REGULATION of EXPRESSION of 5A-REDUCTASES in HUMAN PROSTATE CELLS

REGULATION OF EXPRESSION OF 5a-REDUCTASES

IN HUMAN PROSTATE CELLS

Tasim Ara Begum B.Sc.

A Thesis Submitted For The Degree Of Doctor Of Philosophy To

The Faculty Of Medicine

University College London

Institute of Urology and Nephrology

Research Laboratories

University College London ProQuest Number: 10014997

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.

ProQuest 10014997

Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.

ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT The aim of this project was to study the regulation of expression of the 5a-reductase (5aR) I and II genes in human prostate cells. Both enzymes are expressed in prostate tissue and 5aR II is essential for normal prostate development. 5aR is a potential target for the treatment of benign prostatic hyperplasia and prostate cancer.

To study the regulation of gene transcription, cells constitutively expressing the 5a-reductase enzymes were needed. However this was not possible for 5aRII, since none of the human prostate cell lines available express it. Therefore the first objective of the study was to grow primary cultures from primary and metastatic prostate cancers in bone, in serum-free medium and immortalise the cells with a temperature-sensitive conditionally immortalising T-antigen construct. Conditionally immortalised cell lines would be more likely to express differentiated characteristics such as 5aRII, PSA etc lacking in most available cell lines and therefore could be used to study the regulation of 5aRII gene and would serve as more representative in vitro models for prostatic research. However, the serum-free media (WAJC 404) used to maintain the epithelial cell cultures derived from the primary prostate cancers did not support their long-term growth. Attempts were also made to establish cell lines from prostate cancer métastasés in the bone marrow of hormone-relapsed patients. However, most of the bone marrow aspirates did not contain prostate cancer cells and no cultures were established. On the basis of these studies, using a new serum free medium (PrEGM), an epithelial (Pre2.8) and stromal cell (S2.13, which expresses 5aRII) line from the same patient were established subsequently by others in the laboratory.

To study the regulation of transcription, the 5' regulatory region of the 5aR I gene was isolated from a human genomic DNA library, cloned and sequenced. A series of deletion constructs ranging in size from 0.16-4.6kb upstream of the ATG start site were made in the promoterless luciferase reporter vector pGL2Basic, and transfected in prostate and non- prostate cells. A 0.6kb fragment upstream of the ATG start site produced the highest promoter activity in cell lines, including PC3 and DU 145, derived from human prostate cancers. Primer extension analysis showed that the transcription start site was located at a putative TATA box, 56 bases upstream of the ATG codon. There are many potential transcription factor (TF) binding sites on the promoter, including AP2 and SPl, but transient transfection with expression vectors for these TPs did not influence transcription from the 5aR I promoter construct.

The 5' regulatory region of the 5aR II gene was isolated from a human genomic DNA library, cloned and sequenced. A series of deletion constructs ranging in size from 0.15-0.7kb upstream of the ATG site were made in the promoterless luciferase reporter vector pGL2Basic, and transfected in cells as for the 5aRI constructs. A 0.4kb fragment produced the highest promoter activity in a prostate and non-prostate cell line. Attempts at cloning the 8kb sequence upstream of the O.Vkb, in the O.Vkb luciferase construct were unsuccessful.

Because of the lack of human 5aRII expressing prostate cell lines, which could be used for testing therapeutic agents targeting this enzyme, a serum free derivative of the prostate cancer cell line DU 145 called DUSF was stably transfected with a 5aRII expression vector. An overexpressing clone of DUSF was isolated and found to convert more testosterone to dihydrotestosterone in a crude metabolism assay. This is the first human cell line clone shown to express 5aRII.

As a result of this work, novel information has been obtained concerning the regulation of transcription of the 5aR genes. In addition, new human prostate cell line clones have been developed which express 5aR II. II Dedicated to my parents

m ACKNOWLEDGEMENTS

I am indebted to my supervisor Dr John Masters for the training, encouragement and support he has provided during my Ph.D. studies at the Institute of Urology. I would like to thank the

Covent Garden Cancer Research Trust for providing the financial support for this project.

I would also like to thank Prof. Reinhart Buettner at the Institute for Pathology, University of

Regensburg for the technical guidance he has provided throughout the duration of the project. I am also grateful to the following people from the Institute of pathology; Silvia

Seegers for providing the sequencing data and technical support for the cloning work, Drs.

Armin Pscherer, Georg Paputsoglu and Markus Moser for their technical expertise and invaluable advice on the cloning project. My heartfelt thanks go to everyone at the Institute for making my visits there an enjoyable experience.

I would like to thank Dr. Mike O’Hare for transducing the primary cultures with the SV40 construct. I would also like to thank all my colleagues at the Institute of Urology, particularly Dr David Hudson, Dr. Pat Fry, Dr John Hothersall, Vicky Samara and

Bernadette Daly for all their help and encouragement throughout my studies.

Finally, I would like to thank my husband and family for their belief in me, for their understanding, encouragement and unquestioning support without which this work would not have been possible.

IV TABLE OF CONTENTS

Page

CHAPTER 1 GENERAL INTRODUCTION 1

1.1 EMBRYOLOGY AND THE ANATOMY OF THE PROSTATE 3 1.1.1 Embryology Of The Prostate 3 1.1.2 The Adult Prostate 3 1.2 DISEASES OF THE PROSTATE 5 1.2.1 Benign Prostatic Hyperplasia 5 1.2.2 Prostate Cancer 7

1.3 ANDROGENS AND ITS METABOLISM IN THE PROSTATE 10 1.3.1 Role Of Androgens In The Prostate 10 1.3.2 The Role Of The Androgen Receptor 12 1.3.3 Androgen Metabolism In The Prostate 14

1.4 5a REDUCTASE ENZYMES 16 1.4.1 Mode Of Action 16 1.4.2 Isolation And Characterisation Of The 5a-Reductase enzymes 17 1.4.3 Characterisation Of The Sa-Reductase Genes 18 1.4.4 Tissue And Cell Specific Expression Of Sa-Reductase enzymes 19

1.5 ANDROGENS AND ITS METABOLISM IN PROSTATIC DISEASE AND TREATMENT 25 1.5.1 Androgens In BPH 25 1.5.2 Androgens In Prostate Cancer 27 1.5.3 5a-Reductase Inhibitors In The Treatment of BPH 29 1.5.4 5a-Reductase Inhibitors In The Treatment of Prostate Cancer 30

1.6 IN VITRO MODELS OF THE PROSTATE 31 1.6.1 SV40 Immortalisation OF Cultured Cells 31 1.6.2 Immortalised Prostate Cell Lines 33 1.6.3 Prostate Cancer Cell Lines 33

1.7 Thesis Aims 37

CHAPTER 2 MATERIALS AND METHODS 39

2.1 MATERIALS 40 2.1a Chemicals And Reagents 40 2.1b Screening Primers and Probes 44 2.1c Cloning Primers 45 2.1d Sequencing Primers 45 2.1e Fluorescent Labelled Primer for 5a-Reductase I Primer Extension Assay 47 2.1f Libraries, Cloning Vectors and Expression Plasmids 47 2.1g RT-PCR Primers 51

V 2.2 CELL CULTURE 51 2.2a Culture Of Cells Derived From Primary Prostate Cancers 51 2.2b Culture of cells derived from the bone marrow 54 2.2c Culture of Continuous Cell Lines 56

2.3 CLONING OF THE 5a REDUCTASE PROMOTERS 58 2.3a Preparation of Probes for Sequencing 58 2.3b Genomic DNA Library screening 61 2.3c Cloning into Plasmids Vectors 65

2.4 GENERATION OF 5a-REDUCTASE PROMOTER DELETION CONSTRUCTS 71 2.4a Cloning of the 5' Region of The 5a-Reductase I Gene into pGL2Basic reporter plasmid 71 2.4b Cloning of the 5' Region of The 5a-Reductase II Gene into pGL2Basic reporter plasmid 73 2.4c Generation of Smaller 5a-Reductase I and H reporter Constructs 73

2.5 TRANSFECTION AND ASSAY OF PUTATIVE 5a-REDUCTASE PROMOTER CONSTRUCTS IN CELL LINES 74 2.5a Transfection of CNS Derived Cell Lines 74 2.5b Optimisation of Conditions and Transfection of Prostate Cancer Cell Lines 76 2.5c Assay of Luciferase and P-Galactosidase Activity in Transfected Cell Lysates 85 2.5d Normalisation of Luciferase against P-Galactosidase Readings 86

2.6 CHARACTERISATION OF 5a REDUCTASE PROMOTERS 88 2.6a Primer Extension Analysis of 5a-reductase I gene 88 2.6b Analysis of 5a-Reductase Promoter Regions For Putative Transcription Factor binding Sites 89 2.6c Identification of Transcription Factors Involved In 5a-Reductase I Promoter Activity 90

2.7 5a REDUCTASE mRNA EXPRESSION IN PROSTATIC TISSUE AND CELL LINES 90 2.7a Extraction of Total RNA From Cultured Cells And Tissue 90 2.7b RT-PCR of Prostatic RNA 90

2.8 STABLE TRANSFECTION OF 5a REDUCTASE H GENE IN DUSF AND COS-I CELL LINES 92 2.8a Transfection of 5a-Reductase H Expression Vector in DUSF and COS-I cell lines 92 2.8b Maintenance, Selection and Serial Expansion of G418 Resistant clones 93 2.8c Testing G418 Resistant Clones 94 2.8d Assay of 5a-Reductase activity 94

CHAPTER 3 CULTURE OF CELLS FROM PROSTATE CANCERS 97

VI 3.2 AIM 98 3.3 CULTURE OF CELLS DERIVED FROM PRIMARY PROSTATE CANCERS 100 3.3.1 Experimental plan 100 3.3.2 Results 100 3.4 CULTURE OF CELLS DERIVED FROM BONE MARROW ASPIRATES 104 3.4.1 Experimental plan 104 3.4.2 Results 104 3.5 DISCUSSION 108

CHAPTER 4 CLONING AND CHARACTERISATION OF THE 5' REGULATORY REGION OF THE SoREDUCTASE I GENE 114

4.1 INTRODUCTION 115 4.2 AIMS 116 4.3 RESULTS 117 4.3.1 Cloning And Sequencing The 5' Flaking Region Of The 5a-Reductase I Gene 117 4.3.2 Reporter Assay Using The 5a-Reductase I Promoter Constructs 125 4.3.3 Characterisation Of The 5a-Reductase I Promoter 132 4.4 DISCUSSION 144 Appendix 1 148

CHAPTER 5 CLONING AND CHARACTERISATION OF THE 5' REGULATORY REGION OF THE 5gREDUCTASE II GENE 153

5.1 INTRODUCTION 154 5.2 AIMS 154 5.3 RESULTS 155 5.3.1 Cloning And Sequencing The 5' Flaking Region Of The 5a-Reductase II Gene 155 5.3.2 Reporter Assay Using The 5a-Reductase I Promoter Constructs 164 5.3.3 Characterisation Of The 5a-Reductase II Promoter 168 5.4 DISCUSSION 171 Appendix 2 175

CHAPTER 6 DEVELOPMENT OF CELL LINES EXPRESSING 5g-REDUCTASE II 176 6.1 BACKGROUND 177 6.2 AIM 177 6.3 RESULTS 178 6.3.1 Screening A Panel Of Cell Lines For Expression Of 5a-Reductase I And II mRNA 178 6.3.2 Stable Transfection Of DUSF With A 5a-Reductase II Expression Vector 183 6.3.3 Selection Of DUSF And COS-I Clones Overexpressing 5a-Reductase mRNA 185 6.3.4 Metabolism Of ^ H-Testosterone By 5a-Reductase II Expressing Clones 187 6.4 DISCUSSION 193

VII CHAPTER 7 FINAL DISCUSSION AND FUTURE WORK 197

CHAPTER 8 REFERENCES 211

VIII List of Figures Page

Figure 1.1: Zonal anatomy of the prostate. 4 Figure 1.2: Action of testosterone and dihydrotestosterone in the prostate cell. 13 Figure 1.3: Metabolism of testosterone in the prostate. 15 Figure 1.4: Conversion of testosterone to dihydrotestosterone. 16 Figure 1.5: Predominant pathways of T metabolism in benign and malignant human prostate. 28

Figure 2.1 : Map of Lambda FDCII vector. 47 Figure 2.2: Map of pBluescript vector. 48 Figure 2.3: Map of pGL2-Basic vector. 49 Figure 2.4: Map of pcDNA3.1 vector. 50

Figure 3.1 : Culture of stromal cells derived from the bone marrow. 105

Figure 4.1 : Southern blot analysis of restriction digested C14 and C17 phage DNA. 118 Figure 4.2: Restriction digestion and Southern blot analysis of P2 phage DNA. 120 Figure 4.3: CLONE P2. 121 Figure 4.4: 5a-reductase I specific 3' primer. 122 Figure 4.5: Promoter region of clone P2. 124 Figure 4.6: Restriction digestion of constructs used for transfection. 126 Figure 4.7: Transcriptional analysis of the 5a-reductase I promoter constructs in prostate cancer cell lines. 129 Figure 4.8: Transcriptional analysis of the 5a-reductase I promoter constructs in CNS-derived cell lines. 130 Figure 4.9: Primer extension analysis of 5a-reductase I. 133 Figure 4.101: Analysis of the 5a-reductase I promoter using Matlnspector to identify putative consensus binding sites for transcription factors 134 Figure 4. lOII: Analysis of the 5a-reductase I promoter using Signal Scan to identify putative consensus binding sites for transcription factors. 137 Figure 4.11 : Effect of AP2 and SPl transcription factors on the transcription driven by the 5a-reductase I promoter in DU 145. 140 Figure 4.12: Effect of AP2 and SPl transcription factors on the transcription driven by the 5a-reductase I promoter in LAN-1. 142

Figure 5.1 : Restriction digestion and Southern blot analysis of PI6 phage DNA. 157 Figure 5.2: Restriction digestion of P I6 DNA with Sac I. 158 Figure 5.3: 5a-reductase II specific 3' primer. 159 Figure 5.4: Anchored PCR of P I6 DNA. 162 Figure 5.5: Sac I restriction map of clone PI6. 163 Figure 5.6: Restriction digestion of constructs used for transfection. 164 Figure 5.7: Transcriptional analysis of the 5a-reductase II promoter constructs in DU 145 prostate cancer cell line. 166 Figure 5.8: Transcriptional analysis of the 5a-reductase II promoter constructs in LAN-1. 167 Figure 5.9: Analysis of the 5a-reductase II promoter using Matlnspector

IX to identify putative consensus binding sites for transcription factors 168

Figure 6.1 : RT-PCR analysis of 5a-reductase I, II and p-actin mRNA in human prostate and CNS derived cell lines. 179 Figure 6.2: RT-PCR analysis of 5a-reductase I, II and p-actin mRNA in S2.13, Pre2.8 and DUSF human prostate cell lines. 181 Figure 6.3 : Selection of G418 resistant DUSF and COS-I clones. 184 Figure 6.4: Selection of 5a-reductase II mRNA overexpressing COS-I clones. 185 Figure 6.5: RT-PCR analysis of 5a-reductase II mRNA of selected overexpressing DUSF and COS-I clones. 186 Figure 6.6: Separation of testosterone and its metabolites by TLC. 189

X List of Tables

Page Table 1.1: Concentration of substances present in prostatic secretion. 2 Table 1.2: Expression of 5a-reductase isozymes in the prostate. 23 Table 1.3: Prostate cell lines 35

Table 2.1 : Origin of prostatic and non-prostatic continuous cell lines. 57 Table 2.2: Effect of cell number and DNA concentration on transfection efficiency. 76 Table 2.3: The effect of DNA concentration on transfection efficiency. 77 Table 2.4: Transfection of 5a-reductase I promoter constructs in DU 145 using electroporation. 78 Table 2.5: Superfect mediated lipofection in DU145. 79 Table 2.6: Lipofection of promoter constructs in DU 145 using Gibco lipofection reagents. 80 Table 2.7: Lipofectamine mediated transfection of DU 145 in 6 well plates. 80 Table 2.8: Lipofectamine PLUS mediated transfection of DU 145 in 6 well plates. 81 Table 2.9: Effect of large scale calcium phosphate mediated transfection in DU145. 81 Table 2.10: Effect of cell number and DNA concentration on calcium phosphate mediated transfection of PC3. 82 Table 2.11 : Lipofectamine mediated transfection of PC3. 82 Table 2.12: Lipofectamine PLUS mediated transfection of PC3. 83 Table 2.13: Effect of capacitance and voltage on electroporation efficiency in LNCaP. 84 Table 2.14: Lipofectin and DMRIE mediated lipofection of LNCaP. 85 Table 2.15: Normalisation of luciferase against (3-galactosidase readings. 87

Table 3.1 : Primary culture of epithelial and stromal cells from the prostate. 101 Table 3.2: Effect of various media on the colony forming efficiency (CPE) of prostate cancer cell lines. 103 Table 3.3: Cytological analysis of bone marrow smears. 104 Table 3.4: Summary of the results of culture of bone marrow derived cells 106

3 Table 6.1 : Loss of H-T from various experimental steps. 188 3 Table 6.2: H-Testosterone metabolism by 5a-reductase II expressing cell lines and prostate cell lines. 190 3 Table 6.3: % recovery of H metabolites from T metabolism assays. 192

XI ABBREVIATIONS

°C: Degree centigrade CaClz : Calcium chloride CcCl: Caesium chloride CO2 : Carbon dioxide DMEM: Dulbecco’s Modification of Eagles Medium DNA: Deoxyribonucleic acid dNTP: Deoxyribonucleotide triphosphate ECS: Foetal Calf Serum G418: Neomycin HEPES: N-(2-hydroxyethl)-piperazine-N’-(2-ethane) sulphonic acid IPTG: Isopropyl p-D-thiogalactopyranosidase Kb: Kilobase KCl: Pottasium chloride KG AC: Pottasium acetate LB: Luria broth ml: Mililitre M: Molar MgCL: Magnesium chloride Na2HP0 4 : Sodium phosphate NaCl: Sodium chloride NaOH: Sodium hydroxide PBS: Phosphate buffered saline PCR: Polymerase chain reaction RNA: Ribonucleic acid rpm: Revolutions per minute RT-PCR: Reverse transcription -polymerase chain reaction X-gal: p-D-galactopyranosidase

XII CHAPTER 1

INTRODUCTION INTRODUCTION

The human prostate gland is sited at the neck of the bladder in men, surrounding the urethra as it leaves the bladder. The prostate contributes about 25% of the seminal fluid and contains high concentrations of ions, including zinc, citrate, sodium, potassium and chloride (see Table 1.1). It also contains low molecular weight substances, such as cholesterol, amino acids, spermine and enzymes. The enzymes include prostate specific antigen (PSA), amylase, acid and alkaline phosphatase (Aumuller, 1983). However, a functional prostate is not essential for reproduction (Franks, 1983), as sperm taken from the vas deferens can be used to fertilise eggs.

Constituent Concentration IONS Sodium 2.58mg/ml Calcium 0.282mg/ml Potassium 0.91 mg/ml Zinc 0.14mg/ml Chloride l-2mg/ml Citrate l-7mg/ml LOW MOLECULAR WEIGHT SUBSTANCES Cholesterol 0.45mg/ml Amino acids 12.5mg/ml Glutamic acid 2.79mg/ml Spermine 0.6mg/ml Spermidine 0.06mg/ml

PROTEINS (total) 35-50mg/ml SERUM PROTEINS Lactoferrin 1.2mg/ml Transferrin 0.22mg/ml Coeruloplasmin 0.1 mg/ml ENZYMES Acid phosphatase 858ng/gm Creatine kinase 307u/litre Lysozyme 70ng/ml

Table 1.1: Concentration of substances present in prostatic secretion. Adapted from Aumuller, 1983. 1.1 Embryology and anatomy of the prostate 1.1.1 Embryology of the prostate Gender establishment in the embryo consists of three sequential processes. The first process is the selection of chromosomal sex, followed by gonadal sex (when the indifferent gonad differentiates into a testis or an ovary), and the third is phenotypic sex established by gonadal secretions (George and Wilson, 1986, Wilson et al, 1993). During the stage of gonadal sexual development, the progenitor tissue of the urogenital system consists of two ducts: Wolffian and Mullerian ducts. These ducts develop into male (epididymis, vas deferens, and seminal vesicles) or female (fallopian tubes, uterus, and vagina) internal reproductory organs, as well as the urogenital sinus (UGS) and tubercle which form the external genitalia and the lower urinary tract. In the absence of male hormones secreted by the testes, the foetus will develop as phenotypically female (George and Wilson, 1986).

In the male embryo, antimullerian hormone produced by the Sertoli cells of the testis causes regression of the Mullerian ducts and inhibits development of female accessory reproductive organs (Donahoe et al, 1982). At about the 8th week of gestation, the Leydig cells of the testis produce testosterone (T) which induces the Wolffian duct to develop into epididymis, vas deferens and seminal vesicles by the 13th week (Siiteri and Wilson, 1974, George and Wilson, 1986). At about the 10th week of gestation, the prostate arises as a series of buds from the urethra from immediately below the bladder, which grows into the surrounding mesenchyme. The buds grow rapidly, branch and canalise and by the 13th week there can be up to 70 primary ducts (Conga et al, 1987).

1.1.2 The adult prostate Normal human prostatic ducal morph genesis and growth continue until birth (Lee, 1997). At puberty, the prostate increases in weight to about 20g under the influence of androgen (Berry er a/, 1984).

Various anatomical models of the prostate have been put forward in the past 80 years (Viler et al, 1991). Based on morphological, anatomical and histological studies, McNeal (McNeal, 1981a) provided a description of the anatomy of the prostate which is now broadly accepted. Central to McNeal’s description is the urethra, which is taken as the primary anatomical reference point. The posterior wall of the urethra bends at a sharp 35° angle at half the distance between the apex of the prostate and the base of the prostate at the bladder neck. This divides the prostate into an anterior or ventral fibromuscular portion and a posterior or dorsal glandular portion (McNeal, 1988). The glandular and fibromuscular zones represent 66% and 33% of the total gland volume respectively.

Figure 1.1: Zonal anatomy of the prostate. t: Transition zone, c: central zone, p: peripheral zone. Adapted from Algaba et al, 1996.

The glandular portion is divided into three morphologically distinct regions, which are tightly fused to each other and to the fibromuscular components. These zones are the peripheral zone, the central zone and the transition zone (McNeal, 1988, 1989). The central zone forms approximately 25% of the glandular component of the prostate, has a conical structure surrounding part of the proximal urethra and is crossed by the ejaculatory ducts (McNeal, 1989). The tranzition zone is the smallest zone, forming approximately 5% of the glandular tissue, and is located around the urethra. The largest zone is the peripheral zone, contributing approximately 70% of the glandular tissue of the prostate. It is pear shaped, surrounds the central zone and makes up the apex of the prostate. The glandular regions are tightly fused to each other and to the anterior fibromuscular stroma (Figure 1.1). Each of these regions drain into a specific segment of the urethra, so their anatomical features can be distinguished in sections cut along the long axis of the appropriate urethral segment. Along with the ejaculatory ducts more than 90% of the glands drain into the distal prostatic urethra. The zones are important because benign prostatic hyperplasia develops in the transition zone, whereas cancer usually arises in the peripheral zone (McNeal, 1981).

1.2 Diseases Of The Prostate The prostate is affected by two of the most common diseases (benign prostatic hyperplasia and prostate cancer) of the ageing male. Since there has been an increase of 70% in the male population aged 75-84 years over the past thirty years, the number of men at risk from benign prostatic hyperplasia and prostate cancer has increased (Buck, 1995a).

1.2.1 Benign prostatic hyperplasia (BPH) BPH is a progressive condition in ageing men, with more than 50% of men in the UK and USA being affected in their lifetime (Isaacs and Coffey, 1989, Carter and Coffey, 1990). The incidence of BPH increases after 40 years of age and by age 90 it rises to almost 90% (Berry et al, 1984). The benign enlargement can be produced by the expansion of epithelial and stromal components (McNeal, 1978, 1984,1990). However the stromal volume increases by a third in men with symptomatic BPH than normal prostate (Shapiro et al, 1992). This stromal growth in BPH is due to cell proliferation in the absence of apoptosis (Claus et al, 1997). BPH does not occur uniformly throughout the gland, and is restricted to the small region of the prostate surrounding the urethra called the transition zone (McNeal, 1990). The resulting enlargement of the prostate around the urethra can obstruct the outflow of urine from the bladder and lead to lower urinary tract symptoms such as urethral obstruction and even complete urinary retention (Hald, 1989, Bosch, 1997).

The aetiology of BPH is not known, but several theories have been put forward to explain the development of pathological BPH. 1) Androgen or DHT hypothesis: This was based on the fact that functioning testes are required for the development of BPH and earlier observations of increased prostatic levels of DHT (Isaacs and Coffey, 1989). But subsequently Walsh et al demonstrated that the differences observed were artefacts related to metabolism of DHT in cadaveric tissue (Walsh et al, 1983). Therefore prostate enlargement may not be caused by DHT but it may facilitate it’s development (Marcelli and Cunningham, 1999). However T, DHT levels and nuclear androgen receptor (AR) concentrations are higher in the periurethral zone (Monti et

5 al, 1998) where BPH develops. 2) Oestrogen hypothesis: Oestrogen (E) potentiates the effect of androgen in inducing BPH in dogs (Winter et at, 1996) and serum E to T ratio increases with age in men. Stromal level of E increases with age resulting in significant increase in the E to T ratio in the stroma (Krieg et al, 1993). Available data does not support a strong role for E in the development of BPH. 3) Deregulation of growth factors (embryonic reawakening) hypothesis: Stromal- epithelial interaction is very important for growth and maintenance of the prostate and locally produced autocrine and paracrine growth factors released by stromal and epithelial cells are important mediators in this process. This in turn is at least partly regulated by sex steroids (Marcelli and Cunningham, 1999). According to this hypothesis, induction of stromal epithelial interaction may be responsible for prostate growth and is supported by the fact that in BPH, the stromal nodules induce glandular proliferation hence it’s been termed the induction of embryonic growth potential of the stroma (Isaacs and Coffey, 1989). At the molecular level, deregulation of growth factor production and secretion may be responsible for BPH. Altered levels of basic fibroblast (FGF), keratinocyte (KGF), epidermal (EGF) growth factors, transforming growth factor p2, insulin like growth factor n (IGF) and their receptors have been reported in BPH (Mori et al, 1990, Byrne et al, 1996, Culig et al, 1996, Monti et al, 2001), although IGFI, II and IGF receptor increase with age. Although there may be little stimulus for stromal proliferation from deregulation of these pathways, it may inhibit apoptosis (Marcelli and Cunningham, 1999). 4) Stem cell hypothesis: This suggests that BPH results from an increase in the number of stem cells (Isaacs and Coffey, 1989). In the steady state, prostatic cell proliferation is balanced by prostatic cell death to maintain self-renewal of the tissue. The total cell content of the tissue is determined by the number of stem cells present therefore increase in the number of these cells may lead to BPH. Castration of dogs at an early age and treatment with androgen in adulthood only replaces the prostate size to only half of the adult size. Therefore early exposure to androgens can effect the total number of stem cells and which could determine the potential prostate size. But this would result in diffuse enlargement throughout the gland and phenotypically BPH tissue should be the same as non-BPH prostatic tissue, neither of which is true in BPH. But recently it’s been reported that stem cell expansion can be caused by reduced expression of the cell cycle inhibitor p27Kipl in the prostate, which could result in BPH (De Marzo et al, 1998). In conclusion. stromal-epithelial interactions modulated by androgens, and the actions of oestrogen and growth factors are likely to mediate abnormal growth in the prostate (Davies and Eaton, 1991).

The standard treatment for BPH is transurethral resection of the prostate (TURF), surgically removing prostate tissue surrounding the urethra using an endoscopic procedure (Roos et al, 1989). Drug therapies are also used (Geller, 1992, Oesterling, 1995, Smith, 1997). Although TURF is an effective treatment in most men with symptomatic BFH, about a quarter of men do not have satisfactory long-term outcomes (Lepor and Regaud, 1990). There is a high mortality rate (Doll et al, 1992), a high rate of postoperative complications (including failure to void, need for blood transfusion, retrograde ejaculation, urinary tract infection, etc) (Mebust et al, 1989, Oesterling 1995) and a reoperation rate of about 20% in men followed for 10 years or longer (Wennberg et al, 1987, Roos et al, 1989). Non-surgical means of treatment (Lepor, 1989a) are being used more and less operations are taking place (Holtgrewe et al, 1989, Mebust et al, 1989). Resistance to urine outflow from the bladder and prostatic urethra can be reduced by administering a-adrenergic blockers such as prazosin (Janknegt and Chappel, 1993, Lepor, 1989b, 1993). The efficacy of these treatments for symptomatic BFH is measured by decrease in prostate volume and improvement in the rate of urinary flow (Oesterling, 1995). The other main form of drug treatment for BFH is inhibitors of 5a-reductase, such as Finasteride, which will be discussed later in the chapter.

1.2.2 Prostate Cancer Prostate cancer is also a disease of old age. It is the second most frequent cause of cancer deaths in men in the Western world (Deamaley, 1994 a, b, Forti and Selli, 1996). Prostate cancers results from the malignant transformation of prostate epithelial cells, resulting in the development of adenocarcinomas. Like BFH it arises in restricted parts of the prostate, with 70% of cases developing in the peripheral zone (McNeal et al, 1988).

The incidence of latent prostate cancer increases with age. About 30% of men aged over 50 have histological signs of prostate cancer on autopsy (Carter and Coffey, 1990), and this figure rises to 40% by age 70. Only a small percentage of these cancers will cause symptoms. It is said that more men die with prostate cancer than of prostate cancer (Scardino et al, 1992). Prostate cancer produces symptoms of urinary tract obstruction similar to those described for BPH. Localised prostate cancer is most commonly diagnosed during investigation of these urinary symptoms. Metastatic disease more commonly presents with bone pain.

As with BPH the aetiology is not known, but a multistep process of carcinogenesis mediated by genetic alterations in tumour suppressor genes and metastasis suppressor genes followed by androgen receptor gene alterations in the hormone relapsed state is probably involved (Kallioniemi and Visakorpi, 1996). Presence of androgens over a long period of time is important in the development of prostate cancer. Since androgens, in particular DHT, are mitogenic for prostate cells, long periods in the proliferative state could lead to increased genetic instability and expression of mutated genes which could eventually alter the cells phenotype (Wilding, 1992). Various points on the androgen signalling pathway have been investigated to identify potential mechanisms of prostate carcinogenesis. 1) 5a-reductase H mutations: Since 5a-reductase is responsible for producing DHT, the active androgen, germ line mutations in the 5a-reductase II gene have been correlated to risk of developing prostate cancer. The V89L mutation (Makridakis et a/,1997) which significantly reduces and the A49T mutation (Makridakis et a/,1999) which significantly increases the activity of wildtype enzyme are more prominent in Asian men (with low prevalence) and African-American and Caucasian (with high prevalence) men respectively. Therefore it has been suggested that the polymorphisms in the 5a-reductase II genes which affect the enzyme activity and therefore level of DHT in the prostate and risk of developing prostate cancer. 2) Androgen receptor (AR) expression and mutations: Since AR is expressed in all stages of prostate cancer evolution investigators have tried to correlate mutations in the AR gene with prostate cancer development. However AR mutations in primary prostate cancers are rare therefore are unlikely to play a role in development of prostate cancer however the presence of significant number of AR mutations in metastatic prostate cancers indicates it may play a role in acquisition of metastatic phenotype (Marcelli and Cunningham, 1999, Marcelli et al, 2000). Inactivating mutations of AR, frequent in latent prostate cancer in Japanese men and absent in American men may prevent it’s evolution to clinical prostate cancer (Takahashi et al, 1995). 3) AR repeats: Exon 1 of the AR gene contains two polymorphic amino acid tracts.

8 a poly-Q (CAG)n and a poly-G (GGC)n (Irvine et al, 1995). AR activity appears to be negatively correlated to length of the poly Q repeat (Ross et al, 1995). Several groups have reported that shorter alleles of the poly Q is associated with increased risk of developing prostate cancer (Ingles et al, 1997, Stanford et al, 1997, Giovannucci et al, 1997, Hakimi et al, 1997) 4) AR regulation of growth factors: AR acts as a transcription factor which can regulate the expression of a large number of genes including growth factors, oncogenes, proteins involved in invasion and metastasis (Wilding, 1992). The mechanisms by which the AR exerts it’s effect through a multitude of growth factors on the prostate is not completely understood but investigators have sought to associate aberrant expression of these proteins to risk of developing and progression of prostate cancer. Increased levels of IGFI and lower levels of IGF binding protein 3 (Wolk et al, 1998, Giovannucci 1999, Chokkalingam et al, 2001, Harman et al, 2001) increased levels of TGFpI (Strovodimos et al, 2000, Merz et al, 1994) have been reported in the serum and prostate samples from prostate cancer patients. The role of growth factors in prostate cancer development and progression need to be further investigated. In conclusion, although the aetiology of prostate cancer is not known, the androgen signalling pathway is likely to play a central role.

Treatment of prostate cancer depends on the clinical stage and grade of disease (Whitmore, 1988). For localised disease there are three options: radical prostatectomy, radical radiotherapy (external beam or brachytherapy) or, for those patients whose life expectancy is short, "watchful waiting" (Lepor 1989c). For advanced disease, surgical or chemical castration is the first line treatment, first used by Huggins and Hodges in 1941 (Huggins et al, 1941). Androgen ablation therapy (to lower T level) (Dennis and Griffiths, 2000) by administration of androgen receptor antagonists (Reid et al, 1999) such as flutamide (Benson, 1992), bicalutamide (Kolvenbag et al, 1998, Kolvenbag and Nash, 1999) progestational agents such as megestrol (Osborn et al, 1997) has been used with various levels of success. Chemical castration can be achieved by luteinising hormone releasing hormone (LHRH) agonists that reduce T secretion by the testes (St-Arnaud et al, 1986, Labrie, 1991, Labrie et al, 1993). Antiandrogens such as flutamide block the androgen receptor and can be used in conjunction with LHRH agonists to reduce the effect of adrenal androgens and achieve "total androgen blockade" (Furr et al, 1987, Labrie, 1991, Labrie et al, 1991). These treatments are effective (Trachtenberg, 1997), but have significant side effects, including impotence, reduced libido, lethargy and gynaecomastia (Labrie, 1991, Tenover, 1991). The rationale for using 5a-reductase inhibitors such as Finasteride in the treatment of BPH also apply to prostate cancer (see later in introduction).

1.3 Androgens And It’s Metabolism In The Prostate 1.3.1 Role of androgens in the prostate The prostate was recognised to be an androgen dependent organ in the 18th century, when John Hunter made the observation that castration leads to a degeneration of the prostate gland in the bull. Since then, the active testicular androgen testosterone has been isolated and characterised and shown to be necessary for the growth and maintenance of the prostate (Ghanadian, 1983).

Although androgen produced in the testis was implicated in prostate growth, it was not possible to distinguish whether prostate growth is mediated by testosterone (T) or metabolites such as dihydrotestosterone (DHT). In order to determine which is the active androgen, Bruchovsky et al administered radiolabelled T to castrated rats that had been hepatectomised. After a few minutes, the predominant radioactive hormone recovered from the rat ventral prostate was DHT. DHT was also the predominant hormone bound to nuclear proteins (Bruchovsky and Wilson, 1968 a, b). Anderson et al also showed that after mixing rat prostate homogenate with radioactive T, the predominant radiolabelled steroid was DHT (Anderson and Liao, 1968). Bruchovsky et al also demonstrated that other androgens, such as androsterone and 5a-androstane-3a,17p-diol, are also converted to DHT in the prostate (Bruchovsky, 1971).

Time-sequence studies in animal and human embryos have indicated that it is not testosterone (T) but its 5a-reduced metabolite, dihydrotestosterone (DHT), which is responsible for the development of the prostate, male urethra and external genitalia such as the penis and scrotum (Wilson and Lasnitzki, 1971, Siiteri and Wilson, 1974, Geroge and Wilson, 1986, Wilson et al, 1993). Testosterone secreted by the testis reaches the prostate via the circulation, where it is metabolised by the enzyme 5a-reductase to DHT (Wilson et al, 1993). The level of DHT is highest in the urogenital sinus before virilisation, but then becomes undetectable. These studies indicate that T mediates the virilisation of the

10 Wolffian duct while DHT mediates the differentiation of the prostate, urethra and development of the external genitalia in the foetus (Wilson and Lasnitzki, 1971).

This hypothesis was confirmed by a rare autosomal recessive disorder in men called male pseudohermaphroditism type 2, produced by a deficiency in 5a-reductase that results in small prostates. Persons affected by this disease are 46 XY males with predominantly external female genitalia, but with bilateral testes and normal male Wolffian duct structures that terminate in a pseudovagina (Imperato-McGinley et al, 1974). This condition is caused by a deficiency of DHT and subsequently this was attributed to mutations in the 5a- reductase II gene (Andersson et al, 1991, Thigpen et al, 1992, Russell and Wilson, 1994). The absence of functional 5a-reductase during embryogenesis causes the partial failure of the development of the external genitalia mediated by DHT, while male development of the Wolffian duct structures by T remains unaffected. At puberty, these individuals develop a male phenotype and a limited virilisation of the external genitalia takes place (Wilson et al, 1993). This disorder therefore confirmed the central role of DHT in prostate development.

With the advent of specific inhibitors of the 5a-reductase enzymes, it was further demonstrated that DHT was the primary androgen in the prostate. Most inhibitors of 5a- reductase are steroids (Rittmaster, 1994). Of these the 4-azasteroid, Finasteride, has been studied extensively. Treatment of rats and dogs with Finasteride caused a significant reduction of DHT concentration in the prostate (Wenderoth et al, 1983, George et al, 1991). The prostate and other external genitalia failed to develop in these treated animals (Wenderoth et al, 1983, Clarke et al, 1993). When administered to pregnant rats, 5a- reductase inhibitors produce the 5a-reductase II deficiency phenotype in male offsprings. Despite causing an increase in the level of T, Finasteride causes a decrease in the size of the human prostate in some men with BPH and in rats (Lamb et al, 1992, Rittmaster, 1994).

Further evidence of the importance of DHT comes from the observation that 5a-reductase inhibitors can block the T mediated regeneration of the prostate in castrated rats, while the DHT mediated regrowth of the prostate remains unaltered (George et al, 1991).

The importance of androgens in maintaining the prostate is demonstrated by castration. Following castration in the rat and humans the prostate size reduces dramatically within a period of days (Isaacs, 1984). The involution of the prostate gland occurs as a result of

11 inhibition of cell proliferation and stimulation of apoptosis. There is a greater reduction of epithelial cells as compared to the stromal cells (Deklerk and Coffey, 1978, Cunha et al, 1987, Lee, 1997). The androgen independent epithelial cells in the proximal ducts survive, while the androgen dependent cells in the distal ducts regress. The remaining secretory cells become smaller and contain less secretory granules. When androgen levels are restored the epithelial cells regenerate (Isaacs, 1984).

1.3.2 The role of the androgen receptor Although T and DHT seem to have specific roles in male sexual differentiation and development and the maintenance of the prostate, they exert their effect by interacting with the same mediator protein, the androgen receptor. The androgen receptor (AR) belongs to the steroid hormone receptor family of ligand regulated transcription regulatory factors (Beato et al, 1996 a, b). In the classic model of steroid hormone action, the hormone ligand binds to the intracellular receptor protein which causes a conformational change in the receptor protein that enables the receptor-ligand complex to bind to high affinity transcription activation sites on DNA (Mangelsdorf et al, 1995). Since the concentration of T is much higher in the blood than in the prostate, it can enter the tissue down a concentration gradient by passive diffusion. Once inside the prostate cell, T is metabolised by 5a-reductase. The 5a-reductase enzymes are hydrophobic, indicating that they are intrinsic membrane bound proteins (Russell and Wilson 1994). Human prostatic 5a- reductase activity has been localised to the nuclear fraction (Hudson 1981, Houston et al 1985b) and in particular the nuclear envelope (Abalain et al 1989, Savory et al, 1995). T is metabolised by the perinuclear 5a-reductase to DHT, which in turn can directly bind to it's intracellular target the androgen receptor in the nucleus (Figure 1.2). In the steady-state the unliganded androgen receptor is found in the cytoplasm and on exposure to androgen migrates to the nucleus (Tyagi et al 2000). Once bound to the ligand DHT; which has also been localised to the nucleus (Bartsch et al 1982), the activated androgen receptor complex can bind to androgen responsive elements of target genes to regulate their transcription.

12 V ^ Cytoplasm

T lu ic le iis 5aR DHT ____ \ \ AR

D r -; A

m R N A

Figure 1,2: Action of testosterone and dihydrotestosterone in the prostate cell. Testosterone (T) from the circulation enters the prostate and is converted to dihydrotestosterone (DHT) by the perinuclear 5a-reductase . Both T and DHT can bind to the androgen receptor (AR) which can bind to androgen responsive elements on the DNA to upregulate gene transcription. Adapted from Buck, 1995b.

Structure function studies showed that the more planar molecule of DHT can fit inside the hormone binding domain of the AR more closely than T (Wilson, 1996). Once bound to the AR, DHT dissociates from the receptor complex more slowly than T (Grino et al, 1990), consequently DHT binds more avidly with the AR than T (Wilbert et aî, 1983). Therefore, even though T and DHT have similar association rates, the difference in frieir dissociation rates from the receptor complex ensures that in the steady state when T concentration is higher, DHT binds most of the AR (Grino et al, 1990), The DHT-AR complex is also more readily transformed to the DNA binding state than the T-AR complex (Kovacs et al, 1983). Together, these factors act to amplify the weak DHT signal. Despite these differences in the receptor binding, T can still elicit a maximal transcription of a reporter gene linked to androgen response elements (Deslypere et al, 1992).

13 1.3.3 Androgen metabolism in the prostate Since the availability of radiolabelled steroids in 1963 (Farnsworth et al, 1963), the metabolism of testosterone in the prostate has been studied in animals and human prostate tissue preparations. In the initial studies using rat ventral and human BPH tissue perfused with tritiated T, the predominant radiolabelled metabolite was 5a-DHT (Farnsworth et al,

1963) indicating the presence of the 5a-reductase enzyme. That 5a-DHT is the predominant metabolite of T has been confirmed subsequently by numerous studies using both animal and human prostate (Ghanadian, 1983). The conversion of T to DHT is a NADPH dependent, irreversible reaction (Brandt et al, 1990, Li et al, 1995). However, there are other enzymes in the prostate that can convert DHT to less potent androgens (Figure 1.3).

In addition to 5a-reductase, two important groups of enzymes have been shown to be active in the prostate producing various oxidised and reduced products of DHT (Figure 1.3). Firstly the 3a- and 3p-hydroxysteroid dehydrogenases convert DHT to the less potent 5a- androstane-3a,17p-diol (3a-androstane diol) and 5a-androstane-3p,17p-diol (3p- androstane diol) respectively (Ghanadian, 1983). Like 5a-reductase, these enzymes are NADPH dependent but, unlike conversion to DHT, this reaction is reversible. The activity of the 3a form is higher in the prostate (Becker et al, 1975, Jacobi and Wilson, 1977).

The second group of enzymes include 17p-hydroxysteroid dehydrogenase, which reversibly converts an oxo group at the 17 position to an hydroxy group. This reaction converts DHT to androstanedione (Hussein and Kochakian, 1968). It can also convert T to the less potent androstenedione and 5a-androstane-3a, 17p-diol to androsterone to a lesser extent (Ghanadian, 1983). The reversible nature of these enzymes means that all of these weaker androgens can potentially be converted back to the more potent DHT.

In addition to the above metabolites, further metabolites can be formed. For example the 5a-androstane-3p-17p-diol is converted to epiandrosterone by 17p-hydroxysteroid dehydrogenase. However, most of this particular androgen is rapidly and irreversibly converted to hydroxylated 3p-triols by the 3p-hydroxylases present in the prostate (Morfin

14 [" ÔKl'^Tl zp>

A * -A M U m V * I ^ M» • D K iM O

Mue leal' Receptor coBi>lex 1— OMT W . ANOAO#TAN( PIOM« r Gene transcription r ù WM$A# _ : \ I D»DL JSJt AMPNOVIIi NUMI AnMroifenlc effects

. a S ^ M®' ! «0 M I 3 # O lO L Ml AMI»Nf >H f f N« *«•#

M#c p „ . c r 5 ^ V _v#»«v##o#VL*W TZZZAW “ 1* 4 O aTM IO L T«r TA lo t. - • 0 * -ANPNOOTANe ~0#,V«|~DIOL. «T ONK

MO «0 " I ~ WM - t, _ M ON W

Figure 13: Metabolism of testosterone in the prostate. DHT: Dihydrotestosterone, HSDR: Hydroxysteroid dehydrogenase, 3a DIOL: 5a-Androstane-3a,17p-diol, 3p DIOL: 5a-Androstane-3p,17p- diol, 7a TRIOL: 5arAndrostane*3p, 7a, 17p-Triol Adapted from Isaacs^ 1979.

15 et al, 1977, Isaacs et al, 1979). In humans the predominant triol formed is the 7a triol with small amounts of 6(3-triols.

1.4 5a-Reductase Enzymes 1.4.1 Mode o f action Over 90% of the T in the prostate is irreversibly converted to DHT by action of the enzyme 5a-reductase (Coffey, 1979). The enzyme requires NADPH as an essential co-factor to reduce the unsaturated C=C bond of the A ring of testosterone (Figure 1.4). NADPH binds to the enzyme before T, forming a complex with high affinity for T (Brandt et al, 1990, Levy et al, 1990). An electrophylic attack of NADPH on the unsaturated bond results in the reduction of the bond and subsequent release of DHT while leaving a NADP^ -5a- reductase complex. Then the NADP^ dissociates from the enzyme (Li et al ,1995).

OH OH

NADPH NADP

5oc- reductase 0 H ■ l>l II

Figure 1.4: Conversion of testosterone to dihydrotestosterone . The C=C bond in the A ring of is testosterone (T) is reduced by 5a-reductase to form dihydrotestosterone (DHT) with the release of NADP. Adapted from Coffey, 1979.

5a-reductase has been localised to the microsomal and nuclear membrane (Andersson and Russell, 1990). Testosterone is not the only substrate for this enzyme. It will also reduce androstenedione, progesterone, and corticosterone (Andersson and Russell, 1990). Since the Km for T is in the p,M range (Fredrikson and Wilson, 1971, Andersson and Russell, 1990) and the prostatic level of T and NADPH is in the nM and p.M range (Isaacs, 1979) respectively, the rate is only 1% of the maximum velocity of 5a-reductase. Therefore in the prostate, T concentration is the rate limiting step of this reaction. Once formed, DHT binds

16 to the androgen receptor which then translocates to the nucleus to regulate gene transcription in a manner similar to other steroid hormones.

1.4.2 Isolation and characterisation o f the 5 cx-reductase enzymes Attempts at isolating and purifying 5a-reductase from rat and human tissue by various groups proved very difficult as the protein is extremely insoluble. Although the enzyme could be solubilised from the cell membrane using detergents, the activity was lost on chromatography (Russell and Wilson, 1994). This problem was eventually overcome by using expression cloning in Xenopus laevis oocytes, isolating a cDNA from rat liver encoding a 5a-reductase enzyme (Andersson et at, 1989).

Using the full length cDNA isolated from rat liver as a probe, a human prostate cDNA library was screened and a human homologue of 2.1 kb in length was isolated (Andersson and Russell, 1990). The gene encodes a hydrophobic protein of 259 amino acids with a predicted molecular weight of 29kda. Comparison of the characteristics of the human enzyme expressed in simian COS cells with the enzyme expressed in the prostate revealed anomalies. For example, the cDNA encoded enzyme was only weakly inhibited by Finasteride, which strongly inhibits the 5a-reductase enzyme of the prostate (Andersson and Russell, 1990). Also in contrast to the enzyme present in the prostate, the cloned enzyme had an alkaline pH optimum. When the cloned cDNA was isolated from patients with 5a-reductase deficiency, there were no mutations present, indicating that the gene was normal in these patients, although they do have a much reduced 5a-reductase activity. These observations indicated that there is more than one enzyme present in the prostate catalysing the conversion of T to DHT (Jenkins et at, 1992, Russell and Wilson, 1994).

Expression cloning techniques were therefore utilised to isolate the gene for the second putative 5a-reductase enzyme. A second cDNA of 2.4kb was isolated from human prostate, which was different from the first cDNA (Andersson et at, 1991). The two isozymes have about 50% sequence homology and were named in the order that they were cloned. The 5a- reductase type II cDNA also encoded a hydrophobic protein of 254 amino acids. The pharmacological and biochemical properties of the cloned 5a-reductase II were like those of the 5a-reductase activity in the prostate. Mutations were present in this gene in patients with 5a-reductase deficiency (Andersson et at, 1991).

17 Therefore the existence of two 5a-reductase enzymes with different biochemical and pharmacological properties was confirmed. The type I enzyme has a broad alkaline pH optimum (pH 6-8.5) and is relatively insensitive to the 5a-reductase II inhibitor Finasteride (Andersson and Russell, 1990). The type II enzyme has a narrow acidic pH optimum and is sensitive to Finasteride, and is the enzyme that predominates in the prostate (Russell and Wilson, 1994). Both enzymes are hydrophobic proteins, typical of a membrane location, and hence the difficulty in purifying them. Indirect fluorescent immunocytochemistry localised both enzymes to the endoplasmic reticulum. Of the two enzymes, 5a-reductase II has a lower Km for testosterone, indicating an higher affinity for steroid substrates.

1.4.3 Characterisation o f the Sos-reductase genes After the isolation of the 5a-reductase I and II cDNAs (Andersson and Russell, 1990, Andersson et al, 1991), the genes for these two enzymes were isolated by screening genomic DNA libraries. The type I gene, spanning a region of 35kb, was mapped to the distal short arm of chromosome 5 on band pl5 (Jenkins et at, 1991). It contains 5 exons ranging from 0.102 to 1.359kb, separated by four large introns ranging in length from 4.1 to 14kb. The translated reading frame of 777nt is flanked by a 3' untranslated region of ~1.3kb containing a polyadenylation signal upstream of a poly(A) tract (Andersson and Russell, 1990) and the 5' region contains a putative TATA box (Jenkins et at, 1991). During the screening of the genomic DNA library, a second gene which also hybridised to the 5a- reductase I cDNA was isolated. This gene mapped to the long arm of X chromosome (bands q24-qter), lacked introns and was 95% identical to the 5a-reductase I gene in the coding region. It contained a premature termination codon in place of amino acid 147 and the 5' and 3' end of the gene also differed at certain sequences. All these features suggest that it is a non-functional processed pseudogene of 5a-reductase I (Jenkins et al, 1991).

The 5a-reductase II gene, spanning a region of over 40kb, was mapped to band p23 of chromosome 2 (Labrie et al, 1992, Thigpen et al, 1992). Like the type I gene it contained 5 exons ranging in size from 0.102 to 1.7kb, separated by four large introns ranging from 2 to

29kb (Labrie et al, 1992). The translated reading frame of 5a-reductase II is 15nt shorter than that of the type I gene and it is flanked by a 3' untranslated region of 1.6kb. The transcription start site is located 71 bp upstream of the ATG initiation site.

18 Sequence analyses have revealed that both 5a-reductase I and II have identical splicing sites (Jenkins et al, 1992, Labrie et al, 1992). In addition to the similarity in structure, the genes also exhibit significant sequence homology (up to 64%) suggesting that these two isozymes arose by primordial gene duplication (Russell and Wilson, 1994). This homology in sequence and structure is also preserved across species barriers (Jenkins et al, 1992, Thigpen et al, 1992).

1.4.4 Tissue and cell specific expression o f Sos-reductase enzymes

Although expression of human 5a-reductase enzymes have been studied extensively in the prostate, these isozymes are also expressed in a variety of tissues, including the genitourinary tract, skin, liver, kidney and brain of both males and females.

Several studies have demonstrated that the expression of human 5a-reductases is developmentally regulated. Using immunocytochemical techniques it was shown that 5a- reductase II protein is expressed in the stromal cells of the foetal prostate and other tissues in the male reproductive tract such as the seminal vesicle and in scrotal skin (Levine et al, 1996). However there was no expression in the epithelial cells of these tissues. Of seven foetal tissues tested, the type I enzyme was absent from all as determined by immunoblotting, and only genital skin expressed 5a-reductase II (Thigpen et al, 1993a).

In the newborn, 5a-reductase I protein as determined by immunoblotting is transiently expressed in the non genital skin and scalp until the third year, after which it disappears. It reappears at puberty in the skin and remains throughout adult life. The type I enzyme is expressed in the liver at birth and continues throughout life. The expression pattern of 5a- reductase II is the same as that for type I in the liver but differs in the skin. Like the type I enzyme, the type II enzyme is expressed at birth in the non-genital skin and continues until the third year, after which it disappears. However, unlike the type I enzyme, it does not reappear later in life (Thigpen et al, 1993a, Pelletier et al, 1998). 5a-reductase II protein is expressed throughout life in the prostate, epididymis, seminal vesicle and genital skin (Thigpen etal, 1993a).

Presence of 5a-reductase isozymes have been demonstrated in the human prostate by RT- PCR, Western blotting and functional activity (conversion of T to DHT). In the prostate the

19 enzyme activity is optimal at pH 5, indicating that 5a-reductase II is the predominant enzyme (Jenkins et al, 1992, Smith et al, 1996). However, different enzyme activity profiles have also been demonstrated in the prostate (Rennie et al, 1983, Habib et al, 1998), indicating that both isozymes are present.

Presence of 5a-reductase II protein has been demonstrated in the prostate using immunoblotting (Thigpen et al, 1993a) and immunohistochemistry (Eicheler et al, 1994, Silver et al, 1994a, b, Bonkhoff et al, 1996, Levine et al, 1996). 5a-reductase II mRNA has been demonstrated using RT-PCR (Bruchovsky et al, 1996, Bjelfman et al, 1997, Habib et al, 1998, Negri-Cesi et al, 1998, lehle et al, 1999), in situ hybridisation (Habib et al, 1998, Pelletier et al, 1998, lehle et al, 1999) and Northern blotting (Bonnet et al, 1993, Thigpen etal, 1993a, Bruchovsky etal, 1996) (Table 1.2).

The presence of 5a-reductase I in the prostate is more controversial. Thigpen et al and Silver et al detected neither protein nor mRNA for 5a-reductase I using immunoblotting and hybridisation (Thigpen et al, 1993a, Silver et al, 1994b ). However, other groups have found 5a-reductase I protein using immunohistochemistry in the prostate (Bonkhoff et al, 1996, Negri-Cesi et al, 1998) and mRNA using RT-PCR and in situ hybridisation (Bruchovsky et al, 1996, Habib et al, 1998, Negri-Cesi et al, 1998, Pelletier et al, 1998, lehle etal, 1999).

There is conflicting evidence concerning cell type expression of the 5a-reductase isozymes in the prostate (Table 1.2). Two groups reported that 5a-reductase II protein as detected by immunohistochemistry is found exclusively in the stromal cells of the prostate (Levine et al, 1996, Silver et al, 1994b) in some specimens, while in other samples it is found in the basal epithelial cells and the stromal cells, but is absent from the luminal epithelial cells (Silver et al, 1994a). In contrast, Eicheler et al found that the basal epithelial cells of the prostate contained more 5a-reductase II protein than the stromal cells (Eicheler et al, 1994).

Bruchovsky et al observed both 5a-reductase I and II mRNA in the prostate stroma, but the epithelium only expressed the type I enzyme (Bruchovsky et al, 1996). Bonkhoff et al suggested that the luminal epithelial cells express both proteins as detected by immunohistochemistry (Bonkhoff et al, 1996). Recently lehle et al have reported the presence of 5a-reductase I mRNA as detected by RT-PCR and in situ hybridisation in the

20 epithelial cells only, while 5a-reductase II is found in both stromal and epithelial cells (lehle et al, 1999). Several groups have also reported the presence of both mRNAs in both epithelial and stromal cells of the prostate (Berthaut et al, 1997, Habib et al, 1998, Pelletier et al, 1998). At present, it is unclear whether there is cell type specific expression of the 5a- reductase isozymes in the prostate. Certainly whole prostate tissue contains the mRNA for both 5a-reductases (Habib et al, 1998, Negri-Cesi et al, 1998, Pelletier et al, 1998). However since the presence of mRNA does not necessarily mean that it is transcribed and presence of protein does not mean it is functional, enzyme activity of the two 5a-reductases need to be shown in a tissue for it to be significant. When assayed under non-optimal conditions (i.e. both enzymes assayed at the same pH) presence of two isoforms of 5a- reductase was demonstrated in the human prostate (Rennie et al, 1983, Le Goff et al, 1989). Recently, functional activity measured at the optimal pH for the two isozymes (pH 7.5 for 5a-reductase I and pH 5.5 for 5a-reductase II) have demonstrated that the prostate expresses both isozymes (Habib et al, 1998, Bayne et al, 1999).

