Detection was achieved by visualizing the product of enzymatic cleavage following treatment with an HRP-specific substrate.

Using the ELISA technique, DMAG was found to significantly attenuate total IL-1b in the cell lysates of THP-1 macrophages.

109

Figure 3.4.2.2: DMAG Attenuates Total IL-1b using ELISA. PMA-primed (100 nM, 16 hr)

THP1 cells were preincubated with and without 17-DMAG (1 μM, 24 hr) to inhibit Hsp90. LPS

(100 ng/mL, 1 hour and 4 hour) was used as an agonist for the NF-kB signaling pathway. Cell lysates were collected and used for ELISA to detect total IL-1b. The figure indicates IL-1b concentration mean ± SD, over 3 independent experiments (n = 3). Statistics defined as #, p < 0.05 comparing positive control (LPS 4 hour alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) and LPS 4-hour treatment to positive control (LPS 4 hour alone), two-way ANOVA with Tukey’s multiple comparisons test.

110 3.4.3 DMAG Attenuates Pro-IL-1b mRNA Transcription

It is clear that DMAG affects Pro-IL-1b protein levels in THP-1 immune cells. What about gene transcription and the production of messenger RNA (mRNA)? Using the technique known as

Quantitative Reverse Transcription Polymerase Chain Reaction (or qRT-PCR) we were able to quantify the amount of mRNA being transcribed by the cell for a given treatment condition (Figure

3.4.3). The results showed that after 4 hours of LPS treatment, IL-1b mRNA levels increased significantly compared to the no treatment control; however, IL-1b mRNA levels were significantly lower when treated with DMAG for 24 hours prior to the 4 hours LPS treatment.

Since IL-1b protein levels and IL-1b mRNA levels were both significantly reduced upon DMAG treatment, DMAG’s effect on the NF-kB signaling pathway is likely upstream of IL-1b mRNA production.

111

Figure 3.4.3: DMAG Attenuates IL-1b mRNA Transcript Levels. PMA-primed (100 nM, 16 hr) THP1 cells were preincubated with and without 17-DMAG (1 μM, 24 hr) to inhibit Hsp90.

LPS (100 ng/mL, 4 hour) was used as an agonist for the NF-kB signaling pathway. Cell lysates were collected and used for quantitative reverse transcription polymerase chain reaction experiments to detect IL-1b mRNA levels. The mRNA transcript count mean ± SD, over 3 independent experiments (n = 3). Fold change indicates mRNA transcript count following treatment compared to no treatment after normalizing to 18sRNA using the ��Ct data analysis method. Statistics defined as #, p < 0.05 comparing positive control (LPS 4 hour alone) to negative control (no treatment), *, p < 0.05 comparing Hsp90 inhibitor (DMAG) and LPS 4-hour treatment to positive control (LPS 4 hour alone). Two-way ANOVA with Tukey’s multiple comparisons test.

112 3.4.4 DMAG has No Effect on NF-kB Translocation

We have shown that DMAG had an effect on the levels of IL-1b mRNA in THP-1 immune cells.

Therefore, the transcription of the IL-1b gene was affected by DMAG. The transcription factor

NF-kB has been shown to be responsible IL-1b gene transcription upon LPS-mediated activation of the NF-kB signaling pathway63. Under normal, homeostatic conditions of the cell, the transcription factor NF-kB is localized in the cytosol of the cell, held inactive by the inhibitor

IkBa. Upon activation of the NF-kB signaling pathway the inhibitor IkBa is ubiquitinated. This leads to the proteasomal degradation of IkBa and the release of NF-kB’s cytosolic inhibition.

Uninhibited, NF-kB undergoes nuclear translocation, binds to the DNA at the IL-1b promoter (as well as other gene promoters). NF-kB binding to the DNA recruits the transcriptional machinery leading to the subsequent transcription of the IL-1b gene (as well as several other genes) and production of IL-1b mRNA. Our question was does DMAG have an effect on the nuclear translocation of the transcription factor NF-kB? If so, Hsp90 may have a role upstream of NF-kB nuclear translocation. If not, Hsp90’s role may be within the nucleus affecting NF-kB’s ability to transcribe genes. To explore this, a nuclear fractionation protocol was developed. In order to assess the localization of the transcription factor NF-kB a method is required that allows the separation of the nucleus from the cytosol. Once separated, the nucleus and cytosol can be probed for the presence of NF-kB and therefore ascertain its localization based on a given experimental treatment.

To assess the purity of the separation, markers for the nucleus and cytosol were required. Fibrillarin is a methyl transferase enzyme involved in ribosome biogenesis located in the nucleolus, the largest structure within the cell nucleus64. Fibrillarin is one of several proteins considered a marker for the cell nucleus given its minimal expression in the cytosol and strong expression in the

113 nucleolus of the cell nucleus. b-tubulin is a member of the tubulin superfamily of proteins.

Tubulins polymerize to form microtubules, a major part of the cytoskeleton in eukaryotic cells. b- tubulin expression is localized almost exclusively in the cytosol, and therefore is considered a marker for the cytosol. Using these markers, we can establish the performance of the fractionation protocol. Purified cytosolic and nuclear fractions should be enriched in b-tubulin and fibrillarin protein respectively and deficient in fibrillarin and b-tubulin protein respectively. Cell lysis can be done using various means65. These include chemical, physical or a combination of these. Osmotic cell lysis is also an option. RIPA lysis buffer uses detergent (1% NP-40, 0.1% SDS) to breakdown the cell’s plasma membrane and therefore lyse the cell. However, experiments found RIPA lysis buffer to be too stringent, rupturing the nuclear compartment as well as the cell’s plasma membrane. A less stringent 1% NP-40 lysis buffer was attempted (i.e. no SDS detergent) but was also found to be too stringent. Next, a detergent-free mannitol buffer with sucrose (maintains osmolarity) was used together with needle stroke. Needle stroke involves physically shearing the cells by multiple passages through a 27-guage needle attached to a syringe. Again, this method was found to be too stringent. The nuclear compartment makes up a high percentage of the cell volume. For these reasons, both detergent-based methods and the mechanical shearing method failed to keep the nuclear compartment intact during break down of the cell’s plasma membrane.

Finally, a hypo-osmotic technique was developed. A tris-based, detergent-free buffer with very low salt concentration was used. The low salt content creates an osmotic gradient across the plasma membrane of the cells forcing water into the cells to equalize the salt concentration on both sides of the membrane. This inrush of water causes the cells to burst while leaving the nuclear compartment intact. Once the cytosolic fraction was isolated through centrifugation, the nuclear compartment was lysed with a 1% NP-40 lysis buffer. In order to test the nuclear fractionation

114 protocol, THP-1 monocytes were differentiated into THP-1 macrophages using PMA and then treated or not using DMAG. Four hours of LPS treatment was used for activation of the NF-kB signaling pathway. Following hypo-osmotic cell lysis, a western blot analysis was performed on the 3 fractions for each experimental treatment: the homogenates as a control, and then the cytosolic fractions and nuclear fractions (Figure 3.4.4). The results showed that Pro-IL1b protein levels were upregulated following LPS-mediated NF-kB signaling stimulation while DMAG attenuated this upregulation. The results also showed that the nuclear fractionation protocol worked. Both the cytosolic marker b-tubulin and nuclear marker fibrillarin were expressed in the homogenates. In the cytosolic fraction, cytosolic marker b-tubulin was present while nuclear marker fibrillarin was attenuated and in the nuclear fraction, nuclear marker fibrillarin was present while cytosolic marker b-tubulin was attenuated. Densitometry analysis shows there were statistically higher levels of b-tubulin in the cytosol compared to the nucleus and statistically higher levels of fibrillarin in the nucleus compared to the cytosol. This verified the performance of the fractionation protocol. With the experimental treatments and nuclear fractionation protocol confirmed to have worked, the fate of the transcription factor NF-kB was tested. During no treatment, NF-kB should be localized in the cytosol and following LPS-mediated NF-kB signaling pathway activation, NF-kB should be localized in the nucleus. If Hsp90 was involved in NF-kB translocation or IL-1b gene transcription, then the translocation of transcription factor NF-kB will not be affected by DMAG and NF-kB will be localized in the nucleus. If Hsp90 is involved in the

NF-kB signaling pathway upstream of NF-kB translocation, then the translocation of transcription factor NF-kB will be inhibited by DMAG and NF-kB will be localized in the cytosol. The results show that NF-kB protein is uniformly expressed in the homogenates regardless of treatment

115 (Figure 3.4.4). However, in the cytosolic fraction NF-kB protein levels were attenuated whenever the NF-kB signaling pathway was activated via 4 hours LPS treatment. Likewise, in the nuclear fraction NF-kB protein levels were enriched whenever the NF-kB signaling pathway was activated via 4 hours LPS treatment. This indicates that the transcription factor NF-kB translocated from the cytosol of the THP-1 cells to the nucleus upon LPS-mediated activation of the NF-kB signaling pathway. Interestingly, DMAG had no effect on NF-kB’s translocation to the nucleus. This provides evidence that DMAG’s effect on the NF-kB signaling pathway likely occurred within the cell nucleus after translocation of NF-kB. DMAG has an effect on IL-1b gene transcription but as shown in Figure 3.4.4, no effect on NF-kB translocation. These results potentially localize a role for Hsp90 within the cell nucleus either supporting the transcription factor NF-kB’s binding to the

DNA and/or the assembly of the transcriptional machinery after NF-kB binds the DNA.

