Etheostoma Camurum, E

Duquesne University Duquesne Scholarship Collection

Electronic Theses and Dissertations

Fall 2007 Genetic population structure and breeding parameters of three Pennsylvania State threatened darter species: Etheostoma camurum, E. maculatum and E. tippecanoe Laura Howell

Follow this and additional works at: https://dsc.duq.edu/etd

Recommended Citation Howell, L. (2007). Genetic population structure and breeding parameters of three Pennsylvania State threatened darter species: Etheostoma camurum, E. maculatum and E. tippecanoe (Master's thesis, Duquesne University). Retrieved from https://dsc.duq.edu/ etd/666

This Immediate Access is brought to you for free and open access by Duquesne Scholarship Collection. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Duquesne Scholarship Collection. For more information, please contact [email protected]. Genetic population structure and breeding parameters of three Pennsylvania State threatened darter species: Etheostoma camurum, E. maculatum and E. tippecanoe

A Thesis Presented to the Bayer School of Natural and Environmental Sciences, Department of Biological Science Duquesne University

In partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE IN BIOLOGY

Laura Anne Howell B.A. Lafayette College, 1993 B.S. University of Pittsburgh, 2002

Thesis Advisor: Brady A. Porter, Ph.D

Thesis Committee: Lisa Ludvico, Ph.D Michael Jensen-Seaman, Ph.D.

Date: 20 July 2007

Name: Laura Anne Howell

Thesis Title: Genetic population structure and breeding parameters of three Pennsylvania State threatened darter species: Etheostoma camurum, E. maculatum and E. tippecanoe

Degree: Master of Science

Date: 20 July 2007

Approved:______Dr. Brady Porter, Advisor Department of Biological Science

Approved:______Dr. Lisa Ludvico, Committee Member Department of Biological Science

Approved:______Dr. Michael Jensen-Seaman, Committee Member Department of Biological Science

Approved:______Dr. Philip Auron, Chairman Department of Biological Science

Approved:______Dr. David Seybert, Dean Bayer School of Natural and Environmental Sciences

iii ABSTRACT

This conservation-oriented study updates distribution records, examines spawning parameters, and analyzes phylogeography for three Pennsylvania state threatened darters with highly disjunct distributions: the bluebreast darter, Etheostoma camurum, the spotted darter, E. maculatum, and the Tippecanoe darter, E. tippecanoe.

Through weekly catch-and-release sampling of newly discovered E. camurum and E. tippecanoe populations in Deer Creek, Harmarville, PA, we identified the peak and duration of the spawning season for these populations. Observations of population peaks indicate seasonal migrations into spawning areas. Spawning terminated for both species when temperatures exceeded 23°C for several days. Turbid conditions may influence spawning site occupation. Both species show strong site fidelity within the spawning riffle irrespective of depth or flow. Genetic analysis using the mtDNA ND2 gene indicates little population structure for all three species across their entire range. Seven new site records within the Allegheny River drainage suggest possible current gene flow through river-corridor migration.

iv EXPANDED ABSTRACT

Little is known about the breeding parameters and population structure of three

Pennsylvania darters, the bluebreast darter, Etheostoma camurum, the spotted darter, E. maculatum, and the Tippecanoe darter, E. tippecanoe. All are Pennsylvania state threatened species, and they are considered threatened or endangered in several other states throughout their range. Although some limited breeding information is available from populations in other states, the timing and duration of spawning has not been documented for Pennsylvania populations of E. camurum and E. tippecanoe. Both species occupy disjunct riffle habitats in the Allegheny River system, with stable populations in French Creek. We have found an additional population for these species about 110 miles downstream in Deer Creek, Harmarville, PA. Through weekly catch- and-release sampling of this population, we have identified the peak breeding times and the duration of the breeding season for the Deer Creek populations of these two species.

Observations of population peaks indicate possible seasonal migrations into spawning areas. Spawning terminated for both species when temperatures exceeded 23°C for several days. Turbid conditions may influence spawning site occupation. Both species show strong site fidelity within the spawning riffle irrespective of depth or flow. Genetic analysis using the mtDNA ND2 gene indicates little population structure for all three species across their entire range. Seven new site records within the Allegheny River drainage suggest possible current gene flow through river-corridor migration and the possibility of the populations spreading from source population(s) in the Allegheny River to sink populations or seasonal breeding habitats in suitable tributaries. Population structure will be useful to conservation efforts by identifying the degree of population

v fragmentation between isolated populations. Breeding times and an understanding of factors that inhibit spawning will be a useful guide for ecologically responsible development of riparian areas, assisting with avoiding disturbances to important spawning areas during the breeding season.

This work is dedicated to my parents Bob and Karen Howell for all their loving support.

vii ACKNOWLEDGMENTS

Many people have made substantial contributions to this work. Beth Dakin and Brady

Porter helped me tremendously both in the field and in the lab with all aspects of this work. Numerous people helped us collect samples and provided me with additional genetic material, including Ted Cavendar, Marc Kibbey, Brant Fisher, and the Duquesne

University Summer General Biology Class of 2006. I received genetic material or tissue samples from Joe Faber, Tammy Mendelson, the North Carolina State Museum of

Natural History, Tom Near, and Jamie Roberts. Rick Spear and Gary Kenderes of the PA

DEP were vital in getting big river samples via benthic trawling. My sampling at Deer

Creek, rain or shine, would not have been possible without Mike Komarnicki. Lisa

Ludvico gave me direction in considering the design and implementation of my statistical methods. Mike Jensen-Seaman also contributed to my thinking. Porter Lab members including Jen Gabel, Caroline Gallagher, Michele Mulkeen, and Shane Ritchea made contributions to my work. Many Duquesne staff members including Dan Bodnar, Pam

Farchak, Dave Haresty, Phil Hoschar, and Judy Quinque provided both administrative and technical support. Thanks to Bob Harper for midnight computer consultation. I would also like to thank the states of Indiana, Kentucky, Tennessee, Virginia and West

Virginia for issuing me collection permits.

FUNDING

This work was funded by Duquesne University Bayer School of Natural and

Environmental Science, the Bayer Fellowship program, and a grant from the

Pennsylvania Department of Conservation and Natural Resources Wild Resource

Conservation Program.

viii TABLE OF CONTENTS

Page ABSTRACT ...... iv ACKNOWLEDGMENTS ...... viii FUNDING ...... viii LIST OF TABLES ...... xi LIST OF FIGURES ...... xii 1. BACKGROUND ...... 1 1.1. Habitat ...... 1 1.2. E. camurum Life History ...... 5 1.3. E. maculatum Life History ...... 6 1.4. E. tippecanoe Life History ...... 7 1.5. Cryptic species ...... 9 1.5.1. E. chlorobranchium Life History ...... 9 1.5.2. E. denoncourti Life History...... 9 1.6. Deer Creek ...... 10 2. SPAWNING PARAMETERS ...... 13 2.1. INTRODUCTION ...... 13 2.2. MATERIALS AND METHODS ...... 15 2.2.1. Field Collections and Observations...... 15 2.2.2. Statistics ...... 17 2.3. RESULTS ...... 24 2.3.1. Spawning Season ...... 24 2.3.2 Turbidity and Spawning Riffle Occupation...... 33 2.3.3 Other factors ...... 54 2.4. DISCUSSION ...... 56 3. PYLOGENETIC POPULATION STRUCTURE ...... 59 3.1. INTRODUCTION ...... 60 3.2. Methods...... 62 3.2.1. Field Collections ...... 62 3.2.2 Genetic Analyses ...... 65 3.3. Results: Phylogenetic AnalysEs Based on ND2 Gene ...... 74 Etheostoma camurum ...... 74 Etheostoma maculatum ...... 75 Etheostoma tippecanoe ...... 75 3.4. DISCUSSION ...... 90 4. CONCLUSION ...... 93 5. FUTURE WORK ...... 94 WORKS CITED ...... 96

ix Appendix A: Laboratory Procedures and Recipes ...... 103 I. Muscle Digestion and DNA Extraction ...... 103 II. Sequencing Protocol ...... 103 III. Recipes ...... 106 Appendix B: ND2 Sequences ...... 107 Appendix C: Code for Baysian Likelihood Trees ...... 163 Appendix D. Observations on Flora at Deer Creek ...... 164 Appendix E. Individuals Sequenced, Sample Locations and Sources ...... 167 Appendix F. New Pa Site records ...... 180 Appendix G. Abbreviations ...... 182

LIST OF TABLES

Table 1. Total Site Populations and Average Female Reproductive Status…. 26 Table 2. Numbers of E. camurum individuals………………………………… 27 Table 3. Numbers of E. tippecanoe individuals……………………………….. 28 Table 4. E. camurum turbidity x rs treatment assignments………………… 36 Table 5. E. camurum male population turbidity x rs treatment assignments 41 Table 6. E. tippecanoe turbidity x rs treatment assignments……………… 47 Table 7. E. tippecanoe male population turbidity x rs treatment assignments 49 Table 8. Oligonucleotide primers……………………….…………………… 72 Table 9. Models selected by MrModelTest 2.2……………………………… 73 Table 10. Individuals with identical genotypes……………………………… 89 Table 11. E. camurum and E. chlorobranchium ND2 alignment…………… 107 Table 12. E. maculatum ND2 alignment……………………………………… 129 Table 13. E. tippecanoe and E. denoncourti ND2 alignment………………… 140 Table 14. E. virgatum ND2 sequence………………………………………….. 162 Table 15. Observations on Flora at Deer Creek, PA……………………… 164 Table 16. E. camurum individuals sequenced………………………………… 167 Table 17. E. chlorobranchium individuals sequenced………………………… 172 Table 18. E. denoncourti individuals sequenced……………………………… 172 Table 19. E. maculatum individuals sequenced………………………………. 173 Table 20. E. tippecanoe individuals sequenced………………………………. 175 Table 21. E. virgatum. ND2 sequence source…………………………………. 179 Table 22. New PA Site Records………………………………………………… 180 Table 23. Abbreviations………………………………………………………… 182

xi LIST OF FIGURES

Figure 1. Distribution of four Nothonotus species……………………………… 11

Figure 2. Males in breeding color………………………………………………… 12

Figure 3. Distribution of E. camurum and E. chlorobranchium………………… 12

Figure 4. Deer Creek, Harmarville, PA site map……………………………….. 20

Figure 5. Gravidity scale…………………………………………………………… 21

Figure 6. Onset Optic StowAway® Temp Logger employment………………… 22

Figure 7. Number of survey dates at various levels of turbidity………………… 23

Figure 8. Number of E. camurum individuals in each reproductive status……... 29

Figure 9. Number of E. tippecanoe individuals in each reproductive status……. 30

Figure 10. Riffle population over time…………………………………………… 31

Figure 11. Correlation between riffle population and female reproductive

status…………………………………………………………………… 32

Figure 12. E. camurum mean total population size……………………………… 37

Figure 13. Numbers of E. camurum females and juveniles at each SL………… 38

Figure 14. Numbers of E. camurum males and juveniles at each SL…………… 39

Figure 15. E. camurum females by size class……………………………………… 40

Figure 16. E. camurum mean total population size with adjusted rs…………… 40

Figure 17. E. camurum mean male population size……………………………… 42

Figure 18. Stream discharge……………………………………………………… 42

Figure 19. E. camurum parameters ……………………………………………… 43

Figure 20. E. camurum capture depth and flow vs. midpoint depth and flow… 44

Figure 21. E. tippecanoe mean total population size……………………………… 48

xii Figure 22. E. tippecanoe mean male population size…………………………… 50

Figure 23. E. tippecanoe parameters……………………………………………… 51

Figure 24. E. tippecanoe capture depth and flow vs. midpoint depth and flow… 52

Figure 25. Numbers of E. tippecanoe males and females at each SL…………… 53

Figure 26. Water temperature at Deer Creek, Harmarville, PA………………... 55

Figure 27. Benthic (Missouri) trawl……………………………………………...... 64

Figure 28. Cartoon of the ND2 gene……………………………………………… 72

Figure 29. Example of an agarose gel……………………………………………... 73

Figure 30. Saturation plots of ND2………………………………………………... 77

Figure 31. E. camurum Neighbor-Joining Tree………………………………….. 78

Figure 32. E. camurum Maximum Parsimony Tree……………………………... 79

Figure 33. E. camurum Bayesian Likelihood Tree……………………………….. 80

Figure 34. E. maculatum Neighbor-Joining Tree………………………………… 81

Figure 35. E. maculatum Maximum Parsimony Tree…………………………… 81

Figure 36. E. maculatum Bayesian Likelihood Tree……………………………… 82

Figure 37. E. tippecanoe and E. denoncourti Neighbor-Joining Tree…………… 83

Figure 38. E. tippecanoe and E. denoncourtiMaximum Parsimony Tree……….. 84

Figure 39. E. tippecanoe and E. denoncourti Bayesian Likelihood Tree…….….. 85

Figure 40. Neighbor-Joining Tree with all three species………………………… 86

Figure 41. Maximum Parsimony Tree with all three species…………………… 87

Figure 42. Bayesian Likelihood Tree with all three species……………………… 88

xiii 1. BACKGROUND

The subgenus Nothonotus, in the genus Etheostoma, family Percidae (Perches) contains several species that are threatened in Pennsylvania: the bluebreast darter,

Etheostoma camurum (Cope 1870), the spotted darter, E. maculatum Kirtland 1841, and the Tippecanoe darter, E. tippecanoe Jordan and Evermann 1880 (PA Code Paragraph

75.2, effective 10 Sept 2005). Some of the largest populations of these fishes in

Pennsylvania are located in the Allegheny River drainage (Cooper 1983). Factors contributing to the low population numbers and threatened status of these species are numerous.

1.1. HABITAT

In their pristine condition, the Allegheny River of western Pennsylvania and its tributaries contained numerous shoals, boulders, snags, sandbars, and riffles (rapids)

(Muller and Tarr 2003). The Allegheny‘s depth could be as little as 30 cm (12 inches)

(US Corps of Engineers, Pittsburgh District 2007), and it supported primarily raft and towboat traffic until the late 1800s (Corddry 1981).

The expansion of commerce and population in the region brought pressure to modify the rivers to improve navigation. Based on an 1875 river survey, William E.

Merrill of the corps of engineers first proposed the development of a slack-water navigation system for the Allegheny and Ohio Rivers (Corddry 1981). This system would be comprised of a series of locks and dams, eliminating riffles and instating pools that would support a deep channel for boat traffic. While some privately constructed dams and channel modifications had been completed prior to state or federal involvement, the first major effort to alter the character of the river began with the Rivers and Harbors Act

1 of 3 March 1879. With this act, the U.S. Congress appropriated funds for the construction of dams and clearing of the Allegheny‘s channel. Two permanent dams and a temporary dam were constructed (Corddry 1981). Lock and dam No.3 was completed in 1893

(Corddry 1981). Also in 1893, the US Corps of Engineers established a permanent office in Pittsburgh with responsibility for maintaining and improving the navigation system

(US Corps of Engineers, Pittsburgh District website 2007). Congress approved the construction of Locks and Dams Nos. 4-8 with the Rivers and Harbors Act of 25 July

1912, and all were operational by 1933 (Corddry 1981). Construction of Lock and Dam

No. 9 was authorized by the Emergency Relief Appropriation Act of 8 April 1935, and it was operational in 1939. Through the removal of obstacles, dredging, and the use of locks and dams, the Allegheny can now support slack-water traffic to a depth of 2.74m (9 feet) for 72 river-miles from Pittsburgh to East Brady Pennsylvania. Currently, the US

Corps of Engineers maintains eight locks and dams; Lock and Dam No. 1 was removed in 1930 (Corddry 1981). While these modifications benefited commerce, they destroyed riffle habitat for many native fishes.

The development of the slack-water navigation was only one of many stresses to native river fish populations. Other encroachments on their habitat and a vast array of pollutants assaulted them. As the burgeoning industry of the region occupied all of the available floodplain areas, companies sought to expand the space available by filling in shallow channels between the shore and nearby islands, or by extending existing floodplains by adding fill to the river (Muller and Tarr 2003). Commercial dredging for gravel and sand continues to the present (Muller 2003).

2 In the 1800s, Pennsylvania‘s rivers and streams became open sewers as communities piped raw sewage into them. By 1900, municipalities supporting over

350,000 people were draining sewage into the Allegheny upstream of Pittsburgh; the water became deadly not only for the aquatic life within the river, but for the downstream human residents as well (Tarr and Yosie 2003). While filtration and treatment of water for human consumption began in 1907, raw sewage dumped into the river was not treated until 1959 (Tarr and Yosie 2003). Sewage overflow into western Pennsylvania‘s rivers continues to be a problem today (Hopey 2001).

Most of western Pennsylvania contains rich deposits of bituminous coal (Marsh and Lewis 1995). As this coal was mined, oxidation of the iron pyrites within the mines led to the formation of highly acidic mine drainage water. This water, either through direct pumping out of the mines or through seepage, began to raise the pH of streams and rivers in the state. T.M. Morris recognized the problem in 1803 (Miller 1995), but little was done. In 1886, in the case of Pennsylvania Coal Company v Sanderson and Wife, the Pennsylvania Supreme Court ruled in favor of the coal industry. The Sandersons had sued the coal company for damages related to pollution of their farm‘s water supply and related crop losses. The case became a powerful precedent in both Pennsylvania and other states (Casner 2003). It freed coal companies from any responsibility for their acid mine drainage. As a result many western Pennsylvania streams became too polluted for communities to use (Casner 2003).

The primacy of the coal industry was challenged in the case of Pennsylvania

Railroad v Sagamore Coal et al. in 1924. Acidic water was damaging the railroad‘s equipment, so the railroad developed a series of 36 independent reservoirs to protect their

3 investment. The Pennsylvania Railroad sold water from the reservoirs to regional water suppliers so that they could ―manufacture a case‖ against contaminators. When local mines began to contaminate the reservoir, the railroad successfully sued on the grounds that the polluted water was a threat to public health (Casner 2003). Further attempts to curtail acid mine drainage include the federal Water Pollution Control Act of 1948

(Casner 2003), the Pennsylvania Clean Stream Act of 1966, and the Federal Water

Pollution Control Act of 1972 and its amendments in 1977(Miller 1995). In spite of efforts to clean up acid mine drainage, about 2,300 miles of Pennsylvania streams remain polluted (Miller 1995). The effects of acid mine drainage on stream flora and fauna have been devastating, with large stretches of rivers and streams turned in to dead zones with water so unpotable that wildlife and livestock will not drink it (Casner 2003).

Industry also led to siltation of the state‘s waterways. Hillsides were denuded of trees to support construction and provide fuel. Additional deforestation was caused by pollution. Cuts in the hillsides to support construction further destabilized embankments

(Muller 2003). Soil from the hillsides, once held in place by vegetation, was carried into the streams and rivers with storm runoff. Turbid conditions created by sediment, industrial wastes, and urban runoff further challenged the survival of fish that once thrived in clean waters.

Some fish-kills have been caused by dramatic catastrophes, such as the 2006

Norfolk Southern Railway train derailment along Portage Run in the Susquehanna River drainage area near the town of Gardeau, Pennsylvania. About 178,000 L (47,000 gallons) of sodium hydroxide from three ruptured tanker cars spilled into the stream (Hopey

2006), killing fish for at least 48 km (30 miles) downstream (Endeavor News 2007).

4 However, most of the contributors to the decline of native fish species are chronic

(Ringquist 1993), such as problems with sewage and acid mine drainage. While water quality has improved dramatically since 1972, sources of water-quality problems remain an issue for recovering aquatic species.

1.2. E. camurum Life History

The bluebreast darter, Etheostoma camurum, was described by Cope (1870) from a specimen found in the headwaters of the Cumberland River, TN (Lee et al. 1980). It can reach 60mm standard length (SL) (nose to posterior structural base of the tail), with rare individuals reaching 80mm SL (Kuehne and Barbour 1983). Males and Females are sexually dimorphic. Breeding males have bright crimson spots, and a deep blue to blue- green breast, while the female coloration is muted with brown spots. They may have eight or nine small, faint dorsal saddles, and nine (8-11) lateral blotches (square-like in juveniles, vertically elongated in females, distinct vertical bands in males). The posterior

2/3 of the body may have as many as 14 horizontal dark stripes, reduced to 9 on the caudal peduncle (Kuehne and Barbour 1983). The second dorsal, caudal and anal fins have a black margin (Stauffer et al.1995). The lateral line may have 47-70 scales

(Kuehne and Barbour 1983).

E. camurum‘s range consists of the Ohio River basin from the upper Allegheny

River, NY, and the Monongahela and Kahnawha Rivers, WV, to the Tennessee and

Cumberland drainages, west to the Vermilion River, IL and the Tippecanoe River, IN

(Zorach 1972, Lee et al. 1980). See Figure 1A.

The bluebreast darter occupies medium to larger streams and rivers, preferring moderately fast riffle habitat with a gravel, rubble and/or boulder substrate with clear

5 water (Kuehne and Barbour 1983, Cooper 1983), where they consume midge larvae, baetid mayflies, blackflies, and caddisflies (Bryant 1979, Metke et al. 1996). They migrate from deeper waters to riffles for mating (Cooper 1983). Trautman (1957) reported that E. camurum might travel many kilometers to spawn. When mating, the female buries herself in sand or gravel, and the male mounts her. They vibrate together, and eggs are deposited in the gravel. The eggs adhere to the gravel (Mount 1959). The darters may choose a hidden location, as under a rock, to deposit the eggs, and the eggs may form clumps in the gravel (Page and Simon 1988). Males may defend small territories (Mount 1959), but no parental care of the eggs has been reported.

1.3. E. maculatum Life History

The spotted darter, E. maculatum, was described by Kirtland (1841) from specimens in the Mahoning River, OH. It has since been extirpated from the type locality

(Trautman 1957, 1981). The last known record of E. maculatum in the Mahoning River system comes from an unverified report made from the Pennsylvania section of the river in 1890 (Mayasich et al. 2004). While its historic range included the Ohio River drainage from French Creek and the Allegheny River in Pennsylvania, to the Wabash drainage in Indiana and Illinois, it has been extirpated from large parts of this range, including the Tippecanoe River in Indiana. In 1997, a new population of E. maculatum was discovered in the East Fork of the White River (Mayasich et al. 2004). See Figure

1B.

E. maculatum can grow to 70mm SL (Kuehne and Barbour 1983). It can be differentiated from other darter species by its sharp snout and rounded caudal fin. Large juveniles and adults have a whitish margin on the second dorsal, caudal and anal fins

6 (Zorach and Raney 1967, Raney and Lachner 1939). The incomplete lateral line usually has between 57-62 scales (Trautman 1981). The species is sexually dimorphic. During the breeding season, males take on bright coloration, a pronounced white line from the head along the dorsal fins to the caudal fin, blue-green cheeks and breast. They sport red spots rimmed with black during all seasons. Females maintain the same appearance year- round. They have numerous dark spots on their dorsal, caudal and anal fins. The spots on their sides are dark, larger and more diffuse that those found on the males (Raney and

Lachner 1939).

E. maculatum is typically found year-round in fast, deep riffles with large bounders or rubble, and gravel (Raney and Lachner 1939, Cooper 1983). They eat insect larvae and water-mites, and conspecific eggs have been found in their digestive tracts

(Raney and Lachner 1939).

When spawning, females will lay a wedge-shaped egg mass, which adheres to the underside of a rock. A male guards the rock-nest. Females may mate several times in a season. Males will guard the nest even when it has been disturbed, or will hover nearby during a disruption allowing scientists to catch nest-guarding males with their hands

(Raney and Lachner 1939). In the Shenango River, at Delaware Grove, Mercer County,

PA, Raney and Lachner (1939) identified the spawning season as running from the last week of May through the last week of June.

1.4. E. tippecanoe Life History

The Tippecanoe darter, E. tippecanoe, was described by Jordan and Evermann

(1880) from a specimen from the Tippecanoe River, IN. It is the smallest of the darters in the subgenus Nothonotus with a maximum published standard length of 35mm

7 (Kuehne and Barbour 1983). During our sampling for this study, we captured a male from the Tippecanoe River that was 39mm SL, but 20-30mm is typical for adults. The species is sexually dimorphic. Males turn a brilliant orange-gold during the mating season, have a deep blue breast, and often have 4-11 dark or blue bars on the sides, which may attach to saddles. The female is generally a mottled olive-brown with a faint golden caste (Zorach 1969, Troutman 1957, Jenkins and Burkhead 1994). The species generally lacks scales from behind the pelvic fin to midway to the anus, and the lateral line is incomplete with 40-56 scales (Stauffer et al. 1995), 13-17 of which are unpored (Zorach

1969).