5a-reductase expression has also been studied in other organs of the genitourinary tract.

5a-reductase H enzyme activity, protein and mRNA have been detected in the epididymis and seminal vesicle in comparable quantities to those in the prostate (Thigpen et al, 1993a); although again the cellular location is unclear. Levine et al reported strong staining of foetal and Silver et al reported staining of adult seminal vesicle stroma while Eicheler et al reported strong staining in the basal epithelial cells using immunohistochemical analysis (Eicheler et al, 1994, Levine et al, 1996). The basal epithelial cells of the epididymis also express 5a-reductase II (Eicheler etal, 1994, Silver et al, 1994a).

The liver contains both 5a-reductase I and II isozymes (Thigpen et al, 1993a, Silver et al,

1994a), in particular the hepatocytes (Eicheler et al, 1994). The expression of 5a-reductases in the liver is thought to be associated with steroid catabolism.

Along with other steroid hormones, androgens also act in the brain. Androgens are metabolised to oestrogens and DHT in the brain (Celotti et al, 1992). 5a-reductase I is constitutively expressed in the brain and is mainly localised in the adult myelin membranes

(Poletti et al, 1997) and a catabolic role is suggested for this isozyme. 5a-reductase II is transiently expressed in the newborn and in males the expression is controlled by androgens

21 (Poletti et al, 1998a, b, Melcangi 1998). In adults, it is expressed mainly in the hypothalamus and hippocampus after stress. Expression of this isozyme is also seen in the motor neurones of the spinal cords, pyramidal cells of the cerebral cortex and LHRH secreting neurones (Eicheler et al, 1994). 5a-reductase II may have a role in the perinatal differentiation of the brain towards a male pattern (Poletti et al, 1998a, b).

5a-reductase 1 protein and mRNA has also been in found large amounts in non-genital skin such as the scalp (Thigpen et al, 1993a, Eicheler et al, 1994, Luu-The et al, 1994, Pelletier et al, 1998), with little expression in the epidermis and the sebaceous glands. Expression of 5a-reductase I and II is also seen in female organs such as the epithelial cells of the mammary glands, ovaries and oviduct (Eicheler et al, 1994).

22 Cell specific expression of 5a-reductase enzymes in the prostate

5a-reductase I 5a-reductase II Method used, Reference Whole Prostate Epithelium Stroma Whole Prostate Epithelium Stroma Absent Present Immunohistochemistry of foetal, Absent Present ", adult. Levine et al, 1996 Absent Present Immunoblotting of neonatal, Absent Present "adult Absent Present Northern blotting. Present, Present Enzyme activity 20Xlower than Thigpen etal, 1993a typen Predominant form Enzyme activity at pH optimum Jenkins etal, 1992, Smith etal, 1996 Present Present Enzyme activity Rennie gra/, 1983, Habib era/, 1998 Present Immunoblotting Silver era/, 1994a Present Immunohistochemistry Silver era/, 1994b Present, Present Immunohistochemistry, Eicheler et al, 1994 secretory less than in and basal epithelium Present, Present, less Present, Present, less Immunohistochemistry, Bonkhoff etal, 1996 luminal and than basal, less than some basal epithelium than type I epithelium Present Present Present Present Absent Present Northern blotting, RT-PCR, inhibition of enzyme activity Bruchovsky etal, 1996 Present Present, Present, less Present Present, Present, less RT-PCR basal, some than basal, some than Insitu hybridisation

23 luminal epithelium luminal epithelium Habib et al, 1998

5a-reductase I 5a-reductase II Method used, Reference Whole Prostate Epithelium Stroma Whole Prostate Epithelium Stroma Present Hybridisation, Bjelfman et al, 1997 Present Present, V. Present, less Present, low Insitu hybridisation low than type I Present Present RT-PCR, lehle etal, 1999 Present Present RT-PCR, Southern blotting Present, Immunohistochemistry, Negri-Cesi et al, 1998 acinar Present, Present, less Present, Present, less Insitu hybridisation, Pelletier et al, 1998 basal, luminal than basal, than epithelia luminal epithelia Present Present Northern blotting. Bonnet et al, 1993 Present, basal Immunohistochemistry, Patel et al. Present Present Enzyme activity, Hudson, 1987

Table 1.2: Expression of 5a-reductase isozymes in the prostate. Presence of 5a-reductase isozymes in the human prostate as reported in the literature. Prostate tissue used were from normal adult or BPH prostate unless stated otherwise.

24 1.5 Androgens And It’s Metabolism In Prostatic Disease And Treatment 1.5.1 Androgens in BPH Many groups have measured the circulating and prostatic levels of testosterone (T) and dihydrotestosterone (DHT) in patients with BPH to determine whether there is any correlation with the disease.

When circulating T levels in patients with BPH were compared to those in age matched controls, no significant differences were seen, although there was considerable variation within the groups (Vermeulen and De Sy, 1976, Ghanadian et al, 1977, Bartsch et al, 1979, Bonnet et al, 1993). Some authors have reported that circulating levels of DHT are elevated in patients with BPH (Vermeulen and De Sy, 1976, Ghanadian et al, 1977, Bartsch et al, 1979). However recently several studies have reported that BPH correlates positively with elevated levels of free T in the serum patients with BPH (Partin et al, 1991, Stege and Carlstrom, 1992). While one prospective study found no correlation between the variation in circulating androgen levels and development of BPH (Gann et al, 1995). However the reported differences in circulating androgen levels may not be relevant since serum levels of T and DHT may not correlate with their levels in the prostate (Habib et al, 1976, Ghanadian and Puah, 1981, Hsing and Comstock, 1993, Marcelli and Cunningham, 1999).

When intraprostatic androgen levels were measured, T levels in BPH tissue were reported to be similar (Hammond, 1978, Bartsch et al, 1987) to normal tissue. However, DHT levels were found to be significantly higher (~5 fold) in BPH compared to controls (Siiteri and Wilson, 1970). This initial report was confirmed by various groups (Geller et al, 1976, Hammond, 1978, Belis, 1980, Meikle et al 1980, Bartsch et al, 1982, Hudson et al, 1983, Kriegeffl/, 1983).

To determine whether the differences observed in the levels of T and DHT are due to altered metabolic profiles, investigators have studied the level of the enzymes responsible for the metabolism of T in the prostate. Higher 5a-reductase activity has been found in BPH tissue compared to control tissue (Bruchovsky and Lieskovsky, 1979, Krieg et al, 1979, Wilkin et al, 1980, Hudson et al, 1983, Isaacs et al, 1983, Hudson, 1987, Voigt and Bartsch, 1986, Klein etal, 1988a).

25 However these reported differences between DHT level of BPH and normal tissue may be an artefact of the experimental conditions rather than a true reflection of the prostatic DHT level. In some of these earlier studies the histological characterisation of the tissues used were poorly controlled and cadaveric tissue was used for the normal samples. In 1983, Walsh et al showed that the reported lower levels of DHT in normal tissue was due to post mortem cooling of cadavers used to obtain normal prostates (Walsh et al, 1983). In this study, the levels of DHT were similar in the normal prostate tissue obtained at surgery and BPH tissue. This was later confirmed by others (Voight and Bartsch, 1986). There is also variability in DHT levels within prostate tissue with increased DHT level reported in the stroma compared to the epithelial fraction (Cowan et al, 1977, Wilkin et al, 1980, Bartsch et al, 1982, Voigt and Bartsch, 1986, Hudson 1987, Bruchovsky et al, 1988). In BPH the

5a-reductase activity of the epithelial and the stromal compartments increases, but most of the activity is derived from the stromal portion (Voigt and Bartsch, 1986, Hudson, 1987, Bruchovsky et al, 1988). The 5a-reductase of BPH stromal cells is reported to have a higher Vmax than normal stromal cells, and therefore the BPH stromal cells may be more efficient at converting T to DHT (Hudson, 1987, Bruchovsky et al, 1988, Tunn et al, 1988). Therefore the proportion of epithelial versus stromal cells in the whole BPH samples will effect the levels of DHT measured. Thus considering all of these factors, T and DHT levels are probably not altered in BPH (Montie and Pienta, 1994, Marcelli and Cunningham, 1999).

The level of 3a-androstanediol was found to be significantly lower in BPH than normal tissue (Siiteri and Wilson, 1970). This was confirmed by some reports (Bruchovsky and Lieskovsky, 1979, Morimoto et al, 1980), while others found no correlation or an increased level of this androgen (Jacobi and Wilson, 1977, Morfin et al, 1979). Measurement of circulating levels of this hormone also gave conflicting results (Bartsch et al, 1979, Ghanadian and Puah, 1981). One factor which could contribute to conflicting results is the experimental conditions used to measure the conversion of DHT to 3a-androstanediol. The enzyme 3a-hydroxysteroid dehydrogenase can both reduce DHT to 3a-androstanediol and oxidise 3a-androstanediol back to DHT. The direction in which the reaction proceeds depends on the availability of reducing co-factors such as NADPH. When NADPH is included in the incubation, the reaction proceeds along the reductive pathway (Morfin et al, 1979, Voigt and Bartsch, 1986, Klein et al, 1988a), while in the absence of NADPH this

26 reduction was blocked (Krieg et al, 1979). However, even taking this into account, some groups have reported more 3a-androstanediol formation (Malathi and Gurpide, 1977, Klein et al, 1988a), while others have shown no differences in the reduction of DHT to 3a- androstanediol (Bruchovsky and Lieskovsky, 1979, Voigt and Bartsch, 1986).

In conclusion, although earlier reports showed differences in the levels of T and DHT between BPH and normal tissue, this has not been confirmed by more recent and better controlled studies. Therefore it is unclear whether levels of these androgens are causative factors in the aetiology of BPH but are likely to play a permissive role in the disease.

1.5.2 Androgens in prostate cancer Earlier studies on circulating levels of T and DHT in patients with prostate cancer have reported no differences (Bartsch et al, 1977) or slightly raised (Ghanadian et al, 1979) compared to control samples. There were no difference reported between serum T levels of patients with BPH and prostate cancer (Habib et al, 1976, Ghanadian and Puah, 1981). Recently, some authors have also reported no significant differences between the serum T, DHT levels in men with prostate cancer and control groups (Hsing and Comstock, 1993, Vatten et al, 1997), while others reported increased risk of developing prostate cancer in patients with elevated levels of circulating T (Gann et al, 1996). Measuring levels of T in the prostate proved more interesting. T levels have been reported to be higher in prostate cancer tissue compared to benign tissue (Habib et al, 1976, Ghanadian et al, 1979, Krieg et al, 1979, Ghanadian and Puah, 1981, Hudson et al, 1983, Klein et al, 1988a, b). The level of DHT in prostate cancer tissue has been reported to be both lower (Geller et al, 1978, Ghanadian and Puah, 1981) and higher (Farnsworth and Brown, 1976) than that in BPH tissue. The reduction in DHT level in prostate cancer tissue is associated with histological grade, with poorly differentiated tumours having lower DHT levels (Geller et al, 1978, 1979b, Habib etal, 1985, Klein etal, 1988b).

Androgen metabolism in prostate cancer has also been investigated and cancer tissue were found to contain all the T metabolic pathway present in benign tissue (Klein et al, 1988a). The overall metabolic activity of the cancer tissue is lower than that of benign tissue

(Morfin et al, 1977, Klein et al, 1988a). 5a-reductase activity of prostate cancer is lower (Figure 1.5) than that in benign tissue (Bard and Lasnitski, 1977, Bruchovsky and

27 reductase activity would in part explain the higher level of T and lower level of DHT seen in prostate cancer. Poorly differentiated tumours contain lower 5o-reductase activity (Geller el al, 1979b, Habib c/^/, 1985, 1989).

3« -D IO I.

OH OH D H T .CCr .o5^ 1 I \ 3/3-DIOL

CANCER A’EDIONE A’DIGNE b PH

Figure 1.5: Predominant pathways of T metabolism in benign and malignant human prostate Testosterone (T) is converted to 5a-reduced metabolites dihydrotestosterone (DHT) and 5a- androstane-3a, i?P-diol (3a-DlOL) and 5a-androstane-3p, l?P-diol (3P-D10L) in benign tissue while in cancer it is oxidised to androstenedione (A’EDIONE) and 5a- androstanedione (A’DIONE). Addled from Ghanadian, 1983.

There is also a qualitative difference in the metabolic profile of prostate cancer tissue in that it favours the oxidative pathways of T metabolism more than the reductive pathways seen in the benign and normal tissue. Carcinomas produced less DHT from T and more 17-oxo derivatives of T than benign tissue (Bard and Lasnitski, 1977, Morfin ef ah 1977), In o r^n cultures of prostate cancer, 17-oxo derivatives were the major metabolite, with androstenedione contributing 60%, 5a-androstanediols 17%, DHT 14%, 5a- androstanedione 4.5%, and androsterone 2% of recovered metabolite (Smith ei al, 1980) compared to BPH and normal tissue where most of recovered metabolite was DHT. The

28 compared to BPH and normal tissue where most of recovered metabolite was DHT. The oxidation of T by 17p-hydroxysteroid dehydrogenase to androstenedione is a prominent feature of cancer tissue (Morfin et al, 1977, Ghanadian et al, 1981, Smith et al, 1983) (Figure 1.5) and there is a greater tendency towards this conversion in poorly differentiated tumours. 1.5.3 Sos-reductase inhibitors in the treatment o f BPH BPH and prostate cancer do not develop in men who were castrated in childhood (Wilson, 1980). Castration of males with BPH or prostate cancer leads to a reduction in prostatic size (Bosch et al, 1989). Males who are 5a-reductase deficient due to loss of function mutations in 5a-reductase II gene also do not develop BPH or prostate cancer (Imperato-McGinley, 1974) even though plasma T concentrations are normal. Based on these observations, considerable efforts have been directed towards developing inhibitors of 5a-reductase. Since it is DHT, and not T, which mediates prostate growth, drugs which specifically reduce DHT levels should improve the symptoms of BPH without causing the side effects of systemic T withdrawal.

The possible therapeutic applications of 5a-reductase inhibitors attracted the interests of pharmaceutical companies in the 1970s, and several potent inhibitors of the enzyme were developed (Metcalf et al, 1989, Tenover, 1991). Of these, 17p-carboxylic acid was the first 5a-reductase inhibitor to be described (Voigt and Hsia, 1973). The largest class of 5a- reductase inhibitors are the 4-azasteroids (Tenover, 1991, Russell and Wilson, 1994). The compound 4-MA, a competitive inhibitor of 5a-reductase enzymes was first described in 1981, but was metabolised extensively. Another closely related compound was developed. Finasteride (Brooks et al, 1981, Rasmusson et al, 1986). Other inhibitors include SKF 105657 (Holt et al, 1991), which does not compete with DHT and is thought to bind a 5a- reductase-NADP+ complex, and 6-azasteroids such as G1157669X, which is a competitive inhibitor (Russell and Wilson, 1994). Nonsteroidal compounds such as the benzoylaminophenoxybutanioc acid derivative ONO-3805, benzoquinolinones such as LY191704 (Hirsch et al, 1993) and polyunsaturated fatty acids such as linoleic acid also inhibit the 5a-reductase enzymes (Russell and Wilson, 1994, lehle et al, 1995). Finasteride inhibits the 5a-reductase H enzyme (Faller et al, 1993, lehle et al, 1995) and LY191704 is a selective inhibitor of 5a-reductase I (Hirsch et al, 1993). Of these compounds, only Finasteride has been approved for use in BPH.

29 Finasteride lowers the serum and prostatic DHT levels, causes apoptosis of prostate epithelial cells in the prostate and a subsequent reduction in prostate size (McConnell et al, 1992). A 12 month, double blind, placebo-controlled study in 895 men with BPH showed that 5mg Finasteride per day resulted in a 20% decrease in prostate volume, a 22% increase in the maximal urinary flow rate and a 20% decrease in urinary symptoms (Gormley et al, 1992). In a subsequent study, serum DHT level was reduced by 62%, PSA by 46%, prostate volume by 22% and urinary flow rate by 30% without much adverse effects (The finasteride study group, 1993). The longer term effect of Finasteride was studied in an extension study in which patients were followed for three years. The results indicated that the effect of the drug is sustained without increased side effects (Stoner, 1994). Two 24- month, double blind, placebo controlled, randomised studies demonstrated persistent therapeutic effect of the drug on prostate size, urinary flow and patient symptoms (Andersen et al, 1995, Nickel et al, 1996). Based on these studies, it is said that Finasteride is an effective long-term alternative to watchful waiting for the treatment of BPH with mild to moderate symptoms (Nickel and Andersen, 1997).

1.5.4 Sos-reductase inhibitors in the treatment of prostate cancer Finasteride has been shown to reduce prostatic DHT levels to the same extent as surgical castration (Geller and Sionit, 1992) and its efficacy has been proven in BPH. Prostate cancer cell lines also show a dose dependent inhibition of cell growth by Finasteride (Bologna ef fl/, 1995).

Prostate cancer is hormonally sensitive in most patients. 5a-reductase inhibition leads to suppression of androgen dependent tumour growth and suppression of serum PSA level in men with prostate cancer (Gormley, 1997). Japanese men, who have a low incidence of prostate cancer, have low 5a-reductase activity (Ross et al, 1992). African American men who have a high incidence of prostate cancer have a unique family of 121-131 bp alleles of

5a-reductase II gene not found in men with lower life time risk of prostate cancer such as Asian Americans and non-Hispanic whites (Reichardt et al, 1995).

Therefore it was postulated that 5a-reductase inhibitors may be useful in treating prostate cancer. In the first clinical study of 28 men with untreated stage D prostate cancer,

30 Finasteride caused a 20% reduction in serum PSA level (Presti et al, 1992), but did not significantly reduce prostate volume. In a trial of Finasteride in combination with the antiandrogen flutamide, serum PSA levels fell by about 90% within 3 months, with most of the men remaining sexually potent (Fleshner et al, 1993, 1995). The largest study used 120 men treated with Finasteride after radical prostatectomy in a bid to slow the recurrence rate. These patients had a delayed increase in serum PSA level compared to the placebo for up to 3 years (Andriole et al, 1995). The chemopreventative potential of Finasteride was investigated in men with elevated PSA level and high risk of prostate cancer but was shown to be ineffective in preventing prostate cancer in these men (Cote et al, 1998). Therefore the role of 5a-reductase inhibitors in the treatment of prostate cancer remains unclear.

1.6 In Vitro Models Of The Prostate Because the anatomy and pathology of animal prostates are so different from those of the human prostate, in vitro models of the human prostate are particularly important. The first attempts at preparing primary explant cultures from prostate were made in 1917 by Burrows et a l . Since then various techniques have been described to grow prostate cells in culture (Webber, 1980, Peehl, 1992). Primary cultures can express differentiated characteristics such as PSA production for some days (Cussenot et al, 1991, 1994, Bayne et al, 1998a, b). However, individual variation between cultures and the difficulty of obtaining a reliable supply of fresh tissue make cell lines a more convenient option. Cell lines which retain prostatic characteristics, such as expression of prostate specific antigen (PSA), androgen receptor (AR) and 5ocReductase II are needed. However, it is the proliferating undifferentiated cells that are selected in monolayer culture (Fry et al, 2000), and more complex 3-dimensional cultures are needed to allow these cells to express differentiated features.

1.6.1 SV40 immortalisation of cultured cells There are two types of continuous cell line: prostate cancer cell lines and those derived from normal or benign prostate, and immortalised in vitro using viral genes. The commonly used prostate cancer cell lines were derived from metastatic tissue (see section 1.6.3). Although metastatic cancer cells have acquired genetic changes which have allowed them to escape the normal cell cycle regulation and ability to migrate to distant sites, the spontaneous formation of prostate cancer cell lines from metastasis is still a rare event

31 (Peehl, 1992). A reproducible culture system for producing prostate cancer cell lines from metastatic tissue is needed. Normal human cells in culture undergo a finite number of population doublings, after which they become senescent. Viral genomes such as the SV40 genome are used extend the lifespan of such cultures by up to 30 generations (Ide et al, 1984). These cells eventually go through ‘crisis’ during which the cells stop dividing. Sometimes a mutation occurs and the cells acquire the ability to grow again and are immortalised. This approach has been used to produce cell lines of various cell types (Bryan and Reddel, 1994) including prostate cancer (Table 1.3).

The SV40 genome is divided into two functionally distinct regions called the early and late regions, named according to the point in the infection cycle when the genes are transcribed. The early region is required for immortalisation of human cells and encodes three proteins called the large T antigen, small T antigen and 17KT (Bryan and Reddel, 1994). The late region genes encode for viral coat proteins. Of the early genes, the large T antigen gene is essential for immortalisation. It has many functions, the most important being inactivation of p53 and Rb (Stamps et al, 1992). It is the removal of these two crucial cell cycle regulating proteins that enables the cells to proliferate beyond their normal capacity.

Although the SV40 T antigen immortalised cells continue to proliferate, there are disadvantages in using it to produce cell lines. Firstly many functions and tissue specific characteristics are not expressed until the cells have stopped proliferating and have entered the differentiation pathway (Parkar et al, 1999). Secondly, many SV40 immortalised cell types progressively lose their differentiated characteristics and acquire further genetic changes in culture (Taylor-papadimitriou et a/,1982).

More recently, temperature sensitive mutants of the A gene encoding large T (tsA mutants) have been used to ‘conditionally’ immortalise differentiated cells (Stamps et al, 1994). Cells immortalised using tsA mutants proliferate at the low, permissive temperature (33°C) as T antigen is active. While at the high non-permissive temperature (39°C) the T antigen is conformationally inactivate and no longer sequesters on p53 and Rb. Cell division is no longer driven by the viral genes (Jat and Sharp, 1989), making it possible for the cells to enter the differentiation pathway. Several authors have reported that once withdrawn from the cell cycle, conditionally immortalised cells express tissue specific characteristics (Xu et

32 al, 1995, Simon et al, 1996). This approach has also been utilised to conditionally immortalise scleroderma derived human fibroblasts (Xu et al, 1995), mammary epithelial cells (Stamps etal, 1994) and hepatocytes (Yanai etal, 1991).

1.6.2 Immortalised prostate cell lines Normal cell lines immortalised with viral genes include PNTl, PNT2 (Cussenot et al, 1991), BPH-1 (Hayward et al, 1995), 267B1 (Kaighn et al, 1989), P69SV40 T (Bae et al, 1994), PW R-IE (Webber et al, 1996) (Table 1.3). Cell lines immortalised with HPV genes include HPV-18 C-1 (Rhim et al, 1994), PZHPV 7 (Weijerman et al, 1994), CA HPV-10 (Weijerman et al, 1994). Most of these cell lines do not form cancers on xenotransplantation. 267B1 and HPV-18 Cl were transformed using radiation and NMU respectively. E6 and E7 transforming proteins of the human papilloma virus 16 was used to establish a series of cell lines from primary adenocarcinomas and matching normal epithelial and mesenchymal cells (Bright et al, 1997). Immortalised stromal cell lines include pflsvl (Berthon et al, 1995), DuK50 (Roberson et al, 1995), and WPMY-1 (Webber era/, 1999).

1.6.3 Prostate Cancer Cell Lines Cell lines derived from mainly late stage tumours have been established (Table 1.3). The most widely used prostate cancer cell lines, LNCaP (Horoszewicz et al, 1980), DU 145 (Stone et al, 1978) and PC3 (Kaighn et al, 1979) were derived from métastasés.

Other prostatic cancer cell lines that have been established include HPC 36 (Lubaroff, 1977), PC 82 (Hoehn et al, 1980), TSU-PRl (lizumi et al, 1987), JCA-1 (Muraki et al, 1990), ND-1 (Narayan et al, 1992), ALVA-31 (Loop et al, 1993), ALVA-41 (Nakhla and Rosner, 1994), BM1604 (van Helden et al, 1994), MDAPCa2 (Navone et al, 1997). Cell lines derived form human prostate cancer xenografts include DuPro-1 (Gingrich et al, 1991), LRVA-4 (Fan,1988) and HONDA (Ito, 1984).

Most of these cell lines are of limited value as in vitro model systems of prostate cancer, as many of the differentiated characteristics of prostate cells are lost (Table 1.3). For example the androgen receptor (AR) (Sweat et al, 1999a,b), PSA (Djavan et al, 1998) and 5a- reductase H (Silver et al, 1994b) are expressed in prostate cancer but lacking in most cell

33 lines. The LNCaP cell line is widely used because it expresses androgen receptor (AR), 5a- reductase and is hormone sensitive. But the AR in LNCaP is mutated (Veldscholte et al, 1992) therefore making it promiscuous and sensitive to many different hormones. The 5a- reductase expressed is of type I (Bruchovsky et al, 1996, Negri-Cesi et a/,1998); although whole prostatic tissue has been shown to express more type II than type I (Thigpen et al, 1993a, Habib et al, 1998) and studies of 5a-reductase deficient males have shown that type n is more important in prostate development (Russell and Wilson 1994). Therefore prostate cancer cell lines which express “prostate-specific characteristics” are needed for use in prostatic research.

34 Prostatic Epithelial Cell Lines

Cell line Reference Origin PSA Androgen sensitivity Androgen Receptor 5a-R PAP Cancer Derived Epithelial Cell Lines HPC 36 Lubaroff 1977 Primary Androgen independent +

DU145 Stone 1978 Brain metastasis - Sensitive Absent Type 1 + PC3 Kaighn 1979 Bone metastasis Androgen independent Absent Type 1 + LNCaP Horoszewicz Lymph node + Sensitive Present (mutated) Type 1 + 1980 metastasis TSU-PRl lizumi 1987 Lymph node Androgen independent Absent + metastasis LRVA-4 Fan 1988 Primary + + JCA-1 Muraki 1990 Primary + + ND-1 Narayan 1992 Primary + ALV-31 Loop 1993 Primary + Yes Low Present +

ALVA-41 Nakhla 1994 Bone metastasis - Yes Present + BM1604 Van Helden Primary - - 1994 MDA PCa Navone 1997 Spine metastasis + Sensitive Present Cell Lines Derived from Human Prostate Cancer xenografts PC82 Hoehn 1980 Primary + Yes + HONDA Ito 1984 Testis metastasis + Androgen dependent Present + DuPro-1 Gingrich 1991 Lymph node - No metastasis Oncogene Immortalised Cell Lines 267B1 Kaighn 1989 Prostate + PN T l Cussenot 1991 Prostate + Androgen independent Present + P69SV40T Bae 1994 Prostate PRNS-1-1 Lee 1994 Prostate -

35 PZ-HPV-7 Weijerman Prostate - 1994

PNT-1A,B Cussenot 1991 Prostate --

BPH-1 Hayward 1995 Prostate - Absent Present - RWPE-1 Bello 1997 Prostate + Responsive Present PWR-IE Webber 1996 Prostate + Responsive Present 1519- Bright 1997 Primary + CPTX

Table 1.3: Established prostate cell lines.

Characteristics of established prostate cell lines are shown. Origin: Nature of tissue used to obtain cell line is indicated. For metastatic tissue the site is indicated. Primary denotes primary cancer tissue and prostate denotes BPH or normal prostate tissue. Expression of PSA and PAP: + denotes expression and - denotes no expression of PSA and PAP detected.

36 1.7 Thesis aims The enzymes 5a-reductase I and H play a central role in prostate development, maintenance and function and have been used as targets for the treatment of benign prostatic hyperplasia and prostate cancer. They show tissue and cell specific expression and are developmentally regulated. An earlier study carried out in this laboratory on the expression of 5a-reductase in prostate cancer cells showed that 5a-reductase activity is present in primary cultures of prostate cells, but was rapidly lost. The aim of this thesis was to study the regulation of expression of the two 5a-reductase genes in cells that express them. Isolation and cloning of the genes encoding the 5a-reductase enzymes have contributed to our understanding of their role in prostate growth and disease. Isolation of the regulatory regions and eventual identification of specific transcription factor binding sites for other prostate specific genes such as PSA, PSMA, PAP and probasin have advanced our knowledge of the molecular mechanism of their expression and action. Following this rationale, investigating the regulation of transcription of the 5a-reductase I and II genes might provide further insight into the molecular mechanisms of their expression and function in the prostate.

The ideal approach for studying the regulation of gene transcription is to transfect promoter constructs into cells that express the gene. This approach was not possible for 5a-reductase n, because there are no cell lines known to constitutively express this protein. Furthermore, almost all the prostate cancer cell lines available are hormone-insensitive and do not express prostate specific antigen. Therefore, the first aim of the study was to grow primary cultures from primary prostate cancers and metastatic prostate cancers in bone in semm- free medium, and immortalise the cells with a temperature-sensitive conditionally immortalising T-antigen construct. Using this constmct, the immortalising gene can be switched off by a simple temperature shift, allowing the cells to grow and differentiate under normal cellular mechanisms. It was hoped that selected cell lines might express 5a- reductase II at the non-permissive temperature and thus provide a suitable host for the promoter constmcts.

Therefore, in parallel with the development of prostate cancer cell lines that might express

5a-reductase II went the cloning and development of promoter constructs for the 5a- reductase I and II genes, in collaboration with the transcription factor laboratory of Prof. R.

37 Büttner. The following steps were planned to study the regulation of expression of 5a- reductase genes: 1. Isolation and sequencing of upstream regions involved in the transcription of the two genes. Identification of regions critical for transcription of the two genes by 2. Production of a series of reporter constructs of the cloned sequences of different lengths. 3. Transfection and expression of the reporter constructs in cell lines. 4. Identification of transcription start sites and putative transcription factors involved in the regulation of the genes. These studies are of potential importance as they provide essential information that will contribute towards the identification of prostate specific transcription factors.

The following steps were planned to produce conditionally immortalised prostate cancer cell lines. 1. Production of primary cultures of prostate epithelial and stromal cells from primary prostate cancer specimens. 2. Collection of bone marrow aspirates from patients with relapsed prostate cancer and culture of nucleated cells to establish cultures of metastatic prostate cancer cells. 3. Transduction of cultures with a temperature sensitive SV40 T antigen construct, selection and propagation of transfected cells to produce conditionally immortalised cell lines.

In a separate attempt at producing a 5a-reductase II expressing human prostate cell line that can be used to test therapeutic agents targeting this enzyme, the following strategy was used.

4. Transfection of an established prostate cell line with a 5a-reductase II expression vector, selection, propagation and partial characterisation of a positive clone.

38 CHAPTER 2

MATERIALS AND METHODS

39 2.1 MATERIALS 2.1a Chemicals and reagents SUPPLIER CHEMICAL

Advanced Biotechnologies CLP Aerosol barrier pipette tips Epsom, Surrey, UK Magnesium chloride Restriction endonucleases Red hot Taq DNA polymerase lOX PCR Reaction buffer Amersham International [1,2,6,7-^H] testosterone Aylesbury, UK Amersham Pharmacia dNTPs St Albans, Herts, UK. Ficoll 400 BDH, Merc Ltd Absolute ethanol Leicestershire, UK Dichloromethane DPX, mounting medium Ethyl acetate Formamide Glacial acetic acid Harris’ haematoxylin Methanol Sodium hydroxide Xylene Bio/Gene Ltd Bio/RNA-Xcell Kimbolton, Cambs, UK Bio-Rad laboratories Ltd SDS Herts, UK Bio Whittaker UK Ltd Clonetics Prostate epithelial cell growth Wokingham, UK medium (PrEGM), additives bulletkit Collaborative Biomedical products Bovine pituitary extract Universal biomedicals, London UK Costar Ltd. 0.2|xm Sterile filters

40 High Wycombe, Bucks, UK Dako Ltd. Anti Prostate Specific Antigen (PSA) High Wycombe, Bucks, UK antibody Gelman sciences ULC plates Ann Arbor, MI Gibco BRL L-Glutamine Life technologies Ltd Nunc tissue culture flasks, dishes Paisley, Scotland OPTIMEM Penicillin / Streptomycin solution Phosphate buffered saline (PBS) Random hexamers RNASEOUT ribonuclease inhibitor R PM I1640 Superscript RT-PCR system Subcloning efficiency DH5a Competent cells Streptomycin Transfection reagents Lipofectamine-Plus, Lipofectin, Lipofectamine, Cellfectin, DMRIE-C Trypsin/EDTA Imperial laboratories Dulbecco’s Modified MEM West portway, Andover, Hants, UK Foetal calf Serum Kyokuto Pharmaceuticals, WAJC 404 basal medium Chone Nikonbushi Noncho, Chuo-Ku, Tokyo Micron separations Inc. NitroPure nitrocellulose transfer membrane Westboro, MA 01581, USA Paesel and Lorei, Extracellular matrix coated flask Macrofarm Ltd, London, UK Pharmacia Biotech Ficoll-Paque St Albans, Herts, UK Oligolabelling kit Spin columns T4 polynucleotide kinase

41 Promega Caesium chloride Southampton, UK Calf intestinal alkaline phosphatase Luciferase assay system T4 DNA ligase QIAGEN Ltd QIAEX n gel extraction kit Crawley, Sussex, UK Sigma-Aldrich Company Ltd Agarose, electrophoresis grade Gillingham, Dorset, UK Androstenedione

3 a-androstanediol

3|3-androstanediol BBS Bovine serum albumin Calcium chloride Chloroform Cholera toxin, from Vibrio cholerae Collagenase type 1 A, from Clostridium Histolyticum Dexamethasone Diethyl polycarbonate Dihydrotestosterone BDTA Epidermal growth factor, human recombinant Ethidium bromide Foetal bovine serum Formaldehyde Glucose Heparin from porcine intestinal mucosa HEPES Hydrogen peroxide Insulin, from bovine pancreas Isoamyl alcohol 42 Isopropanol Magnesium chloride Millers Luria agar Millers Luria Broth base MOPS Non enzymatic dissociation solution Pan cytokeratin antibody Phenol Phosphomolybdic acid reagent spray (10%) Potassium acetate Potassium chloride Sodium azide Sodium chloride Sodium hydrogen carbonate Sodium selenite Testosterone Transferrin, human Tris base Stratagene Lambda FIX® II library Cambridge, UK TROPIX Inc Galacto-Star p-Galactosidase assay system Warrington, Cheshire, UK Vector laboratories Vectastain ABC kit Bretton, Peterborough, UK

43 2.1b Screening primers and probes Probe A1 For the initial screen probe A1 was obtained by digesting the 5a-reductase I expression vector (Q805) with Bam H I. This 5.8kb pCMV expression vector containing a 820bp 5a- reductase I cDNA fragment cloned into pCMV7 vector was a kind gift from Prof DW Russell, University of Texas (Andersson et al, 1989, Thigpen et al, 1993b).

Probe A2 Probe A2 used to screen the library was a 55bp oligoprobe corresponding to nucleotides - 228 to -173 of the 5a-reductase I gene.

5'GCTTGCAGGTCCCTCCCCGCGCAAGTGCTCGCCCCGCCCCCGGGGCCGCACC CAC.

Probe A3 To obtain probe A3 to screen the library two PCR primers corresponding to nucleotides -20 to -43 (sense primer) and +126 to +150 (anti-sense primer) were synthesised which would amplify a PCR product of 193bp corresponding to partial exon I of the 5a-reductase I gene. Sense primer 5' GCCGCGGCCTCTGGGGCATGGAGC 3' Anti-sense primer 5' GCCTGTGGCTGGGCAGCGCGTGGCG 3'

Probe E l

For the initial screen probe B1 was obtained by digesting the 5a-reductase II expression vector (S303) with Sal I. This 5.8kb pCMV expression vector containing a 825bp 5a- reductase II cDNA fragment cloned into pCMV7 vector was a kind gift from Prof DW Russell, University of Texas (Andersson etal, 1989, Thigpen etal, 1993).

Probe B2 To obtain probe B2 to screen the library two PCR primers corresponding to nucleotides -1 to -27 (sense primer) and +164 to +187 (anti-sense primers) were synthesised which would amplify PCR product of 214bp corresponding to partial exon I of the 5a-reductase II gene.

Sense primer 5' GCGGCCACCGGCGAGGAACACGGCGCG 3'

Anti-sense primer 5' CCGCGAAGGAAGGCAGCTCCTGC 3'

44 2.1c Cloning primers 5a-reductase I To subclone the 587 bp sequence immediately upstream of the ATG start site of the 5a- reductase I gene a 3' primer corresponding to nucleotides -22 to -1 upstream of a Bgl H site was synthesised. 5' AGATCTCGCCATTTCTGGGCAGCGTGCT 3'

5a-reductase II To subclone the 743 bp sequence immediately upstream of the ATG start site of the 5a- reductase II gene a 3' primer corresponding to nucleotides -25 to -1 upstream of a Bgl II site was synthesised. 5' AGATCTCGCGCCGTGTTCCTCGCCGGTGGCC 3' pBluescript Universal sequencing primer To subclone the above mentioned fragments the Universal primer from pBluescript was used as the 5' primer along with the above primers

3' TGACCGGCAGCAAAATG 5'

2.1d Sequencing primers pBluescript Reverse sequencing primer To sequence pBluescript recombinant plasmids the Reverse primer from pBluescript was also used. 5' GGAAACAGCTATGACCATG 3'

A FIX II phage DNA primers

The T3 and T7 primers flanking the multiple cloning site of X FIX II (Stratagene) was also used to partially screen the phage clones.

T3 primer 5' AATTAACCCTCACTAAAGGG 3'

T7 primer

45 3' CGGGATATCACTCAGCATAATG 5' pGL5odU 4.6 sequencing primers pGL5ocRI 4.6 vector was first sequenced partially with pGL2Basic vector sequencing primers GL3, GL4 and subsequently various sequencing primers were designed from preceding sequences to sequence this plasmid fully. GL3 primer 5' AGTAAGCTTGGCATTCCGGTACTGTTGGTA 3'

GL4 primer 5' TGTATCTTATGGTACTGTAACTGAGC 3'

To sequence the plasmid in the 3' to 5' direction the following primers were used.

1) 5' CCTCCTTCCCAGCCCTGAGGA 3'

corresponding to nucleotides -813 to -834 upstream of the ATG of the 5a-reductase I gene.

2) 5' GAAGATTACCCCAGGAGCCGA 3'

corresponding to nucleotides -1205 to -1225 upstream of the ATG of the 5a-reductase I gene. 3) 5' GGAGAATCTCTTTTGCGTGGC 3' corresponding to nucleotides -1603 to -1623 upstream of the ATG of the 5a-reductase I gene. 4) 5' GCGAAGTACCAGGAGACAACC 3' corresponding to nucleotides -2132 to -2152 upstream of the ATG of the 5a-reductase I gene.

To sequence the plasmid in the 5' to 3' direction the following primers were used

1) 5' GCTTATCTGTGATAGGGACAA 3'

corresponding to nucleotides -2935 to -2955 upstream of the ATG of the 5a-reductase I gene. 2) 5' CCTATACTGTACCCTTCAAGC 3'

corresponding to nucleotides -3305 to -3325 upstream of the ATG of the 5a-reductase I gene. 3) 5' GGCTTCTTCCTTTGCTCAGCA 3’

corresponding to nucleotides -3731 to -3751 upstream of the ATG of the 5a-reductase I gene. 4)5' TTCTTATCCCGTCTCTGCGC 3' 46 corresponding to nucleotides 4048 to 4068 upstream of the ATG of the 5oc-reductase 1 gene. 2.1e Fluorescent labelled primer for 5a-reductase I primer extension assay To determine the transcription start site of the 5a-reductase 1 gene a fluorescent (HEX labelled) primer corresponding to +17 to +46 of the 5a-reductase I gene (M68882) was prepared.

5^HEX^GCGCGGCCAGCAGGCGCTCCTCCGCCACCC 3'

2.1 f Libraries, cloning vectors and expression plasmids

Uimhda FIX 11 library A human placenta genomic DNA library in Lambda FIX II replacement vector (Stratagene) was screened to isolate the 5' regions of the 5a-reductase I and II genes. The map of the vector is shown below,

*88Sgs|s S 8

_ 1 5 â O LU x to w Zto X m CO ♦ f 4 f r- \ A

{ninL44) # {KH 54 ) ( n/o5)

Lam bda FIX I! vector

Figure 2.1: Map of Lambda FDÜI vector

47 pBluescript cloning vector After isolating genomic DNA fragments from the phage vector, they were cloned into pBluescript phagemid vector initially (Stratagene). The map of the vector with its multiple cloning sites used to clone the genomic DNA fragments is shown below.

Nae I 134

Ssp I 445 Ssp I 2850

Xmn I 2645 Nae 1 333

Sea I 2526 Pvu I 503 PvuW 532

Kpn I 657 ^7 \ pBluescript SK (+/-) phagemid vector Sac I 759 2958 bp

PvuW 977

origin

Figure 2.2: Map of pBluescript vector.

48 pGL2Basic reporter vector Once isolated, the 5' regions of the genes were cloned into a luciferase gene containing reporter vector called pGL2Basic (Promega). The map of the vector with its multiple cloning sites used to clone the 5' regions is shown below.

Amp^ poly(A) signal (for background reduction)

Sma I Kpn I on f1 ori Sac I 2744 Mlu I 2738 pGL2-Basic Nhe I Vector Xho I (5597bp) BglW Hind poly(A) signal ^ (for lue reporter) SV40

lue 2043 Pf/M

Figure 2.3: Map of pGL2-Basic vector pCMVLuc This plasmid containing the luciferase gene under the CMV promoter was used as the positive control plasmid and was obtained from Prof. R. Buettner, University of Regensburg.

This plasmid containing the P-Gal gene under the CMV promoter was used in co transfection with the promoter constructs to normalise transfection efficiency and was a kind gift from Dr P. Henttu, University of London.

AP2 a expression plasmid A mammalian expression vector containing the AP2a cDNA, pCM-PLl-AP2a, was a gift

49 SPl expression plasmid The SPl expression plasmid was a gift from Dr T Shenk, Princeton University.

5a-reduçtase U expression plasmid The 5a-reductase II expression plasmid S303, described above were used for producing 5a- reductase 11 overexpressing DUSF clones (Chapter 6 ).

pCDNA3,1 (Invitrogen) plasmid was used in co transfection with the S303 plasmid to select geneticin resistant clones of DUST cells since the latter plasmid contains only an ampicillin resistant gene.

(+)

5a%%ag'5.e'i=i (-)

pcDNA3

Figure 2.4: Map of pcDNA3.1 vector

50 2.1g RT-PCR primers RT-PCR primers spanning intron-exon boundaries were chosen so as not to amplify genomic DNA but only to amplify the reverse transcribed cDNA. 5a-reductase I

To detect the presence of 5a-reductase I mRNA; the following pair of primers spanning nucleotides 453-624 (intron 2 and 3) of 5a-reductase I gene were used (Bayne et al, 1998a) to amplify a 170bp PCR product. Sense primer 5' TGCTGATGACTGGGTAACAG 3'

Anti-sense primer 5' GTTGGCTGCAGTTACGTATTC 3'

5 a-reductase II

To detect the presence of 5a-reductase II mRNA; the following pair of primers spanning nucleotides 98-447 (intron 1) of the 5a-reductase II gene were used (Bayne et al, 1998) to amplify a 350bp PCR product. Sense primer 5' CCTTGTACGTCGCGAAGC 3' Anti-sense primer 5'CCACCCATCAGGGTATTCAG 3' p-actin To act as internal RT-PCR control, I designed a pair of primers spanning nucleotides 606 to 871 of the p-actin cDNA (Ponte et al, 1984) to produce a 266bp PCR product.

Sense primer 5' CTCATGAAGATCCTCACCG 3'

Anti-sense primer 5’ GTTTCGTGGATGCCACAGG 3'

2.2 CELL CULTURE 2.2a Culture of cells derived from primary prostate cancers Patients The tissue used for primary culture was TURP chips obtained from 14 patients who, based on digital rectal examination and PSA level, were suspected of having prostate cancer and were undergoing transurethral resection of the prostate (TURP) at the North Middlesex Hospital, Edmonton. Although the TURP samples probably contained both cancer and normal cells they were used to produce primary cultures as we planned to screen multiple immortalised clones using loss of heterozygosity (LOH) studies to determine which clone/s

51 were derived from cancer. LOH at multiple foci on chromosome 8 p has been used to characterise prostate cancer cell lines (Bright et al, 1997).

Tissue collection The TURP chips were collected in universals containing sterile transport medium (RPMI 1640 with 10% PCS, 20mM HEPES , 2IU/ml penicillin, 2|Xg/ml streptomycin), taken to the laboratory and processed within 24 hours.

Primary culture of prostate cells In a flow cabinet, the TURP chips were washed in fresh transport medium and, using crossed scalpels, blood clots and large charred areas removed. At this stage a small piece was frozen in liquid nitrogen and another fixed in formalin for histological analysis. The remaining tissue was weighed and cut into small pieces (- Imm^) using sterile scissors. The method used to produce the primary culture of epithelial and stromal cells was developed by Dr. Anne Collins (Collins et al 1996, Robinson et al, 1998, Robson et al 1999) and the selective epithelial growth medium WAJC 404, was originally developed by McKeehan et al (McKeehan etal 1984, Chaproniere etal 1986).

To the minced tissue 5ml of transport medium and 2.5ml of 600U/ml collagenase solution (RPMI 1640 supplemented with 5% PCS, 2mM L-glutamine, 600 U/ml collagenase type 1 A) per gram of tissue used was added to give a final collagenase concentration of 200U/ml. The tissue was incubated for 5-7 hours at 37°C on an orbital shaker very gently to prevent the disruption of acini. After the digestion was completed, the mixture was repeatedly pipetted with a wide mouthed lOml-graduated pipette, followed by a 1ml pipette until a broth like mixture was obtained. The mixture was decanted into sterile universals and centrifuged at 2(XX) rpm for 10 minutes to sediment the cells. The supernatant was discarded and the pellet washed twice by resuspending in 15ml of PBS (using 10ml pipettes) and centrifuging at 2000 rpm for 10 minutes. Pollowing the second wash, the supernatant was discarded and the pellet resuspended in 10ml of PBS. The clumps of epithelial cells (acini) were allowed to settle by centrifuging at 800 rpm for 20 seconds. The acini settled out forming deposits at the bottom of the universal while the supernatant contained aggregates of fibroblasts and single cells. The sedimented acini were collected with a sterile glass Pasteur pipette (rinsed in PBS to prevent attachment to the pipette) and 52 placed into another sterile universal. Any remaining acini were centrifuged at 800 rpm for 20 seconds, collected and combined with those previously collected. This procedure was repeated until all the acini were collected. The acini deposits were resuspended in 3-4ml of WAJC 404 in a T-25 flask (1 flask for Ig original tissue used), incubated at 37°C for 24-48 hours then supplemented with another l-2ml. The medium was changed when the cells were attached to the bottom of the flask (after 2-3 days). The supernatant left (after acini deposits were removed) was centrifuged at 2 0 0 0 rpm for 10 minutes, and the pellet resuspended in 5ml of fibroblast growth medium. Cells were placed in a T-25 flask (1 flask per Ig of tissue used) and incubated at 37°C for 48 hour. After 48 hour medium was removed from the cells, washed in medium by shaking the flask to remove any remaining white blood cells. Cells were fed with 5ml of fibroblast growth medium.

Culture media Primary cultures of epithelial cells were grown in WAJC 404 basal medium (5.52g medium powder, 3.35g (28.1mM) HEPES, 0.6g (14.3mM) sodium hydrogen carbonate dissolved in 500ml water, pH adjusted to 7.6 with IM NaOH) supplemented with 2|ig/ml insulin (from bovine pancreas) lOng/ml cholera toxin (from Vibrio cholerae) 4|ig/ml dexamethasone, lOng/ml epidermal growth factor (human recombinant), 15|ig/ml bovine pituitary extract, 5 U/ml heparin (from porcine intestinal mucosa) 10|ig/ml human transferrin, lOng/ml sodium selenite, 0.1 nM DHT, 2IU/ml penicillin 2|Xg/ml streptomycin and 2mM glutamine. The medium was sterilised by filtering through a 0.2pm filter. Primary culture of stromal cells were grown in RPMI 1640 (with 20mM Hepes) supplemented with 10% PCS, 2 lU/ml of penicillin, 2pg/ml streptomycin, 2mM L-Glutamine. To subculture primary epithelial and stromal cells, cells were washed in PBS once, incubated with trypsin or non enzymatic dissociating solution (Sigma) at 37° C for a few minutes and resuspended in the culture medium.

Transduction of cells with SV40 T antigen construct Cultures with growing foci were transduced with a retrovirally packaged temperature sensitive SV40 T antigen construct, PA/tsA58-U19/8, containing the tsA58 and U19 mutations (Jat and Sharp, 1989) by Dr. M O'Hare (Department of Surgery, University College London) in a level 3 laboratory. Transduced cells were also selected by Dr. O'Hare in geneticin and maintained. 53 2.2b Culture of cells derived from the bone marrow Patients The bone marrow was obtained from 9 patients with hormone relapsed prostate cancer who were treated at UCL hospitals by Dr S Harland.

Sample collection Diac crest bone marrow samples (5-20ml depending on cellularity of the marrow) were obtained by aspiration by a haematologist and transferred to EDTA/heparin coated vacutainers, inverted 4-5 times to prevent clotting and transported to the laboratory. The haematologist prepared 5-10 marrow smears from each sample and subsequently provided a report.

Preparation of smears In the laboratory, 5-10 smears were prepared from the samples by applying a drop of aspirate on to the end of one slide and using another slide held at 45° the drop was smeared on to the slide. The slides were air dried for 10 minutes, fixed in methanol at room temperature for 10 minutes and stored at -20°C for later use.

Separation and culture of nucleated cells from red blood cells Prior to culturing, the nucleated fraction of the cells (including any metastatic cancer cells) of the bone marrow was separated from the red blood cells and two such methods were tested. The first employed a lysis buffer to remove the red blood cells; and in the second method ficoll was used as previously described (Pantel et al, 1995).

Method 1: After preparing the smears, to the remaining marrow sample, 3 volumes of erythrocyte lysis buffer (0.144M NH4CI, pH 7.65, 17mM Tris adjusted to pH 7.2 with HCl) was added and mixed by inverting at room temperature for 2 minutes to lyse the red blood cells. The marrow suspension was centrifuged at 2000 rpm for 10 minutes to pellet the intact cells. The supernatant was removed and the pellet resuspended again in lysis buffer and centrifuged as above. The pellet (containing over 90% mononuclear cells) was resuspended in either WAJC 404 medium (as described above) or bone marrow medium (BMM, RPMI supplemented with 10% PCS, lOpg/ml transferrin, 5pg/ml insulin, 54 1 Ong/ml human EGF and 1 Ong/ml bFGF) to compare cell growth and plated in a T25 Primaria tissue culture flask (Table 3.3). A small aliquot of the suspension was removed at this stage and smears made as described above. At this stage there is likely to be a higher concentration of cancer cells so detection is likely to be easier than using marrow smears.

Method 2: The marrow sample was mixed with 20ml PBS and centrifuged at 850 rpm for 10 minutes. The supernatant containing the fat was removed and the pellet resuspended in 10ml PBS. The bone marrow solution was overlaid on 20ml Ficoll-Paque in a 50ml Falcon tube and centrifuged at 2300 rpm for 30 minutes. The top layer containing the plasma was discarded and the interface containing the lymphocytes and any cancer cells was removed and washed in 50ml PBS followed by centrifuging at 1500 rpm for 10 minutes at 4°C. The washing and centrifuging steps were repeated and the pellet was resuspended in 2 ml of medium. From this lOpl was removed for a cell count and 50,000 cells used to prepare a cytospin slide. From the remaining cell suspension 1x10^ cells were plated per T25 extracellular matrix coated flask (Paesel and Lorei) in BMM or PrEGM. medium to compare cell growth.

Immunocytochemical characterisation of cells present in bone marrow smears To determine whether the bone marrow aspirates used to initiate culture contained any prostate cancer cells, the expression of cytokeratins (characteristic of epithelial cells) and PSA (characteristic of prostate cells) was determined using immunocytochemistry employing the Vectastain ABC kit. Fixed smears (of marrow or cell suspension) were removed from -20°C and thawed at room temperature. As red blood cells contain peroxidase the endogenous peroxidase was quenched by incubating in 0.3% H 2O2 in 100% methanol for 30 minutes. The slides were washed twice in PBS for 5 minutes each and incubated with blocking serum, (NHS: normal horse serum, 3 drops from the Vectastain Kit to 10ml PBS) for 20 minutes in a humidity chamber. Excess serum was removed by gentle tapping of the slide. The primary antibody (mouse anti-human Prostate Specific Antigen, PSA or Pan Cytokeratin antibody, Dako) was diluted (optimum concentration was determined from preliminary experiments) in 0.1% BSA (bovine serum albumin) and 0.1% sodium azide in PBS, 200pl applied to each slide and incubated for 1 hour at room temperature. The slides were washed three times in PBS for 5 minutes each. The biotinylated secondary antibody (horse anti-mouse antibody) was diluted (1 drop 55 from Vectastain Kit in 5ml PBS), added dropwise to each slide and incubated for 30 minutes. The slides were washed three times in PBS for 5 minutes each. The Vectastain ABC reagent (avidin-biotinylated peroxidase complex) was prepared 30 minutes before use by mixing 2 drops of reagent A and 2 drops of reagent B with 5ml of PBS. Two drops of ABC reagent was applied to the slides and incubated for 30 minutes. Then the slides were washed twice in PBS for 5 minutes each. The peroxidase substrate was prepared by dissolving a 3.5mg tablet of 3,3'-diaminobenzidine tetrahydrochloiide (DAB) and a lOmg tablet of urea hydrogen peroxide in 5ml of distilled water in a 30ml universal. 200pl of the substrate was then applied to each slide and incubated for 5-10 minutes until a coloured precipitate formed. DAB produces a brown end product and signals the presence of the antigen. The slides were washed under running tap water for 5 minutes. The slides were then counterstained in Harris' haemotoxylin for about 5 seconds and washed in tap water. This was followed by dehydration in 70% alcohol for 1 minute twice, in 100% alcohol for 1 minute twice and in xylene twice. The slides were mounted in DPX and allowed to dry for 30 minutes.

2.2c Culture of continuous cell lines Cell lines The cell lines used in this study are shown in Table 2.1.

Prostate cell lines used for transfection of 5a-reductase promoter constructs were DU 145, PC3 and LNCaP. A human neuroblastoma cell line SK-N-MC, human neuronal cell line LAN-1 and a rat pituitary cell line GHFTl was also used.

DUSF (DU 145 adopted to Serum Free growth conditions in produced in this lab) and COS- 1 cells were used to transfect 5a-reductase I and H gene constructs. DNA fingerprinting of DUSF, using the method of short tandem repeat profiling described for the authentication other cell lines (Masters et al, 2001), showed that it was derived from DU145. The SV40 immortalised prostate cell lines S2.13 and Pre2.8 produced in this laboratory were also

tested for 5a-reductase expression.

Media and culture conditions Cells unless otherwise stated, were routinely cultured in RPMI 1640 medium 56 supplemented with heat inactivated 10% foetal calf serum and 2mM L-glutamine at 37°C in a humidified atmosphere of 5% CO 2 in air. Cells were subcultured using 0.25% trypsin in versene.

Cell line Origin Culture medium Reference Human prostate cell lines PC3 Bone metastasis of prostate RPMI 1640 medium Kaighn (1979) adenocarcinoma supplemented with LNCaP Lymph node metastasis 2mM glutamine and Horoszewicz et al, DU145 CNS metastasis 10% FCS (1983) Stone et al, (1978) DUSF Serum free derivative of DU 145 OPTIMEM Pre2.8 SV40 T antigen immortalised normal PrEGM human epithelial cell line S213 Stromal cell line derived as Pre2.8 DMEM supplemented with 2mM glutamine and 10% FCS Neuroblastoma and pituitary cell lines SK-N-MC Bone marrow metastasis of DMEM supplemented Biedler etal, (1973) neuroblastoma with 2mM glutamine LAN-1 Human neuronal cell line and 10% FCS Dorflinger et al, 1999 GHFTl Rat Pituitary cell line Schaufele 1996 COS 1 Monkey kidney cells Gluzman 1981

Table 2.1: Origin of prostatic and non-prostatic continuous cell lines.

DUSF cells were routinely cultured in semm free OPTIMEM medium as described above. Pre2.8 cells were cultured in PrEGM (basal medium is supplemented with BPE, insulin, hydrocortisone, gentamycin, retinoic acid, transferrin, T3, epinephrin and human EGF from the additives bulletkit) while the S2.13 cells were cultured in DMEM supplemented with

10% FCS and routinely maintained at 33°C. The CNS derived cell lines and COS-I cell lines were routinely maintained in DMEM supplemented with 10% FCS.