116

Figure 3.4.4: DMAG has No Effect on NF-kB Translocation. PMA-primed (100 nM, 16 hr)

THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90. LPS (100 ng/mL, 4 hour) was used as an agonist for the NF-kB signaling pathway. Cells were lysed using a hypotonic lysis buffer in order to breakdown the plasma membrane while preserving the nuclear membrane. After nuclear isolation RIPA lysis buffer was used to breakdown the nuclear membrane. Immunoblotting was used to probe the homogenate, cytosolic fraction and nuclear fraction for NF-kB, the cytosolic marker b-tubulin and the nuclear marker Fibrillarin. (A) is a

117 representative blot (B)(C) cytosolic and nuclear marker densitometry mean ± SD, over 6 independent experiments (n = 6). Fold change indicates fraction marker protein level compared to homogenate marker protein. (D)(E) NF-kB localization densitometry mean ± SD, over 3 independent experiments (n = 3). Fold change indicates NF-kB protein level following treatment compared to no treatment after normalizing to the fraction marker. Statistics defined as *, p < 0.05 comparing negative control (no treatment) to positive control (LPS 4 hours alone) two-way

ANOVA with Tukey’s multiple comparisons test.

118 3.4.5 DMAG has No Effect on I-kBa Phosphorylation

Translocation of transcription factor NF-kB to the nucleus is dependent on the proteasomal degradation of its cytosolic inhibitor, IkBa. Prior to degradation, IkBa is phosphorylated by the

IKK complex followed by its ubiquitination and subsequent degradation. In order to test whether

DMAG was having no effect on NF-kB translocation we hypothesized that DMAG should also have no effect on IkBa phosphorylation. If IkBa phosphorylation is also not affected by DMAG like NF-kB, then this suggests that Hsp90 has no role upstream of NF-kB translocation along the

NF-kB signaling pathway. THP-1 monocytes were differentiated into THP-1 macrophages using

PMA and then treated using DMAG. LPS was used as an agonist for activation of the NF-kB signaling pathway. A time course of 1 hour and 4 hours LPS treatment was used to verify previous studies that showed IkBa was phosphorylated at 1 hour followed by NF-kB-dependent Pro-IL-1b protein level at 4 hours. As shown in Figure 3.4.5, IkBa is constitutively expressed in THP-1 immune cells and after 1 hour of LPS stimulation there is a conversion of IkBa into p-IkBa. After

4 hours of LPS stimulation, there is an NF-kB-mediated increase in IkBa protein level and likewise a subsequent increase in the p-IkBa form. Interestingly, DMAG was found to have no effect on levels of IkBa protein or its phosphorylated form following 1 hour and 4 hours of LPS stimulation. The results showed the difference in IkBa and p-IkBa protein levels were minimal regardless of DMAG treatment.

119

Figure 3.4.5: DMAG has No Effect on IkBa Phosphorylation. PMA-primed (100 nM, 16 hr)

THP1 cells were preincubated with and without DMAG (1 μM, 24 hr) to inhibit Hsp90. LPS (100 ng/mL, 1 hour and 4 hour) was used as an agonist for the NF-kB signaling pathway. Cell lysates were collected and used for immunoblotting to detect IkBa and p-IkBa protein expression. The figure is a representative blot, n=3.

120 3.4.6 Summary

After confirming DMAG had an effect on NLRP3 inflammasome activity, but with no evidence of an NLRP3-Hsp90 protein-protein interaction, it was recognized that DMAG attenuated NLRP3 inflammasome raw material production. Both NLRP3 and Pro-IL-1b protein levels were affected by DMAG treatment. Further recognizing that these proteins are upregulated via the NF-kB signaling pathway during the phase 1 priming event of NLRP3 inflammasome activation, a means of isolating the NF-kB signaling pathway from NLRP3 inflammasome activation was considered to allow the study of DMAG’s effect on the NF-kB signaling pathway, without activating the

NLRP3 inflammasome. LPS is known to activate the NF-kB signaling pathway by binding to the

TLR4 receptor on the external surface of the cell and low dose (100 ng/mL), short-term treatment

(approximately 4 hours) has been shown to not activate the NLRP3 inflammasome. In order to identify the biological activity along the NF-kB signaling pathway that is influenced by DMAG, experiments were carried out in reverse order on each major activity along the pathway. The first step was to determine whether DMAG has an effect on NLRP3 and Pro-IL1b protein levels independent of NLRP3 inflammasome activation. Using a western blot followed by densitometry,

NLRP3 protein levels were shown to be reduced following DMAG treatment. Likewise, after 4 hours LPS treatment, the upregulation of Pro-IL1b was shown to be significantly reduced. The same experiment was repeated using a second technique to test the results. Using the ELISA technique, total IL-1b protein levels in the cell lysates of THP-1 cells after 4 hours of LPS treatment were shown to be significantly upregulated, but if treated with DMAG for 24 hours prior to LPS treatment total IL-1b protein levels were significantly reduced. These results confirm that

DMAG had an effect on the NF-kB signaling pathway independent of NLRP3 inflammasome

121 activation. After confirming total IL-1b protein levels were disrupted by DMAG, the next major step in the reverse direction along the NF-kB signaling pathway is the production of IL-1b mRNA transcripts. After performing the same experimental treatments on THP-1 cells, qRT-PCR was deployed to measure the level of IL-1b mRNA transcription for each treatment condition. The results showed a significant increase in IL-1b mRNA transcription after 4 hours of LPS treatment and significantly reduced IL-1b mRNA transcription if the THP-1 cells were treated with DMAG for 24 hours prior to 4 hours LPS treatment. After confirming IL-1b mRNA transcript levels were disrupted by DMAG the next major step in the reverse direction along the NF-kB signaling pathway is the translocation of the transcription factor, NF-kB into the nucleus followed by NF- kB binding to the DNA and the transcription of relevant and multiple genes, including the IL-1b gene. First, a nuclear fractionation was developed. After extensive development using multiple techniques, a hypo-osmotic lysis buffer successfully disrupted the THP-1 cell plasma membrane while preserving the nuclear compartment. This allowed separation of the cytosolic fraction from the nuclear fraction and therefore probing for the localization of NF-kB under different experimental treatments. A western blot followed by densitometry was performed after completing the nuclear fractionation protocol in order to determine the purity of the cytosolic and the nuclear fractions. The nuclear marker fibrillarin and the cytosolic marker b-tubulin were used to determine the level of purification. While both markers were uniformly expressed in the homogenate samples regardless of treatment, the marker fibrillarin was enriched significantly in the nuclear fraction compared to the cytosolic fraction while the cytosolic marker b-tubulin was significantly attenuated in the nuclear fraction compared to the cytosolic fraction. This indicates the level of purity of each of the fraction was acceptable to determine the localization of the transcription factor

NF-kB. To determine the localization of NF-kB, both the nuclear and cytosolic fractions as well

122 as the homogenate were probed using an antibody for the NF-kB p65 subunit. The homogenate showed uniform NF-kB protein levels for each of the experimental treatments indicating neither

LPS activation of the NF-kB signaling pathway nor DMAG inhibition of Hsp90 had an effect on

NF-kB protein levels. The result also showed that the experimental technique was consistent across experimental treatments. The nuclear fraction showed minimal NF-kB protein in the nucleus prior to LPS stimulation; however, a significant increase in NF-kB protein level occurred with LPS stimulation. Likewise, the cytosolic fraction shows NF-kB protein in the cytosol prior to LPS stimulation and a significant decrease in NF-kB protein level upon LPS stimulation. Both the nuclear and cytosolic fractions indicated NF-kB was localized to the nucleus upon activation of the NF-kB signaling pathway as expected. Interestingly, if cells were treated with DMAG for

24 hours prior to LPS stimulation, the NF-kB protein levels were not significantly different compared to no treatment. This indicates that DMAG had no effect on NF-kB translocation and therefore suggests Hsp90 may have no role in the translocation of NF-kB from the cytosol to the nucleus upon LPS-mediated NF-kB signaling pathway activation. Previously, DMAG was shown to attenuate IL-1b mRNA transcript levels but here we show that DMAG has no effect on NF-kB translocation. We conclude then, that DMAG’s effect occurs within the nucleus of the cell and involved the ability of NF-kB to bind the DNA and/or transcribe the IL-1b gene. However, it needs to be recognized that DMAG has many protein targets in the cell, not only Hsp90. DMAG inhibits all proteins with ATPase domains that contain the GHKL motif. Many such proteins have been identified. Therefore, this lack of specificity for Hsp90 means we cannot conclusively say the effects seen in these experiments were attributed to Hsp90 alone.