E tippecanoe occupies the Ohio basin, including the Allegheny drainage, PA, the

Muskingum and Scioto drainages, OH, the Little Kanawha and Elk Rivers, WV, the

Wabash drainage, IN, the middle Licking River, upper Kentucky drainage, and the Upper

Green River, KY and the Cumberland drainage, TN (Lee et al. 1980). See Figure 1C.

It occupies riffles in large streams and rivers with moderate current over a clean sand, gravel, and rubble substrate (Cooper 1983, Kuehne and Barbour 1983). Although no extensive studies of diet have been done, these darters are likely to consume aquatic insects (Cooper 1983).

E. tippecanoe exhibits egg-burying behavior like that of E. camurum, with the female burying herself in the sand or gravel substrate, and the male mounting her

(Warren et al. 1986, Page and Simon 1988). Males will guard territories (Trautman 1981,

Warren et al. 1986).

8 1.5. CRYPTIC SPECIES

Cryptic species are morphologically indistinguishable species, at least to the researchers examining the populations, yet they do not interbreed. Often, the only way to distinguish these species is though obscure or slight physical variations or DNA analysis.

Because of the presences of cryptic species within the Nothonotus subgenus I will be including two additional species in my phylogenetic analysis of E. camurum and E. tippecanoe.

1.5.1. E. chlorobranchium Life History

The greenfin darter was described by Zorach (1972), and the type locality is in the

Cullasaja River in North Carolina. It is endemic to the Blue Ridge streams of the

Tennessee drainage in North Carolina, Tennessee and Virginia (Lee et al. 1980). See

Figure 3. It is the largest of the Nothonotus darters, and individuals as long as 86mm SL have been found (Jenkins and Burkhead 1994). The primary morphological difference between the E. chlorobranchium and E. camurum is in the coloration of the breeding males. E. chlorobranchium has green tint on its fin medians, whereas E. camurum has orange tint. Females are indistinguishable (Zorach 1972). See Figure 2. Although the natural history of this species has received little study, it is thought to be much like E. camurum (Jenkins and Burkhead 1994).

1.5.2. E. denoncourti Life History

The golden darter, E. denoncourti, was described by Stauffer and van Snik (1997) from an individual in Copper Creek, Virginia. It differs from E. tippecanoe in having 1-4 scales on its cheek directly behind the eye, while E. tippecanoe’s cheeks are scaleless.

Males have a light line anterior to the dorsal fin origin, while E. tippecanoe has a light

9 saddle bordered by dark saddles (Zorach 1969, Stauffer and van Snik 1997). In all other respects, it appears indistinguishable from E. tippecanoe. E. denoncourti is found in the

Tennessee River Drainage, including the Duck River, Clinch River and the Sequatchie

River. See Figure 1C.

1.6. DEER CREEK

Deer Creek, where a substantial portion of this work was done, is a tributary of the Allegheny River. Its headwater is located in Middlesex Township, Butler County, PA.

Its watershed includes 51.5 square miles (Gazdik 2007). It enters the Allegheny River at

Harmarville, Harmar Township, Allegheny County, PA. It is included in the Deer Creek

Valley Biodiversity Area, which the Allegheny County Natural Heritage Inventory lists as a High Diversity Area and a Community/Ecosystem Conservation Area. This designation is due in part to areas of high quality wetlands and forest in Deer Creek‘s floodplain (Western Pennsylvania Conservancy 1994).

The proposed development of a commercial area in Harmar Township, Deer

Creek Crossing, may impact Deer Creek and its floodplain near its mouth. After ten years of wrangling, permits have been issued for construction at the site (Bannon 2006).

The final state of the development is still in question. The original developer, Woodmont

Co. of Fort Worth Texas, and another developer, THF Realty of St. Louis, have abandoned development plans (Schooley 2006). Kimco Reality Corporation of New York recently purchased the 101 hectare (250 acre) site and has plans for a 36140 m2 (389000 sq. ft.) commercial development on the site (Schooley 2007).

x x x

Figure 1. Distribution of four Nothonotus species. Black or open dots represent all known museum records. Colored dots indicate locations of samples used in this study. Stars indicate type locality. Red ―X‖ indicates extirpation of a population. A.) E. camurum B.) E. maculatum C.) E. tippecanoe (black dots and red dots) and E.denoncourti (Open dots and green dots). All maps are modified from Lee, et al. 1980. 11

B. Figure 2. A) Bluebreast darter, E. camurum, nuptial male. Copy write: Fishes of Alabama and the Mobile Basin. http://www.outdooralabama.com/ fishing/freshwater/ fish/ other/darters/bluebreast/ B) Greenfin darter, E. chlorobranchium, Nuptial Male. Photograph by Richard T. Bryant and Wayne C. Starnes: http://www.dlia.org/atbi/species/animals/ vertebrates/fish/ Percidae/ E_chlorobranchium.shtml

Figure 3. Distribution of E. camurum and E. chlorobranchium. Solid black dots indicate all known museum records of E. camurum. Open dots represent all known museum records of E. chlorobranchium. Colored dots indicate locations of E.chlorobranchium samples used in this study. Star indicates E. chlorobranchium type locality. Map is modified from Lee, et al. 1980.

12 2. SPAWNING PARAMETERS

In developing conservation plans, information about the season, necessary habitat and water quality conditions for spawning is useful. Little is known about the spawning parameters of the Tippecanoe darter, E. tippecanoe or the bluebreast darter, E. camurum in Pennsylvania. In this section, I address the question of spawning season peak and duration in Deer Creek, Harmar Township, Allegheny Co., PA. I take into account other habitat considerations such as turbidity, temperature, and site preference. I consider the population composition within spawning riffle over the course of the season.

2.1. INTRODUCTION

The spawning season for E. camurum and E. tippecanoe in the Allegheny watershed is not clearly defined in the literature. In Ohio, E. camurum has been found to breed as early as 22 April, with most breeding occurring between 15 May and 10 June

(Mount 1959). In Pennsylvania, ripe E. camurum females have been found on 7 June

(Raney and Lachner 1939), but the breeding season parameters in Pennsylvania have not been identified. Etheostoma tippecanoe has been found to breed in July in Kentucky

(Warren 1986). Little is known about the breeding season of E. tippecanoe in

Pennsylvania. Hubbs (1985) reports that numerous darter species show geographic variation in their spawning season. Additionally, these darters may migrate to the riffle habitat only for spawning, leaving once spawning is complete. This behavior has been noted in other darter species, which migrate to a riffle, spawn, then return to deeper waters (Winn 1958).

Many other factors may influence spawning. Milton Trautman (1957, 1981) states the following regarding E. camurum:

13 Fluctuations in abundance seemed to be correlated with stream flow and turbidity, for the largest populations were present during or following those years when there were neither extended periods of low stream levels nor floods which caused the waters to remain turbid for long periods of time.

Regarding the E. tippecanoe, Trautman (1957, 1981) states:

The males usually deserted their territories whenever storms caused the water to become turbid, and siltation over the sandy gravel was rapid.

No published data prior to our study supported or rejected these claims. Turbidity may inhibit spawning for two reasons. First, Etheostoma darters are brightly colored during the breeding season. Coloration may play a role in mate identification (Stiles 1972, Fisher

1990) or in male-male territorial interactions (Fuller 2003). Turbid conditions will inhibit visual cues used in mating behaviors (Seehausen et al. 1997) . Secondly, siltation can cover fish eggs, causing them to suffocate and die (Birtwell 2000). Sediment may also reduce fertilization success in some fish (Galbraith et al. 2006). Turbidity can be caused naturally through storm runoff, or through man-made activities including construction.

Upstream of the Deer Creek study site located in Allegheny County, Harmar

Township, PA, developers are planning to build a large commercial complex called Deer

Creek Crossing. The development plans may include major disruptions of Deer Creek.

Construction could alter the water quality for an extended time period. Because nest abandonment could have implications for breeding success, determining whether or not they do abandon their spawning areas, and under which conditions, will be important for conservation of the species and for planning upstream construction.

14 Other variables that may impact spawning darter population density are pH and temperature. Temperature has been found to correlate with the reproductive status, as see in the greenthroat darter E. lepidum, although light has not (Hubbs and Strawn 1957).

In this study, I identify the spawning season of E. tippecanoe and E. camurum in

Deer Creek, Allegheny Co., Harmar Township, PA. I address the issue of spawning site occupation and turbidity, and I consider other factors related to spawning for these two species.

2.2. MATERIALS AND METHODS

2.2.1. Field Collections and Observations

For my work on spawning season and spawning riffle occupation, all collections were made at Deer Creek in Harmarville, PA, at a riffle just down stream of the PA

Route 22 bridge between grid coordinates N40°32‘16.0‖ W 79°50‘33.0‖ (upstream boundary) and N40°32‘15.3‖ W 79°50‘31.1‖ (downstream boundary) as recorded from the left descending bank. The riffle was mapped and measured, and landmarks were identified so that each sampling consisted of the same stretch of creek (Figure 4).

Sampling was conducted at least weekly from April through August 2006. Sampling was designed to cover a specific area consistently. Most sampling was done between 09:00 a.m. and 01:00 p.m. Occasionally, few individuals were found within the study area. In order to verify the reproductive status of the population on such days, a riffle located approximately 300m upstream of the study area was surveyed. The alternate site was used twice. Site population data was also collected on six dates between April and

October of 2005.

15 Sampling was done using a 1.8m x1.8m (6‘ x 6‘) kick seine with 3.2mm (1/8‖) mesh. Between 2-4 workers held the brails and/or kicked the substrate. Electrofishing was not used at this site during the 2006 collections to protect breeding darters from the repeated threat of shocking mortality. All E. tippecanoe and E. camurum individuals captured were measured for standard length (SL), sexed, and their reproductive status was evaluated. Water depth and flow at 60% depth was measured at the location of each captured individual. The location of capture for each individual was recorded on a site map of the riffle. Sampling was performed systematically from downstream to upstream, and from creek-left to creek-right.

The reproductive status of males was evaluated by gently squeezing the ventral belly while observing the urogenital opening for the presence or absence of milt. Females were evaluated from 0-4 using the gravidity index as shown in Figure 5. Additionally, a ranking of ―5‖ was indicated if the individual extruded eggs when handled; this designation was not used in any statistical analysis. Following evaluation each individual was released at the capture site. In E. camurum, adults were differentiated from juveniles by color, presence of eggs or milt, the stiffening of the pectoral fins (adults), and size.

Additional parameters were measured at a location 58.2m downstream from the study area on each sampling day. These measurements were made downstream of the site to avoid disturbing the animals. The downstream site was chosen for its uniformity; the streambed had been rechanneled there, and creek width was almost invariable throughout the season. As a result the midpoint was also consistent at this location. Conductivity, pH and temperature were measured using a YSI 556 Multiprobe System. Turbidity was measured using a HACH® 2100P Turbidimeter, which has a measurement range of 0-

16 1000 nephelometric turbidity units (NTU). Depth and flow were measured with a Marsh

McBirney Flow-MateTM Model 2000 portable flowmeter. Flow was measured at 60% depth per the manufacturer‘s instructions using a calibrated wading rod. Creek width was measured using a tape measure. Depth and flow readings were made at 1.5 m intervals from creek-left to creek-right. These measurements were used to calculate total stream discharge. Temperature was measured at 15-minute intervals from a location approximately 96.9m upstream of the upstream boundary of the study area using an Optic

® StowAway Temp Logger and Optic ShuttleTM system (Onset Computer Corporation,

Bourne, MA) . The logger was housed in a steel pipe casing for protection and lashed to a large tree on the bank using a chain (see Figure 6 for casing design and employment).

The system remained at the site from April through late August, and data were downloaded approximately every two weeks. The upstream location was chosen for its inaccessibility and proximity to a large tree root that we were able to use as an anchor.

The temperature data from the logger was analyzed with BoxCar® Pro4 software (Onset).

2.2.2. Statistics

Statistical analysis was performed using Microsoft® Excel 2000 and a Texas

Instruments TI-30X IIS calculator. The spawning season was defined by a period when both gravid females and milt-running males were present in the spawning site. Average adult female reproductive status was calculated based on the 0-4 scale using the formula: ∑gravidity ranking of each adult female =average adult female reproductive status Number of adult females

A Pearson‘s regression was performed using two methods to evaluate whether spawning riffle population correlates with average female reproductive status. In the first regression, a partial correlation was performed by factoring out sampling dates with

17 turbid water conditions. In the second, to control for all environmental factors, a sliding window is used to average the population and reproductive status in a given time period based on three data points: the average of a given sample, the sampling before and the sample after. This normalizes the data for site conditions.

To evaluate the impact of turbidity on spawning site occupation, a 2x3 factorial experimental design was used, with a total of six possible treatment groups. Each of the

20 survey points was assigned to a group according to the average female reproductive status (rs), with rs<2 in one group and rs> 2 in the other, and based on turbidity with 0-10

NTU being ‗low‘, greater than ten through 20 NTU as ‗medium‘, and greater than 20

NTU as ‗high‘. The designation of rs<2 in one group and rs>2 in the other is based on the visibility of eggs in No.2 ranked individuals, and the expectation that if eggs are visible through the skin, the individuals are in spawning condition. The designation of the groups by turbidity is based approximately on the appearance of three categories when turbidity data points are charted in 2 NTU increments as in Figure 7. The mean population size in each group was used to evaluate the impact of turbidity. This design tests the hypothesis that mean population size is a function of female reproductive status and turbidity. On several survey dates, no E. tippecanoe females were found. These survey points were assigned to groups based on an average of the reproductive status of the females on the survey prior to and the survey following the point in question.

Significance of the difference between groups was tested using the Kruskal-Wallis One

Way ANOVA method, with rankings assigned to each replicate based on population size.

18 The formula used to calculate the Kruskal-Wallis H-value was:

k 2 H=(12/(N(N+1)))(Σ Ri /ni))-(3(N+1)) i=1

3 3 Corrected H= H/(1-(Σs (ts -ts)/(N -N))

Where: k=the total number of treatments N=the total number of sample dates Ri=sum of the Ranks of the ith group ni = the number of sample dates in a treatment t= the total number of tied scores s= a set of tied scores.

(Modified from Meyers and Grossen 1978)

Sample End Point

Bank Bank

Flow

Sample Start Point

Figure 4. Deer Creek, Harmarville, PA site map. Map is to scale with one grid equal to one foot. It represents the riffle downstream of the PA Rt. 28 Bridge where spawning parameter data collection on spawning status was conducted. Only the location of seining is shown. Addition data were collected downstream of this location (pH, turbidity, and discharge measures) and upstream (temperature logging).

Figure 5. Gravidity Scale for assessment of Female Reproductive Status in darters.

B .

Figure 6. Onset Optic StowAway® Temp Logger employment. A) Logger housing design. B) In-stream placement of the logger and its housing. The logger recorded temperature at 15 minute intervals. It was located approximately 96.9m upstream of the population sampling site.

2 Numbersurveyof dates

0 0- >2.0- >4.0- >6.0- >8.0- >10.0- >12.0- >14.0- >16.0- >18.0- >20.0- >22.0- >24.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 18.0 20.0 22.0 24.0 NTU

Figure 7. Number of survey dates at various levels of turbidity. Turbidity is measured in nephelometirc turbidity units (NTU).

2.3. RESULTS

2.3.1. Spawning Season

The study site at Deer Creek in Harmarville, Allegheny County, PA was surveyed on 20 dates between April and August 2006. The abundance of each study species on each date is recorded in Table 1. For E. camurum, both juveniles and adults are tallied.

For E. tippecanoe I only consider the total captured population. The low capture rate in E. tippecanoe juveniles is likely due to their small size; only adults are large enough to remain in the seine. The numbers of adults in each stage of reproductive condition on each survey date is shown on Table 2 and Figure 8 for E. camurum and Table 3 and

Figure 9 for E. tippecanoe. In Figures 8 and 9, individuals in non-breeding condition

(males not running milt and females ranked ―0‖ on the gravidity index) are shown on the negative y-axis as they do not contribute to the breeding population on a given date.

There is a positive correlation between site abundance and average adult female reproductive status (rs). When calculated with high turbidity days partialed out, the r2=

0.5611 (p=0.0013) for E camurum and r2= 0.5657 (p=0.0121) for E. tippecanoe. When all survey dates are used, r2= 0.3316 (p=0.0079) for E. camurum and r2= .2353 (p=0.0930) for E. tippecanoe. The difference between the regression including all data points and the regression with high turbidity data points partialed out is 0.2295 for E. camurum and

0.3301 for E. tippecanoe. This indicates that environmental factors are significant in spawning riffle population size fluctuations. When a sliding window of three surveys is used to normalize for conditions across sampling dates, r2= 0.531 (p=0.0004) for E. camurum and r2=0.6347 (p=0.0000) for E. tippecanoe. See Figure 11 .

24 For E. camurum, spawning-condition individuals of both sexes were first present in the riffle on 17 May, and they were last simultaneously found on 25 July, although males continued to run milt for several more weeks. The peak spawning season was identified by considering the female reproductive condition of the population, and it fell between 31 May and 30 June, when both the spawning condition of females and the population within the riffle was high (Figure 8 and 10).

For E. tippecanoe, spawning-condition individuals of both sexes were present on

14 June, and they were last observed on 25 July, with a peak between 14 June and 17 July

(Figure 9 and 10). We verified the completion of the E. tippecanoe season by sampling an additional site about 300 meters upstream of the study site on 16 August. On that date all females captured (n=7) were ranked zero ‗0‘ on the gravidity index, confirming that they were no longer breeding. Only one male out of eight captured extruded milt.

25 Table 1: Total Site Population and Average Adult Female Reproductive Status by date for E. camurum and E. tippecanoe . Etheostoma camurum Etheostoma tippecanoe Date Total Adult Average Female Total Average Female Population Population Reproductive Populatio Reproductive Status n Status 10-Apr-05 0 - - 0 - 10-May-05 5 - - 0 - 2-Jun-05 19 - - 9 - 6-Jun-05 6 - - 9 - 8-Jun-05 25 - - 20 - 30-Oct-05 3 - - 1 -

26-Apr-06 3 1 0.0 0 * 8-May-06 15 8 1.8 0 * 17-May-06 9 4 2.0 0 * 24-May-06 18 11 1.4 3 0.0 31-May-06 23 11 2.3 1 * 1-Jun-06 47 17 1.8 8 0.6 7-Jun-06 34 17 2.6 7 0.7 14-Jun-06 50 24 2.2 8 2.6 21-Jun-06 49 28 2.8 13 2.6 28-Jun-06 9 7 2.8 3 3.0 30-Jun-06 25 14 2.4 7 2.0 5-Jul-06 3 2 1.5 5 2.0 7-Jul-06 13 8 2.4 1 * 12-Jul-06 3 1 1.0 5 0.3 17-Jul-06 11 9 1.0 8 1.2 18-Jul-06*** 8 8 0.3 2 0.0 25-Jul-06 18 17 0.7 5 1.7 4-Aug-06 5 4 1.0 2 * 9-Aug-06 11 11 0.0 2 * 15-Aug-06 1 1 0.0 1 0** Notes: *No females were captured during this collection; female reproductive status could not be evaluated. **No females were captured at the study site, but reporductive status was evaluated based on females captured ~300m upstream (n=7).***Collection from ~300m upstream of study area to confirm rs.

Table 2: Numbers of E. camurum individuals in each reproductive status category by date. Males were evaluated on milt production. Females were evaluated by gravidity index. Status Male Female Date Milt No Milt 0 1 2 3 4 26-Apr-06 - - 1 - - - - 8-May-06 - 4 - 1 3 - - 17-May-06 1 - - - 3 - - 24-May-06 2 4 2 - 2 1 - 31-May-06 - - 1 1 4 4 1 1-Jun-06 4 1 - 7 2 2 1 7-Jun-06 7 - - 1 5 1 3 14-Jun-06 11 - - 1 9 3 - 21-Jun-06* 12 - - 1 5 5 4 28-Jun-06 3 - - 1 1 - 2 30-Jun-06 5 2 - 1 2 4 - 5-Jul-06 - - - 1 1 - - 7-Jul-06 3 - 1 - 1 2 1 12-Jul-06 - - - 1 - - - 17-Jul-06 5 - 2 - 2 - - 18-Jul-06** 4 - 3 1 - - - 25-Jul-06 9 2 4 1 - 1 - 4-Aug-06 3 - - 1 - - - 9-Aug-06 6 1 4 - - - - 15-Aug-06 - - 1 - - - - *One female not evaluated for reproductive status.**Individuals captured 300m upstream; included in evaluation of reproductive status, but not site population

Table 3: Numbers of E. tippecanoe individuals in each reproductive status category by date. Males were evaluated on milt production. Females were evaluated by gravidity index. Status Male Female Date Milt No Milt 0 1 2 3 4 26-Apr-06 ------8-May-06 ------17-May-06 ------24-May-06 - - 3 - - - - 31-May-06* ------1-Jun-06 - - 3 5 - - - 07-Jun-06** - - 4 1 - 1 - 14-Jun-06 2 1 - 1 1 2 1 21-Jun-06 6 - - - 4 2 1 28-Jun-06 2 - - - - 1 - 30-Jun-06 - - 1 1 2 3 - 5-Jul-06 2 1 - - 2 - - 7-Jul-06 - 1 - - - - - 12-Jul-06 2 - 2 1 - - - 17-Jul-06 3 - 2 - 3 - - 18-Jul-06 1 - 1 - - - - 25-Jul-06 2 - - 1 2 - - 4-Aug-06 2 ------9-Aug-06 2 ------15-Aug-06*** (1) 1(7) 0(7) - - - - Notes: *One male collected but escaped; no reproductive status could be determined. **One juvenile capture; included in total population but not included in reproductive status evaluation. ***Individuals captured 300m upstream indicated in parentheses; included in evaluation of reproductive status, but not site population.

Female 4 20 Nfemale=113 Female 3 15 Female 2 Female 1 10 Female 0 5

Number of Females 0

-5

5/8/2006 6/1/2006 6/7/2006 7/5/2006 7/7/2006 8/4/2006 8/9/2006 Time 4/26/2006 5/17/20065/24/20065/31/2006 6/14/20066/21/20066/28/20066/30/2006 7/12/20067/17/20067/18/20067/25/2006 8/15/2006 15 Male No Milt Nmale=89 Male Milt 10

Number of Males 0

-5

Figure 8. Number of E. camurum individuals in each reproductive status category on each survey date. Individuals in non-breeding condition are shown on the negative y- axis.

Female 4 Female 3 8 Female 2 Female 1 6 Nfemale=58 4 Female 0 2 0 -2 -4 -6Females of Number -8

5/8/2006 6/1/20066/7/2006 7/5/20067/7/2006 8/4/20068/9/2006 Time 4/26/2006 5/17/20065/24/20065/31/2006 6/14/20066/21/20066/28/20066/30/2006 7/12/20067/17/20067/18/20067/25/2006 8/15/2006*

8 Male No Milt N =36 6 male Male Milt 4

2 0

-2

-4 Number of Males of Number -6 -8

-10 Figure 9. Number of E. tippecanoe individuals in each reproductive status category on each survey date. Individuals in non-breeding condition are shown on the negative y-axis. *15 Aug reproductive status includes individuals from a second site ~300m upstream of the study site.

30 E. camurum E.tippecanoe

60 #Overall 14 Adults 12 50 10 40 8 30 6

Individuals. 20 Individuals. 4 10 2

0 0

5/3/06 6/7/06 7/5/06 8/2/06 8/9/06

4/26/06 5/10/06 5/17/06 5/24/06 5/31/06 6/14/06 6/21/06 6/28/06 7/12/06 7/19/06 7/26/06 8/16/06

4/26/06 5/10/06 5/17/06 5/24/06 5/31/06 6/14/06 6/21/06 6/28/06 7/12/06 7/19/06 7/26/06 8/16/06 A. Time D. Time

60 14

50 12 10 40 8 30 6 20

4 Average Population Average Population 10 2 0 0

5/3/06 6/7/06 7/5/06 8/2/06 8/9/06 5/3/06 6/7/06 7/5/06 8/2/06 8/9/06

5/10/06 5/17/06 5/24/06 5/31/06 6/14/06 6/21/06 6/28/06 7/12/06 7/19/06 7/26/06 8/16/06 4/26/06 5/10/06 5/17/06 5/24/06 5/31/06 6/14/06 6/21/06 6/28/06 7/12/06 7/19/06 7/26/06 8/16/06 B. 4/26/06 E. Time Time

3 3.5 3 2.5 2.5 2 2 1.5

1.5 Average rs Average rs 1 1 0.5 0.5 0 0

5/3/06 6/7/06 7/5/06 8/2/06 8/9/06 5/3/06 6/7/06 7/5/06 8/2/06 8/9/06

Figure 10. Riffle population over time. A) E.camurum total population and adult population over time. B) E. camurum total population averaged over three sample dates. C) E. camurum female reproductive status averaged over three sample dates. D) E. tippecanoe total population over time. E) E. tippecanoe total population averaged over three sample dates. F) E. tippecanoe female reproductive status averaged over three sample dates.