Clonogenic assays Since the primary prostate epithelial cells could not be grown long term in WAJC 404, in an attempt to identify which medium would support the growth of these cells, the colony forming efficiency of established prostate cancer cell lines LNCaP, DU 145, and PC3 in

57 other serum free media were determined. A semi confluent (70%) T25 flask of cells was washed once with PBS and cells detached using 2ml of trypsin. The cells were resuspended in 15ml of RPMI 1640 medium (without FCS) and counted using a haemocytometer. The cell suspension was diluted in medium to produce an appropriate final cell density. Petri dishes for control (4 dishes) and for each medium to be tested (3 dishes) were labelled and 5ml of the appropriate medium was pipetted to each petri dish. 50pl of cell suspension as added to each petri dish. To make sure the cells were evenly distributed in the dish, all the dishes were placed on a tray and gently moved backward and forward five times and side to side five times. The cells were incubated at 37°C for 10-14 days for growth to occur. The colonies were fixed in 70% IMS for 10 minutes and stained with 10% Giemsa for 30 minutes. The dishes were washed once with water and air dried. Colonies consisting of 50 cells or more were counted. For each assay, the mean for each medium was calculated and % colony forming efficiency (CFE) was calculated as percentage of the control medium. Each assay was repeated three times after optimisation of the number of cells required for plating. The epithelial growth media tested were WAJC 404, WAJC 404 supplemented with 1% FCS, WAJC without cholera toxin, MEBM (Mammary epithelial growth medium) with all the WAJC supplements, KGM (Keratinocyte growth medium) with all the supplements of WAJC 404 medium while RPMI supplemented with 10% FCS was the positive control medium.

2.3 CLONING OF THE Sa-REDUCTASE PROMOTERS All the sequencing reactions described in this study were performed by S Seegers on an automated DNA sequencer, at the University of Regensburg.

2.3a Preparation of probes for screening Probes for 5 CC-RI gene Two probes for the 5a-R I gene were used to screen the genomic DNA library.

5c cM ? Probe A l: Probe A1 (described above), was radiolabelled using a oligolabelling kit (Pharmacia Biotech) following manufacturer’s instructions. This kit uses Klenow DNA polymerase, random hexamers and labelled dCTP to label DNA. 0.5pg of plasmid DNA was added to 37.5pl of double distilled water, heated to 95°C for 5 minutes to denature and placed on ice. To the DNA lOpl of buffer containing dATP, dGTP, dTTP and random 58 hexamers, Ipl Klenow polymerase and 2.5pl of dCTP were added and incubated at 37°C for 1 hour. The radiolabelled probes were then separated from excess label using a spin column (Pharmacia Biotech) used according to the manufacturer’s instructions. IpL of the labelled probe was added to 5ml of scintillation fluid and radioactivity determined in a scintillation counter.

Probe A2: Probe A2 (described above) was 5' end labelled using T4 polynucleotide kinase

(PNK, Pharmacia Biotech). To 0.5|Xg of DNA 2|xl of lOX kinase buffer, 5|xl of ô P^^ ATP

(50|LiCi) and Ijil of PNK (lOU) were added and incubated at 37°C for 30 minutes. Unincorporated label was removed by passing through a Sephadex G50 column.

Probe A3: To obtain probe A3 to screen the library two PCR primers (described above) which would amplify 193bp product corresponding to partial exon I of the 5a-reductase I gene was synthesised. These purified primers were used to amplify human colon genomic DNA. 50)il of PCR reaction mixture contained l|xl of human colon genomic DNA, lOpmol of each primer, 100|iM dNTP, 5|xl of lOX PCR buffer and 5U of Taq polymerase. After a hot start of 94°C for 5 minutes, PCR was carried out at 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 45 seconds for 30 cycles followed by a final extension step of 72°C for 10 minutes. The products were run on a 4.5% polyacrylamide gel and a band excised whose mobility corresponded to the expected 193bp product. It was processed as described in isolation and reamplification of PCR products (described below). The fragment was sequenced (described below) using the original PCR primers and when the sequence of the fragment was confirmed it was radiolabelled as described for probe A2.

Probes for 5 a-R II gene

Two probes for the 5a-R U gene were used to screen the genomic DNA library.

Probe B l: Probe B1 (described above) was random labelled using a oligolabelling kit as described for probe Al above.

Probe B2. To obtain probe B2 to screen the library, two PCR primers (described above) which would amplify a 214bp product corresponding to partial exon I of the 5a-reductase II

59 gene were synthesised. These purified primers were used to amplify human colon genomic DNA. 50|il of PCR reaction mixture contained l|il of human colon genomic DNA, lOpmol of each primer, lOOpM dNTP, 5|xl of lOX PCR buffer and 5U of Taq polymerase. After a hot start of 94°C for 5 minutes, PCR was carried out at 94°C for 45 seconds, 55°C for 45 seconds, 72°C for 1 minute for 30 cycles followed by a final extension step of 72°C for 10 minutes. The products were run on a 4.5% polyacrylamide gel and a band excised whose mobility corresponded to the expected 214bp product. It was processed as described in isolation and reamplification of PCR products (described below). The fragment was sequenced (as described below) using the original PCR primers and when the sequence of the fragment was confirmed it was radiolabelled as described for probe A2.

Isolation, reamplification and sequencing of PCR products excised from gels The excised gel containing the fragment of interest was squashed using a plastic coated pestle and mixed with lOOpl TE and 1ml of water and shaken vigorously for 1 hour on an Eppendorf shaker. The eppendorf was centrifuged (at 13,000 rpm) for 30 minutes to pellet the gel. The supernatant containing the DNA was carefully removed with a pipette and placed in another tube. The 1.5ml tube was filled with butanol, mixed and centrifuged for 5 minutes. The top layer was removed, filled with butanol, mixed and centrifuged as above to concentrate the DNA solution. This procedure was repeated until ~0.5ml of DNA suspension was left. The DNA was precipitated with 1/10 volume of 3M sodium acetate, pH 5.2 and 2 volumes of 100% ethanol at room temperature (RT) for 20 minutes and centrifuged for 30 minutes to pellet the DNA. The supernatant was carefully removed with a pipette and the pellet air dried for 15 minutes. The pellet was re-dissolved in 20pl of water. Ijil of this DNA was then used to reamplify the fragment using the appropriate PCR conditions. To check the amplified product, 10|Xl was run on 4.5% polyacrylamide gel. To determine whether the reamplified product contained the sequence of interest, it was sequenced.

Preparation of PCR products for sequencing To sequence PCR products excess dNTP was removed from the PCR mixture as described below. 35|il of reamplified product was mixed with an equal volume of PEG mix (52.4g polyethylene glycol 8000, 40ml 3M sodium acetate pH 5.2, 1.32 ml IM MgCl 2 made up to

60 200ml with water) in an eppendorf tube, vortexed and allowed to stand at RT for 10 minutes. Then the tube was centrifuged for 10 minutes and the supernatant carefully removed with a pipette. To the tube 100 |Lil of 100% ethanol was added and centrifuged for 10 minutes. The supernatant was removed with a pipette and the pellet dried for 15 minutes. The pellet was dissolved in 30|xl water. The DNA was then sequenced on an automated DNA sequencer.

2.3b Genomic DNA library Screening The protocol used for screening the library was based on Sambrook et al, (1989) (Buettner, personal conununication).

Preparation of maltose induced E. coli Adsorption of phage to maltose receptors on the outer membrane of E. coli is needed for efficient infection. An isolated colony of E. coli C600 was picked and grown up overnight in 50ml of Luria broth (LB) containing 0.5ml of 20% maltose and 0.5ml of lOmM MgCL at 37°C on a shaker. After the overnight incubation the cells were centrifuged at 2200 rpm for 20 minutes, the supernatant discarded and the pellet gently resuspended in 50ml of TM buffer (lOmM Tris pH 7.4, 50mM NaCl, 5mM MgCL). This was followed by centrifugation at 2200 rpm for 20 minutes. The resulting pellet was resuspended in 20ml of TM buffer.

Primary screening of genomic DNA library A human placenta genomic DNA library (partially digested with Sau 3A1) in X, Fix II (Stratagene) was used for screening. The library was diluted in TM buffer (lOmM Tris pH 7.4, 50mM NaCl, 5mM MgCli), sixty thousand plaque forming units were incubated with

500|li1 of maltose induced E Coli C600 HFL (prepared as described below) at 37° C for 20 minutes in 9 sterile test tubes. To each tube 7ml of molten 0.4% top agar was added, mixed and poured onto 15cm diameter agar plates. The plates were allowed to set and incubated inverted overnight at 37° C. The plates were sealed with parafilm and chilled on ice for 6 hours to harden the top agar. For each plate two 132mm diameter 0.2|LI nitrocellulose transfer membranes (Micron Separations Inc.) were numbered with the plate number and marked wearing gloves. The first transfer membrane for plate 1 was placed marked side down onto the plate and the marks copied onto the base of the plate. The membrane 61 was removed and the plate rotated by 90°. The second membrane was placed on the plate and the marks copied as before. Two such transfers were done so that any positive signal can be checked on two separate blots. This is likely reduce false positive signals. The membranes were placed on a tray containing a Whatman 3MM filter paper soaked in denaturing buffer marked side up for 5 minutes and transferred onto another tray containing denaturing buffer (1.5M NaCl, 0.5M NaOH, pH >10) for 5 minutes. The membranes were placed on another tray containing neutralising (0.5M Tris, 1.5 M NaCl pH 7) buffer for 5 minutes twice. The plaques were blotted for the remaining plates and the DNA denatured and neutralised as described. The membranes were placed in a UV crosslinker (Stratalinker 1800, Statagene) for 2 minutes to crosslink the DNA to the nitrocellulose membrane.

Hybridisation The membranes containing the plaques were prehybridised with denatured (heated at 95°C for 5 minutes) prehybridisation solution (6 X SSC, 5 X Denhardt’s reagent, 0.5% SDS, lOOpg/ml denatured, fragmented salmon sperm DNA and 50% formamide) in a sealed plastic container at 65°C for 2 hours on a rotating platform in a water bath. The radiolabelled probe was denatured as above, added to the filters in the prehybridisation solution, sealed and incubated overnight at 65°C. The following day the radiolabelled probe was decanted and kept at 4°C for reuse. The membranes were washed once in wash solution (2 X SSC, 0.5% SDS) for 1 minute, once in 50% wash solution (diluted in distilled water) for 5 minutes, once in 25% wash solution for 10 minutes and twice in 12.5% wash solution for 10 minutes each. The filters were blotted, air-dried, covered with Saran wrap, exposed to X-ray film at -80°C and developed.

Secondary screening Plaques that hybridised to the probes were identified on the agar plates, marked and using a

1ml pipette and pipette aid the area corresponding to the positive plaque was removed and placed in a eppendorf tube containing 1ml TM and a few drops of chloroform. The tube was vortexed for 30 seconds and shaken for 2 hours at room temperature. Serial dilutions of the phage pick were prepared in l(X)|il o f TM, incubated with 200|li1 o f maltose induced

C600 at 37°C for 30 minutes. To each phage bacterial mixture 2.5ml of 0.4% top agar was added, mixed and poured onto a 9.2cm diameter agar plate. The plates were allowed to set and incubated overnight at 37°C. The plaques were lifted on 82mm diameter, 0.2|i 62 transfer membranes and processed as described previously. The membranes were hybridised with labelled probe and exposed to X-ray film as described. After identification of a positive isolated plaque, it was amplified as described below. If multiple plaques hybridised then tertiary screening was carried out to isolate a single plaque that still hybridised to the probe.

Amplification of X phage DNA To amplify the phage DNA contained in the plaques that hybridised to the radiolabelled oligo probes the following procedure was carried out. To appropriately labelled eppendorfs containing 1ml of TM buffer 100|Lil of chloroform was added (to kill bacterial cells). From the agar plates containing the plaques, the appropriate plaque was picked (using sterile 1ml graduated pipettes) and transferred to an eppendorf. The plaque was resuspended by vortexing and placed on a shaker. To a conical flask 0.5ml of maltose induced E. coli and 150pl of the phage solution (without removing any of the top chloroform layer) was added and incubated at room temperature for 20 minutes. To each flask 50ml of LB containing

MgCl2 was added and the bacteria grown up overnight at 37°C on a shaking incubator.

Extraction of X phage DNA To extract the phage DNA from the amplified positive clones, a protocol was adapted from Sambrook et al. When the phage enters the E. coli, it replicates and during the lytic phase the bacteria burst releasing the phage particles. This results in the bacterial cultures becoming clear. The cleared overnight cultures were centrifuged at 3200rpm for 30 minutes. 25ml of the supernatant was added to labelled 50ml Beckman centrifuge tubes containing 10ml of 40% glycerol in TM buffer. The supernatant was added slowly so as not to disturb the glycerol gradient. The solutions were then centrifuged in a Beckman centrifuge for 2 hours at 20,000 rpm at 4°C. The supernatant was discarded and the pellet containing the phage particles was resuspended in 1ml of TM buffer for every 50ml of original culture. The phage suspension was placed in sterile eppendorf tubes and incubated with 5pg/ml of DN’ase I and Ipg/ml of RN’ase I at 37°C for 1 hour (this step digests nucleic acids from E. coli, liberating the phage particles from the viscous solution). The phage particles were then incubated with 50pg/ml of Proteinase K solution containing 20mM EDTA, 0.5% SDS at 56°C overnight (Proteinase K digests the protein coating phage particles releasing the DNA). The DNA was extracted with 1 volume of 1:1 63 mixture of phenol:chloroform by centrifuging at 13,000 rpm for 10 minutes. Using a wide mouthed pipette tip, the top layer was removed, placed in another tube containing 1 volume of chloroform and centrifuged as above. The top layer was removed and placed in another tube containing 1/10 volume 3M sodium acetate and 2 volumes of ethanol. The solutions were mixed thoroughly to precipitate the DNA. The resulting precipitate of DNA was carefully removed using a sterile pipette tip and washed in 70% ethanol by centrifuging at 13,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the DNA pellet air dried and dissolved in 200pl of TE by gently shaking for 48 hours on an eppendorf shaker. The concentration of DNA was determined by measuring OD at 260nm (OD 1 = 50pg/ml double stranded DNA).

PCR amplification of X phage DNA

To determine whether the phage clones identified in the tertiary screen contained the 5a- reductase H partial exon I, phage DNA from the clones was amplified using the two original PCR primers used to generate probe B2. lOOpl of PCR reaction mixture contained Ipl of phage DNA, lOpmol of each primer, lOOjiM dNTP, lOjxl of lOX PCR buffer and 5U of Taq polymerase. After a hot start of 94°C for 5 minutes, PCR was carried out at 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 1 minute for 30 cycles followed by a final extension step of 72°C for 10 minutes. When products were seen, the annealing temperature was increased to 62°C to amplify more specific products. The products were run on a 4.5% polyacrylamide gel, stained and photographed. The correct sized fragments were excised and DNA extracted as described previously. PEG purified DNA was sequenced to determine whether it contained the correct sequence.

Restriction enzyme digestion and agarose gel electrophoresis of X phage DNA To check the amplified phage DNA from positive clones identified during the screening procedure, the DNA was digested with appropriate restriction enzymes. lOpg of phage DNA was incubated with 25U of Xba I or Sal /, 2pl of 10 X buffer made up to a final volume of 20pl with water at 37°C overnight. Larger quantity of phage DNA was digested in larger volumes (as the size of X DNA is quite big, the final reaction volume was never less than 20|il) with at least 3-5 units of enzyme per jxg of DNA. To check the digested products, 1/lOvolume of lOX loading buffer (5X TAE, 15% Ficoll 400, 0.05%

64 bromophenol blue and xylene cyanol) was added and mixed. A 0.8% agarose gel was prepared by adding O.Sg of electrophoresis grade agarose in 100ml of IX TAE buffer

(40mM Tris Acetate, ImM Na2 EDTA) and heated until the agarose melted. Once the gel was cooled to about 50°C, ethidium bromide solution was added to give a final concentration of 50ng/ml, mixed and poured. The gel was submerged in IX TAE in the electrophoresis tank and samples loaded in to wells. DNA size markers were also loaded to estimate the sizes of the digested products. Electrophoresis was carried out at lOOmV for the required amount of time to separate the products fully. The products were visualised under UV light and photographed.

Southern hybridisation After checking the digested products by gel electrophoresis, Southern hybridisation was carried out to ensure the extracted phage DNA still hybridised to the radioactive probe used to screen the library. After photography the DNA was denatured by soaking the gel in denaturing solution (1.5M NaCl, 0.5 N NaOH) for 30 minutes on a orbital shaker. The gel was rinsed briefly in water and neutralised by soaking in neutralising solution (IM Tris pH 7.4, 1.5 M NaCl) for 20 minutes on an orbital shaker. The DNA on the gel was blotted onto nitrocellulose membrane using capillary transfer overnight (Sambrook et al , 1989). The membrane was blotted, air dried and the DNA fixed in a UV crosslinker. The immobilised DNA was then hybridised using the radiolabelled oligoprobes as described earlier for the primary screen. The membrane was washed, dried and exposed to X-ray film as described for colony hybridisation earlier.

2.3c Cloning into plasmid vectors Since phage DNA shears easily and it is more convenient to manipulate plasmid DNA, the genomic DNA insert of positive phage clones were cloned into the plasmid, pBluescript.

Digestion and dephosphorylation of 5' ends of digested vectors The vector, pBluescript (pBS) was digested with the appropriate enzyme in a reaction mixture containing 3U of enzyme / pg of DNA, 1/10 volume lOX digestion buffer, made up to 20pl with distilled water and incubated at 37°C for 1 hour. The digestion was checked by electrophoresis of Ipl aliquot on a 1% agarose gel. If a single enzyme was used to cut the vector, the ends are identical. To prevent self-ligation of the plasmid, it was 65 dephosphorylated with calf intestinal alkaline phosphatase (CIAP). To the digested pBS, lOp.1 of lOX CIAP buffer, 0.0 lU CIAP/pmol of 5'ends and nuclease free water were added to make up the volume to lOOpl and incubated at 37°C for 30 minutes. An equal volume of

CIAP was added and incubated for a further 30 minutes. To inactivate the enzyme 2|il of

0.5M EDTA was added and heated to 65°C for 20 minutes. The DNA was extracted once with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) and the upper layer removed to a new tube. The DNA was precipitated with 0.5 volumes of 7.5M ammonium acetate and 2 volumes of 100% ethanol at -20°C for 25 minutes. The DNA was pelleted by centrifuging at 13,000 rpm for 10 minutes at 4°C. The pellet was washed with 200|li1 of 70% ethanol, air dried for 5 minutes and resuspended in double distilled water.

Digestion and extraction of digested phage DNA fragment from agarose gels 20pg of phage DNA was digested with the appropriate enzyme as described above. The digested DNA was heated at 65°C for 10 minutes to inactivate excess enzyme. l|il of the digested product was electrophoresed on a 0 .8 % agarose gel to check that complete digestion had taken place. If the phage DNA was not separated from the human genomic DNA insert before ligation to pBluescript, the DNA was prepared for ligation as follows. If however, a particular genomic DNA fragment from the phage clone was chosen for subcloning into the plasmid vector, it was first gel purified using the QIAEX II gel extraction kit (Qiagen) according to the manufacturers instructions (described below).

Once an aliquot of the digest had been checked by electrophoresis, the remaining digest was diluted with ISOpl of double distilled water. The digested phage DNA was then purified and concentrated as follows. The DNA was extracted with 1 volume of phenohchloroform (1:1), the top layer removed and the DNA precipitated with 1/10 volume of sodium acetate and 3 volumes of ethanol at 20°C. The solution was centrifuged at 13,000 rpm for 20 minutes at 4°C. The pellet was resuspended in 8 pl of water.

QIAEX n agarose gel extraction protocol To isolate a genomic DNA fragment for subcloning into plasmid vector, the remaining digest was mn on a 0 .8 % low melting point agarose gel and the desired band excised with a clean sharp scalpel. The gel slice was weighed in an 1.5ml eppendorf tube and 3 volumes of QXl buffer was added from the QIAEX II kit. The QIAEX II was resuspended by 66 vortexing, lOjxl of the particles added to the gel slice and mixed by inverting the tube. The tube was then incubated at 50°C for 10 minutes to solubilise the agarose and bind the DNA, while being mixed by vortexing every two minutes to keep the QIAEX II in suspension. After the adsorption of the DNA to the QIAEX II particles, the sample was centrifuged for 30 seconds at 13,000 rpm and the supernatant containing the agarose particles was removed with a pipette. The pellet was washed with 500|il of buffer QXl, the tube inverted and flicked to resuspend the pellet. The sample was centrifuged for 30 seconds at 3000 rpm and the supernatant carefully removed with a pipette. The pellet was washed twice with 500|xl of PE buffer as described above to remove residual salt contamination. The pellet was air dried for 10-15 minutes and the DNA eluted by adding 20|il of water and inverting and flicking the tube to resuspend the pellet. The sample was centrifuged for 30 seconds and the supernatant containing the DNA was carefully transferred to a clean tube.

Ligation IpL each of the digested, cleaned DNA (from above) and vector was checked by gel electrophoresis as described to estimate DNA concentration by electrophoresis with a known amount of marker DNA. The digested phage DNA or a genomic DNA fragment of interest from the digest was then ligated to the digested and dephosphorylated vector in various ratios by incubating digested phage and vector DNA with Ipl of T4 DNA ligase, Ipl of 10 X T4 DNA ligase buffer, made up to lOpl with water and incubated at 15°C overnight for blunt end ligations or 22°C for 3 hours for sticky end ligations. The DNA fragment to be subcloned was always in excess of the vector DNA, using ratios in excess of 3:1. The amount of vector and insert DNA needed was calculated using the formula below, [(ng of vector X kb size of insert) / kb size of vector] X molar ratio of insert / vector = ng of insert.

Transformation The recombinant plasmids prepared by ligating phage DNA with pBS were then used to transform DH5a competent E. coli cells. To 50pl of thawed competent cells, Ipl of ligation mixture was added, the tube gently tapped to mix and left on ice for 30 minutes. The cells were heat-shocked at 37°C for 20 seconds and left to stand on ice for a further 2 minutes. 0.95ml of room temperature LB was added to the suspension and the cells grown for 1 hour by shaking at 225 rpm at 37°C. To LB agar plates containing 50pg/ml of ampicillin, 67 5|il of 200mg/ml IPTG (isopropylthio-p-D-galactosidase) and 40pl of 20mg/ml X-gal (in dimethyl formamide) was added. lOOjil of the bacterial culture was spread onto the plate, allowed to dry and incubated at 37°C inverted, overnight. The multiple cloning site (MCS) of pBS is contained within the Lac Z gene in the plasmid, the product of which is needed for a functional p-galactosidase protein. If a fragment of foreign DNA is cloned into the MCS of pBS then the Lac Z gene is interrupted and bacterial cells do not contain functional

P-galactosidase enzyme and cannot utilise the chromogenic substrate X-gal; thus forming white colonies. The clones that do not contain foreign DNA insert form blue colonies as the cells are able to utilise the chromogen. White colonies were picked and grown up in 4ml of LB containing 100|ig/ml ampicillin overnight at 37°C with vigorous shaking. pBS contains an ampicillin resistance gene and therefore transformed bacterial cells will be resistant to ampicillin.

Minipreparation of plasmid DNA

1ml of the transformed cell suspension grown up as above was transferred to an eppendorf tube and centrifuged (13,000 rpm) for 30 seconds to pellet the cells. DNA was extracted by the alkaline lysis method as described (Sambrook et al, 1989). The supernatant was carefully removed and the pellet resuspended in lOOpl of solution I (50mM glucose, 25mM Tris pH 8.0, lOmM EDTA pH 8.0) by vortexing thoroughly. To the cell suspension, 200pl of freshly made ice cold solution II (0.2N NaOH diluted from ION stock, 1% SDS) was added, mixed and left on ice for 2 minutes. To this 150pl of solution m (60ml 5M potassium acetate, 11.5ml of glacial acetic acid, 28.5ml water) was added and left on ice for 10 minutes. This was followed by centrifugation for 10 minutes at 4°C. The supernatant was transferred to another tube containing an equal volume of phenol:chloroform ( 1:1), mixed thoroughly and centrifuged for 2 minutes. The supernatant was transferred to a fresh tube containing 1/10 volume of sodium acetate pH 5.2 and 2 volumes of ethanol and allowed to stand at -20°C for 10 minutes to precipitate the DNA. The suspension was centrifuged for 10 minutes at 4°C to pellet the DNA. The DNA was washed with 70% ethanol, air dried and resuspended in lOpl of TE (lOmM Tris-Cl, ImM Nai EDTA, pH 8 ). The DNA was checked by digesting Ipl with restriction enzyme as described before and product sizes checked by agarose gel electrophoresis as described above. The pattern of digestion was compared with that of phage DNA.

68 Minipreparation of plasmid DNA for sequencing To check that the colonies containing expected product sizes contained the correct DNA sequence, the plasmid DNA was extracted for sequencing as above, except to remove the RNA that interferes with the sequencing, the samples were incubated with 40pl of lOmg/ml of RN’ase at 37°C for 30 minutes. EDTA in TE interferes with the sequencing process so the DNA was dissolved in ISpl of double distilled water.

Maxipreparation of plasmid DNA Large scale preparation of plasmid DNA (maxiprep) was carried out using the following method based on Sambrook et al, 1989. lOOng of miniprep DNA was used to transform competent E. coli cells as described above and lOpl plated on an agar plate containing

50|xg/ml ampicillin. After overnight incubation a large, isolated colony was picked and used to inoculate 10ml LB supplemented with 100|ig/ml of ampicillin, in a 50ml Falcon tube and shaken at 250 rpm in a 37°C orbital shaker for 6-8 hours. This 10ml culture was then transferred to a conical flask containing 250-1000ml of LB/ampicillin and shaken overnight as described above. The following day, 250ml of the overnight culture was transferred to a Sorvall centrifuge tube and centrifuged at 6000 rpm for 10 minutes at 4°C to pellet the cells in a Sorvall centrifuge. The supernatant was discarded and the pellet resuspended thoroughly in 10ml of solution I (50mM glucose, 25mM Tris pH 8 , lOmM EDTA) by vortexing and pipetting up and down and placed on ice. The tube was placed on a shaker and shaken gently while 20ml of freshly made solution II (0.2M NaOH, 1% SDS) was added dropwise. 10ml of solution m (3M KG Ac, 5M glacial acetic acid) was added drop wise to the tube and then placed on ice for 30 minutes. The tube was then centrifuged at 10,000 rpm for 10 minutes at 4°C to pellet the cell debris. The supernatant was poured through sterile gauze to separated any remaining cell debris from the DNA solution. The DNA was then precipitated by adding 2 volume of 100% ethanol at room temperature (RT) and incubated for 30 minutes. The DNA was pelleted by centrifuging at 10,000 rpm for 10 minutes at RT to avoid precipitating salts with the DNA. The pellet was washed by resuspending gently in 30ml 70% ethanol and centrifuging at 10,000 rpm for 10 minutes.

The supernatant was discarded, the pellet dried at 37°C for 15 minutes and resuspended in 4ml of IXTE using a pipette. The DNA was then purified through a caesium chloride (CsCl) gradient as follows. To the 4ml of DNA suspension in a sterile tube, 4.8g of CsCl was added and the tube inverted until it dissolved. To visualise the DNA, ethidium 69 bromide (EtBr) solution was added to a final concentration of 500)ig/ml, mixed and centrifuged at 3000 rpm for 10 minutes to pellet bacterial protein-EtBr complexes. The red, clear solution containing the DNA was transferred to 1ml quickseal Beckman centrifuge tubes until full and sealed. The tubes were then centrifuged at 70,000 rpm overnight in a Beckman centrifuge at RT. The following day the tubes were removed from the centrifuge and the plasmid band removed using a 21G needle attached to a 1ml syringe as described in Sambrooks et a/,1989. The solution containing the plasmid was pooled in a sterile tube and extracted 3 times with an equal volume of water saturated isoamyl alcohol (lAA) to remove the EtBr. For each extraction, the DNA was mixed with the lAA by vortexing and centrifuging at 3000 rpm for 5 minutes. The top lAA layer was removed after each extraction until the DNA solution was colourless. To reduce the CsCl concentration, 2 volumes of water was added and the DNA precipitated by adding 2 volume of 100% ethanol and mixed at RT for 30 minutes. The DNA was pelleted by centrifuging at 10,000 rpm for 15 minutes and the pellet washed with 70% ethanol and air dried. The DNA was resuspended in 1ml of sterile water and transferred to an eppendorf tube. The DNA was then extracted twice with an equal volume of phenol:chloroform:lAA (25:24:1), each time transferring the top layer to a fresh tube, and centrifuged at 13,(XX) rpm for 10 minutes each. The pooled extract was then extracted once with an equal volume of chloroform:lAA (24:1) to remove the phenol and centrifuged at 13,000 rpm for 5 minutes. The DNA was precipitated by adding 10% 3M sodium acetate and 2 volumes of 100% ethanol, mixed and centrifuged at 13,000 rpm for 15 minutes. The pellet was washed once with 1ml 70% ethanol and centrifuged for 15 minutes. The supernatant was carefully discarded, the pellet air dried and resuspended in 5(X)|il of water. The concentration of the DNA was determined by measuring the OD of a diluted solution at 260nm in a spectrophotometer. The plasmid DNA was checked by digesting with 2 or more restriction enzymes and the pattern compared with the miniprep DNA used to transform the cells. If the digestion pattern of the maxiprep DNA was the same as that for the miniprep DNA then it was used for transfection as described later.

2.4 GENERATION OF 5a-REDUCTASE PROMOTER DELETION CONSTRUCTS 2.4a Cloning of the 5' region of 5a-reductase I gene into pGL2Basic reporter plasmid To study the promoter activities of the genomic DNA fragments isolated from 70 screening the library, DNA sequences that were upstream of the ATG start site needed to be cloned into a reporter plasmid. The putative promoter regions were cloned into the promoterless pGL2Basic plasmid containing the luciferase reporter gene (see map in previous section). The multiple cloning site (MCS) is present before the luciferase gene in the plasmid; therefore the effectiveness of a cloned promoter at transcribing the luciferase gene can be measured.

To clone only the sequence 5'of the ATG site of the 9kb Not I genomic DNA fragment cloned into pBS, a PCR and restriction digestion based strategy was used. A 5a-reductase I specific 3' primer complementary to bases -22 to -1 next to a Bgl H restriction site was synthesised (described earlier). Since a Bgl H restriction site is present on the 3' end of the

MCS of pGL2Basic (see map), it can be utilised to clone the 3' end of the fragment into this vector.

-22 -1 Bg/n

I------1------1 5a-reductase I specific 3' primer.

Using the universal primer (M l3-20 primer complementary to sequences at the start of multiple cloning site on pBS) as the 5' primer and the 9kb Not I fragment cloned into pBS as a template, a PCR reaction was carried out. l(X)|xl of PCR reaction mixture contained 200ng of template DNA, lOpmol of each primer, KXlpM dNTP, 10)il of lOX PCR buffer and 5U of Taq polymerase. PCR was carried out at 94°C for 1 minute, 63°C for 1 minute,

72°C for 1 minute for 30 cycles followed by a final extension step of 72°C for 10 minutes. lOjil of the reaction mixture was checked on a 4.5% polyacrylamide gel and a ~0.75kb PCR product seen. Then the remaining products were run on the gel, the band excised and processed as described in isolation and reamplification of PCR products from gels (described above).

To clone the 5' end of the fragment into pGL2Basic, a restriction digestion strategy was used. 5' of the Not I site in the MCS of pBS (used to clone the genomic fragment into this plasmid), there is a Xba I site (See map of pBS). Although a site for Xba I is not present on pGL2Basic, there is a Nhe I site 5' of the Bgl II site which produces ends compatible with

71 Xba I. Therefore 3|Xg of pGL2Basic was digested Bgl II and Nhe I in a 20|xl reaction mixture containing 5U of each enzyme and 2 |l i 1 of appropriate lOX buffer at 37°C for 2 hours. The cleaned 0.75kb PCR product was also digested with 5U each of Bgl II and Xba I and l|il of each digest checked on a 1% agarose gel. Both the digested pGL2Basic and the PCR product were then extracted with an equal volume of phenol:chloroform:IAA (25:24:1), vortexed and centrifuged at 13,000 rpm for 10 minutes to remove excess enzymes. The top layer was then extracted once with an equal volume of chloroform:lAA (24:1) to remove the phenol and centrifuged at 13,000 rpm for 5 minutes. The DNA was precipitated with 1/10 volume of 3M sodium acetate, pH 5.2 and 2 volumes of 100% ethanol at room temperature (RT) for 20 minutes and centrifuged for 30 minutes to pellet the DNA. The supernatant was carefully removed with a pipette and the pellets air dried for 5 minutes. The pellets were redissolved in lOpl of water. A ligation reaction was carried out as described using 3 times excess of PCR product compared to pGL2Basic. The ligated product was used to transform competent E. coli cells, isolated colonies grown and miniprep DNA extracted. The resulting plasmid DNA was checked by digesting with restriction enzyme. It was also prepared for sequencing using the original PCR primers. The sequencing reaction showed that only 587bp of the original 9kb Not I fragment that hybridised to the probe was 5' to the ATG site and the resulting plasmid was called pGL5ocRI0.59.

Cloning of the 4.6kb 5a-reductase I promoter construct Since the 4kb Not I fragment is immediately upstream of the 587bp fragment already cloned into pGL5ocRI 0.59, it was cloned upstream of the smaller 587bp promoter fragment to create a larger 5a-reductase I promoter construct. 3|Xg of pGL5(xRI 0.59 was cut with

Not I and dephosphorylated. 20|Xg of phage DNA from P2 was digested with Not I and separated on an agarose gel. The band corresponding to the 4kb fragment was excised and the DNA gel extracted using the QIAEX II kit. Ligation reactions were set up using the 4kb fragment with the Not I cut and dephosphorylated pGL5ocRI 0.59 and used to transform competent E. coli cells. Resulting colonies were picked, minipreped and the miniprep DNA digested with enzymes to check insert sizes. Clones with the correct sized fragments were sequenced and found to contain the 4.59kb 5a-reductase I promoter sequence in the correct orientation. This vector was called pGL5(xRI 4.6.

72 2.4b Cloning of the 5' region of 5a-reductase II gene into pGL2Basic reporter plasmid To clone the sequence 5'of the ATG site of the 5kb Sac I genomic DNA fragment in pBS, a

PCR and restriction digestion based strategy was used, as for the type I promoter. A 5a-R II specific 3' primer complementary to bases -25 to -1 next to a Bgl II restriction site was synthesised.

-25 -1 BglU I------1------1

5a-reductase II specific 3' primer.

Using the universal primer as the 5' primer and the 5.5kb Sac I fragment cloned into pBS as a template, a PCR reaction was carried out. lOOfil of PCR reaction mixture contained

200ng of template DNA, lOpmol of each primer, lGG|iM dNTP, 10|xl of lOX PCR buffer and 5U of Taq polymerase. PCR was carried out at 94°C for 1 minute, 62°C for 1 minute, 72°C for 1 minute for 30 cycles followed by a final extension step of 72°C for 10 minutes. lOjil of the reaction mixture was checked on a 4.5% polyacrylamide gel and a -O.Skb PCR product seen. The remaining products were then run on the gel, the band excised and processed asdescribed in isolation and reamplification of PCR products from gels. Since pGL2Basic contains a Sac I site, both this plasmid and the PCR product were digested with Sac I and Bgl n, the products purified and ligated. Ligated product was used for transformation and miniprep DNA of isolated colonies sequenced. Only 743bp of the 5.5kb Sac I fragment that hybridised to the probe was 5' to the ATG site and the resulting plasmid was called pGL5otRII0.75.

2.4c Generation of smaller 5a-reductase I and II deletion constructs Once the 4.6kb and 0.75kb pGL2Basic constructs of the 5a-reductase I and II promoters were made, smaller constructs were prepared utilising restriction enzyme sites present in both the pGL2Basic plasmid and the promoter regions. The procedure for one such construct, pGL5oRI 0.3 is described below. In the pGL2Basic MCS, there is a Sac I site upstream of the Bgl II site. The sequence of the 0.59kb construct showed that there is a Sac

73 I site 302 bp upstream from the ATG site. pGL5otRI 0.59 vector was digested with Sac I which cut at both the promoter and at the MCS to excise the 285bp distal promoter fragment, leaving the first 302bp of 5a-Reductase I promoter in the pGL2Basic vector. 3p,g of pGL5ocRJ 0.59 was digested in a 20|Xl reaction volume with 5U of Sac I and 2|il of lOX buffer at 37°C for 2 hours. Ijxl of the digested product was checked on a 0.8% agarose gel. The remaining digest was also electrophoresed and the corresponding band was excised and gel cleaned using the QIAEX II kit. To 1|li1 of the gel cleaned plasmid Ipl of T4 DNA ligase and 2pl of 10 X T4 DNA ligase buffer were added and made up to lOpl with water and incubated at 15°C overnight for blunt end ligations or 22°C for 3 hours for sticky end ligations. Ipl of the ligation mix was used to transform competent E. coli cells, colonies were picked and miniprep DNA digested with Sac I and other enzymes to check insert size. Colonies containing the correct sized insert of 0.3 kb were sequenced using pGL2Basic sequencing primers. This vector was called pGL5oRI 0.3.

2.5 TRANSFECTION AND ASSAY OF PUTATIVE 5a-REDUCTASE PROMOTER CONSTRUCTS IN CELL LINES 2.5a Transfection of CNS derived cell lines To test the promoter activities of the deletion constructs, they were transfected and luciferase activity measured. Three CNS derived cell lines, LAN-1, GHFT, SK-N-MC were transiently transfected using the calcium phosphate method as described below.

The transfection efficiency achieved using the calcium phosphate method was high and therefore no other methods were tested. Cells were that were about 70% confluent were trypsinised and counted. 3X10^ cells (optimal cell number determined in preliminary experiments) were plated in six well plates in 3ml DMEM medium supplemented with

10% PCS in duplicate for each plasmid and incubated overnight at 37°C for the cells to attach. The following day, the medium was removed and replaced with 3ml fresh DMEM and placed at 37°C while the transfection mix was prepared. For each well 200pl of transfection mix containing 50|il CaC^, (2.5M) 5pg of promoter construct, Ijig of the control P-Gal plasmid pCMVp-Gal and lOOjXl of 2XBES buffer (50mM BES, 280mM

NaCl, 1.5mM Na2HP0 4 ) was added dropwise whilst being vortexed. The mixture was incubated at RT for 20 minutes to allow the formation of DNA precipitate. To each well,

74 200|il of the transfection mix was added and the plate gently moved from side to side to mix the solution with the medium and incubated overnight (-15 hours) at 37°C. The following morning the medium containing the transfection mix was removed and replaced with 3ml of fresh DMEM and left to incubate at 37°C overnight to express the transfected DNA. The following day the cells were washed twice with 5ml of PBS and cells lysed with 250)11 of lysis buffer (from the Galacto-star P-Galactosidase assay system). Three different lysis buffers were tested in a preliminary experiment to lyse cells transfected with the positive control plasmid pCMVLuC to compare luciferase and p-galactosidase activity. The cells were incubated with this Galactostar lysis buffer for 10 minutes. The cells were scraped off the plate and the lysate was collected using a pipette and placed in a 1.5ml eppendorf tube. The lysate was then centrifuged at 13000 rpm for 1 minute to pellet the cell debris. A 5|il aliquot of cell lysate from the pCMVLuc well was tested for luciferase activity in a luminometer (described below). The lysate volume for the subsequent samples was adjusted according to this reading, i.e. if the reading was in the maximum range of the luminometer then a smaller aliquot (i.e. Ipl) was assayed for all the samples and vice versa. The same volume was also assayed for p-Galactosidase activity (described below). Experiments were repeated at least three times with duplicate wells for each construct in an assay. An example of p-Galactosidase and luciferase readings obtained for an assay of the CNS cell line LAN-1 is shown on table 2.15 (page 87).

75 2.5b Optimisation of conditions and transfection of prostate cancer cell lines For transient transfection of the 5a-reductase promoter constructs, 5a-reductase expressing cell lines which would express the associated transcription machinery were needed. For the 5a-reductase I constructs, DU145 and PC3 which express 5a-reductase I were used. Since

5a-reductase II expressing cell lines were not available, DU 145 and PC3 were used to transfect the type II promoter constructs as well. Initially three prostate cancer cell lines, DU 145, PC3, LNCaP, were chosen for transfection of the 5a-reductase I and II promoter constructs. Due to the low transfection efficiency of LNCaP cell line it was excluded. To determine optimal transfection conditions, the positive control plasmid pCMVLuC was transfected in these cell lines using several methods.

2.5bi DU145 Calcium phosphate mediated transfection Using the conditions for the CNS derived cell lines, the effect of cell number and DNA concentration on the transfection efficiency was tested in DU145 (Table 2.2).

Cell Number/Amount of DNA Luciferase readings (ng) DU145 2X10’ cells, 2.5ng of DNA pGL2Basic 0,0 pCMVLuc 40.3,43.2 3X10^ cells, 5pgofDNA pGL2Basic 0,0 pCMVLuc 132.1, 150 4X10^ cells, 5pg of DNA pGL2Basic 0,0 PCMVLuc 117.1, 112.6

Table 2.2; Effect of cell number and DNA concentration on transfection efficiency.

4X10 DU 145 cells were transfected with 5|Xg of the 5a-reductase I promoter constructs to determine if the transfection efficiency was high enough to detect their promoter activity.

However, the luciferase and p-Galactosidase activity was too low to be reliable for the 5a- reductase I promoter constructs (results not shown) even if much higher volumes of lysates were assayed (i.e. lOOpl). To determine if increasing the amount of 5a-reductase I promoter construct further increased the transfection efficiency, DU 145 (4X10^ cells) 76 was transfected as described for the CNS derived cell lines with increasing amounts of promoter DNA. The results showed (Table 2.3) that even increasing the DNA concentration to lOjig/well, the luciferase readings for the 5a-reductase I constructs were still too low.

3jig 5llg Plasmid Luciferase p-galactosidase Luciferase P-galactosidase pGL2Basic 0,0 13.2, 12.5 0,0 32.3, 39.4 PCMVLuc 9.7, 10 8.5,7.6 40.3,47.4 23.4, 20.5 pGL5aRI0.6 0,0 12.3,21.3 0.1,0.1 43.4,46.5 w 10 Luciferase P-galactosidase Luciferase p-galactosidase pGL2Basic 0 ,0 35.2, 52.2 0,0 53.1,65.0 PCMVLuc 163.7, 194 31.8,31.7 217.3,210 26.3,31.4 pGL5aRI0.6 0.4,0.6 45.8,61.5 0.5, 1.2 65.8, 54.9

Table 2.3: The effect of DNA concentration on transfection efficiency.

Electroporation To determine if electroporation would increase the transfection efficiency, DU 145 cells were electroporated using conditions similar to those tested for LNCaP (10X10^ cells transfected with 20|ig of plasmid, 500pF, 250mV in 2XBES buffer, described in the following section). Briefly, subconfluent cells in T80 flasks were trypsinised and resuspended in medium to inactivate the trypsin. The cells were pelleted by centrifuging at 1000 rpm for 5 minutes, resuspended in PBS to wash and cell number counted. The cells were centrifuged again as above and resuspended in an appropriate volume of 2XBES

(50mM BES, 280mM NaCl, 1.5mM Na 2HP0 4 ) to produce cell density of 1.43X10^ cells/ml. 0.7ml of cell suspension (10X10^ cells) was aliquoted in sterile eppendorf tubes on ice. To each labelled tube 10|ig of promoter plasmid was added, mixed and placed on ice. The content of each tube was transferred to a sterile, labelled 1ml electroporation cuvette and placed on ice for 10 minutes to chill. The cuvette was then placed in the cuvette holder of a Biorad electroporator (Biorad Gene Puiser), capacitance set at 960pF and voltage at 250mV and electroporated according to manufacturer’s instructions. The cuvette was then incubated on ice for 10 minutes to chill the cells. The cell suspension was transferred to a T80 flask and mixed with 15ml of RPMI medium supplemented with 10% ECS and incubated overnight at 37°C. The following day the medium was removed to discard 77 dead cells and replaced with 20ml of fresh medium and incubated at 37°C overnight. The medium was removed the following day and cells washed with PBS and lysed using 1ml of lysis buffer as described for the CNS derived cell lines. An aliquot was tested for luciferase activity as described (Table 2.4).

Plasmid Luciferase readings pGL2Basic 0,0 pCMVLuc 101.9, 125.5 pGL5(xRI4.4 0,0.1 pGL5oRI1.7 0.1,0.1 pGL5(xRI0.6 0.1,0.1 pGL5(xRI0.52 0.1,0 pGL5aRI0.3 0,0 pGL5aRI0.15 0,0

Table 2.4: Transfection of 5a-reductase I promoter constructs in DU145 using electroporation.

Since the luciferase readings for pCMVLuc was even lower than for calcium phosphate method, electroporation was not repeated.

Lipofection To determine if lipofection would increase the transfection efficiency in prostate cancer cell lines, some commercially available reagents were tested.

Superfect transfection reagent 4X10^ DU 145 cells were plated in duplicate in 6 well plates and incubated overnight at

37°C. The following day the Superfect reagent (SF) was prepared as described by the manufacturer. Briefly, in sterile tubes 2|Xg of either the positive control plasmid pCMVLuC or 5ocRJ0.6 were mixed with Ipg of pCMVp-Gal in lOOjxl of serum free RPMI. To the

DNA mix, SF was added in a final DNA:SF ratio of 1:2 or 1:5 (2 or 5|xl of SF per |ig of plasmid DNA to be transfected) as recommended, mixed and left at room temperature (RT) for 10 minutes to allow complex formation. The medium was removed from the cells and washed with 3ml of PBS. To each tube containing the DNA-SF mix, 600|xl of complete RPMI medium was added, mixed by pipetting and transferred to labelled wells. Cells were

78 incubated for 3 hours at 37°C after which the transfection medium was removed and cells washed once with PBS. The cells were incubated with 3ml of fresh medium and incubated overnight. The following day the cells were assayed for luciferase and p-galactosidase. The results (Table 2.5) indicated that this reagent was also not suitable for transfecting the 5a- reductase promoter constructs.

DNAiSF ratio 1:2 1:5 Luciferase p-galactosidase Luciferase p-galactosidase pCMVLuc 53.5,42.3 19.6, 15.4 101.1,86.4 36.2, 28.8 pGL5ocRI0.6 0, 0.2 38.2, 24.6 0.1, 0.1 58.7,49.9

Table 2.5: Superfect mediated lipofection in DU145.

Gibco Lipofection reagents The use of Lipofectin and Lipofectamine in the transfection of prostate cancer cell lines have been reported in the literature previously. So all four available Gibco lipofection reagents were tested in a 24 well format in DU 145 as recommended by the manufacturer. Briefly, for each reagent and plasmid to be tested, cells (80,000/well) were plated in 6 wells in a row of a 24 well plate, allowed to attach and the following day washed with 1ml of Optimem. A separate sterile 24 well plate was labelled exactly as this plate and 300|xl of Optimem added to each well. Then 20|xl, lOpl, 15|Xl and lOpl of Lipofectin, Lipofectamine, Cellfectin and DMRIE respectively were added to the first well of each row and incubated at RT for 30 minutes. To each of these 4 wells 300pl of Optimem containing 3.2pg of reporter DNA was added and incubated at RT for 15 minutes to allow complex formation between the DNA and the lipids. The lipidiDNA complex was serially diluted by transferring 300pl of the solution to the next well, mixing and transferring 300pl to the next one and so on. The diluted lipid:DNA complex solution (300pl/well) was transferred to the corresponding wells of the plate containing the cells and incubated in a 37°C incubator for 5 hours. The DNA solution was removed and replaced with 1ml of RPMI medium containing serum and incubated at 37°C. 48 hours after transfection the cells were washed twice with 1ml of PBS, lysed with lOOpl of lysis buffer and 20pl assayed for luciferase and

P-gal activity. The results (Table 2.6) indicated that the second and the third dilution of Lipofectamine produced the highest transfection efficiency.

79 R eagent/ R eagent/ dilution Luciferase readings dilution Luciferase readings Lipofectin PCMVLuc pGL5ocRIO. Lipofectamine pCMVLuc pGL5oRI0. 6 6 1 12.2 0 1 17.3 0 2 20.9 0 2 42.5 0.1 3 10.9 0 3 34.5 0 4 3.7 0 4 7.4 0.1 5 1.5 0 5 0.8 0 6 0.5 0 6 0.2 0 Cellfectin DMRIE 1 19.3 0 1 14.1 0 2 29.4 0.1 2 17.6 0 3 24.4 0 3 17.1 0 4 12.8 0 4 6.1 0.1 5 4.4 0 5 3.0 0 6 0.8 0 6 0.5 0

Table 2.6: Lipofection of promoter constructs in DU145 using Gibco lipofection reagents.

Therefore Lipofectamine was tested next in 6 well plates using 5 times more cells (4X10 ) and reagent using the second and third dilutions as described. The results (Table 2.7) indicated that scaling up the transfection to 6 well plates did not increase the transfection efficiency in DU 145 significantly.

2"“ dUution 3*^** dilution Plasmid DU145 Luciferase P-gal Luciferase P-gal pCMVLuc 58.6 5.5 32.9 6.1 pGL5otRI0.6 0.2 13.4 0.1 8.1

Table 2.7: Lipofectamine mediated transfection of DU145 in 6 well plates. Lipofectamine PLUS was claimed to give even higher transfection efficiency by the manufacturer, so this reagent was also tested in DU145, using 1 and 2pg of promoter DNA. 4X10^ cells were plated in 6 well plates and cells transfected using Lipofectamine-PLUS (LM) exactly as described below for PC3 cells in 10cm dishes. However the transfection efficiency was still quite low (Table 2.8).

80 Amount of Luciferase p-gal Amount of Luciferase P-gal plasmid plasmid pCMVLuc pGL5odRI0.6 1 ng 164 16.1 1 ng 0.6 24.4 2 n g 118.0 13.3 2 n g 0.4 23.1

Table 2.8: Lipofectamine PLUS mediated transfection of DU145 in 6 well plates.

Large scale calcium phosphate mediated transfection Finally the calcium phosphate method was tested again using more cells and a different transfection buffer. Briefly, cells were plated on 10cm petri dishes the day before transfection. The following day, for each dish, 1ml of transfection mix containing 50|il

(2.5M) CaCl2„ 15pg of promoter construct, 2pg of the control p-Gal plasmid pCMVP-Gal and 500|il of 2XBES buffer (50mM BES, 280mM NaCl, 1.5mM Na 2HP0 4 ) or 2X HBS

(280mM NaCl, lOmM KCl, 1.5mM Na 2HP0 4 , 12mM Dextrose, 50mM HEPES) buffer added dropwise whilst being vortexed was prepared. The DNA mixture was incubated at RT for 20 minutes. The medium was removed from the cells and replaced with 10ml of fresh DMEM medium followed by 1ml of the transfection mix, and gently moved from side to side to mix the solution with the medium and incubated overnight (-15 hours) at 37°C. The following morning the medium containing the transfection mix was removed and replaced with 10ml of fresh DMEM and left to incubate at 37°C overnight to express the transfected DNA. The following day the cells were washed twice with 10ml of PBS, trypsinised and resuspended in 10ml of RPMI in sterile universal tubes. The tubes were centrifuged at 1000 rpm for 5 minutes to pellet the cells and lysed with only lOOpl of lysis buffer and 40|xl was assayed for luciferase and p-Galactosidase. The results (Table 2.9) indicated that scaling up the transfection to 10 cm dishes and using HBS buffer did improve the transfection efficiency but still not to the same extent as for the CNS derived cell lines.

pCMVLuc Luciferase readings / Buffer pGL5oRI0.6 Luciferase readings / Buffer Cell number HBS BES HBSBES 0.5X106 0.1 142.8 0.5X106 0.4 0.1 1X106 338 134.6 1X106 1 0.8 1.5X106 451 108.9 1.5X106 1.4 0.9

Table 2.9: Effect of large scale calcium phosphate mediated transfection in DU145.

81 The 5a-reductase I and II promoter constructs were finally transfected in 2.5X10 cells in HBS buffer in duplicate using the conditions described above. Experiments were repeated at least three times with duplicate wells for each construct in an assay.

2.5bü PC3 Calcium phosphate mediated transfection Using the conditions described for the CNS derived cell lines, the effect of cell number and DNA concentration on the transfection efficiency was tested in PC3. The results (Table 2.10) indicated that this method was not suitable for transfecting PC3 cells.

Cell Number/Amount of DNA (jig) Luciferase readings PC3 2X10^ cells, 2.5ng of DNA PGL2Basic 0,0 PCMVLuc 22.7, 32.6 3X10^ cells, 5|X g of DNA PGL2Basic 0,0 PCMVLuc 43.5,54.1 4X10^ cells, 5|Lig of DNA PGL2Basic 0,0 PCMVLuc 72.1,70.4 Table 2.10: Effect of cell number and DNA concentration on calcium phosphate mediated transfection of PC3.

Lipofection Since Lipofectamine has been used previously to transfect PC3 cells, this reagent was tested in PC3 cells to determine if the transfection efficiency improved. Using 4X10^ PC3 cells in 6 well plates the second and the third dilution of Lipofectamine was tested for its ability to transfect the promoter constructs as described for DU 145 cells. The luciferase readings (Table 2.11) obtained for the positive control plasmids were the highest obtained so far.

2"** dilution 3"^^ dilution Plasmid PC3 Luciferase P-gal Luciferase 3-gal PCMVLuC 1130 106.1 344,432.9 23.5 pGL5aRI0.6 17 752.5 6.9 137.4

Table 2.11: Lipofectamine mediated transfection of PC3.

Lipofectamine PLUS was claimed to give even higher transfection efficiency by the 82 manufacturer, so this reagent was also tested in PC3, using more cells and different amounts of promoter DNA. Briefly 1.5X10^ PC3 cells were plated in 10cm tissue culture dishes as described before. The following day for each dish to be transfected, lp.g of promoter DNA and Ipg of pCMp-Gal plasmid was mixed with 9|il of PLUS reagent, made up to 100|xl using GIBCO transfection medium Optimem and incubated at RT for 15 minutes for the DNA to form complex with the PLUS reagent. Then for each well, 9|i,l of

Lipofectamine was diluted with 9Ipl of Optimem and mixed with lOOpl of the diluted DNA-PLUS solution in labelled eppendorf tubes at RT for 15 minutes for DNA to form complexes with the lipofectamine. Before transfection the cells were washed once with 2ml of serum free Optimem medium and replaced with 1.8ml of fresh Optimem to which 200pl of the DNA-PLUS-Lipofectamine solution was added. The plates were gently rocked to mix the reagent with the medium and cells incubated at 37°C for 4 hours. 2ml of RPMI supplemented with 10% PCS was added to each well and incubated overnight at 37°C. The following day the medium was changed with 3ml fresh RPMI and incubated for a further 24 hours. The following day the cells were washed, lysed with 1ml of lysis buffer and 20pl assayed for luciferase and P-galactosidase as described for the CNS derived cell lines. The results obtained (Table 2.12) indicated that the highest transfection efficiency was obtained with 1 pg of promoter plasmid.

Amount of PC3 Amount of PC3 plasmid plasmid pCMVLuC Luciferase P- pGL5cxRI0. Luciferase P-galactosidase galactosidase 6 8139 896.5 ijig 115.9 4354 2 p g 5584 368.9 2Hg 119.9 3226 3 p g 4980 211.4 3 u g 97.8 2295 4 p g 4935 145.1 4 n g 97.9 1813

Table 2.12: Lipofectamine PLUS mediated transfection of PC3.

Subsequently, all the 5a-reductase I promoter constructs were transfected in PC3 in duplicate exactly as described above except 1.75pg of promoter DNA and 0.25pg of pCMVp-Gal plasmid was used for each dish (this increased the amount of promoter DNA without altering the overall DNA concentration used. Experiments were repeated at least

83 three times with duplicate wells for each construct in an assay.

2.5biii LNCaP Calcium phosphate mediated transfection Using 4X10^ cells in 6 well plates and 5|lg of promoter plasmid as with the other prostate cell lines LNCaP cells were transfected. But the luciferase reading obtained for the positive control plasmid were too low (results not shown).

Electroporation Electroporation has been used previously to transfect LNCaP cells by our collaborator (Prof. Buettner, University of Regensburg, personal communication). Using electroporation conditions suggested by him, 10X10^ cells were transfected with 20|ig of plasmid, 500pF, 250mV in 2XBES buffer as described for DU 145 above. The luciferase activity was almost undetectable in the transfected cells (results not shown). To optimise the elctroporation conditions, a range of resistance and voltages were tested in 10X10^ cells transfected with 10|Xg of promoter DNA in RPMI culture medium. The results are shown in Table 2.13.

Plasmid Luciferase readings pCMVLuC 500pF 960pF 200V 44.4 134.7 250V 146.6 559.4 300V 520.1 836.3 350V 693.8 792.2 400V 889.7 1003 450V 770.1 609.1 PGL5(XRI0.6 200V 0 0 250V 0.1 0.3 300V 0.2 0.4 350V 0.2 0.5 400V 0.6 0.1 450V 0.6 0.2

Table 2.13: Effect of capacitance and voltage on electroporation efficiency in LNCaP.

The cell suspension became very viscous after being electroporated at the highest resistance and voltage 960|iF and 450V; however the luciferase reading for 5a-Reductase I construct

84 was too low.