123 CHAPTER 4: DISCUSSION

4.1 NLR Inflammasomes at the Heart of Danger Detection

Innate immune cells at the host-microbial interface of the intestinal epithelium detect danger and regulate the inflammatory response to pathogens or injury. Innate immune cells maintain a variety of families of sensor proteins known as pattern recognition receptors. These families of proteins detect a large number of pathogen/damage-associated molecular patterns both extracellularly at the surface of the cell and intracellularly within the cytoplasm of the cell. The NLR family of proteins are intracellular sensors that detect internalized pathogens and cellular stress. Upon detection of danger, NLR proteins oligomerize and recruit other proteins to form large protein structures known as inflammasomes58. Inflammasomes activate cytokines leading to their secretion from the immune cells. Cytokines are messenger molecules that activate the host inflammatory response. The activation of inflammasomes is an important and central element in the regulation of the host’s inflammatory response to a variety of pathogens and injury. It’s not surprising then that both NOD2 and NLRP3, prominent members of the NLR family of intracellular sensors, have been implicated in IBD66.

124 4.2 Heat Shock Protein, Hsp90, Stabilizes Proteins upon Cellular Stress

Heat shock protein, Hsp90, is one of a family of proteins that maintain client protein integrity in the crowded environment of the cell. Heat shock proteins assist client proteins with de-novo folding, re-folding, while minimizing protein entanglements and aggregations through direct interaction with clients and indirect interaction via chaperone proteins. Most members of the heat shock protein family are upregulated during cellular stress (i.e. an accumulation of unfolded proteins). However, members of the heat shock protein family, including Hsp90, are present during physiological conditions, regulating conformational stability for a range of client proteins critical for signal transduction20. In 2007, NLRP3 was identified as a client protein of Hsp90 and co- chaperone protein SGT128. Hsp90 was described as maintaining NLRP3 conformationally competent during physiological conditions allowing NLRP3 to perform its role as sensor protein41.

In these papers, Hsp90 was found to be required for successful activation of the NLRP3 inflammasome. If this were true, could Hsp90 be a target of drug treatment in order to block

NLRP3 inflammasome activation and therefore limit the host’s inflammatory response and therefore break the cycle of chronic inflammation? Afterall, drug development in the field of

Hsp90 inhibition has been going on for years. Heat shock proteins have been found to be instrumental in maintaining the immortality of cancer cells. Generations of increasingly higher specificity Hsp90 inhibitor drugs have already been in clinical trials for several years. After discovery of the natural inhibitor of Hsp90, geldanamycin, drug companies have developed geldanamycin-analogs with increasing affinity for the ATP binding site of Hsp90, the mechanism used to inhibit its function38.

125 4.3 DMAG Affects NLRP3 Independent of the Inflammasome

In order to investigate Hsp90 interactions with NLRP3, the most successful of these Hsp90 inhibitor drugs, DMAG (Alvespimycin) was used37. In order to test that DMAG has an effect on

NLRP3 function, differentiated THP-1 macrophages were exposed to microbial toxin, nigericin in order to activate the NLRP3 inflammasome. Secretions of activated cytokine IL-1b from the THP-

1 macrophages was monitored to test activation of the NLRP3 inflammasome. DMAG treatment for 24 hours prior to nigericin treatment was found to significantly attenuate IL-1b secretions from the THP-1 macrophages. These results were confirmed by repeating the experiment multiple times and by using multiple techniques. C. diff toxins TcdA and TcdB are known to activate the NLRP3 and pyrin inflammasomes leading to the secretion of IL-1b from differentiated THP-1 immune cells46. Again, DMAG treatment for 24 hours prior to C. diff toxin treatment was found to significantly attenuate IL-1b secretions from THP-1 immune cells. While these results confirm

DMAG has an effect on NLRP3 function, the literature describes Hsp90 supporting NLRP3 prior to NLRP3 inflammasome activation. In fact, the proposed role for Hsp90 was described as upstream of and independent of NLRP3 inflammasome activation. To test Hsp90 supports NLRP3 independently of the NLRP3 inflammasome, an NLRP3 inflammasome-independent role for

NLRP3 was sought. Inflammasome-independent NLRP3 has been described in non- hematopoietic, renal tubular epithelial cells. NLRP3 was shown to be required for TGF-b signaling during the process of epithelial-mesenchymal transition (EMT)48. TGF-b-mediated EMT induction leads to the increased expression of phenotype-modifying proteins such as matrix metalloproteinases (MMP-9, MMP-2), and a-smooth muscle actin (a-SMA). Following TGF-b stimulation, NLRP3-/- tubular epithelial cells (TECs) showed reduced MMP9 expression compared

126 to wild-type TECs. Again, DMAG treatment for 24 hours prior to TGF-b-mediated EMT induction significantly attenuated MMP-9 protein expression in wild-type TECs similar to NLRP3-/- TECs.

These results show that DMAG has an effect on NLRP3 function and is independent of NLRP3 inflammasome activation supporting the literature description of Hsp90 support of NLRP3 upstream of NLRP3 inflammasome activation.

127 4.4 No Evidence of Hsp90-NLRP3 Protein Interactions in THP-1 Cells

Direct Hsp90-NLRP3 protein-protein interactions were evaluated. The literature describes Hsp90 and its cochaperone SGT1 as interacting partners with NLRP328. In a HEK293T overexpression cell line, the literature describes experiments performed on cells transfected with FLAG-tagged polypeptide constructs representing both the individual domains of NLRP3 and its’ full protein form. Using Co-immunoprecipitation, FLAG antibodies were used as bait. Both Hsp90 and SGT1 endogenous proteins were found to bind the LRR domain of NLRP3 and also bind the full protein form. We used THP-1 immune cells to pull-down endogenous proteins. Using NLRP3 antibodies bound to Protein G-coated Sepharose beads, we failed to detect either Hsp90 or SGT1 bound to

NLRP3 despite successfully detecting all proteins of interest in cell lysates and successfully pulling down NLRP3. After multiple attempts, all ending in a failure to detect a protein interaction, we used endogenous SGT1 as bait in multiple experimental attempts to detect NLRP3 interactions.

But again, we failed to detect either Hsp90 or NLRP3 bound to SGT1 despite successfully pulling down SGT1. Co-immunoprecipitation is a useful technique for binding interaction studies although weak interactions, or interactions of an intermittent nature, can be difficult to detect67.

Simply processing the assay can be too harsh for weak electrostatic interactions. Binding partner proteins may simply come apart or if the interaction is transient in nature, the interaction can be missed. Hsp90 is an example of a protein described as having an intermittent interaction with its binding partners as part of the mechanism that Hsp90 uses to assist client protein folding. Hsp90 has an ATPase domain and has been shown to hydrolyze an ATP molecule once every 20 minutes24. Upon ATP binding and then hydrolysis, Hsp90 is undergoing conformational changes.

Studies have shown that Hsp90 releases its binding partner during this interval33. Hydrophobic amino acid residues on the client protein surface are exposed to the hydrophilic cell cytosol, forcing

128 the client protein to change confirmation (i.e. protein folds) to minimize interaction of its’ hydrophobic surface with the hydrophilic cytosol. In this situation, alternative techniques can be deployed to detect proteins that have an interacting relationship. Immunofluorescence (IF) is one such technique. Immunofluorescence uses fluorescence to detect protein colocalizations as opposed to detecting direct binding interactions. With immunofluorescence, antibodies with attached fluorophores bind to proteins. If two proteins have been tagged with different fluorophores, protein colocalizations as in the case of two interacting partner proteins, tend to cause a merging of the immunofluorescence signals at the interface of the binding interaction57.

The appearance of a third emission spectrum is confirmation of protein colocalization and is evidence of a potential protein interaction. Prior to investigating Hsp90-NLRP3 protein colocalizations, a control experiment was performed to demonstrate both a negative and positive example of protein colocalization using the immunofluorescence technique. A known and relevant condition of protein binding interacting partners was used. NLRP3 and ASC are known to not associate prior to inflammasome activation. Upon activation of the NLRP3 inflammasome, both

NLRP3 and ASC are known to oligomerize and form the inflammasome protein structures via binding interactions. Using immunofluorescence, NLRP3 was tagged with an Alexa 488 dye fluorophore and ASC was tagged with an Alexa 568 dye fluorophore in differentiated THP-1 immune cells. Prior to activation of the NLRP3 inflammasome, the immunofluorescence image shows two distinct immunofluorescence signals at the two emission spectrums for each fluorescent dye with no indication of a third emission spectrum emerging. This result is indicative of an absence of protein colocalizations when using immunofluorescence. However, the situation changes considerably after NLRP3 inflammasome activation. The formation of the ASC specks and NLRP3 oligomers produce large, distinct immunofluorescence signals at the two emission

129 spectrums for each fluorescent dye. Also, within many cells, a third, distinct emission spectrum was detected at the interface of each of the individual immunofluorescence signals. This result is a positive indication of protein colocalizations using the technique immunofluorescence.

