Contribution of WFS1 to Pancreatic Beta Cell Survival and Adaptive Alterations in WFS1 Deficiency: a Dissertation

University of Massachusetts Medical School eScholarship@UMMS

GSBS Dissertations and Theses Graduate School of Biomedical Sciences

2012-04-20

Contribution of WFS1 to Pancreatic Beta Cell Survival and Adaptive Alterations in WFS1 Deficiency: A Dissertation

Bryan M. O'Sullivan-Murphy University of Masschusetts Medical School

Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss

Part of the Amino Acids, Peptides, and Proteins Commons, Biochemistry, Biophysics, and Structural Biology Commons, Cell and Developmental Biology Commons, Cells Commons, Cellular and Molecular Physiology Commons, Endocrine System Diseases Commons, Hormones, Hormone Substitutes, and Hormone Antagonists Commons, Immune System Diseases Commons, and the Nutritional and Metabolic Diseases Commons

Repository Citation O'Sullivan-Murphy BM. (2012). Contribution of WFS1 to Pancreatic Beta Cell Survival and Adaptive Alterations in WFS1 Deficiency: A Dissertation. GSBS Dissertations and Theses. https://doi.org/10.13028/ c6e3-gx67. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/590

This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected].

CONTRIBUTION OF WFS1 TO PANCREATIC BETA CELL

SURVIVAL AND ADAPTIVE ALTERATIONS IN WFS1

DEFICIENCY

A Dissertation Presented

Bryan M.O’Sullivan-Murphy

Submitted to the Faculty of the

University of Massachusetts Graduate School of Biomedical Sciences, Worcester

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

April 20th, 2012

MD/PhD Program CONTRIBUTION OF WFS1 TO PANCREATIC BETA CELL SURVIVAL AND ADAPTIVE ALTERATIONS IN WFS1 DEFICIENCY

A Dissertation Presented By Bryan M.O’Sullivan-Murphy

The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation

______Dr. Fumihiko Urano, Thesis Advisor

______Dr. Rita Bortell, Thesis Co-Advisor

______Dr. Lawrence Hayward, Member of Committee

______Dr. Klaus Pechhold, Member of Committee

______Dr. John Harris, Member of Committee

______Dr. Gökhan Hotamisligil, External Member of Committee

The signature of the Chair of the Committee signifies that the written dissertation meets the requirements of the Dissertation Committee

______Dr. Dale Greiner, Chair of Committee

The signature of the Dean of the Graduate School of Biomedical Sciences signifies that the student has met all graduation requirements of the school.

______Anthony Carruthers, Ph.D., Dean of the Graduate School of Biomedical Sciences

MD/PhD Program April 20th, 2012 iii

DEDICATION

This work is lovingly dedicated to my wonderful wife, Sorcha, and my beloved daughters, Emer and Orla. They have been a constant source of support throughout the research years. Sorcha, Emer, and Orla fill my life with joy and happiness. iv

ACKNOWLEDGEMENTS

I would like to express my sincere appreciation and gratitude to my thesis advisors Fumihiko Urano and Rita Bortell. Their guidance and support has assisted me not only during the last three years of graduate research, but since my arrival at UMass in

2003. As my primary thesis advisor, Fumi has been exceptional. He is the epitome of a truly great mentor and I feel extremely fortunate and honored to have studied research in his laboratory. Every interaction with Fumi is positive and his cheerful, optimistic, energized attitude instills confidence in his students and their scientific ability and encourages his students to always perform their best. I thank Fumi for accepting me into his laboratory and being a fantastic supportive and understanding mentor during my research years.

Within scientific research, it is imperative to have strong mentors along the way to aid in training and advancement of one’s abilities, techniques, and confidence. I am very fortunate to have interacted with a number of individuals during my scientific training. My first scientific experience outside of school was in the laboratory of Dr.

Ethan Dmitrovsky at Dartmouth Medical School in the idyllic Hanover, NH. I am forever grateful to Dr. Dmitrovsky for taking a chance on extending an invitation to pursue research in his laboratory to a newly-graduated student from Ireland on the basis of a telephone conversation. The introduction to research under his and Dr. Konstantin

Dragnev’s tutelage initiated my desire to pursue the MD/PhD track. v

Shortly thereafter, I transitioned to Worcester, MA and was fortunate to accept a position in the laboratory of Dr. Aldo Rossini at UMass Medical School. Dr. Rossini’s passion for science is infectious and it was an immense pleasure to conduct research in his laboratory and consolidated my pursuit of the dual degree. In the Rossini laboratory,

Dr. Rita Bortell was a wonderful and patient advisor who assisted my scientific growth. I will be always grateful to Dr. Bortell for allowing me to participate in grant-writing and manuscript preparation, imperative aspects to successful research.

The Urano laboratory members have been a fantastic group who has helped me in this research with interesting conversations, constructive comments, and research assistance. Thank you to Kohsuke and Mai Kanekura, Takashi and Mariko Hara, Karen

Sargent, Simin Lu, Christine Oslowski, and Victor Liu. I would also like to thank members of the Diabetes Division, especially Linda Leehy, Elaine Norowski, and Agata

Jurczyk.

I am eternally grateful to the love and support of family. From an early age, my parents, Ray and Bridget, encouraged my curiosity in science; without their support, I would not have made it this far. I would like to thank my wife’s parents who have been very helpful over the past few years by maintaining a supportive environment. Finally, I would like to express my deepest gratitude to my wife, Sorcha, and our daughters, Emer and Orla. Sorcha has supported my decision to pursue this long course of training. Their collective love, encouragement, and sacrifice has helped me get this far and I want to thank them from the bottom of my heart. vi

ABSTRACT

Diabetes mellitus comprises a cohort of genetic and metabolic diseases which are characterized by the hallmark symptom of hyperglycemia. Diabetic subtypes are based on their pathogenetic origins: the most prevalent subtypes are the autoimmune-mediated type 1 diabetes mellitus (T1DM) and the metabolic disease of type 2 diabetes mellitus

(T2DM). Genetic factors are major contributory aspects to diabetes development, particularly in T2DM where there is close to 80% concordance rates between monozygotic twins. However, the functional state of the pancreatic β cell is of paramount importance to the development of diabetes. Perturbations that lead to β cell dysfunction impair insulin production and secretion and precede diabetes onset.

The endoplasmic reticulum (ER) is a subcellular organelle network of tubes and cisternae with multifaceted roles in cellular metabolism. Alterations to ER function such as those begotten by the accumulation of misfolded and unfolded ER client proteins upset the ER homeostatic balance, leading to a condition termed ER stress. Subsequent sensing of ER stress by three ER transmembrane proteins, initiates an adaptive reaction to alleviate ER stress: this is known as the unfolded protein response (UPR). Divergent cascades of the UPR attempt to mitigate ER stress and restore ER homeostasis: Failing that, the UPR initiates pro-apoptotic pathways. The demand of insulin production on the

β cell necessitates the presence of a highly functional ER. However, the consequence of dependence on the ER for insulin synthesis and secretion portends disaster for the functional state of the β cell. Disturbances to the ER that elicit ER stress and UPR vii

activation causes β cell dysfunction and may lead to apoptosis. There are numerous well- characterized models of ER stress-mediated diabetes, including genetic mutations in UPR transducers and insulin. Recently, polymorphisms in Wolfram syndrome 1 (WFS1), an

ER transmembrane protein involved in the UPR, were suggested to contribute to T2DM risk.

In this thesis, one of the highlighted WFS1 polymorphism, H611R, was examined to identify its contribution to β cell function and viability, and hence, diabetes risk. It was revealed that augmentation of WFS1 expression increased insulin secretion and cellular content. In addition, WFS1 protected β cells against ER stress-mediated dysfunction, with a more pronounced effect in the WFS1-R611 protective allele. Subsequent gene expression analysis identified netrin-1 as a WFS1-induced survival factor.

As a contributory factor to diabetes progression, ER stress and UPR are potential drug and biomarker targets. In this dissertation, a novel UPR-regulating microRNA

(miRNA) family was uncovered in ER stressed, WFS1-deficient islets. These miRNAs, the miR-29 family, are induced in WFS1-/- islets as a possible adaptive alteration to chronic ER stress conditions, and indirectly decreases the expression of UPR transducers, while directly targeting downstream ER stress-related pro-apoptotic factors.

Collectively, this work extends the function of WFS1 as a protective factor in the pancreatic β cell through the induction of netrin-1 signaling. Additionally, it further strengthens the role of miRNA as regulatory members of the UPR which contribute to cell survival. viii

TABLE OF CONTENTS

Approval Page...... ii Dedication...... iii Acknowledgements...... iv Abstract...... vi Table of Contents...... viii List of Tables...... xi List of Figures...... xii List of Abbreviations ...... xiv Copyright Information...... xvi

CHAPTER I: INTRODUCTION……………………………………………………………………1

THE PANCREATIC  CELL…………………...... 1

1.1. Overview of pancreatic  cell function……………………….…………………...1 1.2. Insulin production and secretion………………………………………...... 2 1.3. Peripheral insulin action and glucose regulation………………….....………....6

DIABETES MELLITUS...... 7

1.4. Classification of diabetes subtypes………………...... ……...... ……………...... 8

ENDOPLASMIC RETICULUM STRESS...... 11

1.5. Unfolded Protein Response...... 12

1.5.1. ATF6...... 14 1.5.2. IRE1...... 15 1.5.3. PERK...... 16

1.6. ER stress-mediated apoptosis...... 19

1.7. Physiological ER stress signaling...... 19 ix

1.8. Pathological ER stress signaling...... 20

ER STRESS-MEDIATED DIABETES...... 21

1.9. Genetic Forms of ER stress-mediated diabetes...... 22 1.10. Acquired Forms of ER stress-mediated diabetes...... 24

WOLFRAM SYNDROME...... 28

1.11. Mutations leading to Wolfram syndrome...... 33 1.12. Allelic polymorphisms of WFS1 as a diabetes risk factor...... 35 1.13. Adaptive alterations to WFS1 deficiency...... 36

1.13.1. MicroRNA...... 37

SIGNIFICANCE OF STUDYING WFS1 AND ER STRESS FOR DIABETES...... 39

CHAPTER II: ALLELIC VARIANTS OF WFS1 GENE CONTRIBUTE TO PANCREATIC

BETA CELL VIABILITY BY UPREGULATION OF NETRIN-1 EXPRESSION……...... 42

SUMMARY...... 42

INTRODUCTION...... 44

MATERIALS AND METHODS...... 49

RESULTS...... 56

Exogenous expression of WFS1 protects INS-1 cells from ER stress- mediated cell death...... 56 Augmentation of WFS1 expression increases insulin production and secretion...... 60 Microarray data for WFS1 allelic variants...... 62 WFS1 augmentation induces the expression of netrin-1...... 67

DISCUSSION...... 69

FUTURE DIRECTIONS...... 76

CHAPTER III: MICRORNA-29B EXPRESSION IS INDUCED AS A COMPENSATORY -/- SURVIVAL MECHANISM IN WFS1 ISLETS...... 78

SUMMARY...... 78

INTRODUCTION...... 80

MATERIALS AND METHODS...... 83

RESULTS...... 88

Mice with a pancreatic β cell-conditional Wfs1 deficiency (WFS1-/-) display glucose intolerance...... 88 WFS1-/- islets show diverse alterations in the microRNA expression profile...... 90 WFS1-/- islets have increased expression of the miR-29 family members...... 93 Introduction of miR-29b mimic into INS-1cells decreases the expression of UPR markers and ER stress transducers...... 95 Exogenous administration of miR-29b decreases the expression of the UPR-related apoptotic genes PUMA and Bim-EL...... 98 ER stress-mediated caspase-3 cleavage is reduced in the presence of miR-29b mimic...... 100

DISCUSSION...... 102

FUTURE DIRECTIONS...... 105

CHAPTER IV: DISCUSSION AND PERSPECTIVES...... 107

REFERENCES...... 121

LIST OF TABLES

Table 2.1: List of altered ER stress/UPR-related genes in WFS1-WT and WFS1-R611 cells………………………………………………64

Table 2.2: List of altered genes related to the secretory pathway in cells with augmented expression of WFS1-WT or WFS1-R611…………65

Table 2.3: List of netrin-1 and netrin receptors with altered expression in WFS1-WT or WFS1-R611 cells……………………………….66

Table 3.1: List of miRNA with altered expression from WFS1-/- islets compared to control islets……………………………………...92

xii

LIST OF FIGURES

Figure 1.1: Sequence of events leading to insulin secretion by the pancreatic β cell following glucose challenge ……………………………….5

Figure 1.2: The spectrum of DM diseases ………………………………...10

Figure 1.3: The unfolded protein response (UPR) ………………………...18

Figure 1.4: Physiological and pathological ER stress and UPR activation in the pancreatic β cell ……………………………………………….27

Figure 1.5: Chronological appearance of Wolfram syndrome symptoms ...29

Figure 1.6 Roles of WFS1 in the pancreatic β cell ……………………….32

Figure 1.7: WFS1 structure and mutations ………………………………..34

Figure 1.8: The therapeutic and biomarker potential of the ER stress pathway in diabetes ……………………………………………………..41

Figure 2.1: Hypothetical structure of WFS1protein ………………………48

Figure 2.2: Induction of WFS1 expression in INS-1 cell lines…………….57

Figure 2.3: WFS1 expression protects against ER stress-mediated cellular dysfunction and death………………………………………….59

Figure 2.4: Glucose-stimulated insulin secretion (GSIS) of WFS1 allele- expressing INS-1 cells…………………………………………61

Figure 2.5: Confirmation of netrin-1 induction in INS-1 cells expressing either WFS1-H611 (WFS1-WT) or WFS1-R611 allelic variants……68

Figure 2.6: Roles of WFS1 in the pancreatic β cell………………………..70 xiii

Figure 3.1: Intraperitoneal glucose tolerance test (IPGTT)………………..89

Figure 3.2: Confirmation of increased expression of miR-29 family members in WFS1-/- islets………………………………………………..94

Figure 3.3: miR-29b decreases expression of ER stress markers and UPR transducers……………………………………………………..97

Figure 3.4: miR-29b decreases the expression of UPR-related apoptotic genes…………………………………………………………...99

Figure 3.5: miR-29b prevents the activation of caspase-3 in TG-treated INS-1 cells…………………………………………………………...101

Figure 3.6: Potential role of miR-29b as an ER stress regulating molecule………………………………………………………106

Figure 4.1: Summative conclusions from current thesis………………….120

xiv

ABBREVIATIONS

AATF anti-apoptotic transcription factor ATF4 activating transcription factor 4 ATF6 activating transcription factor 6 b-ZIP basic leucine zipper Ca2+ calcium CHOP C/EBP-homologous protein CISD2 CDGSH iron sulfur domain 2 diabetes insipidus, diabetes mellitus, optical DIDMOAD atrophy, deafness eIF2 eukaryotic initiation factor 2 ELISA enzyme-linked immunosorbent assay ER endoplasmic reticulum ERAD ER-associated degradation ERO1 ER oxidoreductin 1 ERSE ER stress response element FFA free fatty acid GADD34 growth-arrest DNA-damage gene 34 GRP78 glucose-regulated protein 78 GSIS glucose-stimulated insulin secretion HOMA homeostatic model assessment IAPP islet amyloid precursor protein IFN- interferon- IL-1 interleukin-1 IRE1 inositol-requiring enzyme 1 IRS insulin receptor signal JNK c-Jun n-terminal kinase miRNA micro-RNA NO nitric oxide xv

PDI protein disulfide isomerase PERK PKR-like ER kinase PUMA p53 upregulated modulator of apoptosis RISC RNA-induced silencing complex S1P site-1 protease S2P site-2 protease SERCA sarcoendoplasmic reticulum Ca2+ ATPase SNP single nucleotide polymorphism T1DM type 1 diabetes mellitus T2DM type 2 diabetes mellitus TG thapsigargin TM tunicamycin UPR unfolded protein response UTR untranslated refion WFS1 wolfram syndrome 1 XBP1 X-box binding protein 1

Portions of this dissertation will appear in:

O’Sullivan-Murphy B, Liu V, Hara T, Kanekura K, Urano F. WFS1 augmentation leads to the induction of netrin-1 signaling in pancreatic β cells. (In preparation).

O’Sullivan-Murphy, B., Liu, V., Hara, T., Kanekura, K., Urano, F. The role of miR-29 family members in maintaining β cell survival in WFS1-/- islets. (In preparation).

O’Sullivan-Murphy, B., and Urano, F. Chapter 9: Pathological ER Stress in β Cells. In: P

DOI 10.1007/978-94-007-4351-9_9, © Springer Science+Business Media Dordrecht

2012. (In print).

CHAPTER I:

INTRODUCTION

THE PANCREATIC BETA CELL

The pancreas is a flattened, retroperitoneal, glandular organ consisting of loosely- structured acinar (or exocrine) glands and duct system involved in digestive enzyme production and secretion into the duodenum. Interspersed among the acinar tissue and comprising 1-2% of the pancreatic volume reside the endocrine islets of Langerhans, first described by the German pathologist Paul Langerhans in 1869 1. The islets harbor a number of endocrine cell types which vary in quantity and intrainsular location: these include the glucagon-secreting  cells, insulin-secreting  cells, somatostatin-producing

 cells, polypeptide-producing PP cells, and ghrelin-secreting  cells 2. The major secretory product of the pancreatic β cell, insulin, is the sole glucoregulatory molecule produced by the body and is indispensable for maintaining whole body energy production and metabolism.

1.1. Overview of pancreatic beta cell function

Pancreatic  cells, which comprise 65-80% of each islet, are committed to the production, storage and secretion of the unique blood glucose-reducing hormone, insulin. 2

To achieve on-demand insulin production and secretion, the pancreatic  cell is functionally equipped. Indeed, proinsulin mRNA constitutes approximately 30% of all mRNA expressed in the  cell and proinsulin biosynthesis is induced 25-fold to almost

50% of total protein production following glucose stimulation 3, 4. During glucose challenge, it is suggested that the ER of the pancreatic  cell synthesizes approximately 1 million molecules of insulin per minute 5. To enable efficient and abundant production of insulin, the pancreatic  cell has an extensive ER network consisting of thin ER cisternae, in addition to efficient packaging, intracellular transport, and secretory systems.

1.2. Insulin Production and Secretion

There are approximately one million islets in a healthy human pancreas, each of which is primed to respond to respond to fluctuations in blood glucose levels. At the cellular level, the response to glucose has been fully elucidated: initially, glucose enters passively into  cells through cell surface-bound glucose transporter 2 (GLUT2) molecules. Subsequently, the six-carbon carbohydrate fuel is phosphorylated by glucokinase to form glucose-6-phosphate (glucose-6-P), trapping the carbohydrate within the cell. This is the rate-limiting step for glucose-stimulated insulin release. Enzymatic degradation of glucose-6-P in the glycolytic pathway leads to an increase in ATP concentration, elevating the ATP: ADP ratio and stimulating the closure of ATP-sensitive

K+ channels. Consequently, the rise in the intracellular potassium ion concentration of the

β cell leads to depolarization of the β cell plasma membrane, which stimulates the 3

opening of membrane-bound voltage-gated Ca2+ channels. The subsequent influx of Ca2+ ions into the  cell dramatically increases the concentration of free cytoplasmic Ca2+ ions, which activates exocytosis of insulin secretory granules (Figure 1.1).

Following glucose challenge, the first-phase of insulin is released in pulsatile manner from the β cell. The biosynthesis of nascent insulin molecules is also initiated by induction of transcription from the Insulin gene. Cytoplasmic insulin mRNA forms the templates to derive preproinsulin, which is co-translationally translocated into the ER lumen with coincident cleavage of the N-terminal ER-localizing signal peptide, to yield proinsulin. The concerted action of chaperones, foldases and isomerases in the ER lumen direct the precise folding and disulphide bond formation consistent with the characteristic proinsulin structure 6. Proinsulin is subsequently transported to the Golgi and packaged into secretory vesicles, where mature insulin is generated following the enzymatic cleavage by specific endopeptidases. Secretory vesicles may be made and secreted on- demand or stored as mature readily-releasable pools, which are in close proximity to the plasma membrane. However, glucose stimulation releases young secretory vesicles preferentially during the initial phase, followed by the recruitment of older vesicles for secretion 7.

Insulin secretion responds to increasing circulating levels of glucose, the major insulin secretagogue. However, amino acids, ketones, gastrointestinal peptides and neurotransmitters also influence insulin secretion. Clinically, a number of compounds are used to achieve insulin release to maintain blood normoglycemia. The aforementioned 4

ATP-sensitive K+ channels contain binding sites for oral hypoglycemic drugs, such as the sulfonylureas and meglitinides, which cause depolarization and insulin release.

Neuroendocrine cells of the gastrointestinal trace release the incretins glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1) in response to dietary nutrients. Incretins stimulate the synthesis and release of insulin from β cells and promote β cell growth and survival 8, 9. Incretin-based therapies that stimulate insulin release include GLP-1 analogs and dipeptidyl peptidase-4 (DPP-4, the incretin inactivator) inhibitors.

Figure 1.1: Sequence of events leading to insulin secretion by the pancreatic β cell following glucose challenge. Glucose enters via the GLUT2 transporter and is quickly phosphorylated by glucokinase into glucose-6-phosphate. Metabolism of glucose results in an increase in the ATP: ADP ratio. This alteration inactivates the ATP-sensitive potassium channel, leading to accumulation of intracellular potassium ions, which triggers membrane depolarization. Subsequently, the voltage-gated calcium channel opens, allowing calcium ions to flow into the β cell. The resulting rise in calcium concentration leads to the exocytosis of insulin from their storage vesicles. 6

1.3. Peripheral insulin action and glucose regulation

Following secretion, insulin travels via the hepatic portal vein to the liver, where the majority is degraded. The remaining circulating insulin is dispersed throughout the body by the bloodstream where it binds to cell surface-bound insulin receptors on muscle and adipose tissue. Insulin binding to the insulin receptor, a receptor tyrosine kinase family member, leads to the trans-autophosphorylation of intracellular tyrosine residues

10. Activation of the insulin receptor initiates an intracellular signaling cascade which involves the recruitment and phosphorylation of a number of adaptor proteins, including the insulin receptor substrate (ISR) proteins 11-13. Downstream of the IRS proteins, two major kinase families are activated: these are the phosphatidylinositol-3 kinase (PI3 kinase) family, which is involved in the metabolic effects of insulin, and the mitogen- activated protein kinase (MAPK) pathway, which mediates the mitogenic effects of insulin 14.