E. camurum E.tippecanoe 10 50 r2 = 0.6678, p=0.0000 r2 = 0.531, p=0.0004 9 45 8 40

35 7 opulation

30 P 6

25 5 otal

20 T 4 15 3

10 2

Averaged Averaged Total Population 5 1 0 0 A.0.0 1.0 2.0 3.0 D. 0.0 1.0 2.0 3.0 Averaged rs Averaged rs

14 60 2 r2 = 0.3316, p=0.0079 r = 0.2353, p=0.0930 12 50 10 40 8 30 6 20 4

Total Population Total Population 10 2

0 0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 B. rs E. rs

60 r2 = 0.5611, p=0.0013 14 r2 = 0.5657, p=0.0121 50 12 40 10 8 30 6 20 4 10 2 0

Total Population on Non-turbid Days 0

Total Population on Non-turbid Days 0.0 0.5 1.0 1.5 2.0 2.5 3.0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 C. F. rs rs

Figure 11. Correlation between riffle population and average female reproductive status (rs). A) E.camurum based on a 3-sample sliding window average of population and rs. B) E. caumurum without a sliding window including all surveys. C) E. camurum when surveys with only low to moderate levels of turbidity are considered. D) E.tippecanoe based on a 3-sample sliding window average of population and rs. E) E. tippecanoe with without a sliding window and including all surveys. F) E. tippecanoe when surveys with only low to moderate levels of turbidity are considered.

2.3.2 Turbidity and Spawning Riffle Occupation

E. camurum

Survey dates were assigned to a treatment by average adult female reproductive status (rs) and turbidity as shown in Table 4. Each collection date was given a rank using the Kruskal-Wallis test method according to the total population, which is also shown in

Table 4. The treatment with an rs greater than 2 (females in peak reproductive condition) and low turbidity differed from the other treatments (Kruskal-Wallis H=8.32, corrected

H=8.37, p=0.0532, Figure 12). The low reproductive status (rs<2), medium turbidity treatment has a large deviation. This deviation is due to one sampling point, June 1, with an rs value of 1.8. The female population on this date consisted of five females with gravidity between 2-4, and larger number (7) of very small females ranked 1 on the gravidity scale. This ratio of females reduced the rs, artificially putting a peak reproductive sampling day into a low reproductive category. To verify this assessment, I evaluated all the E. camurum individuals by gender and size (Figure 13 and 14). Most of the gravid scale No. 1 females from the 1 June sample are about 30mm standard length, which is at the size boundary between juveniles and adults. I then assessed gravidity of all females by size class. I divided them into four size classes: 30-34mm, 35-39mm, 40-

44mm and 45-49mm SL. The smallest class, 30-34mm, is based on its overlap with juvenile sizes. The other classes are based on the slight appearance of peaks in the size ranges in figures 13 and 14. While otoliths (Mosher and Eckles 1954) or scale annuli

(Walford and Mosher 1943) could be used to determine the age of the fish, that was

33 beyond the scope of this study and might have required sacrificing state threatened fish.

The life expectancy for E. camurum is unknown.

I then considered the number of individuals of each gravidity rank in each size class (Figure 15). The smallest size class, 30-34mm, contained no individuals ranked higher than 2. Based on this, I recalculated rs without the small size-class females, yielding an rs of 2.5 for June 1. The rs for all other survey dates remained the same after recalculation. When the data are reevaluated based on this, the results are significant: population was high only when turbidity was low to moderate during the spawning season (Kruskal-Wallis H=14.25, corrected H=14.35, p=0.0085, Figure 16). When only male population is considered, the result is not significant (Kruskal-Wallis H=6.58, corrected H=6.62, p=0.7581) . See Table 5 for the Kruskal-Wallis ranking, and Figure 17.

I also considered a correlation between turbidity and population during the one month peak spawning period as a Pearson‘s regression (r2=0.4835, p=0.0828, Figure

19A).

With rain-generated turbidity, an additional concern is that stream discharge may be impacting darter population. With rain, discharge would be expected to increase through both greater flow and greater depth. Because discharge is the product of both depth and flow, a similar volume of discharge can be achieved by either having deep, slow moving water or shallow, fast-moving water (Figure 18). When a regression is done of peak- spawning population and discharge, there is no correlation, r2=0.1061 (p=0.4760, Figure

19B). Discharge, therefore, will not be useful in considering confounding factors related to turbidity. When flow is considered, it is also insignificant (r2=0.1578, p=0.3776,

Figure 19C). Depth, however, is at least as important as turbidity (r2=0.5993, p=0.0410,

34 Figure 19D). When I considered whether depth and turbidity were independent variables,

I found that they were. When all samples were considered, turbid conditions existed even on relatively shallow days and there was no correlation between depth and turbidity

(r2=0.0349, p=0.4440, Figure 19E) .

To consider what depth and flow conditions are optimal, using the data collected at each capture site, I plotted capture depth against capture flow. This method may underestimate optimal flow due to refuges or eddies behind boulders. It indicates that the preferred depth may be around the median of 24cm (SE+ 0.7cm), and the flow median of

62.2cm/sec (SE+1.9cm/sec). This is based on observations of 291 individuals (Figure

19F).

To test whether E. camurum has greater loyalty to depth or location, I plotted mean capture depth verses depth at the creek‘s midpoint. The expectation is that if depth is more important than location, the darters will move to maintain a constant depth regardless of depth at the midpoint. If they are loyal to a location, the capture depth will increase with midpoint depth. There was a strong correlation between capture depth and midpoint depth both when all survey dates were considered (r2=0.5956, p=0.0008, Figure

20A), and when only peak spawning survey dates were considered (r2=0.9447, p=0.0002

Figure 20B). When I tested site loyalty based on flow, I found similar results when all survey dates were tested (r2=0.6744, p=0.0002) and when peak spawning dates were tested (r2=0.5718, p=0.0492). Site loyalty is further supported when the survey maps indicating the capture locations of all individuals are compared. We consistently captured

E. camurum at specific locations within the stream, regardless of conditions. They did not move to other locations as depth and flow conditions changed.

Table 4: E.camurum turbidity x rs treatment assignments with Kruskal-Wallis rank (R) sorted by treatment.

Total Rank Date Treatment rs Turbidity Population (R) 5-Jul-06 rs<2/High 1.5 76.30 3 3 12-Jul-06 rs<2/High 1.0 51.30 3 3 25-Jul-06 rs<2/High 0.7 21.10 18 12.5 26-Apr-06 rs<2/Low 0.0 7.63 3 3 8-May-06 rs<2/Low 1.8 4.39 15 11 24-May-06 rs<2/Low 1.4 4.34 18 12.5 17-Jul-06 rs<2/Low 1.0 6.65 11 8.5 4-Aug-06 rs<2/Med 1.0 15.40 5 5 9-Aug-06 rs<2/Med 0.0 11.90 11 8.5 15-Aug-06 rs<2/Med 0.0 16.90 1 1 *1-Jun-06 rs<2/Med 1.8 10.90 47 17 17-May-06 rs>2/High 2.0 23.80 9 6.5 28-Jun-06 rs>2/High 2.8 37.10 9 6.5 31-May-06 rs>2/Low 2.3 5.82 23 14 7-Jun-06 rs>2/Low 2.6 5.65 34 16 14-Jun-06 rs>2/Low 2.2 3.89 50 19 21-Jun-06 rs>2/Low 2.8 4.31 49 18 30-Jun-06 rs>2/Low 2.4 7.21 25 15 7-Jul-06 rs>2/Low 2.4 5.36 13 10 *Rs=2.5 when smallest female size class (30-34mm) is excluded. All other rs calculations remain the same when the smallest female size class is excluded.

36 45

40 *

20 15

Mean population size . population size Mean 10

_ _ rs<2/High rs<2/Med rs<2/Low rs>2/High rs>2/Low Treatment

Figure 12. E. camurum mean total population size when females are not very gravid (rs<2) or gravid (rs> 2) and turbidity is low(NTU <10), medium(1020). (*Kruskal-Wallis H=8.32, corrected H=8.37, p=0.0532)

35 Juvenile 30 Female

Number of individuals of Number 10

0 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Standard lenght (mm)

Figure 13. Numbers of E. camurum females and juveniles (both genders) at each standard length (mm).

35 Juvenile 30 Male

Number of individuals of Number 10

0 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 Standard length(mm)

Figure 14. Numbers of E. camurum males and juveniles (both genders) at each standard length (mm).

43+ Gravidity Scale Ranking 4 39-42 3 2 1 35-38 (mm) class Size 0

30-34

0 5 10 15 Number of females

Figure 15. E. camurum females by size class as defined by standard length in mm, and gravidity scale ranking. Numbers of females in each gravidity rank and size class are shown.

50 * 45 40 35 30 25 20 15

Mean population size . . size population Mean 10 5 0 rs<2/High rs<2/Med rs<2/Low rs>2/High_ rs>2/Med _ rs>2/Low _ Treatment

Figure 16. E. camurum mean total population size with adjusted rs when females are not very gravid (rs<2) or gravid (rs> 2) and turbidity is low(NTU <10), medium(1020). (*Kruskal-Wallis H=14.25, corrected H=14.35, p=0.0085, significant)

Table 5 E.camurum male population turbidity x rs treatment assignments with Kruskal Wallis Rank (R) sorted by treatment.

Male Rank Date Treatment rs* Turbidity Population (R) 5-Jul-06 rs<2/High 1.5 76.30 0 3

12-Jul-06 rs<2/High 1.0 51.30 0 3

25-Jul-06 rs<2/High 0.7 21.10 11 17.5 26-Apr-06 rs<2/Low 0.0 7.63 0 3 8-May-06 rs<2/Low 1.8 4.39 4 10 24-May-06 rs<2/Low 1.4 4.34 6 13 17-Jul-06 rs<2/Low 1.0 6.65 5 11.5 4-Aug-06 rs<2/Med 1.0 15.40 3 8

9-Aug-06 rs<2/Med 0.0 11.90 7 15

15-Aug-06 rs<2/Med 0.0 16.90 0 3 17-May-06 rs>2/High 2.0 23.80 1 6 28-Jun-06 rs>2/High 2.8 37.10 3 8 31-May-06 rs>2/Low 2.3 5.82 0 3 7-Jun-06 rs>2/Low 2.6 5.65 7 15 14-Jun-06 rs>2/Low 2.2 3.89 11 17.5

21-Jun-06 rs>2/Low 2.8 4.31 12 19

30-Jun-06 rs>2/Low 2.4 7.21 7 15 7-Jul-06 rs>2/Low 2.4 5.36 3 8 1-Jun-06 rs>2/Med 2.5 10.90 5 11.5 *Smallest female size class (30-34mm) not included in calculation.

41 _ _ _

9 8

7 6

4 3

Population Male Mean 2 1

rs<2/High rs<2/Med rs<2/Low rs>2/High_ rs>2/Med _ rs>2/Low _

Treatment

Figure 17. E. camurum mean male population size when females are not very gravid (rs<2) or gravid (rs> 2) and turbidity is low(NTU <10), medium(1020). (*Kruskal-Wallis H=6.58, corrected H=6.62, p=0.7581, not significant).

A. B.

Figure 18. Stream Discharge. In A) the stream is deep, but the flow is modest. In B) the stream is shallow, but the flow is fast. Both achieve the same level of discharge.

42 r2 = 0.4835, p=0.0828 2 40.0 80.0 r = 0.1061, p=0.4760 35.0 70.0

30.0 60.0 /s)

3 25.0 50.0 20.0 40.0 15.0 30.0

10.0 Discharge(ft Turbidity (NTU) 20.0 5.0 10.0 A. 0.0 B. 0.0 0 20 40 60 0 20 40 60

Population Population

2 1.6 r = 0.1578, p=0.3776 r2 = 0.5993, p=0.0410 2.50 1.4

1.2 2.00 1.0 1.50 0.8 0.6 1.00

0.4 0.50 0.2

Deptat midpoint . (ft.) atFlow Midpoint (ft/s) 0.0 0.00 C. 0 20 40 60 D. 0 20 40 60 Population Population

r2 = 0.0349, p=0.4440 6.0 100.0 5.0 80.0 4.0 60.0 3.0 40.0 2.0 Turbidity(NTU) 20.0 1.0 0.0 0.0 atFlow 60% Depth (Ft/Sec) 0.0 0.5 1.0 1.5 2.0 2.5 E. 0.0 0.5 1.0 1.5 2.0 2.5 F. -1.0 Depth at Midpoint (Ft) Depth (ft)

Figure 19. E. camurum parameters A) Turbidity plotted against population during peak spawning. B) Discharge plotted against population during peak spawning. C) Flow at the midpoint downstream of the riffle plotted against population during peak spawning. D) Depth at the midpoint downstream of the riffle plotted against population during peak spawning. E) Turbidity plotted against depth at midpoint over the entire sampling period. F) Capture location depth and capture location flow for 291 individuals.

2 2 2.5 r = 0.5956, p=0.0008 2.0 r = 0.6744, p=0.0002

2.0 1.5 1.5 1.0 1.0 0.5

0.5

Depthat midpoint (ft) Flow atFlow midpoint (ft/s)

0.0 0.0 0.0 0.5 1.0 1.5 2.0 0.0 1.0 2.0 3.0 4.0 5.0 A.A. Meam capture depth (ft) C. C. Mean flow at capture site (ft/s)

r2 = 0.9447, p=0.0002 2 2.5 1.6 r = 0.5718, p=0.0492 1.4 2.0 1.2 1.5 1.0 0.8 1.0 0.6 0.4

0.5

Depthatmidpoint (ft) Flow atFlowmidpoint (ft/s) 0.2 0.0 0.0 0.0 0.5 1.0 1.5 2.0 0.0 1.0 2.0 3.0 B.B. Mean capture depth (ft) D. D. Mean flow at capture site (ft/s)

Figure 20. E. camurum capture depth and flow vs. midpoint depth and flow. A) Depth at the creek midpoint vs. mean capture depth in the spawning riffle including all survey dates. B) Depth at the creek midpoint vs. mean capture depth in the spawning riffle for peak spawning survey dates. C) Flow at the creek midpoint vs. mean capture depth in the spawning riffle including all survey dates. D) Flow at the creek midpoint vs. mean capture depth in the spawning riffle for peak spawning survey dates.

44 E. tippecanoe

Sampling days were assigned to a treatment by average adult female reproductive status (rs) and turbidity and given a Kruskal-Wallis rank as shown in Table 6. Treatments were not significantly different (Kruskal-Wallis H=5.25, corrected H=5.36, p=0.2129,

Figure 21). When only males are considered, the results are less significant. (Kruskal-

Wallis H=1.73, corrected H=1.88, p=0.3657; see Table 7 for the Kruskal-Wallis ranking, and Figure 22).

Considering turbidity during the one month peak spawning period, I calculated a

Pearson‘s regression (r2=0.1297, p=0.3809, Figure 23A.) which did not indicate a correlation. Regressions of discharge and population (r2=0.1538, p=0.3366, Figure 23B), flow and population ((r2=0.0015, p=0.9276, Figure 23C), and depth and population

(r2=0.1865, p=0.1563 Figure 23D), are all not significant. The lack of significance of any of the factors is most likely due to the very low capture rates of E. tippecanoe regardless of conditions.

To consider what depth and flow conditions are optimal, using the data collected at each capture site, I plotted depth against flow (Figure 23E). This method may underestimate optimal flow due to refuges or eddies behind boulders. The median depth was 24.2cm (SE + 1.53cm), and the median riffle flow at capture locations was 61.9 cm/s (SE + 3.8 cm/s). This is based on observations of 78 individuals.

When site loyalty verses depth or flow preference is tested for E. tippecanoe, I found a correlation between mean capture depth and depth at the creeks midpoint, both with all survey points used (r2=0.5265, p=0.0039, Figure 24A), and when only peak spawning survey dates were used, (r2=0.5976, p=0.0415, Figure 24B). There was a strong

45 correlation between mean flow at the capture site and flow at the midpoint, both for all survey dates (r2=0.6711, p=0.0003, Figure 24C) and for peak spawning dates (r2=0.8494, p=0.0032, Figure 24D). These results indicate that E. tippecanoe utilize the same locations in the riffle, regardless of conditions. They do not relocate within the riffle when depth and flow conditions change. This finding is supported by our riffle site maps, which indicate that we consistently captured E. tippecanoe at specific locations in the riffle.

Generally, only E. tippecanoe adults were captured, with one individual being classified as a juvenile. The smallest adult male, at 22mm standard length (SL), was running milt. The largest male captured at Deer Creek was 37mm SL. The smallest female captured was 20mm SL, and a female of 21mm was ranked a No. 3 on the gravidity scale. The largest female from Deer Creek was 30mm SL. A comparison of the number of individuals at each standard length was inconclusive regarding the number of age classes for this species (Figure 25).

Table 6. E. tippecanoe turbidity x rs treatment assignments with Kruskal- Wallis Rank (R) sorted by treatment. Total Rank Date Treatment rs Turbidity population (R) 17-May-06 rs<2/High * 23.80 0 2 12-Jul-06 rs<2/High 0.3 51.30 5 12 25-Jul-06 rs<2/High 1.7 21.10 5 12 26-Apr-06 rs<2/Low * 7.63 0 2 8-May-06 rs<2/Low * 4.39 0 2 24-May-06 rs<2/Low 0.0 4.34 3 9.5 31-May-06 rs<2/Low * 5.82 1 5 7-Jun-06 rs<2/Low 0.7 5.65 7 14.5 7-Jul-06 rs<2/Low * 5.36 1 5 17-Jul-06 rs<2/Low 1.2 6.65 8 17 1-Jun-06 rs<2/Med 0.6 10.90 8 17 4-Aug-06 rs<2/Med * 15.40 2 7.5 9-Aug-06 rs<2/Med * 11.90 2 7.5 15-Aug-06 rs<2/Med * 16.90 1 5 28-Jun-06 rs>2/High 3.0 37.10 3 9.5 5-Jul-06 rs>2/High 2.0 76.30 5 12 14-Jun-06 rs>2/Low 2.6 3.89 8 17 21-Jun-06 rs>2/Low 2.6 4.31 13 19 30-Jun-06 rs>2/Low 2.0 7.21 7 14.5 *No females captured. Rs assesment for treatment assignment is based on the closed collection points in which females were assessed.

47 12

. 10

Mean population size size population Mean 2

0 rs<2/High rs<2/Med rs<2/Low rs>2/High rs>2/Low Treatment _ _

Figure 21. E. tippecanoe mean total population size when females are not very gravid (rs<2) or gravid (rs> 2) and turbidity is low(NTU <10), medium(1020) (Kruskal-Wallis H=5.25, corrected H=5.36, p=0.2129, not significant).

Table 7. E. tippecanoe male population turbidity x rs treatment assignments with Kruskal-Wallis rank, sorted by treatment. Male Rank Date Treatment rs Turbidity Population (R) 17-May-06 rs<2/High * 23.80 0 3.5 12-Jul-06 rs<2/High 0.3 51.30 2 13 25-Jul-06 rs<2/High 1.7 21.10 2 13 26-Apr-06 rs<2/Low * 7.63 0 3.5 8-May-06 rs<2/Low * 4.39 0 3.5 24-May-06 rs<2/Low 0.0 4.34 0 3.5 7-Jun-06 rs<2/Low 0.7 5.65 0 3.5 31-May-06 rs<2/Low * 5.82 1 9 7-Jul-06 rs<2/Low * 5.36 1 9 17-Jul-06 rs<2/Low 1.2 6.65 3 17 1-Jun-06 rs<2/Med 0.6 10.90 0 3.5 15-Aug-06 rs<2/Med * 16.90 1 9 4-Aug-06 rs<2/Med * 15.40 2 13 9-Aug-06 rs<2/Med * 11.90 2 13 28-Jun-06 rs>2/High 3.0 37.10 2 13 5-Jul-06 rs>2/High 2.0 76.30 3 17 30-Jun-06 rs>2/Low 2.0 7.21 0 3.5 14-Jun-06 rs>2/Low 2.6 3.89 3 17 21-Jun-06 rs>2/Low 2.6 4.31 6 19

49 5

Meanpopulation size 1

0 _ _ rs<2/High rs<2/Med rs<2/Low rs>2/High_ rs>2/Low _ Treatment

Figure 22. E. tippecanoe mean male population size when females are not gravid (rs<2) or gravid (rs> 2) and turbidity is low(NTU <10), medium(1020). (Kruskal-Wallis H=1.73, corrected H=1.88, p=0.3657, not significant).

50 A. B.

C. D.

E. F.

2 2 100.0 r = 0.1297, p=0.3809 100.0 r = 0.1538, p=0.3366

80.0 80.0

60.0 60.0 Upper 95.0%

40.0 40.0 Discharge(ft3/s) Turbidity(NTU) 20.0 20.0

0.0 0.0 0 5 10 15 0 5 10 15 A. B. A. Population B. Population

A. B. 2 2 2.0 r = 0.0015p=0.9276 5.0 r = 0.1865, 0.1563

4.0 1.5

3.0 1.0 2.0

0.5

1.0

Depthmidpoint at (ft) Flowmidpoint at (ft/s) 0.0 0.0 0 5 10 15 0.0 0.5 1.0 1.5 2.0 2.5

Lower 95.0% C. UpperPopulation 95.0% D. Population C. 1.616001765 D. 1.274573779

C. 6.0 D.

5.0

4.0

3.0

(Ft/sec) 2.0

Flow60% at depth 1.0 0.0 0.00 0.50 1.00 1.50 2.00 2.50 E. F. E. Depth (Ft)

Figure 23. E. tippecanoe parameters A) Turbidity plotted against population during peak spawning. B) Discharge plotted against population during peak spawning. C) Flow at the E. midpoint downs tream of the riffle plotted against population during peak spawning. D) Dept at the midpoint downstream of the riffle plotted against population during peak spawning. E) Capture location depth and capture location flow for 78 individuals.

51 2 r = 0.5265, p=0.0039 r2 = 0.6711, p=0.0003 2.5 2.0 2.0 1.5 1.5 1.0 1.0

0.5 0.5

Flow at midpoint at Flow Depthmidpoint at (ft) 0.0 0.0 0.0 0.5 1.0 1.5 2.0 0.0 1.0 2.0 3.0 4.0 5.0 A. Mean capture depth (ft) C. Mean flow at capture site (ft/s)

A. B. r2 = 0.5976, p=0.0415 2 2.5 2.0 r = 0.8494, p=0.0032

2.0 1.5 1.5 1.0 1.0

0.5 0.5 Depthmidpoint at (ft) midpoint at Flow (ft/s) 0.0 0.0 0 0.5 1 1.5 2 0.0 1.0 2.0 3.0 4.0 5.0 B. Mean capture depth (ft) D. Mean flow at capture site (ft/s)

Figure 24. E. tippecanoe capture depth and flow vs. midpoint depth and flow. A) DepthC. at the creek midpoint vs. mean capture depth D. in the spawning riffle including all survey dates. B) Depth at the creek midpoint vs. mean capture depth in the spawning riffle for peak spawning survey dates. C) Flow at the creek midpoint vs. mean capture depth in the spawning riffle including all survey dates. D) Flow at the creek midpoint vs. mean capture depth in the spawning riffle for peak spawning survey dates.

52 14 12 Female 10 Male 8 6 4

Number of individuals . . individuals of Number 2 0 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 Size (mm) Figure 25. Numbers of E. tippecanoe males and females at each standard length (mm).

2.3.3 Other factors

The mean pH was 8.064, with a deviation of 0.205. A temperature increase to between 18 and 20°C can be seen prior to the onset of spawning in E. camurum. Water temperatures remained fairly constant until mid-July, with daily fluctuations of about 5°.

In mid-July, water temperature rose to 20-22°C, reaching a sustained peak for about a week at 22-24ºC during daylight hours (Figure 26). The peak in temperature corresponds to the termination of spawning in both species around the 25th of July. We made observations of streamside flora on each survey date. Black locust, Robinia pseudoacacia, was seeding at the start of spawning for E. camurum. Common ninebark,

Physocarpus opulitolius, had set fruit near the start of spawning in E. tippecanoe. See

Appendix D for notes on plants found along Deer Creek during the surveys.