Lipofection The Gibco lipofection reagents tested previously for the other cell lines were also tested in a 24 well format as described before. The luciferase readings for the first dilution for pGL5(xRI0.6 were zero (results not shown). Since Lipofectin and DMRIE produced the highest luciferase readings for the positive control plasmid pCMVLuC, these two reagents were used to transfect 3X10^ cells with Ijig of plasmid and two different DNA:reagent ratio in a 6 well format. The results (Table 2.14) indicated that the luciferase readings obtained were still too low for the 5a-reductase I promoter construct.

DMRIE Lipoi'ectin Reagent 18|il 24nl Reagent 18pl 24til PCMVLuc 349.1 546.8 pGL5aRI0. 0.2 0.3 6 pGL5aRI0.6 0.3 0.3

Table 2.14: Lipofectin and DMRIE mediated lipofection of LNCaP. Due to time constraint other transfection methods could not be tested in LNCaP cells and the 5a-reductase I promoter constructs were tested in DU145 and PCS only.

2.5c Assay of luciferase and p-galactosidase activity in transfected cell lysates After transfection, cells were lysed with the lysis buffer from the p-Galactosidase kit and an aliquot tested for both luciferase and p-Galactosidase as described below.

Luciferase assay

Since the 5a-reductase promoter fragments were cloned upstream of the luciferase gene of the pGL2Basic reporter plasmid, the activity of these promoter fragments could be measured by assaying for the luciferase activity in the cell lysates. The Luciferase assay system (Promega) used contains luciferin which, when oxidised by luciferase, produces a photon that can be measured in a luminometer, thus indicating luciferase activity and therefore promoter activity. Luciferase assay reagent (LAR) was stored at -20°C in the dark and before each assay it was thawed at RT. lOOfil aliquot of the LAR was then placed in luminometer tubes, l-40|il of the cell lysate added and mixed. The tubes were then placed

85 in cuvette holder of the luminometer (LKB Wallac 1250 Luminometer) and the reading taken immediately.

P-galactosidase assay The Galacto-Star (Tropix Inc.) assay kit used is a chemiluminescent reporter assay system for the detection of p-galactosidase reporter enzyme in cell lysates. It contains the chemiluminescent substrate of P-galactosidase, Galacto-Star along with a lunimescence enhancer. Therefore the activity of the transfected P-galactosidase reporter plasmid pCMVp-Gal can be measured in a luminometer. Before each assay was carried out, the

Galacto-Star substrate was freshly diluted 1:100 with RT reaction buffer diluent. 280|il of the diluted substrate was then aliquoted into luminometer tubes, l-40|xl of cell lysate added as required and vortexed to mix. The extracts were incubated at RT for 1 hour to enable maximum light emission to be reached. The tubes were then placed in the luminometer and the reading taken immediately.

2.5d Normalisation of luciferase against p-galactosidase readings To correct for differences in luciferase readings due to differences in transfection efficiency, the p-galactosidase plasmid was also co-transfected and it’s activity measured. The luciferase readings for a given sample were normalised against the p-galactosidase readings using the formula below.

Corrected luciferase reading for a particular construct in an assay = Luciferase reading for the construct X (Maximum P galactosidase reading for the assay / P-galactosidase reading for the construct).

The luciferase readings were corrected for all the assays and the results expressed as a percentage of the positive control plasmid pCMVLuC. An example of normalisation of luciferase against P-galactosidase readings for an assay in LAN-1 is shown in Table 2.15.

86 Plasmid Mean luciferase Mean p- Corrected Luciferase reading reading galctosidase luciferase as % of reading reading pCMVLuC pGL2Basic 0.7 1394 3 0.018 pCMVLuC 5111 1942 16491 100 pGL5oRI4.4 88.7 1656 336 2.04 pGL5otRI1.7 54.8 1220 281 1.7 pGL5(xRI0.6 749 6266 749 4.54 pGL5ocRI0.5 113 1332 532 3.23 2 pGL5aRI0.3 167 1969 531 3.22 pGL5(xRI0.15 7.8 1694 29 0.176

Table 2.15: Normalisation of luciferase against p-galactosidase readings. Mean luciferase/p-galactosidase readings: Mean of the duplicate wells assayed for each plasmid. Corrected luciferase reading: For example for pGL5(xRJ4.4, the corrected luciferase reading is [the maximum P-galactosidase reading for the assay (6266) / reading for this plasmid (1656)] X the luciferase reading (88.7) = 336. % of pCMVLuC: The corrected luciferase reading for each plasmid was expressed as a % of the luciferase reading for the positive control plasmid pCMVLuC. For example for pGL5oRI4.4, (336/16491) XlOO = 2.04%; i.e. this promoter plasmid shows only 2% of the promoter activity of pCMVLuC.

87 2.6 CHARACTERISATION OF 5a-REDUCTASE PROMOTERS 2.6a Primer extension analysis of 5a-reductase I gene To identify the transcription start site of the 5a-reductase I gene, primer extension analysis was carried out.

Total RNA Extraction Total RNA was extracted from cells using Bio/RNA-XCell, a single step extraction procedure using guanidine salts and urea based on the method of Chomczynski (Chomczynski et al, 1987), used according to the manufacturer’s instructions. Briefly, semi confluent PC3 and DU145 cells grown in T80 flasks were washed with 10ml of sterile PBS for 5 minutes. The Bio/RNA-XCell solution was incubated at 37°C in a water bath for 20 minutes and mixed thoroughly to give a homogenous solution. To each flask, 2ml of this solution were added with a sterile, plastic pipette and the flask swirled to ensure all the cells were covered and lysed. After one minute incubation at room temperature the lysate was passed several times through a pipette, collected in a sterile polypropylene tube on ice and incubated for 5 minutes to allow complete dissociation of nucleoprotein complexes. To each tube, 0.2ml of chloroform was added per ml of Bio/RNA-XCell, samples covered and shaken vigorously for 15 seconds to mix the two phases and incubated on ice for a further 5 minutes. The homogenate was centrifuged at 12,000g at 4°C for 15 minutes. After the centrifugation, the upper aqueous phase containing the RNA was carefully removed with a sterile pipette and transferred to a sterile tube. The RNA was precipitated overnight with 2 volumes of isopropanol at -70°C overnight. The following day the RNA was pelleted by centrifuging at 12,000g for 15 minutes. The supernatant was discarded carefully and the pellet air dried for a few minutes in a sterile flow cabinet. The pellet was resuspended in 0.2ml of DEPC water (0.1% DEPC in sterile distilled water, incubated overnight and autoclaved) and transferred to a sterile eppendorf tube and stored at -70°C. An aliquot was diluted and OD determined in a spectrophotometer at 260nm and 280nm. RNA samples with a A260/A280 ratio of 1.8-2.0 were used for subsequent procedures.

Fluorescent Primer Extension Assay The primer extension assay was carried out according to a protocol from Prof Buettner

(University of Regensburg). 10|Xg of total RNA was precipitated with 2 volume of isopropanol at -80°C overnight. The following day the RNA was pelleted by 88 centrifuging at 13000 rpm in a microfuge at 4°C for 15 minutes. The supernatant was carefully discarded and the pellet air dried in a sterile flow cabinet. To the pellet 3|il of lOpM HEX-labelled primer for 5a-reductase I was added, followed by 30|il of DEPC water. The RNA was denatured for 5 minutes at 98°C and placed on ice for 5 minutes. The tube was centrifuged for 5 seconds to collect all the RNA and the primer allowed to anneal at 60°C for 1 hour. After the incubation period the following reverse transcription reagents

(Roche) were added. To the annealed RNA, lOfxl of 5X reverse transcriptase (RT) buffer,

2.5|xl of lOmM dNTP, 2.0 fil of 40U/|xl RN’ase-Inhibitor, 2.5pl of M-MuLV-RT was added and extension carried out at 37°C for 2 hours. The sample was then incubated at

70°C for 10 minutes to inactivate the RN’ase-Inhibitor, placed on ice for 5 minutes and centrifuged for a few seconds. 2\i\ of 2mg/ml RN'ase A was added and incubated at 37°C for 1 hour to degrade the RNA. The RN’ase was then denatured as above for the RN’ase- inhibitor. The reverse transcribed product was purified for sequencing with PEG 8000. Briefly, to the product 50|xl of water and 100|il of freshly prepared PEG 8000 mix (52.4g PEG 8000, 40ml of 3M CHgCOONa pH 5.2, 1.32ml IM MgCl]) was added and vortexed to mix and incubated at RT for 20 minutes. The sample was centrifuged at 13000 rpm for 30 minutes and the supernatant containing unincorporated label, dNTP was removed carefully and the pellet washed with 500|il of 100% ethanol. The sample was centrifuged at 13000 rpm for 10 minutes and supernatant carefully removed with a pipette. The pellet was air dried for 5 minutes and dissolved in 20|il of sterile water. The products were separated by electrophoresis and sequenced by S Seegers in Regensburg.

2.6b Analysis of 5a-reductase promoter regions for putative transcription factor binding sites In order to identify whether there are any putative transcription factor (TF) binding sites present on the critical promoter regions of the 5a-reductase I and II genes, the sequences upstream of the ATG were analysed using the Matlnspector (http://transfac.gbf- braunschweig.de) programme (Quandt et al, 1995) and Signal Scan (http://bimas.cit.nih.gov/molbio/signal) utilising the Transfac database available on the world wide web.

89 2.6c Identification of transcription factors involved in Sa-reductase I promoter activity To determine whether AP2 and SPl is involved in the regulation of the 5a-reductase promoter, pGL5txRI0.59 was co-transfected with either or both AP2 and SPl expression vectors in LAN-1 and DU 145 cell lines. LAN-1 cells were transfected and assayed as described in section 2.5a except 1 pg of pGL5otRI0.59 was co-transfected with 0.25pg of pCMVp- Gal and AP2, SPl or a non-specific plasmid (pBluescript) in different ratios. For example, for a ratio of 10:1 of pGL5cxRI0.59 and the transcription factor (TF) expression vectors, 0.1 pg of the latter plasmids were added to Ipg of the former. DU 145 cells were transfected exactly as described in section 2.5bi except the TF expression vectors were added in the different ratios described in section 4.3.3.

2.7 5a-REDUCTASE mRNA EXPRESSION IN PROSTATIC TISSUE AND CELL LINES 2.7a Extraction of total RNA from cultured cells and tissue Total RNA was extracted from cell lines as described for the primer extension analysis. RNA was extracted from prostatic tissue as follows. Frozen or freshly obtained TURP chips were weighed and placed in sterile polypropylene tubes and 1ml of Bio/RNA-XCell per lOOmg of tissue added and homogenised immediately using a hand held polytron homogeniser while keeping the tube on ice. Once the tissue had been homogenised the tube was incubated on ice for 5 minutes. Then 0.2ml of chloroform per ml of Bio/RNA-XCell was added, vortexed and incubated on ice. After centrifuging at 12,000g at 4°C for 15 minutes the upper aqueous layer containing the RNA was carefully removed without disturbing the interphase containing the tissue debris. The RNA was precipitated and processed as described above for the cultured cells.

2.7 b Reverse Transcription -PCR (RT-PCR) of prostatic mRNA Reverse transcription of mRNA to cDNA To determine whether the 5a-reductase isozymes are expressed in the tissue and cell lines tested, the mRNA was reverse transcribed to cDNA for use in PCR. Routine RT of total RNA was carried out using the Superscript II reverse transcriptase (Gibco) used according to the manufacturers instructions. Briefly, first strand cDNA synthesis was carried out in a

90 20jil reaction volume containing l-5|Xg of total RNA. To a sterile, RN’ase free eppendorf tube l|il of 500|Xg/ml of Oligo (dT)i 2-i8 primer was added to 5jig of total RNA and made up to \2\i\ with water. The mixture was heated to 70°C for 10 minutes to denature and chilled on ice. The contents of the tube were collected by centrifuging for 5 seconds and 4pl of 5X first strand buffer, 2fxl O.IM DTT, l|Lil lOmM dNTP mix (lOmM each of dATP, dGTP, dCTP, dTTP at neutral pH) added. The contents of the tube were mixed by gently tapping the tube and incubated at 42°C for 2 minutes. l|xl (200U) of Superscript II reverse transcriptase was added and mixed by pipetting up and down. The tube was incubated at 42°C for 50 minutes for cDNA synthesis to occur. The enzyme was inactivated by heating at 70°C for 15 minutes and kept on ice. The cDNA was then used for PCR as described below.

PCR amplification of 5a-reductase and P-Actin RT-cDNA

To determine whether the cell lines and the BPH tissue expressed 5a-reductase isozymes, PCR of the RT-cDNA was carried out as described below.

5a-reductase I Two PCR primers spanning introns 2 and 3 of the 5a-reductase I gene were synthesised. A lOOjil PCR reaction mixture contained 2|xl of RT-cDNA, 10|il of lOX PCR buffer (200mM

Tris-HCl pH 8.4, 500mM KCl), ImM MgCb, 25|iM dNTP mix, 500ng of each primer and lU of Tag ON A polymerase. PCR was carried out after a hot start of 96°C for 3 minutes; dénaturation at 96°C for 1 minute 30 seconds, annealing at 52°C for 1 minute, polymerisation at 72°C for 1 minute 30 seconds for 35 cycles, followed by a final extension step at 72°C for 10 minutes. A product of 170bp was expected.

5 a-reductase II

Two PCR primers spanning intron 1 of the 5a-reductase II gene were synthesised. lOOfxl

PCR reaction mix was prepared with the 5a-reductase II specific primers. PCR was carried out after a hot start of 96°C for 3 minutes; dénaturation at 96°C for 1 minute 30 seconds,

annealing at 56°C for 1 minute, polymerisation at 72°C for 1 minute 30 seconds for 35

cycles, followed by a final extension step at 72°C for 10 minutes. A product of 350bp was expected. 91 P-Actin A 266bp p-actin cDNA fragment was PCR amplified to act as a positive control for the RT-PCR process and ensure equal loading. Two PCR primers spanning bases 606 to 871 were designed as described before. 100|il PCR reaction mix was prepared with the p-actin specific primers. PCR was carried out after a hot start of 96°C for 5 minutes; dénaturation at 96°C for 1 minute 30 seconds, annealing at 59°C for 1 minute, polymerisation at 72°C for 1 minute 30 seconds for 30 cycles, followed by a final extension step at 72°C for 10 minutes.

20)li1 of PCR products were electrophoresed on a 2% agarose gel to check the presence of the three transcripts in the RNA of the cell lines and BPH tissue.

2.8 STABLE TRANSFECTION OF Sa-REDUCTASE II GENE IN DUSF AND COS-I CELL LINES

2.8a Transfection of 5a-reductase II expression vector in DUSF and COS-I cell lines To produce a 5a-reductase II expressing prostate cell line, DUSF cells were stably transfected with a 5a-reductase II expression vector S303, obtained from Prof. DW Russell. The COS-I cell line was also transfected. Since this vector only contained an ampicillin resistance gene, to select for mammalian cells it was co-transfected with pCDNA3.1 containing the geneticin resistance gene. Maxiprep DNA of both plasmids were checked by digesting with restriction enzymes. PCR amplification of S303 DNA was also carried out using the two 5a-reductase II RT-PCR primers described in the previous section. A 350bp product confirmed the presence of part of the 5a-reductase II gene.

Semi-confluent cells in T25 flasks were each co-transfected with 10 times excess of S303 as compared to pCDNA3.1 plasmid to make it more likely that any geneticin (G418) resistant clones also contained the 5a-reductase II gene. For each flask 1ml of transfection mix containing 125mM CaClz, 20pg of S303, 2|ig of pCDNA3.1 and 500|xl 2XHBS buffer added dropwise to the DNA whilst being vortexed was prepared and incubated at RT for 20 minutes. The medium was removed from the DUSF cells and replaced with 4ml of

92 Optimem supplemented with 10% charcoal stripped serum for the transfection. COS-I cells were media changed with DMEM medium. To each flask 1ml of transfection mix was added, mixed and incubated at 37°C overnight. Control flasks were also transfected with either 2pg pCDNA3.1 or without DNA. The following day the medium containing the transfection reagents was removed and replaced with Optimem and DMEM respectively for DUSF and COS-I cells and incubated for a further day. The following day the medium was replaced as before except with 1 mg/ml and 0.5mg/ml G418 for DUSF and COS-I cells respectively.

2.8b Maintenance, selection and serial expansion of G418 resistant clones DUSF Transfected cells were routinely maintained in medium containing G418 as described above. G418 treated, mock transfected DUSF cells started to die at around 5 days after transfection; with most cells dead after 9 days. However for the transfected cells the flasks were about 50% confluent even 20 days after transfection. Although most cells were dead at around 25 days after transfection they did not form isolated colonies. So the cells were subcultured and plated in very low densities (100-500 cell) in 10cm dishes in only Optimem to allow the cells to recover from the subculturing. The cells were transferred to medium containing G418 the following day. At around 35 days after transfection cells plated in 10cm dishes formed diffuse colonies of only 4-12 cells. After around 50 days these colonies were large enough to ring clone in to 6 well plates. Briefly, cells were washed once with PBS for 5 minutes and 1ml of Versene was added to the plates. Sterile cloning rings were placed around the selected clones and incubated at 37°C for 5 minutes. 200pl of Optimem supplemented with G418 was added to the wells and the cells dislodged by pipetting up and down. The 200|Xl medium containing the cells were placed in a well of a 6 well dish in 2ml of medium. Some ring cloned colonies were subcultured from the 6 well dishes to T25 flasks at around 70 days after transfection. Once these flasks were confluent they were subcultured again and grown to confluence.

COS-I G418 treated, mock transfected COS-I cells started to die at around 5 days after transfection; with most cells dead after 7 days. However, for the transfected cells resistant colonies started to emerge around 10 days after transfection. After around 15 days these 93 colonies were large enough to ring clone and transfer to 6 well plates. Briefly, cells were washed once with PBS for 5 minutes. The top of the flask was cut out using a hot scalpel blade in a flow cabinet. Sterile cloning rings were placed around the selected clones and incubated for 5 minutes. Trypsin was added to the wells and the cells dislodged by pipetting up and down. The cell suspensions was placed in a well of a 6 well dish in 2ml of medium. COS-I clones had a much faster growth rate than the DUSF cells and some ring cloned colonies were subcultured from the 6 well dishes to T25 flasks at around 30 days after transfection. Once these flasks were confluent they were subcultured again and grown to confluence. RNA was extracted from some clones at round 45 days after transfection.

2.8c Testing G418 resistant clones for Sa-reductase II expression Once the clones were grown up in T80 flasks, one was used for RNA extraction to detect the expression of 5a-reductase H (described below) while the others were maintained in 0418. Semi confluent cells in a T80 flask were washed once with PBS and RNA extracted with 2ml of Bio/RNA-XCell. The RNA was resuspended in 200)li1 of DEPC water containing lU/pl RN’ase inhibitor and kept at -70°C. The presence of the 5a-reductase II gene in the selected clones was checked by using 5|Xg of the RNA for PCR of 5a-reductase n using the two RT-PCR primers described in the previous section. If a clone contained the expected 350bp PCR product, then it was frozen down. A near confluent T 80 flask for each overexpressing clone was trypsinised, resuspended in RPMI with 10% PCS and centrifuged at 1000 rpm for 5 minutes to pellet the cells. The pellet was resuspended in 8ml of freezing medium (20% PCS, 70% RPMI medium, 10% DMSO) and aliquoted into labelled 1ml cryotubes and frozen in liquid nitrogen using standard procedures.

Characterisation of selected clones

Once the clones had been tested for 5a-reductase II expression, two overexpressing DUSP clones (clones 9 and 12), a pCDNA3.1 vector only clone (clone 11) and a overexpressing COS-I clone (clone 5) and a vector only clone (clone 3) were chosen for further characterisation. To determine whether the clones that overexpress the 5a-reductase II mRNA contains functional 5a-reductase II and therefore converts more testosterone (T) to dihydrotestosterone (DHT), a crude assay of 5a-reductase activity was performed.

94 2.8d Assay of 5a-reductase activity 5a-reductase activity was assayed using a protocol based on one described by Dr F Habib (University of Edinburgh, personal communication).

Metabolism of^H-testosterone Briefly, semi-confluent cells growing in T80 flasks were washed once with PBS for 5 minutes and replaced with 1ml of serum-free Optimem or RPMI medium containing ~l|iCi of ^H-testosterone (1,2,6,7- ^H-testosterone) and made up to 20nM with cold T. A 2|il aliquot of this medium was taken and counted in a liquid scintillation counter to determine the amount of radioactivity added to each flask. The cells were incubated at 37°C for 1 hour whilst being gently rocked from side to side. Previous work in this laboratory has shown that T metabolism is linear during the first hour in BPH cell suspensions (Smith, thesis 1993). After this incubation period the medium was removed using Pasteur pipettes and placed in a sterile glass tube. To stop the reaction an equal volume of ethyl acetate containing ~500cpm of *"^C-DHT and ~25|ig of each trace steroid (T, DHT, Androstenedione, 3a and 3|3-androstanediols) was added, the tubes capped and vortexed to mix. The samples were centrifuged at KXX) rpm for 10 minutes and the top organic layer containing the steroids was removed and placed in a sterile glass tube. The medium was extracted again with an equal volume of ethyl acetate and the top organic layer pooled with the first extract. The steroid extracts were evaporated to dryness under nitrogen gas and resuspended in 50|il of ethanol.

Separation and analysis of metabolites The steroid metabolites were applied to a TLC plate using micropipettes, air dried, and separated in a TLC tank containing a solvent system of dichloromethane/ethylacetate (9:1 vol/vol) for 50 minutes. 25|Xg of cold steroid standards were also applied and separated to identify the radioactive metabolites. The plates were air dried and sprayed with phosphomolybdic acid reagent spray (10% in methanol) to visualise the spots. The plates were air dried for 5 minutes and baked at 90°C for 2 minutes until the steroids appeared as blue spots. The radioactive metabolites were identified by comparing their TLC mobilities with the cold standards and were cut from the TLC plates. The TLC strips were placed in labelled scintillation vials containing 3.5ml of Optima gold scintillation fluid and the

95 metabolites were quantified using a Tri-Carb liquid scintillation counter. Due to time constraints, the conditions for dual scintillation counting (^H and could not be optimised, so ^^C-DHT was not added to extraction mixes subsequently. Also, since the solvent system used did not resolve the T from the androstanediols completely, these two steroids were not quantified.

Aliquots taken at different steps of the experiment revealed that most of the ^H-T was lost in the experimental procedure and total recovery was poor. However for each experiment the recovery from the T, DHT and Androstenedione strips were calculated as a percentage of the total count added to the cell initially (from the aliquot taken at the beginning).

96 CHAPTER 3

CULTURE OF CELLS FROM PROSTATE CANCERS

97 3.1 BACKGROUND Human prostate tissue and primary cultures derived from benign prostatic hyperplasia (BPH) express 5a-reductase II (Habib et al, 1998). BPH tissue and COS cells expressing 5 a-reductase II have similar pH profiles of testosterone metabolism and similar sensitivities to inhibitors of 5a-reductase (Smith et al, 1996). In contrast, the biochemical characteristics of reductase activity in prostate cancer cell lines were similar to those of COS cells expressing 5a-reductase I (Smith et al, 1996) and no cell lines have been described which express the 5a-reductase II enzyme (see section 1.6). The expression of 5a-reductase falls rapidly in primary cultures of prostate epithelial cells over a 10-day culture period (Smith, thesis 1993). These findings indicate that 5a-reductase H activity tends to be lost in culture. Therefore, prostate cell lines and primary cultures are not representative models of the prostate.

In order to study the transcriptional activity of the promoter constructs for the 5a-reductase n gene in the prostate (described in the following chapter), a prostate cell line that expresses the enzyme and its associated transcriptional machinery was needed. Also, availability of cell lines that express prostate specific characteristics such as 5a-reductase II would be helpful in prostatic research. Although primary cultures initially do express Sa- reductase n, variation in the genetic background between cultures and the lack of available tissue for producing primary cultures mean that immortalised cell lines represent a more reliable option. Particularly, conditionally immortalised cell lines that could be induced to express differentiated characteristics when needed would represent a better model of the prostate. 3.2 AIM The aim of this chapter was to use a temperature sensitive SV40 T antigen construct to produce conditionally immortalised primary and metastatic prostate cancer cell lines. The rationale for using this strategy was that cell lines obtained using such a construct should proliferate at the permissive temperature (33°C) driven by T antigen. When shifted to the non-permissive temperature (39°C), the absence of T antigen should stop proliferation and allow the cells to enter the differentiation pathway. These cells are more likely to express differentiated characteristics (see section 1.6) of prostate cells e.g. 5a-reductase H, lacking in most available cell lines.

98 In this study, two approaches were taken in producing prostate cell cultures for immortalisation.

Prostate Cancer Ceil Lines

Primary cancer cell» Metastatic cancer cells I I rU R P chips Bone marrow aspirates

Initially, primary prostate cancers obtained from transurethral resection of the prostate (TURP) were used to produce prostate epithelial and stromal cell cultures. Having epithelial and stromal cell lines from the same tissue will allow the study of eell-eell interaction, thought to be very important in the prostate, to be carried out within the same genetic background. Organ confined cancers are likely to have different genetic characteristics from more advanced cancers. Therefore, primary prostate cancer cell lines that express the associated characteristics would be an useful tool for prostatic research. Secondly, bone marrow aspirates from patients with metastatic disease were obtained with a view to culturing metastatic prostate cancer cells. Although the commonly used metastatic prostate cancer cell lines PC3, DU 145, LNCaP were immortalised spontaneously, it is nevertheless a rare event (Peehl, 1992). Therefore immortalising cultures with SV40 T antigen is more likely to produce continuous cell lines. Bone is the most common site of prostate cancer metastasis, occurring in over 85% of patients who die of the disease ( Jacobs, 1983). It has been reported that metastatic prostate cancer cells present in the bone marrow of patients with cancer can be cultured and immortalised to produce cell lines (Pantel et al, 1995, Putz et al, 1999). Availability of metastatic cell lines conditionally immortalised using temperature sensitive SV40 T antigen may also enable us to study the changes that occur during progression of prostate cancer.

99 3.3 CULTURE OF CELLS DERIVED FROM PRIMARY PROSTATE CANCERS

3.3.1 Experimental plan • Produce primary culture of prostate epithelial cells from TURP specimens.

• Produce corresponding primary cultures of prostate stromal cells. • Transduce the cultures using a retrovirally packaged temperature sensitive SV40 antigen construct, PA/tsA58-U19/8 containing the tsA58 and U19 mutations (Jat and Sharp, 1989). • Select and expand surviving clones.

3.3.2 Results Tissue was obtained by transurethral resection from 14 men who, based on digital rectal examination and PSA levels, were suspected of having prostate cancer.

Culture of epithelial cells After collagenase digestion, epithelial organoids were separated using density sedimentation and resuspended in WAJC 404 medium. The organoids attached to the surface of the flask and within 2-5 days epithelial cells grew in a halo. Epithelial cultures had a ‘cobblestone’ morphology and the cells were polygonal in shape. Of 14 samples tested, 11 gave rise to epithelial outgrowths (Table 3.1) with varying number of foci (2-15 per T25 flask).

After 1-2 weeks in culture the cells were larger, more flattened and appeared vacuolated and granular. After 2-3 weeks, they stopped dividing but remained attached to the flask. With successive changes of medium, the organoids followed by the cells slowly detached from the flask. Fibroblast contamination was rarely seen in the serum-free medium.

100 Sample Growth of Epithelial cells Growth of stromal cells

+ +

E/F 10 11 E/F 12 E/F 13 + 14 0 0

Table 3.1: Primary culture of epithelial and stromal cells from the prostate.

Summary of results following primary culture of epithelial and stromal cells from biopsies of primary prostate cancer.

+ = Growth of cells, 0 = no growth

C = lost to contamination, E/F = mixed culture of epithelial and stromal cells.

Epithelial cells did not reattach well after trypsinisation. Most of the cells remained rounded and failed to reattach to the flask even after a week in some cases. The difficulty in subculturing primary prostate epithelial cultures was recognised early on (Stoneet al, 1976,

Lechner et al, 1978). Harper reported that only 4% of cultures survived two further subcultures (Harper, 1991) while Peehl et al reported low colony forming efficiency of secondary (-25%) and tertiary cultures (-8%) (Peehl et al, 1988). The plating efficiency in this study was improved when^n-enzymatic dissociation solution was used. Of 4 epithelial cultures subcultured with trypsin, epithelial cells reattached and grew in only 1 sample. Of

3 epithelial cultures subcultured with a non-enzymatic dissociation solution some

reattachment and growth of cells were seen in all cultures. The use of non-enzymatic dissociation solutions and other enzymatic solutions have also been reported in the

literature in order to improve plating the efficiency of subcultured cells with varying levels

of success (Lechner et al, 1978, Harper, 1991, Szucs et al, 1994, Tsugaya et al, 1996).

Absence of serum in WAJC 404 could mean that any residual trypsin could not be

101 inactivated, rendering the cells more susceptible to the actions of trypsin. Washing the cells in a serum containing medium prior to replating in WAJC 404 or including a trypsin inhibitor may improve the plating efficiency of subcultured cells as has been reported (Harper, 1991, Peehl, 1992, Szucs et al, 1994). Also, the poor plating efficiency of the dispersed cells from the organoids could be due to the lack of a support matrix like collagen. Plating cells on Matrigel or collagen coated flasks may improve attachment (Harper, 1991, Peehl, 1992, Hudson et al, 2000). Another possible reason for the lack of attachment of trypsinised cells could be the low plating density. Plating cells in smaller dishes may also improve plating efficiency (Chaproniere and McKeehan, 1986). Finally, the poor plating efficiency of subcultured cells may be due to the lack of proliferative cells in the primary culture. In primary culture of prostate epithelial cells, the majority of the colonies formed are of a differentiated transit-amplifying population (Hudson et al, 20(X)) that are less likely to keep dividing after subculture.

Culture of stromal cells For stromal cell culture, the supernatant was collected following density sedimentation and plated in RPMI 1640 supplemented with 10% foetal bovine serum. There was a lag period of between 5 and 14 days before stromal cell growth was seen. After this initial lag period, the rate of growth was faster than that of epithelial cells. The prostate fibroblasts were long, thin, spindle-shaped and grew in whorls. The success rate of culturing stromal cells was low (Table 3.1). Of 14 samples, only 6 produced stromal cultures. Stromal cells could be subcultured with trypsin and one culture was maintained for over three months.

Transduction of cultures with SV40 T antigen construct Epithelial foci showing signs of cell division (presence of attached rounded cells, see Figure 2) were transduced with PA/tsA58-U19/8 by Dr O'Hare (within 2-14 days after plating). Eight cultures were transduced and some cells survived G418 selection for about 2-3 weeks. However, the cells were vacuolated and did not survive in either WAJC 404 alone or with serum. By the fifth week after transduction, the cells stopped proliferating and were discarded.

Of 7 stromal cultures established, 5 were transduced with PA/tsA58-U19/8. But none survived G418 selection.

102 Culture of prostate cancer cell lines in serum free media Since WAJC 404 did not support the long term growth of the prostate epithelial cells, to determine whether other serum free media available in the lab (MEGM, KGM) can better support the growth of prostate cells, established prostate cancer cell lines (PC3, LNCaP, DU 145) were seeded in MEGM and KGM and the effect on colony forming efficiency measured. LNCaP did not form colonies in any of the serum-free media tested. PC3 formed colonies in the mammary epithelial growth medium (MEGM) but the colony forming efficiency was very low (Table3.2). DU 145 had a low colony forming efficiency in MEGM (Table 3.2). Inclusion of 1% serum to WAJC 404 enabled DU 145 to grow in the medium while WAJC 404 alone did not support its growth. Therefore, under these conditions none of the serum free media supported the clonal growth of the prostate cancer cells.

Mean, SEM RPM I WAJCWAJC- W AJC + MEGM KGM of % CFE 10% PCS CT 1%FCS PC3 100,0 0,0 0,0 0.5,0.5 1.2, 1.17 0,0 LNCaP 100,0 0 ,0 0 ,0 0 ,0 0,0 0,0 DU145 100,0 0 ,0 6.3, 6.34 20.6,4.82 2.6, 2.19 0,0

Table 3.2: Effect of various media on the colony forming efficiency (CFE) of prostate cancer cell lines. Clonogenic assays were carried out in the various media in triplicate and the mean colony numbers calculated for each media. The CFE for a particular media was calculated as a % of the control medium (RPMI-i-10% ECS). The table shows the mean and SEM of three independent assays for each cell line in the media indicated.

103 3.4 CULTURE OF CELLS DERIVED FROM BONE MARROW ASPIRATES

3.4.1 Experimental plan • Obtain bone marrow aspirates from patients with relapsed prostate cancer and metastatic disease. • Separate cancer cells from the bone marrow cells. • Culture prostate cancer cells obtained from the bone marrow samples. • Transduce the prostate cancer cells with PA/tsA58-U19/8. • Select and expand clones.

3.4.2 Results

Bone marrow aspirates were obtained from 9 patients with positive bone scans associated with prostate cancer. The bone marrow smears were assessed by a haematologist (Table 3.3).

Sample Description of smear Presence of cancer cells

1 Aparticulate, haemodilute - 2 Aparticulate, normal haemopoietic cells -

3 Cellular aspirate, active haemopoiesis -

4 Haemodilute, fatty - 5 Cellular +

6 Normocellular marrow - 7 Dry tap marrow with few haemopoietic cells + 8 Haemodilute marrow, little normal haemopoietic + particles 9 No haematological cells seen -

Table 3.3: Cytological analysis of bone marrow smears. Summary of the report provided by the haematologist on the bone marrow smears taken prior to culture.

Effect of lysis buffer on cells derived from the bone marrow As the majority of the cells in the bone marrow aspirate are red blood cells, removing these cells prior to culture will ensure that the remaining cells (which include the mononuclear

104 mononuclear white blood cells, bone marrow stromal cells and any circulating cancer cells) can be plated at a higher density. To determine whether the lysis buffer used to remove most of the red blood cells has any adverse effect on the remaining cells in the bone marrow, cells from one sample were spirt and processed with either erythrocyte lysis buffer or WAJC as described in Method 1 (see section 2.2b). The cells were then plated in WAJC supplemented with 1% PCS. The culture treated with the lysis buffer still contained some red blood cells, but most o f these and the white blood cells were removed during subsequent media changes, leaving a few colonies of bone marrow stromal cells. The cells processed with WA.1C contained many red blood cells (resulting in the medium turning red). Subsequent media changes failed to remove a layer of ‘shrunken’ red blood cells, and no stromal cells grew in this culture.

Growth o f cells derived from the bone marrow

Of the 9 bone marrow samples, 8 were exposed to ammonium chloride lysis buffer to remove the red blood cells. In no case were epithelioid cells seen. Bone marrow stromal cells grew in 4 of these cultures (Table 3.4). The tenth sample was processed with Ficoll to separate the mononuclear cells. Stromal cells also grew in this culture.

The bone marrow stromal cells were between three and five times larger than the white blood cells and were polygonal in shape. However, while proliferating they become elongated and grew in whirls characteristic o f fibroblasts in culture (Figure 3.1 ).

Figure 3,1; Culture of stromal cells derived from the bone marrow. Nucleated cells were plated in the bone marrow medium (BMM) after separation from the red blood cells.

105 Sample Method of Medium Cancer cells Cell growth separation used Epithelial Stromal cells 1 1 WAJC Absent No No 2 1 WAJC Absent Pungal contamination 3 1 WAJC Absent No No 4 1 WAJC Absent No Yes 5 1+/- Lysis WAJC+1% Present No Only in lysis buffer buffer PCS treated flask 6 1 WAJC+20% Absent No Yes PCS 7 1 WAJC +/- Present No No 1%PCS 8 1 WAJC+1% Present No Only in BMM PCS/BMM 9 2 BMM/ Absent No Only in BMM PrEGM

Table 3.4: Summary of the results of culture of bone marrow derived cells +/-: Cells split into two and processed as described. Method of separation: Method used to separate the nucleated cells from the bone marrow. In method 1, the ammonium chloride lysis buffer was used to remove red blood cells and concentrate the nucleated cells while in method 2 centrifugation through Ficoll was used to concentrate the nucleated cells. BMM = Bone marrow medium (see section 2.2b). Cancer cells: As detected by the haematologist from the bone marrow smears taken initially. Cell growth: Cells grown from the aspirate after processing by either method 1 or 2.

106 There was no growth of bone marrow derived cells (stromal cells or circulating epithelioid cells as determined morphologically) in two out of three cultures plated in serum-free WAJC. Stromal cells (thin, elongated and forming swirls) grew in the remaining culture. To determine whether the inclusion of a high concentration of serum in the medium supports the growth of bone marrow derived cells, 20% serum was included in WAJC to establish one culture. Stromal cells in this culture became confluent within three weeks. To test the effect of a low concentration of serum, cells from one sample were grown in both serum free and serum containing (1%) WAJC. There was no cell growth in either culture.

Pantel and colleagues (Pantel et al, 1995) have used RPMI supplemented with 10% PCS and growth factors (called BMM) to grow bone marrow derived cells and prostate cancer cells. Two samples were split and grown in either WAJC supplemented with 1% PCS or BMM. Stromal cells grew in BMM only. Single cells were seen within three days. To determine whether the new prostate epithelial growth medium PrEGM is suitable for preferentially growing prostate cancer cells from other bone marrow cells, cells from one sample were plated in both BMM or PrEGM in flasks coated with extracellular matrix, after being separated through Picoll. Only the stromal cells in BMM grew.

Immunocytochemical analysis of bone marrow smears To determine whether the initial bone marrow aspirate used to set up the cultures contained metastatic prostate cancer cells, smears of each sample were made as described in section 2.2b. Immunocytochemical analysis was carried out on these fixed smears using an pan cytokeratin antibody (detects a mixture of cytokeratin indicating presence of epithelial cells). The smears which contained unusual cells according to the haematologist, were then incubated with anti-PSA antibody to detect the expression of PSA. Of the samples tested, I only detected cytokeratin positive, PSA negative cells in sample 9 in contrast to the three samples in the haematology report.

107 3.5 DISCUSSION

Culture of cells from primary prostate cancers Collagenase dissociation followed by density sedimentation in combination with serum- free WAJC 404 medium produced good initial outgrowth of epithelial cells in 11 of 14 samples. This method of separation of epithelial cells has been used in combination with various media to produce primary culture of prostate epithelial cells by various groups (Brawer et al, 1985, Ofner et al, 1985, Chaproniere and McKeehan, 1986, Sherwood et al, 1989, Delos et al, 1995, Collins et al, 1996). The absence of growth in the remaining three cultures could be due to the lack of viable cells in the TURP chips from these samples. Although charred areas were removed as much as possible prior to culture to remove cauterised tissue, no cell growth occurred in these three samples. Since stromal cells also did not grow from these samples, it would indicate that the tissue probably did not contain many viable cells from which to initiate culture.

After the initial period of growth, the epithelial cells became irreversibly vacuolated; since addition of serum to the medium did not reverse the situation (results not shown) and stopped dividing after 2-3 weeks in culture. This finding implies that the long-term nutritional requirements of the cells were not being met by the WAJC 404 medium. This medium has been used in short-term studies where primary culture cells were used in various assays and discarded (Sherwood et al 1989, Taketa et al, 1990, De Angeli et al 1995, Collins et al 1996, Tsugaya et al, 1996, Robson et al, 1999). Since our goal was to maintain the cells long-term and to keep them proliferating long enough to produce continuous cell lines, a different culture medium was needed. Subsequent to this work, PrEGM, a prostate epithelial growth medium from Clonetics, has been shown to maintain prostatic epithelial cells without vacuolation and permits cloning (Hudson et al, 2000), routine passage and immortalisation (Fry et al, 2CKX)).

Stromal cells grew in only 6 of 14 samples using collagenase dissociation. Three of the samples also did not give rise to epithelial cells suggesting they did not contain many viable cells. However, the remaining five samples produced viable epithelial cultures so should have also given rise to stromal cultures. Collagenase dissociation was used in this study to separate the prostatic acini resting on the basal lamina from the underlying stromal

108 elements. While the acini are released intact after digestion, Collagenase is selectively toxic to fibroblasts and inhibits fibroblast growth (Webber, 1980). Perhaps the 7-hour collagenase digestion period used here to separate the stromal cells from the prostate cancer samples caused irreversible damage to the stromal cells thus accounting for the failure of stromal cell growth in the five samples. Although even longer period of digestion (upto 20 hours) have been reported to produce viable stromal cell cultures from normal (Roberson et al, 1995, Peehl and Sellers, 1997) and BPH (Collins et al, 1994, Delos et al, 1995, Kassen et al, 1996, Tsugaya et al, 1996) samples. However in our hands using this method the success rate of culturing prostatic stromal cells was un acceptably low (-50%). A shorter and more intense period of digestion (Ofner et al, 1984) followed by passage through nylon mesh of decreasing size to obtain a single cell suspension has also been reported for producing stromal cultures from prostate tissue (Swinnen et al, 1991, Vlahos et al, 1993). Expiant culture which does not involve the use of collagenase has also been used to produce stromal cultures (Schweikert et al, 1982, Chang and Chung, 1989, Sherwood et al, 1989, De Angeli et al, 1995, Kooistra et al, 1995). The faster growth rate of stromal cells results in overgrowth of epithelial cells from the explant. Indeed explant culture was used to produce the prostate stromal cell line DuK50 (Roberson, 1995). Subsequent to my work, a shorter digestion period (upto 4 hours) followed by passage through nylon mesh of decreasing size to obtain stromal cells have been used successfully and reproducibly to produce stromal cell cultures from prostate tissue in this laboratory.

Of 11 epithelial cultures, 8 were successfully transduced with the temperature sensitive SV40 T antigen construct with a view to producing conditionally immortalised cell lines. Some of the cells in these cultures survived G418 selection indicating the presence of the T antigen construct, but none continued to proliferate beyond the 5th week. Extensive vacuolation was observed in all the cultures which could not be reversed by the addition of semm to the medium. This would indicate that since WAJC 404 did not support the longer term growth of the prostate epithelial cells it may be the cause for failure of the cultures to thrive. Since none of the other semm free medium supported the clonal growth of established prostate cancer cell lines and in the absence of a culture medium that would support the growth of transduced prostate epithelial cells long term this work was not continued. Subsequent to my work, using PrEGM, the new prostate epithelial growth medium and the technique described here for culturing epithelial cells a conditionally

109 immortalised epithelial cell line called Pre2.8 was established from a BPH sample (O' Hare, personal communication) by others in the laboratory. Since this medium supported epithelial cell proliferation for longer without the vacuolation seen with WAJC 404, it was possible for this culture to remain viable for long enough to emerge from crisis.

Of the 5 stromal cultures transduced none ultimately survived G418 selection. Although the stromal cultures thrived in it's culture medium before transduction, perhaps transducing more stromal cultures would have produced cells that were successfully transduced and eventually immortalised. However, due to the time scale involved in producing stromal cell lines and since I failed to produce prostate epithelial cell lines this work was not continued. Subsequent to my work, using the alternative technique of shorter digestion period and the nylon mesh described above a conditionally immortalised stromal cell line S2.13 (from the same BPH sample as that used to produce the epithelial cell line Pre2.8 mentioned above) was produced (O’Hare, personal communication) by others in the laboratory. Both these cell lines are in the process of being characterised. Based on the work described in this study and the subsequent work carried out, it has been estimated that immortal cell lines are produced at a low frequency, in approximately 10% of cultures successfully transduced with the SV40 construct (O’Hare, personal communication). Therefore had more stromal cultures been transduced, cell lines may have been established in this study.

Bone marrow derived cells To grow metastatic prostate cancer cells, bone marrow samples were obtained from nine patients with metastatic prostate cancer. At autopsy, the rate of bone metastasis has been shown to be about 80% in prostate cancer (Berrettoni and Carter, 1986), with most foci being found predominantly in the bone marrow. Since bone scans done previously showed presence of metastasis in the bone marrow of these nine patients, it was assumed that obtaining bone marrow aspirates from the Diac crest would provide us with a supply of metastatic prostate cancer cells. However, I did not observe growth of any epithelioid cells in culture. The haematology reports of the samples provided subsequently showed that although these patients had positive bone scans only three of the nine aspirates actually contained any metastatic deposits. Therefore the failure to grow metastatic prostate epithelial cells in this study was mainly due the absence of metastatic cells in the aspirates used to initiate the cultures.

110 There are a number of possible explanations for the absence of prostate cancer cells in the aspirates obtained, including sampling failure. This problem might be avoided by taking aspirates from known ‘hot spots’ of metastasis as determined by bone scans done immediately before obtaining aspirates rather than all the samples being taken from the iliac crest. Secondly, some of the patients had radiotherapy prior to obtaining the bone marrow sample. This may have killed any metastatic cancer cells. Therefore obtaining samples from patients who have yet to undergo radiotherapy should improve the chances of obtaining metastatic cells from the bone marrow. Thirdly, some of the samples were very dilute, unlike the cellular bone marrow, which suggests that the sample contained only peripheral blood and not marrow. Therefore using only cellular aspirates for culturing may improve the chances of culturing metastatic cells.

Of the three remaining samples that contained cancer cells according to the haematologist, epithelial cells grew in none of the cultures. Of these three samples, only one aspirate was described by the haematologist to be cellular containing normal haemopoietic cells. Only stromal cells grew in this culture. However the remaining two cultures were described as being dilute with little haemopoietic cells present. Only stromal cells grew in one of these cultures. There are a number of possible reasons why epithelial cells did not grow in these three cultures. Firstly, two of the aspirates contained only a few haemopoietic and other cells. Perhaps the low plating density did not favour the growth of epithelial (i.e. prostate cancer) cells. Pantel and colleagues estimated that prior to culture, an aspirate contained fewer than 10 tumour cells per 8X10^ nucleated cells (Pantel et al, 1995). Plating on collagen or basement membrane coated flasks may improve culture success of epithelial cells. Secondly, the metastatic cells in the bone marrow smears were seen in clumps according to the haematologist, and not as single circulating cells. Pantel and colleagues used aspirates from patients with primary disease and occult micrometastasis, hence the cells were single isolated cells. Perhaps the heavier clumps of cells seen in the relapsed patients in this study, were deposited with the lysed erythrocytes during the several centrifugation steps. Dispersing the aspirate through a 19g subculturing needle prior to processing may retain more of the circulating cancer cells for plating. Thirdly, the medium used to plate the cells, WAJC 404 did not support growth of the epithelial cells described in the previous study. The bone marrow medium (BMM) which is serum and growth factor

111 supplemented has been used successfully to culture micrometastatic epithelial cells from the bone marrow (Pantel et al, 1995, Putz et al, 1999) although this would be expected to grow more stromal cells. It was reported that both epidermal and basic fibroblast growth factor was essential for the growth and expansion of the cancer cells.

Of the nine samples, 8 were processed with the ammonium chloride erythrocyte lysis buffer. This buffer removed over 90% of the red blood cells. In a preliminary experiment it was found that LNCaP cells treated with the lysis buffer were still able to form colonies. It was concluded that this buffer is suitable for separating prostate cancer cells in the bone marrow from red blood cells. When cells from one of the aspirates were divided and half treated with the buffer and half untreated, stromal cells grew only in the sample treated with the lysis buffer. In contrast to this method Pantel and colleagues (Pantel et al, 1995, Putz et al, 1999) used Ficoll to separate the nucleated fraction of cells. These single cells are found in the interphase sandwiched between the upper layer of plasma and lower layer of red blood cells. However from the haematology reports of the smears, the cancer cells were seen in clumps. Therefore these heavier cells may deposit to the bottom layer in this system.

The serum and growth factor supplemented medium, BMM produced only growth of stromal cells derived from the aspirate from a sample that contained cancer cells according to the haematologist. However, Pantel and colleagues, have used this medium successfully to culture micrometastatic epithelial cells from the bone marrow. Also, prostate cell lines derived retained tissue specific characteristics such as PSA (Pantel et al, 1995).

To overcome the problems associated with bone marrow biopsies, another possible source of prostate cancer cells is trephine biopsy of the bone from these patients. Trephine biopsies done by the haematologist on two of the patients revealed prostate cancer cells growing in the bone. However, the trephine biopsy is solid, and has to be processed first to release the cancer cells. We are now comparing trephines and bone marrow samples to obtain metastatic prostate cancer cells in this laboratory.

However, since only a third of the aspirates actually contained metastatic cancer cells the chances of culturing prostate cancer cells was low unless the samples could be better

112 targeted. In the absence of a continuous supply of aspirates from known hotspots of metastasis this work was also not continued.

Conclusion Although prostate cancer cell lines were not established in this study, based on this work culture conditions needed for producing such cell lines were optimised subsequently by others in the laboratory which led to the establishment of conditionally immortalised prostate cell lines. However, due to the timescale involved in producing cell lines, the work for this study was not repeated subsequently with the new culture conditions.

113 CHAPTER 4

CLONING AND CHARACTERISATION OF THE 5' REGULATORY REGION OF THE 5a-REDUCTASE I GENE

114 4.1 INTRODUCTION

The enzyme 5a-reductase converts testosterone to 5a-dihydrotestosterone (5a-DHT), required for the development of the prostate. Two isoforms of 5a-reductase, type I and type n, were cloned from a human prostate cDNA library by Andersson et al, (Andersson and Russell, 1990, Andersson et at, 1991). A processed pseudogene for the 5a-reductase I gene has also been cloned (Jenkins et al, 1991).

These isozymes show tissue and cell specific expression. The type U enzyme is found in both foetal and adult prostate, foreskin and genital tissues such as the epididymis and seminal vesicle. The type I enzyme is found in other adult tissues such as non genital skin (Thigpen et al, 1993a). The type I isozyme is not present in the foetus but is transiently expressed in the new-born skin and scalp along with the type II enzyme (Thigpen et al, 1993a). The adult liver contains both isozymes. The adult prostate also contains the type I enzyme (Bonnet et al, 1993, Habib et al, 1998, Negri-Cesi et al, 1998) although at a lower concentration than the type II enzyme (Habib et al, 1998, Thigpen et al, 1993a). Within the prostate, 5a-reductase I is preferentially expressed by the epithelial cells, while 5a- reductase II is expressed by both epithelial and stromal cells (Bonnet et al, 1993, Bonkhoff et al, 1996, Bruchovsky et al, 1996, Levine et al, 1996, lehle et al, 1999).

Such developmental, tissue and cell specific expression of genes can occur by pre- transcriptional, transcriptional, translational or post-translational regulation. In higher eukaryotes, transcriptional control is the major mechanism for regulating gene expression (Darnell, 1982). Transcriptional regulation involves the binding of fm»j-activating proteins (transcription factors) to cw-acting regulatory DNA elements to activate the basal transcription machinery, resulting in activation of RNA polymerase II and increased transcription of the gene. Many eukaryotic genes also contain additional regulatory elements called enhancers or repressors depending on whether they increase or reduce gene transcription, and which are thought to contribute to tissue specific gene expression (Kumar and Tindall, 1998).

The sequence and structure of the 5a-reductase I gene has been determined and it has been mapped to the distal short arm of chromosome 5 (Jenkins et al, 1991). This group

115 have sequenced a short portion of the 5' region of the 5a-reductase I gene. Therefore, to identify the DNA regulatory elements and transcription factors involved in the regulation of this gene, the 5' region needed to be further sequenced and characterised. This chapter describes the cloning and sequencing of the 4.6kb region immediately upstream of the 5a- reductase I gene, generation and testing of deletion constructs containing this cloned region in cell lines and identification of critical regions of the promoter and the transcription start site.

4.2 AIMS AND OBJECTIVES

The aim of this chapter was to clone and characterise at least 3-4 kb of sequence 5' of the 5 a-reductase I gene. In general, regulatory sites lose effectiveness when placed more than lOOObp away from the promoter (Magasanik, 1989). Therefore, this 4kb region is likely to contain most of the sequences needed for the functional regulatory region of the 5a- reductase I gene. The specific objectives were to

• Clone and sequence 3-4kb of DNA upstream of the 5a-reductase 1 gene. • Produce deletion constructs of the cloned region.

• Test promoter activity of the deleted reporter constructs. • Identify the transcription start site.

Experimental plan In order to achieve these objectives the following experimental plan was devised.

• Screen a human genomic DNA library in X-FIXn using probes to the 5a-reductase I gene.

Subclone isolated genomic DNA into a plasmid vector, pBluescript.

Sequence DNA upstream of the 5a-reductase I gene.

Subclone the 5' region of 5a-reductase I gene into the pGL2Basic reporter plasmid. Produce deletion constructs in pGL2Basic.

Transfect constructs into cell lines to test promoter activity.

Perform primer extension analysis to identify the transcription start site.

Co-transfect expression vectors for transcription factors (TF) with promoter constructs

to determine which are involved in the regulation of the 5a-reductase I gene.

116 4.3 RESULTS

4.3.1 CLONING AND SEQUENCING THE 5' FLANKING REGION OF THE 5a- REDUCTASE I GENE In order to isolate the 5' region of the 5a-reductase I gene, a human genomic DNA library was screened using 5a-reductase I cDNA, which should hybridise to any plaque that contains part of the cDNA sequence. Since the size of the cDNA is 820bp and the size of the insert in the library vector is between 9-23kb, any insert containing the 5a-reductase I cDNA could also contain either or both 3' and 5' sequences.

Strategy 1: Screening with 5a-reductase I cDNA Isolation of positive clones The genomic DNA library in X FIX II was screened using radiolabelled probe A1 (see section 2.1b), which was the 5a-reductase I cDNA in a pCMV expression vector (donated by Prof. Russell), linearised and end-labelled. Two clones (C14 and C17) were isolated which hybridised to the probe strongly in the secondary screen.

These clones were picked and the phage DNA amplified in E. colt C600. The phage DNA was extracted and digested with Sal I or Xba I, which cut on both sides of the insert (see map of X n x n , section 2. If). The products were separated by agarose gel electrophoresis. Southern blotted and probed with Al. Sal I digested the human DNA in clone C14 once and in C17 twice. The probe Al strongly hybridised to some of the fragments of the digested DNA (Figure 4.1).

Subcloning isolated genomic DNA into pBluescript Amplification of phage DNA is more time consuming than plasmid DNA and the genomic DNA inserts of the 1-FIXn library may be large (between 9-23kb, according to manufacturer). Therefore, to make subsequent maxipreparation of DNA from phage clones and manipulations such as subcloning quicker, fragments of the genomic DNA insert from all positive phage clones were subcloned into the bacterial plasmid, pBluescript (pBS).

117 Cl 4 C17

Sail Xba I Sail Xba I

Figure 4.1: Southern blot analysis of restriction digested C14 and Cl 7 phage DNA. Phage DNA from clones C14 and C 17 was digested with Sal I or Xha I, separated on a 0.8% agarose gel, blotted and hybridised with probe Al.

The plasmid pBS and phage DNA from clones C l4 and C l7 were digested with Sal I. The pBS was then dephosphorylated and added to the digested C l4 or C l7 phage DNA, ligated and used to transform XLBlue MRF competent E. coli cells. Transformed cells were grown on ampicillin agar plates with Xgal and IPTG for blue-white selection. White colonies indicating presence of recombinant pBS were picked, grown up overnight in LB/ampiçillin, the DNA extracted and checked by digesting with Sal I. Electrophoresis of digested DNA showed that the white colonies from C14 contained inserts of either ~6 or ~20kb. Bands representing the vector (~3kb) were also present. Since the ~20kb insert was unlikely to be the genomic DNA fragment, and was probably the right phage arm (which is 19kb) and the ~6kb band was similar in size to die band which hybridised, the DNA from the latter clones were chosen for sequencing. Since the white colonies from C l7 did not contain the vector band, they were not sequenced.

The DNA from C14 cloned into pBS was sequenced with universal and reverse primers which have complementaiy sites on the vector, and found to contain 5a-reductase I pseudogene sequences and not the 5a-reductase I gene sequences as expected. About 5% of

118 et al, 1991), so the two can be distinguished. Since clone C17 was isolated using the same probe, it was likely that it too contained the 5a-reductase I pseudogene. I therefore designed a short probe to distinguish the 5a-reductase I gene from the pseudogene.

Strategy 2: Screening with 50t-reductase I promoter specific probe Isolation of positive clones Since the initial screening strategy preferentially identified the 5a-reductase I pseudogene, the library was screened using a 55bp oligoprobe (probe A2, see section 2.1b) corresponding to bases -228 to -173 in the 5' region of the gene. The 5a-reductase I gene is homologous to the pseudogene up to 110 bases upstream of the ATG initiation site, after which the sequence of the two genes differs (Jenkins et al, 1991). Therefore, the region corresponding to probe A2 should not hybridise to the pseudogene. Two clones were identified from the primary screen, but neither of these hybridised to the probe in the secondary screen. The library was screened three times but I failed to identify any positive clones. This could be because the probe was too short to hybridise strongly to the filters. During the stringent washing steps weakly the hybridising probe may have been removed.