The goal of insulin release is to restore blood normoglycemia. To achieve this insulin promotes glucose uptake into muscle and adipose tissues by stimulating the translocation of GLUT4 glucose transporters to the cell surface 12-13. In addition, insulin signals the storage of glucose and other fuels in the liver and adipose tissue by activating glycogen synthesis, protein synthesis, and lipogenesis 12, 13, 15-18. To maintain normoglycemic levels, insulin also reduces glucose output from the liver by decreasing the expression of gluconeogenic enzymes 12.

DIABETES MELLITUS

Diabetes mellitus (DM) has been recognized for over two thousand years and was originally described as a disease of the kidneys and urinary tract due to the presenting symptom of excessive urinary output. The term “diabetes mellitus” derives from the

Greek diabētēs, meaning siphon, and the Latin mellitus, honey-sweet, and together they relate to glycosuria, the excretion of glucose into the urine as the body loses its ability to maintain normal blood glucose levels. It was not until the late nineteenth century that the pancreas was connected to diabetes when the German physician-researchers Oskar

Minkowski and Johann von Mering observed that pancreatectomized dogs developed diabetes, leading to death 19. Further research on the pancreas lead to the discovery of insulin by the Canadian surgeon, Frederick Banting, and his medical student assistant,

Charles Best, in 1921 19.

DM is one of the most prevalent and chronic diseases in the world with significant impact on economic and healthcare resources. As of 2011, the American Diabetes

Association (ADA) report approximately 25.8 million people in the United States (8.3% of the population) with a confirmed diagnosis of DM. In addition, individuals considered pre-diabetic exceeds 80 million, highlighting the vast enormity of diabetes as a major disease 20. On a global scale, the World Health Organization (WHO) estimates that DM affects 220 million people worldwide, with a forecast of an explosion of DM incidence worldwide to 366 million people by 2030 21.

1.4. Classification of diabetes subtypes

Diabetes mellitus is not a single disease, but encompasses a collection of metabolic and genetic diseases of different etiologies, each of which is characterized by the hyperglycemic state, as outlined in Figure 1.2. The plasma glycemic state is classified into three categories based on fasting blood glucose (FBG): (1) FBG < 5.6 mmol/L

(100mg/dL) is normoglycemic; (2) FBG = 5.6-6.9 mmol/L (100-125mg/dL) is defined as impaired fasting glucose (IFG), or pre-diabetic; and (3) FBG ≥ 7.0 mmol/l (126mg/dL) indicates hyperglycemia and warrants the diagnosis of DM. Currently, the criteria to confirm the diagnosis of DM include: (A) FBG readings above 7mmol/L (126mg/dL),

(B) 2-hour blood glucose readings greater than 11.1mmol/L (200mg/dL) following oral glucose tolerance test (OGTT), or (C) random blood glucose test above 11.1mol/L

(200mg/dL) with accompanying diabetic symptoms of increased urinary frequency, increased thirst or unexplained weight loss.

Classification of DM is based on the pathological process that precedes the onset of hyperglycemia. The two major forms of DM include type 1 (T1DM) and type 2

(T2DM). On one end of the spectrum of diabetes lies T1DM, with near-complete insulin deficiency. T1DM is further subdivided into the immune-mediated type 1A and idiopathic type 1B forms. Recently, a number of novel preproinsulin gene mutations associated with monogenic DM have been discovered and termed „mutant Ins-gene- induced diabetes of youth‟ (MIDY) that also causes hyperglycemic states through almost complete insulin deficiency 22-24. 9

On the other extreme of the DM spectrum is T2DM, a heterogenous group of disorders characterized by variable degrees of insulin resistance, impaired insulin secretion, and increased glucose production. DM may also manifest as a result of particular genetic or metabolic defects that affect insulin secretion or action. One subtype of DM consists of the autosomally dominant maturity onset diabetes of the young

(MODY) forms, which encompass genetic defects in hepatocyte nuclear transcription factor (HNF) 4α (MODY1), glucokinase (MODY2), HNF-1α (MODY3), insulin promoter factor-1 (IPF-1) (MODY4), HNF-1β (MODY5), and neuroD1 (MODY6) 25.

Hyperglycemia can manifest as a result of other genetic syndromes that are associated with DM including Klinefelter‟s, Turner‟s, and Prader-Willi syndromes.

Genetic mutations in the Wfs1 or CISD2 genes lead to the development of Wolfram syndrome, a complex disease also known by the acronym DIDMOAD due to the clinical presentation of diabetes insipidus, diabetes mellitus, optical atrophy and deafness.

Wolfram syndrome is discussed in more detail later in this introductory chapter.

Hyperglycemic states due to glucose intolerance may also arise during pregnancy

(gestational diabetes). Finally, DM may also arise following exposure to particular drug classes, including glucocorticoids, antipsychotics, and HIV protease inhibitors.

Figure 1.2: The spectrum of DM diseases. DM with absolute insulin deficiency includes types 1A and 1B DM, mutant Ins-gene diabetes of the youth (MIDY), and

Wolfram syndrome. Latent autoimmune diabetes of adults (LADA; type 1.5 DM) is a slowly-progressive form of T1DM. The maturity-onset diabetes of the young (MODY) forms of DM comprises a collection of hereditary forms of DM that affect insulin secretion or action. T2DM is a heterogenous group of disorders with relative insulin deficiency.

ENDOPLASMIC RETICULUM STRESS

Within most cells, there exist many distinct organelle compartments which differ by their structure, location, quantity and specific metabolic tasks. Cellular organelles, which include the nucleus, mitochondria, endoplasmic reticulum and Golgi network, lysosomes, centrioles, cytoskeleton, and vacuoles, work cooperatively to maintain cellular function, growth, signaling, and viability. The endoplasmic reticulum (ER) is a specialized cellular organelle with a distinct structural network of interconnected tubules, vesicles and cisternae. Functionally, the ER is the primary site for the synthesis, folding and modification of transmembrane and secreted proteins 26-28. In addition, the ER may be involved in lipid and steroid biosynthesis and is a major intracellular storage depot of calcium ions 29-31. The ER also contains multiple signaling molecules involved in intracellular signaling pathways. For the pancreatic β cell, the ER is extremely important to maintain efficient insulin production and secretion.

In regards to protein synthesis, the ER contains numerous chaperones, foldases, oxidoreductases, and isomerases to achieve efficient folding of proteins. In addition, the

ER compartment contains a reliable quality control system which guarantees homeostasis of the ER lumen. The state of ER homeostasis, or equilibrium, is defined as the unique dynamic balance between the functional demand on the ER and the capacity of the ER to respond. Pertaining to protein production, ER homeostasis would encompass the folding capacity of the ER following increased protein translational influx into the ER. The extensive ER network is extremely sensitive to alterations in homeostasis, which may 12

result from the accumulation of unfolded or misfolded proteins in the ER lumen, changes to the calcium flux across the ER membrane, or alteration to the redox potential of the ER lumen 32, 33. ER homeostasis can also be modified by signals emanating from the extracellular milieu: alterations in nutrient content such as amino acid deprivation, elevation of fatty acid or glucose concentration also perturb ER homeostasis 30-33. In addition, several drugs and chemical compounds have the ability to upset the homeostatic balance of the ER. Experimentally, the equilibrium of the ER can be offset in cell lines or animal models using chemical agents: these include tunicamycin, an inhibitor of N-linked glycoslation, and thapsigargin, an inhibitor of the sarco-endoplasmic reticulum Ca2+

ATP-ase (SERCA). Nevertheless, regardless of the inciting factor, the condition in which

ER homeostasis is perturbed is entitled “ER stress”.

1.5. Unfolded Protein Response

Once ER homeostasis has been perturbed and ER stress has been induced, the ER initiates an adaptive cellular signaling cascade that attempts to alleviate ER stress and restore ER homeostasis: this is known as the unfolded protein response (UPR) 30, 34.

Initially, the UPR was described in the budding yeast Saccharomyces cervisiae, where the ER transmembrane protein kinase Ire1p senses ER stress and activates the transcriptional expression of genes involved in protein folding and glycosylation and membrane biogenesis 34-36. In higher-order animals, the basic adaptive UPR mechanism is phylogenetically preserved although the complexity is increased to encompass protein 13

translational control and activation of apoptotic pathways 37-39. Thus, commencement of the UPR instigates an adaptive signaling response that attempts to restore ER homeostasis through four distinct mechanisms: the UPR increases the expression of protein-folding and modifying genes to facilitate protein folding and egress from the ER, attenuates protein translation in order to limit protein influx into the ER, activates the ER-associated proteasomal degradation (ERAD) to remove ER stress-inducing unfolded or misfolded proteins, and, in the event that ER homeostasis is not restored, initiates ER stress- mediated apoptotic pathways.

Perception of ER stress is achieved through the presence and response of three specific ER transmembrane UPR master regulators: these are activating transcription factor 6 (ATF6), inositol-requiring enzyme 1(IRE1), and double-stranded RNA-activated kinase (PKR)-like ER kinase (PERK) (Figure 1.3). An ER-resident chaperone, immunoglobulin heavy chain-binding protein (BiP, or glucose-regulated protein 78,

GRP78) binds to the ER luminal domains of each transducer, maintaining their inactive state. Upon ER stress induction, BiP is sequestered away by the increasing volume of unfolded or misfolded proteins in the ER, leaving the UPR transducers amenable to activation. Subsequently, the transducers alter the activation status of distinct downstream protein effectors and modulate gene expression in an ER-to-nucleus signaling cascade termed the UPR. The initial response of the UPR is adaptive and aims to enhance the ER folding capacity by increasing the expression of ER chaperones and modifying enzymes.

In addition, the protein load on the ER is decreased by a dual mechanism: decreasing protein influx into the ER by translational repression and mRNA degradation, and 14

increasing the efflux of accrued proteins via enhancing ER-associated degradation

(ERAD) and autophagy 40-42. To maintain cellular homeostasis and obviate hyperactivation of UPR signaling, the UPR has an integrated feedback control system that can dampen the activation status of the UPR transducers and their downstream effectors. Finally, the UPR also has an inherent ability to promote cell survival factors or death effectors based on the nature, severity, and duration of the inciting ER stress inducer.

1.5.1. ATF6

ATF6 is a single-pass type II ER transmembrane protein with the cytoplasmic

NH2-terminal domain encoding a transcription factor of the basic-leucine zipper (b-ZIP) family. The ER luminal domain of ATF6 is bound by the central UPR regulator, BiP 37,

43. Following ER stress, BiP titrates away from ATF6, revealing a Golgi localization signal, permitting the relocation of the 90kDa ATF6 protein from the ER to the Golgi.

There, ATF6 undergoes regulated intramembraneous proteolysis by the sequential enzymatic cleavages by site-1 protease (S1P) and site-2 protease (S2P), releasing a

37, 44, 45 50kDa NH2-terminal proteolytic fragment, which enters the nucleus . ATF6 binds to the cis-acting ER stress-response element (ERSE) in the promoter region of target genes such the ER chaperones BiP, glucose-regulated protein 94 (GRP94), protein disulfide isomerase (PDI), calreticulin, and ER protein 72 (ERp72) 37, 46. The resulting 15

increase in ER chaperone content enhances protein folding in the ER in an attempt to assuage ER stress due to accretion of unfolded proteins (Figure 1.3).

1.5.2. IRE1

IRE1 is a single-pass type I ER transmembrane protein that comprises serine- threonine kinase and endoribonuclease moieties in the cytoplasmic COOH-terminal domain and an ER stress-sensing region in the ER luminal NH2-terminal domain and is highly conserved from yeast to humans 37, 47, 48. There are two IRE1 isoforms: the IRE1α isoform is expressed in all cells whereas the IRE1β isoform is restricted to the gastrointestinal tract 49, 50. Pursuant to ER stress induction, BiP dissociates from the IRE1 luminal domain, allowing the dimerization of IRE1 molecules with subsequent trans- autophosphorylation, which triggers the activation of the cytoplasmic endoribonuclease domain 51, 52. Active, phosphorylated IRE1 (P-IRE1) entraps the mRNA of the transcription factor X-box binding protein-1 (XBP-1) and endoribonucleolytically splices out a 26 nucleotide intron, generating spliced XBP1 mRNA (sXBP1) 53-55. IRE1 releases sXBP1 mRNA, which encodes a b-ZIP transcription factor that translocates to the nucleus and binds to the ER stress response-element (ERSE; CCAAT-N9-CCACG),

ERSE-II (ATTGG-N-CCACG) or UPR-element (UPRE; TGACGTGG) in the promoter of various genes, including those involved in protein maturation, folding, and ER export

56. Other target genes of sXBP1 consist of those genes that encode proteins involved in

ERAD, such as ER degradation-enhancing α-mannosidase-like protein (EDEM) 57, 58. 16

Thus, the coordinated effort of IRE1 activation and XBP1 splicing function to increase the folding capacity of the ER while simultaneously decreasing the protein load on the

ER by enhancing protein degradation.

1.5.3. PERK

The remaining UPR transducer is PERK which, like IRE1, is a single-pass type I

ER transmembrane protein with its NH2-terminal domain acting as an ER stress sensor in the ER lumen 38. PERK activation proceeds in a manner similar to that of IRE1: BiP dissociation permits the dimerization of PERK molecules, followed by trans- autophosphorylation to yield phosphorylated PERK (P-PERK) 31, 59, 60. The kinase domain of P-PERK directly phosphorylates the serine residue at position 51 on the α subunit of eukaryotic initiation factor 2 (eIF2α) 31, 45, 61, 62. P-eIF2α inhibits the GDP-GTP exchange by eIF2B, thus reducing the formation of the active translational initiation ternary complex which consequently drastically reduces protein translation. Thus, the activation of PERK leads to protein translation attenuation decreases the workload on the

ER, permitting adaptive restoration of ER homeostasis.

In contradiction to the general attenuation of protein translation, there occurs selective and more efficient translation of specific UPR target genes, including ATF4 45,

63, 64. ATF4 functions as a bZIP transcription factor to induce the expression of the genes involved in amino acid transport, glutathione biosynthesis and reduction of oxidative stress. In addition, ATF4 induces the expression of the specific UPR target genes growth 17

arrest and DNA damage gene 34 (GADD34) and C/EBP-homologous protein (CHOP) 65.

As part of the integrated feedback control system of the UPR, GADD34 interacts with protein phosphatase 1c (PP1c) and functions to remove the phosphate moiety from eIF2 to allow recovery of protein translation and restore protein synthesis 37, 66, 67. Prolonged

ER stress conditions extends the presence of ATF4, leading to the induction of CHOP expression, which is involved in ER stress-mediated apoptotic signaling. Overall, PERK activation permits temporary recovery from ER stress and activation of apoptosis if ER homeostasis is not achieved.

Figure 1.3: The unfolded protein response (UPR). In response to ER stress, the three arms of the UPR are activated: (1) PERK signaling leads to eIF2α phosphorylation and translational attenuation with paradoxical increased ATF4 transcription, which leads to induction of specific genes; (2) ATF6 is cleaved in the Golgi releasing a transcription factor that increases the expression of ER chaperones, CHOP, and XBP-1; (3) signaling through IRE1 leads to splicing of XBP-1 mRNA, leading to XBP-1-mediated upregulation of ER chaperones, ERAD proteins and p58IPK.

1.6. ER stress-mediated apoptosis

Activation of the UPR by ER stress is an attempt to restore ER homeostasis and maintain cell viability 51, 68. However, persistent, unresolved ER stress forces the UPR to initiate apoptosis-inducing signaling 5, 69. The UPR has two fundamental apoptotic signaling mechanisms: IRE1-JNK signaling and induction of CHOP expression. The former signaling pathway involves the chronic activation of IRE1, which recruits the adaptor protein TNF receptor-associated factor 2 (TRAF2). The IRE1-TRAF2 complex enlists the apoptosis signal-regulating kinase 1 (ASK1), leading to the phosphorylation of c-Jun N-terminal kinase (JNK) 70. JNK influences apoptotic pathways by phosphorylation of B-cell lymphoma 2 (Bcl2) at the ER membrane suppressing its anti-apoptotic activity.

JNK also phosphorylates Bcl-2 homology domain 3 (BH3)-only Bcl2 members, such as

Bim, enhancing their pro-apoptotic role. The latter apoptotic signaling mechanism involves the increase in CHOP expression via the PERK-ATF4 and ATF6 arms of the

UPR 64, 71. CHOP represses the promoter of the Bcl-2 gene, decreasing the level of the anti-apoptotic Bcl-2 protein, allowing unrestricted activity of the pro-apoptotic BH3-only proteins 72, 73.

1.7. Physiological ER stress signaling

The ability of the ER to perceive stress and activate a specific response to restore homeostasis indicates that this response is an intrinsic physiological event. In the pancreatic  cell, the overwhelming increase in insulin production following glucose 20

challenge imparts transient stress on the ER and necessitates UPR activation to maintain

ER integrity 30, 69, 73. Physiological ER stress signaling has also been shown in the differentiation of B lymphocytes into antibody-secreting plasma cells 37, 74, 75. In myoblast differentiation, elements of the UPR were also activated 76. ER stress signaling has also been demonstrated in liver cells, osteoblasts and the renal tubular epithelium 77. In the differentiation of T helper cells and during T cell activation, activation of the ER stress and UPR were also noted 78, 79. Thus, UPR activation in response to ER stress is prevalent in a wide range of physiological roles and is involved in diverse developmental and metabolic processes.

1.8. Pathological ER stress signaling

Since ER stress and activation of the UPR can lead to the induction of apoptosis, upsetting the ER homeostatic balance, such as that brought about by an increase in protein misfolding or a decrease in the ER folding capacity, has the potential to lead to cellular dysfunction and disease. In numerous neurodegenerative disorders in which the formation of protein aggregates is a prominent feature, ER stress and UPR activation have been demonstrated to be integral to pathogenesis. These diseases include

Parkinson‟s disease (PD), Alzheimer‟s disease (AD), retinitis pigmentosa (RP), amyotrophic lateral sclerosis (ALS), and Huntington disease (HD) 80-84. The UPR also becomes activated during viral infections as a means to control the replication of viruses intracellularly. PERK signaling attenuates viral protein synthesis 85. However, some 21

viruses including herpes simplex virus type I (HSV-I) have evolved to counteract this regulatory mechanism 86. In the field of cancer, hypoxia-induced UPR is strongly linked to tumor growth 87, 88. CHOP and XBP-1 signaling has been observed to be augmented in carcinogenesis and implicated with tumor growth 89, 90. The physiological role of UPR activation in plasma cell differentiation is extended in multiple myeloma where IRE1 and

XBP-1 signaling is significantly increased 91. In the pathogenesis of atherosclerosis, oxidized lipids and homocysteine induce ER stress in vascular cells, while cholesterol in macrophages similarly stimulates the UPR 92, 93.

ER STRESS-MEDIATED DIABETES

Pancreatic β cells are particularly sensitive to alterations in ER homeostasis such that ER stress signaling and UPR activation have been strongly associated with diabetes pathogenesis. There are several physiological, environmental, and genetic conditions that alter the ER homeostasis of pancreatic β cells. Alterations in blood glucose or fatty acid levels due to diet or genetic disease impart physiological stress on β cells that are transduced into ER stress with subsequent activation of the UPR 94, 95. In addition, mutations in ER stress transducer or effector genes similarly cause ER stress and UPR activation, leading to β cell dysfunction or apoptosis.

1.9. Genetic forms of ER stress-mediated diabetes

ER homeostasis is essential for the β cell‟s role in insulin production and genetic mutations that cause ER stress may engender β cell dysfunction. Mutations in the genes encoding ER-related proteins have the potential to perturb ER homeostasis. ER stress- mediated pancreatic  cell death underlies the pathogenesis of a number of specific genetic diseases including Wolcott-Rallison syndrome, permanent neonatal diabetes

(PND), and Wolfram syndrome (Figure 1.4).

Mutations in the EIF2AK3 gene, which encodes the ER stress transducer PERK, leads to a condition known as Wolcott-Rallison syndrome. In this disease, decreased

PERK kinase activity would diminish total eIF2 phosphorylation, preventing the attenuation of protein translation. Consequently, persistent proinsulin translation and protein influx into the ER would culminate in ER stress-mediated pancreatic  cell apoptosis. In PERK-/- mice, diabetes develops in the immediate neonatal period with associated elevations in IRE1 phosphorylation in the pancreatic islets, suggestive of ER stress 96, 97. However, meticulous examination of PERK-/- mice revealed defects in fetal pancreatic  cell development, decreasing the overall  cell mass in addition to dysfunctional  cells 97. Therefore, not only is a functional UPR signaling network necessary for maintaining pancreatic  cell function, but it is also a requirement for successful in utero pancreatic  cell generation. 23

Genetic mutations in the gene encoding eIF2α, a downstream signaling partner of the PERK pathway also has significant diabetogenic effects. Mutations at the serine-51 phosphorylation site of eIF2 in the transgenic Eif2si+/tm1Rjk mouse lead to obesity, pancreatic  cell dysfunction, and diabetes 98. Mice homozygous for this mutation (Eif2si tm1Rjk/tm1Rjk) succumb to hypoglycemia during the neonatal period, with severe pancreatic

 cell defects noted 99. Knockout of the PERK inhibitor, P58IPK, in a mouse model, also leads to a gradual development of diabetes due to increased apoptosis of pancreatic

 cells, further highlighting the involvement of ER stress pathways and the PERK arm of

UPR signaling in pancreatic  cell death and diabetogenesis 100.

Permanent neonatal diabetes (PND) can manifest as a result of mutation in the transcription factors insulin promoter factor-1 (IPF-1) and forkhead box-P3 (FOXP3) in addition to the insulin secretory components glucokinase (GCK) and the pancreatic  cell

ATP-sensitive K+ channel 101. However, ER stress-mediated pancreatic  cell death leading to PND may also arise through mutations in the preproinsulin (INS) gene 22, 23.

The Akita mouse model of diabetes harbors a mutation in the Ins2 gene, leading to the substitution of cysteine for tyrosine at amino acid 96. This mutation prevents the formation of a critical disulphide bond, and leads to proinsulin misfolding, instigating ER stress and activation of the UPR and ultimately, pancreatic  cell death 98. Similarly, the

Cys95Ser mutation in the Ins2 gene in the Munich mouse disrupts proinsulin folding, causing ER stress and UPR activation, and leads to severe  cell loss and development of diabetes 103. In humans, preproinsulin gene mutations associated with monogenic diabetes 24

have been termed „mutant INS-gene-induced diabetes of youth‟ (MIDY) 22-24. Expression of MIDY mutations in MIN6 insulinoma cells leads to induction of ER stress 104. Thus, the impact of INS gene mutations coupled with the burden of insulin production on the

 cell combines to generate ER stress, leading to UPR activation,  cell dysfunction and contributes to diabetes.