30 28 26 24 22 20 18 16 14 12

Temperature in C . 10 8 E. camurum

(°C) Temperature 6 4 2 E.tippecanoe 0

Date Figure 26. Water temperature at Deer Creek, Harmarville, PA. Temperature was logged every 15 minutes from May 8 through August 30, 2006 by an Onset Optic StowAway Temp Logger. The peak spawning season for E. camurum and E. tippecanoe are shown by the boxes, and the range of the season by the bars extending from the boxes.

2.4. DISCUSSION

Other workers have noted a season migration of E. camurum from deeper waters into riffles when they spawn (Trautman 1957, Winn 1958, Cooper 1983). The correlation between the increased population size and female gravidity in the riffle at Deer Creek provides addition evidence of a seasonal spawning migration. My work suggest that both

E. camurum and E. tippecanoe undergo a seasonal migration into Deer Creek for spawning at ideal riffle locations (Figure 10-11). Ensuring that riffles on the Allegheny

River‘s tributaries remain intact and accessible to migrants may be important for sustained species recovery.

Trautman‘s (1957) hypothesis regarding fluctuation in abundance of E. camurum at the spawning riffle when conditions are turbid is supported. While I was only able to observe short periods of turbidity cause by storm conditions, this finding has implications for managing human-generated turbidity. Longer periods of turbidity, as might be caused by streamside construction or industry, could have a negative impact on species maintenance. When only males are considered, the data set is much more subject to the foibles of field sampling. While it was not statistically significant, I should note some idiosyncrasies that contribute to skew. On 31 May, we captured a large number of individuals, including many gravid females, but we captured no males. On 25 July, near the end of the spawning period, we captured 11 males, one of the largest capture dates for males, on a day when turbidity was 21.10 NTU, a high turbidity day. Because of the small male data set, small variations and outliers can make a large difference statistically.

When E. tippecanoe is considered, the low overall numbers make statistical analysis difficult. The Tippecanoe darter evaluation was done on the basis of 96

56 individuals over 20 dates, while the bluebreast darter evaluation was done based on 354 individuals. Tippecanoe darters are smaller than the bluebreast darters, and they may contributing more to the reproductive success of the species at a smaller size on the gravidity scale. We found several No. 2 ranked females in which we could clearly see eggs through the ventral skin. I used the same parameters for both species to define the treatments, when perhaps the Tippecanoe darters should have been treated differently.

Although the mean total population chart (Figure 21) appears to support the idea of abandonment, it is not significant based on Kruskal-Wallis evaluation. The data set using males instead of total population has the same problem as the E. camurum set. Generally we captured 1-3 males on a given day. During the peak season when turbidity was low, we caught a record 6 males, but on a similar day, we caught none. While the data are not statistically significant, I would hesitate to reject or accept Trautman‘s (1957) claim based on this data set of Tippecanoe darters.

Both E. camurum and E. tippecanoe were loyal to locations within the spawning riffle. They did not move to new locations to accommodate some ideal depth or flow.

Flow never correlated with site occupation within the range found at Deer Creek, and it is not likely to be a factor in fluctuations in the riffle population of either species. This contradicts Trautman‘s (1957) assertion that flow impacts population size of E. camurum.

My observations are of each survey date individually, while Trautman was considering flow in different years at one location. Our difference in methods may account for our different findings. Depth may be a factor, but only in that it may make the preferential locations less desirable, rather than causing the darters to seek a constant depth.

57 Water temperature did track the start of E. camurum spawning, and spawning terminated before any temperature drop. Stable temperature during June and July was likely maintained in part by overhanging foliage along the banks. Hubbs (1985) found that some darters terminate spawning when water temperatures increase to 20-23°C. My observations that both E. camurum and E. tippecanoe ceased spawning simultaneously with an increase in average daytime temperature to about 23°C is consistent with the suggestion that the cue for spawning termination is an increase in temperature. Foliage along watersheds may help prevent the rise in water temperature, prolonging or maintaining the spawning period.

Changes in foliage along watershed may correspond to darter spawning seasons.

Some plants and tress come into season based on period of sensing temperature/degree- days. Black Locust, Robinia pseudoacacia, flowering corresponded to E. camurum spawning, and common ninebark, physocarpus opulitolius, fruiting corresponded to E. tippecanoe spawning.

While an essential component to darter spawning success is likely to be appropriate substrate, as indicated by both species‘ site loyalty, information on the darters‘ preferred depth, pH, temperature and acceptable turbidity levels will be useful for predicting locations where the species might potentially spawn. This information will also be useful in maintaining high quality stream conditions conducive to spawning success. These sensitive animals will be useful as indicators of habitat quality as more creeks and streams in Western Pennsylvania are rehabilitated from past industrial, mining or rechanneling damage.

3. PYLOGENETIC POPULATION STRUCTURE

Several methods have been used by various researchers to develop phylogenies of species within the family Percidae. Page (1981) used morphological characters to develop phenograms of species relationships. He also used reproductive behaviors to infer evolutionary relationships between percid taxa (Page 1985). Wood (1996) used allozymes to develop phylogenies of darters within the subgenus Nothonotus. The mitochondrial 12S rRNA and cytochrome b genes have been used to develop phylogenies of the family Percidae (Sloss et al. 2004, Song et al. 1998). To consider population structure within a species, Near et al. (2001) used cytochrome b to look at the phylogeographic structure within Percina evides. Near and Keck (2005) used cytochrome b to develop a phylogeny of all darters of the subgenus Nothonotus. Ritchea (2006) analyzed full mitochondrial genomes from several groups of closely related fishes, including tunas, trouts, salmons, and sea bream, to identify the three most variable mitochondrial genes. She then compared the sequences of these highly variable genes

(ND2, ND4 and cytochrome b) from nine closely related darter species and found that the

ND2 gene was the most variable. She used ND2 and the Control Region to develop phylogenies of two Nothonotus darters, E. etowahae and E. jordani.

Here I will utilize the ND2 gene to develop phylogenies for three Pennsylvania state threatened darters, E. camurum, E. tippecanoe, and E. maculatum. Results of this study will be useful to conservation planners in prioritizing populations for conservation and developing conservation plans.

59 3.1. INTRODUCTION

Etheostoma camurum, E. maculatum and E. tippecanoe have historically been found in disjunct populations across the Ohio River basin. They have been found in the

Allegheny drainage in Pennsylvania, across the Tennessee and Cumberland drainages, and as far west as the Wabash drainage and Tippecanoe River in Indiana. E. maculatum has been extirpated from parts of its range, and all three have had their habitat reduced by pollution, lock and dam construction, dredging and rechanneling. Subpopulations within each species are located hundreds of kilometers apart. The population structure of all three species may consist of one large metapopulation with emigration between smaller populations, or it may consist of numerous small, genetically distinct populations with little exchange between them. Currently, Pennsylvania populations of these darters are in danger of having their habitat degraded by construction projects along riparian corridors.

Recently, new populations of E. tippecanoe and E. camurum have been found at Deer

Creek, Harmar Township, Allegheny County, and Pine Creek, at Etna, Allegheny

County. Populations of E. camurum, E. tippecanoe and E. maculatum have been found in the Allegheny River mainstem in Harmarville, Allegheny County. All of these newfound populations are over 160km away from historic populations in Pennsylvania and Ohio. Their discovery raises the question of population structure within each species.

Because isolated populations and connected populations have different survival potentials, determining the genetic population structures for the three species will aid in conservation work.

Two of the species groups I will consider include potential cryptic species. I include the greenfin darter, E. chlorobranchium (Zorach), along with my phylogenetic

60 trees of E. camurum. It closely resembles E. camurum, with the most significant differences seen in the coloration of the breeding males (Figure 2). Females and juveniles are virtually indistinguishable. Etnier and Starnes (1993) suggest that E. chlorobranchium may not be a separate species, but rather a high-altitude morphotype of E. camurum.

Several other species of Nothonotus, including E. vulneratum, E. rufilieneatum, and E. blenioides, have green-tinted morphotypes at high altitudes (Etnier and Starnes 1993).

Within the Nolichucky River system, E. camurum and E. chlorobranchium have been found to hybridize (Eisenhour 1995). In other regions within the range of E. chlorobranchium, populations are isolated by significant geographic barriers, such as dams and lakes. These barriers also roughly correspond to boundaries between E. chlorobranchium and E. camurum because dams are often built at elevation changes. The region in which the fishes might have been sympatric has been altered. Neither species occupies impoundments or tailwaters (Etnier and Starnes 1993). Between each E. chlorobranchium population is a lower- elevation E. camurum population. Allozyme analysis (Eisenhour 1995), and cytochrome b analysis (Near and Keck 2005) suggest that these are distinct species.

When considering the population structure of E. tippecanoe, the cryptic species E. denoncourti (Stauffer and van Snik 1997), the golden darter, must also be considered. E. tippecanoe and E. denoncourti are anatomically nearly identical and could easily be mistaken for one another. Cytochrome b analysis shows them to be distinct (Kinziger et al. 2001, Near and Keck 2005), indicating that they can be differentiated on a molecular level.

61 Because new populations of E. camurum and E. tippecanoe have been located in

Deer Creek in Harmarville, PA, over 100 river miles from the nearest previously identified populations, determining the phylogenetic relationships between these new populations and known populations should help assess the source of the population.

Phylogenetic assessment may also help identify relationships between populations of E. maculatum. Here I begin work on determining the genetic population structure of E. camurum, E. maculatum, and E. tippecanoe. Addressing the question of population structure will contribute to conservation efforts, which may, in turn, keep these darters off the Federal Endangered Species List.

3.2. METHODS

3.2.1. Field Collections

When making collections for genetic material at sites other than Deer Creek, we used a Smith-Root, Inc. LR-24 Electrofisher in addition to a 1.8m x1.8m (6‘x 6‘) with

3.2mm (1/8‖) mesh kick-seine. In strong currents, we used a larger, 1.8 x 3m (6‘x10‘) seine with 4.8mm (3/16‖) mesh in conjunction with dip nets.

For several Allegheny River sites, we used a benthic ―Missouri‖ Trawl as described by Herzog (2004) in coordination with the PA Department of Environmental

Protection. The Missouri trawl consists of a double mesh net, weighted on the bottom edge with a heavy chain. The inner mesh was 3.18mm, while the outer mesh was 4.76 mm (Figure 27). The net was let out to 15.2m, then pulled for about 120 seconds per trawl along the bottom, unless the net caught a snag. See Appendix E for lists of individuals by site for each species used in the study.

62 When E. tippecanoe, E. camurum or E. maculatum were caught, each individual was measured for standard length, sexed, evaluated for gravidity, and fin clipped. About

⅓ to ½ of the caudal fin was removed from each individual. In a mark-recapture study performed in conjunction with this research, recaptured individuals showed substantial

(about half) regrowth, including reestablishment of the color pattern at the edge of the fin, several weeks after having been clipped. All individuals were held in a bucket until they had recovered from the electrofishing and clipping, typically about 10-15 minutes, before being released. Tissue samples were preserved in 1000μL of absolute ethanol. When whole individuals were vouchered, they were preserved in absolute ethanol as well. For all samples, the ethanol was changed at least once within 24 hours of preservation to maintain high ethanol concentration. Using this method, the tissues are completely dehydrated. Replacing the ethanol ensures better preservation of the DNA as water is displaced from the tissue.

Figure 27. Benthic, modified two-seam balloon trawl, or “Missouri Trawl” (Herzog 2004).

3.2.2 Genetic Analyses

We acquired tissue samples from across the ranges of each of the darter species either through direct collection or through contributions from other researchers. See

Figure 1 for maps of ranges and sample sites; Appendix E lists sites and sources of tissue.

DNA was extracted from either muscle tissue or fin clips using a phenol:chloroform:isoamyl alcohol procedure (Maniatis et al. 1982). A small piece of muscle, about 3mm x 3mm x 1mm, was cut from the right side of the caudal peduncle.

The skin was removed, muscle was blotted dry of ethanol, and the tissue was finely minced. When fin clips were used, the fin clip was blotted and minced. Tissue was placed in a 1.5mL microcentrifuge tube and incubated at 55° for at least 6 hours or overnight in

500µL ABI lysis buffer (0.1M Tris, 4M urea, 0.2M NaCl, 0.01M CDTA, 0.5% lauroyl sarcosine) with 5μL proteinase K solution (0.1mg/mL concentration). 500μL buffered phenol:choloroform:isoamyl alcohol in a 25:24:1 ratio was added to the reaction microtube and inverted seven times. After spinning for 10 minutes in a microcentrifuge, the top layer containing DNA and buffer was transferred to a new tube. 500μL chloroform was added, the tube was inverted seven times, and mixture was spun in microcentrifuge for two minutes. The top layer containing DNA and buffer was transferred to a new tube, and 1000μL cold 95% ethanol was added. The tube was inverted seven times and spun in a refrigerated centrifuge at 4°C, 3000 RPM, for 20 minutes. The ethanol and buffer were poured off, leaving the pellet of DNA. The pellet was washed with 200μL cold 70% ethanol. The tubes containing the pellets were inverted and allowed to dry for at least 8 hours. When the pellets had dried completely, the DNA

65 was resuspended in 50μL HPLC H2O. Concentration of DNA was determined using a spectrophotometer (either a Cary 1E UV-Visible Spectrophotometer or a WPA Biowave

S2100 Diode Arrray Spectrophotometer).

The mitochondrial NADH Dehydrogenase Subunit 2 (ND2) gene was selected to sequence for analyzing population structure. The 1047bp ND2 gene has been used in developing phylogenies in both African cichlids (Kocher et al. 1995) and poeciliid fish in the Caribbean (Hamilton 2001). The ND2 gene was used by Ritchea (2006) to construct a population structure for two other darter species – the Etowha darter E. etowahae and the greenbreast darter E. jordani. Work by these researchers showed the ND2 gene to be the most variable mitochondrial coding gene within darter species and useful for addressing questions of population structure (Ritchea 2006).

I used several primers to amplify and sequence the ND2 gene: the previously published PCR primers GLNF and ASNR and sequencing primers METF (Kocher et al.1995), the sequencing forward primer SBRF and the reverse primer RGLN, designed and provided to me by Ritchea (2006), and several additional sequencing primers,

END2F, GLN2F, and LAHF, that I designed to complete and clarify parts of the sequence. The primer sequences are provided in Table 8. A cartoon of the locations of primers is provided in Figure 28.

For PCR amplification of the ND2 gene, I used 200ng of template genomic DNA,

2.5mM MgCl2, 0.2 mM of each dNTP, 0.5 units Fisher brand Taq DNA polymerase, 5pM each of the primers GLNF and ASNR, 1 X Fisher buffer B to total reaction volume of

50μL (Porter et al. 2002). PCR was conducted in a MJ Technologies DNA Dyad

Thermocycler using the following program: temperature control mode is calculated, lid

66 control mode is constant at 100˚C, incubate 2 minutes at 93°C, followed by 45 cycles of

45 seconds at 93ºC, 1 minute at 58°C, and 2 minutes at 72ºC. After cycling, a final extension step of 10 minutes at 72°C was added, and samples were maintained at 15°C until they were removed from the thermocycler.

To verify that the ND2 gene had been amplified, 5µL of PCR product and 2µL blue loading dye (0.2M EDTA, glycerol, 1% bromophenol blue) were loaded into a 2%

SB (1 X sodium hydroxide-boric acid buffer) agarose (Amersco brand) gel containing ethidium bromide, immersed in SB buffer (Brody et al. 2004) and run using electrophoresis at 300 V for 18 minutes. Gels were visualized with ultraviolet light and documented with a Kodak DC290 digital camera with Kodak 1D 3.5.4 LE USB software using an exposure time of 3.5 seconds (Figure 29 shows an example). Successful PCR products were cleaned as follows: Sigma Sephadex® G-50 was hydrated at a ratio of 1g

Sephadex® G-50:16µL HPLC H2O, 800µL Sephadex® was loaded in each Princeton separation column and centrifuged for 2-3 minutes. PCR products were added to the columns and centrifuged for 2 minutes. The clean PCR products were quantified using the Cary 1E UV-Visible Spectrophotometer. Clean PCR products were frozen at –20°C for storage.

For sequencing I used the ABI BigDye® v 3.1 cycle sequencing kit. I used 25ng of cleaned PCR product per reaction when using the primers END2F, LAHF, SBRF and

50ng of cleaned PCR product per reaction when using GLN2F, METF or RGLN.

Additionally, each reaction included 2µL BigDye® master mix, 20 pmol sequencing primer (Table 8, Figure 28), 6 µL of 2.5x sequencing buffer, and HPLC H2O to a total volume of 20µLs. Reactions ran on the MJ Technologies DNA Dyad Thermocycler

67 using the following profile: temperature control mode is calculated, lid control mode is constant at 100˚C, initially denature at 95˚C for 1 min (ramp 1.0˚C /sec), cycle 75 times starting with incubation at 95˚C for 30 sec (ramp 1.0˚C /sec), then incubate at 50˚C for 5 sec (ramp 1.0˚C /sec), then incubate at 60˚C for 4 min (ramp 1.0˚C /sec). Once the cycling was finished, samples were maintained at 10˚C until they were removed from the thermocyler. Following the ABI BigDye® reaction, the reaction products were cleaned using Sigma Sephadex® in Princeton separation columns as described above. Clean

BigDye® reaction products were transferred to a 96-well plate and dried in the MJ

Technologies DNA Dyad Thermocycler using the following program: temperature control mode is calculated, lid control mode is off and the lid is open, incubate at 95˚C for 16 minutes. Dried reaction products were resuspended in 10µL DI formamide and denatured in the MJ Technologies DNA Dyad Thermocycler using the following program: temperature control mode is calculated, lid control mode is constant at 100˚C, incubate at 95˚C for 2 minutes. The 96 well-plate was removed immediately and flash- cooled on ice. An ABI PRISM® 3100-Avant Genetic Analyzer was used to generate sequences, and sequence data were analyzed using 3100-Avant Data Collecting Software

Version 1.0 (Applied Biosystems, Forest City, CA).

Overlapping contigs generated by the sequencing reactions were aligned and unified using Eyeball Sequence Editor (ESEE3S) ver. 3.0s (Cabot and Bechenback

1989). Generally, each individual‘s contigs were aligned independently, generating a sequence for the ND2 gene. Once individually sequences had been generated, they were aligned with other samples by species. Alignments were edited by eye. Completed alignments were exported to MEGA v 3.1.2 (Kumar, Tumara, and Nei 2004). Large,

68 multipopulation or species alignments exceeding ESEE3S‘ limit were exported to MS

Word, where populations/species were combined into a large database, then transferred to

MEGA v 3.1.2, where the DNA sequence data sets were further converted into NEXUS

4.0 format for use in other programs. I tested each data set using MrModelTest2.2

(Nylander 2004) and used the results in selecting models to use for generating Bayesian

Likelihood trees.

Neighbor-Joining trees were generated in MEGA v3.2.1 using 1,000 bootstrap replicates to test node support. I used the Jukes-Cantor model (Jukes and Cantor 1969), which assumes equal rates for transitions and transversions at any position, for the E. maculatum data set. I used the Jukes-Cantor model because this data set contains one transition and one transversion. I used the Kimura 2-parameter Model (Kimura 1980) for all other data sets because this model permits transition and transversion rates to differ; I calculated the ratio of transition rates to transversion rates for use in this model.

Maximum Parsimony trees were generated in PAUP 4.0 (Swofford 2000). I used an exhaustive search to select trees for E. maculatum and heuristic searches for all other datasets retaining only the best trees. Trees were rooted with a designated outgroup (See

Table 9) and 50% majority rule trees were generated. I used 1000 bootstrap and 1000 jackknife replicates with full heuristic search to analyze node support. Bootstrap and jackknife support values of 50% or greater are represented at the nodes on these trees.

Bayesian Likelihood trees were generated in MrBayes v. 3.1.2 (Huelsenbeck et al.

2001). I ran the species-level trees for 10 million generations, and the multi-species tree for 5 million generations. A 10 million-generation run will produce 100000 trees, of which, I discarded the first 10000 trees (burnin). I verified that this burnin was adequate

69 by checking the support values for the trees. Log likelihood values should be approximately equal following the burnin period (Hall 2004), and this was true in all cases. I generated strict consensus trees Bayesian Likelihood trees. Bayesian Likelihood utilizes Markov Chain Monte Carlo random walks to generate posterior probabilities indicating support for nodes on a phylogenetic tree. Four Markov chains were run simultaneously in my program. My command block was modified from an example in

Hall (2004) (See Appendix C). Posterior probability values of 50% or greater are represented on the trees. I selected the models and rates for my command blocks based on the results of running MrModelTest 2.2 (Nylander 2004), which evaluates 24 potential evolutionary models. MrModelTest 2.2 generates the command line code to use in

MrBayes. See Table 9 for rates and models selected for each tree. In all cases I used a general time reversible model (GTR), which treats the likelihood of substation of any of the four bases as equal over time. For three data sets, I used a gamma distribution, which allows for differences in the rate of substitution of transitions (A-G and T-C, more common) and transversions (all other substitutions), and differences in codon position for synonymous and non-synonymous substitutions. For the E. maculatum data set, an equal rate was recommended by MrModelTest 2.2. This is reasonable because this data set contains one transition and one transversion.

To evaluate saturation of the ND2 gene, MEGA for DOS 1.02 (Kumar, et al.

1993) was used to generate pairwise comparisons of the sequences of all 52 individuals used in generating the trees. MEGA generated counts of transitions and transversions, for each sequence pair. These data were downloaded into Microsoft Excel, where comparisons of transversions and transitions to overall sequence divergence were made

70 and scatter plots were generated. I used these plots to calculate the gamma parameter to use when generating neighbor-joining trees using the Kimura 2-parameter model.

71 Table 8. Oligonucleotide primers used for PCR amplification and sequencing of the NADH dehydrogenase subunit 2 mitochondrial gene Primer Primer Sequence Usage ASNR 5‘–CGCGTTTAGCTGTTAACTAA-3‘ Reverse PCR primer END2F 5‘-AAGAATTAACCAAGCAGGATCTTG-3‘ Forward sequencing primer GLNF 5‘-CTACCTGAAGAGATCAAAAC-3‘ Forward PCR primer GLN2F 5‘-TCTTGGTGCTTCCACTACAC-3‘ Forward sequencing primer LAHF 5‘-TACAATTTTCGCCCTCCCTCAC-3‘ Forward sequencing primer METF 5‘-CATACCCCAAACATGTTGGT-3‘ Forward sequencing primer SBRF 5‘-GGCTTATCCTCTCGACCTG-3‘ Forward sequencing primer RGLN 5‘-TCATGCGTTGGTGGTGCTGG-3‘ Reverse sequencing primer

Figure 28. Cartoon of the ND2 gene. Primer locations and directions are indicated by the arrows. For primers within the ND2 gene, location distance from the start of the gene are indicated. (Modified from Ritchea, 2006)

C189 C190 C223 C224 C138 C26 C75 NC Ladder

ND2

Figure 29. Example of an agarose gel infused with ethidium bromide which was used to verify successful amplification of the ND2 Gene. The gel was visualized using a UV light. This gel was created on 22 December 2006. The sample identification number is printed above each sample well. NC indicates a negative control. The ladder was a 100 base pair ISC BioExpress GeneMate® Quanti-Marker.

Table 9. Models selected by MrModelTest 2.2 (Nylander 2004) for each data set. Date Set Out group Model Rate E. camurum and E. chlorobranchium E. maculatum GTR Gamma E. maculatum E. camurum GTR Equal E. tippecanoe and E. denoncourti E. camurum GTR Gamma All five species E. virgatum GTR Gamma

3.3. RESULTS: PHYLOGENETIC ANALYSES BASED ON ND2 GENE

Plotting all pairwise comparisons of transitions against uncorrected nucleotide divergence shows a generally linear relationship, indicating that this data set is not saturated for transitions across all species (Figure 30, top). When pairwise transversion to total uncorrected nucleotide divergence is considered, the relationship is linear to about

3.5% nucleotide divergence when all species are used (Figure 30, bottom). At greater than 3.5% divergence, the relationship begins to deviate from a line, indicating that this data set may be saturated for transversions for sequences with >3.5% divergence. The taxonomic relationships may be unreliable after that point due to multiple mutational

―hits‖ at the same sites. Dividing the transition sequence divergence value of 1.4 by the transversion sequence diversion value of 0.035 (the saturation point), I calculated a ration of 4:1. I used this value for the Neighbor-joining models. Using a data set for the genus

Percina, sister genus to Etheostoma, Near (2002) calculated a ratio of 5.5:1 for cytochrome b, which is slightly greater than my value, but for a different gene.