Following these positive control experiments, immunofluorescence was used to image NLRP3 and

Hsp90 using Alexa 488 dye and Alexa 568 dye respectively. The literature describes NLRP3 and

Hsp90 interacting prior to NLRP3 inflammasome activation. Immunofluorescence images were taken both prior to and after NLRP3 inflammasome activation. Regardless of NLRP3 inflammasome activation, the images show patches of the two individual immunofluorescence signals resembling the negative control image. After multiple attempts, there was no indication of

Hsp90 and NLRP3 proteins colocalizing when using the technique immunofluorescence.

Following immunofluorescence, a third technique was deployed in an attempt to detect Hsp90 and

NLRP3 interacting. Proximity ligation assay (PLA) is an advanced immunofluorescence technique used to detect protein colocalizations between two proteins54. There are two main advantages of using PLA compared to immunofluorescence. First, the protein colocalization is defined. A positive signal from the assay means proteins are colocalizing within 40 nm. Secondly, the results of a proximity ligation assay can be quantified. Positive signals of proteins colocalizing may be counted before and after a given experimental treatment and the difference analyzed statistically to determine if any change is significant. Again, a control experiment was performed using NLRP3 and ASC, known colocalizing proteins upon inflammasome activation. The PLA signals appearing in images before and after NLRP3 inflammasome activation were quantified and the results indicate a significant difference in protein colocalization between NLRP3 and ASC when comparing PLA signals both before and after NLRP3 inflammasome activation. The proximity ligation assay was then used to investigate Hsp90 and NLRP3 protein colocalizations. No

130 significant difference was found between PLA signals both before and after NLRP3 inflammasome activation when detecting Hsp90 and NLRP3. Also, there is no significant difference between Hsp90-NLRP3 PLA signals when compared to the negative control (i.e.

NLRP3-ASC prior to NLRP3 inflammasome activation). Using PLA, protein colocalizations between Hsp90 and NLRP3 failed to be detected. In fact, using 3 different techniques namely, co- immunoprecipitation, immunofluorescence and proximity ligation assay there was no evidence found for protein binding interactions between endogenous NLRP3 and Hsp90 in THP-1 immune cells. Importantly though, the literature describes an Hsp90-NLRP3 protein interaction in a

HEK293T overexpression cell line using transfected FLAG-tagged NLRP3 protein, not endogenous NLRP3 protein in THP1 immune cells.

131 4.5 Hsp90-NLRP3 Protein Colocalization Detected in HEK293T Cells

In order to reproduce the findings described in the literature a HEK293T cell line was acquired.

These cells stably overexpress GFP-tagged NLRP3 protein. Ideally, the acquired cell line would stably overexpress FLAG-tagged NLRP3 as per the literature however, a cell line overexpressing

FLAG-tagged NLRP3 were not available and would require development. The cell line overexpressing GFP-tagged NLRP3 were first characterized prior to their use in experiments.

Selection media was used to identify the cell line. HEK293 cells are known to have no antimicrobial resistance while HEK293T cells are known to have neomycin resistance. The plasmid used to create the HEK293T cell line stably transfected the SV40 large T antigen and also conferred neomycin resistance. The plasmid used to stably transfect the HEK293T cells with the

NLRP3-AcGFP gene also has genes for both neomycin and kanamycin resistance. As expected, the stably transfected HEK293T-NLRP3-AcGFP cell line were the only cells to survive selection media containing both neomycin and kanamycin. While both the HEK293T cell line and the

HEK293T-NLRP3-AcGFP cell line both survived selection media containing neomycin only. All

3 cell lines, including the HEK293 cell line, survived media alone. After identifying the cell line, a protein inventory experiment was performed. The HEK293T-NLRP3-AcGFP cell line was confirmed to produce both NLRP3 and GFP at the molecular weight expected for two covalently bound proteins (i.e. 135 kDa). These cells also expressed loading controls Hsp90 and b-tubulin and do not express caspase 1, ASC or Pro-IL-1b. Therefore, the cells are not capable of forming

NLRP3 inflammasomes, as expected. The HEK293T cell line was confirmed to not produce either

NLRP3 or GFP. These cells also expressed loading controls Hsp90 and b-tubulin and do not express caspase 1, ASC or Pro-IL-1b. Both cell lines were compared to control cell line THP-1 immune cells. The THP-1 cell line was confirmed to express NLRP3 and not GFP protein.

132 Importantly, the amount of NLRP3 protein produced by the THP-1 immune cells was much lower than the HEK293T-NLRP3-AcGFP overexpression cell line. The importance of this finding will be discussed later. The THP-1 immune cells also expressed loading controls Hsp90 and b-tubulin and expressed caspase 1, ASC or Pro-IL-1b. Therefore, the THP-1 immune cells were the only cell line capable of forming NLRP3 inflammasomes. Immunofluorescence was performed to verify the protein inventory results. For the HEK293T-NLRP3-AcGFP cell line the results confirm the expression of NLRP3 via its bound GFP fluorophore. No primary or secondary antibody were used in the experiment, only DAPI stain to identify the cell nucleus. The HEK293T cell line was confirmed to not express NLRP3. Both NLRP3-mouse primary antibodies and Alexa 488-mouse secondary antibodies were used but no immunofluorescence signal was present in the image.

Hsp90 expression was confirmed in these cells. Hsp90-rabbit primary antibodies and Alexa568- rabbit secondary antibodies were used and an immunofluorescence signal at the appropriate emission spectrum was present in the image. When using no primary antibodies with the HEK293T cell line, only the emission spectrum for the DAPI nuclear stain was present as expected. With confirmation that the HEK293T-NLRP3-AcGFP cells are HEK293T cells, they express Hsp90, and stably express their transfected NLRP3-AcGFP plasmid genes, the cells were used in an attempt to test the literature finding that NLRP3 and Hsp90 are binding interacting partner proteins.

A co-immunoprecipitation experiment was conducted. After harvesting the HEK293T-NLRP3-

AcGFP cells, GFP primary antibodies bound to Sepharose beads coated with protein G were used to pull down GFP protein. While the western blot indicates the presence of both GFP and NLRP3 protein, neither Hsp90 nor SGT1 protein were present, even after an extended time exposure.

Surprisingly, a co-immunoprecipitation experiment using a HEK293T cell line overexpressing

NLRP3 also failed to detect an interaction between NLRP3 and Hsp90, like the THP-1 immune

133 cells. To test this finding an immunofluorescence experiment was performed on the HEK293T-

NLRP3-AcGFP cells. Immunofluorescence allows the identification of protein colocalizations.

The HEK293T-NLRP3-AcGFP cells express GFP-tagged NLRP3 allowing the indirect detection of NLRP3 by imaging the emissions from the bound GFP fluorophore. NLRP3 protein was successfully detected. A secondary antibody with bound Alexa568 dye was incubated with Hsp90 primary antibodies to detect endogenous Hsp90 protein expressed in the HEK293T-NLRP3-

AcGFP cells. The immunofluorescence images confirm the finding of the protein inventory experiment. The HEK293T overexpression system is producing vast amounts of GFP-tagged

NLRP3 protein. The immunofluorescence images confirm the HEK293T-NLRP3-AcGFP cells are also expressing Hsp90. Importantly, the merged image revealed evidence of an overlap of the emission spectrums of the GFP tag and Alexa 568 dye, indicative of close proximity of both

NLRP3 and Hsp90 in the cell. The presence of the immunofluorescence signal at this emission spectrum is not definitive evidence of protein interaction, only that proteins were colocalizing such that an overlap in immunofluorescence signals was present. However, when compared to control images, other data derived from multiple techniques, and the published literature, confirmation that a protein-protein interaction has been detected can be argued. Two questions were raised with these results. (1) If a protein interaction between Hsp90-NLRP3 was detected in a HEK293T overexpression system in agreement with published literature using the technique immunofluorescence, why was the protein interaction not detected using the technique co- immunoprecipitation similar to the published literature? (2) If Hsp90 and NLRP3 were indeed interacting, why can the interaction only be detected in a HEK293T overexpression system and not detected in THP-1 immune cells?