1.10. Acquired forms of ER stress-mediated diabetes

In contrast to the genetic mutations that elicit primary ER dysfunction and contribute to early-onset diseases, including diabetes mellitus, secondary ER dysfunction arises as a result of other underlying conditions. This acquired form of ER dysfunction is involved in the progression of age-related diseases, such as diabetes mellitus and neurodegeneration.

The concentration of blood glucose fluctuates continually as a result of ingestion of nutrients, metabolic activity and release of gluconeogenic hormones. The pancreatic

 cell responds to high glucose levels by synthesizing and secreting insulin. Transient or chronic hyperglycemic conditions induce phosphorylation of IRE1 in  cells 8. Sustained hyperglycemia, however, leads to chronic hyperactivation of IRE1, precipitating the formation of oligomers of P-IRE on the ER membrane. Oligomeric P-IRE1 molecules induce conformational alterations to the endoribonuclease domains such that alternative

ER-localized mRNA, including insulin mRNA, are recognized and degraded 8, 105, 106.

Prolonged IRE1 activation also leads to TRAF-mediated JNK activation and apoptosis 70, 25

83. Thus, during periods of prolonged hyperglycemic (glucotoxic) conditions,

IRE1 hyperactivation is promoted and results in insulin degradation and UPR-mediated

 cell apoptosis (Figure 1.4)

Type 2 DM has long been associated with increased body mass index (BMI) and obesity. Circulating free fatty acids (FFAs), especially the commonly-found saturated fatty acid palmitate (C16:0), results in the activation of UPR signaling in pancreatic

 cells as demonstrated by PERK and eIF2 phosphorylation and the induction of ATF4 and CHOP expression 107, 108. Palmitate also leads to IRE1 and ATF6 activation and increases the expression of numerous ER chaperones 107, 109. There has been a dramatic increase in obesity in the United States over the past few decades. With increased adiposity and subsequent metabolic dysregulation, the elevation in circulating free fatty acids has the potential to have lipotoxic effects on  cells, leading to diabetes progression.

Other acquired forms of ER stress in the  cell include islet amyloid polypeptide

(IAPP), reactive oxygen species (ROS), and inflammatory cytokines (Figure 1.4).

Pancreatic  cells secrete other molecules in addition to insulin, such as the 37kDa islet amyloid polypeptide (IAPP). Islet amyloid is commonly found in the islets of T2DM patients at autopsy and has been reported to contribute to  cell dysfunction 110. IAPP is highly amyloidogenic and spontaneously forms ER membrane-destroying amyloid sheets, leading to ER stress 111-113. With the increased demand for insulin biosynthesis, there is simultaneous increased activity of oxidoreductase enzymes to form disulfide 26

bonds in insulin. Increased oxidative reactions in the ER generate toxic reactive oxygen species (ROS), which causes calcium leak from the ER, triggering activation of the UPR

94. Inflammation is a predominant feature in both T1DM and T2DM. Inflammatory cytokines interleukin-1β (IL-1β) and interferon-γ (IFN-γ) have been reported to induce nitric oxide (NO) signaling, which decreases sarco-endoplasmic reticulum Ca2+ ATPase

2b (SERCA2b) pump activity, leading to the depletion of ER Ca2+ stores and inducing

ER stress in β cells 94. Thus, inflammatory signals may lead to ER stress-mediated pancreatic β cell dysfunction or apoptosis, contributing to diabetogenesis.

It is apparent that the ER is a fundamental organelle within the cell. Primary or secondary ER dysfunction has the potential to contribute to various forms of disease, including diabetes and neurodegeneration. Therefore, it is paramount to understand the signals emanating from ER stressed cells and identify an approach to resolve ER stress in order to dissipate ER dysfunction, maintain cell survival and prevent the progression to disease.

Figure 1.4: Physiological and pathological ER stress and UPR activation in the pancreatic β cell. ER stress and UPR activation arise from diverse environmental and genetic conditions that perturb the ER homeostatic balance in the pancreatic β cell.

Hyperglycemia can induce both physiological or pathological ER stress; circulating free fatty acids (FFAs) leads to ER stress; genetic conditions, including Insulin gene mutations, Wolfram syndrome, and Wolcott-Rallison syndrome, lead to diabetes mellitus; islet amyloid polypeptide (IAPP) fibrils cause ER stress in the β cell; reactive oxygen species (ROS) perturb ER homeostasis leading to ER stress; and inflammation, cause ER stress and UPR activation. 28

WOLFRAM SYNDROME

Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder with a prevalence of 1/100,000-700,000, characterized by early-onset, insulin-dependent DM and progressive optical atrophy (OA) in the first decade of life. The association of DM and optical atrophy was first described by the German ophthalmologist, Albrecht von

Gräfe in 1858 114. Eighty year later, Wolfram and Wagener characterized for patients with a syndrome consisting of DM and optical atrophy, leading to the name Wolfram syndrome 115, 116. While juvenile-onset DM and OA are required for the diagnosis, many

Wolfram syndrome patients also develop a number of associated symptoms including central diabetes insipidus, sensorineural hearing loss, peripheral neuropathy, urinary tract atony, ataxia, and diverse psychiatric illnesses including dementia, severe depression, and psychosis 117. For this reason, the acronym DIDMOAD (diabetes insipidus, diabetes mellitus, optical atrophy, and deafness) has also been attributed to the disease. Barrett and

Bundey (1997) delineated the chronological appearance of clinical symptoms of Wolfram syndrome, as reproduced in Figure 1.5. However, more recent neuroradiological imaging studies and thorough neurological examinations have found cerebellar atrophy and ataxia, respectively, as early as the beginning of the second decade of life in Wolfram patients.

Figure 1.5: Chronological appearance of Wolfram syndrome symptoms. DM = diabetes mellitus, OA = optic atrophy, DI = diabetes insipidus, D = deafness, Renal = renal tract abnormalities, Ataxia = neurological abnormalities (reproduced from Barrett and Bundey, 1997).

The vast majority of Wolfram syndrome cases arise as a result of homozygous or compound heterozygous mutations in the gene encoding Wolfram syndrome-1 (WFS1,

Wolframin) on the short arm of chromosome 4. WFS1 was identified independently by two groups 119, 120. However, a small percentage of Wolfram syndrome patients have mutations in the gene encoding WFS2 (CDGSF iron sulfur domain-2, CISD2), on the long arm of chromosome 4 121, 122. Wolfram patients with mutations in the Wfs2 gene do not develop diabetes insipidus, but have profound gastrointestinal ulceration and bleeding

122. Interestingly, there have been a few case reports linking Wolfram syndrome to deletions of mitochondrial DNA (mtDNA), but the cause of the association is unknown

123.

Examination of various tissues demonstrates that WFS1 mRNA is expressed in almost all adult tissues, with highest expression found in the brain and pancreas 124.

WFS1 protein localizes to the ER as a multi-pass transmembrane protein, with the C- terminal and N-terminals located in the ER lumen and cytoplasm, respectively 125, 126. The expression of WFS1 is increased following induction of ER stress and is cooperatively regulated by IRE1 and PERK signaling 127, 128. One goal of increasing WFS1 protein content in the cell during the UPR is in the restoration of ER homeostasis since WFS1 functions in a negative feedback loop, exerting an inhibitory effect on XBP-1 and ATF6

129. In Wolfram syndrome, loss of WFS1 function in  cells renders them susceptible to chronic hyperactivation of the UPR, leading to  cell dysfunction and apoptosis. Mice harboring a pancreatic  cell-conditional Wfs1 gene deletion display induction of ER stress markers, fewer secretory vesicles, with enhanced apoptosis and reduced overall 31

pancreatic  cell mass 130. These observations suggest that WFS1 protein counteracts ER stress and mutations in Wfs1 gene in Wolfram syndrome shifts the equilibrium of ER homeostasis, initiating persistent UPR activation, resulting in  cell pathology.

A recent report by Hatanaka et al (2011) revealed that the WFS1 protein also localizes to insulin secretory granules of pancreatic  cells. The authors reported the role of WFS1 in granular acidification, insulin processing and secretion 131. Since insulin secretion in response to glucose stimulation is the hallmark of the  cell, this discovery further highlights the potential dysfunction that may ensue in the absence of functional

WFS1 protein (Figure 1.6).

Figure 1.6: Roles of WFS1 in the pancreatic β cell. WFS1 protein expression is increased by ER stress and performs a number of functions in the β cell: (1) WFS1 on the

ER membrane regulates ATF6 expression to alleviate UPR activation and restore homeostasis, (2) WFS1 co-regulates the expression of AATF, preventing apoptosis, and

(3) the presence of WFS1 on secretory granules permits granular acidification required for insulin maturation.

1.11. Mutations leading to Wolfram syndrome

The Wfs1 gene encompasses 33.4kb of genomic DNA, transcribing as a 3.6kb mRNA that encodes the 890 amino acid WFS1 protein. The Wfs1 gene consists of eight exons, the first of which is non-coding. Exons 2-7 and most of the final and largest exon,

8, encode the WFS1 protein. There are many mutations in the Wfs1 gene that result in

Wolfram syndrome. These mutations, which number over one hundred, are distributed over the entire gene and include missense mutations, frameshifts, and amino acid deletions and insertions (Figure 1.7).

Figure 1.7: WFS1 structure and mutations. Hypothetical structure of WFS1 based on hydrophobicity/hydrophilicity plots of the amino acid sequence, showing nine predicted transmembrane domains. Mutations include nonsense, missense, deletions and insertions

(reproduced from Khanim et al (2001)).

1.12. Allelic polymorphisms of WFS1 as a diabetes risk factor

Recently, genome-wide association studies (GWAS) have successfully revealed susceptibility genes for T2DM. Some of these genes include the E23K variant of the K+ inwardly-rectifiying channel subfamily J, number 11 (KCNJ11), the peroxisome proliferator-activated receptor-γ (PPARG) P12A variant, and the transcription factor 7- like 2 (TCF7L2) genes133-137. However, the candidate-gene approach is also effective to identify those genes that confer susceptibility to common diseases. Since WFS1 mutations lead to Wolfram syndrome and DM is one of the major features of this syndrome, there have been a number of studies investigating if allelic variants in WFS1 could be lead to increased susceptibility for T1DM or T2DM progression.

The first candidate-gene report by Awata et al (2000) focused on the possible contribution of allelic variations in WFS1 as a non-autoimmune genetic basis for T1DM susceptibility. The authors identified four common missense mutations (R456H, G576S,

H611R, and I720V) in WFS1, with the R456H, H611R, and I720V alleles being strongly associated with T1DM. The association of WFS1 alleles with T2DM is even stronger.

Minton et al (2002) studied five non-synonomous SNPs encoding distinct amino acid changes in the UK population and found that the R-allele at residue 456 and the H-allele at residue 611 were over-transmitted to T2DM-affected offspring. Furthermore, they reported that the H611 allele is present in more T2DM than control individuals, strongly suggesting that the WFS1-R611 allelic variant was protective from T2DM progression.

This finding was confirmed in a separate study focusing on Japanese T2DM patients 140. 36

Non-coding SNPs in WFS1 have also been strongly associated with T2DM; however, likelihood ratio test suggest that the H611R allele is the functional variant explaining the association 141. A Swedish study found borderline statistical significance for R611 with a reduced risk for T2DM 142. Interestingly, Florez et al (2008) suggested that WFS1 allelic variants may confer a protective role through an improvement in β cell function. Indeed, they proposed that the R611 allele homozygotes demonstrated higher insulinogenic indices 143. In accordance with this observation, Chistiakov et al (2011) showed the protective role of R611 amongst other SNPs against T2DM in a Russian population.

Furthermore, the authors demonstrated that the R-611 was evolutionary conserved by multiple pairwise alignment of the human WFS1 protein sequence with primates and rodents 144.

Thus, allelic variation in WFS1 may alter the risk for development of DM. Since

WFS1 functions in the β cell to alleviate ER stress by counteracting chronic UPR activation, promote anti-apoptotic behavior, and increase intravesicular insulin maturation, it seems fitting that allelic variants of WFS1 could induce β cell dysfunction and fragility, accelerating the development of DM.

1.13. Adaptive alterations to WFS1 deficiency

In humans with Wolfram syndrome, the chronological appearance of clinical symptoms has been well characterized (Figure 1.4). For the onset of DM, the tender age of six is the median, indicating that pancreatic β cell mass has slowly degenerated over 37

the course of years due to the loss of functional WFS1 protein. It is quite likely that β cells undergo adaptive changes in gene expression in order to maintain insulin secretion during chronic UPR activation. In addition, WFS1 deficiency may signal an alteration in the expression of microRNA as a compensatory response.

However, mouse models of Wolfram syndrome do not accurately recapitulate the human disease. The mice display progressive glucose intolerance with insulin deficiency, consistent with diabetes 130. Nevertheless, the diabetic phenotype is not strong due to the persistence of islets despite the absence of WFS1 protein. Animal models are not perfect for examining human disease due to their increased metabolic rates and differences in gene number and expression. The incomplete phenocopy of the disease in mouse models highlights the possibility that the surviving pancreatic β cells have somehow adapted to the absence of WFS1 by altering the expression of distinct genes or genetic regulators.

1.13.1. MicroRNA

MicroRNAs (miRNAs) are small, noncoding, 21-23 nucleotide RNA molecules that impact gene expression through post-transcriptional regulation 145, 146. Initially, miRNA were discovered in Caenorhabditis elegans in 1993 147, 148. Functionally, miRNA are specific gene silencers that base pair with the 3‟ untranslated region (UTR) of target mRNA, leading to the inhibition of translation or affecting mRNA stability and degradation 146, 149. 38

In the β cell, there are a number of active miRNA that control insulin content and secretion. Most notably, miR-375 plays a negative role in glucose-stimulated insulin secretion 150. MiR-124a affects the expression of a number of genes in the β cell, including the transcription factors FoxA2 and Pdx1, secretory protein SNAP25 and

Rab3a, and ion channels Kir6.2 and Sur1 151, 152. Recently, the list of β cell-active miRNAs includes miR-130a, miR-200, and miR-410, which have been shown to be involved in the regulation of insulin secretion 153. Melkman-Zehavi et al (2011) reported that knockdown of miR-24, miR-26, miR-182, or miR-148 lead to the downregulation of insulin promoter activity and insulin mRNA levels.

In relation to ER stress, there are a few miRNAs reported to date. Behrman et al

(2011) demonstrated the ER stress-mediated induction of miR-708. Interestingly, the expression of miR-708 was regulated by the ER stress-induced transcription factor

CHOP. The sequence for miR-708 is embedded within an intron of the CHOP-regulated gene Odz4, such that Odz4 and miR-708 are co-regulated by CHOP. The authors demonstrated that miR-708 targets rhodopsin mRNA and suggested that the induction of miR-708 is an additional mechanism in the UPR to decrease protein influx into the ER in an attempt to restore ER homeostasis 155. In a similar manner, the UPR-related transcription factor XBP-1 induces the expression of miR-346, which targets transporter

1 (TAP1), decreasing the ER load 156. There are also a number of ATF6-controlled miRNAs, including miR-455, whose suppression by ATF6 permits translation of its target mRNA, calreticulin, an ER chaperone involved in restoring ER homeostasis 157. In 39

addition, modulation of the UPR by decreasing the expression of XBP1 is the goal of the

PERK-induced miR-30c-2-3p 158.

It is clear that miRNA play a prevalent role in β cell function. With the identification of an ER stress-related miRNA, it is tempting to propose that β cells in

Wolfram syndrome, which are undergoing chronic ER stress conditions, may have altered the expression profile of distinct miRNAs as compensatory survival mechanisms.

SIGNIFICANCE OF STUDYING WFS1 AND ER STRESS FOR DIABETES

As outlined above, the subtypes of diabetes are delineated based on their pathogenic mechanism leading to hyperglycemia. However, it is the functional state of the pancreatic  cell and the critical  cell mass within the pancreas that defines whether blood glycemia can be regulated. During the development of diabetes,  cell dysfunction and reduced  cell mass accelerate the progression (Figure 1.7). Since ER stress and UPR activation are inherent features of the  cell, it is not surprising that disturbance of ER homeostasis can lead to  cell dysfunction and death, and hence, reduction in the  cell mass (Figure 1.8)

Given the fact that ER stress is elevated and the UPR is chronically activated during the pre-diabetic phase, it may be possible to study this association with two goals in mind. First, examining the role of ER stress-regulating genes, such as WFS1, in maintaining  cell viability may lead to the identification of unique compounds or 40

signaling pathways that promote  cell survival. In current diabetic treatment, weight- loss, bariatric surgery, and dietary modifications have the potential to reverse diagnosis of diabetes. In contrast, diabetic medications attempt to extend the function and number of the remaining  cell mass without alleviating the underlying condition. The outcome of this first research goal would be to develop an ER stress-mitigating therapy that would alleviate ER stress in  cells during the pre-diabetic phase with the hope of prolonging  cell viability and preventing  cell loss. Ultimately, this would delay or prevent diabetes progression.

Second, exploring the association of chronic ER stress and  cell viability may lead to the discovery of biomarkers of ER stressed  cells. Currently, the pre-diabetic phase is screened by periodic assessment of blood glucose and glycosylated A1C levels.

These clinical readings, while useful is predicting and diagnosing diabetes, do not directly assess the functional state of the  cell. Whether ER stress in  cells leads to the release of distinct biomarkers is unknown, but it remains a possibility. The potential advantage of determining the functional state of an individual‟s  cells months-to-years prior to hyperglycemic readings as a result of severely diminished  cell mass would be extremely beneficial. Biomarker screening for ER stressed- cells would permit the use of ER stress-regulating chemical or biological compounds to restore  cell function and maintain  cell mass, preventing diabetes progression.

Figure 1.8: The therapeutic and biomarker potential of the ER stress pathway in diabetes. ER stress level fluctuates in the pancreatic  cell as a physiological response to the increased demand of insulin biosynthesis and exposure to blood-borne nutrients.

During diabetogenesis, elevated ER stress contributes to pancreatic  cell loss. The remaining  cells have increased workload, thus pushing ER stress conditions to much higher levels. Examination of ER stress and UPR activation in  cells may reveal novel pre-diabetic biomarkers that indicate the  cell mass is (1) undergoing chronic ER stress or (2) dramatically diminished prior to clinical diabetes onset. The ability to modulate ER stress levels in  cells by chemical or biological compounds may lead to maintenance of

 cell mass such that diabetes onset is prolonged or prevented. 42

CHAPTER II

ALLELIC VARIANTS OF WFS1 GENE CONTRIBUTE TO PANCREATIC BETA

CELL VIABILITY BY UPREGULATION OF NETRIN-1 EXPRESSION

SUMMARY

Wolfram syndrome is a rare disease characterized by juvenile-onset, nonautoimmune diabetes mellitus and progressive optical atrophy. The vast majority of

Wolfram patients have mutations in the Wfs1 gene. The roles of WFS1 protein in the pancreatic β cell include the maintenance of ER homeostasis through the regulation of

ATF6 signaling and secretory granule acidification 128, 129, 131, 159. In addition to the numerous mutations that lead to the development of Wolfram syndrome, the Wfs1 gene has also been associated with low-frequency sensorineural hearing loss and psychiatric symptoms. Genome-wide association studies and candidate gene studies have lead to the association of Wfs1with increased risk for development of T2DM 138-143, 160-164. In particular, the SNP, H611R, has been linked with T2DM.

In this chapter, the two allelic variants histidine (H) and arginine (R) at amino acid residue 611 of WFS1 were compared. It was determined that while expression of both alleles lead to an increase in both cell viability and insulin secretion, the minor allele, R611, had an increased cytoprotective role. Gene expression comparative study of the alleles revealed that netrin-1 signaling was increased following WFS1 expression and 43

that the protective WFS1-R611 allelic variant increased the expression of netrin-1 to a greater extent. Netrin-1 has been previously reported to play a role in pancreatic morphogenesis and protection of β cells from hyperglycemia-induced apoptosis 165-167.

These data collectively suggest that in addition to the reported roles of WFS1 in alleviation of chronic UPR conditions and involvement in secretory granule acidification and insulin maturation, WFS1 also maintains pancreatic β cell survival through the increase in Netrin-1 signaling.

INTRODUCTION

During the pre-diabetic phase of diabetogenesis, there is a profound reduction in pancreatic β cell mass. Whether this decrease is mediated by β cell apoptosis or loss of lineage fidelity, induction of ER stress and UPR activation is among the list of contributory factors. The necessity to maintain normoglycemia imparts increased burden on the residual β cells to manufacture sufficient insulin to regulate blood glucose.

Increased demand of amplified insulin synthesis exhausts the folding capacity of the ER of the remaining β cells, leading to chronic ER stress and UPR activation. There are currently no known pharmaceutical options to alleviate ER stress in the β cell as a therapeutic approach to maintain β cell viability and stave off β cell loss.

As outlined in the introductory chapter, deficiency of WFS1 protein leads to chronic ER stress and hyperactivation of the UPR in pancreatic β cells, culminating in β cell dysfunction and death, and promotes the pathogenesis of DM in Wolfram syndrome.

WFS1 functions in a number of roles in the β cell, depending on its location and the functional state of the β cell. As an integral ER membrane protein, WFS1 expression is increased by ER stress and is involved in maintaining the homeostatic balance of the ER through the degradation of ATF6 128, 129. In addition, WFS1 controls the expression of the anti-apoptotic factor AATF 159. More recent evidence indicates that WFS1 also localizes to secretory vesicles in pancreatic β cells where it promotes insulin maturation and secretion 131. 45

In Wolfram syndrome, it is the loss of functional WFS1 protein that causes ER stress, chronic UPR activation and β cell death. Thus, Wolfram syndrome has been used as a prototype to study chronic ER stress conditions and UPR hyperactivation in the pancreatic β cell. Since the presence of WFS1 is necessary to maintain β cell viability and prevent dysfunction, the augmentation of WFS1 expression in pre-diabetic β cells may protect against ER stress, prevent β cell dysfunction and death, such that the β cell mass would be maintained.