Strategy 3: Screening with SOC-reductase I partial exon I and S' region Isolation of positive clones The third strategy utilised a probe complementary to part of exon I of the 5a-reductase I gene and sequences 5' to the coding region (probe A3). This would ensure that positive phage clones would contain exon I and some 5' sequences. We planned to screen the library with this probe and then screen the positive clones again with probe A2 to distinguish clones containing the gene from those containing the pseudogene. To produce the probe, primers complementary to bases -20 to -43 and +126 to +150 of the 5a-reductase I gene (see section 2.1b) were used to amplify a 193bp product from human colon genomic DNA. The product was sequenced to confirm that it contained 5a-reductase I gene sequence, radiolabelled and used to screen the library.

2 positive clones (PI and P2) were identified in the secondary screen. For primary identification, the phage DNA of P2 was partially sequenced with T3 and T7 primers flanking the multiple cloning sites of A,-FIXn and found to contain 5a-reductase I gene

119 flanking the multiple cloning sites of A,-FIXI1 and found to contain 5a-reductase Î gene sequences. Therefore, there was no need for further screening. Restriction digestion of P2 with Not 1 produced a ~9kb and a -4kb fragment and Sac I also cut the insert (Figure 4.21). Southern blotting indicated that the -9kb Not Î fragment and the ~5kb Sac I insert fragments from P2 hybridise to the probe (Figure 4.2Hf I

XHindm Notl SacI Sail Xbal

Not I Sacl Sail Xbal

Figure 4.2: Restriction digestion and Southern blot analysis of P2 phage DNA. Phage DNA from clone P2 was digested with Not I, Sal I, Sac Î, and Xha I, separated on a 0.8% agarose gel (I), blotted and hybridised with probe A3 (H). Sizes (bp) of DNA marker fragments are indicated on the left.

120 Subcloning isolated genomic DNA into pBluescript Phage DNA from P2 was digested with Not I or Sacl and separated on an agarose gel. The 9kb Not I fragment and 5kb Sac I fragments which hybridised to the probe were excised from the gel and the DNA extracted.

The plasmid pBS was also digested with either Not I or Sac I and dephosphorylated. The 9kb Not I fragment of P2 was ligated to Not I digested pBS and the 5kb Sac I fragment was ligated to Sac I digested pBS. The ligated DNA was used to transform competent E. coli cells. Transformed cells were grown on ampicillin agar plates with Xgal and IPTG for blue- white selection. White colonies indicating presence of recombinant pBS were picked, grown overnight in LB/ampicillin, the DNA extracted and checked by digesting with Not I or Sac I. Electrophoresis of digested DNA showed that the white colonies from Not I clones contained a ~9kb insert and from Sac I clones contained a ~5kb insert.

The 9kb Not I/pBS and 5kb Sac I/pBS recombinant plasmids were sequenced with universal and reverse primers in both directions. The sequencing indicated that the 9kb Not I genomic DNA fragment contained only 587bp upstream of the ATG initiation site of 5a- reductase I gene. Of the 5kb Sac I fragment, only 302bp were upstream of the ATG initiation site. Using these sequencing data and the partial sequencing of the phage DNA that revealed the T7 linker flanks the 5a-reductase I gene sequences, a crude map of the clone P2 was constructed (Figure 4.3). Since Not I cuts the P2 insert to produce a ~9kb and a ~4 kb fragment, the latter must be flanked by the T3 linker and 5' to the 9kb fragment.

5' -0.59kb ATG 5oRI gene 3'

T3— I------4— kb ------1------1------9------kb ------1—T 7

Not I Not I Not I

Figure 4.3: Map of clone P2

121 Subcloning the 5 region of 5Ot-reductase I gene into pGL2Basic reporter vector

For the promoter studies, the pGL2 reporter plasmids (Promega) containing the luciferase gene was used. pGL2Basic is the negative control plasmid while pCMVLuc is the positive control plasmid containing the luciferase gene driven by the CMV promoter.

To subclone the 587bp fragment from the 9kb Not FpBS plasmid into pGL2Basic, the sequence 5' to the ATG initiation site was PCR amplified. A 5a-reductase I specific 3' primer, complementary to bases -22 to -1 positioned next to a Bgl II restriction site sequence (see section 2.1c) was synthesised (Figure 4.4). Bgl II was chosen because its’ restriction site is at the 3' end of the multiple cloning site (MGS) of pGL2Basic.

-22 -1 Bgl n restriction sequence I------1------1

Sa-Reductase I sequence

Figure 4.4: 5a-reductase I specific 3' primer.

Using this construct as the 3' primer, the universal primer (M l3-20 primer complementary to sequences at the start of the MGS on pBS) as the 5' primer and the 9kb Not I fragment cloned into pBS as a template, a 0.75kb PGR product was amplified. pGL2Basic has a Bgl II cloning site but no Not I cloning site. Just upstream of the Not I site in the MGS of pBS there is a Xba I site which produces ends compatible with Nhe I, which is present in pGL2Basic. Therefore, the PGR product was digested with Xba I and Bgl II and ligated to Nhe I and Bgl II digested pGL2Basic.

Construction of reporter plasmids 1)pGL5aRI0.59 The plasmid resulting from cloning the 587bp promoter into pGL2Basic was called pGLSa

RI0.59. It was sequenced and was shown to contain the 587bp upstream sequence of 5a- reductase I gene already published. 2) pGL5aRI0J

122 In order to produce a shorter promoter construct, the following cloning strategy was used. In the pGL2Basic MCS, there is a Sac I site upstream of the Bgl II site. The sequence of the 0.59kb construct showed that there is a Sac I site 302bp upstream from the ATG site. pGL5 (xRIO.59 vector was digested with Sac I to excise the 285bp distal promoter fragment, leaving the first 302bp of 5a-reductase I promoter in the pGL2Basic vector. The resulting smaller plasmid was religated and used to transform competent E. coli cells. Colonies were picked and miniprep DNA digested with Sac I and Bgl II to check insert size. Colonies containing the 0.3 kb insert were sequenced and shown to contain the expected 5a- reductase I sequence. This vector was called pGL5aRI0.3. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

3)pGL5aRI0.16 In order to produce a promoter construct smaller than pGL5(xRI0.3, the following strategy was used. There is a Sma I site 188bp upstream of the ATG site of the 5a-reductase I promoter. pGL2Basic vector also has a Sma I site in its MCS. pGL5aRI0.3 was digested with Sma I to excise the 115bp distal promoter while leaving the first 188bp of 5a- reductase I promoter in the pGL2Basic vector. The resulting smaller plasmid was religated and used to transform competent E. coli cells. Colonies were picked and miniprep DNA digested with Bgl II to get one linearised band of about 6kb. However when the new plasmid was sequenced it was found to contain only 161bp of 5a-reductase I promoter and not 188bp as expected. This may have been due to the original digest containing DN’ase activity. Since the vector contained the correct and therefore useful sequence, it was used for subsequent transfection experiments. This vector was called pGL5aRI0.16. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

4) pGL5oRI0.52 The sequence of the 0.6kb construct showed that there is a Sma I site 526bp upstream from the ATG initiation site of the 5a-Reductase I gene. Since this enzyme did not cut at the second Sma I site 188bp upstream of the ATG (as seen during cloning of pGL5ocRI0.16), the site at 526bp was utilised to produce another construct. pGL2Basic has a Sma I site in its MCS upstream of the Bgl II site. pGL5aRI0.59 vector was digested with Sma I to excise the 64bp distal promoter fragment while leaving the first 526bp of 5a-reductase I promoter

123 in the pGL2Basic vector. The resulting smaller plasmid was religated and used to transform competent E. coli cells. Colonies were picked and miniprep DNA digested with Sma I and Bgl n to check that the insert size was ~0.5kb. Colonies containing the 0.5 kb insert were sequenced and found to contain 5a-reductase I sequence. This vector was called pGL5a RI0.52. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

5) pGL5ûRI4.6 Since the 4kb Not I fragment is immediately upstream of the 9kb fragment, this region must contain sequences 5' of the 587bp already cloned (Figure 4.5). To clone this 4kb fragment upstream of the 587bp promoter fragment, pGL5(xRI0.59 was cut with Not I and dephosphorylated.

Not I Not I Not I

T3—I------1------1—T7

l~4.59kb promoter-1 5(xRI gene 1

Figure 4.5: Promoter region of clone P2

The 4kb fragment was gel extracted from Not I digested P2 DNA and ligated with the Not I cut and dephosphorylated pGL5otRI0.59 and used to transform competent E. coli cells. Miniprep DNA of resulting colonies were checked by digesting with Not I and Bgl n. Colonies containing ~0.6kb, -4kb fragments and a ~5,6kb vector band were sequenced and compared to the partial sequence data of the phage DNA. A clone which contained the 4kb Not I fragment cloned in the correct orientation, 5' to the 0.59kb Not I fragment, was chosen and fully sequenced. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

6)pGL5oRlL7 To obtain an intermediate sized promoter fragment the following strategy was used.

124 pGL2Basic has a Kpn I site in the MCS. The sequence of the 4.6kb construct showed that there is a Kpn I site 1717 bp upstream from the ATG site. pGL5otRI4.6 vector was digested with Kpn I to excise the 2761bp distal promoter fragment while leaving the first 1717bp of

5a-reductase I promoter in the pGL2Basic vector. The resulting smaller plasmid was religated and used to transform competent E. coli cells. Colonies were picked and miniprep DNA digested with Kpn I to check insert size. Colonies containing the ~1.7kb insert were sequenced and found to contain 5a-reductase I promoter. This vector was called pGL5a RI1.7. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

Nucleotide sequence of the 5 a-reductase I promoter The sequence of the 5a-reductase I promoter as determined from sequencing pGL5otRI4.6 is shown in Appendix 1. Sequencing primers were designed from each sequenced fragment to sequence the next fragment (see section 2. Id) until the whole promoter was sequenced. The restriction sites used for cloning are indicated. The putative TATA box is overlined.

4.3.2 REPORTER ASSAYS USING THE 5a-REDUCTASE I PROMOTER CONSTRUCTS Checking constructs for transfection For reporter assays, the negative control plasmid pGL2Basic, a positive control plasmid pCMVLuc (containing the CMV promoter upstream of the luciferase gene) and a transfection control plasmid pCMVp-Gal (containing the CMV promoter upstream of the p -galactosidase gene) were used. The miniprep DNA of each construct was used to maxiprep DNA for transfection. The maxiprep DNA was checked by digesting with the relevant restriction enzymes to check the size of the plasmids (Figure 4.6).

Transient transfection analysis of Sa-reductase I promoter constructs To determine the effectiveness of transcription driven by the 5a-reductase I promoter constructs, transient transfections were carried out. The optimal transfection condition was determined for each cell line (see section 2.5). PC3 and DU145, which express the Sa- reductase I gene (Chapter 6), were used. Although LNCaP expresses 5a-reductase I, it

125 Figu re 4,6; Restriction digestion of constructs used for transfection, Maxiprep DNA of the constructs were checked by digesting with the enzymes indicated, electrophoresed on a 0.8% agarose gel and photographed under UY. Sizes (bp) of DNA marker fragments are indicated on the right. Lane 3; Sal VBgl U digested pGL2Basic, Lane 4,11 ; Ecor I digested pCMVLuc Lane 5: Sac VBgl II digested pGL5aRI4.6 Lane 6; Kpn VBgl II digested pGL5aRIL7 Lane 7; Not VBgl II digested pGL5(xRI0.59, Lane 8: Sma VBgl II digested pGL5oRI0.52 Lane 9; Sac VBgl II digested pGL5oRJ0.3, Lane 10; Bgl 11 digested pGLScxRlO. 16. had low transfection efficiency using the methods tested in this study in keeping with earlier reports (Ruokonen et al 1996). Since PC3 and DU 145 prostate cancer cells showed similar promoter activity for all the constructs, transfection conditions for LNCaP were not further optimised and this cell line was not used for subsequent transfections. Since the CNS has been shown to contain 5a-reductase activity (Celotti et al, 1992) three tumour cell lines

126 lines SKNMC, LAN-1 and GHFT-1 derived from human neuroblastoma, glioma and rat pituitary respectively, were also used to transfect the promoter constructs. It was later discovered that the CNS-derived cell lines did not express 5a-reductase I, as tested by RT- PCR using the same conditions used successfully for the prostate cell lines. They also had a much higher transfection efficiency than the prostate cells, so were used.

Transfection of prostate cancer cell lines Cells were plated in 90cm tissue culture dishes and co-transfected the following day with the promoter constructs and the p-galactosidase construct. Cells were assayed for both luciferase and p-galactosidase activity 48 hour after transfection and luciferase values normalised with respect to p-galactosidase as described in section 2.5d.

All the promoter constructs tested were able to transcribe the luciferase reporter gene at a level higher than the promoterless pGL2Basic vector in both the cell lines. However luciferase gene transcription provided by these promoter constructs were relatively low compared with transcription provided by the promoter in the positive control plasmid, the cytomegalovirus (CMV) promoter. The lowest promoter activity was provided by the smallest construct pGL5ocRI0.16. The pGL5(xRI0.59 construct gave the highest promoter activity (Figure 4.7 I, II). The smaller 0.52kb construct was less effective than the 0.59kb construct in providing luciferase gene transcription. However the luciferase gene transcription is most drastically reduced when the promoter is truncated below 300bp. The larger 1.7kb construct produced lower promoter activity than the 0.59 or 0.52kb constructs. The largest construct, pGL5ocRI4.6, produced even weaker promoter activity than the 1.7kb, 0.59kb and 0.52kb constructs. The reporter constructs showed the same relative activity in both PC3 and DU 145, although overall activity was -2.5 fold higher in DU 145 compared to PC3.

127 Transfection of CNS~derived cell lines Cells were plated in 6 well plates and co-transfected the following day with the promoter constructs and the p-galactosidase construct. Cells were assayed for both luciferase and p- galactosidase activity 48 hour after transfection and luciferase values normalised with respect to p-galactosidase. As with the prostate cell lines, all the promoter constructs were able to transcribe the luciferase reporter gene at a level higher than the promoterless pGL2Basic vector. However, the activity of the 5a-reductase I promoter constructs as compared to the positive control plasmid was higher than in the prostate cancer cell lines. For example, the promoter activity of the 0.59kb promoter construct was at least an order of magnitude higher in the CNS derived cell lines as compared to the prostate cell lines. The pGL5otRI0.59 construct gave the highest promoter activity (Figure 4.8 I, H, IE) as in the prostate cell lines. Truncating the promoter below 300bp resulted in the greatest loss of promoter activity. The largest 4.4kb promoter construct was also transcriptionally less active than the smaller 1.7kb construct. The relative promoter activity of the individual constructs was the same in all cell lines, indicating that tissue specific transcription was not being provided by the promoter constructs. Surprisingly, these human promoter constructs were most active in the rat pituitary cell line GHFT-1.

128 Transcription of the luciferase gene by Sa- reductase I promoter constructs in OU145

0.2 i OpGL2Basic ■pGL5aRI4.6 0.15 i °pGL5aRj1,7 PpGL5aRI0.59 OpGL5aRI0.52 °pGL5aRi0.3 PpGL5aRID.15

Transcription of the luciferase gene by Sa- reductase I promoter constructs in PC3

PpGL2Basic O 0.05 ■ pGL5aRI4.6 OpGL5aRI1,7 QpGL5aRI0,59 ■pGL5aRi0.52 DpGL5aR10.3 PpGL5aRI0,15

IÎ Figure 4,7: Transcriptional analysis of the 5a-reductase I promoter constructs in prostate cancer cell lines. DU 145 (J) and PC3 (JJ) cells were transiently transfected with the 5a-reductase I promoter constructs and the p-galactosidase construct (section 2.5b) and luciferase activity normalised against P-galactosidase activity. Results are expressed as the luciferase activity of the promoter constructs as a percentage of the positive control construct pCMVLuc and are mean of three independent experiments and their SEM.

129 Transcription of the luciferase gene by Sa- reductase I promoter constructs in SKNMC

5 -

°pGL2B9Sic Ü npGL5aRI4.6 Q. o □pGL5aRi1.7 si? □ pGL5aRI0.59 ■ pGL5aRI0.52 □pGL5aR10.3 1 r □pGL5aRI0.15

4.81

Transcription of the luciferase gene by Sa- reductase I promoter constructs in LAN-1

4.5 4

3.5

3 E3pGL2Basic ■ ■ pGL5aRI4.6 ■ □ pGL5aRI1.7 ■ 1 ppGL5aRI0.59 ■ ||»pGL5aR10.52 ■ PpGL5aRI0.3 ■ pGL5aRl0.15

4.8 II

130 Transcription of the luciferase gene byS a- reductase I promoter constructs In GHFT-1

6 t

°p G L 2 B asic lpGL5aRI4.6 □pGL5aRI1.7 □pGL5aRI0.59 lpGL5aRI0,52 OpGL5aRI0.3 lpGL5aRI0.15

III

Figure 4.8: I'ranscriptional analysis of the 5a-reductase I promoter constructs in CNS- derived cell lines. SKNMC (I), LAN-1 (II) and GHFT-1 (III) cells were transiently transfected with the Sa- reductase 1 promoter constructs and the p-galactosidase construct (section 2.5a) and luciferase activity normalised against p-galactosidase activity. Results are expressed as the luciferase activity of the promoter constructs as a percentage of the positive control construct pCMVLuc and are mean of three independent experiments and their SEM.

131 4.3.3 CHARACTERISATION OF THE Stt-REDUCTASE I PROMOTER

Identification of the transcription start site of the 5a-reductase I gene In order to identify the transcription start site of the 5a-reductase I gene, primer extension analysis, was carried out (see section 2.6a). Total RNA from PC3 and DU 145 prostate cancer cell lines were extracted and 10|Xg used for primer extension by MuMLV reverse transcriptase. Using a HEX labelled primer corresponding to sequences +17 to +46 downstream of ATG initiation site (see section 2.le) an extension product of 84 bases was produced, indicating that the transcription start is -55bp upstream of the ATG initiation site (Figure 4.9). This corresponds to the position of the putative TATA box at -55bp upstream of the ATG.

Putative transcription factors interacting with the Sa-reductase I promoter In order to further characterise the 5a-reductase I promoter, the sequence of the promoter was analysed by using the Matlnspector (http://transfac.gbf-braunschweig.de, Quandt et al, 1995) and Signal Scan (http://bimas.cit.nih.gov/molbio/signal) programmes utilising the Transfac database available on the world wide web. These programmes are designed to identify consensus sequence elements of transcription factors (TF) and other DNA elements such as hormone responsive elements. There is a putative TATA box 55bp upstream of the ATG initiation site. There are many consensus sequences for putative TF binding sites including a number of SPl, AP2, GCF and T-Ag sites, but no hormone-responsive elements such as androgen responsive element ARE. Two examples of such analysis are shown in Figure 4.101 (Matlnspector) and II (Signal Scan).

132 ABI ' ^ GeneScarKB: 2 1 untitled Display-10 Page 1 of 1 PRISM

20 30 40 50 60 70 80 90 TOO 110 120 130 140 150 160 170 180 190 200 210

1 1: 11 240C •• 1! 1: il 160C : : 1: |i 80C i l l ' . - '

; t ' .1 C .

2G : AlDu 145 / [email protected] UU 2R; AlDu 145/

24 OC i 160C I ! 80C ; i h ji 1 'I- K ' '■ , f[ / ( , ( ' i ^ i ' i ...... ;

u n 4G :A5PC 3 / [email protected] n n 4R;A5PC3/

240C

160C 1 80C : i' '! Î ^ C V ...... r ______i L l L j i ______i '

6G : ABWasserkontrolle / 5#Red.l-1 6R : A9Wasserkontrolle

Figure 4.9: Primer extension analysis of Sa-reductase 1. lOjag of total RNA from DU 145 and PC3 was reverse transcribed using a fluorescent primer(section 2.6a) and extended products separated by electrophoresis. The extended product appears as a green peak as the primer was labelled in green while the internal size standai ds appear as red peaks. The size of the peaks are indicated on the top horizontal panel.

133 Processed sequence: 5a-reductase I promoter

1 GCGGCCGCGCACGCAGCACGCAGAAACCGGCCCGCCACGGCCAGAACTAT 51 AGCCCTACACCTCCCGGGACTTCCGGCCGGAAACCAAGGCCCCACGTGTC 101 CGGGCCTGGTCCTTTCGGGGACCTTTGGGGACCGTCC AGG AATA AGCCC A 151 AAGCGCACAACCCGTCTTTCAGAAAAGCGGCGTGACAGGGAAAAC AGCG A 201 AC AGCTCTAAGGGGAAAA AAATGCTCC AGG AAGC AGCG AC A AAGGCGTCT 251 CCGCGCGAAGCGCCCAGGTTTCCCACGCGGGCTCAAGGAGCTCCGCGGAC 301 AGCCTGAAGCCGCGCGTGCGCAGAGCGGCGCGGGGTTACTGCGGCCCCGG 351 CGTGGGTGGGGCGCTTGCAGGTCCCTCCCCGCGCAAGTGCTCGCCCCGCC 401 CCCGGGGCCGACCCACAGCCCCGGCTACCCCGGAG AAGCCTGACTTGAGA 451 ACCCTTTCTGCAGAGTCCCGGCAGTGCGGGACTCCGGTAGCCGCCCCTCC 501 GGTAGCCGCCCCTCCTGCCCCCGCGCCGCCGCCCTATATGTTGCCCGCCG 551 CGGCCTCTGGGGCATGGAGCACGCTGCCCAGCCCTGGCGATG

Matrix Position (str) Core Matrix Sequence Name of Matrix Simil. Simil,

NGFIC 01 1 5(-)l 1.0001 0.8511 ctGCGTgcgcgg EGR3 Oil 5(-)l 1.0001 0.8651 ctGCGTgcgcgg EGR2 Oil 5(-)l 1.0001 0.8681 ctGCGTgcgcgg AHRARNT Oil 7(-)l 1.0001 0.9231 tgcgtgctgCGTGcgc AP4 051 12(+)l 1.0001 0.8741 cgCAGCacgc RFXl Oil 13(+)l 0.8821 0.8661 gcagcacgcaGAAAccg AHRARNT Oil 14(-)l 1.0001 0.8981 cggtttctgCGTGctg THIE47 Oil 37(-)l 1.0001 0.8641 ctatagttCTGGccgt DELTAEFl Oil 55(+)l 1.0001 0.9351 ctacACCTccc CETSIP54 Oil 58(-)l 0.8331 0.8851 ccGGGAggtg IK2 Oil 58(-)l 1.0001 0.8791 tcccGGGAggtg IK2 Oil 62(+)l 1.0001 0.9151 tcccGGGActtc NFKAPPAB65 Oil 65(+)l 1.0001 0.8641 cgggacTTCC CREE Oil 65(+)l 1.0001 0.9491 cgggacTTCC ELKl Oil 65(-)l 1.0001 0.8861 ccggccGGAAgtcccg NFKAPPAB Oil 66(+)l 1.0001 0.8501 GGGActtccg NRF2 Oil 68(-)l 1.0001 0.9351 gccGGAAgtc CETSIP54 Oil 68(-)l 1.0001 0.9861 gcCGGAagtc NEAT 061 75(+)l 1.0001 0.9061 ggccgGAAAcca CETS1P54 Oil 76(+)l 1.0001 0.9351 gcCGGAaacc ARNT Oil 88(-)l 1.0001 0.9291 ccggacaCGTGgggcc ARNT Oil 88(+)l 1.0001 0.9471 ggccccaCGTGtccgg MYCMAX Oil 89(-)l 1.0001 0.8761 cggaCACGtggggc USF Oil 89(+)l 1.0001 0.9841 gcccCACGtgtccg USF Oil 89(-)l 1.0001 0.9841 cggaCACGtggggc MYCMAX Oil 89(+)l 1.0001 0.8761 gcccCACGtgtccg MAX Oil 89(+)l 1.0001 0.9211 gcccCACGtgtccg MAX Oil 89(-)i 1.0001 0.9211 cggaCACGtggggc NMYC Oil 90(+)l 1.0001 0.9961 ccccaCGTGtcc MYCMAX 021 90(+)l 1.0001 0.9211 cccCACGtgtcc LM02C0M Oil 90(+)l 0.7761 0.8931 cccCACGtgtcc LM02COM Oil 90(-)l 0.7761 0.8821 ggaCACGtgggg NMYC Oil 90(-)l 1.0001 0.9561 ggacaCGTGggg MYCMAX 021 90(-)l 1.0001 0.8791 ggaCACGtgggg MYOD Oil 90(-)l 0.7781 0.8581 ggaCACGtgggg USF 061 91(-)1 1.0001 0.9381 gaCACGtggg MYOD 061 91(+)l 0.7661 0.8921 ccCACGtgtc USF 061 91(+)l 1.0001 0.9561 ccCACGtgtc USF Cl 92(+)l 1.0001 0.9981 cCACGTgt USF Cl 92(-)l 1.0001 0.9901 aCACGTgg CETS1P54 Oil 95(-)l 1.0001 0.9001 ccCGGAcacg IK2 Oil 114(+)l 1.0001 0.8711 ttcgGGGAcctt MZFl Oil 114(+)l 1.0001 0.9511 ttcGGGGa RREBl Oil 117(-)l 1.0001 0.8601 cCCCAaaggtcccc MZFl Oil 124(+)l 1.0001 0.9651 tttGGGGa IK2 Oil 124(+)l 1.0001 0.8871 tttgGGGAccgt NFKB 061 126(+)l 1.0001 0.8801 tgGGGAccgtccag CETS1P54 Oil 136(+)l 0.9261 0.8521 ccAGGAataa CEBPB Oil 164(-)l 0.9861 0.8971 cttttctGAAAgac CEBPB Oil 165(+)l 0.9861 0.8841 tctttcaGAAAagc BARBIE Oil 170(+)l 1.0001 0.8601 cagaAAAGcggcgtg AHRARNT Oil 172(+)l 1.0001 0.8821 gaaaagcggCGTGaca TCFll Oil 174(-)l 1.0001 0.8771 GTCAcgccgcttt USF 061 17701 1.0001 0.8631 gtCACGccgc APIFJ 021 181(+)l 1.0001 0.9091 cgTGACaggga API 021 181(+)l 1.0001 0.8781 cgTGACaggga IKl Oil 184(+)l 1.0001 0.8881 gacaGGGAaaaca IK2 on 184(+)l 1.0001 0.9471 gacaGGGAaaac NFAT 061 185(+)l 1.0001 0.9371 acaggGAAAaca AP4 061 200(+)l 1.0001 0.8661 aaCAGCtcta AP4 051 200(+)l 1.0001 0.9141 aaCAGCtcta MZFl on 208(+)l 1.0001 0.9541 taaGGGGa IKl on 208(+)l 1.0001 0.8621 taagGGGAaaaaa IK2 on 208(+)l 1.0001 0.9081 taagGGGAaaaa NFAT 061 2090)1 1.0001 0.9601 aagggGAAAaaa CETS1P54 on 2260)1 0.9261 0.9491 ccAGGAagca NFAT 061 266(-)l 1.0001 0.9321 cgtggGAAAcct IKl on 26601 1.0001 0.9241 gcgtGGGAaacct RFXl 021 266(-)l 0.8821 0.8611 agcccgcgtggGAAAcct IK2 on 267(-)l 1.0001 0.9711 gcgtGGGAaacc NMYC on 2710)1 0.7791 0.8521 tcccaCGCGggc NMYC on 27101 1.0001 0.8971 gcccgCGTGgga AHRARNT Oil 27101 1.0001 0.8551 ttgagcccgCGTGgga USF 061 272(+)l 1.0001 0.8931 ccCACGcggg USF Cl 273(-)l 0.8131 0.8681 cCGCGTgg ziD on 2790)1 1.0001 0.8641 ggGCTCaaggagc AHRARNT Oil 3060)1 1.0001 0.9151 gaagccgcgCGTGcgc NMYC on 3100)1 1.0001 0.8881 ccgcgCGTGcgc USF 061 31101 1.0001 0.8521 cgCACGcgcg USF Cl 3120)1 0.8131 0.8671 gCGCGTgc AP2 061 326(-)l 0.9761 0.8711 aaCCCCgcgccg RFXl on 33301 0.9451 0.8821 cggggccgcaGT AAccc RFXl 021 33301 0.9451 0.9151 ccggggccgcaGT AAccc EGRi on 3480)1 0.8261 0.8591 cggcgtgGGTGg EGR2 on 3480)1 1.0001 0.8831 cgGCGTgggtgg EGR3 on 3480)1 1.0001 0.8851 cgGCGTgggtgg NGFIC on 3480)1 1.0001 0.9241 cgGCGTgggtgg G c on 3510)1 0.8721 0.9101 cgtgGGTGgggcgc SPl 061 3510)1 0.8191 0.9041 cgtgGGTGgggcg MZFl on 3550)1 1.0001 0.8541 ggtGGGGc IK2 on 36801 1.0001 0.8881 gggaGGGAcctg GC on 369(-)l 0.8771 0.8881 gcggGGAGggacct SPl 061 370(-)l 0.8451 0.8931 gcggGGAGggacc IK2 on 372(-)l 1.0001 0.8701 cgcgGGGAggga MZFl Oil 376(-)l 1.0001 0.9751 cgcGGGGa MYCMAX 021 381(-)l 0.8101 0.8711 gagCACTtgcgc LM02C0M Oil 381(4-)! 0.7941 0.9001 gcgCAAGtgctc USF Cl 383(-)l 0.8361 0.9121 gCACTTgc NKX25 Oil 383(-H)l 1.0001 0.9461 gcAAGTg GC Oil 391(-)l 1.0001 0.9701 cgggGGCGgggcga SPl 061 392(-)l 1.0001 0.9941 cgggGGCGgggcg AP2 061 397(-)l 1.0001 0.9041 gcCCCGggggcg AP2 061 397(4-)! 0.9761 0.8871 cgCCCCcggggc AP2 061 398(4-)! 0.9761 0.8671 gcCCCCggggcc AP2 061 399(4-)! 1.0001 0.8641 ccCCCGgggccg AP4 051 414(4-)! 1.0001 0.8551 caCAGCcccg CETSIP54 Oil 429(-k)l 1.0001 0.8591 ccCGGAgaag TCFll Oil 432(-)l 1.0001 0.8761 GTCAggcttctcc API 041 439(-H)l 1.0001 0.8531 ccTGACttgag API 021 439(-h)I 1.0001 0.8701 ccTGACttgag APIFJ 021 439(4-)! 1.0001 0.8911 ccTGACttgag CREEPICJUN Oil 441(-h)I 0.7631 0.8561 tgACTTga NKX25 Oil 442(-)l 1.0001 0.8801 tcAAGTc CEBPB Oil 452(-)l 0.9861 0.8751 ctctgcaGAAAggg NFKB Cl 459(-)l 1.0001 0.8601 cGGGACtctgca IK2 Oil 462(-)l 1.0001 0.8961 tgccGGGActct IK2 Oil 474(- h)I 1.0001 0.9321 gtgcGGGActcc CETS1P54 Oil 479(-)l 1.0001 0.8771 acCGGAgtcc SPl 061 487(-)l 1.0001 0.8631 gaggGGCGgctac CETSIP54 Oil 494(-)l 1.0001 0.9071 acCGGAgggg SPl 061 502(-)l 1.0001 0.8631 gaggGGCGgctac GC on 506(-)l 0.8771 0.8501 ggcaGGAGgggcgg CETS1P54 on 509(-)l 0.9261 0.8711 gcAGGAgggg GC on 524(-)l 1.0001 0.8621 atagGGCGgcggcg SPl 061 525(-)l 1.0001 0.8781 atagGGCGgcggc AP2 061 552(-)l 0.9051 0.8521 gcCCCAgaggcc AHRARNT Oil 567(-)l 1.0001 0.9051 gctgggcagCGTGctc

Figure 4.101: Analysis of the 5a-reductase I promoter using Matlnspector to identify putative consensus binding sites for transcription factors. The sequence of the 0.59kb 5a-reductase I promoter (shown above) was analysed using the Matlnspector programme as described on the website using the parameters described below. Solution parameters: Core similarity:0.75. Matrix similarity:0.85 Explanation fo r column outputtMdiivix positions correspond to sense strand numbering, but all sequences are given in 5'- 3' direction, n/a in column 'core simil.' indicates, that no core search was conducted. Capital letters within the sequence indicate the core string.

136 Factor or Site name Loc.Str. Match Ratio Factor or Site name Loc.Str. Mate

TCF-1 factor 165(-) 0.61 GCF factor 28(-) 0.90 TCF-1 factor 173(-k) 0.72 TR factor 52(-) 0.55 Lva factor 199(4-) 1.00 ElA -F factor 69(-) 1.00 TCF-1 factor 207(4-) 0.67 f_alp-f_eps factor 70(-) 1.00 PU.l factor 211(4-) 0.81 Elk-1 factor 70(-) 1.00 ENKTFl factor 222(-) 0.76 GTE factor 74(+) 0.53 LBP-1 factor 226(-) 1.00 T-Ag factor 89(-) 0.93 PU.l factor 227(4-) 0.74 NF-uE4 factor 92(+) 0.93 Elk-1 factor 227(4-) 1.00 MLTF factor 93(+) 0.81 TCF-1 factor 240(4-) 1.00 LBP-1 factor 105(+) 1.00 E2F-DRTF factor 253(-) 0.82 H4TF2 factor 108(4-) 1.00 LBP-1 factor 264(-) 1.00 TCF-1 factor lll(-) 0.75 TEF factor 302(-) 0.86 Elk-1 factor 112(-) 0.79 GCF factor 309(4-) 0.90 ARP-1 factor 119(4-) 0.81 MRE-BP factor 31K-) 0.76 H4TF2 factor 119(-) 1.00 NRF-1 factor 31K-) 0.96 AF-1 factor 120(4-) 1.00 MEP-1 factor 316(-) 0.88 NF-BAl factor 121(+) 1.00 TCF-1 factor 32K-H) 0.82 TCF-1 factor 122(-) 1.00 GCF factor 325(-k) 1.00 CTF factor 125(-) 0.43 AP-2 factor 327(-) 0.61 AP-3 factor 126(+) 0.66 AP-2 factor 344(+) 0.69 TR factor 128(4-) 0.57 T-Ag factor 344(-) 0.93 H4TF2 factor 129(-) 1.00 CAC-BF factor 353(-) 0.96 LBP-1 factor 136(-) 1.00 Spl factor 354(4-) 0.77 PU.l factor 137(4-) 0.74 T-Ag factor 358(4-) 0.93 TCF-1 factor 149(4-) 0.89 TR factor 362(-) 0.66 SIF factor 161(4-) 1.00 TEF factor 363(-h) 0.80

137 LVc factor 367(-) 1.00 R2 factor 510(4 1.00 H4TF2 factor 370(+) 1.00 Spl factor 508(-) 0.66 Spl factor 371(4 0.69 T-Ag factor 508(4 0.93 GCF factor 392(-) 1.00 LVc factor 514(+) 1.00 Spl factor 393(-) 1.00 CTF factor 515(4 0.40 T-Ag factor 393(-) 0.93 EGR-1 factor 516(+) 0.77 EGR-1 factor 397(+) 0.80 T-Ag factor 517(4 0.93 T-Ag factor 398(-) 0.93 ETE factor 518(+) 0.93 AP-2 factor 399(+) 0.75 GCF factor 522(4 1.00 TR factor 40K-) 0.65 AP-2 factor 526(+) 0.67 T-Ag factor 404(+) 0.93 Spl factor 526(-) 0.74 TCF-1 factor 414(+) 0.56 E2F-DRTF factor 541(+) 0.60 GCF factor 417(-) 0.86 AP-2 factor 548(+) 0.62 AP-2 factor 418(+) 0.69 T-Ag factor 553(4 1.00 T-Ag factor 418(-) 0.93 TCF-1 factor 554(-) 0.93 TEF factor 438(-) 0.86 T-Ag factor 559(+) 0.93 NF-BAl factor 451(+) 0.91 ENKTFl factor 565(+) 0.76 TCF-1 factor 453(4 0.75 CTF factor 567(+) 0.46 Elk-1 factor 454(4 0.79 Spl factor 576(-) 0.60 TCF-1 factor 461(+) 0.54 LBP-1 factor 578(-) 0.90 T-Ag factor 493(-) 0.93 AP-2 factor 581(+) 0.63 TR factor 508(4 0.60 LBP-1 factor 583(+) 1.00

Figure 4.10II: Analysis of the 5a-reductase I promoter using Signal Scan to identify putative consensus binding sites for

transcription factors. The sequence of the 0.59kb 5a-reductase I promoter was analysed using the Signalscan programme as described on the website.

138 Identification of transcription factors involved in 5a-reductase I promoter activity Using the consensus sequence identification programmes, the critical sequence between -150 and -300 bp upstream of the 5a-reductase I promoter was analysed. There are several SPl, GCF and AP2 transcription factor binding sites present in this region. SPl is found in GC rich promoters (Valerio et al, 1985) and since this is also GC rich, this TF could be involved in the activation of this promoter. Since AP2 expression is seen in the adult prostate (Moser et al, 1995) this together with SPl were chosen for further study.

To determine whether SPl and AP2 can modify the level of transcription of the luciferase gene driven by the 0.59kb 5a-reductase I promoter, this construct was co-transfected with either the SPl or AP2 expression vector in the prostate cell line DU145 (Figure 4.1 II, H) and the glioma cell line LAN-1 (Figure 4.121, U) in various ratios (see section 2.6c). The rate of transcription driven by the 0.59kb promoter was not altered by either AP2 or SPl expression vectors (Figure 4.11, 4.12). Since it was possible that these two transcription factors worked in concert to alter transcription, these cells were transfected with the 0.59kb promoter together with both AP2 and SPl expression vectors. However the rate of transcription remained unaltered (Figure 4.1 in, 12H). Therefore under the conditions described in this study AP2 and SPl do not modify the transcription driven by the 0.59kb 5a-reductase I promoter construct.

139 Effect of AP2 on transcription driven by the 5a-reductase I promoter in DU 145

///

Figure 4.111

140 Effect of SP1 on transcription driven by the 5a-reductase I promoter in DU145

0.9

0.8

0.7

u 0.6

> 0.5 I- ^ 0.3

0.2

0.1

0 ..é k‘> /^ <•' 4^ ^s>

Figure 4.11 II Figure 4.11: Effect of AP2 and SPl transcription factors on transcription driven by the 5a-reductase I promoter in DU145. Cells were transiently transfected with the pGL5cxRI0.59 (RI) and p-galactosidase constructs with either or both the AP2 and SPl expression vectors in different ratios (section 2.6c) and luciferase activity normalised against p-galactosidase activity. To determine the effect of DNA concentration on transcription, the experiments were also repeated with the same amount of a non-specific plasmid (NSP). Results are expressed as the luciferase activity of the constructs as a percentage of the positive control construct pCMVLuc and show two independent experiments. 141 Effect of AP2 on transcription driven by the 5a-reductase i promoter in LAN-1

Figure 4.12 I

142 Effect of SP1 on transcription driven by the 6a-reductase I promoter in LAN-1

ll]pGL2Basic ■ pGLR5al0.59 Ratio of RI:SP1 □ 10:1 ■ 1:1 □ 1:5 ■ 1:10 Ratio of R1:NSP ■ 10:1 □ 1:1 □ 1:2 ■ 1:5 ■ 1:10 Ratio of RI:AP2:SP1 ■ 1:1:1 ■ 1:5:5

Figure 4.12 II

Figure 4.12: Effect of AP2 and SPl transcription factors on transcription driven by the 5a-reductase I promoter in LAN-1. Cells were transiently transfected with the pGL5aRI0.59 (RI) and p-galactosidase constructs with either or both the AP2 and SPl expression vectors in different ratios (section 2.6c) and luciferase activity normalised against P-galactosidase activity. To determine the effect of DNA concentration on transcription, the experiments were also repeated with the same amount of a non-specific plasmid (NSP). Results are expressed as the luciferase activity of the constructs as a percentage of the positive control construct pCMVLuc and show two (I) and three (II) independent experiments with their SEM.

143 4.4 DISCUSSION

In this study, 4.6kb of the 5' flanking region of 5a-reductase I gene was cloned and sequenced, the ability of a series of deletion constructs to transcribe a reporter gene analysed, critical regions of the promoter and the transcription start site identified.

Initial screening of the genomic DNA library with the 5a-reductase I cDNA probe isolated clones containing the pseudogene. The sequence homology between the 5a-reductase I gene and it’s pseudogene is about 95% (Jenkins et al, 1991), so any probe designed to hybridise to 5a-reductase I gene sequences may also hybridise to it’s pseudogene. Also, since this pseudogene lacks introns, it bound preferentially to the probe rather than to the gene, which contains four large introns of 4-14kb. To address this problem, a shorter probe designed to hybridise to sequences 5' of the gene that differ from the pseudogene was produced. However, the short probe failed to hybridise specifically to any clones. The third strategy, using a probe consisting of partial exon I and some sequences 5' of the 5a- reductase I gene, identified a clone containing the type I gene sequences, as unlike the first probe it did not contain the cDNA which hybridised to the pseudogene more efficiently.

From clone P2, 4.6kb of sequences 5' of the 5a-reductase I gene was cloned and sequenced. A series of deletion constructs ranging from 4.6kb to 160bp were produced. Since there were convenient restriction enzyme cleavage sites present in the 5' region, nested deletion was not necessary. Transfection of these constructs in prostate and CNS- derived cell lines showed that the relative promoter activity of the constructs was similar in all the cell lines tested. Critical regions involved in 5a-reductase I gene transcription were identified from these transfection studies. The lowest promoter activity was seen in the first 160bp, higher than that of the control plasmid, indicating that sequences needed for basal transcription is located within this region. Indeed, primary sequence analysis revealed that there is a putative TATA box in this region. The highest promoter activity was seen in the first 600bp upstream of the ATG initiation site, suggesting that this region possibly contains promoter and/or enhancer element(s) that enhance transcription together with the basal transcriptional unit. Since the smaller 0.52kb construct produced lower promoter activity than the 0.59kb construct, it indicates that truncating the 0.59kb promoter may remove part of some enhancer element. Therefore, the enhancer region extends further 5' to the 0.52kb promoter. Truncating the promoter below 300bp produced the greatest loss of promoter 144 activity, indicating that the sequence between 150 to 300bp upstream of the ATG initiation site is the region where important enhancer elements are present. Since the larger 4.4kb and 1.7kb promoter fragments produced weaker promoter activity than the 0.0.59kb or the 0.52kb promoter constructs they are likely to contain elements inhibiting transcription. Putative repressor element(s) present further upstream of the first 600bp reduces the promoter activity as does truncating the 0.59kb promoter fragment below 520bp.

An earlier study showed that a 528bp promoter fragment (nucleotides -556 to -28) of the 5a -reductase I gene induced approximately 10 times more chloramphenicol acetyltransferase activity than control (Jenkins et al, 1991). The 0.59kb construct produced in this study induced more than 20 times and 40 times luciferase activity than the control plasmid in

PC3 and DU145 respectively. Although the activity of the 5a-reductase I promoter fragments were low compared to the positive control CMV promoter (one of the strongest known promoters), it was similar to other prostate specific luciferase promoter constructs tested in prostate cell lines. For example the 1614bp promoter fragment immediately upstream of the fibroblast growth factor 1 (FGFl) gene produced 13 times more luciferase activity than the promoterless pGL2Basic vector in PC3 cells (Payson et al, 1998). While the 2kb PSMA promoter was about 7 times more active than the control plasmid in DU 145 cells (Good et al, 1999).

The promoter activity was at least an order of magnitude higher in the CNS-derived cell lines which do not express the 5a-reductase I gene, than the prostate lines which do express the gene (as determined by RT-PCR, see chapter 6). Since the gene is not expressed in the CNS-derived cell lines, the specific transcription factors required to drive the transcription of the gene are likely to be absent, in contrast to the prostate cell lines. The higher activity of the promoter constructs in these cell lines could be a consequence of much higher transfection efficiency. Tissue specific transcription mediated by the 5a-reductase I promoter did not take place since the relative order of activity of the constructs were the same in both the prostate and the CNS-derived cell lines. Therefore more general transcription factors were probably interacting with the 5a-reductase I promoter to transcribe the luciferase gene.

The 5' promoter of the 5a-reductase I gene is GC rich, the GC content of the first 300bp

145 upstream of ATG is -75%. Initial sequence analysis showed a putative TATA element at - 55bp. Primer extension analysis carried out in PC3 and DU145, with a 29nt Hex labelled primer, produced an extension product of 84bp. Therefore subtracting the primer length indicates that the start site is at -55bp upstream of ATG, where the TATA box is situated. The presence of the TATA box, which binds RNA polymerase to initiate transcription, helps to anchor the transcription start site and as a result a single start site was identified unlike for the type II gene (Labrie et al, 1992). A single transcription start site in the rat 5a- reductase I gene was previously mapped at -17bp (Andersson et al, 1989).

The consensus sequence identification programmes failed to identify any hormone responsive elements such as androgen response elements (ARE) in this promoter. DHT has been shown to induce 5a-reductase expression in rats in a feed forward mechanism (George et al, 1991). Therefore this promoter would be expected to contain an ARE to which DHT activated androgen receptor (AR) could bind to upregulate transcription. Nevertheless not all androgen-inducible genes contain AREs in their promoter. For example PSMA expression is down regulated by androgens (Wright et al, 1996) but its’ promoter does not contain an ARE (Good et al, 1999). Also androgen regulation could be mediated by non-consensus AREs (sequences of which diverge considerably from the ARE consensus sequence of GG(A/T)ACAnnnTGTTCT) (Chang et al, 1995) as is the case for the AREs found in the PSA enhancer (Huang et al, 1999). Alternatively 5a-reductase mRNA expression could be under paracrine control with prostate specific factors regulating enzyme activity (Bayne et al, 1998b) in which case AREs may not be necessary.

However consensus sequences for many transcription factors (TPs) notably SPl, AP2 and GCF were identified in the 5a-reductase I promoter particularly in the critical region between 150 and 300bp upstream of the ATG site. SPl sites are found on GC rich promoters like the SV40 early promoter region (Fromm et al, 1982). AP2 has been shown to mediate transcriptional activation by phorbol-ester and diacylglycerol-activated protein kinase C, and cAMP-dependent protein kinase A (Imagawa et al, 1987). Since we did not know which, if any, of the putative TF sites are functional, SPl and AP2 were chosen for further study. If these TFs were involved then transfecting the expression plasmid with the promoter construct would either up or down regulate the promoter activity. Co-transfection of the 0.59kb promoter construct with SPl or AP2 expression vectors alone or together

146 showed that these TFs do not effect transcription from this promoter under the conditions described in the study. Therefore other TFs are probably involved in mediating enhanced transcription from the 5a-reductase I promoter. Future studies should be concentrated towards identifying the DNA elements responsible for regulating transcription form the 5a- reductase promoter. Identifying the TFs that are functionally relevant in this promoter may help elucidate the mechanism of gene regulation of this important enzyme.

147 Appendix 1

1 TCTACAATGT TTTGTTCATA CCCTTCAGCT GTGTGTTCAG AAAATTAAAG

51 C AAAC AAAAA C ATAGCTGGC TGTTGGC AG A GAGC AATTCA CCTTC ATTCT

101 TCAACTACAG ACAACCTGCA GATTCTAAGA GTTTGGTAAT TACCTTGTCA

151 TATACCC AGA C AC ATTGTT A AAC AAGGTGG AAAAGCAGCT ATGTAAATGT

201 TAAAAGGGCT GATCAAATCC AAGTGTAACT GTAGTTTGCA GAGAATAATA

251 AAAAACTAGC AAGCCTTATT GACATCGTAT GGTTTCTCCT AGTTTGTTGG

301 AGCCTGCAGA AGAAAATGCC CACATGGAGG TGCCTTAAGA GCACACCTCT

351 TCCCTATAGA CACATGCTGA AACGTTCCTC CTGGACAGGA ACTTCTTCAT

401 CTTAAAAGCA TTTCTTATCC CGTCTCTGCG CTTCTAAACA CAAGGTTTTA

451 GAAACAAATG TTTCCAGGTG ATTGTGTGAA GCAGCACATA CATGCATCAC

501 TGCTAAAAAT ACAAACATGC CCGAGGAGAA TCGTAATCCT GTCTTCTTAA

551 AATATTTTAG ATGGTTTGGC TCTGTGTTCC CACCCCAATT TCACCTTGTA

601 ATTGTAATAT TCCCCACGTG TCAAGGGCAG GACGAGGTGG AGATAATTAA

651 ATCCCCGGGC CGTTTCCCTC ATGTTGTTCT CACAACAGTG AGTTCGTTCT

701 CAGGGGGAGA TCTAATGGTT TATTAGGGGC TTCTTCCTTT GCTCAGCACT

751 CATTCTCTCT CCTGCCACCC TGTGCAGAGA GATCTTCCGC CATGATTTTA

801 AGCTTCCTGA GGCCTCCCCG GCGATGTGGA AATGTGAGTC AATTAAGCCT

851 ATTTCCTTTA TCTATACATT ACTCAGGTAT GTCCTTATAA CAGTGTGAAA

901 ATGGACTACT ACAGTATCAG ACCTCTACTT CAAGTACAAC ACAATCAGTG

951 TCGTCAATCA AATCTTCAAA CCAAACGACT TGAGCAAAGT CTACAACCTA 148 1001 GTTACCAGGA GGAAGAAAAG CTTGATCTCG TGAAGGTTAC CTCATCTCAG

1051 C AATGCCATA ACTAGAGGCT GAAAAAC ATC TACCTTTTCC ACTGATCTCA

1101 CTACAGTGGA CAATTAGTGA CCACTAACAG CAACGTAGCA CCCGTATCAT

1151 TTTCCTATAC TGTACCCTTC AAGCTTTTAA AAATCTAAG A TGTGGC ATAT

1201 CTATTCTTTT TTCCCTTTTT GAGACATGGT CTCGCTCTGT GGCCCAGGCT

1251 GGAGTGCAGT GGCATGATCT TGGCTTACTG CAACCTCCAC CTCCTGGGTT

1301 CAAGCGATTC TCATGCCTCA GCCTCCCTAG TGTCTGGGAT TACAGGCGTG

1351 TGCCACCATG CCTGTCTAAT TTTTGTATTT TTAGTANAGA TAGGGTTTCA

1401 CGATGTTGGT CATATTTATT CCTATATCCC AGCAACACAT TCCATGATGG

1451 TGATATTCGG TCTTGATACT GGTTGAATAC TGACTTAATG TTTGGCCAGT

1501 CAGCATTCAT TGTGAATGTA TATGCTTATC TGTGATAGGG ACAATGAAAA

1551 TCCAAATAGC CAATGAAAGA AAAACAAGCA AATCTGTACC CCATGATTAA

1601 TGAAAATCTG ACCTTGATTT GCGAACACTA AAGGTTATCC AAAAAGGAAA

1651 G ATAAC ACT A CGTACTGGAA TAGTC AAAAC CTC AAAAGTT G ATGC AAAAC

1701 GCTTAATTTG GCAGGGCGCA GTGGCTCACG CCTGTAATCC CAGCACTTTG

1751 GGAGGCCGAG GTGGGCGGAT CATGAGGTCA GGAGATGAGA CCATCCTGGC

1801 TAGCAAGGTG AAAACCCGTC TCCACTAAAA ATACAAAAAA ATTGGCCGGG

1851 CGTGGTGGCG GGCACCTGTA GTCCCAGCTA CTCGGGAGGC TGAGACAAGA

1901 GAATGGCGTG AACCAGGGAG GTGGAGCTTG CAGTGAGCCA AGATGGTGCC

1951 ACTGCTCTCC AGCCTGGGCG ACAGAGTGAG ACTCCGTCTC CCAACCAACA

149 2001 AACAGACAAA CCAAAAACGG CTTAATTCAC CTTTTCGTGC ATTACTTTTC

2051 TGAGAACTCA ATACCTCAAA GTTAATAATA ACGACTTTCC CACTTATGTA

2101 AGTTAACTGA AGGACTGGCG CCTCCGGAGT TCTCCAAGCA TCTTTACAAG

2151 ATGCTATCAG C ACAAGGGAT C ACCTTCATA CAACTG AGAC TAGNACCGAG

2201 CCATGAGGNA TAGGTAACCC AGAAGGCACC TCCAGGACAG GTCAAGAAAG

2251 AGGTAGCTCC CAGAGTAGTA GCACGCTTGG GTGCTGAGAC TCGGAAATGC

2301 TAACATTGGC TGGTGCAGTC TGTACTGCGA AGTACCAGGA GACAACCTGA

2351 CAGCAGACAG TGGTAACCTG TCTGTAATGG AAAACACTAA GAGACTACCT

2401 ACCAGGAGAC TGTTGTCAAG CTAAGTCTGT CCTTTTTCTG AAGGCAAAGC

2451 AGCCACTCTG CAACAGTTTT GATGTGAGAA AACAAGGGCT GTAAAAGGGA

2501 GCTGGCGGAA GTGGTGACAT AAAGGAAGAG GCTGGATGTA CTAGGAAGAG

2551 CTGGCTGAAA TCAGTGACTC ATAAAGCTGC AAATCGCAAA TCGCATGAAA

2601 ACTTGCGTAG CAATATAATG TTGATAAAAG CACCAGGTAC TAGAACATTA

2651 GGATGTTTGC AAAGTATACC CAAGCTCTTT AACAGCAAAT GCAGTACCAA

2701 GAAATATAAT TCAAGTGATA GAGATTAATA TCCCAAATAA ATATTCGGCA

Kpnl 2751 TGAAGCACTG TGGTACCTAC CAACTCAGTG GCTGTGGAAC TTCAACTTTC

2801 TGACCGTCCA CCTCCAGGTC CTCCAATTCC TTAAAATATT TGTTCTTTAA

2851 GCAATGGAGA ATCTCTTTTG CGTGGCTATT GAAAAATAAG GAAGTTTCAA

2901 ACTGATCTAA AAAACTAAGT TAATACATTG TATCTTCTTA AATTTAAGAC

2951 TGCAAGTGTT TTAAAACTAA AACCAACTTT TGCATGGAGA GTAAACATTC

150 3001 TTTAGTCACT ACTTTTACAC TGTATGCCTT CAAAATTTAA GCAATCCACA

3051 CTGTTTGAGC CCTAAGAGCA ACACTGCATG CCTTCTCTCC TAAGCATATC

3101 CT AC AGTTAT AGTTTTACTT GCG ACTC ATT TAG AAAG ATG TAACTAC AAA

3151 GATGGAGGGG GGGCGCGGAG GAGGGGAGAA CCAAGGGGTT TTATGCATTC

3201 TCTATAAATT GTCCTACGTT CCAAAAGGTA AGACCCTCAG CTTACCCTAN

3251 NTGGAAGATT ACCCCAGGAG CCGAATNTTA CCTCAGATNT CATTTTCATT

3301 TNGTGTTCTA ACCTTGCGCC TGCAATACCT CCGTGACCAT TTCATTGGAC

3351 CNTGTGCTCC CCACCTCAAT GCTTCCTGAA TCCAAACCGN TGAAACGCCA

3401 CGGTTCTCTG GCACTGTAAC ACTTGTCGAA GAAAACACCG TCGCCTTTAA

3451 CCTCCAGCAT CNTGGCCCCA ACTCCCAAAA AATCAGGCAC TGCCTCCNTA

3501 CCTTTTGTAA CCAGTAATTN TTAAAGTGGC CGGGAGCGGC TCCCTGAGAG

3551 CGTCCATGAA CTGGCCCCAC TCGCCCTCGG GCACGATCTT GAGCTCATGG

3601 TAGTAGTGCT CGAACAGCTT GTTCTCCTAG ACGATCTCGG GGTAGCCTCC

3651 TTCCCAGCCC TGAGGAAAGG AAAAGAGACT TTACCCCGAG GCCCAAGGAA

3701 CCGCCCCTTC GCCGCCGCNT NGCAGGCCTC GGTGTCCGGG AAGCCCAGGA

3751 GGAGCCCCTG GCCCGCCCGC CGGGTCCCGG CTCCTACCGC CTCGCCGCGC

3801 TTTCCACCAC CCTCGGCGCC ATCCTCCGCG TCCTCCGGCC GCTGCTGTTG Not\ 3851 CTGGAGCCGC CGACCCCGCG ACCGCCGCCC CATAGCCCAC GCGGCCGCGC

3901 ACGCAGCACG CAGAAACCGG CCCGCCACGG CCAGAACTAT AGCCCTACAC Sma I 3951 CTCCCGGGAC TTCCGGCCGG AAACCAAGGC CCCACGTGTC CGGGCCTGGT

151 4001 CCTTTCGGGG ACCTTTGGGG ACCGTCCAGG AATAAGCCCA AAGCGCACAA

4051 CCCGTCTTTC AGAAAAGCGG CGTGACAGGG AAAACAGCGA ACAGCTCTAA

4101 GGGGAAAAAA ATGCTCCAGG AAGCAGCCAC AAAGGCGTCT CCGCGCGAAG Sac I 4151 CGCCCAGGTT TCCCACGCGG GCTCAAGGAG CTCCGCGGAC AGCCTGAAGC

4201 CGCGCGTGCG CAGAGCGGCG CGGGGTTACT GCGGCCCCGG CGTGGGTGGG

4251 GCGCTTGCAG GTCCCTCCCC GCGCAAGTGC TCGCCCCGCC CCCGGGGCCG pGL5oRI0.15 4301 ACCCACAGCC CCGGCTACCC CGGAGAAGCC TGACTTGAGA ACCCTTTCTG

4351 CAGAGTCCCG GCAGTGCGGG ACTCCGGTAG CCGCCCCTCC GGTAGCCGCC TATA box 4401 CCTCCTGCCC CCGCGCCGCC GCCCTATATG TTGCCCGCCG CGGCCTCTGG Translation start site 4451 GGC ATGGAGC ACGCTGCCCA GCCCTGGCGA TG

Sequences upstream of the Sa-Reductase I gene

152 CHAPTER 5

CLONING AND CHARACTERISATION OF THE 5' REGULATORY REGION OF THE 5a-REDUCTASE II GENE

153 5.1 INTRODUCTION

The 5a-reductase H gene has been sequenced and mapped to band p23 of chromosome 2

(Andersson et al, 1991, Labrie et al, 1992). The transcriptional start site and 743bp of 5' region of the gene have been sequenced but the gene regulatory activity of this fragment has not been characterised (Labrie et al, 1992). However to identify the DNA regulatory elements and transcription factors involved in regulation of the 5a-reductase II gene, sequences further upstream need to be cloned and transcriptional activity assayed. Therefore, in this study attempts were made at cloning and characterising sequences further upstream of the 5a-reductase II gene. However, as in the above study only 743bp immediately upstream of the 5a-Reductase II gene was cloned, sequenced and it's transcriptional activity assayed. A clone containing lOkb Sac I fragment upstream of this sequence was also isolated.