134 4.6 GFP Tags Known to Cause Steric Hindrance in Binding Interaction Studies

When considering question 1, we look to the differences in the experimental systems deployed.

The literature describes using a stably transfected HEK293T cell line overexpressing FLAG- tagged NLRP3 protein while the experiments reported here utilized a stably transfected HEK293T cell line overexpressing GFP-tagged NLRP3 protein. FLAG is a relatively short 8 amino acid polypeptide sequence. FLAG is a member of a group of short epitope tags used specifically for the detection and purification of proteins they are fused to. They are short, linear motifs with high antibody specificity and rarely affect the properties of the protein of interest. GFP on the other hand is a 238 amino acid protein with a molecular weight of 26.9 kDa. When exposed to ultraviolet light, GFP exhibits bright fluorescence at a wavelength of approximately 510 nm. GFP is a member of a family of fluorescent proteins, (including YFP, CFP, RFP, etc.), gaining widespread usage in reporter applications such as fluorescence microscopy and fluorescence resonance energy transfer

(FRET), etc. Importantly, both FLAG and GFP fusions are at the C-terminus of NLRP3. The C- terminus of NLRP3 is the location of the LRR domain of NLRP3. The LRR domain of NLRP3 is one of the locations NLRP3 binds its interacting partners. Given the vast size difference of both fusion tags, it seems plausible that the GFP-tag may be interfering with the binding interaction of

NLRP3 partner proteins, including Hsp90 in the HEK293T overexpression system. GFP tags are known to interfere with protein function and methods papers describing the study of binding interactions recommend the use of small epitope tags such as FLAG, HA, or c-myc to avoid interference68. Future studies in this area should attempt to eliminate this inconsistency in the experimental data by acquiring or generating stably transfected FLAG-tagged NLRP3 in an overexpressing HEK293T cell line in an attempt to recreate the literature findings that a Hsp90-

NLRP3 protein interaction can be detected using the technique co-immunoprecipitation.

135 4.7 Overexpression Systems Require Controls in Binding Interaction Studies

For question 2, the Hsp90-NLRP3 protein-protein interaction was detected in the HEK293T overexpression cell line yet failed to be detected in THP-1 immune cells. While these findings are consistent with the current literature, the literature concluded that the Hsp90-NLRP3 protein interaction is a valid result and describe this interaction as the key mechanism explaining the requirement for Hsp90 in NLRP3 function. The data provided here shows evidence that endogenous Hsp90 and NLRP3 protein were not interacting in THP-1 immune cells. Using multiple techniques, the Hsp90-NLRP3 interaction described in the literature could not be detected. Given the fact that an interaction can be detected in the HEK293T overexpression suggests a false positive. In the protein inventory experiment the HEK293T-NLRP3-AcGFP cells were shown to express vast amounts of NLRP3 protein in comparison to THP-1 immune cells.

When considering the thermodynamics of protein-protein interactions, protein concentration is the critical factor in determining protein complex formation69. The association constant is one of the first things determined when studying protein-protein complexes. The association constant is defined by the following equation:

An equilibrium constant can be defined for any reaction between a protein, P and its ligand, L. A constant relationship exists between the concentration of a protein bound with ligand and the concentration of unbound protein and its ligand alone. Maintaining this constant is the result of the physical phenomena that all thermodynamic systems maintain Gibbs Free energy at its’ minimum.

From this relationship, we can see that increased protein-ligand interaction will be the direct result

136 of an increase in protein or ligand concentration. When comparing the amount of NLRP3 protein in the HEK293T overexpression system compared to THP-1 immune cells there is a vast increase.

Therefore, in order for the HEK293T overexpression system to maintain the association constant unchanged and therefore Gibb’s free energy at a minimum, there will be a vast increase in protein interactions in the HEK293T-NLRP3-AcGFP cells compared to THP-1 cells. This is a known problem for overexpression systems and researchers are warned to take mitigating actions to avoid false positives in protein interaction studies70. These recommendations include the use of controls and confirmation through the use of multiple techniques. An important control is to return to your cell line of interest to confirm the interaction. In this study, protein interaction detected in the

HEK293T-NLRP3-AcGFP cells, failed to be confirmed in the cell line of interest, THP-1 immune cells, despite multiple attempts using multiple techniques. Inducible expression systems are available to researchers that allow variable levels of overexpression71. If there is concern that a false positive has been detected, overexpression levels can be reduced to a level of expression that avoids false protein interactions to be detected. Other recommendations include avoiding the use of a single technique to test a protein interaction. In this present study, co-immunoprecipitation was used followed by immunofluorescence and proximity ligation assay. Many other techniques are available including FRET, electron microscopy, etc. The literature describes only one technique, co-immunoprecipitation to validate the Hsp90-NLRP3 protein interaction. They did not show the finding using additional techniques nor did they deploy inducible expression to confirm their findings. Finally, they were not able to show their finding in their control cell line, THP-1 immune cells.

137 4.8 DMAG has an Effect on NF-kB-mediated Protein Levels

While we failed to detect any evidence for an Hsp90-NLRP3 protein in THP-1 immune cells, we did show that Hsp90 inhibitor, DMAG has an effect on NLRP3 function. If a direct binding interaction was not responsible for this relationship, what is the mechanism? Reviewing our original findings, we showed the IL-1b secretions from THP-1 immune cells were significantly attenuated following DMAG treatment 24 hours prior to NLRP3 inflammasome activation.

Studying these results carefully, we see that protein levels of NLRP3 and Pro-IL1b, the precursor to secreted IL1b, were significantly attenuated with DMAG treatment, regardless of NLRP3 inflammasome activation. NLRP3 and Pro-IL1b are products of the NF-kB signaling pathway and are upregulated as part of the Signal 1 or priming event during NLRP3 inflammasome activation.

If NLRP3 and Pro-IL1b protein levels are low, there will be insufficient raw materials to form

NLRP3 inflammasomes or insufficient precursor cytokines available for activation. Either of these will result in significant attenuation of secreted IL1b. This suggests that Hsp90 has a role in the

NF-kB signaling pathway and not NLRP3 inflammasome activation. To test this hypothesis, the

NF-kB signaling pathway needed to be isolated from NLRP3 inflammasome activation. Low concentrations of LPS, a component of the cell wall of gram-negative bacteria72, is known to bind

TLR4 receptors on the outside surface of THP-1 immune cells leading to the intracellular stimulation of the NF-kB signaling pathway without activating the NLRP3 inflammasome.

Following four hours of low dose LPS treatments THP-1 immune cells were shown to significantly upregulate Pro-IL1b protein expression. However, if the cells had been treated with Hsp90 inhibitor, DMAG for 24 hours prior to LPS treatment, both NLRP3 and Pro-IL1b protein levels

138 were significantly attenuated. Multiple techniques were used to test this finding. These results confirm the hypothesis that DMAG has an effect on the NF-kB signaling pathway.

4.9 DMAG has an Effect on NF-kB-mediated IL1b mRNA Transcript Levels

Pro-IL-1b protein expression is the product of the NF-kB signaling pathway. To identify the location along the NF-kB signaling pathway that Hsp90 has a role, we moved up the pathway in a reverse direction in order to evaluate Hsp90’s role at each step along the pathway. Prior to protein translation is gene transcription. The effects of DMAG treatment on IL1b gene transcription was determined by measuring levels of IL1b mRNA transcripts using quantitative reverse transcription polymerase chain reaction (qRT-PCR). Following 4 hours of LPS treatment on THP-1 immune cells, the qRT-PCR results showed a significant upregulation in levels of IL1b mRNA transcripts.

However, following 24 hours of DMAG treatment prior to LPS treatment, levels of IL1b mRNA transcripts were significantly attenuated. These results suggest DMAG is having an effect on IL1b mRNA transcription.

4.10 DMAG has No Effect on Transcription Factor NF-kB’s Nuclear Translocation

The transcription factor NF-kB is responsible for gene transcription upon stimulation of the NF- kB signaling pathway. During homeostatic conditions of the cell, NF-kB is localized in the cytosol of the cell, inhibited by the protein IkB73. LPS-mediated stimulation of the NF-kB signaling pathway leads to degradation of IkB, removing NF-kB’s inhibition, allowing NF-kB to translocate to the cell nucleus to begin gene transcription. To assess whether Hsp90 has a role in NF-kB- mediated gene transcription, the effects of DMAG treatment on NF-kB nuclear translocation were

139 evaluated. A nuclear fractionation protocol was developed in order to separate the nuclear compartment from the cytosol in order to evaluate the localization of the transcription factor NF- kB before and after treatment. To successfully separate the nuclear compartment from the cytosol, the outer plasma membrane of the cell needed to by lysed without rupturing the nuclear compartment. Multiple techniques were tried and failed. Chemical means of lysing the cells through the use of various detergents was tried. Regardless of trying detergents with varying stringency all attempts to use chemical techniques to lyse the cells failed to protect the nuclear compartment. Mechanical means of lysing the cells was tried using the technique known as needle stroke. With needle stroke, cells were moved through a 1mL syringe with 27-gauge needle in order to physically rupture the cellular plasma membranes without affecting the nuclear compartment.