There are a myriad of mutations in WFS1 that engender Wolfram syndrome. The online repository maintained by the Kresge Hearing Research Institute at the University of Michigan lists two hundred and twenty-five mutations in the Wfs1 gene, which encompasses one hundred and seventeen base substitutions, seventy-seven deletions and thirty-one insertions. The database also reveals a total of one-hundred and forty-three single nucleotide polymorphisms (SNPs) in Wfs1, including sixty-one synonymous, fifty- one non-synonymous, two insertions, and twenty-nine non-coding polymorphisms 168.

Genomic population studies investigating the involvement of genes and their polymorphisms on diabetes risk have suggested that a number of SNPs in WFS1 are associated with increased T2DM risk. Some of these SNPs are non-coding and their association may be due to the co-segregation with other mutations. One of the SNPs, rs734312, involving a histidine-to-arginine substitution at amino acid position 611

(H611R) is strongly linked to T2DM 138-143, 160-164. However, genome-wide association studies includes a plethora of confounding factors including the wide genetic variation of the populations studied in addition to diverse environmental and metabolic conditions. 46

Thus, direct comparison of the allelic variants at position 611 in a cell line may reveal the protective nature of the R611 allelic variant.

The precise location of the amino acid at position 611 of the WFS1 protein in relation to the ER membrane, lumen and cytoplasm is not known. Hypothetical models of the structure of WFS1 vary in the positioning of the predicted nine transmembrane domains. In the model proposed by Khanim et al (2001), residue 611 lies within the ER membrane as part of the eighth transmembrane domain (Figure 1.5). However, an alternative structure suggested by Alimadadi et al (2011) reveal the location of residue

611 in a cytoplasmic loop between the eighth and ninth transmembrane-spanning regions

(Figure 2.1). The location and function of a particular amino acid may be intimately linked: the location may affect function. The substitution of a particular amino acid that occurs as a result of a polymorphism may affect both location of the protein and function of the protein. In the WFS1 protein at position 611, the major allelic variant is histidine

(H), a positively-charged, aromatic amino acid. Histidine has a pKa of 6.5, which enables easy protonation/deprotonation of the imidazole sidechain at the physiological pH range of the cytoplasm (pH 7.4) and the ER (pH 7.2). This flexibility permits histidine to alternate between embedding within the hydrophobic protein core and being exposed to the environment. For this reason, histidine residues are often in the active or binding sites of a protein. Arginine (R), like histidine, is a positively-charged, polar amino acid. The high pKa value of 12.5 imparts a positive charge on the guanidium group of arginine at all pH ranges, leading to arginine’s preference to be on the surface of a protein. Arginine forms salt-bridges with negatively-charged amino acids, increasing the stability of 47

proteins. Thus, substitution of histidine for arginine at residue 611 may alter the local structure and/or function of WFS1. There are a number of reported histidine-arginine substitutions that lead to various diseases; examples include the H209R substitution in the insulin receptor protein causing Donohue syndrome 170, the H65R change in proinsulin leading to familial hyperproinsulinemia 171, and R311H in the c-erbA beta thyroid hormone receptor in pituitary resistance to thyroid hormones 172. Thus, it is possible that the histidine-to-arginine substitution in WFS1 may alter its function.

In this chapter, the polymorphic variants at position 611 of the WFS1 protein are compared in their relation to β cell function and viability. The findings reveal that augmentation of WFS1 expression leads to an increase in both cellular insulin content and glucose-induced insulin release. In addition, WFS1 increases the viability of β cells when challenged by an ER stress agent, with the WFS1-R611 allele have a stronger effect. To further compare the alleles, gene microarray analysis was performed on cell lines expressing each allelic variant. The results of this analysis indicated an increase in netrin-1 signaling in both allelic variants, with the T2DM-protective arginine variant having greater induction of netrin-1 expression.

Figure 2.1: Hypothetical structure of WFS1protein. Hypothetical structure of WFS1 based on transmembrane protein display software (reproduced from Alimadadi et al

(2001)).

MATERIALS AND METHODS

Cell Culture

The rat insulinoma cell line, INS-1 832/13, was generously provided by

Christopher Newgard (University of Texas Southwestern Medical Center, Dallas, TX).

To generate doxycycline-inducible gene expression, INS-1 832/13 cells had been transduced with a lentivirus bearing the tetracycline repressor construct by Shinsuke

Ishigaki; these cells are termed “INS-1” or “control”). INS-1 cells were cultured in RPMI

1640 medium containing 10% Tetracycline-free FBS, 1% Pen/Strep, 0.1% β- mercaptoethanol, and 1% sodium pyruvate. Doxycycline-inducible WFS1-WT (H611)- expressing INS-1 cells had been previously established by Shinsuke Ishigaki; these cells are termed “WFS1-WT”. To generate INS-1 cells expressing doxycycline-inducible

WFS1-R611, a lentivirus containing human WFS1-R611-FLAG was transduced into

INS-1 832/13 cells stably expressing the tetracycline repressor, pTetR. Transduced cells were selected by incubation in 2 µM Puromycin for fourteen days; these cells are termed

“WFS1-R611”. To induce WFS1 expression, WFS1-WT and WFS1-R611 cells were cultured in 1 µg/mL doxycycline in 5mM RPMI medium for 48 hr prior to protein/RNA isolation. 293FT cells were maintained in DMEM containing 10% FBS, 1% Pen/Strep,

1% MEM-NEAA, 1% Glutamate, 1% Sodium pyruvate and 1% G418. G418-free medium was used for lentiviral production.

Lentiviral Plasmid Construction

Plasmids used for lentiviral-mediated expression included pENTR1A-noccDB, pLenti-CMV/TO Puro, pEF-ENTRA, and pLenti CMV-GFP, generously supplied by Eric

Campeau (UMass Medical School, Worcester, MA) or purchased from Addgene

(Cambridge, MA). The WFS1-R611 allelic variant was generated by mutagenesis of pENTR1A-hWFS1-WT (H611) using the PCR-based KOD-Plus Mutagenesis Kit

(Toyobo, Osaka, Japan) and the following primer pairs: WFS1-H611R-F2: 5’- gctggtggaccaaggccagcttc-3’ and WFS1-H611R-Rev: 5’gcaacagcaggggcacactacagac-3’.

The LR clonase recombination reaction was used to introduce the WFS1-R611 cassette into the pLenti CMV/TO Puro plasmid for inducible expression. For constitutive and traceable expression of either WFS1 allele, the WFS1 gene sequences were transferred by restriction digest and ligation into the pEF-ENTRA plasmid. LR clonase recombination transferred the EF-WFS1 cassettes into pLenti CMV-GFP to generate pLenti-CMV/GFP-

EF1α-hWFS1-H611 (or R611).

Lentiviral Generation, Titration and Transduction

Plasmids used for lentiviral generation included pLP1, pLP2, and pVSVg kindly given by Michael Green (UMass Medical School, Worcester, MA). Lentiviral generation involved the transfection of 293FT cells (Invitrogen, Carlsbad, CA) with the packaging plasmids (pLP1, pLP2, pVSVg) and the specific lentiviral vector (pLenti-) of choice using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Virus-containing supernatant was 51

harvested after 48 and 72 hour durations, centrifuged at 1500rpm for 5min to pellet cellular debris and filtered through 0.45µm filter system. The viral supernatant was subsequently ultracentrifuged at 25000rpm for 2hr at 4°C. Supernatant was decanted into bleach and the lentiviral pellets were air-dried for < 5min. Lentiviral pellets were resuspended in 100µl medium, aliquoted as 25µl samples and stored at -80°C. Titration of lentivirus was performed by transducing 293FT cells with 10-fold serial dilutions of the lentivirus.

Immunoblotting

INS1-832/13 cells were lyzed in a solution of M-PER (Pierce, Rockford, IL) containing protease inhibitors (Sigma, St. Louis, MO) and phosphatase inhibitors (Roche,

Indianapolis, IN) by repeated freeze-thaw cycles, followed by centrifugation at

10,000rpm for 15min to pellet DNA and insoluble material. Protein lysate concentrations were determined using Nanodrop (Thermo Fisher Scientific, Waltham, MA) and 30-50

µg protein were separated using a 4-20% gradient SDS-PAGE (BioRad, Hercules, CA).

Proteins were transferred to PVDF membrane (Millipore, Billerica, MA), blocked with

5% non-fat dry milk, and probed with specific primary antibodies. After washing and secondary antibody incubations, proteins on the membranes were visualized using ECL

(Amersham Piscataway, NJ). Antibodies included anti-FLAG M2 (Sigma, St.Louis,

MO), anti-WFS1 (Origene, Rockville, MD), and GAPDH (Cell Signaling Technology

Inc., Danvers, MA). 52

Flow-assisted Cell Sorting (FACS)

Parental INS-1 832/13 TetR (INS-1), WFS1-WT, and WFS1-R611 cells were plated out onto 24-well plates and cultured in 5mM culture medium in the presence or absence of 1µg/mL doxycycline for 48 hours. After 24 hour in culture, selected wells were treated with 5nM thapsigargin (TG) for remaining 24 hours. Next, propidium iodide was added to medium for 10min to stain apoptotic cells. Cells were then washed twice in

PBS and collected by trypsinization, centrifugation and resuspension in 1mL PBS containing Mitoprobe (Invitrogen). Cells in suspension were transferred to FACS tubes and read on a multicolor BD LSR II flow cytometer (BD Biosciences). Data was analyzed using FlowJo software version 7.6.3 (Treestar Inc., San Carlos, CA).

Glucose-stimulated Insulin Secretion (GSIS)

Cells (INS-1, WFS1-WT, and WFS1-R611) were counted and plated at 100,000 cells/ well on 24-well plates and cultured in 5mM glucose RPMI medium the presence or absence of 1µg/mL doxycycline for 48 hours. On the day of experiment, medium was aspirated and cells were washed twice with 1X PBS. The cells were then incubated in

0.5mL Kreb’s Ringer Buffer (KRB: 135mM NaCl, 3.6mM KCl, 10mM Hepes, pH7.4,

5mM NaHCO3, 0.5mM NaH3PO4, 0.5mM MgCl2, and 1.5mM CaCl2) devoid of glucose for 30min. Next, 0mM KRB was aspirated and cells were incubated in 1mL KRB containing 2.5mM glucose for 1 hour at 37°C to bring the cells to baseline. Next, the

2.5mM-KRB was removed and the cells were washed 2X with PBS. Finally, 0.8ml KRB 53

containing 3mM or 15mM glucose, with or without other secretagogues, was added for 1 hour at 37°C. The supernatant from each well was harvested, centrifuged at 1500rpm for

5 min to remove cellular debris, transferred to microfuge tubes and stored at -80°C. To extract cellular insulin, 0.5mL of acidifed ethanol (1.5% concentrated HCL, 23.5% water,

75% ethanol) was added to each well. The plates were wrapped in parafilm and stored overnight at -20°C. Following day, 0.5mL normalization buffer (1M Tris, pH 7.4) was added to each well and mixed on a plate shaker for 10min. The supernatant was collected, centrifuged to pellet cellular debris and 900 µL was transferred to microfuge tubes and stored at -80°C. Insulin ELISA was performed using rat insulin kit (ALPCO Diagnostics,

Salem, NH). ELISA plates were analyzed on a plate reader using Softmax Pro software version 5.0 for Windows (Molecular Devices Corporation, Sunnyvale, CA).

DNA microarray

INS-1, WFS1-WT, and WFS1-R611 cells were plated at a density of 500,000 cells/ well on 6-well plates and cultured in 5mM glucose RPMI medium supplemented with 1µg/mL doxycycline for 48 hours. Cells were harvested by trypsinization, centrifuged and washed with 1X PBS. Wells were resuspended in 600µL RLT buffer containing β-mercaptoethanol (10µ/mL). Total RNA was isolated using RNeasy mini kit

(Qiagen, Valencia, CA). Microarray analysis was performed on triplicate RNA samples of doxycycline-treated INS-1, WFS1-WT, and WFS1-R611 cells using Genechip Rat 1.0

ST array (Affymetrix, Santa Clara, CA). DNA microarray was performed by the Genome 54

Technology Core at the Whitehead Institute, Cambridge, MA. Microarray data was analyzed by biostatisticians in the Program in Gene Function and Expression at UMass

Medical School, Worcester, MA.

Real-Time Qualitative Polymerase Chain Reaction (qPCR)

Total RNA was isolated using RNeasy Mini kit (Qiagen, Valencia, CA) and cDNA was generated by reverse transcription of 1µl of total RNA with Oligo-dT primer.

Triplicate qPCR samples were analyzed using the iQ5 system (BioRad, Hercules, CA) with the general program: 95°Cfor 10min, 40 cycles of 95°C for 10sec and 55°C for

30sec. The relative expression of each transcript was determined by a standard curve of cycle thresholds for serial dilutions of cDNA and normalized to the expression of actin.

Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and the following primers were used for real-time PCR: rat actin: gcaaatgcttctaggcgac and aagaaagggtgtaaaacgcagc; rat BiP:, tgggtacatttgatctgactgga and ctcaaaggtgacttcaatctggg; rat CHOP, agagtggtcagtgcgcagc and ctcattctcctgctccttctcc; rat spliced XBP-1, tggccgggtctgctgagtccg and atccatgggaagatgttctgg; rat INS2, atcctctgggagccccgc and agagagcttccaccaag; and rat WFS1: atcgacaacagcgccgc and gcatccagtcacccaggaag, Netrin-1: gcttccaaaggaaaactgaa and cttccaccagtcccctgctt;

Unc5a: ggcagatcttccagctcaac and tagcttctgccggataggaa; and DCC: ttcggagcaggaagaactgt and cacaggctgtagggatggtt.

Statistical Analysis

Statistics on data from FACS and GSIS included one-way ANOVA with

Bonferroni’s post-test and was performed using the Graphpad Prism version 5.04 for

Windows (Graphpad Software, La Jolla, CA. www.graphpad.com).

RESULTS

Exogenous expression of WFS1 protects INS-1cells from ER stress-mediated cell death

Mutations in the Wfs1 gene lead to the development of Wolfram syndrome 118, 119.

Recent findings report that Wfs1 may be a candidate gene for T2DM development. A number of reports have suggested specific single nucleotide polymorphisms in Wfs1that may alter the susceptibility to the development of T2DM 138-143, 160-164. Functional characterization and analysis of allelic variants would reveal the true impact of these alleles on β cell survival and function.

To demonstrate that the on-demand exogenous expression of allelic variants of

WFS1 following doxycycline treatment, an immunoblot probing for WFS1 was performed. The predicted size of WFS1 protein is approximately 100 kiloDalton (kDa).

As shown in Figure 2.2a, WFS1 protein was increased following doxycycline treatment.

In addition, it was noted that the previously-reported oligomeric forms of WFS1 at roughly 200 and 300 kDa were also observed 126. However, the level of WFS1-R611 expression was not consistent with that of WFS1-WT (Figure 2.2b) possibly due to lower titers of infectious lentivirus used to generate the WFS1-R611 cell line.

Figure 2.2: Induction of WFS1 expression in INS-1 cell lines. INS-1 832/13 cells containing the expression tetracycline repressor (TetR) gene were transduced with lentivirus bearing WFS1-WT (H611) or WFS1-R611 alleles and selected for positive cells with puromycin. (a) WFS1 is induced by incubation with doxycycline. (b) Comparison of expression of WFS1-WT and three cell lines of WFS1-R611 shows that the expression level of the latter allele was lower at the same concentration of doxycycline. 58

Using the doxycycline-inducible WFS1-WT or WFS1-R611 cell lines, the potential of these alleles to protect against cell stress was examined. Cell viability was assessed by determining mitochondrial activity with Mitoprobe and propidium iodide

(PI), to determine apoptosis and assessed by flow cytometric analysis. As shown in

Figure 2.3a, flow-assisted cell sorting (FACS) could identify those cells with decreased mitochondrial potential and/or increased PI staining. Cells treated with thapsigargin (TG) had increased percentage of cells with lower mitochondrial potential (control: 6.21% vs.

TG: 24.3%). The number of cells with positive PI staining also increased in TG-treated cells compared to control cells (control: 8.53% vs. TG: 10.7%). When WFS1 expression was induced by addition of doxycycline, the percentage of cells with lower mitochondrial activity (“Mitoprobe-low”) and positive PI staining were dramatically reduced (compared to Dox(-), TG-treated cells), indicating a protective effect of WFS1 expression.

In WFS1-WT and WFS1-R611 cells, treatment with the ER stress-inducing agent thapsigargin lead to a dramatic increase in the “Mitoprobe-low” population of cells

(Figure 2.3b and c, respectively). Following induction of WFS1-WT expression, there was a significant decrease in the “Mitoprobe-low” percentage of cells, reflecting protection from TG-mediated stress in these cells. In a similar manner, expression of

WFS1-R611 had a protective effect against TG-mediated cell stress. However, the protective response with WFS1-R611 expression was greater than that for WFS1-WT.

Figure 2.3: WFS1 expression protects against ER stress-mediated cellular dysfunction and death. (a) Flow-assisted cell sorting allowed calculation of

“Mitoprobe-low” and “PI-positive” cells following WFS1 expression and TG-treatment.

(b) WFS1-WT expression in INS-1 cells protects cells from TG-mediated cell death. (c)

Expression of WFS1-R611 demonstrated a statistically significant protective effect against TG-mediated apoptosis. 60

Augmentation of WFS1 expression increases insulin production and secretion

WFS1 deficiency in Wolfram syndrome leads to progressive β cell loss as a result of chronic ER stress and UPR hyperactivation. In addition, using the β cell-specific Wfs1 knockout mouse, Riggs et al (2005) demonstrated impaired glucose-stimulated insulin secretion. The subcellular localization of WFS1 on secretory granules in β cells further highlights the importance of WFS1 to β cell function. Thus, the augmentation of WFS1 expression in β cells may further enhance their response to glucose challenge.

To analyze the effect of WFS1 augmentation on insulin secretion, INS-1 832/13 cells with doxycycline-inducible expression of each WFS1 allele (WFS1-WT and WFS1-

R611) were grown in the presence or absence of doxycycline. Glucose-stimulated insulin secretion was performed and secreted and cellular insulin content was determined by

ELISA. Induction of expression of either WFS1-WT or WFS-R611 leads to a dramatic increase in the cellular insulin content (Figure 2.4b, d). There was a slight and expected decrease in cellular insulin content following challenge with glucose. The secreted insulin content was also significantly elevated in those cells that had induction of WFS1 expression when compared to non-induced cells (Figure 2.4a, c). These results demonstrate the profound effect that augmented WFS1 expression in the β cell has on insulin content and secretion stemming from the involvement of WFS1 in maintenance of

ER homeostasis, insulin maturation and secretion.

Figure 2.4: Glucose-stimulated insulin secretion (GSIS) of WFS1-expressing INS-1 cells. (a) INS-1 cells with augmented WFS1-WT expression secrete higher levels of insulin following challenge with 15mM glucose. (b) WFS1-WT expression increases the cellular insulin content. (c) WFS1-R611 cells secrete higher insulin when challenged with glucose. (d) WFS1-R611 cells contain increased cellular insulin content. (***, p<0.001).

Microarray data for WFS1 allelic variants

In order to discern differences in gene expression between the two allelic variant of WFS1, a gene expression microarray was performed. WFS1 is not a transcription factor but augmented expression of WFS1 may indirectly alter the transcription of other genes. The microarray data revealed that the expression of many different genes was altered in both WFS1 variants. Due to the lower expression of the WFS1-R611 allelic variant, the number of genes identified by the microarray was significantly lower.

Since WFS1 is involved in alleviation of ER stress, there was a wide array of ER stress/UPR related genes that were altered (Table 2.1). Of particular interest was the strong decrease in expression of the ER stress-related thioredoxin-interacting protein

(TXNIP), the most highly upregulated gene in pancreatic β cells following exposure to hyperglycemic conditions 173. Other genes that were altered included those involved in

ERAD (Derlin3, Herpud1, Fbxo6, Syvn1, and Os9) and ER chaperones (Dnajb9, Pdia2,

Dnajc3, Pdia6, Pdia4, Dnajb4, Pdia5, Ero1lb, Ppil4, Ppil6, Fkbp11, and Hsp4l). In directly comparing the WFS1 alleles, the Derl3 gene was significantly increased following WFS1-WT expression, but decreased in cells with increased expression of the

WFS1-R611 allele.

Recently, WFS1 was localized to the secretory granules in β cells, where it is required for intragranular acidification, a necessary step for efficient insulin maturation and secretion 131. The results of the microarray revealed the alteration in a number of genes involved in secretion, including synaptotagmins (Syt12, Syt4, Syt2, Syt14, Syt15, 63

and Syt10), synaptic vesicle glycoproteins (Sv2b, Sv2c), and other secretion-related proteins (Scrn1, Rab27a, Vamp5, Snca, Trappc21, Snap23, Exoc3, and Synj2) (Table

2.2).

Since there was a notable difference between the protective effects of the WFS1 alleles, the gene microarray data was examined to identify specific genes involved in cell viability or survival. One of the most interesting discoveries was the alteration of gene expression of those genes involved in netrin-1 signaling (Table 2.3). Netrin-1 (Ntn1) expression was increased in both WFS1-WT and WFS-R611 expressing cells, but to a greater extent in the latter allelic variant. There were also significant modifications in the receptors for netrin-1: Uncoordinated-5c (Unc5c) expression was increased by both

WFS1 allelic variants and deleted in colorectal cancer (Dcc) expression was significantly diminished by both WFS1 variants. WFS1-WT also induced another netrin-1 receptor,

Unc5b. These data propose a potential role of WFS1 in regulating netrin-1 signaling in the pancreatic β cell.