5.2 AIMS

The aim of this chapter was to clone and characterise at least 3-4 kb of DNA 5' of the 5a- reductase II gene, as this region is likely to contain most of the regulatory sites. Specifically the objectives were to • Clone and sequence 3-4kb of DNA 5' upstream of the 5a-reductase II gene. • Produce deletion constructs of the cloned region. • Test promoter activity of the deleted reporter constructs in cell lines.

Experimental plan In order to achieve these objectives the following experimental plan was devised. • Screen a human genomic DNA library in X-FIXn using probes to the 5a-reductase II gene.

Subclone isolated genomic DNA into a plasmid vector, pBluescript. Sequence DNA 5' upstream of the 5a-reductase II gene.

Subclone 5' region of 5a-reductase II gene into the pGL2Basic reporter plasmid.

Produce deletion constructs in pGL2Basic.

Transfect constructs into cell lines to test promoter activity.

Co-transfect expression vectors of relevant transcription factors (TF) with promoter constructs.

154 5.3 RESULTS

5.3.1 CLONING AND SEQUENCING THE 5' FLANKING REGION OF THE 5a-REDUCTASE II GENE

To isolate the 5' region of the 5a-reductase II gene, a human genomic DNA library was screened using 5a-reductase II cDNA, which should hybridise to any plaque that contains the cDNA sequence. Since the size of the cDNA is SOObp and the size of the insert in X FIX n is between 9-23kb, any insert containing the 5a-reductase II cDNA could also contain either or both 3' and 5' sequences.

Strategy 1: Screening with 5a-reductase II cDNA Isolation of positive clones The genomic DNA library in X FIX II was screened using a radiolabelled probe called B1 (section 2.1b), which was 5a-reductase II cDNA in a pCMV expression vector (donated by Prof. Russell), linearised and end-labelled. Two clones (DIO and D17) were isolated which hybridised to the probe strongly in the secondary screen.

These clones were picked and the phage DNA amplified in E. colt C600. The phage DNA was extracted and digested with Sal I or Xba I, which cut on both sides of the insert. The products were separated by agarose gel electrophoresis; Southern blotted and probed with B 1. Sal I excised the human DNA in clone DIO and D17 from the phage vector while Xba I cut the human DNA in clones DIO and D17 many times as it produced many small fragments. The probe B 1 hybridised to some of the fragments of the digested DNA.

Subcloning isolated genomic DNA into pBluescript The plasmid pBluescript (pBS) and phage DNA from clones DIO and D17 were digested with Sal I. The pBS was then dephosphorylated and added to the digested DIO or D17 phage DNA, ligated and used to transform XLBlue MRF competent E. colt cells. Transformed cells were grown on ampicillin agar plates with Xgal and IPTG for blue-white selection. White colonies indicating the presence of recombinant pBS were picked, grown up overnight in LB containing ampicillin, the DNA extracted and checked by digesting

155 with Sal I. Electrophoresis of digested DNA showed that some of the white colonies from DIO contained an insert of ~23kb and the vector band (~3kb). The other clones did not contain the correct sized vector band. The DNA from one of the clones which contained a large ~23kb insert was chosen for sequencing. Upon sequencing with universal and reverse primers that have complementary sites on pBS, it was found not to contain the 5a-reductase n gene but phage DNA sequence. The genomic DNA fragments from clones DIO and D17 were not separated by agarose gel electrophoresis after digestion because the possibility of shearing such large DNA fragments during extraction from the agarose gel is high. Also using this method may result in the introduction of UV induced mutations. Since digesting with Sal I produces the insert and the two phage arms there was one in three chance that former would be cloned into the plasmid. However on this occasion it seems that only the right phage arm (~19kb) was cloned, as the other clones didnot have the correct vector band.

Strategy 2: Screening with 5a-reductase II partial exon I and5' region Isolation of positive clones As for the type I gene, the next strategy was to use a probe complementary to part of exon I of the 5a-reductase H gene and sequences 5' to the coding region (probe B2). Using this probe, positive phage clones that contained exon I and some 5' sequences would be isolated. To produce the probe, primers complementary to bases -1 to -27 and +164 to +187 of the 5a-reductase II gene were used to amplify a 214bp product from human colon genomic DNA (section 2.1b). The product was sequenced to confirm that it contained 5a- reductase II gene sequences, radiolabelled and used to screen the library.

22 positive clones were identified from the primary screen. Of these, only 7 hybridised in a secondary and 6 hybridised to the probe in a tertiary screen. Phage DNA from these clones denoted P3, P4, P6, PI6, P20 and P21 were amplified and extracted. To determine whether the DNA extracted from these clones contained the 5a-reductase II partial exon I sequence, the two original PCR primers used to amplify the 214bp probe B2 described above, were used the sequence the phage DNA. However, four of the clones contained % DNA. The clone PI6 contained 5a-reductase II gene sequences; therefore subsequent work was carried out on this clone. Phage DNA from clone PI6 was digested with various enzymes, including Sal I, Not I, Xba I and Bgl H, and separated by electrophoresis. Sal I and Not I cut

156 so it is about ~17kb. Figure 5.1 shows electrophoresis and Southern blotting of Bgl II and Bgl II + Not 1 digested PI6 DNA. The radiolabelled probe hybridised to the digested DNA.

1 Hind in Bgm Bglll-^Notl Bgl II Bglll+Notl

6557

2322

Figure 5.1: Restriction digestion and Southern blot analysis of P16 phage DNA. Phage DNA from clone P16 was digested with Bgl II or Not I + Bgl II, separated on a 0.8% agarose gel (I), blotted and hybridised with probe B2 (H). The sizes of the various fragments in bp are indicated on the left.

157 Subcloning isolated genomic DNA into pBluescript Since not separating the human DNA insert from rest of the phage DNA after digestion resulted in cloning the phage arm previously, phage DNA from clone PI6 was digested with Sal I, separated on agarose gel and the 17kb band extracted. Although gel purification of such a large fragment has its disadvantages, the purified DNA was ligated with Sal I- digested, dephosphorylated pBluescript, used to transform competent E. coli cells and selected on ampicillin agar plates. Colonies were picked, grown overnight in LB/ampicillin and extracted DNA digested with Sal I. While some colonies contained only the vector DNA fragment others contained DNA fragments of various sizes, none contained the single 17kb insert. This strategy was repeated with a range of vector to insert ratios but no clones with the correct sized insert were obtained. This could be because the insert is large (~17kb) while pBS is only ~3kb.

Since attempts at subcloning the whole insert from P16 failed, subcloning smaller fragments of this ~17kb insert was attempted next. From the initial digests it was shown that Sac 1 cuts the insert of P16 to produce fragments o f-1.3, -1.0, -8 and -5 kb (Figure 5.2).

Ikb Marker P16 XHindlll

8000

5000 4,361 3000 2.322

1500

1000

Figure 5.2: Restriction digestion of P16 DNA with Sac L Phage DNA from clone P16 was digested with Sac I and separated on a 0.8% agarose gel. The sizes of the various fragments in bp are indicated.

158 The digested products were separated on a 0.8% agarose gel, blotted and probed with B2. Southern blotting indicated that the probe hybridised to the ~5 kb Sac I digested fragment. To isolate the ~5kb fragment which hybridised to the probe, phage DNA from P16 was digested with Sac I, electrophoresed on a 0.8% agarose gel, the ~5kb band excised and the DNA extracted. This DNA was ligated to Sac I digested and dephosphorylated pBS, used to transform competent E. coli cells and white colonies from Xgal/IPTG selection grown up as described before. The miniprep DNA from these colonies was checked by digesting with Sac I and found to contain a ~5 kb insert. The 5kb Sac FpBS recombinant plasmid was sequenced with universal and reverse primers in both directions. The sequencing indicated that the 5kb Sac I genomic DNA fragment contained only 743bp upstream of the ATG initiation site of 5a-reductase II gene.

The phage DNA from PI6 was also partially sequenced with T3 and T7 primers flanking the MGS of X-FIXn and the T3 linker was found next to the 5a-reductase II gene. Since the 5kb fragment contains the gene sequences it must be flanked by T3.

Subcloning the 5 'region o f 5os-reductase II gene into pGLZBasic reporter vector The pGL2 reporter plasmids (Promega) were used for promoter assays as for the 5a- reductase I promoter constructs.

To subclone the 743bp fragment from the 5kb Sac I/pBS plasmid into pGL2Basic, the sequence 5' of the ATG initiation site was PCR amplified. A 5a-reductase II specific 3' primer, complementary to bases -25 to -1 upstream of a Bgl II restriction site sequence was synthesised (Figure 5.3). Bgl II was chosen because its’ restriction site is at the 3' end of the multiple cloning site (MGS) of pGL2Basic.

-25 -1 U restriction sequence I------1------1

5a-Reductase II sequence Figure 5.3 : 5a-reductase II specific 3' primer.

Using this construct as a 3' primer, the universal primer (M l3-20 primer complementary to

159 sequences at the start of the MCS on pBS as the 5' primer and the 5kb Sac I fragment cloned into pBS as a template, a ~0.8kb PCR product was amplified. Since pG12Basic has a Sac I site in it’s multiple cloning site the PCR product was cloned into it. The PCR product was digested with Sac I and Bgl H and ligated to Sac I and Bgl H digested pGL2Basic. The resulting plasmid containing 743bp of the 5' region was called pGL5cxRII0.75.

Construction of reporter plasmids 1)pGL5cdUI0.75 pGL5ocRII0.75 was sequenced and was shown to contain the 743bp upstream sequence of the 5a-reductase II gene, already published (Labrie et al, 1992).

2) pGL5cxRII0.65 In order to produce a shorter promoter construct, the following cloning strategy was used. In the pGL2Basic MCS, there is a Kpn I site upstream of the Bgl II site. The sequence of the 0.75kb construct showed that there is a Kpn I site 644 bp upstream from the ATG site. pG15(xRJI0.75 vector was digested with Kpn I to excise the 99 bp distal promoter fragment, leaving the first 645 bp of 5a-reductase I promoter in the pG12Basic vector. The resulting smaller plasmid was gel purified, religated, used to transform competent E. coli cells and selected on ampicillin agar plates. Colonies were picked and miniprep DNA digested with Kpn I and Bgl II to check insert size. A colony containing the -0.65 kb insert was sequenced and shown to contain the expected 5a-reductase II5' sequence. This vector was called pGL5(xRn0.65. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

3) pGLSoRIIOA

To produce a promoter construct smaller than pG15cxRIIQ.65, the following strategy was used. There is a Pvu II site 379 bp upstream of the ATG site of the 5a-reductase II promoter. pG12Basic vector has a Sma I site in the MCS which produces ends compatible with Pvu n. pG15a-Rn0.75 was digested with Sma I and Pvu II to excise the 374 bp distal promoter while leaving the first 379 bp of 5a-reductase II promoter in the pG12Basic vector. The resulting smaller plasmid was gel purified, religated, used to transform competent E. coli cells and selected on ampicillin agar plates. Colonies were picked and miniprep DNA digested with Kpn I and Bgl II (since the Sma I site is destroyed after 160 religation to the Pvu H restriction site) to produce a vector band of ~5.6kb and an insert band of ~0.4kb. A colony was picked, the plasmid sequenced and called pGL5otRII0.4. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting restriction enzymes.

4)pGL5cdUI0.23

There is a Stu I site 222 bp upstream from the ATG initiation site of the 5a-Reductase II gene. pGL2Basic has a Sma I site in the MCS upstream of the Bgl II site which produces ends compatible with Stu I. pGL5ocRIIO,75 vector was digested with Stu I and Sma I to excise the 521 bp distal promoter fragment, leaving the first 222 bp of 5a-reductase II promoter in the pG12Basic vector. The resulting smaller plasmid was gel purified, religated, used to transform competent E. coli cells and selected on ampicillin agar plates. Colonies were picked and miniprep DNA digested with Kpn I and Bgl II to check the insert size. A colony containing the -0.2 kb insert was picked, the DNA sequenced and called pGL5otRn0.23. Maxipreparation of plasmid DNA was carried out and the DNA checked by digesting with restriction enzymes.

Further subcloning o f the 5 Of-reductase II promoter Since all the promoter constructs prepared so far were below 750bp, to clone further 5' region of the 5a-reductase II gene the following strategies were used.

Anchored PCR of the 5a-reductase II promoter from PI 6 phage DNA

In order to obtain further 5' sequences of the 5a-reductase II gene, long distance anchored PCR using the original PCR primers for screening the library along with T3 or T7 primers (found flanking the multiple cloning site of the phage DNA) was attempted. PCR of phage DNA from P16 was carried out using the sense primer in combination with either the T3 or T7 primers and the antisense primer in combination with either the T3 or T7 primers.

Depending on where the 5' region of the 5a-reductase II gene is found, it should be possible to PCR amplify this region using the correct combination of the four primers (Figure 5.4).

161 T7-> <-T3

Sense—>

<—AS

ADNA Human genomic DNA A DNA Figure 5.4: Anchored PCR of P16 DNA

Using the antisense 5a-reductase H primer with the T7 primer in combination with Taq extender (Stratagene) to obtain longer PCR product, several products were amplified of which a 2.5kb product was amplified consistently. This product was gel purified, reamplified and sequenced using these primers. However sequencing revealed that this DNA did not contain any 5a-reductase II sequences.

Cloning of the 8kb Sac I fragment of the human DNA insert ofP16 into pBluescript Since attempts at cloning the whole of the 17kb human DNA insert of P I6 into pBluescript failed, smaller fragments of this DNA were cloned into pBluescript. Sac I digests the human DNA insert of P16 into fragments of approximately 8, 5, 1.3, Ikb. Since the T3 linker of phage DNA (as described earlier) flanks the 5kb fragment, the remaining Sac I digested fragments must be upstream of this 5kb fragment. To determine which fragment is immediately upstream, phage DNA from P16 was digested with Sac I and separated on an agarose gel. The smaller fragments of -Ikb, ~1.3kb and -Skb were excised from the gel and DNA extracted. The extracted DNA was ligated with Sac I digested and dephosphorylated pBluescript, used to transform competent E. coli cells and selected on ampicillin agar plates. Colonies were picked, DNA extracted and checked by digesting with Sac I. Only the two smaller fragments of ~1.3kb and - Ikb were cloned successfully. These were sequenced with universal and reverse primers on pBluescript. This sequencing data and that for partial sequencing of PI6 DNA with T3 and T7 primers (described earlier) revealed that the 1.3kb fragment flanks the T7 linker of phage DNA. To determine whether the remaining Skb or the Ikb fragment was upstream of the 5kb fragment a 21mer new sequencing primer was designed. This primer corresponded to bases -682 to -703 of the 5a- reductase II promoter going in the 3' to 5' direction into bases upstream of the 5kb Sac I fragment. Using this primer as the 3' primer and the T7 primer as the 5' primer, phage DNA 162 from clone P16 was partially sequenced. This sequencing data revealed that the sequence immediately upstream of the 5kb Sac I fragment is not the same as that for the smaller Ikb fragment. Therefore the 8kb fragment not cloned is upstream of the 5kb Sac I fragment. Using this data the following Sac I restriction map was generated (Figure 5.5).

1.3kb Ikb ~8kb ~5kb

Sac I Sac I Sac I Sac I

Figure 5.5: Sac I restriction map of clone P16 P= Primer used to sequence PI6 ,0.7kb= 743bp promoter fragment of 5a-reductase H.

Therefore to further sequence the 5a-reductase II promoter, it was necessary to clone the 8kb Sac I fragment in front of the 0.74kb fragment already cloned and sequenced.

Several problems were encountered in subcloning this 8kb Sac I fragment. Phage DNA from P16 was cut with Sac I and separated on an agarose gel. It was difficult to separate the 9kb phage arm from the 8kb Sac I fragment on a low melting point agarose, even after overnight electrophoresis and the recovery of this large fragment of DNA from the gel was poor. Therefore it was difficult to set up ligations with high insert to vector ratios to ensure efficient ligation into the vector. The isolated 8kb fragment was ligated to the Sac I cut, dephosphorylated pGL5ocRII 0.75, used to transform competent E. coli cells and selected on ampicillin agar plates. The ligation was also carried out in the melted gel fragment containing the 8kb band according to a protocol from Sambrook (Sambrook et al, 1989). However both these approaches failed to isolate clones that contained the 8.7kb insert.

Nucleotide sequence o f the 5 os-reductase II promoter The sequence of the 5a-reductase II promoter as determined from sequencing pGL5ocRII 0.75 is shown in Appendix 2. The restriction sites used for cloning are indicated.

163 53.2 REPORTER ASSAYS DSING THE Sa-REDDCTASE H PROMOTER CONSTRUCTS Since I failed to clone larger fragments of the 5a-reductase II promoter, reporter analysis was carried out using the small constructs in the prostate cell line DU 145 and the glioma cell line LAN-1.

Checking constructs for transfection For reporter assays, the negative control plasmid pG12Basic (lacking promoter), a positive control plasmid pCMVLuc (containing the CMV promoter upstream of the luciferase gene) and a transfection control plasmid pCMV(3-Gal (containing the CMV promoter upstream of the P-galactosidase gene) were used. The miniprep DNA of each construct was used to maxiprep DNA for transfectioa The maxiprep DNA was checked by digesting with the relevant restriction enzymes to check the size of the plasmids (Figure 5.6.).

xriijid III pCL5o(.RTI0 65 XPst I pGI.5a.RIT0 4 ^.Hijidlll i5GL5aRJI0.23

U B K/B U B S/B U B

6.557

Figure 5.6: Restriction digestion of constructs used for transfection. Maxiprep DNA of the constructs were checked by digesting with the enzymes indicated, electrophoresed on a 0.8% agarose gel and photographed under UV. U; Uncut, B; Bgl IÎ, K:

164 Transient transfection analysis of 5a-reductase II promoter constructs Transfection of constructs in DU145 prostate cancer cell line Cells were plated in 90cm tissue culture dishes and co-transfected the following day with the promoter constructs and the p-galactosidase construct (see section 2.5b). Cells were assayed for both luciferase and P-galactosidase activity 48hour after transfection and luciferase values normalised with respect to p-galactosidase.

The pGL5ocRIIG.4 construct gave the highest promoter activity that was significantly diminished when the promoter was extended to 650bp, which gave the lowest promoter activity (Figure 5.7). However, the activity of the 0.75kb promoter was much higher than the 0.65kb and 0.23kb promoter and slightly lower than the 0.4kb promoter. The small 0.23kb construct gave lower promoter activity than the 0.4kb or the 0.75kb but it was still higher than that for the promoterless pG12Basic vector, indicating the sequences needed for basal transcription are within this region.

Transfection of LAN-1 glioma cell line Since LAN-1 has a high transfection efficiency, this cell line was chosen for transfection of the 5a-reductase E promoter constructs. Cells were plated in 6 well plates and co transfected the following day with the promoter constructs and the P-galactosidase construct. As with the prostate cell line, the pGL5ocRII 0.4kb construct gave the highest promoter activity, (Figure 5.8). The 0.75kb promoter construct was also less active than the smaller 0.65kb or 0.4kb constructs. The relative promoter activity of the individual constructs was the same in both the prostate and glioma cell line. However the constructs were more active in the glioma cell line than the prostate cell line.

165 Transcription of the luciferase gene by 5a-reductase II promoter constructs In DU145

4 -

, 6 :

O 3 - 1 i pGL2Basic 3 2,5 : ■ pGL5aRII0.75

Ü 2 ; □ pGL5aRII0.65 Q. o 1.5 □ pGL5aRll0.4

^ 1 ■ pGL5aRII0.23

0.5 0

Figure 5,7: Transcriptional analysis of the 5a-reductase If promoter constructs in DU145 prostate cancer cell line. DU 145 were transiently transfected with the 5a-reductase 11 promoter constructs and the p- galactosidase construct (see section 2.5b) and luciferase activity normalised against P- galactosidase activity. Results are expressed as the luciferase activity of the promoter constructs as a percentage of the positive control construct pCMVLuc and are mean of four independent experiments and their SEM.

166 Transcription of the luciferase gene by 5a- reductase 11 promoter constructs in LAN-1

O pQ 2Basic ■ PGL5aRII0.75 □ pQSaRIIO.eS □ pa5aRII0.4 ■ pa5aRII0.23

Figure 5.8: Transcriptional analysis of the 5a-reductase II promoter constructs in LAN-1 LAN-1 were transiently transfected with the 5a-reductase II promoter constructs and the (3- galactosidase construct (see section 2.5a) and luciferase activity normalised against (3- galactosidase activity. Results are expressed as the luciferase activity of the promoter constructs as a percentage of the positive control construct pCMVLuc and are mean of four independent experiments and their SEM.

167 5.3.3 CHARACTERISATION OF THE 5a-REDUCTASE II PROMOTER

Sequence analysis o f the 5 os-reductase II promoter

To determine the presence of putative transcription factor binding sites and hormone responsive elements, the sequence of the 5a-Reductase II promoter between 230 to 400 bp was analysed by the TFSEARCH site. Like the 5a-reductase I promoter, there are many putative transcription factor binding sites e.g. various SPl, AP2, GCF and T-Ag sites but no hormone responsive elements such as androgen responsive element ARE. An example of such an analysis is shown in Figure 5.9.

Matrix Position (str) Core Matrix Sequence Name of Matrix Simil. Simil.

AP4_Q5I 4(+)l 1.000! 0.923! ctCAGCggac AP4_Q6I 4(+)l 1.000! 0.880! ctCAGCggac ER_Q6I 12(+)l 1.0001 0.866! acgctcctctcTGACccag TCF11_01I 14(-)l 1.000! 0.866! GTCAgagaggagc AP1_Q2I 21(+)l 1.000! 0.885! tcTGACccagg AP1_Q4I 21 (+)l 1.000! 0.879! tcTGACccagg AP1FJ_Q2 21(+)l 1.000! 0.915! tcTGACccagg IK2_01I 39 (+)l 1.000! 0.893! ctcaGGGAcgcg AHRARNT_01I 40 (+)l 1.000! 0.921! tcagggacgCGTGcgg NMYC_01I 44(+)l 1.000! 0.880! ggacgCGTGcgg USF_Q6I 45(-)l 1.0001 0.895! cgCACGcgtc AP2_Q6I 47 (-)l 1.000! 0.895! atCCCGcacgcg IK2_01I 50(+)l 1.000! 0.925! gtgcGGGAtgca AP4_Q6I 68(-)l 1.000! 0.900! ctCAGCggtt AP4_Q5I 68(-)l 1.000! 0.940! ctCAGCggtt S8_01l 72(+)l 1.000! 0.928! gctgaggaATTAgggc TST1_01I 75(+)l 1.000! 0.870! gaggAATTagggccg NKX25_02I 78(-)l 1.000! 0.910! ccTAATtc IK2_01I 85(+)l 1.000! 0.901! ggccGGGAgaga AHRARNT_01I 105 (+)l 1.000! 0.878! tgccgggggCGTGtgg MZF1_01I 119(+)l 1.000! 0.854! ggtGGGGc AP4_Q5I 126(-)l 1.000! 0.902! gcCAGCtctg NF1_Q6I 129(4-)! 1.000! 0.873! agcTGGCactgatgctga GKLF_01I 170(4-)! 1.000! 0.885! ccagagcagaAGGG NF1_Q6I 182(-k)! 1.000! 0.859! gggTGGCagacgctcaga CREL_01I 224(-)! 1.000! 0.912! ggaccTTCC NFKAPPAB65_01I 224 (-)! 1.000! 0.855! aggaccTTCC IK2_01I 239(4-)! 1.000! 0.914! gggtGGGAgctg AP4_Q6I 243(-)l 1.000! 0.8951 caCAGCtccc AP4_Q5I 243 (-)! 1.000! 0.9181 caCAGCtccc IK2_01I 250(-h)! 1.000! 0.901! gtgaGGGAgtga NKX25_01I 260(-h)! 1.000! 0.884!gaAAGTg E2_Q6I 273(-)! 1.000! 0.867 ! ccatctcctcCGGTtc

168 CETS1P54_01I 275 (+) 1 1.0001 0.913 1 acCGGAggag NFAT_Q6 1 283 (+) 1 1.0001 0.938 1 agatgGAAAgac BARBIE_011 285 (+) 1 1.0001 0.8701 atggAAAGaccttgg CREL_01 1 287 (-) 1 1.0001 0.9411 aggtctTTCC NFKAPPAB65_01I 287 (-) 1 1.0001 0.9041 aggtctTTCC NF1_Q6I 294 (+)l 1.0001 0.9201 cctTGGCttgggtgttcg IK2_01I 313 (+)l 1.0001 0.9511 gggtGGGActgc AHRARNT_01I 315 (+) 1 1.0001 0.888 1 gtgggactgCGTGgtg ER_Q6 1 318 (+) 1 1.0001 0.8711 ggactgcgtggTGACcgac TCF11_01I 320 (-) 1 1.0001 0.8761 GTCAccacgcagt AP1_Q4I 327 (+) 1 1.0001 0.905 I ggTGACcgacg AP1_Q2 1 327 (+) 1 1.0001 0.9061 ggTGACcgacg AP1FJ_Q2 1 327 (+) 1 1.0001 0.938 1 ggTGACcgacg RREB1_01I 346 (-)l 1.0001 0.873 1 cCCCAacacacacc SP1_Q6I 354 (+)l 1.0001 0.868 1 ttggGGCGgaaga NRF2_01I 358 (+) 1 1.0001 0.879 1 ggcGGAAgaa CREL_01I 361 (-) 1 1.0001 0.9141 tggttcTTCC AP4_01I 367 (-) 1 1.0001 0.8541 cgattCAGCtggggtggt AP4_Q5I 372 (+) 1 1.0001 0.9511 ccCAGCtgaa AP4_Q6I 372 (-) 1 1.0001 0.9521 ttCAGCtggg AP4_Q5I 372 (-)l 1.0001 0.968 1 ttCAGCtggg AP4_Q6I 372 (+) 1 1.0001 0.928 1 ccCAGCtgaa IK2_01I 381 (-) 1 1.0001 0.878 1 cacgGGGAcgat NMYC_01I 384 (+) 1 1.0001 0.8811 gtcccCGTGggg MZF1_01I 385 (-) 1 1.0001 0.9541 cacGGGGa USF_Q6I 385 (-) 1 1.0001 0.8911 ccCACGggga IK1_01I 397 (-) 1 1.0001 0.883 1 acacGGGAagaaa NRF2_01I 398 (-) 1 1.0001 0.8701 acgGGAAgaa IK2_01I 398 (-) 1 1.0001 0.9261 acacGGGAagaa NMYC_01I 400 (+) 1 1.0001 0.8811 cttccCGTGtct USF_Q6I 401 (-) 1 1.0001 0.893 1 gaCACGggaa TH1F47_01I 413 (-) 1 1.0001 0.8721 ggcaacttCTGGaact CFBPB_01I 421 (-) 1 1.0001 0.8861 tgatgcgGCAActt S8_01l 436 (-) 1 1.0001 0.857 1 cctcaactATTAgcgt AP1_Q2I 452 (-)l 1.0001 0.8861 caTGACttgtt AP1_Q4I 452 (-)l 1.0001 0.865 1 caTGACttgtt AP1FJ_Q2I 452 (-)l 1.0001 0.899 1 caTGACttgtt TCF11_01I 457 (+) 1 1.0001 0.983 1 GTCAtggaaggac IK2_01I 475 (+) 1 1.0001 0.8901 aagcGGGAggtg DFLTAFF1_01I 479 (-) 1 1.0001 0.9521 attcACCTccc BARBIF_01I 488 (+) 1 1.0001 0.903 1 atgtAAAGccgtgga SP1_Q6I 502 (+) 1 1.0001 0.9041 agagGGCGggcga GC_01I 502 (+) 1 1.0001 0.855 1 agagGGCGggcgaa CFTS1P54_01I 533 (-) 1 1.0001 0.9021 gcCGGAggag AP4_Q5I 546 (-)l 1.0001 0.8791 tgCAGCcgcg DFLTAFF1_01I 603 (-) 1 1.0001 0.9501 tcccACCTcgc IK2_01I 606 (+) 1 1.0001 0.917 1 aggtGGGAggca NF1_Q6I 623 (-) 1 1.0001 0.955 1 ctTGGCtcccgcccctc SP1_Q6I 623 (+) 1 1.0001 0.9321 gaggGGCGggagc GC_01I 623 (+) 1 1.0001 0.8811 gaggGGCGggagcc IK2_01I 626 (+) 1 1.0001 0.897 1 gggcGGGAgcca SP1_Q6I 644 (+)l 1.0001 0.8901 agggGGCGgacac GC_01I 644(f)! 1.0001 0.8621 agggGGCGgacacg NMYC_01I 651 (-) 1 1.0001 0.893 1 ccaccCGTGtcc

169 USF_Q6I 652 (+) 1 1.0001 0.908 1 gaCACGggtg TH1E47_01I 658 (+) 1 1.0001 0.9401 ggtggcgtCTGGcgct SRF_Q6I 672 (+)l 1.0001 0.894 1 ctCCATaaaggggt TATA_01I 674 (+) 1 1.0001 0.8601 ccaTAAAggggttgc CMYB_01I 674 (+) 1 1.0001 0.868 1 ccataaagggGTTGcggg RFX1_02I 682 (-) 1 1.0001 0.9001 gcgcggcccccGCAAccc IK2_01I 704 (+) 1 1.0001 0.935 1 ttctGGGAgggc LYF1_01I 705 (+) 1 1.0001 0.926 1 tctGGGAgg NF1_Q6I 709 (-) 1 1.0001 0.8611 cggTGGCcgctgccctcc AP4_Q6I 713 (+) 1 1.0001 0.8541 ggCAGCggcc AP4_Q5I 713(+) 1.0001 0.905 1 ggCAGCggcc E2F_Q6I 737 (+) 1 1.0001 0.8641 cggCGCGagatct

Figure 5.9: Analysis of the 5a-reductase II promoter using Matlnspector to identify putative consensus binding sites for transcription factors.

The sequence of the 0.75kb 5a-reductase H promoter (shown above) was analysed using the Matlnspector programme as described on the website using the parameters described below. Solution parameters: Core similarity: 1.00. Matrix similarity:0.85 Explanation for column owfpwr;Matrix positions correspond to sense strand numbering, but all sequences are given in 5'- 3' direction, n/a in column 'core simil.' indicates, that no core search was conducted. Capital letters within the sequence indicate the core string.

170 5.4 DISCUSSION

In this study, 743bp of the 5' flanking region of 5a-reductase II gene was cloned, sequenced, ability of a series of deletion constructs to transcribe a reporter gene analysed and critical regions of the promoter identified. A Sac I restriction enzyme map of -lOkb upstream of this sequence was also generated from a phage clone containing this sequence.

The sequence of 743bp of the 5' region of the 5a-reductase II gene has already been published (Labrie et al, 1992). Since the cloning strategy used in that study also utilised the Sac I restriction enzyme, the same length of promoter was isolated in both cases and the sequence was identical. However, the transcriptional activity of the promoter fragment has not previously been investigated.

Several attempts at cloning sequences upstream of this 743bp failed. During the initial screening with the 5a-reductase II cDNA, digested phage DNA from P I6 was not separated from the genomic DNA insert prior to ligation, because disadvantages associated with this method. Since restriction digestion of the phage clones produces two vector DNA fragments of ~9kb and ~20kb, digestion with Sal I produced the human DNA insert along with these two fragments. Therefore, there was 1/3 chance that the human DNA insert would be cloned during ligation. Although many miniprep clones were (over 10) examined, none contained 5a-reductase II sequences but some clones contained the large phage fragment. Since using this method I failed to clone the 17kb insert, this fragment was gel purified next. The recovery rate of DNA from the gel was low (-30%). Therefore ligations with high insert to vector ratios were not always possible. Clones isolated contained DNA, which had a lot of non-specific restriction sites. This could be because during the replication stage, such a large recombinant plasmid was rearranged in the host bacteria giving rise to the extra restriction sites. Although it is theoretically possible to clone a insert of ~17kb into the -3kb plasmid vector pBluescript, in practice this was not achieved under the conditions described here.

Cloning and sequencing the smaller Sac I fragments and partial cloning of the P16DNA revealed that the ~8kb Sac I fragment was immediately upstream of the 743bp cloned. Attempts at cloning this -8kb fragment also failed. This 8kb fragment migrated almost to the same position as the -9kb phage DNA fragment on a low concentration, low 171 melting point agar. Therefore, complete separation of the two fragments was not possible for gel extraction. Clones selected also contained DNA which when digested with Sac I contained many fragments, indicating perhaps presence of non-specific restriction sites. It should have been easier to clone the ~8kb fragment in front of the 743bp already cloned into pG12Basic than the 17kb insert. However, this also failed.

Attempts at long distance, anchored PGR of the 5' region of the 5a-reductase H gene using primers used to produce the probe to screen the library and T3 and T7 primers, failed to produce a specific product under the conditions used. However, since PGR of genomic DNA and long distance PGR is generally more difficult, different conditions could have been tried to produce specific products.

Since attempt at cloning the 8kb fragment failed, a series of deletion constructs ranging form 743 to 230bp were produced. Since there was no 5a-reductase H expressing cell line likely to contain the transcriptional machinery needed to activate the transfected promoter fragment, constructs were transfected in DU145 (contains 5a-reductase I) prostate and LAN-1 glioma cell lines. The relative activity of the promoter constructs was the same in the two types of cell lines. Therefore, tissue specific transcription was not provided by the constructs. The first 230bp probably contains only the basal promoter element so the rate of transcription is significantly increased when it is extended to the first 400bp. The highest promoter activity is seen in the first 400bp upstream of the ATG initiation site suggesting that this region possibly contains promoter element/s and or enhancer element/s together with the basal transcription unit. The larger 650bp promoter fragment shows significantly weaker promoter activity than any of the other constructs tested. This would indicate that between 650 and 400 bp repressors or inhibitory element(s) are present. The 750bp promoter construct was more active than the 650bp construct that would indicate that between 650 and 750bp enhancers or positive regulatory element(s) are present. In the presence of the upstream positive element(s), the effect of the downstream negative element(s) at 650bp is minimal. However, the region between 230 to 4(X)bp seems to contain the strongest promoter element.

Although the cell lines used are not likely to contain the transcription factors necessary to utilise the promoter since the gene for 5a- reductase II is not expressed, constructs 172 were still active in the brain tumour cell lines which do not express the 5a-reductase H gene, and the prostate line which contain the 5a-reductase I gene (as determined by RT-

PCR). It seems that the 5a-reductase II promoter constructs were relatively more active in the DU 145 prostate cell line than the 5a-reductase I promoter constructs. This would indicate higher basal transcription from the 5a-reductase II promoter in the prostate cell line. While both the 5a-reductase I and II promoter constructs contained similar, higher level of promoter activity in the LAN-1 cell line. This could be due to high transfection efficiency of this cell line rather than any specific transcription provided by the promoter in these cells.

The 5' promoter of the 5a-reductase II gene is GC rich, GC content of the 2(X)bp fragment upstream of the ATG site is over 70%. It lacks a TATA element, which binds RNA polymerase to initiate transcription. Primer extension analysis carried out by Labrie et al, showed that there were three transcription start sites at 71, 145 and 712 bp upstream of the ATG (Labrie et al, 1992). Multiple mRNA transcripts are seen in promoters lacking the TATA box to anchor transcription. Such mRNAs which differ in their 5' non-coding region has been described for the androgen receptor, 17P-estradiol dehydrogenase (Luu-The et al, 1989), oestrogen and glucocorticoid receptors. These types of promoters contain multiple GC boxes, which have been suggested to be responsible for the regulation of transcription. Also, it has been suggested that such multiple transcripts and promoter elements may play a role in tissue and cell specific expression of the gene.

The 5a-reductase II promoter also lacks hormone responsive elements but contains many putative transcription factor binding sites including SPl (characteristics of GC rich promoter), AP2 and GCF. In the AR gene promoter the SPl site at -37 to-46 is responsible for the transcription initiation (Faber et al, 1993). Perhaps one of the putative SPl sites in the 5a-reductase n promoter is also responsible for the transcription initiation of this promoter.

The work described in this study can form the basis of future work to determine which of these many putative DNA elements are actually functional in the cell.

173 Suggested future work

The 8kb Sac I fragment or part of it, 5' to the 743bp can be cloned by a mixture PCR, sequencing and subcloning. The PCR primer designed to sequence 5' from the 743 bp can be used to sequence PI6 DNA and further PCR primers designed to sequence more in to the 5' region. Primers utilising a restriction enzyme site can be synthesised to PCR amplify fragments which should be easier to ligate in front of the 743bp already cloned into pG12Basic. Also, the process of gel purification and ligating in front of the 743bp should be repeated. Any further reporter constructs should be tested in the various cell lines as for the type I promoter.

174 Appendix 2 S a c /

1 GAGCTCAGCGGACGCTCCTCTCTGACCCAGGCAGGCGGCTCAGGGACGCG Kpn I 51 TGCGGGATGCAGAGAGAAACCGCTGAGGAATTAGGGCCGGGAGAGACTGG

101 TACCTGCCGGGGGCGTGTGGTGGGGC AG AGCTGGC ACTG ATGCTG AGAGT

151 GGCTAAGGAGCGCGGCGCCCCAGAGCAGAAGGGGTGGCAGACGCTCAGAG

201 AGCC AGGATGGTTCAGGGTCCAAGGAAGGTCCTATGTTGGGTGGG AGCTG

251 TGAGGG AGTGAAAGTGCATGAGGAACCGGAGGAGATGGAAAGACCTTGGC

301 TTGGGTGTTCGAGGGTGGGACTGCGTGGTGACCGACGGCAC AGAGGGTG Pvu II 351 TGTGTTGGGGCGGAAGAACCACCCCAGCTGAATCGTCCCCGTGGGGTTTTC

401 TTCCCGTGTCTTAGTTCC AGAAGTTGCCGC ATCAGACGCTAATAGTTG AG

451 GAACAAGTCATGGAAGGACAGCCTAAGCGGGAGGTGAATGTAAAGCCGTG Stu I 501 GAGAGGGCGGGCGAACTAAGAAGGCCITCGTTCTCCTCCGGCCACCGCGG

551 CTGCATCCTTGAGAAAGGGGTATTGCTGCGAAGCCGCGCCGGGCTGGACG

601 CGGCG AGGTGGGAGGCAGGATGGAGGGGCGGGAGCC AAGGCCGAGGGGGC

651 GGACACGGGTGGCGTCTGGCGCTCC ATAAAGGGGTTGCGGGGGCCGCGCT Bgl II 701 CTCTTCTGGGAGGGC AGCGGCCACCGGCG AGG AAC ACGGCGCG AG ATCT

Sequences upstream of the 5a-Reductase II gene Restriction enzymes used to deletion constructs are indicated.

175 CHAPTER 6

DEVELOPMENT OF CELL LINES EXPRESSING 5a-REDUCTASE II

176 6.1 BACKGROUND

Prostate cell lines expressing 5a-reductase II could be used to screen pharmaceutical agents targeting this enzyme and in elucidating the role of this enzyme in the development and aetiology of prostatic diseases. However, no prostate cell line constitutively expressing 5a- reductase II has been described. In contrast, commonly used prostate cancer cell lines such as LNCaP, DU 145 and PC3 constitutively express the 5a-reductase I isozyme (Castagnetta et al, 1994, Delos et al, 1994, Bruchovsky et al, 1996, Smith et al, 1996, Negri-Cesi et al, 1998).

A Chinese hamster ovary (CHO) cell line stably transfected with a 5a-reductase II expression vector was developed to study the biochemical properties of this enzyme (Thigpen et al, 1993b). However, expression of the enzyme in a physiologically relevant, natural cellular background (i.e. human prostate cell) is more desirable. Because CHO cells are derived from a different species and tissue, studies using these cells may be of limited relevance to growth control in human prostate cells. Most recently, the monkey kidney cell line COS-I has been stably transfected with the 5a-reductase II expression vector and the human embryonic kidney cell line HEK293 has been stably transfected with both 5a- reductase I and II to screen 5a-reductase inhibitors (Reichert et al, 2001 a, b). However, these cell lines are also not ideal as in vitro models of human 5a-reductase II expressing prostate cells for reasons indicated above.

6.2 AIM

The aim of this project was to transfect a human prostate cell line with an expression vector for 5a-reductase II enzyme. The specific objectives were to:

• Screen a panel of cell lines for expression of 5a-reductase I and n. • Stably transfect a human prostate cell line with a 5a-reductase II expression vector.

• Select clones that overexpress 5a-reductase II mRNA.

• Study the metabolism of ^H-testosterone by cells expressing 5a-reductase n.

177 6.3 RESULTS

6.3.1 SCREENING A PANEL OF CELL LINES FOR EXPRESSION OF 5 a-

REDUCTASEI AND II mRNA To identify a cell line that can be used to transfect the 5a-reductase H gene, the expression of 5a-reductase I and H mRNA was examined in various cell lines. In addition to the prostate cancer cell lines LNCaP, DU 145 and PC3, a derivative of the DU 145 cell line adapted to semm free growth conditions and called DUSF (DU 145-Serum Free), a human prostate epithelial cell line Pre2.8 and a stromal cell line S2.13 from the same patient, immortalised with a temperature-sensitive SV40 T-antigen construct (established in this laboratory using the conditions described in Chapter 3), were included. Three CNS derived cell lines SKNMC, LAN-1 and GHFT, used for transfecting the 5a-reductase promoter constructs in Chapters 4 and 5, were included, as well as the control monkey kidney cell line COS-I.

The 5a-reductase expression of the cell lines was checked by RT-PCR of selected regions of the mRNAs of each gene. Cells were grown to near confluence, total RNA extracted using RNA-Xcell (Biogenex) and reverse transcribed using Superscript reverse transcriptase (RT, GIBCO). PCR primers for 5a-reductase I and II genes that crossed intron-exon boundaries (Baynes et al 1998a, see section 2.1g) were used to PCR amplify a 170bp and 350bp PCR product respectively from the reverse transcribed cDNA. RNA extracted from human prostate tissue was used as a positive control.

DU 145, LNCaP and PC3 only expressed 5a-reductase I isozyme (Figure 6.1), while prostate tissue expressed both isozymes. However, the serum free derivative of DU 145,

DUSF did not express 5a-reductase I (Figure 6.2). The prostate epithelial cell line Pre2.8 expressed 5a-reductase I isozyme and its corresponding stromal cell line 82.13 expressed

5a-reductase II (Figure 6.2). The COS-I cell line also expressed 5a-reductase I isozyme.

5a-reductase expression was not detected in the three CNS derived cell lines (Figure 6.1).

Amplification of a P-actin cDNA fragment provided a positive control for the RT-PCR reaction.

178 Figure 6.11

5a-reductase I

M LP P3 D5 BPH LZ GT SC -RT-PCR M

M -RT LP P3 D5 BPÏI LZ GT SC -PCR

't.. 35übp

5a-reductase II

179 Figure 6.1 II

M LP P3 DS LZ GT SC BPH -RT -PCR IVf

350bp

250bp

P-Actin

Figure 6.1: RT-PCR analysis of 5a-reductase I, II and ^-actin mRNA in human prostate and CNS derived cell lines, 5jig of total RNA was reverse transcribed and one-eighth of the resulting RT-cDNA used for PCR. 10% of the PCR product was run on a 2% agarose gel with ethidium bromide and visualised under UV. PCR products of 170, 350 and 266bp were expected from 5a- reductase I, II and P-actin respectively. Figure 6.11 represents 5a-reductase I, II, and 6.111 represents P-actin cDNA in the cell lines indicated below.

LP = LNCaP LZ = LAN-1 BPH = BPH tissue P3 = PC3 GT = GHFT - RT = RT negative control D5 = DU145 SC = SKNMC - PCR = PCR negative control

180 Marker BPH S2.13 Marker BPH S2.13 370c 39^C 370c 39<^c

350bp

200bp

50bp

Figure 6.21

Marker Pre2.8 Marker 3 7 ° C 3 9 ° C 37°C 39'^C 37°C 39°C

350bp . 350bp

150bp

50bp

5ot-RI Soc-RII I p-Actin

Figure 6. 211

181 M arker DUSF

3 5 0 b p 2 3 0 t» p

1 O O t i p

5a-RI 5a-Rn p-Actin

Figure 6.2 III

Figure 6.2: RT-PCR analysis of 5a-reductase I, II and P-actin mRNA in S2.13, Pre2.8 and DUSF human prostate cell lines. 5|xg of total RNA was reverse transcribed and one-eighth of the resulting RT-cDNA used for PCR. 10% of the PCR product was run on a 2% agarose gel with ethidium bromide and visualised under UV. PCR products of 170, 350 and 266bp were expected from 5a- reductase I, II and p-actin respectively. Figure 6.21 represents 5a-reductase II, and p-actin cDNA in S2.13 and 6.211 represents 5a-reductase I, II and p-actin cDNA in Pre2.8 cell line grown at 37°C and 39°C and 6.2HI represents 5a-reductase I, II and p-actin cDNA in DUSF cell line. - = RT negative control.

182 6.3.2 STABLE TRANSFECTION OF DUSF WITH A 5a-REDUCTASE II

EXPRESSION VECTOR

Along with PC3, DU145, LNCaP and Pre2.8, DUSF does not express 5a-reductase H. However DUSF is normally grown in a serum and growth factor free medium, OPTIMEM. Therefore it could be used to study the interaction of hormones and growth factors when

5a-reductase II is expressed, in it's normal serum-free culture conditions unlike the other cell lines grown in serum or growth factor supplemented media. Therefore DUSF was chosen for stable transfection with 5a-reductase II cDNA. The COS-I cell line was also transfected as a positive control,

DUSF cells were grown in OPTIMEM (GIBCO) and COS-I cells in DMEM supplemented with 10% ECS in T25 flasks to near confluence. The 5a-reductase II expression plasmid used to produce the 5a-reductase H expressing CHO cell line (Thigpen et al, 1993b) was obtained from Prof. Russell (University of Texas). Cells were co-transfected with the control plasmid pCDNA3.1, which confers geneticin (0418) resistance and 10-fold higher quantity of the 5a-reductase II expression plasmid, using the calcium phosphate method. Cells were grown in medium without 0418 for a day after the transfection, after which DUSF and COS-I cells were routinely maintained in medium containing 1 mg/ml and 0.5mg/ml 0418 respectively. At this concentration parental cells do not survive (Figure 6.3).

Cells resistant to geneticin were cloned and colonies ring cloned and expanded. Since the plasmid in which the 5a-reductase II cDNA was cloned was not available, control cells were transfected with pCDNA3.1 alone and expanded as described.

183 COS-I DUSF MÊSMÊÊâÉà

y ssiSitîîê

'K'

.At % ' :-' ' '

Figure 6.3: Selection of G418 resistant DUSF and COS-I clones. DUSF and COS-I cells were transfected with the 5a-reductase II cDNA and selected with G418. Figure 6.31 represents mock transfected, 6.3II represents mock transfected cells treated with G418 and 6.3111 represents transfected cells treated with G418.

184 6.3.3 SELECTION OF DUSF AND COS-I CLONES OVEREXPRESSING 5a-

REDUCTASE U mRNA Immunocytochemistry or western blotting could not be used to initially select the clones as antibodies against 5a-reductase II are not available. Therefore, clones that overexpressed 5a- reductase IT gene were identified using RT-PCR as described (Figure 6.4). The p-actin levels of the clones provided positive controls for RT-PCR and loading. Since the presence of mRNA does not necessarily mean the protein is transcribed or it is functional, we planned to test the clones that overexpressed 5a-reductase II mRNA for their ability to metabolise T to DHT.

5a-reductase II

350bp

250bp

/3-Actin

Figure 6.4: Selection of 5a-reductase II mRNA overexpressing COS-I clones.

SjLig of total RNA was reverse transcribed and one-eighth of the resulting RT-cDNA used for PCR of 5a-reductase II and p-actin. 10% of the PCR product was run on a 2% agarose gel with ethidium bromide and visualised under UV. PCR products of 350 and 266bp were expected from 5a-reductase 11 and p-actin respectively. Lanes 2-7 represent different G418 selected clones and lanes 8 and 9 represent RT and PCR negative controls.

185 Two DUSF clones; clones 9 and 12, which expressed the 5a-reductase 11 mRNA, were selected for further study (Figure 6.5). A pCDNA3.1 transfected G418 resistant clone called DUSF vector clone 11 was selected for use as a negative control. For COS-I cells, clone 5 overexpressed the 5a-reductase II mRNA and a corresponding pCDNA3.1 vector only clone 3 was selected for use as a negative control (Figure 6.5).

M BPH DU D ll D9 D12 C3 C5 - RT -PCR

350bp

250bp

Figure 6.5: RT-PCR analysis of 5a-reduetase U mRNA of selected overexpressing DUSF and COS-I clones. 5pg of total RNA was reverse transcribed and one-eighth of the resulting RT-cDNA used for PCR. 10% of the PCR product was run on a 2% agarose gel with ethidium bromide and visualised under UV. PCR products of 350 and 266bp were expected from 5a-reductase II and p-actin respectively. BPH = Prostate tissue cDNA DU = DUSF D9 = DUSF 5a-reductase II clone 9 D12 = DUSF 5a-reductase II clone 12 D11 ^ DUSF vector only clone 11 C5 = COS-I 5a-reductase II clone 5 - RT = RT negative control C3 = COS-I vector only clone 3 - PCR = PCR negative control

186 6.3.4 METABOLISM OF -TESTOSTERONE BY 5a-REDUCTASE II EXPRESSING CLONES

Although the selected clones express 5a-reductase II mRNA, it does not necessarily follow that these clones also produce the protein. Also presence of 5a-reductase II protein detected immunochemically does not necessarily mean that it is functional. The classical way to test 5a-reductase function is to measure the conversion of testosterone (T) to dihydrotestosterone (DHT).

To determine whether the selected clones contained increased levels of 5a-reductase activity, ^H-testosterone metabolism was assayed using an adaptation of a published protocol (Houston et al, 1985a, Tsugaya et al, 1996). Because of time constraints, a crude assay was used to give an indication of the relative activity of 5a-reductase in the various clones.

Testosterone metabolism

Briefly, cells were incubated with a known amount of ^H-T for 1 hour and radioactive metabolites of T in the medium concentrated, separated by thin layer chromatography (TLC) and the amount of radioactivity present in each metabolite quantified by liquid scintillation counting.

To determine the percentage of the radioactive T lost at each stage of the process, the following procedure was carried out. Flasks with and without cells were incubated with a known amount of ^H-T, 2|xl aliquots taken at each step of the experiment and counted on a liquid scintillation counter. From the scintillation count obtained for the 2|xl aliquots, the total ^H-T remaining at each step was estimated and expressed as a percentage of the initial

^H-T count added to the cells. The results are shown in Table 6.1 which shows that most of the radioactivity is lost during the TLC procedure.

187 Experimental step Percentage of initial count added to flask Blank Blank DUSF 5oRn clone 12 Incubation medium before addition to 100% 100% 100% flask Removal from flask after incubation 103% 112% 82% Ethyl acetate extract 75% 120% 66% Ethanol resuspension of dried ethyl — 91% 68% acetate extract Total scintillation count of T, DHT, 20% 26% 19% A’DIONE bands from TLC plate

Table 6.1: Loss of H-T from various experimental steps.

To determine the loss of at the different steps of the experimental procedure, 2|il aliquots were taken at the indicated steps and counted in a scintillation counter. The amount of radioactivity remaining at each step as a % of the initial amount added was calculated. Each column represents a separate experiment. T= Testosterone, DHT= Dihydrotestosterone, A’DIONB= Androstenedione.

Separation and identification of T metabolites To separate the metabolites of T, the extract was spotted on an ITLC plate and resolved in a 9:1 solution of dichloromethane and ethyl acetate. The radioactive metabolites were identified by co-chromatography with non-radioactive steroid standards and visualised by spraying with phosphomolybdic acid and baking at 90°C for 2min. Using this method the T, DHT and andronstenedione (A’DIONE) could be well separated whilst the 3a and 3|3 diols ran in similar position as T (Figure 6.6).

Metabolism of T by 5a-reductase II overexpressing DUSF and COS-I clones

To estimate ^H-T metabolism, cells were incubated with ~l|xCi of ^H-T for one hour at

37°C whilst being gently rocked. A 2(xl aliquot of the stock incubation medium was taken prior to addition to cells for liquid scintillation counting to calculate the exact amount of ^H- T added to the cells. Previous work in this laboratory has shown that T metabolism is linear during the first hour in BPH cell suspensions (Smith, Thesis 1993). To estimate the amount of T converted to the various metabolites after the hour-long incubation period, the 188 medium was collected, extracted in ethyl acetate, dried down to concentrate, dissolved in ethanol and separated on a TLC plate with non-radioactive standards. The bands corresponding to T, and its major metabolites DHT and A’DIONE were excised and the radioactivity associated with each band counted on a liquid scintillation counter. The amount of count found in each strip was expressed as a percentage of the initial amount of ^H-T (calculated as described above) added to the cells (Table 6.2).

Of the total count recovered from the three bands, the percentages contributed by each of the three steroids were also calculated (figures in brackets. Table 6.2). The total recovery varied widely from flask to flask (2.2% to 35.2%). Although the rate of recovery of T, DHT and A’DIONE is probably different, it was assumed that the amount of each metabolite recovered from a flask might be proportional to the amount of each present in the incubation medium after 1 hour. Therefore this latter figure may give a crude estimate of relative dilferences in T metabolism. The mean ± SD of these figures are presented in Table 6.3.

A ’DIONJE orH/9E>IOLS M IXTURE DUT T

Figure 6.6: Separation of testosterone and its metabolites by TLC. Testosterone (T), dihydrotestosterone (DHT), androstenedione, 3a and p-diol standards were spotted on an ITLC plate and resolved in a 9:1 solution of diehloromethane and ethyl aeetate. The steroids were visualised by spraying with phosphomolybdic acid and baking at 90°C for 2 minutes. Mixture represents mixture all five steroids separated by TLC.