This technique also failed. Finally, a hypo-osmotic technique was used74. By significantly reducing the salt content in a detergent-free lysis buffer, an osmotic gradient is formed across the plasma membrane. Because of the higher osmolarity within the cell, water is forced into the cell in an attempt to equalize the osmotic gradient. The increased water in the cell bursts the plasma membrane spilling the cytosolic contents into the lysis buffer while holding the nuclear compartment intact. By performing centrifugation, the nuclear compartments of the cells were collected, completing the separation of the cell nucleus from the cytosol. Of course, not 100% of nuclear compartments can be saved and some will burst along with the plasma membrane. Also, not 100% of the cytosol can be removed from the nuclear compartments upon centrifugation.

These issues lead to contamination of the nuclear and cytosolic fractions and an experiment to test the purity of each fraction is necessary. A nuclear marker and cytosolic marker were selected. The protein fibrillarin is a ribonucleoprotein localized in the nucleolus of the cell and is often used as a nuclear marker64. The protein b-tubulin form microtubules, a major component of the cell

140 cytoskeleton is localized in the cytosol of the cell. b-tubulin is a known cytosolic marker. These proteins allow testing of the purity of the nuclear and cytosolic fractions. A clean nuclear fraction will have very limited amounts of b-tubulin protein, while a clean cytosolic fraction will have very limited amounts of fibrillarin protein. The results show high levels of both fibrillarin and b-tubulin in the cell homogenate prior to fractionation. Following fractionation protein levels of b-tubulin in the nuclear fraction were difficult to detect while protein levels of fibrillarin in the cytosolic fraction were low. After repeating the experiment multiple times, the results show a statistically important separation of the fractions, adequate purity of the fractions and successful nuclear fractionation. With the near complete separation of the nuclear compartment from the cell’s cytosol, the localization of transcription factor NF-kB before and after LPS-mediated stimulation of the NF-kB signaling pathway could be determined. The cell homogenate samples were assessed prior to fractionation. The results showed the experimental treatments worked. The protein levels of Pro-IL1b were upregulated following 4 hours of LPS treatment while protein levels of Pro-IL1b were significantly attenuated upon DMAG treatment 24 hours prior to 4 hours of LPS treatment.

After nuclear fractionation, the cytosolic and nuclear fractions were assessed for NF-kB protein levels. After repeating the experiment multiple times, the cytosolic fraction showed a statistically important decrease in NF-kB protein level while the nuclear fraction showed a statistically important increase in NF-kB protein level after 4 hours of LPS treatment. These results provide evidence that upon LPS-mediated stimulation of the NF-kB signaling pathway, the transcription factor NF-kB translocated from the cell cytosol to the cell nucleus. Interestingly, there was no significant change in the protein levels of NF-kB in either the cytosolic or nuclear fractions after

24 hours of DMAG treatment. These results indicate that DMAG has no effect on nuclear translocation of the transcription factor NF-kB.

141 4.11 DMAG has No Effect Upstream of NF-kB Nuclear Translocation

Since DMAG is not affecting NF-kB nuclear translocation but does have an effect on IL1b gene transcription, there is evidence that DMAG’s effect is within the cell nucleus and is involved in the transcription factor NF-kB’s ability to bind the DNA and/or transcribe the IL-1b gene. To test whether DMAG’s effect was localized to the cell nucleus, the effects of DMAG were assessed upstream of NF-kB translocation. As described earlier, the inhibitor IkB binds to the transcription factor NF-kB in the cell cytosol, inhibiting nuclear translocation73. The degradation of IkB by the

26S proteasome releases NF-kB, allowing nuclear translocation. Degradation of IkB is regulated by the NF-kB signaling pathway upstream of NF-kB translocation. Stimulation of the NF-kB signaling pathway eventually leads to formation of the IkB kinase complex (IKK complex). Upon formation, the IKK complex phosphorylates NF-kB’s bound inhibitor IkB. This leads to the ubiquitination of IkB and its eventual degradation by the 26S proteasome. To test for no upstream

DMAG effect, we evaluated IkB phosphorylation to determine if DMAG had any effect. The results showed that one hour after LPS treatment there was a significant increase in IkB phosphorylation followed by the upregulation of Pro-IL1b protein levels after 4 hours of LPS treatment. Importantly, the results showed that DMAG had no effect on IkB phosphorylation after one hour of LPS treatment yet still significantly attenuated Pro-IL1b protein levels after 4 hours of LPS treatment. This data confirms that Hsp90 has no role upstream of NF-kB nuclear translocation.

142 4.12 DMAG affects NF-kB-mediated Transcription in the Nucleus of the Cell

Investigating the role of Hsp90 within the cell nucleus is beyond the scope of this project. It is expected that it will take substantial time and effort to properly investigate Hsp90’s role regulating the transcription factor NF-kB within the cell nucleus and can be considered a stand-alone project for a future student. However, an informal review of the literature surrounding this matter was conducted. A paper published in 2016 describes Hsp90 inhibition suppressing NF-kB transcriptional activation in human lung microvascular endothelial cells (HLMVEC)75. A histone deacetylase from the Sirtuin family (Sirt-2) was shown to act as a transcriptional repressor and bind to the NF-kB target gene’s promoter preventing recruitment of NF-kB and assembly of the transcriptional machinery. Hsp90 inhibition was found to stabilize the Sirt-2/promoter interaction inhibiting the Sirt-2 repressor’s removal and therefore blocking transcription. Further, this transcriptional block could be reversed through Sirt-2 inhibition or Sirt-2 protein downregulation.

In an attempt to rescue IL1b gene transcription in THP-1 immune cells, we performed experiments using the Sirt-2 inhibitor, AGK2. After significant assay development, combined 24-hour Hsp90 inhibition and Sirt-2 inhibition followed by 4 hours of LPS treatment failed to rescue IL1b gene transcription in THP-1 immune cells. It should be noted that the positive control experiment for

Sirt-2 inhibitor function also failed. Nonetheless, an interesting finding was uncovered. In western blot experiments, Sirt-2 appeared as a doublet. Typically, this indicates the presence of two separate isoforms of the same protein or separate post-translational modifications of the same protein. Every time cells were treated with DMAG, the amount of higher molecular weight isoform of Sirt-2 was lower and the amount of lower molecular weight isoform of Sirt-2 was higher. This indicated that DMAG treatment may be having an effect on Sirt-2 and suggests further investigation is justified.

143 4.13 Future Direction

While at the same time confirming an Hsp90 inhibitor has an effect on NLRP3 function in accordance with the current literature, experimental evidence pointed to Hsp90 inhibition regulating the NLRP3 inflammasome by regulating protein expression via the NF-kB signaling pathway as opposed to a direct protein interaction with NLRP3. This finding contradicts the current literature28,41. The theoretical explanation underpinning the cause for this discrepancy seems plausible. The use of an overexpression systems, renowned for false positives caused by a natural propensity for protein aggregation without appropriate controls, may have led to inaccurate conclusions. The only issue remaining was an inability to replicate the findings in the literature of an Hsp90-NLRP3 protein interaction in an overexpression system using coimmunoprecipitation despite positively confirming colocalization using immunofluorescence. Interference caused by the size of the GFP-tag used in this work compared to the small FLAG-tag described in the literature can be considered a reason for this discrepancy. Future work should test this claim. A

HEK293T cell line should be developed that stably expresses FLAG-tagged NLRP3. This cell line should be used to verify the Hsp90-NLRP3 interaction using the technique coimmunoprecipitation similar to the current literature. The key result of this work was the identification of the nuclear compartment as the location for Hsp90’s indirect regulation of the NLRP3 inflammasome via gene transcription. The exact mechanism remains to be elucidated and was not investigated as part of this work. An attempt was made to confirm the findings of an existing publication describing histone deacetylase Sirt-2 as a repressor of NF-kB-mediated gene transcription being stabilized by

Hsp90 in lung endothelial cells. We failed to get the Sirt-2 inhibitor AGK2 to work but did find that DMAG had an effect on Sirt-2’s isoform protein levels. Future studies should investigate the detailed mechanism of Hsp90’s role on NF-kB-mediated gene transcription.