Etheostoma camurum

ND2 was sequenced for 43 E. camurum individuals from 20 locations across the range of the species, and three E. chlorobranchium individuals were sequenced from two locations. Within E. camurum there are 13 variable sites in the sequence. Within E. chlorobranchium there are three variable sites. Between the two species, there are 51 variable sites. Thirty-five E. camurum individuals had identical haplotypes. They were represented by two individuals when generating trees, so that a total of ten E. camurum and three E. chlorobranchium were used in the phylogenetic analyses. All phylogenetic

74 methods used showed a 100% support for the species-level nodes representing E. camurum and E. chlorobranchium.

Within E. camurum, only the node representing the Clinch River population at

Nash Ford has substantial support, with 96% Neighbor-Joining bootstrap support, 90%

Maximum Parsimony bootstrap, and 81% Maximum Parsimony jackknife support, and

100% posterior probability support using Bayesian Likelihood. Two genetically different individuals from the North Fork of the Holsten River in Virginia, consistently clade as sister groups to the Clinch population and the rest of the population. There is no support for any population structure for the remainder of the populations sampled, with samples from across the range being identical, or having autapomorphic differences that are not parsimony - informative (Figure 31-33).

Etheostoma maculatum

For E. maculatum, ND2 was sequenced from 20 individuals from 11 locations.

Within the species only two variable sites were identified. An individual from the

Allegheny River, Pool 9 showed a single transversion from the other individuals. There is modest support for the group including all of the Ohio and Pennsylvania locations, but no support within the group, since most individuals are identical. There is a single transition that differentiates the two identical individuals from the East Fort of the White River from the others. Within the context of the large trees containing all of the species studied, this node also received modest support (Figure 34-36).

Etheostoma tippecanoe

For E. tippecanoe, 40 individuals were sequenced from 24 locations. There were

27 variable sites within the sequence. Five E. denoncourti individuals were sequenced

75 from three locations, and ten variable sites were found. Between E. tippecanoe and E. denoncourti, 87 variable sites were found. The species-level nodes had strong support:

100% with both bootstrap and jackknife using Maximum Parsimony, and 95% for E. tippecanoe and 100% for E. denoncourti using Bayesian Likelihood. Within E. denoncourti, the Duck River population has support as differing from the Sequatchie and

Clinch River populations. Within E. tippecanoe, although several common haplotypes are apparent and have some statistical support as distinct, the haplotypes are found across the geographic range of the species. Individuals from French Creek, PA and the

Allegheny River are found within each of the three major branches, rendering little support for any phylogenetic pattern within the species. There is support for an E. tippecanoe clade of the Big South Fork, TN population, although individuals from the lower Allegheny, PA are sister to this group (Figures 37-39).

All species

When all species are considered using E. virgatum as outgroup, the same pattern of strong support, between 99-100%, is evident for species level nodes. There is equally strong support for E. tippecanoe and E. denoncourti as sister taxa, and E. camurum and

E. chlorobranchium as sister taxa, and E. maculatum as a sister taxon to the group of E. camurum and E. chlorobranchium. This group of three species is supported as a sister to the group containing E. tippecanoe and E. denoncourti (Figures 40-42).

0.25 0.2 0.15 0.1 Transitions . . Transitions 0.05 0 0 0.05 0.1 0.15 Sequence Divergence

0.25 0.2 0.15 0.1 0.05 Transversions . Transversions 0 0 0.02 0.04 0.06 0.08 0.1 Sequence Divergence

Figure 30. Saturation plots of ND2: a plot of frequencies of all pairwise observed transitions (top) and transversions (bottom) against uncorrected nucleotide sequence divergence using the ND2 sequence from all individuals of all species.

Figure 31. E. camurum Neighbor-Joining Tree, generated in MEGA v.3.1 (Kumar et al 2004) using the Kimura 2-parameter model with a gamma parameter of 4.0, and rooted with E. maculatum. 1000 Bootstrap replicates were computed; bootstrap values greater than 50% are represented above or below the node. The individual short identification number is shown in parentheses for unique haplotypes. The tree is based on 1047 total characters, with E. camurum: 13 variable sites within E. camurum, 3 variable sites within E. chlorobranchium, and 51 variable sites between E. camurum and E.chlorobranchium. Branch lengths are proportional to sequence divergence.

Figure 32. E. camurum Maximum Parsimony Tree, generated in PAUP v. 4.0b10 for Macintosh (Swofford 2000) using a heuristic search with 1000 bootstap (value above node) and 1000 jackknife (value below node) replicates, 50% majority rule consensus of one parsimonious tree. Support values of 50% or greater are shown. The tree is rooted with E. maculatum.

Figure 33. E. camurum Bayes ian Likelihood Tree, generated in MrBayes3.1 (Huelsenbeck and Ronquist 2001) using the GTR+G model. Bayesian analysis was run for 10 million generations, with a burnin of 10000 trees. Sample frequency was 100 trees. Trees were based on 1047 total characters, with 13 variable sites within E. camurum, 3 variable sites within E. chlorobranchium, and 51 variable sites between E. camurum and E. chlorobranchium. The strict consensus tree shows posterior probability support greater than 50% above or below the node. Tree is rooted with E. maculatum. Branch lengths are proportional to sequence divergence.

Figure 34. E. maculatum Neighbor-Joining Tree, generated in MEGA v.3.1 (Kumar et al 2004) using the Jukes-Cantor model, rooted with E. camurum. Bootstrap values greater than 50% are represented above the node.

Figure 35. E. maculatum Maximum Parsimony Tree, generated in PAUP v. 4.0b10 for Macintosh (Swofford 2000) using an exhaustive search with 1000 bootstap (value above node) and 1000 jackknife (value below node) replicates, 50% majority rule consensus of one parsimonious tree. Support values of 50% or greater are shown. The tree is rooted with E. camurum.

Allegheny R., Pool 9, vic.Bald Eagle Island, PA (n-1)

Allegheny R., Harmarville, Allegheny Co., PA (n=2) Big Darby C., Fox, OH (n=1) 95 French C. @ vic. Shaw's Landing, PA (n=2) French C.@Cochranton, PA(n=2) French C.@ Franklin, PA(n=1) French C., PA @ Venango, Crawford Co., PA(n=2) French C., PA vic Rt 97(n=2) Kokosing R., OH(n=2) Oil C., Oil City, PA (n=3) Generations: 10 million Burnin: 10000 trees Sample frequency: 100 trees 1047 total characters East Fork of the White R., IN (n=2) Branch lengths proportional to sequence divergence Within-species variable sites: 2

E. camurum

0.01 substitutions/site

Figure 36. E. maculatum Bayesian Likelihood Tree, generated in

MrBayes3.1(Huelsenbeck and Ronquist 2001) using the GTR model with equal rates.

Strict consensus tree with posterior probability support greater than 50% shown above node. Tree is rooted with E. camurum.

82 Figure 37. E. tippecanoe and E. denoncourti Neighbor-Joining Tree, generated in MEGA v.3.1 (Kumar et al 2004) using the Kimura 2-parameter model with a gamma parameter of 4.0, and rooted with E. camurum. 1000 Bootstrap replicates were computed; bootstrap values greater than 50% are represented above or below the node. The individual short identification number is shown in parentheses for unique haplotypes. Branch lengths are proportional to sequence divergence. Tree is based on 1047 sites with 27 variable sites within E. tippecanoe, 10 variable sites within E. denoncourti, and 87 variable sites between E.tippecanoe and E. denoncourti.

83 Figure 38. E. tippecanoe and E. denoncourti Maximum Parsimony Tree, generated in PAUP v. 4.0b10 for Macintosh (Swofford 2000) using a heuristic search with 1000 bootstap (value above node) and 1000 jackknife (value below node) replicates, 50% majority rule consensus of 10 equally parsimonious trees. Support values of 50% or greater are shown. The tree is rooted with E.camurum.

Figure 39. E. tippecanoe and E. denoncourti Bayesian Likelihood Tree, generated in MrBayes3.1(Huelsenbeck and Ronquist 2001) using the GTR+G model. Bayesian analysis was run for 10 million generations, with a burnin of 10000 trees. Sample frequency was 100 trees. Trees were based on 1047 total characters, with 27 variable sites within E. tippecanoe, 10 variable sites within E. denoncourti, and 87 variable sites between E. tippecanoe and E. denoncourti. The strict consensus tree shows posterior probability support greater than 50% above the node. Tree is rooted with E. camurum. Branch lengths are proportional to sequence divergence.

Figure 40. Neighbor-Joining Tree showing all three species and two cryptic species generated in MEGA v.3.1 (Kumar et al 2004) using the Kimura 2- parameter model with a gamma paramenter of 4.0. 1000 Bootstrap replicates were computed; bootstrap values greater than 50% are represented above or below the node. The tree is based on 1047 total characters, with 326 variable sites. Tree is rooted with E. virgatum. Branch lengths are proportional to sequence divergence. See Table 10 for lists of lists of identical-genotype individuals.

86 Figure 41. Maximum Parsimony Tree with all three species and two cryptic species generated in PAUP v. 4.0b10 for Macintosh (Swofford 2000) using a heuristic search with 1000 bootstap (value above node) and 1000 jackknife (value below node) replicates, 50% majority rule consensus of 14 equally parsimonious trees. Support values of 50% or greater are shown. The tree is rooted with E. virgatum. Trees were based on 1047 total characters, with 326 variable sites. See Table 10 for lists of identical-genotype individuals.

87 Figure 42. Bayesian Likelihood Tree with all three species and two cryptic species generated in MrBayes3.1 (Huelsenbeck and Ronquist 2001) using the GTR+G model. Bayesian analysis was run for 5 million generations, with a burnin of 5000 trees. Sample frequency was 100 trees. Trees were based on 1047 total characters, with 326 variable sites. The strict consensus tree shows posterior probability support greater than 50% above or below the node. Tree is rooted with E. virgatum. Branch lengths are proportional to sequence divergence. See Table 10 for lists of lists of identical-genotype individuals.

88 Table 10 Individuals with identical haplotypes. Each group represents one haplotype. Each haplotype was represented by two individuals when generating trees. Group Species Individuals in each Group A E. tippecanoe (ET23)Allegheny R., Pool 4, PA (n=1) French C., Franklin, PA (n=2) (ET19)French C., PA vic Rt 97 (n=1) (ET17)French C., Venango, Crawford Co., PA (n=1) (ET217)French C., Cochranton, PA (n=1) (ET309)Licking R. Butler, KY (n=1) B E. tippecanoe (ET22)Allegheny R. @mouth of Clarion R., PA(n=1) (ET15)E. Fk. White R., Shoals, IN,(n=1) (ET11)French C., Cochranton, PA (n=1) (ET26)French C., Venango, Crawford Co., PA (n=1) (ETI2)French C., vic. Shaw's Lndg, PA(n=1) (ET307)Licking R. Butler, KY (n=1) Little Kanawha R., Calhoun Co., WV(n=2) C E. camurum Allegheny R., Pool 9, vic. Bald Eagle Is., PA(n=1) Allegheny R., Harmarville, Allegheny Co., PA (n=2) Big Darby C., Fox, OH (n=2) Deer C., Harmar Twp., PA (n=1) East Fork of the White R., Shoals, IN (n=2) Elk R., Braxton Co., WV(n=1 Elk R., Ivydale, WV (n=2) French C., Cochranton, PA (n=3) French C., Franklin, PA (n=2) French C., PA vic Rt 97(n=1) French C., vic. Shaw's Landing, PA (n=2) Kokosing R., OH (n=3) Little Kanawha R., Calhoun Co., WV (n=2) Nolichucky R., Warrensburg, Greene Co., TN (n=2) Oil C., Oil City, PA(n=2) Pine C. vic. Etna, PA, (n=1) S. Fork Kentucky R., KY(n=4) Tippecanoe R.,vic Brookston, IN(n=2) D E. maculatum Allegheny R., Harmarville, Allegheny Co., PA (n=2) Big Darby C., Fox, OH (n=1) French C. @ vic. Shaw's Landing, PA (n=2) French C.@Cochranton, PA(n=2) French C.@ Franklin, PA(n=1) French C., PA @ Venango, Crawford Co., PA(n=2) French C., PA vic Rt 97(n=2) Kokosing R., OH(n=2) Oil C., Oil City, PA (n=3)

3.4. DISCUSSION

Although we have a limited sample of locations, the phylogeny of E. camurum supports species status of E. chlorobranchium. These two species form reciprocally monophyletic groups with high bootstrap support. This is consistent with the findings of

Near and Keck (2005) and Eisenhour (1995). The Clinch River, VA, population of E. camurum has support as a distinct subgroup. This population has likely been isolated long enough to diverge genetically from the main population. While there seems to be some individual variation, there is little support for any other node. Other than the unique

Clinch River population, no phylogeographic structure is evident. The lack of phylogeographic structure may arise from one of two possible hypotheses. First, the historic range of this species may have been historically connected with substantial migration between populations until recent times, and the populations have not been isolated long enough to show unique haplotypes for this gene. Man-made barriers such as dams or extensive polluted river stretches would not be expected to significantly influence population genetic divergence in this short period of time provided that the size of the recently isolated population were large. Second, given the demise of the rivers over the past two centuries, and the recent improvements in water quality, the few surviving populations may be expanding their ranges and occupying or recolonizing new areas. The four new locality records (Appendix F) for E. camurum, taken in the mainstem Allegheny

River by benthic trawl or in its tributatries by kick seining between Franklin, PA and

Pittsburgh, PA., support the potential for current genetic exchange throught the

Allegheny River system.

90 A similar pattern is seen in E. maculatum. The East Fork of White River, IN population has a single base difference from all the others. No variation is seen across the remainder of the range tested here. Of the species considered, E. maculatum had the least overall genetic diversity. While this suggests that E. maculatum from one area could be used to repopulate areas from which it has been extirpated, the lack of variation may be a problem for recovery due to inbreeding. Within the Allegheny River, two new localities records (Appendix F) between Franklin, PA and Pittsburgh, PA suggest that E. maculatum may be expanding its range.

E. tippecanoe showed the greatest amount of genetic diversity, with three groups of common haplotypes, and a number of deviations found only in single individuals. The major haplotypes are found across the range, with only Big South Fork, TN appearing to show significant phylogeographic distinction from the other localities. This species may have had a great amount of genetic diversity prior to man-made barrier erection along the waterways, and much of this diversity has not yet been lost. Alternatively, populations of

E. tippecanoe that appear to be disjunct may be involved in current gentetic exchange.

The 6 new locality records (Appendix F) for E. tippecanoe taken in the Allegany River mainstem and its tributaries between between Franklin, PA and Pittsburgh, PA., support this.

My findings on population structure for all three species are similar to those found by Near et al.(2001) when they considered the phylogeography of the gilt darter, Percina evides, using the mtDNA cytochrome b gene sequence. In their work, they found no phylogenetic structure in the eastern populations which occupy the Ohio and Tennessee drainages. My results indicate that no populations of E. camurum, E. maculatum, or E.

91 tippecanoe within this region have been isolated long enough to become genetically distinct, at least at the level detectable by a mitochondrial, coding sequence. The lack of phylogeographic structure is promising for species recovery because it provides opportunity for repopulation without disruption to unique population structures.

The phylogenies based on all three species are consistent with those generated with allozymes (Wood 2006), which showed E. camurum and E. chlorobranchium to be the most closely related of the species considered, and E. maculatum to be more closely related to E camurum than to E. tippecanoe. It is similar to Page‘s (1981) phenograms, placing E tippecanoe as a sister species to the group containing E. camurum, E. chlorobranchium and E. maculatum. My results with ND2 are identical to Near and

Keck‘s (2005) results with cytochrome b for these five species.

The pattern found within E. camurum, with the Clinch River populations diverging genetically, is similar to the one found in the group of E. tippecanoe and E. denoncourti, where the Clinch, Sequatchie and Duck River populations consist of the cryptic species E. denoncourti, but populations of E. tippecanoe generally lack phylogeographic structure. This pattern suggests that the Clinch, Sequatchie and Duck

River populations may have been isolated from the rest of the Ohio Basin watershed for a substantial period of time, leading to the evolutionary divergence of darter species that utilize main stem river habitats. Burr and Mayden (1992) note that the Tennessee River drainage, which includes the Clinch, Duck and Sequatchie Rivers, is a region of significant endemism, with at least 30 endemic species. Given the Tennessee River drainage‘s high level of endemism, the genetic divergence of the Clinch River population of E. camarum, and the divergence of E. tippecanoe and E. denoncourti along this

92 geographic range, I predict that other darter species within the Tennessee River drainage have also diverged genetically from conspecifics in other drainages. This idea could be tested with further research on other darter species.

4. CONCLUSION

In this work, I have identified the spawning season for E. camurum and E. tippecanoe. I have provided information on the water temperature range when they spawn, and on the depth, flow, and pH at their spawning riffles. My results indicate that these two species move into Deer Creek to spawn in mid-spring. I have demonstrated the importance of location and site loyalty, suggesting that ideal substrate should be maintained. I have demonstrated that turbidity impacts spawning riffle population of the bluebreast darter. Stream (midpoint) depth may also be a factor influencing spawning riffle population size.

I have shown that within the Allegheny drainage, there is no geographic population structure for E. camurum, E. tippecanoe, or E. maculatum. With the exceptions of the Clinch River drainage in Virginia for E. camurum and Big South Fork in Tennessee for E. tippecanoe, there is no geographic population structure across the

Ohio, Cumberland or Tennessee basins for any of these three species.

Conservation planners should take into account the spawning season and conditions for spawning when developing plans for riparian areas and watersheds.

Additionally, the lack of population structure may benefit species recovery because isolated populations are either currently in genetic contact, or they have been isolated so recently that restocking from other source populations will not destroy evolutionarily

93 significant units. Conscious efforts to maintain high water quality and preserve remaining habitat will help bluebreast darter, the Tippecanoe darter and the spotted darter recover while keeping them off the U.S. Federal Endangered Species List.

5. FUTURE WORK

Pine Creek, which connects to the Allegheny River near Etna, PA is similar to

Deer Creek at Harmarville. The creeks are similar in drainage size and physical characteristics, such as depth, flow and substrate. Pine creek has numerous riffles near its mouth that look like optimal habitat for both bluebreast and Tippecanoe darters, yet at the same time that we found forty or fifty bluebreast darters at Deer Creek, we found just one at Pine Creek. Identifying what differences exist between the two creeks will help understand requirements necessary for the bluebreast and Tippecanoe darter populations to thrive. If E. tippecanoe and E. camurum are expanding their range from the French

Creek and the Upper Allegheny river, they may not have reached Pine Creek, which drains into the Allegheny south of Deer Creek. The other possibility is that water quality factors make the Pine Creek watershed less desirable habitat. The Pine Creek drainage area has more disruption and is less pristine than Deer Creek‘s area (Gazdik 2007).

Encroachment from housing and industry along the Route 8 corridor may increase turbidity or add pollutants to the creek, and cleared, urban areas without tree cover may lead to increased water temperature during the spawning season. Either of these factors could detract from Pine Creek‘s habitat. Further study will be required to determine which factors prevent E. tippecanoe and E. camurum from utilizing Pine Creek‘s riffles.

94 To pursue the identity and source of new populations through genetics, we will look at nuclear DNA microsatellites and compare the frequencies of genotypes within and between populations. Ongoing work with mtDNA control region repeat fingerprints may also prove useful in studying population structure. This work will provide a clearer picture of the genetic composition of geographically distant populations and help identify those populations that are diverging through genetic drift. This extended work will hopefully have the potential to estimate female effective population size, an important component in conservation planning.

WORKS CITED

Bannon, M.J. (2006) The battle of Deer Creek Crossing: A case study of Rhetorical Exigence and Environmental Controversy. Doctoral Thesis. University of Pittsburgh. Pittsburgh, PA.

Birtwell, I.K. (2000) Effects of sediment on fish and their habitat. DFO Pacific Region Habitat Status Report 2000/01E

Brody, J. R., and Kern, S. E. (2004). Sodium Boric Acid: A tris-free, cooler conductive medium for DNA electrophoresis. Biotechniques 36:214-216.

Bryant R.T. (1979) The life history and comparative ecology of the sharphead darter, Etheostoma acuticeps. Tennessee Wildlife Resources Report 79-50: 60.

Burr, B.M. and Mayden, R.L. (1992) Phylogenetics and North American Fishes. Systemics, Historical Ecology, and North American Fishes. Ed. R.L. Mayden. Stanford University Press. Stanford, CA. 18-75.

Cabot, E.L. and Beckenbach, A.T., (1989) ESEE3S Comput. Appl. Biosci. 5:233-234

Casner, N. (2003) Acid mine drainage and Pittsburgh‘s water quality. Devastation and Renewal: An Environmental History of Pittsburgh and its Region. Ed. J.A.Tarr. University of Pittsburgh Press. Pittsburgh, PA. 89-109.

Cooper, E.L. (1983) Fishes of Pennsylvania and the Northeastern United States. Pennsylvania State University Press. University Park, PA.

Corddry, G.F. and Carpenter, Inc. A History of the Navigation Improvements on the Allegheny River. Prepared for the U.S. Army Corps of Engineers, Pittsburgh District, 1981.

Eisenhour, D. J., (1995) Systematics of Etheostoma camurum and E. chlorobranchium (Osteichthyes: Percidae) in the Tennessee and Cumberland River drainages with analysis of hybridization in the Nolichucky River system. Copeia 1995:368-379.

Etnier, D.A. and Starnes, W.C., (1993) The Fishes of Tennessee, Univ TN Press, Knoxville, 475-479.

Fisher, W.L (1990) Life history and ecology of the orangefin darter, Etheostoma bellum. American Midland Naturalist 123: 268-281.

96 Fuller, R.C. (2003) Disentangling Female Mate Choice and Male Competition in the Rainbow Darter, Etheostoma caeruleum. Copeia 1999: 1084-1088.

Galbraith, R.V. MacIsaac, E.A., Macdonald, J.S. and Farrell, A. P. (2006) The effect of suspended sediment on fertilization success in sockeye (Oncorhynchus nerka) and (Oncorhynchus kisutch) salmon. Canadian Journal of Fisheries and Aquatic Sciences, 63: 2487-2494.

Gazdik, A. (2007) Act 167 Stormwater Management Plan Update: Girtys Runs, Pine Creek, Squaw Run, and Deer Creek Watersheds, Allegheny County, PA. Prepared for North Hills Council of Governments. March 30, 2007. 17-20.

Hall, B.G. (2004) Phylogenetic Trees Made Easy: A How To Manual. 2nd edition. Sinaur Associate, Inc., Sunderland. 130-131.

Hamilton, A. (2001) Phylogeny of Limia (Teleostei: Poeciliidae) Based on NADH Dehydrogenase Subunit 2 Sequences. Molecular Phylogenetic and Evolution 19: 277-289.

Herzog, D.P. (2004) Capture efficiency and habitat use of Sturgeon Chub (Macrhybopsis gelida) and Sticklefin Chub (Macrhybopsis meeki) in the Mississippi River. Masters Thesis. Southeast Missouri State University, Missouri.

Hopey, D. (2001) Teeming waters: Study finds bacteria from sewage overflows at high levels in rivers. http://www.post- gazette.com/healthsceince/20010702rivers0702p2.asp. Pittsburgh Post-Gazette. July 02, 2001.

Hopey, D. (2006) Fishermen mourn toxic spill‘s mass killing of trout. http://www.post- gazette.com/pg/06187/703720-113.stm. Pittsburgh Post-Gazette. July 6, 2006.

Hubbs, C.H. (1985) Darter Reproductive Seasons. Copeia 1985: 56-68

Hubbs, C. H. and Strawn, K. (1957) The effects of light and temperature on the fecundity of the greenthroat darter, Etheostoma lepidum (Girard). Ecology 38:596-602.

Jenkins, R.E. and Burkhead, N.M. (1994) Freshwater Fishes of Virginia. American Fisheries Society. Bethesda, MD. 856-873.

Jordan, D.S. and Evermann, B.W. (1890) Description of a new species of fish from Tippecanoe River, Indiana. Proceedings of the U.S. National Museum. 13: 3-4.

Kinziger, A. P, Wood R.M. and Welsh, S. A. (2001) Systematics of Etheostoma tippecanoe and Etheostoma denoncourti. Copeia 2001: 235-239

97 Kocher, T.D., Conroy, J.A., McKaye, K.R., Stauffer, J.R., and Lockwood, S.F. (1995) Evolution of NADH Dehydrogenase Subunit 2 in East African Cichlid Fish. Molecular Phylogenetic and Evolution 4: 420-432.