189 Cell line Percentage Percentage recovery recovery (Proportion of each metabolite) Testosterone Dihydrotestosterone Androstenedione DU145 1 4.6 4.3 (92.9) 0.1 (2.6) 0.2 (4.5) 2 10.1 9(89) 0.5 (5.2%) 0.6 (5.8%) 3 8.96 8.9 (99.3) 0.04 (0.5) 0.023 (0.2) DUSF 1 6.16 5.96 (96.9) 0.1 (1.54) 0.1 (1.54) 2 15.7 13.7 (87.4) 1.2 (7.8) 0.8 (4.9) 3 4.2 3.2 (76) 0.8 (19) 0.2 (4.9) DUSF vector clone 11 1 18.7 18.1 (96.8) 0.4 (2.3) 0.2 (0.9) 2 10.7 9.6 (89.8) 0.6 (5.4) 0.5 (4.8) 3 5.74 5.4 (94.3) 0.2 (3.3) 0.14(2.4) 4 35.2 32 (91) 1.3 (3.7) 1.9 (5.4) DUSF 5a-RU clone 9 1 9.12 2.8 (30.8) 6.2 (67.9) 0.12(1.3) 2 7.5 1 (13.2) 6.2 (82.8) 0.3 (4) 3 3.79 2.33 (61.4) 1.34 (35.4) 0.12(3.2) 4 16.1 4 (24.4) 12 (74.8) 0.1 (0.8) DUSF 5a-RII clone 12 1 17 16 (94.5) 0.4 (2.2) 0.6 (3.3) 2 7.8 6.7 (85.7) 0.6 (8) 0.5 (6.3) 3 6.65 6.3 (94.7) 0.22 (3.3) 0.13(2) 4 18.8 17 (91) 0.8 (4) 1(5) PC3 1 6.04 0.7(11.2) 0.6(10.4) 4.74 (78.4) 2 17 1 (5.8) 2.2(12.8) 13.8 (81.4) COS I 1 9.65 0.5 (5.2) 0.35(3.6) 8.8(91.2)

190 2 19.9 1.1 (5.7) 1.5 (7.4) 17.3 (86.9) 3 13.6 0.2 (1.5) 0.2 (1.6) 13.2 (97) COS vector clone 3 1 19.1 0.6 (3.4) 1(5) 17.5 (91.6) 2 9.56 0.88 (9.2) 0.18(1.9) 8.5 (88.9) 3 31.6 0.8 (2.4) 2(6.4) 28.8 (91.2) COS- SotRII clone 5 1 5.3 0.5 (8.9) 0.8 (14.7) 4 (76.4) 2 2.2 0.5 (22.2) 1.1 (49.8) 0.6 (28) 3 6.96 0.83(11.90 1.2(17.2) 4.93 (70.9) 4 21.6 0.7 (3.2) 1.4 (6.3) 19.5 (90.5)

Table 6.2: H-Testosterone metabolism by 5a-reductase II expressing cell lines and prostate cell lines.

Cells grown in T80 flasks were incubated with ~l|iCi testosterone for 1 hour and metabolites passed into the incubation medium extracted in ethyl acetate. These metabolites were separated by TLC in a solvent system of dichloromethaneiethyl acetate (9:1), visualised and quantified by counting the three metabolite bands in a liquid scintillation counter. Results are expressed as the total recovery of the three metabolites as a% of the total count added to cells and % of the total recovered count contributed by each of the three metabolites in brackets. Each row represents separate experiments.

191 Under these conditions, there was little metabolism of T to DHT or A’DIONE by DU 145 cells (Table 6.2, 6.3). This indicates a low constitutive level of 5a-reductase and 17p- hydroxysteroid dehydrogenase activity. DUSF had a similar pattern of T metabolism to the parental line DU 145. However, PC3 metabolised most of the T in 1 hour (Table 6.3), to A’DIONE rather than DHT, indicating higher constitutive 17p-hydroxysteroid dehydrogenase activity.

Cell line Mean ± SD of percentage recovery Testosterone Dihydrotestosterone Androstenedione DU145 93.73 ±5.2 2.76 ±2.35 3.5 ±2.9 DUSF 86.76 ±10.46 9.44 ± 8.84 3.78 ±1.94 DUSF 5a-RII vector 92.98 ±3.18 3.68 ±1.29 3.38 ±2.1 clone 11 DUSF 5a-RII clone 9 32.45 ± 20.63 65.73 ± 20.79 2.33 ±1.52 DUSF 5a-RII clone 12 91.48 ±4.7 4.38 ± 2.53 4.15 ±1.88 PC3 8.5 ±3.82 11.6 ±1.69 79.9 ±2.12 COS-I 4.13 ±2.3 4.2 ±2.95 91.7 ±5.07 COS-5a-RII vector clone 5 ± 3.67 4.43 ± 2.3 90.56 ± 1.46 3 COS SoRII clone 5 11.55 ±7.96 22 ±19.11 66.45 ± 26.7

Table 6.3: % recovery of H metabolites from T metabolism assays. The amount of radioactivity recovered from the T, DHT and ADIONE bands were expressed as a percentage of the total radioactivity recovered (the sum of the three bands).

The results are expressed as mean ± SD of the % of total recovered ^H count from the three metabolites from the experiments in Table 6.2 (figures in brackets).

The DUSF vector clone 11 (to compare vector only, mock transfected cells with the cells transfected with 5a-reductase H) had a similar pattern of T metabolism to the parent lines DUSF and DU145 (Table 6.2, 6.3) in that most of the T remained unmetabolised after 1 hour. The DUSF-5otRII clone 9 seems to convert more T to DHT in 1 hour as compared to the mock transfected clone (Table 6.3), although DUSF-5aRII clone 11 did not.

COS-I cells and the vector-only clone 3 had a similar pattern of testosterone metabolism to PC3 cells in that they converted most of the T to A’DIONF in 1 hour with little conversion to DHT. The 5a-reductase II overexpressing CGS-5aRII clone 5 converted more of the T to

192 DHT. 6.4 DISCUSSION

The aim of this chapter was to produce a 5a-reductase II expressing human prostate cell line. To this end, a 5a-reductase II overexpressing clone of DUSF, a serum free derivative of DU145, was isolated. This should serve as a better in vitro model, for testing therapeutic agents targeting this enzyme and investigating it's role in human prostate growth and disease, than the 5a-reductase II overexpressing CHO (Thigpen et al, 1993b), COS-I (Reichert et al, 2001a) or HEK293 (Reichert et al, 2001b) clones produced already.

50 6-reductase expression of cell lines Expression of both isozymes was checked in DU145, LNCaP and PC3 cell lines. All three prostate cell line expressed 5a-reductase I and not the type II enzyme as detected by the RT- PCR assay used in this study. This has been reported previously and the identity of the enzyme present in these cell lines was confirmed by enzyme activity in different pH and presence of the mRNA as detected by both Northern blotting and RT-PCR (Castagnetta et al, 1994, Delos et al, 1994, Bruchovsky et al, 1996, Smith et al, 1996, Habib et al, 1998, Negri-Cesi et al, 1998). DUSF, derived from DU 145, also did not express 5a-reductase H.

Since the CNS contains 5a-reductase activity (Poletti et al, 1997, Melcangi, 1998), it was possible that the three CNS derived cell lines used to test the 5a-reductase promoter constructs in chapters 4 and 5, may also express 5a-reductase. However 5a-reductase expression could not be detected in these cell lines using the RT-PCR conditions used to detect expression in prostate cell lines.

Stable transfection with a 5 (X-reductase II expression vector

DUSF and COS-I cells were co-transfected with the 5a-reductase II expression plasmid, previously used to generate an overexpressing CHO cell line (Thigpen et al, 1993b), and the plasmid pCDNA3.1 conferring resistance to geneticin (G418). Over 20 G418 resistant

DUSF clones were selected, but only 2 overexpressed 5a-reductase II mRNA. Due to the lack of a 5a-reductase II antibody, a RT-PCR assay described by Bayne et al, 1998 was used to detect the presence of the mRNA. Since this method of selection would not ensure that a clone would express the protein and more importantly that it would be functional, the clones were tested for 5a-reductase activity.

193 Testosterone metabolism Cells were exposed to ^H-T for 1 hour and the presence of the tritiated metabolites DHT and A’DIONE in the supernatant determined. However, as seen from Table 6.1, most of the tritiated material was lost in the various steps of the experiment. Most of the radioactivity was recovered from the flask after the incubation period. Some of the radioactivity (-20%) was lost during the ethyl acetate extraction procedure and subsequent resuspension of the extract in ethanol. In a bid to pool only the top organic layer containing the steroids, not all the top layer was removed during each extraction step. As a result some of the radioactive steroids may have remained in the extraction mix. Also some of the radioactivity may have been lost during the evaporation step or perhaps the dried extract may not have been dissolved properly in the ethanol before application to the TLC plate. The most significant loss occurred during the application of the concentrated metabolites on to TLC plate, separation and counting in the scintillation counter. Since most of the radioactivity (-80%) was present in the ethanol suspension, it is likely that most of the remaining radioactivity was applied to the TLC plate and separated. Therefore the majority of the loss probably occurred in the counting stage. The different metabolite bands were cut out whole and placed in a vial of scintillation fluid and measured in a scintillation counter. This probably meant the small volume of scintillation fluid (3ml) was saturated. Cutting out the individual metabolite bands into smaller strips and counting them separately may have given a better indication of the actual radioactivity present.

Since the conditions for the androgen metabolism experiments were not optimised, the results only give a crude indication as to whether the transfected clones metabolise more T than the parent cells. The metabolism of T can be further improved by using cell homogenates and adding a NADPH generating system. This way the T can be directly metabolised by the 5a-reductase and released in to the tube. Using the current method, the T would have to diffuse into the cells down a concentration gradient, be metabolised by the

5a-reductase in the cells and the metabolites transported outside the cell in one hour. Carrying out the incubation in smaller volumes e.g. eppendorf tubes will reduce loss of radioactivity during the various steps. To estimate recovery of metabolites in each experiment C-DHT should be added during the ethyl acetate extraction procedure and it's

194 recovery calculated. This figure can be used to correct the recovery of ^H-DHT. Since the recovery of each metabolite may vary, e.g. recovery of A'DIONE may be different from that of DHT, C-A'DIONE should also be added and it's recovery calculated to correct the recovery of ^H-A'DIONE.

DU 145 converted little T to either DHT or A’DIONE in Ihour (Table 6.3). A similar pattern was also observed for DUSF, DUSF-5(xRII clone 12 and vector clone 11. These cell lines metabolised less than 5% of the ^H-T to DHT. This is consistent with previous work that showed that DU 145 cells converted less than 2% of the ^H-T to 5a-reduced products during a 3 hour incubation period (Smith, thesis 1993). The DUSF-5otRII clone 9 which overexpressed the 5a-reductase II mRNA in the initial screening, did convert more T to

DHT. Therefore this clone expresses functional 5a-reductase H.

PC3, the other widely used prostate cell line which also contains 5a-reductase I, converted most of the T to A ’DIONE in 1 hour (Table 6.3). This is also in keeping with earlier results (Smith et al, 1994), which indicated that PC3 had a much higher rate of T metabolism than DU 145. Also it was shown that PC3 metabolised T primarily to A’DIONE (Smith, thesis 1993).

COS-I, like PC3 cells, converted most of the T to A’DIONE in 1 hour with little conversion to DHT. It was reported previously that untransfected COS-M6 cells do not convert much T to DHT (Andersson and Russell, 1990) and after transient transfection cells are able to metabolise 50% of the given T to DHT in 1 hour. A recent report has shown that a 5a- reductase II transfected COS-I clone converted ~9X more androstenedione to androstanedione in 1.5hours (Reichert et al, 2001a). In this study, conversion of T to DHT was also not that high in 5a-reductase II transfected COS-5aRQ clone 5 although this clone expresses more 5a-reductase II mRNA. Testing more 5a-reductase II mRNA overexpressing clones may isolate a clone that converts more T to DHT.

Conclusion A novel clone of the prostate epithelial cell line DUSF, which expresses 5a-reductase II mRNA and contains functional 5a-reductase activity, has been isolated. After further

195 characterisation, it represents an useful tool for testing therapeutic agents targeting this enzyme in a physiologically relevant cellular environment. Since this line is regularly maintained in serum-free medium it can also be used for investigating the role of 5 a- reductase H, hormones and growth factors on prostate growth and disease in it’s normal serum free culture conditions.

196 CHAPTER 7

FINAL DISCUSSION AND FUTURE WORK

197 DISCUSSION

The objectives of this thesis were to study the regulation of transcription of the 5a-reductase

I and n genes in human prostate cells and develop representative cell lines which can be used to study the molecular genetics and other aspects of prostate growth and function.

In this study, genomic DNA fragments upstream of the coding regions of the 5a-reductase I and n genes were cloned, sequenced and functional activity measured by transfecting deletion constructs in cell lines. The promoters were partially characterised by determining the transcription start site of the 5a-reductase I promoter and the critical regions for transcriptional activity of the two promoters. Attempts were made to produce conditionally immortalised prostate cell lines from primary prostate cancers and bone marrow métastasés, which could be used to test the promoter constructs. Although cell lines were not established, this work formed the basis of establishing culture conditions for producing conditionally immortalised prostate cell lines and the subsequent development of a 5a- reductase U expressing prostate stromal cell line, S2.13, by others in the laboratory. In addition, the DUSF prostate cell line was stably transfected with a 5a-reductase II expression vector. A clone which expressed 5a-reductase II mRNA and which metabolised testosterone (T) to dihydrotestosterone (DHT) was isolated.

7.1 Regulation of transcription of the 5a-reductase I and II genes

The enzyme 5a-reductase catalyses the conversion of T to DHT and is responsible for the development of the prostate during embryogenesis. Two isoforms of this enzyme, type I and type n, coded by different genes (Andersson and Russell, 1990, Andersson et al, 1991) but catalysing the same reaction have been identified. While expression of the two isozymes are developmentally regulated (Thigpen et al 1993a, Levine et al, 1996), in the adult the type I enzyme is expressed mainly in peripheral organs such as skin and the liver while the type II enzyme is found mainly in the prostate. Although the mRNA and enzyme activity for both enzymes are present in the adult prostate (Habib et al, 1998), it is generally thought that 5a- reductase II is the more important isozyme in prostate development since mutation in it’s 198 gene lead to male pseudohermaphroditism (Andersson et al, 1991).

It is not clear why both isozymes catalysing the same reaction are expressed in the prostate.

There is conflicting evidence regarding which cells express the two isozymes in the prostate, with some groups reporting expression in epithelial cells and not fibroblasts and vice versa.

However, recently mRNA and enzyme activity for both isozymes have been reported in co cultured prostate epithelial and stromal cells (Bayne et at, 1998a, b) reflecting perhaps their normal in vivo expression.

In multicellular organisms, differential expression of genes is essential for not only maintaining differentiation and function of different cell types within the organism but also within a particular tissue. It is now generally accepted that transcriptional control is the major mechanism for regulating gene expression in eukaryotes (Darnell, 1982). Therefore, genes that show developmental, tissue and cell specific expression as the 5a-reductase genes may be transcriptionally regulated by binding of specific transcription factors present in the cell to specific DNA binding sites present in the regulatory regions of these genes. A variety of developmentally regulated factors such as the homeobox proteins (Gehring et al, 1994), cell and tissue specific transcription factors such as MyoDl in the skeletal muscle (Davis et al, 1987), NFkB in the B cells (Thanos and Maniatis, 1995), TIN-1 in the testis (Goto et al,

1991), mammary gland specific nuclear factor MGF (Wakao et al, 1992) and others have been isolated, which confer tissue and cell specificity to their respective genes. The transcriptional activity of genes in differentiated cells such as prostate epithelial cells is mediated by the array of transcriptional regulatory proteins present in the cells. In the prostate, the only putative transcription factor gene described is the mouse Nkx-3.1 homeobox gene (Bieberich et al, 1996). However, prostate specific genes such as probasin

(Dodd et al 1983, Patrikainen et al, 1999), prostatic acid phosphatase (Virkkunen et al,

1994), prostate specific antigen (Schuur et al, 1996) and prostate specific membrane antigen

(Good et al, 1999) contain specific DNA binding sites that may bind as yet unidentified transcription factors. When the rat 5a-reductase I gene was first cloned, experiments in 199 castrated animals suggested that it’s expression is under transcriptional control in both the liver and in the ventral prostate (Andersson et al, 1989, Normington and Russell, 1992). In the rat DHT induces the expression of 5a-reductase mRNA (George et al, 1991). Therefore the regulatory regions of the 5a-reductase I and II genes may contain specific transcription factor binding sites which could explain the differential regulation of these two genes. There may also be specific sites present in the regulatory regions that determine the relative importance of each isozyme when both are present in a cell as in the prostate. Therefore, to identify the molecular mechanisms underlying the regulation of 5a-reductase expression, the regulatory regions of these genes needed to be cloned and characterised.

In eukaryotes, the region of DNA found immediately upstream of genes contains short sequence elements that are involved in the control of transcription, such as the TATA box

(found about 30 base pairs upstream of the transcription start site, Breathnach and

Chambon, 1981), Sp 1 box and the CAAT box (found upstream of the TATA box, Dynan and Tjian, 1985). In addition to these elements, other short sequences that are responsible for regulated transcription can be found in the upstream promoter elements. For example, expression of the prostate specific antigen gene is regulated by androgen; brought about by interaction of the androgen receptor with specific DNA elements called androgen response elements (ARE) present in the 5' region of the PSA gene (Riegman et al, 1991). Eukaryotic genes also contain other regulatory sequence elements found further away from the transcription start site that can bind specific proteins, which in turn interact with the basal transcription factors to upregulate transcription. Therefore enhancers can be located up to several thousand bases away, are active when placed in either orientation and can activate the promoter when placed either upstream or downstream of the promoter (Latchman,

1998). Some enhancers can be active in all tissues while others function as tissue specific enhancers that activate a particular promoter in a specific cell type (Yaniv, 1984, Garcia et al, 1986, Supakar et al, 1995). As well as elements that enhance transcription, regulatory regions also contain sequences that repress transcription. These elements called silencer elements or repressors can be constitutively active or can be cell type specific (Zhou et al, 200 1992, Sawada et al, 1994).

Therefore isolating the region upstream of the 5a-reductase I and H genes may allow identification of the important regulatory sites that bind transcription factors to regulate the expression of the two genes. To isolate the 5' regulatory regions of the 5a-reductase I and H genes, a human genomic DNA library was screened using standard molecular techniques.

For 5a-reductase I, a 4.6kb fragment of the 5' region was isolated and sequenced. Sequence comparison confirmed that it was not the 5a-reductase I pseudogene, and contained the

850bp of the 5' region already cloned (Jenkins et at, 1991). To determine whether this cloned fragment is transcriptionally active, it was cloned into the pGL2Basic reporter plasmid. A series of deletion constructs ranging from 0.16 to 4.6kb were made and tested by transient transfection assays in prostate (DU145, PC3) and non-prostate (SKNMC, LAN-1,

GHFT) cell lines. Since DU 145 and PC3 express the 5a-reductase I gene, they should also contain the associated transcription machinery needed to transcribe from this promoter fragment. In all the cell lines tested, a significant level of transcription of the luciferase gene was provided by the deletion constructs at a similar level to other prostate specific promoters tested in the prostate cell lines (Payson et al, 1998, Good et al, 1999). The 0.16kb construct contained the basal promoter including the putative TATA box. Since the 0.6kb construct produced the highest promoter activity, it probably contained enhancer elements needed to upregulate transcription. In addition, silencer elements are probably found upstream of this proximal 0.6kb as promoter activity diminished with larger fragments. The critical region appears to be between 150 and 300bp upstream of the gene where several putative AP2, SPl and GCF binding sites are present. To determine the functional relevance of the putative sites, co-transfection assays were carried out with the transcription factors and the 0.59kb promoter. However, from the co-transfection assays, neither AP2 or SPl influenced promoter activity of the 0.6kb construct. There were no AREs present, even though 5a- reductase expression is thought to be regulated by DHT (George et al, 1991). However, recently it has been demonstrated that 5a-reductase mRNA expression is under paracrine control with prostate specific factors regulating enzyme activity (Bayne et al, 1998b). 201 Therefore, AREs in the regulatory region may not be necessary. A single transcription start site was mapped to -55bp upstream of the ATG start site where the TATA box is found. In the rat a single transcription start site was previously mapped at 17bp upstream of the ATG site (Andersson et al, 1989).

Although there are many putative transcription factor binding sites present on the 5a- reductase I promoter, we have not been able to identify any that are specifically involved in the regulation of the gene. Since the critical regions in the upstream region of the 5a- reductase I gene have been identified, specific transcription factor binding sites and subsequently the factors themselves can be isolated. After the initial isolation of the PSA promoter region (Riegman et al, 1989) over a decade ago, numerous studies subsequently have reported the isolation and characterisation of new enhancer elements (Schurr et al,

1996, Zhang et al, 1997a), androgen responsive (Riegman et al, 1991, Zhang et al, 1997b) and non responsive elements (Yeung et al, 2000), elements responsive to other hormones such as T3 (Zhu et al, 2001), elements that confer tissue specific expression (Pang et al,

1997), prostate epithelium specific transcription factor that activates PSA gene expression

(Gettgen et al, 2(X)1) etc. Also based on the information obtained so far numerous reports on the use of the PSA promoter for gene therapy have been published (Wu gr al, 2(X)1). Such studies have also been carried out for other prostate specific gene promoters such as the

PSMA (Good et al, 1999), PAP (Banas et al 1994, Virkkunen et al, 1994), and probasin

(Rennie et al, 1993, Kasper et al, 1994) promoters. This is the first study to describe the isolation and sequencing of the 5a-reductase 1 promoter, production of deletion constructs to assay transcriptional activity to locate the regions critical for transcription and it’s transcriptional start site. Based on this information, studies to isolate both positive and negative DNA elements responsible for binding transcription factors and thereby mediating transcription of the gene can be designed as for the prostate specific genes described above.

For 5a-reductase n, 0.75kb of the 5' upstream region was cloned from the genomic DNA library and sequenced. Although phage clones containing a much larger fragment (lOkb) of 202 the upstream region was isolated it was not possible to clone it into the reporter plasmid due to technical difficulties. Deletion constructs ranging from 0.15 to 0.7kb were made and tested in transient transfection assays in DU 145 and LAN-1, since 5a-reductase H expressing cell lines were not available. Like the type I constructs a high level of transcription of the luciferase gene was provided by the type II constructs. Specifically these constructs were more active in DU145 prostate cell line than the 5a-reductase I promoter constructs. The 0.23kb upstream fragment contained the basal transcription element, although a TATA box is not present. Therefore in keeping with a TATA less promoter other initiator elements should be present within this region. The 0.4kb construct produced the highest promoter activity and probably contains an enhancer element needed for maximal transcription of the gene. The transfections also indicate that between 0.65 and 0.4kb, a silencer element is present and between 0.65 and 0.75kb a further enhancer may be present.

The region between 0.23 and 0.4kb seems to contain the strongest enhancer. There are many putative SPl, AP2, GCF and T-Ag sites present in this region but due to time constraint it was not possible to determine which ones are relevant in this promoter. Of these the SPl sites are likely to be important since SPl has been postulated to facilitate the recognition of a weak TATA box. The transcription start sites have been previously mapped to 71, 145 and

712bp upstream of the ATG site (Labrie et al, 1992).

The most striking difference between the 5a-reductase I and II promoters is that type I contains a TATA box while the type II seems to be a TATA less promoter. In keeping with this finding, only a single transcription start site was identified for the type I promoter from the primer extension assay, while multiple start sites have been reported previously for the type n promoter (Labrie et al, 1992). Although the TATA box is found in the promoter region of most genes, it is often absent (Weis and Reinberg, 1992) in housekeeping genes expressed in all tissues and in some tissue specific genes.

The most critical regions for promoter activity of the type I and II genes are between 150 and 300bp and 230 and 400bp respectively indicating the presence of enhancer elements in 203 these regions. Although no AREs were detected in these regions it is possible that the enhancer elements utilise some other unknown transcription factor binding sites to upregulate transcription, as is the case for the PSMA promoter (Good et al, 1991). There are also several known putative transcription factor binding sites present in these regions.

The relative activities of the deletion constructs for both sets of promoters were the same in the non-prostate and the prostate cell lines. Therefore these promoters were not mediating prostate specific transcription. For the type II constructs this could be due to them being tested in 5a-reductase I expressing cell lines. Both promoters also contain silencer regions which when present in the deletion constructs lower promoter activity. For the type II promoter the silencer region may confer tissue specific activity, which could be tested using type n expressing cell lines. Interestingly, the type II promoter constructs were more active than the type I promoter constructs in DU 145 cells, perhaps indicating higher basal transcription from of the type II promoter in the prostate.

Although the sequence of the 0.75kb promoter has been published previously, this is the first report to describe the production of deletion constructs to test the transcriptional activity of the 5a-reductase II promoter. The critical regions for transcription within this region were identified. Although a phage clone containing a larger promoter fragment was isolated and characterised, any further deletion constructs may not be necessary since the 0.4kb promoter fragment was transcriptionally most active. As for the 5a-reductase I promoter this study can form the basis of further studies to locate important DNA elements and to isolate the associated transcription factors needed to regulate this important gene.

Expression of 5a-reductase II in prostate cell lines

The enzyme 5a-reductase II is essential for the normal development of the prostate

(Andersson et al, 1991, Thigpen et al, 1992) and is expressed in the foetal and adult prostate, BPH and in prostate cancer tissue (Thigpen et al, 1993a, Habib et al, 1998).

Therefore any in vitro model of the prostate that does not express this isozyme is not 204 representative of the organ and is of limited use. Yet none of the established prostate cell lines expresses this enzyme. Therefore prostate cell lines that constitutively express 5a- reductase II are needed for prostatic research. Also to study the gene regulation of this important prostatic enzyme I needed a prostate cell line that constitutively expressed 5a- reductase II (see chapter5).

To develop more representative cell models of the prostate, i.e. cells that also express 5a- reductase n , primary cultures of epithelial cells and fibroblasts derived from primary prostate cancer specimens were cultured after collagenase dissociation. Cells were then transduced with a SV40 constmct PA/tsA58-U19/8 (Jat and Sharp, 1989) containing temperature sensitive mutations of the T antigen, with a view to ultimately producing conditionally immortalised cells. Immortalised cells would proliferate at the permissive temperature driven by T antigen and when shifted to the non permissive temperature it’s absence would stop cell proliferation (see introduction). These cells are then more likely to enter the differentiation pathway and express differentiated characteristics of prostate cells such as 5a-reductase H. It has been reported that once withdrawn from the cell cycle, conditionally immortalised cells express tissue specific characteristics (Xu et al, 1995,

Simon et al, 1996). Conditionally immortalised scleroderma derived human fibroblasts (Xu et al, 1995), mammary epithelial cells (Stamps et al, 1994) and hepatocytes (Yanai et al,

1991) have been produced this way.

Although some of the epithelial cell cultures survived G418 selection indicating the cells had been transduced, the WAJC 404 media used in this study did not support their long term growth. The cells became irreversibly vacuolated and stopped proliferating. However

WAJC 404 has been used successfully to initiate primary culture cells by other groups

(Sherwood et al, 1989, Taketa et al, 1990, De Angeli et al, 1995, Collins et al, 1996) but not to maintain cells long term. For this study we needed a medium that would maintain the cells through transduction, crisis and eventually immortalisation. Established prostate epithelial cells also did not form colonies in other commercially available serum free 205 formulations. In the absence of a medium that supported the long term growth of prostate epithelial cells this work was not continued. However since this work, a prostate epithelial growth medium from Clonetics, PREGM, was developed and used in this laboratory to maintain prostatic epithelial cells without vacuolation and shown to permit cloning (Hudson et al, 2000), routine passage and immortalisation (Fry et al, 2000).

Although the stromal cells could be grown and passaged more easily than the epithelial cells, the success rate of establishing stromal cultures from the prostate samples was low

(-50%). In addition, immortal cell lines are produced at a low frequency, approximately

10% of cultures successfully transduced with the SV40 construct (O’Hare, personal communication). Therefore if more stromal cultures were produced and transduced an immortalised cell line would have been established. A shorter and more intense period of digestion followed by passage through nylon mesh of decreasing size to obtain a single cell suspension has been shown to be more successful in producing stromal cultures from prostate tissue subsequently in this laboratory and by others (Swinnen et al, 1991, Vlahos et al, 1993).

Subsequent to the work described in this thesis, using the PREGM medium and the alternative technique for culturing stromal cells, an immortalised epithelial cell line Pre2.8 and a stromal cell line S2.13 from a BPH tissue sample were established by others in this laboratory. Preliminary characterisation indicates that the stromal line S2.13 expresses 5a- reductase II mRNA.

Attempts were also made to establish cell lines from prostate cancer métastasés present in the bone marrow of hormone-relapsed patients, since bone is the most common site of metastasis. Pantel and colleagues have shown that metastatic prostate cancer cells present in the bone marrow of patients with cancer can be cultured and immortalised by microinjection with a SV40 construct to produce cell lines with high success rate (55%, Pantel et al, 1995,

Putz et al, 1999). Therefore, in this study bone marrow biopsies were collected with a view 206 to growing human prostate cancer cells and immortalising them. However, only a third of the bone marrow aspirates collected contained prostate cancer cells and no cultures were established for transduction. If aspirates were collected from known hot-spots of prostate cancer metastasis, then perhaps more of the samples would have contained métastasés.

Again this work has formed the basis for subsequent workers in the laboratory to compare the suitability of trephine biopsies and bone marrow samples in obtaining metastatic prostate cancer cells.

This work towards producing cell lines was carried out at the beginning of the study in parallel with cloning of the 5a-reductase promoters, as I needed a 5a-reductase II expressing cell line to test the promoter constructs for this gene towards the end of this study. Although the improved techniques for producing immortalised cell lines became available later on, due to the time constraint (it takes a year or more to establish cell lines), it was not repeated.

Instead prostate cancer cell lines that express 5a-reductase I were used to test the 5a- reductase II promoter constructs.

One of the long term aims of this laboratory has been to produce in vitro models of 5a- reductase activity that can be used to screen potential therapeutic agents (Smith et al, 1996).

In this study, along with attempts at producing cell lines that constitutively express 5a- reductase n, attempts were also made at producing cell lines that express transfected 5a- reductase n. To this end, a prostate cancer cell line was stably transfected with an expression vector for this isozyme, used previously to produce a 5a-reductase II expressing CHO cell line (Thigpen et al, 1993b). The serum free derivative of the DU145 cell line, DUSF was stably transfected with this expression vector and a clone which over-expressed the 5a- reductase II mRNA was isolated. Preliminary results from a crude testosterone metabolism assay indicate that this over-expressing clone metabolises more testosterone to dihydrotestosterone than the parent cell line.

This is the first study to describe the cloning, sequencing, assaying transcriptional activity of 207 the 5a-reductase I and H promoters and partially characterise the regulation of the genes.

This work can form the basis of further studies to examine the interaction of the regulatory proteins involved and eventually identify transcription factors that confer prostate specific transcription to these genes. Availability of this information will help elucidate the role of these two enzymes in the prostate and their relative importance. Since DHT is the active androgen in the prostate responsible for it’s growth, mechanisms that regulate the expression of the enzyme responsible for it’s production, may have implications for diseases of aberrant prostatic growth. Characterising the action of these isozymes is key to understanding the development and growth of the prostate. Also prostate specific transcription factors may also be a potential gene therapy target for prostatic diseases.

As a result of this work new human prostate cell models have been developed which express

5a-reductase H. Based on this work, culture conditions for producing conditionally immortalised prostate cell lines have been established. Subsequently, a new prostate stromal cell line, S2.13, has been established by others in the laboratory, that has been shown to express 5a-reductase n. Conditionally immortalised prostate cell lines produced this way are more likely to express differentiated characteristics and would serve as more representative cell models of the prostate. A 5a-reductase IlmRNA over-expressing clone of

DUSF prostate cell line has also been established. Although CHO, COS I and HEK293 cells that overexpress 5a-reductase H have been reported previously, this DUSF clone is the first

5a-reductase II expressing human prostate cell model described. Because of it’s physiologically relevant cellular background, this clone represents a better in vitro model for testing therapeutic agents targeting 5a-reductase II than the ones described earlier.

208 Further investigations

The 5a-reductase promoters can be further characterised as follows:

• Using PCR based techniques the type H promoter can be further sequenced, deletion constructs prepared and all the constmcts tested in the type II expressing prostate cell line

S2.13 and the cell lines used previously. This may identify regions that confer prostate specific promoter activity to the type II promoter.

• Further deletion constructs spanning the critical regions of both promoters can be made

using PCR techniques and re-tested to identify smaller regions (up to lOObp) that confer

enhancer activity. These regions can then be used in electrophoretic mobility shift assays

to pinpoint the regions where the transcription factors bind. These regions can be further

characterised to determine whether these sites bind known or unknown transcription

factors.

• Clone prostate specific transcription factors.

• Since DHT has been shown to regulate the expression of 5a-reductase genes in rats,

prostate cells can be treated with DHT and the level of 5a-reductase mRNA measured to

determine whether the 5a-reductase expression is altered in human cells. Also COS

cells can be co-transfected with the androgen receptor cDNA and the 5a-reductase

promoter constructs and treated with DHT to determine whether the 5a-reductase

promoter activity is modulated.

To further characterise the 5a-reductase H expressing cell lines

• Testosterone metabolism can be investigated in the presence of a NADPH generating

system, in cell pellets of DUSF-5a-reductase II over-expressing clone and S2.13 to

reduce experimental loss. The assay can be carried out in neutral and acidic pH to

determine which isozyme is active in these cells. Recovery of specific metabolites

should be calculated by adding labelled metabolite to the extraction mix and 209 determining its recovery. The 5a-reductase isozymes can be further characterised by

studying metabolism in cells treated with specific inhibitors.

• Determine the localisation of the enzyme in the cells by immunocytochemistry using

monoclonal antibody against 5a-reductase H.

• 5a-reductase II expression and enzyme activity can be studied in cells treated with

testosterone to determine if expression is under hormonal control.

210 References

Abalain JH, Quemener E, Carre JL, Simon B, Amet Y, Mangin P, Floch HH. Metabolism of androgens in human hyperplastic prostate: evidence for a differential localization of the enzymes involved in the metabolism. J Steroid Biochem 1989;34(l-6):467-71.

Algaba F, Trias I, Martinez de Hurtado J (1996). In Hormone dependent cancers (eds Pasqualini JR, Katzenellenbogen BS), Chapter 12, Marcel Dekker inc.

Andersen JT, Ekman P, Wolf H, Beisland HO, Johansson JE, Kontturi M, Lehtonen T, Tveter K. Can finasteride reverse the progress of benign prostatic hyperplasia? A two-year placebo-controlled study. The Scandinavian BPH Study Group. Urology 1995 Nov 46:5 631-7.

Anderson KM, Liao S. Selective retention of dihydrotestosterone by prostatic nuclei. Nature 1968 Jul 20 219:151 277-9.

Andersson S, Berman DM, Jenkins EP, Russell DW. Deletion of steroid 5 alpha-reductase 2 gene in male pseudohermaphroditism. Nature 1991 Nov 14 354:6349 159-61.

Andersson S, Bishop RW, Russell DW. Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation. J Biol Chem 1989 Sep 25 264:27 16249-55.

Andersson S, Russell DW. Structural and biochemical properties of cloned and expressed human and rat steroid 5 alpha-reductases. Proc Natl Acad Sci U S A 1990 May 87:10 3640-4.

Andriole G, Lieber M, Smith J, Soloway M, Schroeder F, Kadmon D, DeKemion J, Rajfer J, Boake R, Crawford D. Treatment with finasteride following radical prostatectomy for prostate cancer. Urology 1995 Mar 45:3 491-7.

Aumiiller G. Morphologic and endocrine aspects of prostatic function. Prostate 1983 4:2 195-214.

Bae VL, Jackson_Cook CK, Brothman AR, Maygarden SJ, Ware JL. Tumorigenicity of SV40 T antigen immortalized human prostate epithelial cells: association with decreased epidermal growth factor receptor (EGFR) expression. Int J Cancer 1994 Sep 1 58:5 721- 9.

Banas B, Blaschke D, Fittler F, Horz W. Analysis of the promoter of the human prostatic acid phosphatase gene. Biochim Biophys Acta 1994 Mar 1 1217:2 188-94.

Bard DR, Lasnitzki I. The influence of oestradiol on the metabolism of androgens by human prostatic tissue. J Endocrinol. 1977 Jul;74(l):l-9.

Bartsch W, Becker H, Pinkenburg FA, Krieg M. Hormone blood levels and their inter relationships in normal men and men with benign prostatic hyperplasia (BPH). Acta Endocrinol (Copenh) 1979 Apr 90:4 727-36. 211 Bartsch W, Horst HJ, Becker H, Nehse. G. Sex hormone binding globulin binding capacity, testosterone, Salpha-dihydrotestosterone, oestradiol and prolactin in plasma of patients with prostatic carcinoma under various types of hormonal treatment. Acta Endocrinol (Copenh). 1977 Jul;85(3):650-64.

Bartsch G, Keen F, Daxenbichler G, Marth C, Margreiter R, Brungger A, Sutter T, Rohr HP. Correlation of biochemical (receptors, endogenous tissue hormones) and quantitative morphologic (stereologic) findings in normal and hyperplastic human prostates. J Urol. 1987 Mar;137(3):559-64.

Bartsch W, Krieg M, Becker H, Mohrmann J, Voigt KD. Endogenous androgen levels in epithelium and stroma of human benign prostatic hyperplasia and normal prostate. Acta Endocrinol (Copenh). 1982 Aug; 100(4):634-40.

Bayne CW, Donnelly F, Chapman K, Bollina P, Buck C, Habib F. A novel coculture model for benign prostatic hyperplasia expressing both isoforms of 5 alpha-reductase. J Clin Endocrinol Metab 1998a, Jan 83:1 206-13.

Bayne CW, Donnelly F, Ross M, Habib FK. Serenoa repens (Permixon): a 5alpha- reductase types I and H inhibitor-new evidence in a coculture model of BPH. Prostate. 1999 Sep 1;40(4):232-41.

Bayne CW, Ross M, Donnelly F, Chapman K, Buck C, Bollina P, Habib FK. Selective interactions between prostate fibroblast and epithelial cells in co-culture maintain the BPH phenotype. Urol Int 1998b, Oct 61:1 1-7.

Beato M, Chavez S, Truss M. Transcriptional regulation by steroid hormones. Steroids 1996a, Apr 61:4 240-51.

Beato M, Sanchez-Pacheco A. Interaction of steroid hormone receptors with the transcription initiation complex. Endocr Rev 1996b, Dec 17:6 587-609.

Becker H, Horst HJ, Krieg M, Steins P, Voigt KD. Uptake, metabolism and binding of various androgens in human prostatic tissue: in vivo and in vitro studies. J Steroid Biochem 1975 Mar-Apr 6:3-4 447-52.

Belis JA. Méthodologie basis for the radioimmunoassay of endogenous steroids in human prostatic tissue. Invest Urol 1980 Jan 17:4 332-6.

Bello D, Webber MM, Kleinman HK, Wartinger DD, Rhim JS. Androgen responsive adult human prostatic epithelial cell lines immortalized by human papillomavirus 18. Carcinogenesis. 1997 Jun;18(6): 1215-23.

Benson-RC. A rationale for the use of non-steroidal anti-androgens in the management of prostate cancer. Prostate-Sw^^\.\992\ 4: 85-90.

Berrettoni BA, Carter JR. Mechanisms of cancer metastasis to bone. J Bone Joint Surg Am. 1986Feb;68(2):308-12. 212 Berry SJ, Coffey DS, Walsh PC, Ewing LL. The development of human benign prostatic hyperplasia with age. J Urol 1984 Sep 132:3 474-9.

Berthaut I, Mestayer C, Portois MC, Cussenot O, Mowszowicz I. Pharmacological and molecular evidence for the expression of the two steroid 5 alpha-reductase isozymes in normal and hyperplastic human prostatic cells in culture. Prostate. 1997 Aug 1;32(3):155- 63.

Berthon P, Cussenot O, Hopwood L, Le Duc A, Maitland N. Functional expression of SV40 in normal human prostatic epithelial and fibroblastic cells: Differentiation pattern of non-tumorigenic cell lines. Int J Oncol 1995 6:333-343.

Bieberich CJ, Fujita K, He WW, Jay G. Prostate-specific and androgen-dependent expression of a novel homeobox gene. J Biol Chem 1996 Dec 13 271:50 31779-82.

Biedler JL, Helson L, Spengler BA. Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res 1973 Nov 33:11 2643-52

Bj elf man C, Soderstrom TO, Brekkan E, Norlén BJ, Egevad L, Unge T, Andersson S, Rane A. Differential gene expression of steroid 5 alpha-reductase 2 in core needle biopsies from malignant and benign prostatic tissue. J Clin Endocrinol Metab 1997 Jul 82:7 2210-4.

Bologna M, Muzi P, Biordi L, Festuccia C, Vicentini C. Finasteride dose-dependently reduces the proliferation rate of the LnCap human prostatic cancer cell line in vitro. Urology 1995 Feb 45:2 282-90.

Bonkhoff H, Stein U, Aumüller G, Remberger K. Differential expression of 5 alpha- reductase isoenzymes in the human prostate and prostatic carcinomas. Prostate 1996 Oct 29:4 261-7.

Bonnet-P, Reiter-E, Bruyninx-M, Sente-B, Dombrowicz-D, de-Leval-J, Closset-J, Hennen-G. Benign prostatic hyperplasia and normal prostate aging: differences in types I and n 5 alpha-reductase and steroid hormone receptor messenger ribonucleic acid (mRNA) levels, but not in insulin-like growth factor mRNA levels. J-Clin-Endocrinol- Metab. 1993 Nov; 77(5): 1203-8.

Bosch JLHR (1997). In Recent advances in prostate cancer and BPH (ed. Schroder FH), Chapter 1. Parthenon Publishing.

Bosch RJ, Griffiths DJ, Blom JH, Schroeder FH. Treatment of benign prostatic hyperplasia by androgen deprivation: effects on prostate size and urodynamic parameters. JU rol 1989 Jan 141:1 68-72.

Brandt M, Greway AT, Holt DA, Metcalf BW, Levy MA. Studies on the mechanism of steroid 5 alpha-reductase inhibition by 3-carboxy A-ring aryl steroids. J Steroid Biochem Mol Biol 1990 Nov 30 37:4 575-9.

213 Brawer MK, Peehl DM, Stamey TA, Bostwick DG. Keratin immunoreactivity in the benign and neoplastic human prostate. Cancer Res 1985 Aug 45:8 3663-7.

Breathnach R, Chambon P. Organization and expression of eucaryotic split genes coding for proteins. Anna Rev Biochem 1981 50: 349-83.

Bright RK, Vocke CD, Emmert_Buck MR, Duray PH, Solomon D, Fetsch P, Rhim JS, Linehan WM, Topalian SL. Generation and genetic characterization of immortal human prostate epithelial cell lines derived from primary cancer specimens. Cancer Res 1997 Mar 1 57:5 995-1002.

Brooks JR, Baptista EM, Berman C, Ham EA, Hichens M, Johnston DB, Primka RL, Rasmusson GH, Reynolds GF, Schmitt SM, Arth GE. Response of rat ventral prostate to a new and novel 5 alpha-reductase inhibitor. Endocrinology 1981 Sep 109:3 830-6.

Bruchovsky N. Comparison of the metabolites formed in rat prostate following the in vivo administration of seven natural androgens. Endocrinology 1971 Nov 89:5 1212-22.

Bruchovsky N, Lieskovsky G. Increased ratio of 5 alpha-reductase: 3 alpha (beta)- hydroxysteroid dehydrogenase activities in the hyperplastic human prostate. J Endocrinol 1979 Mar 80:3 289-301.

Bruchovsky N, Rennie PS, Batzold FH, Goldenberg SL, Fletcher T, McLoughlin MG. Kinetic parameters of 5 alpha-reductase activity in stroma and epithelium of normal, hyperplastic, and carcinomatous human prostates. J Clin Endocrinol Metab 1988 Oct 67:4 806-16.

Bruchovsky N, Sadar MD, Akakura K, Goldenberg SL, Matsuoka K, Rennie PS. Characterization of 5alpha-reductase gene expression in stroma and epithelium of human prostate. J Steroid Biochem Mol Biol 1996 Dec 59:5-6 397-404.

Bruchovsky N, Wilson JD. The conversion of testosterone to 5-alpha-androstan-17-beta- ol-3-one by rat prostate in vivo and in vitro. J Biol Chem 1968a, Apr 25 243:8 2012-21.

Bruchovsky N, Wilson JD. The intranuclear binding of testosterone and 5-alpha- androstan-17-beta-ol-3-one by rat prostate. J Biol Chem 1968b, Nov 25 243:22 5953-60.

Bryan TM, Reddel RR. SV40-induced immortalization of human cells. Crit Rev Oncog 1994 5:4 331-57.

Buck AC. In Prostate cancer: questions and answers , page 13. (1995a) Merit publishing international.

Buck AC. In Prostate Cancer, questions and answers, page 66. (1995b) Merit publishing international.

Byrne RL, Leung H, Neal DE. Peptide growth factors in the prostate as mediators of stromal epithelial interaction. Br J Urol. 1996 May;77(5):627-33.

214 Carter HB, Coffey DS. The prostate: an increasing medical problem. Prostate 1990 16:1 39-48.

Castagnetta L, Granata OM, Polito L, Blasi L, Cannella S, Carruba G. Different conversion metabolic rates of testosterone are associated to hormone-sensitive status and - response of human prostate cancer cells. J Steroid Biochem Mol Biol 1994 Jun 49:4-6 351-7.

Celotti F, Melcangi RC, Martini L. The 5 alpha-reductase in the brain: molecular aspects and relation to brain function. Front Neuroendocrinol 1992 Apr 13:2 163-215.

Chang C, Saltzman A, Yeh S, Young W, Keller B, Lee HJ, Wang C, Mizokami. A Androgen receptor: an overview. Crit Rev Eukaryot Gene Expr 1995 5:2 97-125.

Chang SM, Chung LW. Interaction between prostatic fibroblast and epithelial cells in culture: role of androgen. Endocrinology 1989 Nov 125:5 2719-27.

Chaproniere DM, McKeehan WL. Serial culture of single adult human prostatic epithelial cells in serum-free medium containing low calcium and a new growth factor from bovine brain. Cancer Res 1986 Feb 46:2 819-24.

Chokkalingam AP, Poliak M, Fillmore CM, Gao YT, Stanczyk FZ, Deng J, Sesterhenn lA, Mostofi FK, Fears TR, Madigan MP, Ziegler RG, Fraumeni JF Jr, Hsing AW. Insulin-like growth factors and prostate cancer: a population-based case-control study in China. Cancer Epidemiol Biomarkers Prev. 2001 May;10(5):421-7.

Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. A / z a / 1987 Apr 162:1 156-9

Clark RL, Anderson CA, Prahalada S, Robertson RT, Lochry BA, Leonard YM, Stevens JL, Hoberman AM. Critical developmental periods for effects on male rat genitalia induced by finasteride, a 5 alpha-reductase inhibitor. Toxicol Appl Pharmacol 1993 Mar 119:1 34-40.

Claus S, Berges R, Senge T, Schulze H. Cell kinetic in epithelium and stroma of benign prostatic hyperplasia. J Urol. 1997 Jul;158(l):217-21.

Coffey DS. Prostate cancer: a series of workshops on the biology of human cancer: report no.9. (eds Coffey DS, Isaacs JT).(1979) UICC Technical report series.

Collins AT, Robinson BJ, Neal DB. Benign prostatic stromal cells are regulated by basic fibroblast growth factor and transforming growth factor-beta 1. J Endocrinol. 1996 Nov;151(2):315-22.

Collins AT, Zhiming B, Gilmore K, Neal DB. Androgen and oestrogen responsiveness of stromal cells derived from the human hyperplastic prostate: oestrogen regulation of the androgen receptor. J Endocrinol. 1994 Nov; 143(2):269-77.

215 Cote RJ, Skinner EC, Salem CE, Mertes SJ, Stanczyk FZ, Henderson BE, Pike MC, Ross RK. The effect of finasteride on the prostate gland in men with elevated serum prostate- specific antigen levels. Br J Cancer. 1998 Aug;78(3):413-8.

Cowan RA, Cowan SK, Grant JK, Elder HY. Biochemical investigations of separated epithelium and stroma from benign hyperplastic prostatic tissue. J Endocrinol. 1977 Jul;74(l):lll-20.

Culig Z, Hobisch A, Cronauer MV, Radmayr C, Hittmair A, Zhang J, Thumher M, Bartsch G, Klocker H Regulation of prostatic growth and function by peptide growth factors. Prostate. 1996 Jun;28(6):392-405.

Cunha GR, Donjacour AA, Cooke PS, Mee S, Bigsby RM, Higgins SJ, Sugimura Y. The endocrinology and developmental biology of the prostate. Endocr Rev 1987 Aug 8:3 338- 62.

Cussenot O, Berthon P, Berger R, Mowszowicz I, Faille A, Hojman F, Teillac P, Le Duc A, Calvo F. Immortalization of human adult normal prostatic epithelial cells by liposomes containing large T-SV40 gene. J Urol 1991 Sep 146:3 881-6.

Cussenot O, Berthon P, Cochan d_Priollet B, Maitland NJ, Le Duc A. Immunocytochemical comparison of cultured normal epithelial prostatic cells with prostatic tissue sections. Exp Cell Res 1994 Sep 214:1 83-92.

Darnell JE. Variety in the level of gene control in eukaryotic cells. Nature 1982 Jun 3 297:5865 365-71.

Davies P, Eaton CL. Regulation of prostate growth. J Endocrinol 1991 Oct 131:1 5-17.

Davis RL, Weintraub H, Lassar AB. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 1987 Dec 24 51:6 987-1000.

De Angeli S, Valenti F, Durante E, Bassani V, Pamigotto PP. Primary cultures of human hypertrophic prostate tissue in WAJC 404 medium: a study of cell morphology and kinetics. AnatAnz 1995 Mar 177:2 185-92.

Deamaley DP. Cancer of the prostate. 1994a CRC Factsheet 20.1.

Deamaley DP Cancer of the prostate. BMJ 1994 b. Mar 19 308:6931 780-4.

DeKlerk DP, Coffey DS. Quantitative determination of prostatic epithelial and stromal hyperplasia by a new technique. Biomorphometrics. Invest Urol 1978 Nov 16:3 240-5.

De Marzo AM, Meeker AK, Epstein JI, Coffey DS. Prostate stem cell compartments: expression of the cell cycle inhibitor p27Kipl in normal, hyperplastic, and neoplastic ctWs. Am J Pathol. 1998 Sep;153(3):911-9.

Delos S, Carsol JL, Ghazarossian E, Raynaud JP, Martin PM. Testosterone metabolism in primary cultures of human prostate epithelial cells and fibroblasts. J Steroid Biochem Mol Biol 1995 Dec 55:3-4 375-83. 216 Delos S, lehle C, Martin PM, Raynaud JP. Inhibition of the activity of 'basic' 5 alpha- reductase (type 1) detected in DU 145 cells and expressed in insect cells. J Steroid Biochem Mol Biol 1994 Mar 48:4 347-52.

Denis LJ, Griffiths K. Endocrine treatment in prostate cancer. Semin Surg Oncol 2000 Jan-Feb 18:1 52-74.

Deslypere JP, Young M, Wilson JD, McPhaul MJ. Testosterone and 5 alpha- dihydrotestosterone interact differently with the androgen receptor to enhance transcription of the MMTV-CAT reporter gene. Mol Cell Endocrinol 1992 Oct 88:1-3 15- 22.

Djavan B, Zlotta AR, Byttebier G, Shariat S, Omar M, Schulman CC, Marberger M. Prostate specific antigen density of the transition zone for early detection of prostate cancer. J Urol 1998 Aug 160:2 411-8; discussion 418-9.

Dodd JG, Sheppard PC, Matusik RJ. Characterization and cloning of rat dorsal prostate mRNAs. Androgen regulation of two closely related abundant mRNAs. J Biol Chem. 1983 Sep 10;258(17):10731-7.

Doll HA, Black NA, McPherson K, Flood AB, Williams GB, Smith JC. Mortality, morbidity and complications following transurethral resection of the prostate for benign prostatic hypertrophy. J Urol 1992 Jun 147:6 1566-73.

Donahoe PK, Budzik GP, Trelstad R, Mudgett-Hunter M, Fuller A Jr, Hutson JM, Ikawa H, Hayashi A, MacLaughlin D. Miillerian-inhibiting substance: an update. Recent Prog Norm Res 1982 38 279-330.

Dorflinger U, Pscherer A, Moser M, Rummele P, Schule R, Buettner R. Activation of somatostatin receptor II expression by transcription factors MIBPl and SEF-2 in the murine brain. Mol Cell Biol 1999 May 19:5 3736-47.

Dynan WS, Tjian R. Control of eukaryotic messenger RNA synthesis by sequence- specific DNA-binding proteins. Nature 1985 Aug 29-Sep 4 316:6031 774-8.

Eicheler W, Tuohimaa P, Vilja P, Adermann K, Forssmann WG, Aumüller G. Immunocytochemical localization of human 5 alpha-reductase 2 with polyclonal antibodies in androgen target and non-target human tissues. J Histochem Cytochem 1994 May 42:5 667-75.

Faber PW, van Rooij HC, Schipper HJ, Brinkmann AO, Trapman J. Two different, overlapping pathways of transcription initiation are active on the TATA-less human androgen receptor promoter. The role of Spl. J Biol Chem 1993 May 5 268:13 9296-301.

Faller B, Farley D, Nick H. Finasteride: a slow-binding 5 alpha-reductase inhibitor. Biochemistry 1993 Jun 1 32:21 5705-10.

217 Fan K. Heterogeneous subpopulations of human prostatic adenocarcinoma cells: potential usefulness of P21 protein as a predictor for bone metastasis. J Urol 1988 Feb 139:2 318- 22.

Farnsworth WE, Brown JR. Androgen of the human prostate. Endocr Res Commun. 1976;3(2): 105-17.

Farnsworth WE, Brown RJ, Buffalo AB. Testosterone metabolism in the human prostate. JAMA 1963 183: 140-143.

Fleshner NE, Trachtenberg J. Combination finasteride and flutamide in advanced carcinoma of the prostate: effective therapy with minimal side effects. J Urol 1995 Nov 154:5 1642-5; discussion 1645-6.

Fleshner NE, Trachtenberg J. Treatment of advanced prostate cancer with the combination of finasteride plus flutamide: early results. Eur Urol 1993 24 Suppl 2: 1 Ob- 12.

Forti G, Selli C. Prospects for prostatic cancer incidence and treatment by the year 2000. Int J Androl 1996 Feb 19:1 1-10.

Franks LM. In Benign Prostatic Hepertrophy, (ed. Hinman F), page 141. (1983) Springer, New York.

Frederiksen DW, Wilson JD. Partial characterization of the nuclear reduced nicotinamide adenine dinucleotide phosphate: delta 4-3-ketosteroid 5 alpha-oxidoreductase of rat prostate. J Biol Chem 1971 Apr 25 246:8 2584-93.

Fromm M, Berg P. Deletion mapping of DNA regions required for SV40 early region promoter function in vivo. J Mol Appl Genet. 1982;1(5):457-81.

Fry PM, Hudson DL, 0_Hare MJ, Masters JR. Comparison of marker protein expression in benign prostatic hyperplasia in vivo and in vitro. BJU Int 2000 Mar 85:4 504-13.

Furr BJ, Valcaccia B, Curry B, Woodburn JR, Chesterson G, Tucker H. ICI 176,334: a novel non-steroidal, peripherally selective antiandrogen. J Endocrinol 1987 Jun 113:3 R7- 9.

Gann PH, Hennekens CH, Longcope C, Verhoek-Oftedahl W, Grodstein F, Stampfer MJ. A prospective study of plasma hormone levels, nonhormonal factors, and development of benign prostatic hyperplasia. Prostate. 1995 Jan;26(l):40-9.

Gann PH, Hennekens CH, Ma J, Longcope C, Stampfer MJ. Prospective study of sex hormone levels and risk of prostate cancer. J Natl Cancer Inst. 1996 Aug 21;88(16):1118- 26.

Garcia JV, Bich_Thuy LT, Stafford J, Queen C. Synergism between immunoglobulin enhancers and promoters. Nature 1986 Jul 24-30 322:6077 383-5.

218 Gehring WJ, Affolter M, Burglin T. Homeodomain proteins. Annu Rev Biochem 1994 63: 487-526.

Geller J, Albert J, Lopez D, Geller S, Niwayama G. Comparison of androgen metabolites in benign prostatic hypertrophy (BPH) and normal prostate. J Clin Endocrinol Metab 1976 Sep 43:3 686-8.

Geller J, Albert J, de la Vega D, Loza D, Stoeltzing W. Dihydrotestosterone concentration in prostate cancer tissue as a predictor of tumor differentiation and hormonal dependency. Cancer Res. 1978 N ov;38(ll Ft 2):4349-52.

Geller J, Albert J, Loza D. Steroid levels in cancer of the prostate—markers of tumour differentiation and adequacy of anti-androgen therapy. J Steroid Biochem. 1979b Jul; 11:631-6.

Geller J, Sionit L. Castration-like effects on the human prostate of a 5 alpha-reductase inhibitor, finasteride. J Cell Biochem Suppl 1992 16H: 109-12.

Geller J. Nonsurgical treatment of prostatic hyperplasia. Cancer 1992 Jul 1 70:1 Suppl 339-45.

George FW, Russell DW, Wilson JD. Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha- reductase. Proc Natl Acad Sci U SA 1991 Sep 15 88:18 8044-7.

George FW, Wilson JD. Hormonal control of sexual development. Vitam Horm 1986 43: 145-96.

Ghanadian R, Lewis JG, Chisholm GD, O Donoghue EP. Serum dihydrotestosterone in patients with benign prostatic hypertrophy. Br J Urol 1977 Nov 49:6 541-4.

Ghanadian R, Puah CM, ODonoghue EP. Serum testosterone and dihydrotestosterone in carcinoma of the prostate. Br J Cancer. 1979 Jun;39(6):696-9.

Ghanadian R, Puah CM. Relationships between oestradiol-17 beta, testosterone, dihydrotestosterone and 5 alpha-androstane-3 alpha, 27 beta-diol in human benign hypertrophy and carcinoma of the prostate. J Endocrinol. 1981, Feb;88(2):255-62.