144 Clostridium difficile associated disease (CDAD) is a bacterial infection of the gut that causes inflammation and is commonly found in patients suffering from inflammatory bowel disease. C. diff Toxin TcdA and TcdB are known agonists of both the NLRP3 inflammasome and Pyrin inflammasome. Could Hsp90 inhibition have benefits for CDAD patients in controlling inflammation, reducing symptoms and allow the avoidance of chronic inflammatory conditions such as IBD? Future work should include mouse studies to determine the effects of Hsp90 inhibition on C. diff toxin-mediated intestinal damage with a goal to move into patient trials at a future date. The focus of this work was the NLR sensor, NLRP3. NLRP3 is one of several members of the NLR family of sensors. In addition to members of the NLR family, there are several other families including TLR, CLR, etc. All of these families form the protein super family known as the pattern recognition receptors (PRR) of the innate immune system. All members of the superfamily work together detecting pathogen or damage-associated molecular patterns, activating the immune response and managing inflammation. If Hsp90 inhibition has a potential in clinical applications, future work should include a survey to determine which of the PRR’s require Hsp90 for function. A more system-level, global approach to managing inflammation will be required instead of a focus on a single member of the NLR Family (i.e. NLRP3).

145 4.14 Summary

Within our immune cells, the NLRP3 inflammasome lies at the center of the innate immune system. After sensing pathogenic or damage associated danger, the NLRP3 inflammasome forms, then activates the immune response through the activation and following secretion of pro- inflammatory cytokines, such as IL-1b. It was shown that NLRP3 protein requires Hsp90, a heat shock protein, in order to function. Evidence presented suggested Hsp90 supports NLRP3 through a direct binding interaction via its co-chaperone SGT1. The proposed mechanism described Hsp90 holding NLRP3 conformationally competent during physiological conditions. Upon sensing danger, Hsp90-SGT1 releases NLRP3 allowing it to oligomerize with other molecules to form the inflammasome. The basis of my thesis was the exploration of this mechanism. Our data confirmed that Hsp90 inhibitor, DMAG affects NLRP3 function however, we failed to find any evidence that

Hsp90 has a direct binding interaction with NLRP3 despite attempting to detect the interaction using multiple techniques. Therefore, the hypothesis that Hsp90 regulates the activation of the

NLRP3 inflammasome through direct protein interaction has been refuted. Our evidence suggested that DMAG has an effect on NLRP3 and Pro-IL1b protein levels, known products of the NF-kB signaling pathway. Without adequate levels of protein, NLRP3 inflammasome formation is limited and cytokine secretions were significantly attenuated. Further work showed that DMAG had an effect on IL1b gene transcription but not nuclear translocation of the transcription factor responsible for gene transcription, NF-kB. This suggested a role for Hsp90 within the nucleus of the cell supporting NF-kB-mediated gene transcription. Determining the role for Hsp90 in the nucleus of the cell is beyond the scope of this work but should be studied in the future. The result of this work suggests that drugs that inhibit Hsp90 may potentiate inflammation and perhaps provide some relief of symptoms for sufferers of chronic inflammation.

146 References

1. Abelson, M.; Gamache, D.; McLaughlin, M. Innate Immunity: A Question of Balanace.

Rev. Opthalmology XXI, 70–75 (2014).

2. Cattaneo, C. et al. Analysis of Toll-Like Receptors in Human Milk: Detection of

Membrane-Bound and Soluble Forms. J. Immunol. Res. 2019, 1–12 (2019).

3. Hoving, J. C., Wilson, G. J. & Brown, G. D. Signalling C-type lectin receptors, microbial

recognition and immunity. Cell. Microbiol. 16, 185–194 (2014).

4. Kell, A. M. & Gale, M. RIG-I in RNA virus recognition. Virology 479–480, 110–121

(2015).

5. Gray, E. E. et al. The AIM2-like Receptors Are Dispensable for the Interferon Response

to Intracellular DNA. Immunity 45, 255–266 (2016).

6. Motta, V., Soares, F., Sun, T. & Philpott, D. J. NOD-Like Receptors: Versatile Cytosolic

Sentinels. Physiol. Rev. 95, 149–178 (2014).

7. Saxena, M. & Yeretssian, G. NOD-like receptors: Master regulators of inflammation and

cancer. Frontiers in Immunology 5, 1–16 (2014).

8. Moreira, L. O. & Zamboni, D. S. NOD1 and NOD2 signaling in infection and

147 inflammation. Frontiers in Immunology 3, 1–12 (2012).

9. Vladimer, G. I., Marty-Roix, R., Ghosh, S., Weng, D. & Lien, E. Inflammasomes and host

defenses against bacterial infections. Current Opinion in Microbiology 16, 23–31 (2013).

10. Tuncer, S., Fiorillo, M. T. & Sorrentino, R. The multifaceted nature of NLRP12. J.

Leukoc. Biol. 96, 1–10 (2014).

11. Afonina, I. S., Zhong, Z., Karin, M. & Beyaert, R. Limiting inflammation - The negative

regulation of NF-κB and the NLRP3 inflammasome. Nat. Immunol. 18, 861–869 (2017).

12. Takai, K. et al. Acquired Thermotolerance and Temperature-Induced Protein

Accumulation in the Extremely Thermophilic Bacterium Rhodothermus obamensis

Acquired Thermotolerance and Temperature-Induced Protein Accumulation in the

Extremely Thermophilic Bacterium Rhodothermus. 180, 2770–2774 (1998).

13. Richter, K., Haslbeck, M. & Buchner, J. The Heat Shock Response: Life on the Verge of

Death. Mol. Cell 40, 253–266 (2010).

14. Requena, J. M., Montalvo, A. M. & Fraga, J. Molecular Chaperones of Leishmania:

Central Players in Many Stress-Related and -Unrelated Physiological Processes. Biomed

Res. Int. 2015, 1–21 (2015).

148 15. Jahn, T. R. & Radford, S. E. Folding versus aggregation: Polypeptide conformations on

competing pathways. Arch. Biochem. Biophys. 469, 100–117 (2008).

16. Xu, Q., Metzler, B., Jahangiri, M. & Mandal, K. Molecular chaperones and heat shock

proteins in atherosclerosis. Am. J. Physiol. - Hear. Circ. Physiol. 302, H506–H514 (2012).

17. Kumar, C. M. S., Mande, S. C. & Mahajan, G. Multiple chaperonins in bacteria—novel

functions and non-canonical behaviors. Cell Stress Chaperones 20, 555–574 (2015).

18. Richter, K. & Buchner, J. Hsp90: Chaperoning signal transduction. J. Cell. Physiol. 188,

281–290 (2001).

19. Whitesell, L. & Lindquist, S. L. HSP90 and the chaperoning of cancer. Nat. Rev. Cancer

5, 761–72 (2005).

20. Hoter, A., El-Sabban, M. E. & Naim, H. Y. The HSP90 Family: Structure, Regulation,

Function, and Implications in Health and Disease. Int. J. Mol. Sci. 19, 1–33 (2018).

21. Chen, B., Piel, W. H., Gui, L., Bruford, E. & Monteiro, A. The HSP90 family of genes in

the human genome: Insights into their divergence and evolution. Genomics 86, 627–637

(2005).

22. Wolmarans, A., Lee, B., Spyracopoulos, L. & LaPointe, P. The Mechanism of Hsp90

149 ATPase Stimulation by Aha1. Sci. Rep. 6, 1–15 (2016).

23. Lackie, R. E. et al. The Hsp70/Hsp90 chaperone machinery in neurodegenerative diseases.

Front. Neurosci. 11, 1–23 (2017).

24. Li, J., Soroka, J. & Buchner, J. The Hsp90 chaperone machinery: Conformational

dynamics and regulation by co-chaperones. Biochim. Biophys. Acta - Mol. Cell Res. 1823,

624–635 (2012).

25. Prodromou, C. Mechanisms of Hsp90 regulation. Biochem. J. 473, 2439–52 (2016).

26. Mollapour, M. & Neckers, L. Post-translational modifications of Hsp90 and their

contributions to chaperone regulation. Biochim. Biophys. Acta - Mol. Cell Res. 1823, 648–

655 (2012).

27. Röhl, A., Rohrberg, J. & Buchner, J. The chaperone Hsp90: Changing partners for

demanding clients. Trends Biochem. Sci. 38, 253–262 (2013).

28. Mayor, A., Martinon, F., De Smedt, T., Pétrilli, V. & Tschopp, J. A crucial function of

SGT1 and HSP90 in inflammasome activity links mammalian and plant innate immune

responses. Nat. Immunol. 8, 497–503 (2007).

29. Shirasu, K. & Schulze-Lefert, P. Complex formation, promiscuity and multi-functionality:

150 Protein interactions in disease-resistance pathways. Trends Plant Sci. 8, 252–258 (2003).

30. Chisholm, S. T., Coaker, G., Day, B. & Staskawicz, B. J. Host-microbe interactions:

Shaping the evolution of the plant immune response. Cell 124, 803–814 (2006).

31. The UniProt Consortium. UniProt: a worldwide hub of protein knowledge The UniProt

Consortium. Nucleic Acids Res. 47, D506–D515 (2019).