ER stress/UPR

Probe ID log(FC) p-Value Symbol WFS1-WT Up-regulated

10832487 2.229 7.06E-13 Derl3 10889766 1.694 2.56E-13 Dnajb9 10809328 1.642 8.13E-14 Herpud1 10895861 1.509 7.96E-11 Ddit3 10905453 1.390 1.67E-10 Kdelr3 10741723 1.340 8.00E-13 Pdia2 10847474 1.260 1.47E-09 Creb3l1 10856232 1.093 2.95E-12 Eif2ak3 10721865 1.072 3.24E-11 Ppp1r15a 10782028 1.028 2.11E-12 Dnajc3 10707824 0.995 3.32E-10 Sels 10892859 0.991 1.85E-10 Pdia6 10919996 0.990 4.62E-11 Manf 10808041 0.946 8.74E-12 Aars 10862361 0.903 1.45E-10 Pdia4 10773290 0.862 5.60E-09 Wfs1 10881583 0.846 3.78E-10 Fbxo6 10819787 0.837 1.03E-09 Dnajb9 10838823 0.817 6.86E-07 Chac1 20751498 0.792 3.41E-07 Pdia5 10799038 0.719 1.86E-09 Ero1lb 10701734 0.696 2.57E-08 Ppil4 10713160 0.672 3.64E-10 Syvn1 10830546 0.667 8.88E-08 Ppil6 10906934 0.624 4.03E-06 Fkbp11 10897760 0.618 1.36E-08 Atf4 10882111 0.615 3.66E-08 Rer1 10902892 0.597 5.44E-09 Os9 WFS1-WT Down-regulated

10815099 -0.674 1.26E-09 Hspa4l 10884926 -0.711 5.69E-08 Ppil5 10857546 -0.828 1.50E-08 Itpr1 10885516 -0.862 5.44E-11 Eif2s1 10871582 -1.150 2.18E-10 Ppih 10817552 -3.970 2.46E-15 Txnip WFS1-R611 Up-regulated

10727260 0.920 5.76E-09 Ccnd1 WFS1-R611 Down-regulated

10832487 -0.798 6.06E-08 Derl3

Table 2.1: List of altered ER stress/UPR-related genes in WFS1-WT and WFS1-R611 cells

Secretion

Probe ID log(FC) p-Value Symbol WFS1-WT Up-regulated

10722830 2.521 9.20E-13 Sv2b 10820613 1.738 1.14E-10 Sv2c 10862634 1.275 9.18E-12 Scrn1 10911524 1.253 1.30E-09 Rab27a 10863215 1.249 3.61E-12 Vamp5 10816179 1.192 3.57E-11 Sh3d19 10862820 1.046 6.89E-11 Snca 10807140 1.032 2.05E-12 RGD621098 10716712 0.950 1.81E-10 Stxbp5 10808014 0.867 1.11E-10 Cog4 10870369 0.810 1.89E-08 Sgip1 10807609 0.767 2.52E-10 Vps4a 10727588 0.743 3.41E-09 Syt12 10803577 0.725 1.39E-08 Syt4 10764174 0.706 8.82E-07 Syt2 10939242 0.704 1.00E-08 Sytl4 10811947 0.700 1.04E-09 Exoc8 10808547 0.696 2.87E-09 Trappc2l 10821243 0.691 7.21E-10 Rab27a 10809459 0.680 2.02E-09 Trappc2l 10861268 0.670 2.34E-08 Cadps2 10940444 0.652 8.72E-10 Snap23 10929263 0.634 2.82E-09 Scg2 10936877 0.618 2.30E-08 Sytl5 10882111 0.615 3.66E-08 Rer1 10702453 0.595 7.85E-08 Exoc3 WFS1-WT Down-regulated

10825120 -0.590 3.40E-08 Vps45 10710936 -0.658 1.89E-08 Doc2a 10810040 -0.737 4.36E-08 Syce2 10863757 -0.749 1.13E-09 Anxa4 10702829 -0.771 7.77E-10 Synj2 10738716 -0.867 1.40E-09 Arf2 10902232 -1.167 5.60E-10 Syt12 10711260 -1.591 1.83E-13 Trim72 WFS1-R611 Up-regulated

10782590 2.918 1.04E-12 Synpr 10716880 1.262 1.80E-07 Stx11 WFS1-R611 Down-regulated

10781361 -1.092 6.12E-09 Lgi3 10906364 -1.465 3.40E-10 Syt10 10711260 -1.486 3.96E-13 Trim72

Table 2.2: List of altered genes related to the secretory pathway in cells with augmented expression of WFS1-WT or WFS1-R611.

Netrins

Probe ID log(FC) p-Value Symbol WFS1-WT Up-regulated

10833013 2.125 2.55E-14 Unc5b 10819469 2.069 2.65E-15 Unc5c 10743774 0.739 3.04E-07 Ntn1 WFS1-WT Down-regulated

10805132 -0.593 4.94E-06 Dcc WFS1-R611 Up-regulated

10743774 2.472 3.04E-07 Ntn1 10819469 1.160 2.65E-15 Unc5c WFS1-R611 Down-regulated

10805132 -1.413 4.94E-06 Dcc

Table 2.3: List of netrin-1 and netrin receptors with altered expression in WFS1-WT and WFS1-

R611 cells.

WFS1 augmentation induces the expression of netrin-1

To confirm the induction of netrin-1 expression, RNA from WFS1-WT and

WFS1-R611 cells following doxycycline treatment was collected and used for quantitative PCR assessment of netrin-1. The data revealed that the expression level of netrin-1 in the control INS-1 cells was very low. Doxycycline-mediated induction of

WFS1-WT expression in WFS1-WT cells leads to a dramatic increase in netrin-1 expression (Figure 2.5). The fold change difference in expression of netrin-1 in WFS1-

WT cells was approximately 6 times when compared to the control INS-1 cells. In accordance with the microarray data, netrin-1 expression following induction of WFS1-

R611 protein was significantly higher than either INS-1 or WFS1-WT cells. In these cells, the fold expression increase in netrin-1 was 22-fold (Figure 2.5).

Figure 2.5: Confirmation of netrin-1 induction in INS-1 cells expressing either

WFS1-H611 (WFS1-WT) or WFS1-R611 allelic variants. Control (INS-1), WFS1-

WT, and WFS1-R611 cells were plated and maintained in 5mM medium containing

1µg/mL doxycycline to induce WFS1 expression. At 48 hours, RNA was harvested and used to determine the level of (a) netrin-1 and (b) Unc5c expression by qPCR using a

BioRad iQ5 system.

DISCUSSION

In this chapter, the effect on pancreatic β cell function and viability following augmentation of WFS1 expression was examined. The results indicate that WFS1 expression increases both cellular insulin content and glucose-stimulated insulin secretion, with no allele-dependent variation. Elevated WFS1 expression also increased the viability of pancreatic β cells exposed to ER stress-inducing conditions. Interestingly, the reported diabetes-protective R611 allele of WFS1 had a greater protective function when compared with the H611 allele. Gene expression analysis by microarray revealed increased netrin-1 signaling in both allelic variants. However, the expression was further amplified in the protective R611 allele. Based upon these findings, we propose that netrin-1 signaling provides an additional mechanism by which WFS1 promotes pancreatic β cell survival and β cell mass (Figure 2.6)

Figure 2.6: Role of WFS1-induced netrin-1 signaling in the pancreatic β cell. This chapter identified increased netrin-1 expression following augmentation of WFS1 expression. Netrin-1 signaling has been demonstrated to be protective by preventing caspase-3 cleavage in β cells and is involved in the recruitment of pancreatic progenitor cells. WFS1-induced netrin-1 expression extends the role of WFS1 in the β cell and highlights why WFS1 allelic variation may contribute to β cell mass, and consequently, diabetes resistance.

ER stress can be induced in β cells by numerous physiological and pathological stimuli. Physiological activators of ER stress include increased demand for insulin secretion due to elevated blood glucose levels in the immediate postprandial period.

Ingestion of food also exposes the β cell to amino acids and fatty acids, which trigger physiological ER stress. The term physiological ER stress implies that this is a normal event and UPR activation within the cell is a temporary event to facilitate the alleviation of ER stress, returning the ER to homeostasis, and maintaining the functional state of the

β cell. However, pathological ER stress can also occur within the β cell. Exposure to chronic hyperglycemia or fatty acids, viral infection, or reactive oxygen species can precipitate pathological ER stress in the β cell. In this instance, there is unmitigated UPR activation such that ER homeostasis is not restored. Uncontrolled UPR activation leads to

β cell dysfunction and apoptosis.

WFS1 protein functions as part of the UPR where it controls the HRD1-mediated ubiquitination and proteasomal degradation of the UPR transducer ATF6 129. In addition, there is substantial crosstalk between WFS1 and the anti-apoptotic AATF 159. Thus, it can be postulated that augmentation of WFS1 expression would increase β cell survival. The results in this chapter demonstrate that the introduction of exogenous WFS1 into INS-1 cells leads to the protection against ER stress-mediated apoptosis (Figure 2.3). There are a number of reports concerning the contribution of polymorphisms in the Wfs1 gene to risk for T2DM development 138-143, 160-164. These articles bring to attention the presence of a “protective” arginine at amino acid residue 611 in WFS1 (R611). Our data reveal that induced expression of the WFS1-R611 allele in INS-1 cells leads to greater protection 72

against ER stress-mediated cell death when compared to the “susceptible” WFS1-H611 allele (Figure 2.2b). Pancreatic β cells are particularly sensitive to disturbances in ER homeostasis. WFS1 is a key molecule in regulating ER stress levels. Thus, elevated expression of WFS1, in particular the WFS1-R611 allele, in the fragile β cells would prevent hyperactivation of the UPR, permitting prompt restoration of ER homeostasis, and protect against β cell dysfunction or death.

A number of articles have assessed the contribution of each allele at residue 611 in WFS1 to diabetogenic risk using the Homeostasis Model Assessment (HOMA) program, which estimates β cell function and insulin sensitivity as percentages of a normal reference population 174. Minton et al (2002) reported that WFS1-H611 homozygotes had reduced, but not statistically significant β cell function. In another study, WFS1-R611 homozygotes were determined to have a higher insulinogenic index

143. In support of these findings, another research group reported that the diabetogenic risk H611 allele of WFS1 conferred decreased insulinogenic index and lowered thirty minute serum insulin levels after oral glucose challenge in individuals with abnormal glucose regulation 160. However, in contrast to these findings, the data in this chapter reveal no significant difference in insulin secretion between the two allelic variants at residue 611 in WFS1. The previous population-based studies compared β cell function and found that the diabetogenic WFS1-H611 had decreased insulin release. However, this observation was not replicated in INS-1 cells expressing the allelic variants. Possible reasons for this discrepancy are the involvement of other co-segregating polymorphisms in WFS1 or other genetic modifiers in the population-based studies that affect insulin 73

secretion, which were not examined in the current research. Also, the whole-body assessment of β cell function by HOMA is very different to cell culture-based glucose- stimulated insulin secretion studies.

In order to identify genes that may have been involved in increasing the viability of β cells by augmentation of WFS1 expression, gene expression analysis by microarray was performed. The findings revealed alterations in numerous genes, especially those involved in ER homeostasis and secretion (Tables 2.1 and 2.2). Interestingly, the most highly decreased gene was TXNIP. This gene is the most strongly induced gene in the β cell following exposure to hyperglycemic conditions 173. The protein product of this gene is involved in mediating ER stress-related cytokine induction in β cells and leads to β cell dysfunction. The fact that WFS1 augmentation decreased TXNIP strengthens the protective role of WFS1 signaling in both ER homeostasis and increasing cell viability.

However, the microarray data also revealed some puzzling findings. Most notably, the expression of derlin-3 (Derl3) was strongly induced in cells expressing WFS1-WT, but decreased in WFS1-R611-expressing cells. Derlin-3 is induced by the UPR and is involved in ER-associated degradation. It is be possible that the considerably higher expression levels of WFS1-WT may be accountable for the increase in derlin-3 expression. As a rule, the forced expression of genes of interest when researching the function of the ER and activation of the UPR must carry the caveat that high expression will alter ER homeostasis and this must always be considered when using this approach.

Sharpening the focus to survival and anti-apoptotic genes, the netrin signaling pathway was elucidated (Table 2.3). In cells with exogenous WFS1 expression, netrin-1 was significantly increased and was further elevated in the protective WFS1-R611 allele.

There was also some alteration in netrin receptors, as outlined in Table 2.3. Netrins are a group of secreted, laminin-related proteins originally discovered to be involved in chemotropic guidance of migrating cells and axons during neural development 175.

Outside of the central nervous system, netrins and their receptors are expressed during development, contributing to the morphogenetic process and organization of multiple tissues. The netrin family of proteins is involved in directing cell migration and mediating cellular adhesion in the developing lung 176. In mammary gland development, netrin is involved in terminal bud development 177. Netrin signaling contributes to the formation of the semicircular canals in the inner ear 178. In addition, netrins have been implicated in vasculogenesis, development of the lymphatic system, muscle development, and chemorepellence of leukocyte 179-183.

During the development of the pancreas, netrins and their receptors are also expressed 165, 166. Yebra et al (2003) demonstrated the role of Netrin-1 as an adhesive and migratory signal for CK19+/PDX1+ putative pancreatic progenitors. In a separate study, netrin-1 was also found to contribute to pancreatic morphogenesis 166. However, these authors also identified the upregulation of netrin-1 expression in β cells in islets distal to a pancreatic duct ligation injury model, suggesting that netrin-1 secretion from islets may stimulate the migration of precursor progenitor cells during budding islet morphogenesis.

The results from the current DNA microarray experiment showed increased netrin-1 75

expression in both allelic variants of WFS1, which was significantly higher in the

“protective” R611 allele. This suggests that the augmentation of WFS1 expression in β cells may signal the upregulation of netrin-1 expression, leading to an increase in netrin-1 concentration in the local environment. Since netrin-1 has been shown to recruit islet progenitor cells, it is tempting to speculate that WFS1-induced increase in netrin-1 expression would recruit more progenitor cells 165. With regards to the protective effect of the R611 allele against T2DM development, it is possible that increased netrin-1 expression and release would facilitate enhanced recruitment of progenitor cells and maintenance of β cell mass, precluding T2DM progression.

In addition to the involvement of netrin-1 in axonal guidance and branching morphogenesis, netrin-1 has been shown to directly prevent β cell apoptosis 167. Yang et al (2011) administered netrin-1 to MIN6 insulinoma cells treated under hyperglycemic conditions. Their findings revealed a significantly lower apoptotic index for those cells treated with netrin-1. Notably, netrin-1 did not have any effect on β cell proliferation or insulin release. Therefore, the observation of increased netrin-1 signaling in cells expressing WFS1 in the current gene expression analysis may further suggest that netrin-

1 may directly sustain β cell viability as a paracrine or autocrine signal. The anti- apoptotic role of netrin-1 and the fact that the expression of netrin-1 is significantly enhanced by the protective WFS1-R611 allele further supports the involvement of this allele in protection against T2DM by maintaining β cell mass.

FUTURE DIRECTIONS

The results from this chapter highlight the importance of WFS1 in the function and survival of pancreatic β cells. However, there are a number of experiments needed to complete this body of work. Netrin-1 signaling was identified from the DNA microarray and its induction was validated by qPCR. An initial attempt for to demonstrate the increased expression of netrin-1 in cells with elevated WFS1 expression by immunoblotting was not fruitful. It is possible that netrin-1, a secretory protein, is purely released such that its detection method must be through ELISA rather than immunoblotting. Netrins function by interacting with cell surface-bound receptors. In this study, there was considerable alteration in the expression of distinct netrin receptors in the WFS1-expressing cell lines. This expression profile should be confirmed and explored in more detail to ascertain which receptors are involved in maintaining β cell viability following ligation by netrin-1.

Augmentation of WFS1 expression in INS-1 832/13 cells suggested increased insulin content and secretion, and protection from ER stress. In view of these findings, it may be of interest to generate a transgenic mouse that overexpresses the WFS1 gene in the β cell to further examine the mechanisms by which β cell secretion and viability are enhanced by WFS1.

In the current research, the expression level of each WFS1 allele in INS-1 832/13 cells was not equal. To overcome this, it may be beneficial to introduce WFS1 into the cells by an adenoviral-mediated system instead. The advantage of this system is that identical titers of adenovirus-bearing WFS1 alleles could be used to ensure that the 77

expression level of each WFS1 allele would be alike. This would obviate any confusion over expression levels and eliminate the use of doxycycline from the experiments.

Alternatively, zinc-finger nuclease (ZFN) technology could be utilized to insert a single or multiple copies of the WFS1 allelic variants into the AAVS1 site. This would ensure identical gene number and remove the possibility of differences in expression of the alleles in the different cell lines. A follow-on experiment prior to the arrival of transgenic animals would be the augmentation of WFS1 expression in mouse or cadaver-derived human islets. The adenovirus-mediated delivery system or ZFN-mediated insertion would again be optimal approaches for exogenous islets. In preparation for these experiments, both of the WFS1 alleles have been cloned into adenoviral constructs and are ready to be generated. Adenoviral constructs containing netrin-1 may also be developed to examine netrin-1’s role in β cell protection. 78

CHAPTER III

MICRORNA-29B EXPRESSION IS INDUCED AS A

-/- COMPENSATORY SURVIVAL MECHANISM IN WFS1 ISLETS

SUMMARY

In Wolfram syndrome, unregulated ER stress and UPR hyperactivation leads to dysfunction and death of β cells and optical neurons, which present clinically as the hallmark Wolfram disease symptoms of juvenile-onset diabetes mellitus and progressive optical atrophy, respectively. The deficiency of WFS1 protein also contributes to the progressive demise of hypothalamic, otic, and cerebellar neurons, leading to the development of diabetes insipidus, sensorineural deafness and ataxia, respectively.

To elucidate the molecular pathways to dysfunction in Wolfram syndrome, researchers use various cell culture-based and animal models of the disease. Mouse models of the disease include the whole-body and β cell-specific Wfs1 deletion models

130, 184. While these animals portray progressive glucose intolerance, they do not develop frank diabetes due to survival of sufficient residual β cells to maintain blood glucose at normal levels. The remaining β cell mass are under chronic ER stress due to both lack of functional WFS1 protein and the increased demand for insulin production.

The goal of this chapter was to identify microRNA that may be involved in the maintenance of β cell viability in which WFS1 is deficient. Microarray data revealed the 79

induction of the mir-29 family in Wfs1-/- islets. The expression levels of ER stress transducers IRE1, PERK, and ATF6, and UPR genes CHOP and BiP were decreased following treatment of thapsigargin-treated cells with a miR-29b mimic. The ER stress- related pro-apoptotic genes PUMA and Bim-EL were significantly reduced by treatment with a miR-29b mimic. Collectively, these data suggest that in the absence of WFS1 protein, β cells induce the expression of members of the miR-29 family as a compensatory survival mechanism to regulate the chronic UPR activation and ER stress in the cells in an effort to sustain β cell mass.

INTRODUCTION

The function of the endoplasmic reticulum varies slightly on a cell-specific or tissue-type manner. In most cells, the role of the ER is in the productive folding of proteins. ER homeostasis fluctuates dynamically in response to changes in protein client load in the ER, extracellular cues and intracellular metabolic conditions. Circumstances that perturb ER function and cause an imbalance in the ER‟s protein folding capacity precipitate ER stress, from which a specific response, the UPR, is activated. The overall goal of UPR activation is the palliation of ER stress conditions and restoration of ER homeostasis.

Components of the UPR include the three ER transmembrane transducers, ATF6,

IRE1, and PERK, and a variety of transcription factors and induced genes. The adaptive signaling of the UPR has three key mechanisms to achieve ER homeostasis: increase the protein-folding capacity of the ER, translational attenuation, and enhancement of proteasomal degradation. The majority of these mechanisms are achieved by direct protein-protein interaction.

However, very little is known about the flux in miRNA expression that occurs subsequent to the induction of ER stress and the UPR. MicroRNAs are a unique class of small non-coding RNA genes that generate 18-25 nucleotide (nt) RNA molecules.

Transcription of miRNA genes is performed by RNA polymerase II to yield pri-miRNAs, which subsequently undergo „cropping‟, mediated by Drosha and DiGeorge syndrome critical region gene 8 (DGCR8), to form the 65 nt pre-miRNA. Upon nuclear export, the

RNase III Dicer „dices‟ the pre-miRNA to generate 22 nt miRNA duplexes, which is next 81

assembled into the RNA-induced silencing complex (RISC), where mRNA are selectively targeted by the miRNA and destroyed 185.

The rapidly-expanding field of miRNA is being heavily mined to identify new targets and there have been a number of recent advancements in miRNAs linked to ER stress. The UPR-induced transcription factor CHOP increases the expression of Odz4, a member of the teneurin family of developmental regulators essential for neural development. Within the first intron of Odz4 resides the gene encoding miR-708; CHOP co-regulates their transcription 155. In an elegantly integrative manner, miR-708 functions as a unique component of the UPR whereby it decreases the protein load on the ER by targeting rhodopsin mRNA for destruction.

In a similar manner to that of miR-708, PERK-induced expression of miR-30c-2* directly targets the 3‟-untranslated region (UTR) of XBP-1 mRNA, preventing hyperactivation of the UPR 158. However, the UPR-specific transcription factor XBP-1 also promotes transcription of the miR-346 gene. miR- 346 targets the mRNA of the human antigen peptide transporter 1 (TAP1), precluding entry of client proteins into the

ER and reducing ER stress 156. Using human hepatocellular carcinoma cells, Dai et al

(2010) showed that miR-221/222 is decreased by ER stress. Suppression of miR-221/22 mediated a protective role against ER stress-induced apoptosis 186.

Various forms of cells stress which may impinge on the function of the ER have been linked to miRNAs. Within the pancreatic β cell, where the ER is a fundamental organelle for cellular function, the expression of miR-375 may impact ER function as it is involved in negatively regulating glucose-stimulated insulin secretion by controlling the 82

level of myotrophin 150. Another cell type with an extensive and expansive ER network that is essential for cell function is the antibody-secreting plasma cell. In this cell, miR-

155 regulates the production of isotype-switched, high affinity antibodies 187. Hypoxia is another cellular stress that impacts ER homeostasis and initiates the UPR; the hypoxia- induced miR-120 has been shown to regulate normoxic gene expression involved in tumor initiation 188.

There is slowly accumulating evidence that miRNAs are involved in both ER stress induction and regulation. The WFS1-/- mouse model of Wolfram syndrome-related

ER dysfunction and diabetes mellitus is another paradigm to identify miRNA involved in

ER stress-mediated dysfunction or diabetes. Following that lead, the results of this chapter reveal the alteration of various miRNA families in the WFS1-/- islets. In particular, the enhanced expression of the miR-29 family was further explored and shown to be involved in the diminution of all three UPR transducers and other ER stress markers. Pro-apoptotic genes and activated caspase-3 were also decreased by a miR-29b, a member of the miR-29 family. These data contribute to the notion that ER stress- activated miRNAs are active members of the UPR and are involved in the restoration of

ER homeostasis. By this mechanism, these miRNA promote cell survival.