Kuehne, R.A. and Barbour, R.W. (1983) The American Darters. The University Press of Kentucky. Lexington, KY. 112-117, 122-123.

Kumar, S., Tamura, K., and Nei, M. (1993) MEGA1.02: Molecular Evolutionary Genetics Analysis. The Pennsylvania State University.

Kumar, S., K Tamura, K., and Nei, M. (2004) MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 5:150-163.

Lee, D., Gilbert, C., Hocutt, C., Jenkins, R., McAllister, D. and Stauffer, J., Jr., (1980) Atlas of North American Freshwater Fishes. North Carolina State Museum of Natural History. 627, 632-33,664,703.

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Marsh, B. and Lewis, P. (1995) Landforms and human habitat. A Geography of Pennsylvania. Ed. E.W. Miller. Pennsylvania State University Press. University Park, PA. 17-43.

Mayasich, J.M., Grandmaison, D., and Etnier, D. (2004) Spotted Darter Status Assessment. NRRI Technical Report No. NRRI/TR-2004-02.

Meyers, L.S. and Grossen, N.E., (1978) Behavioral Research: Theory, Procedure and Design. W.H. Freemand and Company. San Francisco. 308-309.

Mettee, M. F., O‘Neil, P.E., and Pierson, J. M. (1996). Fishes of Alabama and the Mobile Basin. Oxmoor House. Birmingham, AL.

Miller, E.W. (1995) Mineral Resources. A Geography of Pennsylvania. Ed. E.W. Miller. Pennsylvania State University Press. University Park, PA. 203-233.

Mosher, K.H. and Eckles, H.H. (1954) Age determination of Pacific sardines from otoliths. U.S. Fish and Wildlife Service. Res. Rep 37: 40.

Mount, D.L. (1959) Spawning behavior of the bluebreast darter, Etheostoma camurum (Cope). Copeia 1959:240-243.

98 Muller, E.K. (2003) River City. Devastation and Renewal: An Environmental History of Pittsburgh and its Region. Ed. J.A.Tarr. University of Pittsburgh Press. Pittsburgh, PA. 41-63.

Muller, E.K. and Tarr, J.A. (2003) The Interaction of Natural and Built Environments in the Pittsburgh Landscape. Devastation and Renewal: An Environmental History of Pittsburgh and its Region. Ed. J.A.Tarr. University of Pittsburgh Press. Pittsburgh, PA. 11-40.

Near, T.J. (2002) Phylogenetic Relationships of Percina (Percidae: Etheostomatinae). Copeia 2002:1-14.

Near, T. J., and Keck, B. P. (2005). Dispersal, vicariance, and timing of diversification in Nothonotus darters. Molecular Ecology 14:3485-3496.

Near, T.J., Page, L.M. and Mayden, R. L. (2001) Interaspecific phylogeography of Percina evides (Percidae: Etheostomatinae): and additional test of the Central Highlands pre-Pleistocene vicariance hypothesis. Molecular Ecology 10:2235- 2240

Nylander, J.A.A. 2004. MrModeltest 2.2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University

Page, L.M. (1981) The genera and subgenera of darters (Percidae, Etheostomatini). Occasional Papers of the Museum of Natural History, The University of Kansas. 90: 1-69.

Page, L.M. (1985) Evolution of Reproductive Behaviors in Percid Fishes. Illinois Natural History Survey Bulletin 33: 275-295.

Page, L.M., Hardman, M. and Near, T.J. (2003) Phylogenetic Relationships of Barcheek Darters (Percidae: Etheostoma, Subgenus Catonotus) with Descriptions of Two New Species. Copeia 2003: 512-530.

Page, L.M. and Simon, T. P. (1988) Observations on the reproductive behavior and eggs of four species of darters, with comments on Etheostoma tippecanoe and E. camurum. Transactions of the Illinois Academy of Science. 81: 205-210.

Page, R. D. M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences 12:357-358.

Porter, B. A. (1999). Phylogeny, Evolution, and Biogeography of the Darter Subgenus Ulocentra (Genus Eteostoma, Family Percidae). Ph.D. thesis, The Ohio State University, Columbus.

99 Porter, B.A., Cavender, T.M., and Fuerst, P.A., (2002) Molecular phylogeny of the snubnose darters, subgenus Ulocentra (genus Etheostoma, family Percidae). Molecular Phylogenetics and Evolution 22:364-374.

Raney, E.C. and Lachner, E.A., (1939) Observations on the life history of the spotted darter, Poecilichthys maculaus (Kirtland). Copeia 1939:157-165.

Ritchea, S.B. (2006) Genetic Population Structure of the Federally Endangered Etowah Darter, Etheostoma etowahae. Masters Thesis. Duquesne University. Pittsburgh, Pennsylvania.

Ringquist, E.J. (1993) Environmental Protection at the State Level: Politics and Progress in Controlling Pollution. M.E.Sharp, Inc. Armonk, NY. 16-18, 52-53.

Ronquist, F. and Huelsenbeck, J. P. (2001). MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754-755.

Ronquist, F. and Huelsenbeck, J. P. (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572-1574.

Sambrook, J. and Russell, D.W., (2001) Molecular Cloning: A Laboratory Manual. Third Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Schooley, T. (2006) New developer steps up for Deer Creek Crossing – again. Pittsburgh Business Times http://pittsburgh .bizjournals.com/Pittsburgh/stories/2006/10/16/story3.html. October 13, 2006.

Schooley, T. (2007) Kimco buys into North Hills, takes control of Cranberry Commons. Pittsburgh Business Times http://pittsburgh .bizjournals.com/Pittsburgh/stories/2007/05/21/story4.html. May 18, 2007.

Seehausen, O., van Alpen, J.J. M., and Witte, F. (1997) Cichlid fish diversity threatened by eutrophication that curbs sexual selection. Science 277: 1808-1811

Sloss, B.L., Billington, N., and Burr, B.M. (2004) A molecular phylogeny of the Percidae (Teleostei, Perciformes) based on mitochondrial DNA sequence. Molecular phylogenetics and Evolution 32: 545-562.

Song, C.B., Near, T.J. and Page, L.M. Phylogenetic Relations among Percid Fishes as Inferred from Mitochondrial Cytochrome b DNA Sequence Data. Molecular phylogenetics and Evolution 10: 343-353

Stauffer, J.R., Jr., Boltz, J.M. and White, L.R. (1995) Fishes of West Virginia. Academy of Natural Sciences of Philadelphia. Philadelphia.

100 Stauffer, J.R.,Jr., and van Snik, E.S. (1997) New Species of Etheostoma (Teleostei: Percidae) from the Upper Tennessee River. Copeia 1997: 116-122.

Stiles R.A. (1972) The comparative ecology of three species of Notonotus(Percidae- Etheostoma) in Tennessee‘s Little River, Unpublished Ph.D.diss. University of Tennessee, Knoxville.

Storey, C. M. (2003). Genetic population structure and life history aspects of the federally threatened Cherokee darter, Etheostoma scotti. Masters Thesis, University of Georgia, Athens, GA. 96 pp.

Swofford, D. L. 2000. PAUP*. Phylogenetic Analysis Using Parsimony (*and OtherMethods). Version 4. Sinauer Associates, Sunderland, Massachusetts.

Tarr, J.A. and Yosie, T.F. (2003) Critical Decisions in Pittsburgh Water and Wastewater Treatment. Devastation and Renewal: An Environmental History of Pittsburgh and its Region. Ed. J.A.Tarr. University of Pittsburgh Press. Pittsburgh, PA. 64- 88.

Train Crash: One year later. (2007) Front page, Endeavor News.com http://www.endeavornews.com /news/2007/0630/Front_Page/001.html. June 30, 2007.

Trautman, M. B. (1957) The Fishes of Ohio. Ohio State Univ. Press, Columbus, OH. 581- 589.

Trautman, M. B. (1981) The Fishes of Ohio. Ohio State Univ. Press, Columbus, OH. 668- 679.

U.S. Corps of Engineers, Pittsburgh District 2007. website: http://www.lrp.usace.army.mil/nav/nav.htm

Walford, L.A. and Mosher, K.H. (1943) Studies of the Pacific pilchard or sardine (Sardinops caerulea) No. 3. Determination of age of adults by scales, and effect of environment in first year‘s growth as it bears on age determination. US. Fish and Wildlife Service Spec. Sci. Report No. 21: 29.

Warren, M.L.Jr., Burr, B.M. and Kuhajda, B.R. (1986) Aspects of the reproductive biology of Etheostoma tippecanoe with comments on egg-burying behavior. Amer. Midland Naturalist 116(1): 215-218.

Western Pennsylvania Conservancy (1994) Allegheny County Natural Heritage Inventory. 3.

Winn, H.E. (1958) Observations on the Reproductive Habits of Darters (Pisces-Percidae). Amer. Midland Naturalist 59: 190-212

101

Wood, R. M. (1996). Phylogenetic systematics of the darter subgenus Nothonotus (Teleostei: Percidae). Copeia 2:300-318.

Zorach, T. (1968) Etheostoma bellum, a new darter of the subgenus Nothonotus from the Green River system, Kentucky and Tennessee. Copeia 1968(3):474-482.

Zorach, T. (1969) Etheostoma jordani and E. tippecanoe, species of the subgenus Nothonotus (Pisces: Percidae). American Midland Naturalist 81(2):412-434.

Zorach, T. (1972) Systematics of the percid fishes, Etheostoma camurum and E. chlorobranchium new species, with a discussion of the subgenus Nothonotus. Copeia 3: 427-447.

Zorach, T. and Raney, E.C. (1967) Systematics of the percid fish, Etheostoma maculatum Kirtland, and related species of the subgenus Nothonotus. American Midland Naturalist, 77(2): 296-322.

102

Appendix A: Laboratory Procedures and Recipes

I. Muscle Digestion and DNA Extraction

Cut sample from right side of fish, posterior to the vent on the caudal peduncle. Remove muscle from skin and blot ethanol Mince and put in 1.5mL eppendorf tube. Add 500uL ABI lysis buffer. Add 5uL Proteinase-K solution. Put in 55˚C heatblock overnight. DNA Extraction (work in hood): o Add 500uL P:C:I (25:24:1 mix). o Invert 5-7 times to mix. o Spin in hood centrifuge for 10min. o Transfer top layer to new labeled 1.5mL eppendorf tube (if interface is bad, repeat previous steps). o Add 500uL chloroform. o Invert 5-7 times to mix. o Spin in hood centrifuge for 2min. o Transfer top layer to new labeled 1.5mL eppendorf tube. o Add cold 100% ETOH to 1.5mL mark. o Mix by inverting a few times. o Spin in the refrigerated centrifuge at 4C, 1400rpm, for 20min. o Pour off supernatant (don‘t dislodge the pellet). o Add ~200uL cold 70% ETOH to rinse pellet, and pour off supernatant. o Invert tubes in a foam block with lids open on kimwipes to air dry overnight (or a couple days). o Reconstitute dried pellets with: 100uL HPLC water (if muscle), or 50uL HPLC water (if fin clip) and refrigerate. Dr. Porter recommends refrigerating muscle digested DNA and freezing finclip DNA.

II. Sequencing Protocol

1. PCR on extracted DNA: Spec extracted DNA sample using 5uL sample and 995uL DI water using Dr. Porter‘s spec. You want about 100ng per PCR reaction so divide 100 by your DNA concentration (i.e. If your DNA concentration = 50ng/uL: equation is 100/50=2, so you will use 2uL of sample + 10uL HPLC water to equal a total volume of 12uL if using 50uL reactions). Use 12uL (sample + water) + 38uL stock = 50uL. Stock Recipe for one rxn: i. 5.28uL 10x Promega Buffer ii. 8.8uL dNTPs (1.25mM each) iii. 5uL MgCl2 (25mM)

103 iv. 1.32uL forward primer (10pmol/uL) v. 1.32uL reverse primer (10pmol/uL) vi. 0.15uL Taq (5000units/mL) vii. 19.6uL HPLC water 41.47uL total V Thermocycler Program: (“PCR58EX”) Temperature control mode: Calculated Lid control mode: Constant at 100˚C o 93˚C for 2 min hot start o 93˚C for 45 sec o 58˚C for 1 min o 72˚C for 2 min o 44 cycles o 72˚C for 10 min o 15˚C for infinity 2. Electrophoresis Gel to Check PCR: o Use 6uL PCR product + 2uL Blue Dye o Use 6uL DNA ladder o Run at 300volts, 260mamps, for 18 minutes with volts selected as default 3. Column Clean Successful PCR Samples: o Put a column in a collection tube and add 800uL Sephadex G-50 solution to column. o Spin in refrigerated centrifuge at 25C, 3000rpm, for 3 minutes (keeping ―nubs‖ to outside). o Dab bottoms of columns with kimwipe (to dry any extra water off) and put column into a labeled 1.5mL eppendorf tube. o Add your entire PCR sample to center of Sephadex. o Spin again at 25˚C, 3000rpm, for 2 minutes (keeping ―nubs‖ to outside). o Save eppendorf with clean sample to spec (wash columns and collection tubes with DI water and air dry). 4. Spec Cleaned PCR: o Use 5uL of clean PCR + 995uL DI water on Cary 1E UV-Visible spec. o Figure out 40-100ng DNA per reaction; or make a 5ng/uL dilution: divide 500 by your DNA concentration (i.e. If your DNA concentration = 242ng/uL, then equation is 500/242=2uL, so add 2uL of your clean PCR sample to 98uL HPLC water to make a tV of 100uL). Big Dye Sequencing Recipe for one 50ng Reaction for ABI Sequencer: o 2uL Big Dye (the pink stuff) o 6uL 2.5X Sequencing Buffer o 2uL primer (10pmol/uL) o 10uL sample (at 5ng/uL dilution); or use 40-100ng DNA/rxn+HPLC water to = 10uL

104 20uL tV 5. Run in Thermocycler for Cycle Sequencing Program“BIGDY75”: o Incubate at 95˚C for 1 min (ramp 1.0C/sec) o Incubate at 95˚C for 30 sec (ramp 1.0C/sec) o Incubate at 50˚C for 5 sec (ramp 1.0C/sec) o Incubate at 60˚C for 4 min (ramp 1.0C/sec) o Cycle 74 more times o Incubate at 10˚C forever. 6. Column Clean Cycle Sequenced Samples: o Put a column in a collection tube and add 800uL Sephadex G-50 solution to column. o Spin in refrigerated centrifuge at 25˚C, 3000rpm, for 3 minutes. o Dab bottoms of columns with kimwipe (to dry any extra water off) and put column into a labeled 1.5mL eppendorf tube. o Add your entire cycle sequenced sample to center of Sephadex. o Spin again at 25˚C, 3000rpm, for 2 minutes. o Save eppendorf with clean sample to speed vac, or dry in thermocycler (wash columns and collection tubes with DI water and air dry). 7. Speed Vac and Reconstitute Clean Cycle Sequenced Samples: o Put samples (with lids open) into Speed vac on medium heat for about 30 minutes or until dry; or just add your samples to 96 well plate and dry in thermocycler using ―DrySeq‖ program (takes about 16 minutes). Thermocycler program ―DrySeq‖ Temperature Control Mode: Calculated Lid Control Mode: Off 1. Incubate at 95˚C for 16 minutes 2. Incubate at 15˚C forever

o Bring dry samples up with 10uL DI Formamide. o Get ready for ABI right away or freeze for later use. 8. Prepare for ABI Genetic Analyzer: o Add samples to empty wells on 96 well plate (note where you put them)—if drying in SpeedVac; otherwise they will already be in 96 well plate if using thermocycler drying method. o Put plate in thermocycler and run with Denaturing program (denature for 2 min at 95˚C). o Immediately put the plate on ice (to keep DNA from annealing). o Go up to 4th floor to set up on ABI. ABI Genetic Analyzer: o Make a new plate record: settings are— Sample name (enter your sample IDs) Dye set (―Z‖) Mobility file (―DT3100POP4(BDv3)v1.mob‖) Comment (leave blank)

105 Project name (―3100-Avant Project1‖) Run module 1 (―ultraseq36 POP4DefaultModule‖) Analysis module 1 (―BC-3100APOP4UR SeqOffFtOff.saz‖) o Load your 96 well plate on the machine and link it to the plate record and hit the green arrow to run. Each run of 4 samples takes 45 minutes to run. If you have less than 4 samples use blanks of 10uL DI Formamide to make the total of 4.

III. Recipes

ABI Lysis Buffer o 60.06g Urea o .866g CDTA o 1.25g n-laurylsarcosine o 10mL 5M NaCl o 25mL 1M Tris o HPLC H2O to total volume of 250mL Sephadex: o Measure out 2g of Sephadex G-50 and put in a 50mL conical tube. o Add 32mLs HPLC water. o Put on rocker for 30 minutes, or vortex at 5 min. intervals for about 15 minutes. o Refrigerate. o Good for 14 days then discard. 10X TBE: o Tris 108g. o Boric Acid 55g. o EDTA 7.4g. o Bring up with DI water to 1L. “Blue Juice” Blue Loading Dye o 40 mL 0.2M EDTA o 80mL glycerol o 8mL 1% bromophenol blue (1g/100mL) 2% SB Agarose gel o 6 g Agarose o 300mL SB buffer o 20mL EtBr

106 Appendix B: ND2 Sequences Table 11. E. camurum and E. chlorobranchium ND2 alignment using E. camurum individual 14WR from the East Fork of the White River, IN as a reference. Alignment was created in EESES and corrected by eye. Dots represent bases shared with the reference sequence. The number of the last base on each line is indicated in parenthesis. (48) 14WR ATG AAC CCC TAC ATC TTA GCC GCC CTA CTT TTT GGC CTA GGC CTA GGT C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... T ...... TMCHB1 ...... T ...... TMCHB2 ...... T ......

107 (96) 14WR ACG ACA ATT ACC TTC GCG AGC TCG CAT TGG CTC CTC GCC TGA ATA GGA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... G.. ... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ..C ...... TMCHB1 ..C ...... TMCHB2 ..C ......

108

(144) 14WR CTT GAA ATA AAT ACT CTA GCT ATC ATT CCC CTA ATA GCA CAA CAT CAC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ...... G ...... TMCHB1 ...... G ...... G...... G ...... TMCHB2 ...... G ...... G ......

109 (192) 14WR CAC CCC CGA GCG GTA GAA GCC ACC ACT AAA TAC TTC CTC ACC CAG GCA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... A ... C272 ...... A ... C276 ...... C277 ...... C282 ...... C283 ...... A ... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... T ...... TMCHB1 ...... T ...... TMCHB2 ...... T ......

110

(240) 14WR ACC GCG GCA GCT ATG CTC CTT TTC GCC AGC ACC ACT AAT GCA TGA CTG C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... A ...... T ...... G...... A TMCHB1 ...... A ...... T ...... G...... A TMCHB2 ...... A ...... T ...... G...... A

111 (288) 14WR ACC GGA CAG TGA GAC ATC CAA CAG ATG ACC CAC CCC CTC CCC ATT ACC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... A ...... TMCHB1 ...... A ...... TMCHB2 ...... A ......

112 (336) 14WR CTA ATT ACC CTC GCG CTA GCA CTA AAG ATT GGC CTT GCA CCT GTT CAC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... T ...... TMCHB1 ...... T ...... TMCHB2 ...... T ......

113 (384) 14WR TCA TGA CTG CCC GAG GTT CTC CAA GGA CTA GAC CTT ACT ACC GGG CTC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... A ..T C272 ...... A ..T C276 ...... C277 ...... C282 ...... C283 ...... T C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... TMCHB1 ...... TMCHB2 ......

114 (432) 14WR ATC CTC TCC ACC TGA CAA AAA CTG GCC CCC TTT GCC CTC CTC CTA CAA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... G...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ... TMCHB1 ...... G ... TMCHB2 ...... G ...

115 (480) 14WR GTT CAG CCT GCC AAC TCA ACC ATC TTA ATT GCT TTC GGT GTA GCA TCA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... A.. ... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 A...... TMCHB1 A...... TMCHB2 A...... G

116 (528) 14WR ACG CTT GTG GGA GGC TGA GGC GGG CTA AAT CAG ACC CAG CTT CGT AAA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... A ..G ...... A ... ..A ...... TMCHB1 ...... A ..G ...... A ... ..A ...... TMCHB2 ...... A ..G ...... A ... ..A ......

117

14WR ATT CTC GCC TAC TCA TCC ATC GCC CAT CTT GGC TGG ATA ATT CTT GTT(576) C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ...... TMCHB1 ...... G ...... TMCHB2 ......

118 (624) 14WR TTA CAA TTT TCA CCC TCC CTC ACA CTC CTC ACC CTC CTG ACA TAT TTT C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ...... TMCHB1 ...... G ...... TMCHB2 ...... G ......

119 (672) 14WR GTA ATG ACA ATC TCA ACA TTC CTT GTA TTT AAG CTC AAT AAA TCA ACC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ...... G ...... G ... TMCHB1 ...... G ...... G ...... G ... TMCHB2 ...... G ...... G ...... G ...

120 (720) 14WR ACT CTC AAC ATG CTC GCC ACC TCC TGA GCC AAA GCG CCC GCT TTG ACA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... T ...... A ...... A ... TMCHB1 ...... T ...... A ...... A ... TMCHB2 ...... T ...... A ...... A ...

121 (768) 14WR GCC CTC ACC CCC CTC ATT CTG CTG TCC CTA GGA GGC CTC CCC CCA CTA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... A ... G...... TMCHB1 ...... A ... G...... TMCHB2 ...... A ... G......

122 (816) 14WR ACC GGC TTT ATG CCC AAA TGA CTT ATT CTA CAA GAA TTA ACC AAA CAG C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... TMCHB1 ...... TMCHB2 ......

123 (864) 14WR GAT CTT GCT CCG ACA GCA ACC CTA GCC GCC ATA TCA GCC CTT CTC AGC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... G ...... C272 ...... G ...... C276 ...... C277 ...... C282 ...... C283 ...... G ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... A ... ..G ... ..G ...... TMCHB1 ...... A ... ..G ... ..G ...... TMCHB2 ...... A ... ..G ... ..G ......

124 (912) 14WR CTT TAC TTT TAC TTG CGG CTT TCC TAT GCA ATG GCC CTA ACC ATC TCC C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... A ... ..G ...... C272 ...... A ... ..G ...... C276 ...... C277 ...... C282 ...... G ...... C283 ...... A ... ..G ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... T ...... A ... ..C ...... TMCHB1 ...... T ...... A ... ..C ...... TMCHB2 ...... T ...... A ... ..C ......

125 (960) 14WR CCG AAT AAC TTA ACA GGC ACC ACC CCC TGA CGG CTG CAA CAC TCA CAA C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... ? ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ..A ...... C272 ..A ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... TMCHB1 ...... TMCHB2 ......

126 (1008) 14WR TTT ACA TTA CCC CTA GCC CTC GCA ACC ACT GCC ACC CTC CTT CTG CTT C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... C2SL ...... C31 ...... T...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... G ...... A...... T ... ..A ...... TMCHB1 ...... G ...... A...... T ... ..A ...... TMCHB2 ...... G ...... A...... T ... ..A ......

127

14WR CCG CTT ACG CCC GCA GTT GTG GCA CTG CTC GCT CTT TAA(1047) C1 ...... C10 ...... C115 ...... C12 ...... C138 ...... C15K ...... C16 ...... C17 ...... C18 ...... C189 ...... C190 ...... C1SL ...... C22 ...... C223 ...... C224 ...... C23 ...... C23E ...... C25 ...... C26 ...... C271 ...... C272 ...... C276 ...... C277 ...... C282 ...... C283 ...... A...... C2SL ...... C31 ...... C32 ...... C3A9 ...... C4KO ...... C5 ...... C6S ...... C75 ...... C8S ...... CAM1A ...... CAM4A ...... CM1 ...... CM1P ...... CM20 ...... CM25 ...... CM29 ...... CB5 ...... C ...... T...... TMCHB1 ...... C ...... T...... TMCHB2 ...... C ...... T......