32. Zuehlke, A. & Johnson, J. L. Hsp90 and co-chaperones twist the functions of diverse

client proteins. Biopolymers 93, 211–217 (2010).

33. Karagöz, G. E. & Rüdiger, S. G. D. Hsp90 interaction with clients. Trends Biochem. Sci.

40, 117–125 (2015).

34. Pearl, L. H. Review: The HSP90 molecular chaperone - An enigmatic ATPase.

Biopolymers 105, 594–607 (2016).

35. Kim, L. S. & Kim, J. H. Heat shock protein as molecular targets for breast cancer

therapeutics. J Breast Cancer 14, 167–174 (2011).

36. The Myeloma Beacon Staff. Bristol-Myers Squibb Halts Development of Tanespimycin.

The Myeloma Beacon 1–2 (2010).

151 37. Taldone, T., Gozman, A., Maharaj, R. & Chiosis, G. Targeting Hsp90: small-molecule

inhibitors and their clinical development. Curr. Opin. Pharmacol. 8, 370–374 (2008).

38. Brough, P. a et al. 4,5-Diarylisoxazole Hsp90 Chaperone Inhibitors: Potential Therapeutic

Agents for the Treatment of Cancer. J. Med. Chem. 51, 196–218 (2007).

39. Ramsay, R. R. & Tipton, K. F. Assessment of Enzyme Inhibition: A Review with

Examples from the Development of Monoamine Oxidase and Cholinesterase Inhibitory

Drugs. Molecules 22, pii (2017).

40. Shen, B. et al. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-

target effects. Nat. Methods 11, 399–402 (2014).

41. Martinon, F. Detection of immune danger signals by NALP3. J. Leukoc. Biol. 83, 507–

511 (2008).

42. Hoffman, H. M., Mueller, J. L., Broide, D. H., Wanderer, A. A. & Kolodner, R. D.

Mutation of a new gene encoding a putative pyrin-like protein causes familial cold

autoinflammatory syndrome and Muckle-Wells syndrome. Nat. Genet. 29, 301–305

(2001).

43. Pierantonelli, I. et al. Lack of NLRP3-inflammasome leads to gut-liver axis derangement,

gut dysbiosis and a worsened phenotype in a mouse model of NAFLD. Sci. Rep. 7, 1–15

152 (2017).

44. Li, D. et al. A cytosolic heat shock protein 90 and cochaperone CDC37 complex is

required for RIP3 activation during necroptosis. Proc. Natl. Acad. Sci. U. S. A. 112, 5017–

5022 (2015).

45. Chung, H. et al. NLRP3 regulates a non-canonical platform for caspase-8 activation

during epithelial cell apoptosis. Cell Death Differ. 23, 1–16 (2016).

46. Ng, J. et al. Clostridium difficile toxin-induced inflammation and intestinal injury are

mediated by the inflammasome. Gastroenterology 139, 542–552 (2010).

47. Platnich, J. M. et al. Shiga Toxin/Lipopolysaccharide Activates Caspase-4 and Gasdermin

D to Trigger Mitochondrial Reactive Oxygen Species Upstream of the NLRP3

Inflammasome. Cell Rep. 25, 1525–1536 (2018).

48. Wang, W. et al. Inflammasome-Independent NLRP3 Augments TGF-β Signaling in

Kidney Epithelium. J Immunol 190, 1239–1249 (2013).

49. Herzyk, D. J., Berger, A. E., Allen, J. N. & Wewers, M. D. Sandwich ELISA formats

designed to detect 17 kDa IL-1β significantly underestimate 35 kDa IL-1β. J. Immunol.

Methods 148, 243–254 (1992).

153 50. Akerström, B., Brodin, T., Reis, K. & Björck, L. Protein G: a powerful tool for binding

and detection of monoclonal and polyclonal antibodies. J. Immunol. 135, 2589–2592

(1985).

51. Stadler, C. et al. Immunofluorescence and fluorescent-protein tagging show high

correlation for protein localization in mammalian cells. Nat. Methods 10, 315–323 (2013).

52. Hobro, A. J. & Smith, N. I. An evaluation of fixation methods: Spatial and compositional

cellular changes observed by Raman imaging. Vib. Spectrosc. 91, 31–45 (2017).

53. Bhattacharyya, D., Hammond, A. T. & Glick, B. S. High-quality immunofluorescence of

cultured cells. Methods Mol. Biol. 619, 403–410 (2010).

54. Fredriksson, S. et al. Protein detection using proximity-dependent DNA ligation assays.

Nat. Biotechnol. 20, 473–477 (2002).

55. Zinser, E. & Daum, G. Isolation and biochemical characterization of organelles from the

yeast, Saccharomyces cerevisiae. Yeast 11, 493–536 (1995).

56. Dianati, E. & Plante, I. Analysis of protein-protein interactions and co-localization

between components of gap, tight, and adherens junctions in Murine Mammary Glands. J.

Vis. Exp. 123, 1–8 (2017).

154 57. Spring, Kenneth; Fellers, Thomas; Davidson, M. Colocalization of Fluorophores in

Confocal Microscopy. 1, 1–8 (2012).

58. Martinon, F., Burns, K. & Tschopp, J. The Inflammasome: A molecular platform

triggering activation of inflammatory caspases and processing of proIL-β. Mol. Cell 10,

417–426 (2002).

59. Edwards, T. G., Bloom, D. C. & Fisher, C. The ATM and Rad3-Related (ATR) Protein

Kinase Pathway Is Activated by Herpes Simplex Virus 1 and Required for Efficient Viral

Replication. J. Virol. 92, pii (2017).

60. Rumble, J. R. ed. Handbook of Chemistry and Physics 100th Edition. CRC press/Taylor &

Francis, Boca Raton, FL. (2019).

61. Slee, E. A. et al. Benzyloxycarbonyl-Val-Ala-Asp (OMe) fluoromethylketone (Z-

VAD.FMK) inhibits apoptosis by blocking the processing of CPP32. Biochem. J. 315, 21–

24 (1996).

62. Sharif, O., Bolshakov, V. N., Raines, S., Newham, P. & Perkins, N. D. Transcriptional

profiling of the LPS induced NF-κB response in macrophages. BMC Immunol. 8, 1–17

(2007).

63. Liu, T., Zhang, L., Joo, D. & Sun, S. C. NF-κB signaling in inflammation. Signal

155 Transduct. Target. Ther. 2, pii (2017).

64. Amin, M. A. et al. Fibrillarin, a nucleolar protein, is required for normal nuclear

morphology and cellular growth in HeLa cells. Biochem. Biophys. Res. Commun. 360,

320–326 (2007).

65. Islam, M. S., Aryasomayajula, A. & Selvaganapathy, P. R. A review on macroscale and

microscale cell lysis methods. Micromachines 8, 1–27 (2017).

66. Tourkochristou, E., Aggeletopoulou, I., Konstantakis, C. & Triantos, C. Role of NLRP3

inflammasome in inflammatory bowel diseases. World J. Gastroenterol. 25, 4796–4804

(2019).

67. Meyerkord, C. L. & Fu, H. Protein-protein interactions: Methods and applications:

Second edition. Protein-Protein Interactions: Methods and Applications: Second Edition

(2015).

68. Cranfill, P. J. et al. Quantitative assessment of fluorescent proteins. Nat. Methods 13, 557–

562 (2016).

69. Zhou, H.-X., Rivas, G. & Minton, A. P. Macromolecular Crowding and Confinement:

Biochemical, Biophysical, and Potential Physiological Consequences. Annu. Rev. Biophys.

37, 375–397 (2008).

156 70. Moriya, H. Quantitative nature of overexpression experiments. Mol. Biol. Cell 26, 3932–

3939 (2015).

71. Bersten, D. C. et al. Inducible and reversible lentiviral and recombination mediated

cassette exchange (RMCE) systems for controlling gene expression. PLoS One 10, 1–20

(2015).

72. Raetz, C. R. H. & Whitfield, C. Lipopolysaccharide Endotoxins. Annu. Rev. Biochem. 71,

635–700 (2002).

73. Gupta, S. C., Sundaram, C., Reuter, S. & Aggarwal, B. B. Inhibiting NF-κB activation by

small molecules as a therapeutic strategy. Biochim. Biophys. Acta - Gene Regul. Mech.

1799, 775–787 (2010).

74. Stewart, M. P., Langer, R. & Jensen, K. F. Intracellular delivery by membrane disruption:

Mechanisms, strategies, and concepts. Chem. Rev. 118, 7409–7531 (2018).

75. Xu, S. N., Wang, T. S., Li, X. & Wang, Y. P. SIRT2 activates G6PD to enhance NADPH

production and promote leukaemia cell proliferation. Sci. Rep. 6, 1–13 (2016).

157