MATERIALS AND METHODS

Animals

 cell-specific WFS1-/- mice were generously provided by Dr. M. Alan Permutt

(Washington University, St. Louis, MO) and bred as an heterozygote mixed colony at

UMass Medical School, Worcester, MA. Confirmation of WFS1 absence was performed by PCR analysis of genomic DNA for Cre recombinase and WFS1 using the methods published by Riggs et al (2005). All animals were maintained in a viral and pathogen-free

(VPF) environment with ad libitum access to food and water, in accordance with the guidelines of the University of Massachusetts Medical School Institutional Animal Care and Use Committee (IACUC) and the Guide for the Care and Use of Laboratory Animals

(Institute of Laboratory Animal Resources, National Research Council, National

Academy of Sciences, 1996).

Intraperitoneal Glucose Tolerance Test (IPGTT)

The blood glucose and weights of 24 week-old WRC mice and litter-mate controls were obtained and the animals were fasted overnight. The next day, the mice were again weighed and baseline blood glucose readings were obtained. A 20% glucose solution was administered at 2g/kg pre-fast body weight by intraperitoneal injection.

Glucose readings were obtained at 15, 30, 60, 90, and 120 min post-administration using a handheld glucometer (Lifescan Inc., Milpitas, CA). 84

Islet Isolation and Culture

Islet donor mice were anesthetized with intraperitoneal injection of sodium pentobarbital and maintained anesthetized via inhalational halothane. Alternatively, donor mice were rendered dead via carbon dioxide inhalation and cervical dislocation.

Upon exposure of the abdominal cavity, the pancreas was ballooned by pancreatic duct injection of 5mls of 1.0 mg/ml collagenase P (Roche) solution in HBSS. Ballooned mouse pancreata were extracted, washed with warm RPMI and incubated at 37°C for 25 minutes with mild agitation to enable complete collagenase digestion of the pancreatic extracellular tissue. Digestion was stopped by addition of ice-cold RPMI containing 1% horse serum (1% RPMI). Subsequently, digested pancreata were allowed to settle to the bottom of the tube and the supernatant was decanted. The tissues were then washed with ice-cold 1% RPMI. Using a 14 gauge needle on a 10cc syringe, the tissues were mechanically disrupted, followed by centrifugation at 1000rpm for 10 seconds and decanting of the supernatant. The mechanical disruption and centrifugation steps were repeated once more. The tissues were next resuspended in 1% RPMI, strained through a metal sieve, which were then rinsed with 1% RPMI. The sieved tissue homogenate was centrifuged at 1200 rpm for 10 seconds and the supernatants were vacuum-aspirated. The pancreatic homogenate was centrifuged again and as much of the supernatant as possible was removed by vacuum-aspiration. Pellets were resuspended in 10ml of Histopaque

1077 and gently homogenized by tapping; the homogenate was then overlaid with 10ml of 1% RPMI. This gradient was centrifuged at 1800 rpm for 20 min at 20°C without brake. Islets were collected from the interface of the Histopaque and RPMI by glass 85

pipette and placed into a tube with RPMI containing 5% horse serum (5% RPMI). Islets were washed twice with 50ml of 5% RPMI by centrifugation at 1200 rpm for 10 seconds at room temperature. Islets were placed in a 100mm petri dish in 10mls of 5% RPMI under a dissecting microscope and handpicked for counting. Counted islets were again washed in 15ml RPMI and centrifuged at 1200rpm for 30seconds. The islets were then stored in microfuge tubes in 250μl RPMI prior to use. Islet isolation was expertly performed by Linda Leehy or Elaine Norowski in the Greiner laboratory and Mariko

Hara in the Urano laboratory (UMass Medical School, Worcester, MA). Mouse islets were cultured in RPMI medium containing 10% fetal bovine serum, 1%

Penicillin/Streptomycin, 1% sodium pyruvate, and 0.1% β-mercaptoethanol allowing for recovery by overnight incubation.

Cell Culture

The rat insulinoma cells, INS-1 832/13, were cultured in RPMI 1640 medium containing 10% Tetracycline-free FBS, 1% Pen/Strep, 0.1% -mercaptoethanol, and 1% sodium pyruvate. The mouse insulinoma cell line, MIN6, were maintained in DMEM containing 15% FBS, 1% sodium pyruvate, and 1% Pen/Strep. MIN6 cells harboring doxycycline-inducible short-hairpin RNA (shRNA) targeting WFS1 (MIN6-shWFS1) and non-specific control scrambled (MIN6-shSCR) had been previously established by

Shinsuke Ishigaki.

miRNA microarray

Total RNA was isolated using a miRNeasy mini kit (Qiagen, Valencia, CA).

Microarray analysis was performed on triplicate RNA samples of islets isolated from 24 week-old WFS1-/- islets or age-matched littermate control Cre+/+, Wfs1+/+ mice using the miRBase sequence database version 17 from LC Sciences (LC Sciences, Texas).

Real-Time Qualitative Polymerase Chain Reaction (qPCR)

Total RNA was isolated using miRNeasy Mini kit (Qiagen, Valencia, CA) and cDNA was generated by reverse transcription of 1µg of template RNA using the miScript

Reverse transcription kit. Triplicate qPCR samples were analyzed using the iQ5 system

(BioRad, Hercules, CA) with the miRNA-specific PCR program: 95°C for 15min, 35-40 cycles of 94°C for 15sec denaturation steps, 55°C for 30sec annealing step, and 70°C for

30sec extension step. The relative expression of each transcript was determined by a standard curve of cycle thresholds for serial dilutions of cDNA and normalized to the expression of actin. The miScript SYBR Green PCR kit (Qiagen) and the following miScript Primer Assays were used: Mm_miR-1224_1, Mm_miR-1940_1, Mm_miR-

494_1, mmu-miR-5112 custom primer, Mm_miR-29a_1, Mm_miR-29b_1, Mm_miR-

29c_1, Rn_miR-29a_2, Rn_miR-29b_1, Rn_miR-29c_1 (Qiagen) were used for real-time quantitative PCR.

miRNA mimic transfection

INS-1 cells were harvested by trypsinization and stored on ice until needed.

Transfection of miRNA mimic was performed using HiPerFect transfection reagent and the reverse transfection protocol (Qiagen). Briefly, 37.5ng of miRNA mimic was spotted onto each well of a 24 well-plate in 100µL of OptiMem medium (Invitrogen). To this,

3µL of HiPerFect transfection reagent was added and complexes were allowed to form for 5-10 min at room temperature. INS-1 cells at a density of 40,000-160,000 in 500µL culture medium were added to each well. Specific miRNA mimic included Syn-rno-miR-

29b and the control was the AllStars Negative Control siRNA (Qiagen).

Statistical Analysis

Statistics on the data derived from the IPGTT and qPCR included one-way

ANOVA with Bonferroni‟s post-test and was performed using the Graphpad Prism version 5.04 for Windows (Graphpad Software, La Jolla, CA. www.graphpad.com).

RESULTS

Mice with a pancreatic β cell-conditional Wfs1 deficiency (WFS1-/-) display glucose intolerance

Previous studies on the whole-body and pancreatic β cell-specific WFS1-/- mouse models of Wolfram syndrome have demonstrated impaired glucose homeostasis, defined by the rapid elevation in blood glucose levels and indolent return to normoglycemia following intraperitoneal glucose challenge 130, 184. To validate their findings and demonstrate the phenotype in our WFS1-/- mouse colony, intraperitoneal glucose tolerance tests (IPGTT) were performed (Figure 3.1). At fifteen minutes post- administration of the glucose load, there was a distinct, albeit not statistically significant, elevation in blood glucose in the WFS1-/- mice when compared to control mice. This trend continued to significance at the 30 minute time-point (p<0.001). While the blood glucose level of the control mice steadily returned to normal, the decline for the WFS1-/- mice was considerable slower, with the blood glucose readings for the WFS1-/- mice remaining significantly elevated throughout the remainder of the 2-hour experiment

(Figure 1.3). These observations reconfirm those of previous investigators, indicating glucose intolerance in the WFS1-/- mice 130, 184. However, while the silhouette of the blood glucose for the WFS1-/- animals is shifted upwards and indicative of glucose intolerance, it does follow the same outline as the control mice, suggesting that there are residual β cells that are functional. Therefore, in the WFS1-/- mouse, there may be activation of specific pathways or genes that sustain β cell survival. 89

Figure 3.1: Intraperitoneal glucose tolerance test (IPGTT). Twenty-four week-old

WRC (black triangles) and littermate control (grey circles) mice were challenged with

2g/kg dose of glucose by intraperitoneal injection. Blood glucose readings were recorded over a 2-hour period. The pink bar represents the physiological range of normoglycemia in mice.

Wfs1-/- islets show diverse alterations in their microRNA expression profile

The pancreatic β cells in the islets of the WFS1-/- mouse are under chronic

UPR activation status due to unresolved ER stress conditions. In accordance with this, all three pathways of the UPR are activated and the expression of downstream UPR marker genes is increased in WFS1-/- islets 124, 130. However, the involvement of specific miRNAs in WFS1 deficiency or chronic ER stress in β cells has not been explored. These small

RNA molecules play important cellular roles in regulating a variety of biological processes including signal transduction, apoptosis, cell proliferation, developmental progression, and tumorigenesis 189-191. To date, there has only been one ER stress-related miRNA, miR-708, reported in the literature 155. Thus, it is possible that an alteration to the miRNA expression profile occurs in the WFS1-deficient β cells as a compensatory mechanism to palliate the unresolved ER stress and chronic UPR conditions.

To identify miRNAs that may be altered in WFS1 deficiency, isolated islets from WFS1-/- and control mice were processed for total RNA and sent for miRNA microarray analysis. The data from the microarray revealed that there is considerable fluctuation in the miRNA expression profile of WFS1-/- islets (Table 3.1). The most highly induced miRNAs in WFS1-/- islets included miR-1940 (fold change (FC) = 17.40), miR-5112 (FC = 8.39), miR-29b (FC = 4.42), miR-1224 (FC = 3.30), and miR-494 (FC =

3.23) (Table 3.1). Of these miRNA, miR-1224 has recently been identified to be induced by lipopolysacchiride (LPS) and regulates NFκB expression 192. For those miRNA that were statistically significant and had high microarray signal scores, there seemed to be a trend towards increased expression of distinct miRNA families in the WFS1-deficient 91

islets. For instance, all three mature members of the miR-29 family, miR-29a (FC =

1.59), miR-29b (FC = 4.42), and miR-29c (FC = 2.91), were strongly and statistically induced in the WFS1-deficient islets. The miR-29 family members display different regulation based on their subcellular distribution and tissue type; miR-29 members have been reported as being antifibrotic and pro- or anti-apoptotic 193. There were two members of the miR-154 family induced in the WFS1-/- islets: miR-494 (FC = 3.23) and miR-154 (FC = 1.57). miR-154 family members play a role in lung development 194. In addition, cardiac-specific overexpression of miR-494 led to the regulation of distinct proapoptic and antiapoptoic genes and protected against ischemia-reperfusion cardiac injury 195. Five members of the miR-8 family, miR-141 (FC = 1.93), miR-200a (FC =

1.58), miR-200b (FC = 1.50), miR-200c (FC = 1.34), and miR-429 (FC = 1.27), were also induced in the WFS1-/- islets. Members of the miR-8 family have been reported to be involved in the regulation of Notch and Wnt signaling 196, 197. Interestingly, miR-200 is involved in the regulation of intracellular insulin signaling 198.

The downregulated miRNAs predominantly fell into one specific miRNA family – the miR-467 family. This family consists of the rapidly expanded rodent- specific miRNA cluster located in the intron of the Sfmbt2 gene, a maternally-imprinted polycomb gene 199. Since these miRNA are rodent-specific, this could partially explain the survival of WFS1-/- β cells and incomplete recapitulation of Wolfram syndrome in animal models of the disease.

Up-regulated Down-regulated miRNA Log (G2/G1) Fold change p -value miRNA Log (G2/G1) Fold change p-value mmu-miR-1940 4.12 17.40 2.19E-04 mmu-miR-1895 -0.55 -1.46 1.20E-03 mmu-miR-5112 3.05 8.29 7.60E-04 mmu-miR-214 -0.57 -1.48 6.35E-03 mmu-miR-29b 2.14 4.42 7.26E-05 mmu-miR-1892 -0.66 -1.58 2.97E-04 mmu-miR-1224 1.72 3.30 1.66E-04 mmu-miR-376b -0.74 -1.67 1.93E-03 mmu-miR-494 1.69 3.23 5.68E-04 mmu-miR-3095-3p -0.77 -1.71 2.19E-03 mmu-miR-29c 1.54 2.91 1.36E-03 mmu-miR-1187 -0.79 -1.73 9.03E-03 mmu-miR-5105 1.35 2.55 3.47E-03 mmu-miR-483 -0.80 -1.74 7.98E-03 mmu-miR-762 1.32 2.49 8.64E-03 mmu-miR-3099 -0.88 -1.84 5.21E-03 mmu-miR-5117 1.29 2.45 5.96E-03 mmu-miR-15b -0.88 -1.84 1.42E-03 mmu-miR-15a 1.15 2.22 1.89E-03 mmu-miR-574-5p -0.89 -1.85 1.31E-05 mmu-miR-141 0.95 1.93 1.21E-03 mmu-miR-466h-3p -0.98 -1.98 7.74E-03 mmu-miR-22 0.94 1.92 1.36E-03 mmu-miR-467f -1.02 -2.02 2.53E-03 mmu-miR-690 0.90 1.86 2.53E-03 mmu-miR-5113 -1.02 -2.02 7.29E-03 mmu-miR-129-1-3p 0.74 1.67 2.50E-03 mmu-miR-669a-3p -1.05 -2.07 8.66E-04 mmu-miR-1839-5p 0.72 1.65 1.81E-03 mmu-miR-669c* -1.11 -2.15 1.41E-04 mmu-miR-29a 0.67 1.59 6.34E-04 mmu-miR-467b* -1.17 -2.25 2.52E-03 mmu-miR-200a 0.66 1.58 6.99E-03 mmu-miR-1897-5p -1.19 -2.27 1.40E-04 mmu-miR-154 0.65 1.57 7.50E-03 mmu-miR-3082-5p -1.26 -2.39 5.95E-03 mmu-miR-129-5p 0.61 1.53 7.42E-03 mmu-miR-669f-3p -1.27 -2.42 2.55E-04 mmu-miR-379 0.60 1.52 9.86E-03 mmu-miR-466q -1.32 -2.49 3.30E-04 mmu-miR-200b 0.58 1.50 5.40E-03 mmu-miR-466i-3p -1.32 -2.49 6.92E-03 mmu-miR-705 0.55 1.46 1.06E-03 mmu-miR-3072* -1.34 -2.52 1.54E-03 mmu-miR-1195 0.52 1.43 6.99E-03 mmu-miR-467d* -1.39 -2.62 1.40E-03 mmu-miR-3963 0.48 1.39 1.32E-03 mmu-miR-1966 -1.43 -2.69 2.49E-03 mmu-miR-185 0.48 1.39 3.75E-03 mmu-miR-466g -1.48 -2.78 5.39E-03 mmu-miR-383 0.43 1.34 9.72E-03 mmu-miR-669e* -1.49 -2.81 3.35E-03 mmu-miR-200c 0.42 1.34 1.68E-03 mmu-miR-669n -1.51 -2.84 7.72E-04 mmu-miR-183 0.42 1.34 4.11E-03 mmu-miR-669c -1.52 -2.87 7.86E-04 mmu-miR-425 0.37 1.30 6.65E-03 mmu-miR-574-3p -1.59 -3.01 1.21E-03 mmu-miR-429 0.34 1.27 6.39E-03 mmu-miR-466m-3p -1.69 -3.22 5.02E-04 mmu-miR-32* -1.73 -3.32 4.53E-03

mmu-miR-467a* -1.75 -3.37 3.01E-04 Table 3.1: List of miRNA with altered mmu-miR-150 -1.87 -3.65 3.49E-03 -/- expression from WFS1 islets compared mmu-miR-669f-5p -1.90 -3.72 1.61E-05 to control islets . Statistically significant mmu-miR-466m-5p -1.96 -3.89 4.36E-03 miRNA increased or decreased in expression mmu-miR-467c* -2.00 -4.01 9.65E-04 mmu-miR-669a-3-3p -2.01 -4.02 7.45E-04 in the WFS1-/- islets. The miR-29 (light mmu-miR-467e* -2.12 -4.34 2.28E-03 gray), miR-154 (light blue), miR-8 (light mmu-miR-467g -2.14 -4.42 1.59E-04 green), and miR -467 (light pink) miRNA mmu-miR-3097-5p -2.25 -4.77 3.59E-04 families are highlighted. mmu-miR-568 -3.03 -8.17 1.01E-04

Wfs1-/- islets have increased expression of the miR-29 family members

The miRNA microarray lead to the identification of numerous miRNA families that were increased or decreased in the chronic ER stress conditions of the WFS1- deficient environment of the WFS1-/- islets. All three members of the miR-29 family, miR-29a, miR-29b, and miR-29c, were substantially upregulated in the WFS1-/- islets compared with littermate control islets. Thus, this miRNA family was chosen for further analysis.

To confirm the induction of this miRNA family, total RNA preparations from

WFS1-/- and control mice were subjected to miRNA qPCR using specific primer assays for each miRNA family member. The results confirmed the miRNA microarray data where all three members of the miR-29 family, miR-29a, miR-29b, and miR-29c were elevated in the WFS1-/- islets (Figure 3.2)

Figure 3.2: Confirmation of increased expression of miR-29 family members in

WFS1-/- islets. Total RNA from WFS1-/- and control (WFS1+/+) islets were probed for members of the miR-29 family (miR-29a, miR-29b, and miR-29c). Data are expressed as relative expression over RNU6 control.

Introduction of miR-29b mimic into INS-1 cells decreases the expression of UPR markers and ER stress transducers

There are numerous physiological and pathological conditions that lead to the induction of ER stress in pancreatic β cells. In research, ER stress can also be triggered by the use of chemical agents such as the SERCA inhibitor, thapsigargin (TG). Once ER stress has been initiated, the three protein transducers (ATF6, IRE1, and PERK) on the

ER membrane recognize the alteration of ER homeostasis and initiate the UPR. The downstream signaling events of the UPR lead to the increase in expression of specific genes that contain the unfolded protein response element (UPRE) or ER stress element

(ERSE) in their promoter; some of these genes include BiP and CHOP. To determine the possible involvement of mir-29 family members in regulation of ER stress in β cell, ER stress was induced with TG in the presence or absence of a synthetic miR-29b mimic. All members of the miR-29 family have the same mRNA targets, but an analog of mir-29b was specifically chosen as the prototypical miR-29 family member because its expression was highest in the in the microarray data. INS-1 cells treated with TG lead to a 4-fold increase in CHOP expression and 3.5-fold increase in BiP expression (Figure 3.3a, b).

Pretreatment with the miR-29b mimic prevented the elevation of CHOP and BiP expression in TG-treated cohorts. There was a strong statistically significant reduction in

CHOP expression in “TG+/miR-29b mimic” group to approximately 50% of “TG+/

RNAi control”, while there was a significant 20% reduction in BiP expression in the same cohort (Figure 3.3 a, b). 96

The three transducers that sense ER stress and initiate the UPR are ATF6, IRE1, and PERK. INS-1 cells treated with “TG+/control RNAi” displayed increased expression of all three transducers (Figure 3.3c, d, e). Similar to the previous finding of decreased

CHOP and BiP expression, miR-29b mimic pretreatment significantly decreased the expression level of all three transducers (Figure 3.3c, d, e). Interestingly, miR-29b had no effect on the expression of insulin 2 (Figure 3.3f).

Figure 3.3: miR-29b decreases expression of ER stress markers and UPR transducers. Treatment of INS-1 cells with thapsigargin induces ER stress (a-f); miR- 29b co-treatment prevents TG-induced increase in ER stress markers (a) BiP and (b) CHOP and decreases the expression of the UPR transducers (c) ATF6, (d) IRE1, and (e) PERK. (f) There is no effect of miR-29b on Insulin2 expression. 98

Exogenous administration of miR-29b decreases the expression of the UPR-related apoptotic genes PUMA and Bim-EL

Activation of the UPR following ER stress is an initial attempt by the cell to restore ER homeostasis. This is achieved by limiting the entry of proteins into the ER and increasing the folding capacity of the ER with supplementary chaperones. However, with chronic, irresolvable ER stress, the UPR switches to promote apoptotic signaling 200.

Some of the downstream pro-apoptotic targets of the UPR include the BH3-only family members, such as p53-upregulated modulator of apoptosis (PUMA) and Bim-EL. In a recent publication, mir-29b was shown to be specifically target PUMA and Bim-EL mRNA for degradation, precluding apoptosis in maturing neurons.

To ascertain whether mir-29b had any effect on BH3-only family members in β cells, INS-1 cells were treated with the ER stress inducer TG in the presence or absence of mir-29b mimic. PUMA and Bim-EL were assessed by qPCR. Treatment with TG caused a substantial increase in the expression of both PUMA and Bim-EL. However, co- treatment with the miR-29b mimic decreased the expression level of both genes (Figure

3.4). This result confirms the role of miR-29b in regulating the BH3-only family members PUMA and Bim-EL and postulates a role for miR-29 family members in controlling apoptosis in the WFS1-/- islet.

Figure 3.4: miR-29b decreases the expression of UPR-related apoptotic genes. TG- induced increase in PUMA and Bim-EL expression was blunted in the presence of the miR-29b mimic. 100

ER stress-mediated caspase-3 cleavage is reduced in the presence of the miR-29b mimic

The terminal caspase in the apoptotic pathways is caspase-3. This 32kDa protein is activated by splitting it into 12 and 17kDa cleavage products, which form the active caspase-3 forms. To determine whether mir-29b could limit apoptosis through the moderation of caspase-3 activation, protein lysates of INS-1 cells treated with TG and either the miR-29b mimic or control siRNA, were examined by immunoblotting. As depicted in Figure 3.5, miR-29b mimic was capable of decreasing the activation of caspase-3. This observation further strengthens the role of the increased expression of the miR-29 family members in the WFS1-/- islets as a compensatory mechanism to sustain β cell survival.

101

Figure 3.5: miR-29b prevents the activation of caspase-3 in TG-treated INS-1 cells.

ER stress induction by TG leads to the cleavage of caspase-3 as apoptosis ensues. The presence of the miR-29b mimic decreases TG-induced caspase-3 activation.

102

DISCUSSION

The increase in ER stress markers and activation of UPR transducers has convincingly been shown in β cells with deficiency of WFS1 protein 124, 128, 130. In this chapter, the alteration in the miRNA expression profile in WFS-deficient islets was examined. The results propose a novel mechanism for sustaining β cell mass despite chronic ER stress conditions due to WFS1 deficiency. Increased expression of the miR-

29 family in WFS1-/- islets and its involvement in regulating ER stress transducers and

ER stress-related pro-apoptotic genes supports the conceptual role of miRNA as associate

UPR members. In this study, miR-29 family members act as counter-regulatory UPR components that diminish the activation status of the UPR and limit apoptosis.