128

Table 12. E. maculatum ND2 alignment using individual M1 from the East Fork of the White River, IN as a reference. Alignment was created in EESES and corrected by eye. Dots represent bases shared with the reference sequence. The number of the last base on each line is indicated in parenthesis. (48) M1 ATG AAC CCC TAC ATC TTA GCC GCC CTA CTT TTT GGC CTA GGC CTA GGT M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(96) M1 ACC ACA ATT ACC TTC GCG AGC TCG CAT TGG CTC CTC GCC TGA ATG GGA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

129 (144) M1 CTT GAA ATA AAT ACT CTA GCT ATT ATT CCC CTA ATG GCA CAG CAC CAC M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(192) M1 CAC CCC CGA GCG GTA GAG GCC ACC ACT AAA TAT TTC CTC ACC CAG GCA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

130 (240) M1 ACC GCG GCA GCT ATA CTC CTT TTT GCC AGC ACC ACC AAT GCA TGA CTG M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(288) M1 ACC GGA CAG TGA GAC ATC CAA CAA ATG ACC CAC CCC CTA CCC ATT ACC M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

131 (336) M1 CTG ATC ACT CTC GCG TTG GCA CTA AAA ATT GGC CTT GCA CCT GTT CAC M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(384) M1 TCA TGA CTA CCC GAG GTC CTC CAA GGA CTA GAC CTT ACT ACC GGG CTT M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

132 (432) M1 ATC CTC TCC ACC TGA CAA AAA CTG GCC CCC TTT GCC CTC CTT CTG CAA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(480) M1 ATT CAA CCT GCC AAC TCA ACT ATC TTA ATT GCT TTT GGT GTA GCA TCA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

133 (528) M1 ACG CTT GTA GGA GGC TGA GGC GGG CTA AAT CAA ACC CAA CTT CGT AAG M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(576) M1 ATT CTT GCC TAT TCA TCC ATC GCC CAT CTT GGC TGA ATA ATT CTT GTT M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

134 (624) M1 TTA CAA TTT TCG CCG TCC CTC ACA CTG CTT ACC CTC CTA ACG TAT TTT M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(672) M1 GTG ATG ACA ATC TCA ACA TTC CTT GTA TTT AAG CTC AGT AAG TCG ACC M10 ...... M100 ...... M101 ...... M119 ...... C...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

135 (720) M1 ACG CTC AAT ATA CTC GCC ACC TCC TGG GCC AAG GCA CCC GCT TTG ACA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(768) M1 GCC CTG ACC CCA CTG ATT TTG CTG TCC CTA GGA GGC CTC CCC CCA CTA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

136 (816) M1 ACC GGA TTT ATG CCC AAG TGA CTT ATT CTA CAA GAA TTA ACC AAG CAG M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(864) M1 GAT CTT GCT CCG ACA GCG ACC CTG GCC GCC ATA TCA GCC CTC CTC AGT M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

137 (912) M1 CTT TAC TTT TAT TTG CGG CTT TCC TAT GCA ATA GCC CTG ACC ATC TCC M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

(960) M1 CCT AAT AAC TTA ACA GGT ACC ACC CCC TGG CGG CTG CAA CAT TCA CAA M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

138 (1008) M1 TTT ACA TTG CCC CTG GCC CTC GCG ACC ACT GCC ACC CTC CTT CTG CTT M10 ...... C ...... M100 ...... C ...... M101 ...... C ...... M119 ...... C ...... M125 ...... C ...... M127 ...... C ...... M14 ...... C ...... M2 ...... C ...... M3 ...... C ...... M4 ...... M48 ...... C ...... M49 ...... C ...... M6 ...... C ...... M8 ...... C ...... M89 ...... C ...... MC00 ...... C ...... MC1 ...... C ...... MAC4 ...... C ...... MAC5 ...... C ......

M1 CCG CTT ACG CCC GCA GTT GTG GCA CTC CTC ACT CTT TAA(1047) M10 ...... M100 ...... M101 ...... M119 ...... M125 ...... M127 ...... M14 ...... M2 ...... M3 ...... M4 ...... M48 ...... M49 ...... M6 ...... M8 ...... M89 ...... MC00 ...... MC1 ...... MAC4 ...... MAC5 ......

139 Table 13. E. tippecanoe and E. denoncourti ND2 alignment using individual E29E from the Elk River at Ivydale, Clay Co., WV as a reference. Alignment was created in EESES and corrected by eye. Dots represent bases shared with the reference sequence. The number of the last base on each line is indicated in parenthesis.

(48) E29E ATG AAC CCG TAT ATT TTA GCC GCC CTA CTC TTT GGT CTA GGC CTA GGC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... C...... ET21 ...... C...... C.. ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... C...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... C ... ..C ...... C ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... D3 ...... D4 ...... TIP1DR ...... TIP2DR ......

140 (96) E29E ACA ACA ATT ACC TTC GCC AGC TCG CAC TGG CTC CTC GCC TGA ATG GGA E2E ..G ...... E8K ..G ...... ET102 ..G ...... ET11 ..G ...... ET12 ..G ...... A ...... ET15 ..G ...... ET16 ..G ...... ET17 ..G ...... A ...... ET18 ..G ...... A ...... ET19 ..G ...... A ...... ET20 ..G ...... A ...... ET21 ..G ...... ET217 ..G ...... A ...... ET22 ..G ...... ET23 ..G ...... A ...... ET25 ..G ...... A ...... ET26 ..G ...... ET29 ..G ...... A ...... ET304 ..G ...... ET307 ..G ...... ET309 ..G ...... A ...... ET310 ..G ...... A ...... ET311 ..G ...... A ...... ET319 ..G ...... A ...... ET320 ..G ...... A ...... ET7 ..G ...... A ...... ETI1 ..G ...... A ...... T ...... ETI2 ..G ...... H27J1 ..C ...... G ... ..A ..T ...... TIP17 ..G ...... A ...... TIP1B ..G ... .C...... A ...... TIP1F ..G ...... A ...... TIP1M ..G ...... A ...... TIP2 ..G ...... A ...... TIP21 ..G ...... A ...... TIP2B ..G ...... A ...... TIP2M ..G ...... A ...... TIP37 ..G ...... A ...... TIP4F ..G ...... A ...... TIP6 ..G ...... A ...... D1 ..G ...... A ...... A ...... D3 ..G ...... A ...... A ...... D4 ..G ...... A ...... A ...... TIP1DR ..G ...... A ...... A ...... TIP2DR ..G ...... A ...... A ......

141 (144) E29E TTA GAA ATG AAT ACT CTG GCC ATC ATC CCC CTG ATA GCA CAA CAC CAT E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... G ...... ET15 ...... ET16 ...... ET17 ...... G ...... ET18 ...... G ...... ET19 ...... G ...... ET20 ...... G ...... ET21 ...... ET217 ...... G ...... ET22 ...... ET23 ...... G ...... ET25 ...... G ...... ET26 ...... ET29 ...... G T.. ... ET304 ...... ET307 ...... ET309 ...... G ...... ET310 ...... G ...... ET311 ...... T ...... G ...... ET319 ...... ET320 ...... ET7 ...... G ...... ETI1 ...... G ...... ETI2 ...... H27J1 C.T ... ..A ...... A ... ..T ...... T ..G ... ..G ...... TIP17 ...... TIP1B ...... TIP1F ...... G ...... TIP1M ...... G ...... TIP2 ...... G ...... TIP21 ...... G ...... TIP2B ...... TIP2M ...... G ...... TIP37 ...... G ...... TIP4F ...... TIP6 ...... G ...... D1 ...... T ...... D3 ...... T ...... D4 ...... T ...... TIP1DR ...... T ...... TIP2DR ...... T ......

142 (192) E29E CAT CCC CGG GCA GTA GAA GCA ACC ACC AAG TAT TTT CTT ACC CAA GCA E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... G ... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..C ... ..A ..G ... ..G ..C ...... C ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ...... D3 ...... A ...... D4 ...... A ...... TIP1DR ...... A ...... TIP2DR ...... A ......

143 (240) E29E ACC GCA GCA GCC ATA CTT CTT TTT GCC AGT ACC ACT AAC GCA TGG CTG E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ... ..G ...... C ..C ...... C ... ..C ...... A T.. TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... T ... ..C ...... C ...... D3 ...... T ... ..C ...... C ...... D4 ...... T ... ..C ...... C ...... TIP1DR ...... T ... ..C ...... C ...... TIP2DR ...... T ... ..C ...... C ......

144 (288) E29E ACA GGA CAG TGA GAT ATC CAA CAG ATG ACC CAC CCC CTC CCC ATC ACC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... C ...... ET15 ...... ET16 ...... ET17 ...... C ...... ET18 ...... C ...... ET19 ...... C ...... ET20 ...... C ...... ET21 ...... ET217 ...... C ...... ET22 ...... ET23 ...... C ...... ET25 ...... C ...... ET26 ...... ET29 ...... C ...... ET304 ...... ET307 ...... ET309 ...... C ...... ET310 ...... C ...... ET311 ...... C ...... ET319 ...... C ...... ET320 ...... C ...... ET7 ...... C ...... ETI1 ...... C ...... ETI2 ...... H27J1 ... ..G ... ..G ..C ...... A G.. ..T ...... G.T TIP17 ... ..G ...... C ...... TIP1B ...... C ...... TIP1F ...... C ...... TIP1M ...... C ...... TIP2 ...... C ...... TIP21 ...... C ...... TIP2B ...... C ...... TIP2M ...... C ...... TIP37 ...... C ...... TIP4F ... ..G ...... C ...... TIP6 ...... C ...... D1 ...... C ...... A ...... A...... T ...... D3 ...... C ...... A ...... A...... T ...... D4 ...... C ...... A ...... A...... T ...... TIP1DR ...... C G...... A ...... A...... T ...... TIP2DR ...... C G...... A ...... A...... T ......

145 (336) E29E CTT ATT ACG CTT GCC TTA GCC CTA AAA ATT GGT CTT GCG CCT GTT CAC E2E ...... C ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... A ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..C ... ..C ..C ...... A ...... C ... ..A ...... T TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... A ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 A.A ..C ..A A...... C.. ... D3 A.A ..C ..A A...... C.. ... D4 A.A ..C ..A A...... C.. ... TIP1DR A.A ..C ..A A...... C.. ... TIP2DR A.A ..C ..A A...... C.. ...

146 (384) E29E TCG TGA CTA CCC GAG GTT CTC CAG GGA CTA GAT CTT ACG ACC GGA CTT E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..A ...... C ... ..A ...... C ... ..T ... ..G ... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ..A ... ..G ...... G ...... D3 ..A ... ..G ...... G ...... D4 ..A ... ..G ...... G ...... TIP1DR ..A ...... G ...... TIP2DR ..A ...... G ......

147 (432) E29E ATC CTC TCC ACC TGA CAA AAG CTT GCC CCC TTT GCC CTC CTA CTA CAA E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 G...... T ...... ET320 G...... T ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... G ...... C ... ..T ... ..T ...... TIP17 G...... TIP1B G...... T ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B G...... T ...... TIP2M ...... TIP37 ...... TIP4F G...... TIP6 ...... D1 ...... D3 ...... D4 ...... TIP1DR ...... TIP2DR ......

148 (480) E29E ATT CAA CCT ACC AAC TCA CCT ATC TTA ATT GCC TTT GGC GTA GCA TCA E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... T ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... G.G ...... G.. ..A C...... T ... ..A ... A.. ..C TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... G ...... TIP6 ...... D1 ... ..G ...... A...... G ...... AT. ... D3 ... ..G ...... A...... G ...... AT. ... D4 ... ..G ...... A...... G ...... AT. ... TIP1DR ...... A...... G ...... AT. ... TIP2DR ...... A...... G ...... AT. ...

149 (528) E29E ACT CTT GTA GGA GGC TGG GGC GGG TTA AAT CAA ACC CAA CTT CGT AAG E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... G ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... G ...... A ...... G ...... TIP17 ...... TIP1B ...... TIP1F ...... A...... TIP1M ...... A...... TIP2 ...... A...... TIP21 ...... TIP2B ...... TIP2M ...... A...... TIP37 ...... TIP4F ...... TIP6 ...... A...... D1 ...... A ... ..A ...... D3 ...... A ... ..A ...... D4 ...... A ... ..A ...... TIP1DR ...... A ... ..A ...... TIP2DR ...... A ... ..A ......

150 (576) E29E ATC CTT GCA TAC TCG TCC ATC GCC CAC CTT GGC TGG ATG ATT CTT GTC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ... ..C ..C ... ..A ... ..T ...... AA G.. ..G ..T TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... A ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 G...... T ..A ...... A ..A ...... D3 G...... T ..A ...... A ..A ...... D4 G...... T ..A ...... A ..A ...... TIP1DR G...... T ..A ...... A ..A ...... TIP2DR G...... T ..A ...... A ..A ......

151 (624) E29E TTA CAA TTT TCG CCC TCC CTC ACA TTT CTT ACC CTC CTC ACA TAT TTT E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... A G...... G C.C ..C ...... A ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ...... C ... D3 ...... A ...... C ... D4 ...... A ...... C ... TIP1DR ...... A ...... C ... TIP2DR ...... A ...... C ...

152 (672) E29E GTG ATA ACG ATC TCA ACA TTT CTT CTA TTT AAG CTC AGC AAA TCT ACC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..A ..G ..A ..A ...... C ... G...... A ... .A...... C ..T TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ...... G ... ..A A...... G D3 ...... A ...... G ... ..A A...... G D4 ...... A ...... G ... ..A A...... G TIP1DR ...... A ...... G ... ..A A...... G TIP2DR ...... A ...... G ... ..A A...... G

153 (720) E29E ACT ATT AAT ATG CTA GCC ACC TCG TGA GCC AAA GCA CCC GCT TTA ACG E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..C G.C ... ..A ..C ..G ..T ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ... ..C ...... G ... D3 ... ..C ...... G ... D4 ... ..C ...... G ... TIP1DR ... ..C ...... G ... TIP2DR ... ..C ...... G ...

154 (768) E29E GCC CTC ACC CCC CTT GTT CTT CTG TCC CTA GGA GGC CTT CCC CCA CTA E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... T ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ... ..T G.. ..A ... A...... G ...... A ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ...... C ...... A ...... D3 ...... A ...... C ...... A ...... D4 ...... A ...... C ...... A ...... TIP1DR ...... A ...... C ...... A ...... TIP2DR ...... A ...... C ...... A ......

155 (816) E29E ACT GGT TTT ATG CCA AAA TGG CTT ATT CTT CAA GAA TTA ACT AAG CAG E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... A ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ..G ... ..C ...... C ...... C ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ... ..G ...... D3 ...... A ... ..G ...... D4 ...... A ... ..G ...... TIP1DR ...... A ... ..G ...... TIP2DR ...... A ... ..G ......

156 (864) E29E GAT CTT GCT CCT ACA GCA ACT CTA GCC GCG ATA TCA GCC CTC CTA AGC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... G.A ...... C ..G ...... G.. ..G ...... T ... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... C ...... G ...... T ...... D3 ...... C ...... G ...... T ...... D4 ...... C ...... G ...... T ...... TIP1DR ...... G ...... T ...... TIP2DR ...... G ...... T ......

157 (912) E29E CTT TAC TTT TAT TTA CGA CTC TCC TAT GCA ATA GCC CTC ACC ATG TCC E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... T...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ...... C ...... T ...... G ... ..T ..T ..A ... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... A ... D3 ...... A ... D4 ...... A ... TIP1DR ...... A ... TIP2DR ...... A ...

158 (960) E29E CCT AAC AAC CTA ACA GGT ACT ACC CCC TGA CGC CTG CAA CAA TCG CAT E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... G ET15 ...... ET16 ...... ET17 ...... G ET18 ...... G ET19 ...... G ET20 ...... G ET21 ...... ET217 ...... G ET22 ...... ET23 ...... G ET25 ...... G ET26 ...... ET29 ...... G ET304 ...... ET307 ...... ET309 ...... G ET310 ...... G ET311 ...... G ET319 ...... G ET320 ...... G ET7 ...... G ETI1 ...... G ETI2 ...... H27J1 ..C ... ..T ... ..G ..G G.C ..G ...... A ..A ..G ..T ..A ..G TIP17 ...... G TIP1B ...... G TIP1F ...... G TIP1M ...... G TIP2 ...... G TIP21 ...... G TIP2B ...... G TIP2M ...... G TIP37 ...... G TIP4F ...... G TIP6 ...... G D1 ... ..T ...... G...... A D3 ... ..T ...... G...... A D4 ... ..T ...... G...... A TIP1DR ... ..T ...... G...... A TIP2DR ... ..T ...... G...... A

159 (1008) E29E TTT ACA TTA CCC CTA GCC CTT ACA ACC ACT ACC ACC CTT CTG CTG CTT E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 CCC ...... G ... ..G ...... G...... A ... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... A.. TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ...... C ..G ... ..C G...... A ... D3 ...... C ...... C G.. ... T...... A ... D4 ...... C ...... C G...... A ... TIP1DR ...... C ..G ... ..C G...... A ... TIP2DR ...... C ..G ... ..C G...... A ...

160

E29E CCA CTC ACA CCC GCA GTA GTG GCA CTA CTC ACT CTT TAA(1047) E2E ...... E8K ...... ET102 ...... ET11 ...... ET12 ...... ET15 ...... ET16 ...... ET17 ...... ET18 ...... ET19 ...... ET20 ...... ET21 ...... ET217 ...... ET22 ...... ET23 ...... ET25 ...... ET26 ...... ET29 ...... ET304 ...... ET307 ...... ET309 ...... ET310 ...... ET311 ...... ET319 ...... ET320 ...... ET7 ...... ETI1 ...... ETI2 ...... H27J1 ... ..T .TG ...... C. ..A ...... A .GC ...... TIP17 ...... TIP1B ...... TIP1F ...... TIP1M ...... TIP2 ...... TIP21 ...... TIP2B ...... TIP2M ...... TIP37 ...... TIP4F ...... TIP6 ...... D1 ... ..T ...... A ... T.. ... G...... D3 ... ..T ...... A ... T.. ... G...... D4 ... ..T ...... A ... T.. ... G...... TIP1DR ...... TA. ... T.. ... G...... TIP2DR ...... TA. ... T.. ... G......

161

Table 14. E. virgatum ND2 sequence from GenBank Accession #AF412552 (Page et al. 2003). This individual was used as an out group. The number of the last base on each line is indicated in parenthesis.

ATGAACCCGTATATCTTAGCCACCCTTCTTTTTGGCTTGGGCCTAGGCACTACAGTTACG(60) TTTGCCAGTTCACACTGGCTGCTCGCCTGAATAGGCCTTGAAATGAACACTCTGGCCATC(120) ATTCCATTAATAGCACAACACCACCACCCCCGAGCGGTGGAGGCCACCACTAAATATTTC(180) TTAACTCAGGCTACTGCGGCCGCCATGCTTCTTTTTGCCAGTACCACTAATGCCTGACTA(240) ACAGGACAATGAGATATTCAACAAATAACACACCCCCTTCCCATTACCCTAATTACCCTG(300) GCTTTAGCACTAAAAATTGGCCTTGCCCCTGTACACTCCTGACTTCCTGAGGTTCTCCAA(360) GGACTAGATCTTACCACCGGACTAATCCTCTCCACCTGACAAAAACTCGCCCCTTTTGCA(420) CTCCTTCTTCAAATTCAACCTGCTAATTCAATGATTCTGGTCGCTTTTGGCCTAGCATCC(480) ACACTTATCGGAGGCTGGGGCGGTCTGAATCAGACCCAGATTCGTAAAATTCTTGCTTAT(540) TCATCCATCGCCCACCTTGGCTGAATAATTATTGTGCTTCAATTCTCCCCCTCCCTAACA(600) CTTCTGACCCTACTAACATACTTTGTGATAACATTCTCATCATTCCTTGTATTTAAACTA(660) AATAACTCAACTAATATTAATATGCTTGCCACCTCCTGGGCTAAAGCACCTACCCTGACA(720) GCCCTCACCCCCCTGATTCTTCTCTCATTGGGGGGTCTCCCCCCACTCACTGGCTTTATA(780) CCCAAGTGGCTGGTACTCCAAGAGCTGGCCAAGCAAGATCTTGCCCCAACGGCGACCCTC(840) GCCGCAATATCTGCCCTTCTAAGCCTCTACTTCTACCTTCGACTTTCCTATGCAATGGCC(900) CTCACTTTATCCCCTAACAACTTAGTAGGTATAACCCCCTGACGACTCCACCATTTGCAA(960) ACTACTCTCCCTTTGGCCATCGGAACTGCTGCTACTCTTTTGCTACTTCCACTAACTCCC(1020) ATAGCTGTAGCACTACTCACCCTCTAA(1047)

162 Appendix C: Code for Baysian Likelihood Trees

NEXUS 4.0 files were modified by deleting the heading information prior to the data set and replacing it with the following block:

#NEXUS [ Title dataset] begin data; dimensions ntax=14 nchar=1047; format missing=? gap=- matchchar=. datatype=dna interleave=yes; matrix

[!Domain=Data property=Coding CodonStart=1;]

Areas in bold face were modified based on the data set, with ‗ntax‘ being the number of taxa in the dataset. At the end of the NEXUS file, I added the following block, again modifying the bold faced items based on my data set:

begin mrbayes; log start file=dataset.bay.log replace; charset 1st_pos = 1-1047\3; charset 2nd_pos = 2-1047\3; charset 3rd_pos = 3-1047\3; partition by_codon = 3:1st_pos,2nd_pos,3rd_pos; set partition = by_codon; Lset nst=6 rates=equal; Prset statefreqpr=dirichlet (1,1,1,1); set autoclose = yes; mcmcp ngen=10000000 printfreq=1000 samplefreq=100 nruns=1 nchains=4 savebrlens=yes file= dataset.bay; mcmc; plot file=dataset.bay.p; outgroup 14; sumt file=dataset.bay burnin=10000 contype=allcompat; log stop; end;

In this block, ‗outgroup‘ identifies the location in the dataset of the individual representing the outgroup, which I usually placed last in the matrix. The command ‗ngen‘ indicates the number of generations to run the model. I generated strict consensus trees, as indicated by the command ‗allcompat‘. Four Markov Chain Monte Carlo chains were run simultaneously, as represented in the command ‗nchains.‘ My block is modified from an example in Hall (2004).

163 APPENDIX D. OBSERVATIONS ON FLORA AT DEER CREEK

Table 15. Observations on Flora at Deer Creek, Harmar Township, PA. Observations were made during the 2006 site surveys.