Ghanadian R, Masters JR, Smith CB. Altered androgen metabolism in carcinoma of the prostate. Eur Urol 1981 7:3 169-70.

Ghanadian R. In The endocrinology of prostate tumours (ed. Ghanadian R), Chapter 3. (1983) MTP press ltd.

Gingrich JR, Tucker JA, Walther PJ, Day JW, Poulton SH, Webb KS. Establishment and characterization of a new human prostatic carcinoma cell line (DuPro-1). J Urol 1991 Sep 146:3 915-9.

Giovannucci E. Insulin-like growth factor-I and binding protein-3 and risk of cancer. Horm Res. 1999;51 Suppl 3:34-41. 219 Giovannucci E, Stampfer MJ, Krithivas K, Brown M, Dahl D, Brufsky A, Talcott J, Hennekens CH, Kantoff PW. The GAG repeat within the androgen receptor gene and its relationship to prostate cancer. Proc Natl Acad Sci USA. 1997 Apr l;94(7):3320-3.

Gluzman Y. SV40-transformed simian cells support the replication of early SV40 mutants. Cell 1981 Jan 23:1 175-82

Good D, Schwarzenberger P, Eastham JA, Rhoads RE, Hunt JD, Collins M, Batzer M, Theodossiou C, Kolls JK, Grimes SR. Cloning and characterization of the prostate- specific membrane antigen promoter. J Cell Biochem 1999 Sep 1 74:3 395-405.

Gormley GJ. In Recent advances in prostate cancer and BPH (ed. Schroder FH ), Chapter 5. (1997) Parthenon Publishing.

Gormley GJ, Stoner E, Bruskewitz RC, Imperato_McGinley J, Walsh PC, McConnell JD, Andriole GL, Geller J, Bracken BR, Tenover JS. The effect of finasteride in men with benign prostatic hyperplasia. The Finasteride Study Group. N Engl J Med 1992 Oct 22 327:17 1185-91.

Goto M, Tamura T, Mikoshiba K, Masamune Y, Nakanishi. Y Transcription inhibition of the somatic-type phosphoglycerate kinase 1 gene in vitro by a testis-specific factor that recognizes a sequence similar to the binding site for Ets oncoproteins. Nucleic Acids Res 1991 Jul 25 19:14 3959-63.

Grino PB, Griffin JE, Wilson JD. Testosterone at high concentrations interacts with the human androgen receptor similarly to dihydrotestosterone. Endocrinology 1990 Feb 126:2 1165-72.

Habib FK, Lee IR, Stitch SR, Smith PH. Androgen levels in the plasma and prostatic tissues of patients with benign hypertrophy and carcinoma of the prostate. J Endocrinol 1976 OCT 71:1 99-107.

Habib FK, Busuttil A, Robinson RA, Chisholm GD. 5 Alpha-reductase activity in human prostate cancer is related to the histological differentiation of the tumour. Clin Endocrinol (Oxf). 1985 Oct;23(4):431-8.

Habib FK, Bissas A, Neill WA, Busuttil A, Chisholm GD. Flow cytometric analysis of cellular DNA in human prostate cancer: relationship to 5 alpha-reductase activity of the tissue. Urol Res. 1989;17(4):239-43.

Habib FK, Ross M, Bayne CW, Grigor K, Buck AC, Bollina P, Chapman K. The localisation and expression of 5 alpha-reductase types I and II mRNAs in human hyperplastic prostate and in prostate primary cultures. J Endocrinol 1998 Mar 156:3 509- 17.

Hakimi JM, Schoenberg MP, Rondinelli RH, Piantadosi S, Barrack ER. Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clin Cancer Res. 1997 Sep;3(9): 1599-608.

220 Hald T. Urodynamics in benign prostatic hyperplasia: a survey. Prostate Suppl 1989 2: 69-77.

Hammond GL. Endogenous steroid levels in the human prostate from birth to old age: a comparison of normal and diseased tissues. J Endocrinol 1978 Jul 78:1 7-19.

Harman SM, Metter EJ, Blackman MR, Landis PK, Carter HB. Serum levels of insulin-like growth factor I (IGF-I), IGF-U, IGF-binding protein-3, and prostate-specific antigen as predictors of clinical prostate cancer. J Clin Endocrinol Metab. 2000 Nov;85(l l):4258-65.

Harper ME. Prostate in Human cancer in primary culture, A handbook. JRW Masters (ed). Chapter 12, p261-269, 1991. Kluwer Academic Publishers.

Hayward SW, Dahiya R, Cunha GR, Bartek J, Deshpande N, Narayan P. Establishment and characterization of an immortalized but non-transformed human prostate epithelial cell line: BPH-1. In Vitro Cell Dev BiolAnim 1995 Jan 31:1 14-24.

Hirsch KS, Jones CD, Audia JE, Andersson S, McQuaid L, Stamm NB, Neubauer BL, Pennington P, Toomey RE, Russell DW. LY191704: a selective, nonsteroidal inhibitor of human steroid 5 alpha-reductase type 1. Proc Natl Acad Sci U S A 1993 Jun 1 90:11 5277-81.

Hoehn W, Schroeder FH, Reimann JF, Joebsis AC, Hermanek P. Human prostatic adenocarcinoma: some characteristics of a serially transplantable line in nude mice (PC 82). Prostate 1980 1:1 95-104.

Holt DA, Oh HJ, Levy MA, Metcalf BW. Synthesis of a steroidal A ring aromatic sulfonic acid as an inhibitor of steroid 5 alpha-reductase. Steroids 1991 Jan 56:1 4-7.

Holtgrewe HL, Mebust WK, Dowd JB, Cockett AT, Peters PC, Proctor C. Transurethral prostatectomy: practice aspects of the dominant operation in American urology. J Urol 1989 Feb 141:2 248-53.

Horoszewicz JS, Leong SS, Chu TM, Wajsman ZL, Friedman M, Papsidero L, Kim U, Chai LS, Kakati S, Arya SK, Sandberg AA. The LNCaP cell line—a new model for studies on human prostatic carcinoma. Prog Clin Biol Res 1980 37: 115-32,

Houston B, Chisholm GD, Habib FK. Solubilization of human prostatic 5 alpha- reductase. J Steroid Biochem 1985a, Apr 22:4 461-7.

Houston B, Chisholm GD, Habib FK. Evidence that human prostatic 5 alpha-reductase is located exclusively in the nucleus. FEBS Lett 1985b Jun 17 185:2 231-5.

Hsing AW, Comstock GW. Serological precursors of cancer: serum hormones and risk of subsequent prostate cancer. Cancer Epidemiol Biomarkers Prev 1993 Jan-Feb;2(l):27-32.

Huang W, Shostak Y, Tarr P, Sawyers C, Carey M. Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer. J Biol Chem 1999 Sep 3 274:36 25756-68.

221 Hudson DL, O'Hare M, Watt FM, Masters JR. Proliferative heterogeneity in the human prostate: evidence for epithelial stem cells. Lab Invest 2000 Aug 80:8 1243-50.

Hudson RW. Studies of the nuclear 5 alpha-reductase of human hyperplastic prostatic tissue. J Steroid Biochem 1981 Jun 14:579-84.

Hudson RW. Comparison of nuclear 5 alpha-reductase activities in the stromal and epithelial fractions of human prostatic tissue. J Steroid Biochem 1987 Mar 26:3 349-53.

Hudson RW, Moffitt PM, Owens WA. Studies of the nuclear 5 alpha-reductase of human prostatic tissue: comparison of enzyme activities in hyperplastic, malignant, and normal tissues. Can J Biochem Cell Biol. 1983 Jul;61(7):750-5.

Huggin C, Steven RE, Hodges CV. Studies on prostate cancer. H. The effects of castration on advanced carcinoma of the prostate gland. Arch Surg 1941, 209-223.

Hussein KA, Kochakian CD. 17-beta-hydroxy-C 19-steroid dehydrogenase activity of dog prostate, solubilization and partial purification and characterization. Steroids 1968, Nov 12:5 589-605.

Ide T, Tsuji Y, Nakashima T, Ishibashi S. Progress of aging in human diploid cells transformed with a tsA mutant of simian virus 40. Exp Cell Res 1984 150:2 321-8. lehle C, Delos S, Guirou O, Tate R, Raynaud JP, Martin PM. Human prostatic steroid 5 alpha-reductase isoforms—a comparative study of selective inhibitors. J Steroid Biochem Mol Biol 1995 Sep 54:5-6 273-9. lehle C, Radvanyi F, Gil Diez de Medina S, Ouafik LH, Gerard H, Chopin D, Raynaud JP, Martin PM. Differences in steroid 5alpha-reductase iso-enzymes expression between normal and pathological human prostate tissue. J Steroid Biochem Mol Biol 1999 Mar 68:5-6 189-95. lizumi T, Yazaki T, Kanoh S, Kondo I, Koiso K. Establishment of a new prostatic carcinoma cell line (TSU-Prl). J Urol 1987 Jun 137:6 1304-6.

Imagawa M, Chiu R, Karin M. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 1987 Oct 23;51(2):251-60.

Imperato-McGinley J, Guerrero L, Gautier T, Peterson RE. Steroid 5alpha-reductase deficiency in man: an inherited form of male pseudohermaphroditism. Science 1974 Dec 27 186:4170 1213-5.

Ingles SA, Ross RK, Yu MC, Irvine RA, La Pera G, Haile RW, Coetzee GA. Association of prostate cancer risk with genetic polymorphisms in vitamin D receptor and androgen receptor. J Natl Cancer Inst. 1997 Jan 15;89(2): 166-70.

Irvine RA, Yu MC, Ross RK, Coetzee GA. The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Res. 1995 May 1;55(9): 1937-40. 222 Isaacs JT, McDermott IR, Coffey DS. The identification and characterization of a new C l903 steroid metabolite in the rat ventral prostate: 5 alpha-androstane-3 beta, 6 alpha, 17 beta-triol. Steroids 1979 Jun 33:6 639-57.

Isaacs JT. Prostate cancer: a series of workshops on the biology of human cancer: report no.9. (eds Coffey DS, Isaacs JT). (1979) UICC Technical report series.

Isaacs JT, Brendler CB, Walsh PC. Changes in the metabolism of dihydrotestosterone in the hyperplastic human prostate. J Clin Endocrinol Metab 1983 Jan 56:1 139-46.

Isaacs JT. Antagonistic effect of androgen on prostatic cell death. Prostate 1984 5:5 545- 57.

Isaacs JT, Coffey DS. Etiology and disease process of benign prostatic hyperplasia. Prostate Suppl 1989 2: 33-50.

Ito YZ, Nakazato Y. A new serially transplantable human prostatic cancer (HONDA) in nude mice. J Urol 1984 Aug 132:2 384-7.

Jacobi GH, Wilson JD. Formation of 5alpha-androstane-3alpha, 17beta-diol by normal and hypertrophic human prostate. J Clin Endocrinol Metab 1977 Jan 44:1 107-15.

Jacobs SC. Spread of prostatic cancer to bone. Urology 1983 Apr 21:4 337-44.

Janknegt RA, Chappie CR. Efficacy and safety of the alpha-1 blocker doxazosin in the treatment of benign prostatic hyperplasia. Analysis of 5 studies. Doxazosin Study Groups. Eur Urol 1993 24:3 319-26.

Jat PS, Sharp PA. Cell lines established by a temperature-sensitive simian virus 40 large- T-antigen gene are growth restricted at the nonpermissive temperature. Mol Cell Biol 1989 Apr 9:4 1672-81.

Jenkins EP, Andersson S, Imperato-McGinley J, Wilson JD, Russell DW. Genetic and pharmacological evidence for more than one human steroid 5 alpha-reductase. J Clin Invest 1992 Jan 89:1 293-300.

Jenkins EP, Hsieh CL, Milatovich A, Normington K, Berman DM, Francke U, Russell DW. Characterization and chromosomal mapping of a human steroid 5 alpha-reductase gene and pseudogene and mapping of the mouse homologue. Genomics 1991 Dec 11:4

1102- 12.

Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, Jones LW. Establishment and characterization of a human prostatic carcinoma cell line (PC-3). Invest Urol 1979 Jul 17:1 16-23.

Kaighn ME, Reddel RR, Lechner JF, Peehl DM, Camalier RE, Brash DE, Saffiotti U, Harris CC. Transformation of human neonatal prostate epithelial cells by strontium phosphate transfection with a plasmid containing SV40 early region genes. Cancer Res 1989 Jun 1 49:11 3050-6. 223 Kallioniemi OP, Visakorpi T. Genetic basis and clonal evolution of human prostate cancer. AJv Cancer Res. 1996;68:225-55.

Kasper S, Rennie PS, Bruchovsky N, Sheppard PC, Cheng H, Lin L, Shiu RP, Snoek R, Matusik RJ. Cooperative binding of androgen receptors to two DNA sequences is required for androgen induction of the probasin gene. J Biol Chem 1994 Dec 16 269:50 31763-9.

Kassen A, Sutkowski DM, Ahn H, Sensibar JA, Kozlowski JM, Lee C. Stromal cells of the human prostate: initial isolation and characterization. Prostate. 1996 Feb;28(2):89-97.

Klein H, Bressel M, Kastendieck H, Voigt KD. A Quantitative assessment of endogenous testicular and adrenal sex steroids and of steroid metabolizing enzymes in untreated human prostatic cancerous tissue. J Steroid Biochem 1988a, 30:1-6 119-30.

Klein H, Bressel M, Kastendieck H, Voigt KD. Androgens, adrenal androgen precursors, and their metabolism in untreated primary tumors and lymph node métastasés of human prostatic cancer. Am J Clin Oncol. 1988b; 11 Suppl 2:830-6.

Kolvenbag GJ, Blackledge GR, Gotting-Smith K. Bicalutamide (Casodex) in the treatment of prostate cancer: history of clinical development. Prostate 1998 Jan 1 34:1 61-72.

Kolvenbag GJ, Nash A. Bicalutamide dosages used in the treatment of prostate cancer. Prostate 1999 Apr 1 39:1 47-53.

Kooistra A, Elissen NM, Konig JJ, Vermey M, van der Kwast TH, Romijn JC, Schroder FH. Immunocytochemical characterization of explant cultures of human prostatic stromal cells. Prostate 1995 Jul 27:1 42-9.

Kovacs WJ, Griffin JE, Wilson JD. Transformation of human androgen receptors to the deoxyribonucleic acid-binding state. Endocrinology 1983 Nov 113:5 1574-81.

Krieg M, Bartsch W, Janssen W, Voigt KD A. comparative study of binding, metabolism and endogenous levels of androgens in normal, hyperplastic and carcinomatous human prostate. J Steroid Biochem 1979 Jul 11: IB 615-24.

Krieg M, Bartsch W, Thomsen M, Voigt KD. Androgens and estrogens: their interaction with stroma and epithelium of human benign prostatic hyperplasia and normal prostate. J Steroid Biochem 1983 Jul; 19(1 A): 155-61.

Krieg M, Nass R, Tunn SEffect of aging on endogenous level of 5 alpha- dihydrotestosterone, testosterone, estradiol, and estrone in epithelium and stroma of normal and hyperplastic human prostate. J Clin Endocrinol Metab. 1993 Aug;77(2):375- 81.

Kumar MV, Tindall DJ. Transcriptional regulation of the steroid receptor genes. Prog Nucleic Acid Res Mol Biol 1998 59: 289-306

224 Labrie C, Trudel C, Li S, Martel C, Couêt J, Labrie F. Combination of an antiandrogen and a 5 alpha-reductase inhibitor: a further step towards total androgen blockade? Endocrinology 1991 Jul 129:1 566-8.

Labrie F, Endocrine therapy for prostate cancer. Endocrinol Metab Clin North Am 1991 Dec 20:4 845-72.

Labrie F, Sugimoto Y, Luu_The V, Simard J, Lachance Y, Bachvarov D, Leblanc G, Durocher F, Paquet N. Structure of human type U 5 alpha-reductase gene. Endocrinology 1992 Sep 131:3 1571-3.

Labrie-F; Dupont-A; Cusan-L; Gomez-J; Diamond-?; Koutsilieris-M; Suburu-R; Fradet- Y; Lemay-M; Tetu-B; et-al. Downstaging of localized prostate cancer by neoadjuvant therapy with flutamide and lupron: the first controlled and randomized trial. Clin-Invest- Med 1993 Dec 16(6): 499-509.

Lamb JC, English H, Levandoski PL, Rhodes GR, Johnson RK, Isaacs JT Prostatic involution in rats induced by a novel 5 alpha-reductase inhibitor, SK&F 105657: role for testosterone in the androgenic response. Endocrinology 1992 Feb 130:2 685-94.

Latchman D. In eukaryotic transcription factors page 7. (1998). Academic Press.

Lechner JF, Narayan KS, Ohnuki Y, Babcock MS, Jones LW, Kaighn ME. Replicative epithelial cell cultures from normal human prostate gland. J Natl Cancer Inst, 1978 Apr;60(4):797-801.

Lee C. In Prostate: Basic and clinical aspects (ed. RK Naz), Chapter 3. (1997) CRC press. New York.

Lee M, Garkovenko E, Yun JS, Weijerman PC, Peehl, DM, Chen L, Rhim JS. Characterisation of adult human prostatic epithelial cells immortalised by polybrene- induced DNA transfection with a plasmid containing an origin-defective SV40 genome. Int J Oncol. 1994 4:821-830.

Le Goff JM, Martin PM, Ojasoo T, Raynaud JP. Non-michaelian behavior of 5 alpha- reductase in human prostate. J Steroid Biochem. 1989 Aug;33(2): 155-63.

Lepor H. Nonoperative management of benign prostatic hyperplasia. J Urol 1989a Jun 141:6 1283-9.

Lepor H. Alpha adrenergic antagonists for the treatment of symptomatic BPH. Int J Clin Pharmacol Ther Toxicol 1989b Apr 27:4 151-5.

Lepor H. The role of radical prostatectomy in the treatment of cancer of the prostate. Cancer Treat Res 1989c 46: 15-34.

Lepor H. Medical therapy for benign prostatic hyperplasia. Urology 1993 Nov 42:5 483- 501.

225 Lepor H, Ri gaud G. The efficacy of transurethral resection of the prostate in men with moderate symptoms of prostatism. J Urol 1990 Mar 143:3 533-7.

Levine AC, Wang JP, Ren M, Eliashvili E, Russell DW, Kirschenbaum. A Immunohistochemical localization of steroid 5 alpha-reductase 2 in the human male fetal reproductive tract and adult prostate. J Clin Endocrinol Metab 1996 Jan 81:1 384-9.

Levy MA, Brandt M, Greway AT. Mechanistic studies with solubilized rat liver steroid 5 alpha-reductase: elucidation of the kinetic mechanism. Biochemistry 1990 Mar 20 29:11 2808-15.

Li X, Chen C, Singh SM, Labrie F. The enzyme and inhibitors of 4-ene-3-oxosteroid 5 alpha-oxidoreductase. Steroids 1995 Jun 60:6 430-41.

Loop SM, Rozanski TA, Ostenson RC. Human primary prostate tumor cell line, ALVA- 31: a new model for studying the hormonal regulation of prostate tumor cell growth. Prostate 1993 22:2 93-108.

Lubaroff DM. Development of an epithelial tissue culture line from human prostatic adenocarcinoma. J Urol 1977 Oct 118:4 612-5.

Luu The V, Labrie C, Zhao HP, Couet J, Lachance Y, Simard J, Leblanc G, Cote J, Berube D, Gagne R. Characterization of cDNAs for human estradiol 17 beta- dehydrogenase and assignment of the gene to chromosome 17: evidence of two mRNA species with distinct 5'-termini in human placenta. Mol Endocrinol 1989 Aug 3:8 1301-9.

Luu-The V, Sugimoto Y, Puy L, Labrie Y, Lopez Solache I, Singh M, Labrie F. Characterization, expression, and immunohistochemical localization of 5 alpha-reductase in human skin. J Invest Dermatol 1994 Feb 102:2 221-6.

Magasanik B Gene regulation from sites near and far. New Biol 1989 Dec 1:3 247-51.

Makridakis N, Ross RK, Pike MC, Chang L, Stanczyk FZ, Kolonel LN, Shi CY, Yu MC, Henderson BE, Reichardt JK. A prevalent missense substitution that modulates activity of prostatic steroid 5alpha-reductase. Cancer Res. 1997 Mar 15 ;57(6): 1020-2.

Makridakis NM, Ross RK, Pike MC, Crocitto LE, Kolonel LN, Pearce CL, Henderson BE, Reichardt JK. Association of mis-sense substitution in SRD5A2 gene with prostate cancer in African-American and Hispanic men in Los Angeles, USA. Lancet. 1999 Sep 18;354(9183):975-8.

Malathi K, Gurpide E. Metabolism of 5alpha-dihydrotestosterone in human benign hyperplastic prostate. J Steroid Biochem 1977 Feb 8:2 141-5.

Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schütz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P. The nuclear receptor superfamily: the second decade. Ce// 1995 Dec 15 83:6 835-9.

Marcelli M, Cunningham GR Hormonal signaling in prostatic hyperplasia and neoplasia. J Clin Endocrinol Metab. 1999 Oct;84(10):3463-8. 226 Marcelli M, Ittmann M, Mariani S, Sutherland R, Nigam R, Murthy L, Zhao Y, DiConcini D, Puxeddu E, Esen A, Eastham J, Weigel NL, Lamb DJ. Androgen receptor mutations in prostate cancer. Cancer Res. 2000 Feb 15;60(4):944-9.

Masters JR, Thomson JA, Daly-Bums B, Reid YA, Dirks WG, Packer P, Toji LH, Ohno T, Tanabe H, Arlett CE, Kelland LR, Harrison M, Virmani A, Ward TH, Ayres KL, Debenham PG. Short tandem repeat profiling provides an international reference standard for human cell lines. Proc Natl Acad Sci USA. 2001 Jul 3;98(14):8012-7.

McConnell JD, Wilson JD, George FW, Geller J, Pappas F, Stoner E. Finasteride, an inhibitor of 5 alpha-reductase, suppresses prostatic dihydrotestosterone in men with benign prostatic hyperplasia. J Clin Endocrinol Metab 1992 Mar 74:3 505-8.

McKeehan WL, Adams PS, Rosser MP. Direct mitogenic effects of insulin, epidermal growth factor, glucocorticoid, cholera toxin, unknown pituitary factors and possibly prolactin, but not androgen, on normal rat prostate epithelial cells in serum-free, primary cell culture. Cancer Res 1984 May 44:5 1998-2010.

McNeal JE. Origin and evolution of benign prostatic enlargement. Invest Urol 1978 Jan 15:4 340-5.

McNeal JE. The zonal anatomy of the prostate. Prostate 1981a 2:1 35-49.

McNeal JE. Normal and pathologic anatomy of prostate. Urology 1981 Mar 17:Suppl 3 11- 6.

McNeal JE. Anatomy of the prostate and morphogenesis of BPH. Prog Clin Biol Res 1984 145: 27-53. McNeal JE. Normal histology of the prostate. Am J Surg Pathol 1988 Aug 12:8 619-33.

McNeal JE. In The prostate (ed. Fitzpatrick JM, Krane RJ), (1989) Chapter 1. Churchill Livingstone.

McNeal J. Pathology of benign prostatic hyperplasia. Insight into etiology. Urol Clin North Am 1990 Aug 17:3 477-86.

McNeal JE, Redwine EA, Freiha FS, Stamey TA. Zonal distribution of prostatic adenocarcinoma. Correlation with histologic pattern and direction of spread. Am J Surg Pathol 1988 Dec 12:12 897-906.

Mebust WK, Holtgrewe HL, Cockett AT, Peters PC. Transurethral prostatectomy: immediate and postoperative complications. A cooperative study of 13 participating institutions evaluating 3,885 patients. J Urol 1989 Feb 141:2 243-7.

Meikle AW, Collier ES, Middleton RG, Fang SM. Supranormal nuclear content of 5 alpha-dihydrotestosterone in benign hyperplastic prostate of humans. J Clin Endocrinol Metab. 1980 Oct;51(4):945-7.

227 Melcangi RC, Poletti A, Cavarretta I, Celotti F, Colciago A, Magnaghi V, Motta M, Negri-Cesi P, Martini L. The 5alpha-reductase in the central nervous system: expression and modes of control. J Steroid Biochem Mol Biol 1998 Apr 65:1-6 295-9.

Metcalf BW, Levy MA, Holt DA. Inhibitors of steroid 5 alpha-reductase in benign prostatic hyperplasia, male pattern baldness and acne. Trends Pharmacol Sci 1989 Dec 10:12 491-5.

Monti S, Di Silverio F, Toscano V, Martini C, Lanzara S, Varasano PA, Sciarra F. Androgen concentrations and their receptors in the periurethral region are higher than those of the subcapsular zone in benign prostatic hyperplasia (BPH). J Androl. 1998 Jul- Aug;19(4):428-33.

Monti S, Di Silverio F, Iraci R, Martini C, Lanzara S, Falasca P, Poggi M, Stigliano A, Sciarra F, Toscano V. Regional variations of insulin-like growth factor I (IGF-I), IGF-II, and receptor type I in benign prostatic hyperplasia tissue and their correlation with intraprostatic androgens. J Clin Endocrinol Metab. 2001 Apr;86(4): 1700-6.

Montie JE, Pienta KJ. Review of the role of androgenic hormones in the epidemiology of benign prostatic hyperplasia and prostate cancer. Urology 1994 Jun 43:6 892-9.

Morfin RF, Charles JF, Floch HH. Cl902-Steroid transformations in the human normal, hyperplastic and cancerous prostate. J Steroid Biochem. 1979 Jul;l l(lB):599-607.

Morfin RF, Di Stefano S, Bercovici JP, Floch HH. Comparison of testosterone, 5alpha- dihydrotestosterone and 5alpha-adrostane-3beta, 17beta-diol metabolisms in human normal and hyperplastic prostates. J Steroid Biochem 1978 Mar 9:3 245-52.

Morfin RF, Leav I, Charles JF, Cavazos LF, Ofner P, Floch HH. Correlative study of the morphology and C 19-steroid metabolism of benign and cancerous human prostatic tissue. Cancer 1977 Apr 39:4 1517-34.

Mori H, Maki M, Oishi K, Jaye M, Igarashi K, Yoshida O, Hatanaka M. Increased expression of genes for basic fibroblast growth factor and transforming growth factor type beta 2 in human benign prostatic hyperplasia. Prostate. 1990;16(l):71-80.

Morimoto I, Edmiston A, Horton R. Alteration in the metabolism of dihydrotestosterone in elderly men with prostate hyperplasia. J Clin Invest. 1980 Sep;66(3):612-5.

Moser M, Imhof A, Pscherer A, Bauer R, Amselgruber W, Sinowatz F, Hofstadter F, Schule R, Buettner R. Cloning and characterization of a second AP-2 transcription factor: AP-2 beta. Development 1995 Sep 121:2779-88.

Muraki J, Addonizio JC, Choudhury MS, Fischer J, Eshghi M, Davidian MM, Shapiro LR, Wilmot PL, Nagamatsu GR, Chiao JW. Establishment of new human prostatic cancer cell line (JCA-1). Urology 1990 Jul 36:1 79-84.

Nakhla AM, Rosner W. Characterization of ALVA-41 cells, a new human prostatic cancer cell line. Steroids 1994 Oct 59:10 586-9.

228 Narayan P, Dahiya R. Establishment and characterization of a human primary prostatic adenocarcinoma cell line (ND-1). J Urol 1992 Nov 148:5 1600-4.

Navone NM, Olive M, Ozen M, Davis R, Troncoso P, Tu SM, Johnston D, Pollack A, Pathak S, von Eschenbach AC, Logothetis CJ. Establishment of two human prostate cancer cell lines derived from a single bone metastasis. Clin Cancer Res. 1997 Dec;3(12 Pt l):2493-500.

Negri-Cesi P, Poletti A, Colciago A, Magni P, Martini P, Motta M. Presence of 5alpha- reductase isozymes and aromatase in human prostate cancer cells and in benign prostate hyperplastic tissue. Prostate 1998 Mar 1 34:4 283-91.

Nickel JC, Andersen JT. In Recent advances in prostate cancer and BPH (ed. Schroder FH ), Chapter 3. (1997) Parthenon Publishing.

Nickel JC, Fradet Y, Boake RC, Pommerville PJ, Perreault JP, Afridi SK, Elhilali MM. Efficacy and safety of finasteride therapy for benign prostatic hyperplasia: results of a 2- year randomized controlled trial (the PROSPECT study). PROscar Safety Plus Efficacy Canadian Two year Study. CMAJ 1996 Nov 1 155:9 1251-9.

Normington K, Russell DW. Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions. J Biol Chem. 1992 Sep 25;267(27): 19548-54.

Oesterling JE Benign prostatic hyperplasia. Medical and minimally invasive treatment options. NEnglJ Med 1995 Jan 12 332:2 99-109.

Gettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, Boltax J, Grail F, Dube A, Weiss A, Brown L, Quinn G, Kas K, Endress G, Kunsch C, Libermann TA. PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. J Biol Chem. 2000 Jan 14;275(2): 1216-25.

Ofner P, Douglas WH, Spilman SD, Vena RL, Krinsky_Feibush P, LeQuesne PW. Hydroxylation of [3H]5 alpha-androstane-3 beta, 17 beta-diol by whole tissue, epithelial cells and fibroblasts from the same hyperplastic human prostate. J Steroid Biochem 1985 Mar 22:3 391-7.

Osborn-JL; Smith-DC; Trump-DL. Megestrol acetate in the treatment of hormone refractory prostate cancer. Am-J-Clin-Oncol.\991 Jun 20(3): 308-10.

Pang S, Dannull J, Kaboo R, Xie Y, Tso CL, Michel K, deKernion JB, Belldegrun AS. Identification of a positive regulatory element responsible for tissue-specific expression of prostate-specific antigen. Cancer Res. 1997 Feb l;57(3):495-9.

Pantel K, Aignherr C, Kollermann J, Caprano J, Riethmuller G, Kollermann MW. Immunocytochemical detection of isolated tumour cells in bone marrow of patients with untreated stage C prostatic cancer. Eur J Cancer 1995 Sep 31 A: 10 1627-32.

229 Pantel K, Dickmanns A, Zippelius A, Klein C, Shi J, Hoechtlen_Vollmar W, Schlimok G, Weckermann D, Obemeder R, Fanning E. Establishment of micrometastatic carcinoma cell lines: a novel source of tumor cell vaccines. J Natl Cancer Inst 1995 Aug 2 87:15 1162-8.

Parkar MH, Kuru L, 0_Hare M, Newman HN, Hughes F, Olsen I. Retroviral transduction of human periodontal cells with a temperature-sensitive SV40 large T antigen. Arch Oral Biol 1999 Oct 44:10 823-34.

Partin AW, Oesterling JE, Epstein JI, Horton R, Walsh PC. Influence of age and endocrine factors on the volume of benign prostatic hyperplasia.. J Urol 1991 Feb;145(2):405-9.

Patrikainen L, Shan J, Porvari K, Vihko PIdentification of the deoxyribonucleic acid- binding site of a regulatory protein involved in prostate-specific and androgen receptor- dependent gene expression. Endocrinology. 1999 May;140(5):2063-70.

Payson RA, Chotani MA, Chiu IM. Regulation of a promoter of the fibroblast growth factor 1 gene in prostate and breast cancer cells. J Steroid Biochem Mol Biol 1998 Aug 66:3 93-103.

Peehl DM. Culture of human prostatic epithelial cells. In Culture of epithelail cells, pages 159-180. 1992 Wiley-Liss Inc.

Peehl DM, Sellers RG. Induction of smooth muscle cell phenotype in cultured human prostatic stromal cells. Exp Cell Res. 1997 May 1;232(2):208-15.

Peehl DM, Wong ST, Stamey TA. Clonal growth characteristics of adult human prostatic epithelial cells. In Vitro Cell Dev Biol. 1988 Jun;24(6):530-6.

Pelletier G, Luu-The V, Huang XF, Lapointe H, Labrie F. Localization by in situ hybridization of steroid 5alpha-reductase isozyme gene expression in the human prostate and preputial skin. J Urol 1998 Aug 160:2 577-82.

Poletti A, Celotti F, Rumio C, Rabuffetti M, Martini L. Identification of type 1 5alpha- reductase in myelin membranes of male and female rat brain. Mol Cell Endocrinol 1997 May 16 129:2 181-90.

Poletti A, Negri-Cesi P, Rabuffetti M, Colciago A, Celotti F, Martini L. Transient expression of the 5alpha-reductase type 2 isozyme in the rat brain in late fetal and early postnatal life. Endocrinology 1998a, Apr 139:4 2171-8.

Poletti A, Coscarella A, Negri-Cesi P, Colciago A, Celotti F, Martini L. 5 alpha-reductase isozymes in the central nervous system. Steroids 1998b, May-Jun 63:5-6 246-51.

Ponte P, Ng SY, Engel J, Gunning P, Kedes L. Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res 1984 Feb 10 12:3 1687-96.

230 Presti JC, Fair WR, Andriole G, Sogani PC, Seidmon EJ, Ferguson D, Ng J, Gormley GJ. Multicenter, randomized, double-blind, placebo controlled study to investigate the effect of finasteride (MK-906) on stage D prostate cancer. J Urol 1992 Oct 148:4 1201-4.

Putz E, Witter K, Offner S, Stosiek P, Zippelius A, Johnson J, Zahn R, Riethmuller G, Pantel K. Phenotypic characteristics of cell lines derived from disseminated cancer cells in bone marrow of patients with solid epithelial tumors: establishment of working models for human micrometastases. Cancer Res. 1999 Jan l;59(l):241-8.

Quandt K, Freeh K, Karas H, Wingender E, Werner T. Matind and Matlnspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 1995 Dec 11 23:23 4878-84.

Rasmusson GH, Reynolds GF, Steinberg NG, Walton E, Patel GF, Liang T, Cascieri MA, Cheung AH, Brooks JR, Berman C. Azasteroids: structure-activity relationships for inhibition of 5 alpha-reductase and of androgen receptor binding. J Med Chem 1986 Nov 29:11 2298-315.

Reichardt JK, Makridakis N, Henderson BE, Yu MC, Pike MC, Ross RK. Genetic variability of the human SRD5A2 gene: implications for prostate cancer risk. Cancer Res 1995 Sep 15 55:18 3973-5.

Reichert W, Hartmann RW, Jose J. Stable expression of the human 5alpha-reductase isoenzymes type I and type U in HEK293 cells to identify dual and selective inhibitors. J Enzyme Inhib. 2001b Jan;16(l):47-53.

Reichert W, Michel A, Hartmann RW, Jose J. Stable expression of human 5alpha- reductase type n in COSl cells due to chromosomal gene integration: a novel tool for inhibitor identification. J Steroid Biochem Mol Biol. 2001a Sep;78(3):275-84.

Reid P, Kantoff P, Oh W. Antiandrogens in prostate cancer. Invest New Drugs 1999 17:3 271-84.

Rennie PS, Bruchovsky N, Leco KJ, Sheppard PC, McQueen SA, Cheng H, Snoek R, Hamel A, Bock ME, MacDonald BS. Characterization of two cis-acting DNA elements involved in the androgen regulation of the probasin gene. Mol Endocrinol 1993 Jan 7:1 23-36.

Rennie PS, Bruchovsky N, McLoughlin MG, Batzold FH, Dunstan-Adams EE. Kinetic analysis of 5 alpha-reductase isoenzymes in benign prostatic hyperplasia (BPH). J Steroid Biochem 1983 Jul 19:1 A 169-73.

Rhim JS, Webber MM, Bello D, Lee MS, Amstein P, Chen LS, Jay G. Stepwise immortalization and transformation of adult human prostate epithelial cells by a combination of HPV-18 and v-Ki-ras. Proc Natl Acad Sci U S A 1994 Dec 6 91:25 11874-8.

Riegman PH, Vlietstra RJ, van der Korput JA, Brinkmann AO, Trapman J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 1991 Dec 5:12 1921-30. 231 Riegman PH, Vlietstra RJ, van der Korput JA, Romijn JC, Trapman J. Characterization of the prostate-specific antigen gene: a novel human kallikrein-like gene. Biochem Biophys Res Commun. 1989 Feb 28;159(1):95-102.

Rittmaster RS. Finasteride. N EnglJ Med 1994 Jan 13 330:2 120-5.

Roberson KM, Edwards DW, Chang GC, Robertson CN. Isolation and characterization of a novel human prostatic stromal cell culture: DuK50. In Vitro Cell Dev Biol Anim 1995 Dec 31:11 840-5.

Robson CN, Gnanapragasam V, Byrne RL, Collins AT, Neal DE. Transforming growth factor-beta 1 up-regulates p i5, p21 and p27 and blocks cell cycling in G1 in human prostate epithelium. J Endocrinol. 1999 Feb;160(2):257-66.

Robinson EJ, Neal DE, Collins AT. Basal cells are progenitors of luminal cells in primary cultures of differentiating human prostatic epithelium. Prostate. 1998 Nov 1;37(3):149- 60.

Roos NP, Wennberg JE, Malenka DJ, Fisher ES, McPherson K, Andersen TF, Cohen MM, Ramsey E. Mortality and reoperation after open and transurethral resection of the prostate for benign prostatic hyperplasia V E«g/ 7 Me J 1989 Apr 27 320:17 1120-4.

Ross RK, Bernstein L, Lobo RA, Shimizu H, Stanczyk FZ, Pike MC, Henderson. BE 5- alpha-reductase activity and risk of prostate cancer among Japanese and US white and black males. Lancet 1992 Apr 11 339:8798 887-9.

Ross RK, Coetzee GA, Pearce CL, Reichardt JK, Bretsky P, Kolonel LN, Henderson BE, Lander E, Altshuler D, Daley G. Androgen metabolism and prostate cancer: establishing a model of genetic susceptibility. Eur Urol. 1999;35(5-6):355-61.

Ruokonen M, Shan JD, Hedberg P, Patrikainen L, Vihko P. Transfecting well- differentiated prostatic cancer cell line LNCaP. Biochem Biophys Res Commun 1996 Jan 26 218:3 794-6.

Russell DW, Wilson JD. Steroid 5 alpha-reductase: two genes/two enzymes. Annu Rev Biochem 1994 63: 25-61.

Sambrook J, Fritsch EF, Maniatis T. Molecular cloning, a laboratory manual. Second edition. (1989). Cold Spring Harbour Laboratory Press.

Savory JG, May D, Reich T, La Casse EC, Lakins J, Tennis wood M, Raymond Y, Hache RJ, Sikorska M, Lefebvre YA. 5 alpha-Reductase type 1 is localized to the outer nuclear membrane. Mol Cell Endocrinol. 1995 Apr 28;110(1-2): 137-47.

Sawada S, Scarborough JD, Killeen N, Littman DR. A lineage-specific transcriptional silencer regulates CD4 gene expression during T lymphocyte development. Cell 1994 Jun 17 77:6 917-29.

232 Scardino PT, Weaver R, Hudson MA. Early detection of prostate cancer. Hum Pathol 1992 Mar 23:3 211-22.

Schaufele F. CCAAT/enhancer-binding protein alpha activation of the rat growth hormone promoter in pituitary progenitor GHFTl-5 cells. J Biol Chem 1996 Aug 30 271:35 21484-9

Schuur BR, Henderson GA, Kmetec LA, Miller JD, Lamparski HG, Henderson DR. Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem 1996 Mar 22 271:12 7043-51.

Schweikert HU, Hein HJ, Romijn JC, Schroder FH. Testosterone metabolism of fibroblasts grown from prostatic carcinoma, benign prostatic hyperplasia and skin fibroblasts. J Urol 1982 Feb 127:2 361-7.

Shapiro E, Becich MJ, Hartanto V, Lepor H. The relative proportion of stromal and epithelial hyperplasia is related to the development of symptomatic benign prostate hyperplasia. J Urol. 1992 May; 147(5): 1293-7.

Sherwood ER, Berg LA, McEwan RN, Pasciak RM, Kozlowski JM, Lee C. Two- dimensional protein profiles of cultured stromal and epithelial cells from hyperplastic human prostate. J Cell Biochem 1989 Jun 40:2 201-14.

Siiteri PK, Wilson JD. Dihydrotestosterone in prostatic hypertrophy. I. The formation and content of dihydrotestosterone in the hypertrophic prostate of man. J Clin Invest 1970 Sep 49:9 1737-45.

Siiteri PK, Wilson JD. Testosterone formation and metabolism during male sexual differentiation in the human embryo. J Clin Endocrinol Metab 1974 Jan 38:1 113-25.

Silver RI, Wiley EL, Thigpen AE, Guileyardo JM, McConnell JD, Russell DW. Cell type specific expression of steroid 5 alpha-reductase 2. J Urol 1994a, Aug 152:2 Pt 1 438-42.

Silver RI, Wiley EL, Davis DL, Thigpen AE, Russell DW, McConnell JD. Expression and regulation of steroid 5 alpha-reductase 2 in prostate disease. / Urol 1994b Aug 152:2 Pt 1 433-7.

Simon LV, Beauchamp JR, 0_Hare M, Olsen I. Establishment of long-term myogenic cultures from patients with Duchenne muscular dystrophy by retroviral transduction of a temperature-sensitive SV40 large T antigen. Exp Cell Res 1996 May 1 224:2 264-71.

Smith CB, Masters JR, Ghanadian R. Differential androgen metabolism in prostatic tumours. J. Endocrinol 1980 65, 149.

Smith CM (Thesis). Characterisation of androgen metabolism and 5a-reductase activity in human prostate cell in vitro. 1993 Faculty of medicine, UCL.

Smith CM, Ballard SA, Worman N, Buettner R, Masters JR. 5 alpha-reductase expression by prostate cancer cell lines and benign prostatic hyperplasia in vitro. J Clin Endocrinol Metab. 1996 Apr;81(4):1361-6. 233 Smith CM, Ballard SA, Wyllie MG, Masters JR. Comparison of testosterone metabolism in benign prostatic hyperplasia and human prostate cancer cell lines in vitro. J Steroid Biochem Mol Biol 1994 Aug 50:3-4 151-9.

Smith PH. In Recent advances in prostate cancer and BPH (ed. Schroder FH), Chapter 2. (1997) Parthenon Publishing.

Smith-CB; Masters-JR; Metcalfe-SA; Ghanadian-R. Androgen metabolism by human prostatic tumours in organ culture. Eur-J-Cancer-Clin-Oncol 1983 Jul; 19(7): 929-34.

Stamps AC, Davies SC, Burman J, 0_Hare MJ. Analysis of proviral integration in human mammary epithelial cell lines immortalized by retroviral infection with a temperature- sensitive SV40 T-antigen construct. Int J Cancer 1994 Jun 15 57:6 865-74.

Stamps AC, Gusterson BA, 0_Hare MJ. Are tumours immortal? Eur J Cancer 1992 28A:8-9 1495-500.

Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein BA, Ostrander EA. Polymorphic repeats in the androgen receptor gene: molecular markers of prostate cancer risk. Cancer Res. 1997 Mar 15;57(6):1194-8.

St-Arnaud R, Lachance R, Kelly SJ, Belanger A, Dupont A, Labrie F. Loss of luteinizing hormone bioactivity in patients with prostatic cancer treated with an LHRH agonist and a pure antiandrogen. Clin Endocrinol (Oxf) 1986 Jan 24:1 21-30.

Stege R, Carlstrom K. J. Testicular and adrenocortical function in healthy men and in men with benign prostatic hyperplasia. Steroid Biochem Mol Biol 1992 May;42(3-4):357-62.

Stone KR, Mickey DD, Wunderli H, Mickey GH, Paulson DF. Isolation of a human prostate carcinoma cell line (DU 145). Int J Cancer 1978 Mar 15 21:3 274-81.

Stone KR, Stone MP, Paulson DF. In vitro cultivation of prostatic epithelium. Invest Urol 1976 Jul;14(l):79-82.

Stoner E. Maintenance of clinical efficacy with finasteride therapy for 24 months in patients with benign prostatic hyperplasia. The Finasteride Study Group. Arch Intern Med 1994a, Jan 10 154:1 83-8.

Stoner E. Three-year safety and efficacy data on the use of finasteride in the treatment of benign prostatic hyperplasia. Urology 1994b, Mar 43:3 284-92; discussion 292-4.

Stravodimos K, Constantinides C, Manousakas T, Pavlaki C, Pantazopoulos D, Giannopoulos A, Dimopoulos C. Immunohistochemical expression of transforming growth factor beta 1 and nm-23 HI antioncogene in prostate cancer: divergent correlation with clinicopathological parameters. Anticancer Res. 2000 Sep-Oct;20(5C):3823-8.

Supakar PC, Jung MH, Song CS, Chatterjee B, Roy AK. Nuclear factor kappa B functions as a negative regulator for the rat androgen receptor gene and NF-kappa B activity

234 increases during the age-dependent desensitization of the liver. J Biol Chem 1995 Jan 13 270:2 837-42.

Sweat SD, Pacelli A, Bergstralh EJ, Slezak JM, Bostwick DG. Androgen receptor expression in prostatic intraepithélial neoplasia and cancer. J Urol 1999a, Apr 161:4 1229-32.

Sweat SD, Pacelli A, Bergstralh EJ, Slezak JM, Cheng L, Bostwick DG. Androgen receptor expression in prostate cancer lymph node métastasés is predictive of outcome after surgery. J Urol 1999b Apr 161:4 1233-7.

Swinnen K, Deboel L, Cailleau J, Heyns W, Verhoeven G. Morphological and functional similarities between cultured prostatic stromal cells and testicular peritubular myoid cells. Prostate 1991 19:2 99-112.

Szucs S, Zitzelsberger H, Breul J, Bauchinger M, Hofler H. Two-phase short-term culture method for cytogenetic investigations from human prostate carcinoma. Prostate. 1994 Nov;25(5):225-35.

Takahashi H, Furusato M, Allsbrook WC Jr, Nishii H, Wakui S, Barrett JC, Boyd J. Prevalence of androgen receptor gene mutations in latent prostatic carcinomas from Japanese men. Cancer Res. 1995 Apr 15;55(8):1621-4.

Taketa S, Nishi N, Takasuga H, Okutani T, Takenaka I, Wada F. Differences in growth requirements between epithelial and stromal cells derived from rat ventral prostate in serum-free primary culture. Prostate 1990 17:3 207-18.

Taylor_Papadimitriou J, Purkis P, Lane EB, McKay LA, Chang SE. Effects of SV40 transformation on the cytoskeleton and behavioural properties of human kératinocytes. Cell Differ 1982 May 11:3 169-80.

Tenover JS. Prostates, pates, and pimples. The potential medical uses of steroid 5 alpha- reductase inhibitors. Endocrinol Metab Clin North Am 1991 Dec 20:4 893-909.

Thanos D, Maniatis T. NF-kappa B: a lesson in family values. Cell 1995 Feb 24 80:4 529- 32.

The Finasteride Study Group. Finasteride (MK-906) in the treatment of benign prostatic hyperplasia. Prostate 1993 22:4 291-9.

Thigpen AE, Silver RI, Guileyardo JM, Casey ML, McConnell JD, Russell DW. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. J Clin Invest 1993a, Aug 92:2 903-10.

Thigpen AE, Cala KM, Russell DW. Characterization of Chinese hamster ovary cell lines expressing human steroid 5 alpha-reductase isozymes. J Biol Chem 1993b, Aug 15 268:23 17404-12.

235 Thigpen AE, Davis DL, Milatovich A, Mendonca BB, Imperato_McGinley J, Griffin JB, Francke U, Wilson JD, Russell DW. Molecular genetics of steroid 5 alpha-reductase 2 deficiency. J Clin Invest 1992 Sep 90:3 799-809.

Trachtenberg J. Innovative approaches to the hormonal treatment of advanced prostate cancer. Eur Urol 1997 32 Suppl 3 78-80.

Tsugaya M, Habib FK, Chisholm GD, Ross M, Tozawa K, Hayashi Y, Kohri K, Tanaka S. Testosterone metabolism in primary cultures of epithelial cells and stroma from benign prostatic hyperplasia. Urol Res 1996 24:5 265-71.

Tunn S, Hochstrate H, Grunwald I, Fluchter SH, Krieg M. Effect of aging on kinetic parameters of 5 alpha-reductase in epithelium and stroma of normal and hyperplastic human prostate. J Clin Endocrinol Metab. 1988 Nov;67(5):979-85.

Valerio D, Duyvesteyn MG, Dekker BM, Weeda G, Berkvens TM, van der Voom L, van Ormondt H, van der Bb AJ. Adenosine deaminase: characterization and expression of a gene with a remarkable promoter. EMBO J 1985 Feb 4:437-43. van Helden PD, Wild U, Hoal_van Helden EG, Bey E, Cohen R. Detection by DNA fingerprinting of somatic changes during the establishment of a new prostate cell line. Br J Cancer 1994 Aug 70:2 195-8.

Vatten LJ, Ursin G, Ross RK, Stanczyk FZ, Lobo RA, Harvei S, Jellum E. Androgens in serum and the risk of prostate cancer: a nested case-control study from the Janus serum bank in Norway. Cancer Epidemiol Biomarkers Prev. 1997 Nov;6(l l):967-9.

Veldscholte J, Berrevoets CA, Ris_Stalpers C, Kuiper GG, Jenster G, Trapman J, Brinkmann AO, Mulder E. The androgen receptor in LNCaP cells contains a mutation in the ligand binding domain which affects steroid binding characteristics and response to antiandrogens. J Steroid Biochem Mol Biol 1992 Mar 41:3-8 665-9.

Vermeulen A, De Sy W. Androgens in patients with benign prostatic hyperplasia before and after prostatectomy. J Clin Endocrinol Metab 1976 Dec 43:6 1250-4.

Villers A, Steg A, Boccon-Gibod L. Anatomy of the prostate: review of the different models. Eur Urol 1991 20:4 261-8.

Virkkunen P, Hedberg P, Palvimo JJ, Birr E, Porvari K, Ruokonen M, Taavitsainen P, Janne GA, Vihko P. Structural comparison of human and rat prostate-specific acid phosphatase genes and their promoters: identification of putative androgen response elements. Biochem Biophys Res Commun 1994 Jul 15 202:1 49-57.

Vlahos CJ, Kriauciunas TD, Gleason PE, Jones JA, Eble JN, Sal vas D, Falcone JF, Hirsch KS. Platelet-derived growth factor induces proliferation of hyperplastic human prostatic stromal cells. J Cell Biochem 1993 Aug 52:4 404-13.

Voigt KD, Bartsch W. Intratissular androgens in benign prostatic hyperplasia and prostatic cancer. J Steroid Biochem 1986 Nov 25:5B 749-57.

236 Voigt W, Hsia SL. Further studies on testosterone 5 -reductase of human skin. Structural features of steroid inhibitors. J Biol Chem 1973 Jun 25 248:12 4280-5.

Wakao H, Schmitt_Ney M, Groner B. Mammary gland-specific nuclear factor is present in lactating rodent and bovine mammary tissue and composed of a single polypeptide of 89 kDa. JB iol Chem 1992 Aug 15 267:23 16365-70.

Walsh PC, Hutchins GM, Ewing LL. Tissue content of dihydrotestosterone in human prostatic hyperplasis is not supranormal. J Clin Invest 1983 Nov 72:5 1772-7.

Webber MM. Growth and maintenance of normal prostatic epithelium in vitro—a human cell model. Prog Clin Biol Res 1980 37: 181-216.

Webber MM, Bello D, Kleinman HK, Wartinger DD, Williams DE, Rhim JS. Prostate specific antigen and androgen receptor induction and characterization of an immortalized adult human prostatic epithelial cell line. Carcinogenesis 1996 Aug 17:8 1641-6.

Webber MM, Trakul N, Thraves PS, Bello_DeOcampo D, Chu WW, Storto PD, Huard TK, Rhim JS, Williams DE. A human prostatic stromal myofibroblast cell line WPMY-1: a model for stromal-epithelial interactions in prostatic neoplasia. Carcinogenesis 1999 Jul 20:7 1185-92.

Weijerman PC, Konig JJ, Wong ST, Niesters HG, Peehl DM. Lipofection-mediated immortalization of human prostatic epithelial cells of normal and malignant origin using human papillomavirus type 18 DNA. Cancer Res 1994 Nov 1 54:21 5579-83.

Weis L, Reinberg D. Transcription by RNA polymerase U: initiator-directed formation of transcription-competent complexes. FASEB J 1992 Nov 6:14 3300-9.

Wenderoth UK, George FW, Wilson JD. The effect of a 5 alpha-reductase inhibitor on androgen-mediated growth of the dog prostate. Endocrinology 1983 Aug 113:2 569-73.

Wennberg JE, Roos N, Sola L, Schori A, Jaffe R. Use of claims data systems to evaluate health care outcomes. Mortality and reoperation following prostatectomy. JAMA 1987 Feb 20 257:7 933-6.

Whitmore WF. Clinical management of prostatic cancer. An overview. Am J Clin Oncol. 1988;11 Suppl 2:S88-97.

Wilbert DM, Griffin JE, Wilson JD. Characterization of the cytosol androgen receptor of the human prostate. J Clin Endocrinol Metab 1983 Jan 56:1 113-20.

Wilding G. The importance of steroid hormones in prostate cancer. Cancer Surv. 1992;14:113-30.

Wilkin RP, Bruchovsky N, Shnitka TK, Rennie PS, Comeau TL. Stromal 5 alpha- reductase activity is elevated in benign prostatic hyperplasia. Acta Endocrinol (Copenh). 1980 Jun;94(2):284-8.

237 Wilson JD. The pathogenesis of benign prostatic hyperplasia. Am J Med 1980 May 68:5 745-56.

Wilson JD. Role of dihydrotestosterone in androgen action. Prostate Suppl 1996 6: 88-92.

Wilson JD, Griffin JE, Russell DW. Steroid 5 alpha-reductase 2 deficiency. Endocr Rev 1993 Oct 14:5 577-93.

Wilson JD, Lasnitzki I. Dihydrotestosterone formation in fetal tissues of the rabbit and rat. Endocrinology 1971 Sep 89:3 659-68.

Winter ML, Liehr JG. Possible mechanism of induction of benign prostatic hyperplasia by estradiol and dihydrotestosterone in dogs. Toxicol Appl Pharmacol. 1996 Feb;136(2):211- 9.

Wolk A, Mantzoros CS, Andersson SO, Bergstrom R, Signorello LB, Lagiou P, Adami HO, Trichopoulos D. Insulin-like growth factor 1 and prostate cancer risk: a population-based, case-control study. J Natl Cancer Inst. 1998 Jun 17;90(12):911-5.

Wright GL, Grob BM, Haley C, Grossman K, Newhall K, Petrylak D, Troyer J, Konchuba A, Schellhammer PF, Mori arty R. Upregulation of prostate-specific membrane antigen after androgen-deprivation therapy. Urology 1996 Aug 48:2 326-34.

Wu L, Matherly J, Smallwood A, Adams JY, Billick E, Belldegrun A, Carey M. Chimeric PSA enhancers exhibit augmented activity in prostate cancer gene therapy vectors. Gene Ther. 2001 Sep;8(18): 1416-26.

Xu S, Vancheeswaran R, Bou_Gharios G, 0_Hare MJ, Olsen I, Abraham D, Black C. Scleroderma-derived human fibroblasts retain abnormal phenotypic and functional characteristics following retroviral transduction with the SV40 tsT antigen. Exp Cell Res 1995 Oct 220:2 407-14.

Yanai N, Suzuki M, Obinata M. Hepatocyte cell lines established from transgenic mice harboring temperature-sensitive simian virus 40 large T-antigen gene. Exp Cell Res 1991 Nov 197:1 50-6.

Yaniv M. Regulation of eukaryotic gene expression by transactivating proteins and cis acting DNA elements. Biol Cell 1984 50:3 203-16

Yeung F, Li X, Ellett J, Trapman J, Kao C, Chung LW. Regions of prostate-specific antigen (PSA) promoter confer androgen-independent expression of PSA in prostate cancer cells. J Biol Chem. 2000 Dec 29;275(52):40846-55.

Zhang J, Zhang S, Murtha PE, Zhu W, Hou SS, Young CY. Identification of two novel cis-elements in the promoter of the prostate-specific antigen gene that are required to enhance androgen receptor-mediated transactivation. Nucleic Acids Res. 1997a Aug l;25(15):3143-50.

238 Zhang S, Murtha PE, Young CY. Defining a functional androgen responsive element in the 5' far upstream flanking region of the prostate-specific antigen gene. Biochem Biophys Res Commun. 1997b Feb 24;231(3):784-8.

Zhou MD, Wu Y, Kumar A, Siddiqui MA. Mechanism of tissue-specific transcription: interplay between positive and negative regulatory factors. Gene Expr 1992 2:2 127-38.

Zhu W, Young CY. Androgen-Dependent transcriptional regulation of the prostate- specific antigen gene by thyroid hormone 3,5,3 -L-triiodothyronine. J Androl. 2001 Jan- Feb;22(l): 136-41.

239