The burgeoning influence of miRNA on various biological processes, including the outcome and regulation of the UPR, is being explored with great enthusiasm. In the past few years, a number of ER stress-related miRNAs have been reported in the literature. These include the XBP-1-driven miR-346, PERK-induced miR-30c-2-3p,

ATF6-mediated suppression of miR-455, and the CHOP-transcribed miR-708 155-158. In this chapter, this list is expanded to include the members of the miR-29 family.

There is considerable information on the miR-29 family. A large body of work involves the role of miR-29 members in controlling the fibrotic response in cardiomyocytes, lung tissue, liver, and kidney 201-204. Other research areas that have reported the involvement of miR-29 include cancer, myoblast differentiation, osteoblastogenesis and immunology 205-208. The association of miR-29 with various 103

cancers is complex: miR-29 is elevated in some cancers where it functions as an oncogene 209, 210. However, others have observed anti-apoptotic functions of miR-29 211,

212. In regards to the pancreatic β cell, miR-29a and miR-29b have been shown to be involved in controlling the pancreatic β cell-specific silencing of monocarboxylate transporter 1 (Mct1) 213. Examination of the diabetic Goto-Kakizaki rat revealed upregulation of all three members of the miR-29 family in muscle, fat, and liver 214. In that study, elevated miR-29 was associated with insulin resistance in adipocytes. It seems that miR-29 family has a number of roles depending on the tissue location.

In this research, the introduction of a miR-29b mimic into INS-1 832/13 cells prevented the increase in UPR transducer expression by the ER stress agent, thapsigargin

(TG). It is interesting that all three members of the UPR transducers were decreased, especially given the fact that there is no readily identifiable target recognition site for the miR-29 members in any of the three transducers. It seems that miR-29 may play an indirect role in the regulation of the transducers and it would be worthwhile to determine the expression of their transcription factors and whether miR-29 family members can regulate their expression. Exogenous miR-29b mimic also prevented the expected TG- induced increase in ER stress markers CHOP and BiP. This may be due to the regulation of the aforementioned UPR transducers.

The involvement of miR-29 family members in controlling the expression of

BH3-only proapoptotic genes has recently been published 215. Kole et al (2011) demonstrated that during the maturation process of neurons, the expression of miR-29b is 104

dramatically induced and functions as a novel inhibitor of neuronal apoptosis. The authors proceeded to show that miR-29b specifically targets the mRNA of the BH3-only proteins PUMA, Bim, Hrk, and Bmf. In the current research reported in this chapter, miR-29 members were found to be induced in WFS1-/- islets, which are under chronic ER stress conditions. PUMA, Noxa, and Bim-EL are ER stress-induced BH3-family members that promote apoptosis 216, 217. Therefore, since miR-29b has been shown to regulate BH3-only member expression previously, the role of miR-29 in regulating chronic ER stress-induced BH3-only members in WFS1-/- islets was determined. It was found that a miR-29b mimic decreased the expression TG-induced BH3-only members.

Thus, it is plausible to suggest that the chronic ER stress condition of the WFS1-deficient islets signals the induction of miR-29 family members as a counter-regulatory mechanism to prevent UPR hyperactivation and prevent apoptosis.

The recent reports of the involvement of various miRNA in regulating the UPR and ER stress are intriguing. In the chronic absence of WFS1 in WFS1-/- islets, unresolved ER stress and UPR hyperactivation occurs. Of the ER stress-related miRNA found in the other studies, only miR-346 expression was altered in this study. However, the expression of miR-346 was decreased in this research and was increased by XBP-1 in the previous study. A possible reason for this discrepancy may be cell-dependent differential expression of miRNA. Ultimately, the data herein report the elevated expression of the miR-29 family in WFS1-/- cells and that miR-29b, a prototypical family member, decreases UPR transducers and ER stress markers, and precludes activation of 105

caspase-3. These data strengthen the idea of miRNA as novel regulators of the UPR and provide a mechanism by β cells maintain viability in the face of WFS1 deficiency.

FUTURE DIRECTIONS

In this chapter, the expression of the miR-29 family was observed to be upregulated in WFS1-/- islets as compared to control islets. miR-29 decreased the expression of ER stress markers, UPR transducers, and ER stress-related pro-apoptotic genes, and decreased caspase-3 cleavage in insulinoma cells. So far, examination of miR-

29 protection has focused on changes in mRNA expression. To follow up, the expression level of UPR transducers and ER stress markers should be assessed by immunoblot analysis. There are no miR-29 recognition sites in the 3‟ UTR regions of the UPR transducers. To extend the findings further, the mechanism by which miR-29 members indirectly regulate UPR transducer expression should be elucidated and may revela novel targets for manipulation of the UPR as a therapeutic approach for ER stress-related diseases. Additionally, the protective role of miR-29 family members should be extended to include human islets. To do so, adenoviral constructs expressing miR-29b could be used to deliver and transiently express the miRNA in donor human islets followed by challenge with ER stress-inducing agents and assessment of viability.

106

Figure 3.6: Potential role of miR-29b as an ER stress regulating molecule. This chapter reveals the increase in miR-29 family members as an adaptive alteration to deficiency of WFS1 and provides a route to sustain β cell viability despite chronic ER stress and UPR activation. miR-29 members regulate the expression of UPR transducers and UPR-related apoptotic factors.

107

CHAPTER IV

DISCUSSION AND PERSPECTIVES

Diabetes mellitus is an umbrella term that encompasses a number of diverse diseases with varying pathogenesis that all involve the state of hyperglycemia, or increased blood glucose levels. On the basis of their pathogenesis, the diabetic subtypes are established: these include the autoimmune-driven T1DM, genetically-derived

Wolfram syndrome, MODYs and MIDY, and the insulin-resistant, metabolic syndrome- originating T2DM. Of the forms of diabetes, T2DM has the highest incidence and is a highly prevalent, chronic, global disease that is rapidly expanding, with a predicted number of diabetic individuals worldwide of over 366 million by the year 2030 21.

Diabetes-related complications include cardiovascular disease, neuropathy, nephropathy, retinopathy, and decreased immunity and are directly related to the chronic elevation of blood glucose and the generation of toxic advanced glycation end-products.

Current therapies for T2DM comprise pharmaceuticals that address different aspects of the disease: the biguanides (e.g. metformin) and thiazolidinediones (e.g. pioglitazone) are used to reduce insulin resistance; the sulfonylurea drugs (e.g. glyburide) and meglitinides (e.g. repaglinide) act directly on the pancreatic β cell as insulin secretagogues; and the alpha-glucosidase inhibitors (e.g. acarbose) decrease gastrointestinal carbohydrate metabolism, limiting glucose absorption. The only 108

medicinal approach that has a protective effect on β cells are the incretin-based therapies: the GLP-1 agonists (e.g. exanatide) and analogues (e.g. liraglutide). The DPP4 inhibitors

(e.g. sitagliptin) indirectly increase GLP-1 which protects β cells. Thus, it’s apparent that the majorities of current anti-diabetic medications act in a palliative manner to control hyperglycemia, but do not stop the evolution of the disease. Often, diabetic patients have to increase the dosage of their medications and add supplementary medications to their anti-diabetic regimen as the disease progresses. Therefore, there is a need to develop therapeutic modalities that limit the progression or reverse the course of diabetes. One approach to achieve this goal is by investigating the pathogenesis of the different diabetes subtypes in order to identify the molecular pathways that promote survival and maintenance of β cells.

Accumulating evidence proposes a link between ER stress and pancreatic β cell function, hypothesizing that alterations to ER homeostasis which lead to ER stress could result in β cell dysfunction 8, 104. Extracellular conditions and genetic diseases that cause

ER stress have been implicated in the pathogenesis of T1DM and T2DM 94-102. One disease that has been linked to both ER stress and diabetes mellitus is Wolfram syndrome. In this condition, mutations in the Wfs1 gene on chromosome 4 cause truncations such that shortened, non-functional, misfolded, and rapidly-degraded forms of

WFS1 protein are formed 128. WFS1 protein normally resides on the membrane of the ER or secretory granules 128, 131. On the ER surface, WFS1 responds to ER stress and UPR activation by decreasing the amount of the UPR transducer ATF6 by directing it towards the proteasome for degradation 129. In addition, WFS1 co-regulates the activity of the 109

anti-apoptotic transcription factor AATF 159. Thus, WFS1 is protective in the β cell by preventing UPR hyperactivation and apoptotic signaling. The presence of WFS1 on secretory granules provides an additional advantage whereby WFS1 is involved in maintaining secretory granule acidity necessary for insulin maturation and secretion 131.

More recently, Wfs1 gene was included as a T2DM susceptibility gene and a number of

SNPs in Wfs1 have been associated with increased risk of T2DM development 138-143, 160-

164.

In the development of diabetes, environmental and genetic factors are strong contributory factors. The concordance rate of T1DM between of monozygotic twin is approximately 40%, while that of T2DM is close to 80%, significantly higher than

T1DM. This suggests that genetic factors are extremely important for diabetogenesis, especially for T2DM. Therefore, in this thesis, since the Wfs1 gene has been associated with T2DM development, one of the SNPs of Wfs1, H611R, was chosen for further study.

The goal of this project was to elucidate a possible mechanism by which the arginine (R) allele at amino acid residue 611 was ‘protective’ against T2DM development.

Comparative gene expression of the alleles identified genes that were similarly and differentially regulated by the two alleles and uncovered a specific signaling pathway strongly activated by the R611 allele that promotes protection against diabetogenesis.

In Chapter II, the alleles at SNP rs734312 (H611R) of WFS1 were compared by inducing their expression in an insulinoma cell line. It was found that augmentation of the expression of either allele led to an increase in both cellular insulin content and insulin 110

secretion, which is supported by the previous finding of the subcellular location of WFS1 protein on the secretory granule and its involvement in intragranular acidification and insulin maturation 131. However, this result was in contrast to some reports from population-based studies that showed decreased insulinogenic index for the WFS1-H611 allele 139, 160. One of the roles of WFS1 in the cell is restoration of ER homeostasis. In concordance with this, expression of both alleles protected INS-1 cells from ER stress- mediated dysfunction. Interestingly, the R611 allele of WFS1 had a more pronounced protective effect. These findings suggest that the susceptibility to T2DM progression in the WFS1-H611 is not due to a decreased insulin output of the pancreatic β cells, but protection against T2DM development by the WFS1-R611 allele is borne out through the increased protection from ER stress and maintenance of β cell viability.

In order to establish how the R611 allele of WFS1 was protective, a DNA microarray was performed focusing on genes that play a role in cell survival. The outcome was the identification of increased expression of netrin-1 in both allelic variants, which was significantly higher in the protective R611 allele. There have been a number of reports demonstrating the involvement of netrin-1 in pancreatic morphogenesis, recruitment of pancreatic progenitor cells and protection of β cells against stress 165-167.

Thus, the increased expression of netrin-1 by islets bearing the WFS1-R611 allele may enable protection against apoptosis and recruitment of pancreatic progenitors as a mechanism to maintain β cell mass and preclude diabetes progression. 111

In this section of the thesis report, the focus was directed to those genes identified by the DNA microarray that were involved in cell survival; the outcome of this approach was the observation of alterations in expression of netrin-1 and some of the netrin receptors. However, the DNA microarray data included many other genes, some of which may also act in a similar manner to promote β cell survival. These genes may act in addition to or even surpass the effect of netrin-1 in WFS1-expressing cells and it would be interesting to re-examine the list of genes found in the DNA microarray to identify additional target genes.

ER stress has been implicated in a number of diseases including neurodegeneration, atherosclerosis, and diabetes. With the exclusion of XBP-1, the majority of previous work on ER stress has focused on proteins as the final effectors involved in the UPR. Therefore, using a mouse model of Wolfram syndrome, the connection between ER stress and diabetes was further explored as a separate chapter of this thesis. The miRNA profile of ER stressed WFS1-deficient islets was examined to identify unique miRNA that sustain β cell life in chronic ER stress conditions. The outcome of this research goal was the detection of altered miRNA that promote β cell survival.

The presence of WFS1 is fundamental to the restoration of ER homeostasis and in its absence unmitigated ER stress and chronic UPR activation leads to cell dysfunction and death. However, the loss of cells in WFS1 deficiency takes a long time to manifest as symptoms: diabetes occurs in the first decade of life, followed by progressive optical 112

atrophy, while ataxia appears much later in the course of the disease. This may be partly explained by differences in susceptibility to stress among pancreatic β cells and neurons or the variation in number of cells needed to be destroyed in order to exhibit symptomology. However, it is also possible that the cells are undergoing chronic ER stress and have activated specific responses to counteract that stress to maintain survival as long as possible.

In chapter III, islets from the WFS1-/- mouse models of Wolfram syndrome were used as the paradigm to elucidate novel miRNA whose expression was induced or repressed by the chronic ER stressed state. In that chapter, the expression of all three members of the miR-29 family was found to be increased in WFS1-/- islets. Further examination of the miR-29b family, using miR-29b as the prototypical member, revealed that miR-29b decreased the expression of the ER stress markers CHOP and BiP.

Furthermore, the expression of each of the UPR transducers, ATF6, IRE1, and PERK, were also diminished following treatment with miR-29b. However, there are no known miR-29 target sites in the 3’UTR of the UPR transducers or CHOP or BiP mRNA, indicating that the decreased expression of these genes is an indirect process.

To further investigate the role of miR-29 family in maintaining β cell survival, the downstream ER stress-mediated apoptotic signaling was examined. Interestingly, miR-

29b expression has been reported to be increased during the maturation of neurons and restricts apoptosis in mature neurons by targeting the BH3-only genes for destruction 215.

The 3’ UTR of the BH3-only PUMA and Bim-EL mRNA contain recognition sites for 113

miR-29 annealing and destruction through the RISC 215. In the current research, miR-29b decreased the expression of the ER stress-related pro-apoptotic factors PUMA and Bim-

EL, suggesting that miR-29 induction in WFS1-/- islets is a bona fide adaptive alteration generated by the β cell to restrict apoptosis under ER stressed conditions. Finally, treatment with miR-29b prevented the activation of caspase-3 under ER stress conditions in INS-1 cells. The mRNA level of the Ins2 gene was unaffected by miR-29b mimic administration indicating that there was not a global suppression of transcription.

Collectively, these data propose that ER stressed β cells increase the expression of miR-

29 family members in order to counteract the heightened activation of the UPR in the cell in an attempt to maintain β cell survival.

In chapter III, one miRNA family, miR-29, elucidated by the miRNA microarray was examined further. However, the expression of numerous other miRNA families was induced in WFS1-/- islets. For those miRNAs that had decreased expression, there was one predmininat family, the miR-467 family. Since this is a rodent-specific miRNA family and not found in humans, it could be acting as a contributory factor to the survival of β cells in the mouse in the absence of WFS1 protein. Exploration of additional miRNA families, either increased or decreased in the WFS1-/- mice may reveal additional targets for study.

Wolfram syndrome is a rare autosomal recessive disorder characterized by the close association of diabetes mellitus with progressive optical atrophy. In contrast to

T2DM and T1DM, the majority of Wolfram syndrome patients are not obese and do not 114

have insulitis. Postmortem examination reveals selective loss of β cells in the pancreatic islets as the contributory factor to DM in these patients 219. The gene responsible for 90% of Wolfram syndrome was identified by two separate groups in 1998 and termed WFS1

119, 120. The remaining Wolfram patients have mutations in the WFS2 (CISD2) gene.

There are over two hundred mutations in WFS1 that contribute to Wolfram syndrome, with the vast majority of these mutations residing in exon 8, which encodes the transmembrane and C-terminal domains of the protein, highlighting the role of this region in the function of WFS1. Even mutations in terminal seven amino acids of WFS1 are sufficient to cause Wolfram syndrome. The vast majority of Wolfram patients are compound heterozygotes 220. The absence of functional WFS1 protein leads to unresolved

ER stress and chronic UPR activation, culminating in β cell dysfunction and death. The diminution of pancreatic β cell mass is slowly progressive and diabetic symptoms do not present during the neonatal period, but appear later in the first decade of life. This is possibly due to the higher regenerative capacity of younger islets 221.

Skeptical people would argue that the contribution of mutations in WFS1 to the onset of diabetes mellitus in Wolfram syndrome necessitates other factors, as in a two-hit hypothesis. It is not unreasonable to consider that there are supplementary factors that affect β cell function which are involved in advancing the development of DM in

Wolfram syndrome. However, there have been no additional genetic mutations found in

Wolfram syndrome patients and the disease is completely penetrant in regards to DM and

OA, the pathognomonic symptoms. Furthermore, investigation of the deficiency of

WFS1 and mutant forms of WFS1 have been studied exhaustively using cell culture- 115

based approaches. In these systems, cells display unresolved ER stress and UPR activation, leading to β cell dysfunction and apoptosis. In contrast to humans with

Wolfram syndrome, the syndrome cannot be completely recapitulated in the mouse and the development of overt diabetes is rare in WFS1-/- mice. However, glucose intolerance, a reduction in β cell mass, enhanced apoptosis, and dilated ER in the β cells are noted 130.

To exacerbate the diabetic phenotype in WFS1 deficiency, Akiyama et al (2009) introduced the agouti lethal yellow mutation into the WFS1-/- mouse. The resulting animals had selective β cell loss and severe insulin-dependent diabetes 222. Since there are a number of roles of WFS1 in the β cell, it may be plausible that different mutations in WFS1 affect its location-specific functions in different ways and impact the β cell accordingly. Thus, the combination of WFS1 mutations that are present in compound heterozygote patients may contribute to the demise of the β cell mass at different rates.

The involvement of different WFS1 mutations may explain the incomplete penetrance of

DI, sensorineural deafness, ataxia, and other Wolfram-associated findings. To determine the interplay of different WFS1 mutations and their contribution to DM progression would involve exhaustive cloning of the multitude of mutations and their co-expression in a combinatorial fashion. This would be possible to perform but given the fact that DM is completely penetrant in Wolfram syndrome in any combination of WFS1 mutations, the minimal return for such extensive research would not be worthwhile exploring.

The question may arise concerning the rationale for the manifestation of distinct neurological and endocrine deficits in Wolfram syndrome despite the ubiquitous expression of the protein. The symptoms associated with Wolfram syndrome present 116

predominantly in the pancreatic β cell, optical neurons, and other neurons in the hypothalamus, cerebellum, and vestibulocochlear nerve. These cell types are more sensitive to ER stress-induced damage. In fact, due to the constant demand for insulin biosynthesis, β cells are dependent on a highly efficient ER and the baseline ER stress level is higher in these cells when compared to others 48, 95. It is tempting to state as a generality that all secretory cells, which include the pancreatic β cells and neurons, are rendered more susceptible to apoptosis in the deficiency of WFS1. This would explain the fact that there have been no problems identified in other non-secretory organs, such as the heart and muscle, in Wolfram patients. In addition, cardiac and skeletal myocytes have an increased rate of turnover which could mask the presentation of symptoms due to the absence of WFS1 protein. However, cells of the exocrine pancreas, liver, gastrointestinal system and immune system are also highly secretory, but there are no obvious symptoms associated with dysfunction of these organs in Wolfram patients. This highlights the specific role of WFS1 in pancreatic β cells and neurons and in its absence, unresolved ER stress and cell death occurs. It is widely established that, in spite of different embryological origins, β cells and neurons share a number of similarities, and it is not a huge leap to consider that the functional role of WFS1 may be consistent with this viewpoint 223. However, there is the possibility that there are other proteins that are interact with WFS1 specifically in neurons and β cells; in the absence of WFS1, these interactions do not occur and the cells are rendered more susceptible to ER stress- mediated death. 117

To continue to explore the findings of the current research, one approach is to develop transgenic animals expressing the different allelic variants of WFS1, with the zinc-finger nuclease approach being a plausible unique method for rapid development of these animals. It would be anticipated that augmentation of WFS1 expression in these animals would maintain ER homeostasis in the pancreatic β cells, preventing diabetes progression. Challenging these animals with genetic or environmental diabetic precipitants and comparing with control animals may demonstrate the effect of different allelic variants of WFS1 in promoting β cell viability. Furthermore, the involvement of

WFS1 alleles in insulin secretion could be more accurately assessed in these animals by challenging them with intraperitoneal glucose, performing hyperglycemic clamp studies, or isolating the islets for perfusion studies.

This thesis demonstrates that polymorphisms in WFS1 may be involved in the maintenance of β cell mass through increased netrin signaling. The identification of chemical or biologic compounds that could enhance the function of WFS1 in the β cell would be a major advancement in the field of diabetes. Enhancing WFS1 would also target the β cell directly preventing the loss of functional β cells and circumvent the need for secondary diabetic medications that palliate hypoglycemia without curing the disease itself. Alternatively, with the identification of netrin-1 as a downstream component of

WFS1, it may be possible to directly enhance netrin-1 signaling to maintain β cell mass.

The second half of this thesis elucidated the role of miR-29 family members as adaptive compensatory mechanism to restrict ER stress-mediated apoptosis in β cells. 118

Since this was found in WFS1-deficient islets that are under chronic ER stress conditions, it’s possible that miR-29 family members could be released from those cells within exosomes and act as biomarkers for ER stressed β cells 218. The identification of biomarkers of stressed β cells would allow earlier treatment and limit diabetes progression. Alternatively, the miR-29 family could be co-opted as an adjunctive treatment to maintain β cell survival during human islet transplantation.

Since there are a number of neurological symptoms in Wolfram syndrome and the facts that ER stress is a contributory factor to a number of neurodegenerative diseases and that there are a number of similarities between β cells and neurons, it may also be possible to apply the information derived from this thesis work to generate potential neuroprotective agents. Netrin-1 is involved in recruitment of β cell progenitors and protection against apoptosis in addition to axonal guidance during neurogenesis – would netrin-1 introduction lead to recruitment of neurons and neuroprotection in neurodegenerative diseases? The miR-29b has been shown to limit the induction of the

UPR and restricts apoptosis in mature neurons – would exogenous miR-29 expression protect against ER stress-mediated neuronal cell death in amyotrophic lateral sclerosis,

Alzheimer’s, or Parkinson’s disease? The ability to extrapolate the findings of this thesis work into meaningful therapeutic modalities would be challenging but would be a worthy attempt in order to try to prevent diabetes and neurodegenerative disease progression.