26-Apr-06 8-May-06 17-May-06 24-May-06 31-May-06 1-Jun-06 7-Jun-06 Box elder Japanese Blackberry Cottonwood Cottonwood Cottonwood Catalpa starting foliated and knotweed ~1.5m flowering seeding pods bursting pods bursting to bloom flowering tall Sycamore not Honey suckle Mulberry Japanese Maple-leaved foliated, buds flowering foliated knotweed 4.6m vibernum in full green on older bloom trees Apple tree Dame's rocket Garlic mustard Dogwood has Catalpa starting foliated and flowering stopped green fruitbuds to bud flowering flowering White trilium Box elder fully Japanese Maple-leaved Dame's rocket blooming foliated knotweed ~2.0m vibernum in full still flowering tall bloom Garlic mustard Silver maple Black locust foliated, ~0.3m fully foliated flowering high, flowering Black walnut not Cottonwood Box elder foliated, few foliated fruiting green buds Red bud Mustard blooming flowering Burdock foliated Stagehorn sumack foliated Buttercup flowering Wood sorral flowering

164

165

166

APPENDIX E. INDIVIDUALS SEQUENCED, SAMPLE LOCATIONS AND SOURCES

Table 16. E. camurum individuals sequenced. Table is sorted by location. Short ID Full ID Sample location Source * CAM1A BAP 1236 Allegheny R., Island complex Porter Lab & PA CAM1 300yds dst of Lock and Dam #3, DEP 1st riffle on back channel, island side, Harmarville, Allegheny Co., PA * CAM4A BAP 1236 Allegheny R., Island complex Porter Lab & PA CAM4 300yds dst of Lock and Dam #3, DEP 1st riffle on back channel, island side, Harmarville, Allegheny Co., PA * C3A9 BAP 1251 Allegheny R., Pool 9, upst River Dr. Brady Porter CAM3 left of Bald Eagle Island, Armstrong/Clarion Co., PA

* C10 BAP 1317 Big Darby C., SR 104, Town of Dr. Brady Porter, CAM 10 Fox, Pickaway Co., OH Dr. Beth Dakin, Laura Howell, Mike Komarnicki, Marc Kibbey * C75 BAP 1317 Big Darby C., SR 104, Town of Dr. Brady Porter, CAM21 Fox, Pickaway Co., OH Dr. Beth Dakin, Laura Howell, Mike Komarnicki, Marc Kibbey * C23 LAH 0048 Deer C., dst SR28 Bdg., Harmar Dr. Beth Dakin, CAM 3 Twp., Alleghehy Co., PA Laura Howell, Mike Komarnicki

C25 LAH 0048 Deer C., dst SR28 Bdg., Harmar Dr. Beth Dakin, CAM 5 Twp., Alleghehy Co., PA Laura Howell, Mike Komarnicki

* 14WR BEF08-06 East Fork of the White R., dst of Dr. Brant E. Fisher CAM14 Rt. 50 Bdg., Martin Co., Shoals, IN

167 Short ID Full ID Sample location Source * C1 BAP 1318 East Fork of the White R., dst of Dr. Brady Porter, CAM 1 Rt. 50 Bdg., Martin Co., Shoals, IN Dr. Beth Dakin, Laura Howell, Mike Komarnicki, Dr. Brandt Fisher * C115 BAP 1296 Elk R. @ Ivydale, Clay Co., WV Dr. Brady Porter, CAM2 Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C23E BAP 1296 Elk R. @ Ivydale, Clay Co., WV Dr. Brady Porter, CAM 23 Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C6S BAP 1297 Elk R. upst of Sutton Lake, Braxton Dr. Brady Porter, CAM 6 Co., WV Dr. Beth Dakin, Laura Howell, Mike Komarnicki C8S BAP 1297 Elk R. upst of Sutton Lake, Braxton Dr. Brady Porter, CAM 8 Co., WV Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C1SL BAP 1256 French C. @ 1st riffle upst of Porter Lab & PA CAM1 Shaw's Landing, Crawford, Co., PA DEP

* C2SL BAP 1256 French C. @ 1st riffle upst of Porter Lab & PA CAM2 Shaw's Landing, Crawford Co., PA DEP

* C189 BAP 1291 French C. @ Cochranton dst of Rt. Porter Lab: Dr. CAM1 173 Bdg., Crawford Co., PA Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C190 BAP 1291 French C. @ Cochranton dst of Rt. Porter Lab: Dr. CAM2 173 Bdg., Crawford Co., PA Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki

168 Short ID Full ID Sample location Source * CM20 BAP 1291 French C. @ Cochranton dst of Rt. Porter Lab: Dr. CAM 20 173 Bdg., Crawford Co., PA Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * CM25 BAP 1292 French C. @ Franklin dst of RT. Porter Lab: Dr. CAM 25 322 Bdg., Venango Co., PA Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * CM29 BAP 1292 French C. @ Franklin dst of RT. Porter Lab: Dr. CAM 29 322 Bdg., Venango Co., PA Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * CM1 BAP 1289 French C. vic Rt 97, Erie Co., PA Porter Lab: Dr. CAM 1 Brady Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C4KO BAP 1284 Kokosing R. upst of Pipesville Rd. Dr. Beth Dakin, Dr. CAM4 Bdg. , Knox Co., OH Brady Porter, Laura Howell, Dr. Ted Cavendar, Marc Kibbey * C223 BAP 1321 Kokosing R.@ RT. 715 dst of Zuck Dr. Brady Porter, CAM1 Rd. Intersection, Knox Co., OH Dr. Beth Dakin, Laura Howell, Mike Komarnicki, Marc Kibbey * C224 BAP 1321 Kokosing R.@ RT. 715 DST of Dr. Brady Porter, CAM2 Zuck Rd. Intersection, Knox Co., Dr. Beth Dakin, OH Laura Howell, Mike Komarnicki, Marc Kibbey * C138 BAP1295 Little Kanawha R. @ CR-1, Dr. Brady Porter, CAM3 Calhoun Co., WV Dr. Beth Dakin, Laura Howell, Mike Komarnicki * C15K BAP 1295 Little Kanawha R. @ CR-1, Dr. Brady Porter, CAM 15 Calhoun Co., WV Dr. Beth Dakin, Laura Howell, Mike Komarnicki

169 Short ID Full ID Sample location Source C271 JR Nash Ford, Clinch R., 300m upst of Jamie Roberts, NashFord sr645 Bdg., ~7km N of Lebanon, Virginia Tech CAM1 Russell Co., VA

C272 JR Nash Ford, Clinch R., 300m upst of Jamie Roberts, NashFord sr645 Bdg., ~7km N of Lebanon, Virginia Tech CAM2 Russell Co., VA

* C276 JR Nolichucky R. ~ 300m dst of sr340 Jamie Roberts, Nolichucky Bdg., ~6 km SW of Warrensburg, Virginia Tech Cam1 Greene Co., TN

* C277 JR Nolichucky R. ~ 300m dst of sr340 Jamie Roberts, Nolichucky bdg., ~6 km SW of Warrensburg, Virginia Tech Cam2 Greene Co., TN

C282 JR Saltville North Fork Holston R., at USGS Jamie Roberts, CAM2 gauging station, ~3 km NE of Virginia Tech Saltville, Smyth Co., VA

C283 JR Saltville North Fork Holston R., at USGS Jamie Roberts, CAM3 gauging station, ~3 km NE of Virginia Tech Saltville, Smyth Co., VA

* C26 BAP 1316 Oil C., 1st Riffle upst of Center St. Dr. Brady Porter, CAM2 Bdg. in Oil City, Venango Co., PA Dr. Beth Dakin, Laura Howell, Mike Komarnicki C31 BAP 1316 Oil C., 1st Riffle upst of Center St. Dr. Brady Porter, CAM 8 Bdg. in Oil City, Venango Co., PA Dr. Beth Dakin, Laura Howell, Mike Komarnicki C32 BAP 1316 Oil C., 1st Riffle upst of Center St. Dr. Brady Porter, CAM 9 Bdg. in Oil City, Venango Co., PA Dr. Beth Dakin, Laura Howell, Mike Komarnicki

170 Short ID Full ID Sample location Source * CM1P BAP 1293 Pine C. off Poplar Rd., upst of Dr. Brady Porter, CAM1 railroad bdg., vic. Etna, Alleghany Dr. Beth Dakin, Co., PA Laura Howell, Mike Komarnicki, Dr. Lisa Ludvico and Gen. Biology Class * C16 JF 072006 S. Fork Kentucky R., Rt 11 at J.Faber CAM1 Owsley Co./ Clay Co. Line, KY * C17 JF 072006 S. Fork Kentucky R., Rt 11 at J.Faber CAM2 Owsley Co./ Clay Co. Line, KY * C18 JF 072006 S. Fork Kentucky R., Rt 11 at J.Faber CAM3 Owsley Co./ Clay Co. Line, KY

* C22 JF 072006 S. Fork Kentucky R., Rt 11 at J.Faber CAM7 Owsley Co./ Clay Co. Line, KY

* C12 BAP 1319 Tippecanoe R. upst of Rt. 18 Bdg., Dr. Brady Porter, CAM 12 near Brookston,Carroll/White Co., Dr. Beth Dakin, IN Laura Howell, Mike Komarnicki, Dr. Brant Fisher * C5 BAP 1319 Tippecanoe R. upst of Rt. 18 Bdg., Dr. Brady Porter, CAM 5 near Brookston,Carroll/White Co., Dr. Beth Dakin, IN Laura Howell, Mike Komarnicki, Dr. Brant Fisher Note: *These individuals have identical sequences. C10 and C12 were used to represent them for developing phylogenetic trees.

171

Table 17. E. chlorobranchium individuals sequenced. Table is sorted by location Short ID Full ID Sample location Source CB5 NCSM 37906 Bush C., Swain Co., NC NC State Museum CHB1 of Natural Sciences TMCHB1 TM CHB1 Tuckaseegee R., Jackson Co, Tammy Mendelson NC TMCHB2 TM CHB2 Tuckaseegee R., Jackson Co, Tammy Mendelson NC

Table 18. E. denoncourti individuals sequenced. Table is sorted by location Short Full ID Sample location Source ID D1 YFTC Clinch R. at Grisson Island, Dr.Tom Near #2585 ED Claiborne Co., TN. TIP1DR Duck R., Bedford Co., TN Tammy Mendelson

TIP2DR Duck R., Bedford Co., TN Tammy Mendelson

D4 YFTC Sequatchie R., RM 7.1 near Dr.Tom Near #4110 ED Nickletown, Sequatchie Co., TN D3 YFTC Sequatchie R., RM 7.1 near Dr.Tom Near #4108 ED Nickletown, Sequatchie Co., TN.

172

Table 19. E. maculatum individuals sequenced. Table is sorted by location. Short ID Full ID Sample Location Source

* MAC4 BAP 1347 Allegheny R., Island complex Porter Lab & PA DEP Mac4 206m dst of Lock and Dam #3, river right, Harmarville, Allegheny Co., PA * MAC5 BAP 1347 Allegheny R., Island complex Porter Lab & PA DEP Mac5 206m dst of Lock and Dam #3, river right, Harmarville, Allegheny Co., PA M119 BAP 1250 Allegheny R., Pool 9, upst river Dr. Brady Porter MC1 left of Bald Eagle Island, Armstrong/Clarion Co., PA * M6 BAP 1317 Big Darby C., SR 104, Town of Dr. Brady Porter, Dr. MC 2 Fox, Pickaway Co., OH Beth Dakin, Laura Howell, Mike Komarnicki, Marc Kibbey M1 BAP 1318 East Fork of the White R., dst of Dr. Brady Porter, Dr. MC 1 Rt. 50 Bdg., Shoals, Martin Co., Beth Dakin, Laura IN Howell, Mike Komarnicki, Dr. Brandt Fisher M4 BAP 1318 East Fork of the White R., dst of Dr. Brady Porter, Dr. MC 15 Rt. 50 Bdg., Shoals, Martin Co., Beth Dakin, Laura IN Howell, Mike Komarnicki, Dr. Brandt Fisher * M125 BAP 1256 French C. @ 1st riffle upst of Porter Lab & PA DEP MC6 Shaw's Landing, Crawford Co., PA * M127 BAP 1256 French C. @ 1st riffle upst of Porter Lab & PA DEP MC8 Shaw's Landing, Crawford Co., PA * M100 BAP 1291 French C. @ Cochranton dst of Porter Lab: Dr. Brady MC8 Rt. 173 Bdg., Crawford Co., PA Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * M101 BAP 1291 French C. @ Cochranton dst of Porter Lab: Dr. Brady MC9 Rt. 173 Bdg., Crawford Co., PA Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki

173 Short ID Full ID Sample Location Source

* MC1 BAP 1292 French C. @ Franklin dst of RT. Porter Lab: Dr. Brady MC 1 322 Bdg., Venango Co., PA Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * M89 BAP 1290 French C. @ dst of Walter's Rd. Porter Lab: Dr. Brady MC33 Bdg., Venango, Crawford Co., Porter, Dr. Beth PA Dakin, Laura Howell, Mike Komarnicki * MC00 BAP 1290 French C. @ dst of Walter's Rd. Porter Lab: Dr. Brady MC00 Bdg., Venango, Crawford Co., Porter, Dr. Beth PA Dakin, Laura Howell, Mike Komarnicki * M48 BAP 1289 French C., vic Rt 97, Erie Co., Porter Lab: Dr. Brady MC3 PA Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * M49 BAP 1289 French C., vic Rt 97, Erie Co., Porter Lab: Dr. Brady MC4 PA Porter, Dr. Beth Dakin, Laura Howell, Mike Komarnicki * M14 BAP 1321 Kokosing R.@ RT. 715 dst of Dr. Brady Porter, Dr. MC2 Zuck Rd. intersection, Knox Co., Beth Dakin, Laura OH Howell, Mike Komarnicki, Marc Kibbey * M8 BAP 1321 Kokosing R.@ RT. 715 dst of Dr. Brady Porter, Dr. MC 8 Zuck Rd. intersection, Knox Co., Beth Dakin, Laura OH Howell, Mike Komarnicki, Marc Kibbey * M10 BAP 1316 Oil C., 1st Riffle upst of Center Dr. Brady Porter, Dr. MC 4 St. Bdg. in Oil City, Venango Beth Dakin, Laura Co., PA Howell, Mike Komarnicki * M2 BAP 1316 Oil C., 1st Riffle upst of Center Dr. Brady Porter, Dr. MC 2 St. Bdg. in Oil City, Venango Beth Dakin, Laura Co., PA Howell, Mike Komarnicki * M3 BAP 1316 Oil C., 1st Riffle upst of Center Dr. Brady Porter, Dr. MC 3 St. Bdg. in Oil City, Venango Beth Dakin, Laura Co., PA Howell, Mike Komarnicki Note: *These individuals have identical sequences. M8 and M89 were used to represent them for developing phylogenetic trees.

174

Table 20. E. tippecanoe individuals sequenced. Table is sorted by location. Short ID Full ID Sample location Source

TIP21 P1236 Allegheny R., Island complex Porter Lab & PA DEP TIP21 300yds dst of Lock and Dam #3, 1st riffle on back channel, island side, Harmarville, Allegheny Co., PA TIP4F P1236 Allegheny R., Island complex Porter Lab & PA DEP TIP4F 300yds dst of Lock and Dam #3, 1st riffle on back channel, island side, Harmarville, Allegheny Co., PA ** ET23 BAP Allegheny R., Pool 4 @ Isl. at Porter Lab: Dr. Brady 1336 mouth of Kiskiminetas R., Porter, Dr. Beth Dakin, ETI1 Armstrong/Westmoreland Co. Laura Howell, Mike line, PA Komarnicki and PA DEP: Gary Kenderes, Rick Spear ET25 BAP Allegheny R., Pool 4 @ Isl. at Porter Lab: Dr. Brady 1336 mouth of Kiskiminetas R., Porter, Dr. Beth Dakin, ETI2 Armstrong/Westmoreland Co. Laura Howell, Mike line, PA Komarnicki and PA DEP: Gary Kenderes, Rick Spear * ET22 BAP Allegheny R. @ mouth of the Porter Lab: Dr. Brady 1334 Clarion R., Clarion Co., PA Porter, Dr. Beth Dakin, ETI1 Laura Howell, Mike Komarnicki and PA DEP: Gary Kenderes, Rick Spear ET29 BAP Big Darby C., SR 104, Town Dr. Brady Porter, Dr. 1317 of Fox, Pickaway Co., OH Beth Dakin, Laura ETI4 Howell, Mike Komarnicki, Marc Kibbey *** TIP1F TC05- Big Darby C., SR 104, Town Ted Cavendar, Marc 04 tip1 of Fox, Pickaway Co., OH Kibbey

*** TIP2 TC05- Big Darby C., SR 104, Town Ted Cavendar, Marc 04 tip2 of Fox, Pickaway Co., OH Kibbey

175 Short ID Full ID Sample location Source

ET319 YFTC Big South Fork at Station Dr.Tom Near #7088 Camp C., ~14 km WNW of ETI Oneida, Scott Co., TN ET320 YFTC Big South Fork at Station Dr.Tom Near #7084 Camp C., ~14 km WNW of ETI Oneida, Scott Co., TN TIP1B Big South Fork at Station Tammy Mendelson Camp C. Scott Co., TN TIP2B Big South Fork at Station Tammy Mendelson Camp C. Scott Co., TN TIP17 P1232 Deer C., dst SR28 Bdg., Porter Lab TIP17 Harmar Twp., Alleghehy Co., PA TIP6 P1232 Deer C., dst SR28 Bdg., Porter Lab TIP6 Harmar Twp., Alleghehy Co., PA * ET15 BAP East Fork of the White R., dst Dr. Brady Porter, Dr. 1318 of Rt. 50 Bdg., Shoals, Martin Beth Dakin, Laura ETI 15 Co., IN Howell, Mike Komarnicki, Dr. Brandt Fisher ET16 BAP East Fork of the White R., dst Dr. Brady Porter, Dr. 1318 of Rt. 50 Bdg., Shoals, Martin Beth Dakin, Laura ETI 16 Co., IN Howell, Mike Komarnicki, Dr. Brandt Fisher E29E BAP Elk R. @ Ivydale, Clay Co., Dr. Brady Porter, Dr. 1296 WV Beth Dakin, Laura ETI 29 Howell, Mike Komarnicki E2E BAP Elk R. @ Ivydale, Clay Co., Dr. Brady Porter, Dr. 1296 WV Beth Dakin, Laura ETI 2 Howell, Mike Komarnicki ETI1 BAP French C. @ 1st riffle upst of Porter Lab & PA DEP 1256 Shaw's Landing, Crawford ETI1 Co., PA

176 Short ID Full ID Sample location Source

* ETI2 BAP French C. @ 1st riffle upst of Porter Lab & PA DEP 1256 Shaw's Landing, Crawford ETI2 Co., PA

* ET11 BAP French C. @ Cochranton dst Porter Lab: Dr. Brady 1291 of Rt. 173 Bdg., Crawford Co., Porter, Dr. Beth Dakin, ETI 11 PA Laura Howell, Mike Komarnicki ** ET217 BAP French C. @ Cochranton dst Porter Lab: Dr. Brady 1291 of Rt. 173 Bdg., Crawford Co., Porter, Dr. Beth Dakin, ETI1 PA Laura Howell, Mike Komarnicki ** ET12 BAP French C. @ Franklin dst of Porter Lab: Dr. Brady 1292 RT. 322 Bdg., Venango Co., Porter, Dr. Beth Dakin, ETI 12 PA Laura Howell, Mike Komarnicki ** ET7 BAP French C. @ Franklin dst of Porter Lab: Dr. Brady 1292 RT. 322 Bdg., Venango Co., Porter, Dr. Beth Dakin, ETI 7 PA Laura Howell, Mike Komarnicki ** ET17 BAP French C. @ dst of Walter's Porter Lab: Dr. Brady 1290 Rd. Bdg.,Venango, Crawford Porter, Dr. Beth Dakin, ETI 17 Co., PA Laura Howell, Mike Komarnicki * ET26 BAP French C. @ dst of Walter's Porter Lab: Dr. Brady 1290 Rd. Bdg.,Venango, Crawford Porter, Dr. Beth Dakin, ETI 26 Co., PA Laura Howell, Mike Komarnicki ET18 BAP French C., vic Rt 97, Erie Co., Porter Lab: Dr. Brady 1289 PA Porter, Dr. Beth Dakin, ETI 18 Laura Howell, Mike Komarnicki ** ET19 BAP French C., vic Rt 97, Erie Co., Porter Lab: Dr. Brady 1289 PA Porter, Dr. Beth Dakin, ETI 19 Laura Howell, Mike Komarnicki

177 Short ID Full ID Sample location Source

ET310 YFTC Green R. at KY 88, ~7.5 km Dr.Tom Near #6418 W of Greensburg, Green Co., ETI KY

ET311 YFTC Green R. at KY 88, ~7.5 km Dr.Tom Near #6425 W of Greensburg, Green Co., ETI KY

* ET307 YFTC Licking R. Butler, Hwy. 177 Dr.Tom Near #813 Pendleton Co., KY ETI

** ET309 YFTC Licking R. Butler, Hwy. 177 Dr.Tom Near #815 Pendleton Co., KY ETI

* E8K BAP Little Kanawha R. @ CR-1, Dr. Brady Porter, Dr. 1295 Calhoun Co., WV Beth Dakin, Laura ETI 8 Howell, Mike Komarnicki * ET102 BAP Little Kanawha R. @ CR-1, Dr. Brady Porter, Dr. 1295 Calhoun Co., WV Beth Dakin, Laura ETI1 Howell, Mike Komarnicki *** TIP1M P1235 Muskingum R., @ dam #3, Dr. Ted Cavendar, Dr. tip1 Lowell, Adams Twp, Brady Porter, Marc Washington Co., OH Kibbey, Michele Mulkeen, Caroline Gallagher, Joe Laslo *** TIP2M p1235 Muskingum R., @ dam #3, Dr. Ted Cavendar, Dr. tip2 Lowell, Adams Twp, Brady Porter, Marc Washington Co., OH Kibbey, Michele Mulkeen, Caroline Gallagher, Joe Laslo TIP37 P1234 Pine C. off Poplar Rd. upst of Porter Lab TIP37 railroad bdg., vic. Etna, Alleghany Co., PA

178 Short ID Full ID Sample location Source

ET304 YFTC South Fork Kentucky R. at Dr.Tom Near #459 Oneida at Rt. 66 Clay Co., KY ETI

ET20 BAP Tippecanoe R. upst of Rt. 18 Dr. Brady Porter, Dr. 1319 Bdg., near Brookston, Beth Dakin, Laura ETI20 Carroll/White Co., IN Howell, Mike Komarnicki, Dr. Brant Fisher ET21 BAP Tippecanoe R. upst of Rt. 18 Dr. Brady Porter, Dr. 1319 Bdg., near Brookston, Beth Dakin, Laura ETI21 Carroll/White Co., IN Howell, Mike Komarnicki,Dr. Brant Fisher Note: *These individuals have identical sequences; E8K and ET102 were used to represent them for developing phylogenies. **These individuals have identical sequences; ET12 and ET17 were used to represent them for developing phylogenies. ***These individuals have identical sequence; TIP1F and TIP2 were used to represent them for developing phylogenies.

Table 21. E. virgatum. ND2 sequence source. This individual was used as an outgroup.

Short ID Species Sequence Source

Evir E. virgatum GenBank Accession #AF412552 (Page, et.al)

179

APPENDIX F. NEW PA SITE RECORDS

Table 22 New PA Site Records for E. camurum, E. maculatum and E. tippecanoe Field Record Sample location Grid Source Species and number date coordinates numbers (UTM) BAP 16 June Allegheny R., Pool 2, island complex 300yds 17T Dr. Brady Porter, Rob E. camurum (53) 1236 2005 dst of Lock and Dam #3, 1st riffle on back E 0738625 Criswell, Rick Spear E. tippecanoe (46) channel, island side, Harmarville, Allegheny N 4491358 Co., PA BAP 31 May Allegheny R., Pool 2, island complex 206m 17T Dr. Brady Porter, Dr. E. maculatum (6) 1347 2007 dst of Lock and Dam #3, river right, E 0738625 Beth Dakin, Mike E. camurum (94) Harmarville, Allegheny Co., PA N 4491358 Komarnicki & PA DEP E. tippecanoe (27)

BAP 21 Aug Allegheny R., Pool 4 @ Isl. at mouth of 17T Porter Lab: Dr. Brady E. tippecanoe (1) 1336 2006 Kiskiminetas R., Armstrong/Westmoreland E 0611114 Porter, Dr. Beth Dakin, Co. line, PA N 4552275 Laura Howell, Mike Komarnicki PA DEP: Gary Kenderes, Rick Spear BAP 13 Sept. Allegheny R., Pool 9, upst River left of Bald Porter Lab & PA DEP E. camurum (3) 1250, 2005 Eagle Island, Armstrong/Clarion Co., PA E. maculatum (1) 1251 E. tippecanoe (1)

180

Field Record Sample location Grid Source Species and number date coordinates numbers (UTM) BAP 21 Aug. Allegheny R. @ mouth of the Clarion R., 17T Porter Lab: Dr. Brady E. tippecanoe (1) 1334 2006 Clarion Co., PA E 0611048 Porter, Dr. Beth Dakin, N 4551874 Laura Howell, Mike Komarnicki PA DEP: Gary Kenderes, Rick Spear BAP 05 Oct Deer C., dst SR28 Bdg., Harmar Twp., 17T Dr. Brady Porter, E. camurum (12) 1181 2003 Alleghehy Co., PA E 0598021 Richard Pearsall, E. tippecanoe (3) N 4488056 Rebecca Haynie, Shelby Hott BAP 26 July Oil C., 1st Riffle upst of Center St. Bdg. in 17T Dr. Brady Porter, Dr. E. camurum (10) 1316 2006 Oil City, Venango Co., PA E 0607798 Beth Dakin, Laura E. maculatum (6) N 4587753 Howell, Mike Komarnicki BAP 10 June Pine C. off Poplar Rd. upst of railroad bdg., 17T Dr. Brady Porter, E. camurum (1) 1234 2005 vic. Etna, Alleghany Co., PA E 0589389 Michele Mulkeen, Joe E. tippecanoe (1) N 4483006 Laslo, Caroline Gallagher BAP 26 Apr Pine C. off Poplar Rd. upst of railroad bdg., 17T Dr. Brady Porter, Dr. E. camurum (1) 1278 2006 vic. Etna, Alleghany Co., PA E 0589405 Beth Dakin, Laura N 4483008 Howell, Mike Komarnicki, Dr. Lisa Ludvico, Summer Gen. Bio. Class 2006

181

APPENDIX G. ABBREVIATIONS

Table 23 Abbreviations used in text. Abbreviation Name Bdg. Bridge C. Creek cm Centimeter Co. County dst Down stream of Fk. Fork ft. Foot km Kilometer Lndg. Landing m Meter min. Minute NTU Nephelometric Turbidity Units R. River rd. Road rs Average adult female reproductive status Rt. Route s Second SL Standard Length Twp. Township upst Up stream of UTM Universal Transverse Mercator Coordinate vic Vicinity

182