In conclusion, the current study has provided further insight into the function of the WFS1 protein and identified an ER stress-regulating miRNA. The elucidation of the 119

mechanisms underlying netrin-1 induction by WFS1 remains to be established. The specifics of how miR-29 decreases the expression of UPR transducers also need to be explored. Nevertheless, these observations have expanded on the roles of WFS1 in β cells and demonstrated how adaptive alterations in miRNA expression can maintain cell survival in ER stress (Figure 4.1). These findings have opened the door for further research into the role of WFS1 in β cell survival and of miRNA in ER stress and diabetes.

Ultimately, the knowledge and understanding derived from this cumulative thesis work may lead to the development of novel therapies for ER stress-related diseases, which includes diabetes.

120

Figure 4.1: Summative conclusions from current thesis. Chapter II revealed increased netrin-1 signaling by WFS1, especially the R611 allele. Netrin-1 is β cell-protective and recruits pancreatic progenitors. In chapter III, WFS1-/- islets showed increase expression of miR-29 family members. miR-29 members regulate the expression of UPR transducers and UPR-related apoptotic factors. 121

REFERENCES

1. Langerhans P (1869). "Beitrage zur mikroscopischen anatomie der bauchspeichel druse". Inaugural- dissertation. Berlin: Gustav Lange. 2. Elayat AA, el-Naggar MM, Tahir M. An immunocytochemical and morphometric study of the rat pancreatic islets. J Anat. 1995 Jun; 186 (Pt 3):629-37. PubMed PMID: 7559135; PubMed Central PMCID: PMC1167020. 3. Tillmar L, Carlsson C, Welsh N. Control of insulin mRNA stability in rat pancreatic islets Regulatory role of a 3'-untranslated region pyrimidine-rich sequence. J Biol Chem. 2002 Jan 11; 277 (2):1099-106. PubMed PMID: 11696543. 4. Schuit FC, In't Veld PA, Pipeleers DG. Glucose stimulates proinsulin biosynthesis by a dose- dependent recruitment of pancreatic beta cells. Proc Natl Acad Sci U S A. 1988 Jun; 85 (11):3865-9. PubMed PMID: 3287379; PubMed Central PMCID: PMC280320. 5. Scheuner D, Kaufman RJ. The unfolded protein response: a pathway that links insulin demand with beta-cell failure and diabetes. Endocr Rev. 2008 May; 29 (3):317-33. PubMed PMID: 18436705; PubMed Central PMCID: PMC2528859. 6. Blundell TL, Dodson GG, Dodson E, Hodgkin DC, Vijayan M. X-ray analysis and the structure of insulin. Recent Prog Horm Res. 1971; 27:1-40. PubMed PMID: 4946130. 7. Michael DJ, Xiong W, Geng X, Drain P, Chow RH. Human insulin vesicle dynamics during pulsatile secretion. Diabetes. 2007 May; 56 (5):1277-88. PubMed PMID: 17317765. 8. Lipson KL, Fonseca SG, Ishigaki S, Nguyen LX, Foss E, Bortell R, Rossini AA, Urano F. Regulation of insulin biosynthesis in pancreatic beta cells by an endoplasmic reticulum-resident protein kinase IRE1. Cell Metab. 2006 Sep; 4 (3):245-54. PubMed PMID: 16950141. 9. Drucker DJ. The biology of incretin hormones. Cell Metab. 2006 Mar; 3 (3):153-65. PubMed PMID: 16517403. 10. Van Obberghen E, Baron V, Delahaye L, Emanuelli B, Filippa N, Giorgetti-Peraldi S, Lebrun P, Mothe-Satney I, Peraldi P, Rocchi S, Sawka-Verhelle D, Tartare-Deckert S, Giudicelli J. Surfing the insulin signaling web. Eur J Clin Invest. 2001 Nov; 31 (11):966-77. PubMed PMID: 11737239. 11. Becker AB, Roth RA. Insulin receptor structure and function in normal and pathological conditions. Annu Rev Med. 1990; 41:99-115. PubMed PMID: 2184752. 12. Saltiel AR, Kahn CR. Insulin signalling and the regulation of glucose and lipid metabolism. Nature. 2001 Dec 13; 414 (6865):799-806. PubMed PMID: 11742412. 13. Lizcano JM, Alessi DR. The insulin signalling pathway. Curr Biol. 2002 Apr 2; 12 (7):R236-8. PubMed PMID: 11937037. 14. Ogawa W, Matozaki T, Kasuga M. Role of binding proteins to IRS-1 in insulin signalling. Mol Cell Biochem. 1998 May; 182 (1-2):13-22. PubMed PMID: 9609110. 15. Asnaghi L, Bruno P, Priulla M, Nicolin A. mTOR: a protein kinase switching between life and death. Pharmacol Res. 2004 Dec; 50 (6):545-9. PubMed PMID: 15501691. 16. Schmoll D, Walker KS, Alessi DR, Grempler R, Burchell A, Guo S, Walther R, Unterman TG. Regulation of glucose-6-phosphatase gene expression by protein kinase Balpha and the forkhead transcription factor FKHR Evidence for insulin response unit-dependent and -independent effects of insulin on promoter activity. J Biol Chem. 2000 Nov 17; 275 (46):36324-33. PubMed PMID: 10960473. 17. Shimomura I, Bashmakov Y, Ikemoto S, Horton JD, Brown MS, Goldstein JL. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc Natl Acad Sci U S A. 1999 Nov 23; 96 (24):13656-61. PubMed PMID: 10570128; PubMed Central PMCID: PMC24120. 18. Kitamura T, Kitamura Y, Kuroda S, Hino Y, Ando M, Kotani K, Konishi H, Matsuzaki H, Kikkawa U, Ogawa W, Kasuga M. Insulin-induced phosphorylation and activation of cyclic nucleotide 122

phosphodiesterase 3B by the serine-threonine kinase Akt. Mol Cell Biol. 1999 Sep; 19 (9):6286-96. PubMed PMID: 10454575; PubMed Central PMCID: PMC84592. 19. Kahn C Ronald,Weir Gordon C,King George L,Moses Alan C,Smith Robert J, Jacobson Alan M (2005) Joslin's diabetes mellitus. Lippincott Williams & Wilkins ISBN: 9780781727969. 20. Diabetes Statistic - American Diabetes Association. http://www.diabetes.org/diabetes-basics /diabetes-statistics 21. WHO | Diabetes http://www.who.int/mediacentre/factsheets/fs312/en/index.html. 22. Edghill EL, Flanagan SE, Patch AM, Boustred C, Parrish A, Shields B, Shepherd MH, Hussain K, Kapoor RR, Malecki M, MacDonald MJ, Støy J, Steiner DF, Philipson LH, Bell GI, Neonatal Diabetes International Collaborative Group, Hattersley AT, Ellard S. Insulin mutation screening in 1,044 patients with diabetes: mutations in the INS gene are a common cause of neonatal diabetes but a rare cause of diabetes diagnosed in childhood or adulthood. Diabetes. 2008 Apr; 57 (4):1034-42. PubMed PMID: 18162506. 23. Støy J, Edghill EL, Flanagan SE, Ye H, Paz VP, Pluzhnikov A, Below JE, Hayes MG, Cox NJ, Lipkind GM, Lipton RB, Greeley SA, Patch AM, Ellard S, Steiner DF, Hattersley AT, Philipson LH, Bell GI, Neonatal Diabetes International Collaborative Group. Insulin gene mutations as a cause of permanent neonatal diabetes. Proc Natl Acad Sci U S A. 2007 Sep 18; 104 (38):15040-4. PubMed PMID: 17855560; PubMed Central PMCID: PMC1986609. 24. Liu M, Hodish I, Haataja L, Lara-Lemus R, Rajpal G, Wright J, Arvan P. Proinsulin misfolding and diabetes: mutant INS gene-induced diabetes of youth. Trends Endocrinol Metab. 2010 Nov; 21 (11):652-9. PubMed PMID: 20724178; PubMed Central PMCID: PMC2967602. 25. Powers Alvin C. Chapter 338: Diabetes Mellitus. In: AS Fauci, E Braunwald, DL Kasper, SL Hauser, DL Longo, JL Jameson, J Loscaizo (eds), Harrison’s Principles of Internal Medicine, 17e. New York, McGraw-Hill, 2008 (http://www.accessmedicine.com). 26. Groenendyk J, Michalak M. Endoplasmic reticulum quality control and apoptosis. Acta Biochim Pol. 2005; 52 (2):381-95. PubMed PMID: 15933766. 27. Kaneko M, Nomura Y. ER signaling in unfolded protein response. Life Sci. 2003 Dec 5; 74 (2- 3):199-205. PubMed PMID: 14607247. 28. Kaufman RJ. Orchestrating the unfolded protein response in health and disease. J Clin Invest. 2002 Nov; 110 (10):1389-98. PubMed PMID: 12438434; PubMed Central PMCID: PMC151822. 29. Borgese N, Francolini M, Snapp E. Endoplasmic reticulum architecture: structures in flux. Curr Opin Cell Biol. 2006 Aug; 18 (4):358-64. PubMed PMID: 16806883. 30. Boyce M, Yuan J. Cellular response to endoplasmic reticulum stress: a matter of life or death. Cell Death Differ. 2006 Mar; 13 (3):363-73. PubMed PMID: 16397583 31. Ron D. Translational control in the endoplasmic reticulum stress response. J Clin Invest. 2002 Nov; 110 (10):1383-8. PubMed PMID: 12438433; PubMed Central PMCID: PMC151821. 32. Ma Y, Hendershot LM. The unfolding tale of the unfolded protein response. Cell. 2001 Dec 28; 107 (7):827-30. PubMed PMID: 11779459. 33. Zhao L, Ackerman SL. Endoplasmic reticulum stress in health and disease. Curr Opin Cell Biol. 2006 Aug; 18 (4):444-52. PubMed PMID: 16781856. 34. Patil C, Walter P. Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr Opin Cell Biol. 2001 Jun; 13 (3):349-55. PubMed PMID: 11343907. 35. Rao RV, Peel A, Logvinova A, del Rio G, Hermel E, Yokota T, Goldsmith PC, Ellerby LM, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program: role of the ER chaperone GRP78. FEBS Lett. 2002 Mar 13; 514 (2-3):122-8. PubMed PMID: 11943137. 36. Travers KJ, Patil CK, Wodicka L, Lockhart DJ, Weissman JS, Walter P. Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation. Cell. 2000 Apr 28; 101 (3):249-58. PubMed PMID: 10847680. 37. Gass JN, Gunn KE, Sriburi R, Brewer JW. Stressed-out B cells? Plasma-cell differentiation and the unfolded protein response. Trends Immunol. 2004 Jan; 25 (1):17-24. PubMed PMID: 14698280. 123

38. Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional and translational control in the Mammalian unfolded protein response. Annu Rev Cell Dev Biol. 2002; 18:575-99. PubMed PMID: 1214226549Bertolotti A, Wang X, Novoa I, Jungreis R, Schlessinger K, Cho JH, West AB, Ron D. Increased sensitivity to dextran sodium sulfate colitis in IRE1beta-deficient mice. J Clin Invest. 2001 Mar; 107 (5):585-93. PubMed PMID: 11238559; PubMed Central PMCID: PMC199427. 39. Zhang C, Cai Y, Adachi MT, Oshiro S, Aso T, Kaufman RJ, Kitajima S. Homocysteine induces programmed cell death in human vascular endothelial cells through activation of the unfolded protein response. J Biol Chem. 2001 Sep 21; 276 (38):35867-74. PubMed PMID: 11447214. 40. Meusser B, Hirsch C, Jarosch E, Sommer T. ERAD: the long road to destruction. Nat Cell Biol. 2005 Aug; 7 (8):766-72. PubMed PMID: 16056268. 41. Høyer-Hansen M, Jäättelä M. Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death Differ. 2007 Sep; 14 (9):1576-82. PubMed PMID: 17612585. 42. Yorimitsu T, Klionsky DJ. Autophagy: molecular machinery for self-eating. Cell Death Differ. 2005 Nov; 12 Suppl 2:1542-52. PubMed PMID: 16247502; PubMed Central PMCID: PMC1828868. 43. Lee AS. The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress. Methods. 2005 Apr; 35 (4):373-81. PubMed PMID: 15804610. 44. Shen J, Chen X, Hendershot L, Prywes R. ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev Cell. 2002 Jul; 3 (1):99- 111. PubMed PMID: 12110171. 45. Zhang K, Kaufman RJ. Signaling the unfolded protein response from the endoplasmic reticulum. J Biol Chem. 2004 Jun 18; 279 (25):25935-8. PubMed PMID: 15070890. 46. Yoshida H, Haze K, Yanagi H, Yura T, Mori K. Identification of the cis-acting endoplasmic reticulum stress response element responsible for transcriptional induction of mammalian glucose- regulated proteins Involvement of basic leucine zipper transcription factors. J Biol Chem. 1998 Dec 11; 273 (50):33741-9. PubMed PMID: 9837962. 47. Liu CY, Schröder M, Kaufman RJ. Ligand-independent dimerization activates the stress response kinases IRE1 and PERK in the lumen of the endoplasmic reticulum. J Biol Chem. 2000 Aug 11; 275 (32):24881-5. PubMed PMID: 10835430. 48. Tirasophon W, Welihinda AA, Kaufman RJ. A stress response pathway from the endoplasmic reticulum to the nucleus requires a novel bifunctional protein kinase/endoribonuclease (Ire1p) in mammalian cells. Genes Dev. 1998 Jun 15; 12 (12):1812-24. PubMed PMID: 9637683; PubMed Central PMCID: PMC316900. 49. Bertolotti A, Wang X, Novoa I, Jungreis R, Schlessinger K, Cho JH, West AB, Ron D. Increased sensitivity to dextran sodium sulfate colitis in IRE1beta-deficient mice. J Clin Invest. 2001 Mar; 107 (5) :585-93. PubMed PMID:11238559; PubMed Central PMCID: PMC199427. 50. Wang XZ, Harding HP, Zhang Y, Jolicoeur EM, Kuroda M, Ron D. Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J. 1998 Oct 1; 17 (19):5708-17. PubMed PMID: 9755171; PubMed Central PMCID: PMC1170899. 51. Harding HP, Zeng H, Zhang Y, Jungries R, Chung P, Plesken H, Sabatini DD, Ron D. Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in secretory cell survival. Mol Cell. 2001 Jun; 7 (6):1153-63. PubMed PMID: 11430819. 52. Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, Ron D. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science. 2000 Jan 28; 287 (5453):664-6. PubMed PMID: 10650002. 53. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 2001 Dec 28; 107 (7):881-91. PubMed PMID: 11779464. 54. Shen X, Ellis RE, Lee K, Liu CY, Yang K, Solomon A, Yoshida H, Morimoto R, Kurnit DM, Mori K, Kaufman RJ. Complementary signaling pathways regulate the unfolded protein response and are 124

required for C elegans development. Cell. 2001 Dec 28; 107 (7):893-903. PubMed PMID: 11779465. 55. Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG, Ron D. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 2002 Jan 3; 415 (6867):92-6. PubMed PMID: 11780124. 56. Yamamoto K, Yoshida H, Kokame K, Kaufman RJ, Mori K. Differential contributions of ATF6 and XBP1 to the activation of endoplasmic reticulum stress-responsive cis-acting elements ERSE, UPRE and ERSE-II. J Biochem. 2004 Sep; 136 (3):343-50. PubMed PMID: 15598891. 57. Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori K. A time-dependent phase shift in the mammalian unfolded protein response. Dev Cell. 2003 Feb; 4 (2):265-71. PubMed PMID: 12586069. 58. Lee AH, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol. 2003 Nov; 23 (21):7448-59. PubMed PMID: 14559994; PubMed Central PMCID: PMC207643. 59. Ma K, Vattem KM, Wek RC. Dimerization and release of molecular chaperone inhibition facilitate activation of eukaryotic initiation factor-2 kinase in response to endoplasmic reticulum stress. J Biol Chem. 2002 May 24; 277 (21):18728-35. PubMed PMID: 11907036. 60. Yoshida H. ER stress and diseases. FEBS J. 2007 Feb; 274 (3):630-58. PubMed PMID: 17288551. 61. Harding HP, Zhang Y, Bertolotti A, Zeng H, Ron D. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell. 2000 May; 5 (5):897-904. PubMed PMID: 10882126 62. Liu CY, Kaufman RJ. The unfolded protein response. J Cell Sci. 2003 May 15; 116 (Pt 10):1861-2. PubMed PMID: 12692187. 63. Wek RC, Jiang HY, Anthony TG. Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans. 2006 Feb; 34 (Pt 1):7-11. PubMed PMID: 16246168. 64. Clemens MJ. Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis. Prog Mol Subcell Biol. 2001; 27:57-89. PubMed PMID: 11575161. 65. Marciniak SJ, Garcia-Bonilla L, Hu J, Harding HP, Ron D. Activation-dependent substrate recruitment by the eukaryotic translation initiation factor 2 kinase PERK. J Cell Biol. 2006 Jan 16; 172 (2):201-9. PubMed PMID: 16418533; PubMed Central PMCID: PMC2063550. 66. Novoa I, Zeng H, Harding HP, Ron D. Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of eIF2alpha. J Cell Biol. 2001 May 28; 153 (5):1011-22. PubMed PMID: 11381086; PubMed Central PMCID: PMC2174339. 67. Brush MH, Weiser DC, Shenolikar S. Growth arrest and DNA damage-inducible protein GADD34 targets protein phosphatase 1 alpha to the endoplasmic reticulum and promotes dephosphorylation of the alpha subunit of eukaryotic translation initiation factor 2. Mol Cell Biol. 2003 Feb; 23 (4):1292- 303. PubMed PMID: 12556489; PubMed Central PMCID: PMC141149. 68. Yoshida H, Oku M, Suzuki M, Mori K. pXBP1(U) encoded in XBP1 pre-mRNA negatively regulates unfolded protein response activator pXBP1(S) in mammalian ER stress response. J Cell Biol. 2006 Feb 13; 172 (4):565-75. PubMed PMID: 16461360; PubMed Central PMCID: PMC2063676. 69. Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene. 2003 Nov 24; 22 (53):8608-18. PubMed PMID: 14634622 70. Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, Ron D. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science. 2000 Jan 28; 287 (5453):664-6. PubMed PMID: 10650002. 71. Adachi Y, Yamamoto K, Okada T, Yoshida H, Harada A, Mori K. ATF6 is a transcription factor specializing in the regulation of quality control proteins in the endoplasmic reticulum. Cell Struct Funct. 2008; 33 (1):75-89. PubMed PMID: 18360008. 125

72. Anding AL, Chapman JS, Barnett DW, Curley RW Jr, Clagett-Dame M. The unhydrolyzable fenretinide analogue 4-hydroxybenzylretinone induces the proapoptotic genes GADD153 (CHOP) and Bcl-2-binding component 3 (PUMA) and apoptosis that is caspase- dependent and independent of the retinoic acid receptor. Cancer Res. 2007 Jul 1; 67 (13):6270-7. PubMed PMID: 17616685. 73. McCullough KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol Cell Biol. 2001 Feb; 21 (4):1249-59. PubMed PMID: 11158311; PubMed Central PMCID: PMC99578. 74. Gass JN, Gifford NM, Brewer JW. Activation of an unfolded protein response during differentiation of antibody-secreting B cells. J Biol Chem. 2002 Dec 13; 277 (50):49047-54. PubMed PMID: 12374812. 75. Iwakoshi NN, Lee AH, Vallabhajosyula P, Otipoby KL, Rajewsky K, Glimcher LH. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat Immunol. 2003 Apr; 4 (4):321-9. PubMed PMID: 12612580. 76. Nakanishi K, Sudo T, Morishima N. Endoplasmic reticulum stress signaling transmitted by ATF6 mediates apoptosis during muscle development. J Cell Biol. 2005 May 23; 169 (4):555-60. PubMed PMID: 15897261; PubMed Central PMCID: PMC2171703. 77. Wu J, Kaufman RJ. From acute ER stress to physiological roles of the Unfolded Protein Response. Cell Death Differ. 2006 Mar; 13 (3):374-84. PubMed PMID: 16397578. 78. Pino SC, O'Sullivan-Murphy B, Lidstone EA, Thornley TB, Jurczyk A, Urano F, Greiner DL, Mordes JP, Rossini AA, Bortell R. Protein kinase C signaling during T cell activation induces the endoplasmic reticulum stress response. Cell Stress Chaperones. 2008 Dec; 13 (4):421-34. PubMed PMID: 18418732; PubMed Central PMCID: PMC2673927. 79. Scheu S, Stetson DB, Reinhardt RL, Leber JH, Mohrs M, Locksley RM. Activation of the integrated stress response during T helper cell differentiation. Nat Immunol. 2006 Jun; 7 (6):644-51. PubMed PMID: 16680145. 80. Ryu EJ, Harding HP, Angelastro JM, Vitolo OV, Ron D, Greene LA. Endoplasmic reticulum stress and the unfolded protein response in cellular models of Parkinson's disease. J Neurosci. 2002 Dec 15; 22 (24):10690-8. PubMed PMID: 12486162. 81. Hoozemans JJ, Veerhuis R, Van Haastert ES, Rozemuller JM, Baas F, Eikelenboom P, Scheper W. The unfolded protein response is activated in Alzheimer's disease. Acta Neuropathol. 2005 Aug; 110 (2):165-72. PubMed PMID: 15973543 82. Ryoo HD, Domingos PM, Kang MJ, Steller H. Unfolded protein response in a Drosophila model for retinal degeneration. EMBO J. 2007 Jan 10; 26 (1):242-52. PubMed PMID: 17170705; PubMed Central PMCID: PMC1782370. 83. Nishitoh H, Kadowaki H, Nagai A, Maruyama T, Yokota T, Fukutomi H, Noguchi T, Matsuzawa A, Takeda K, Ichijo H. ALS-linked mutant SOD1 induces ER stress- and ASK1-dependent motor neuron death by targeting Derlin-1. Genes Dev. 2008 Jun 1; 22 (11):1451-64. PubMed PMID: 18519638; PubMed Central PMCID: PMC2418582. 84. Kouroku Y, Fujita E, Jimbo A, Kikuchi T, Yamagata T, Momoi MY, Kominami E, Kuida K, Sakamaki K, Yonehara S, Momoi T. Polyglutamine aggregates stimulate ER stress signals and caspase-12 activation. Hum Mol Genet. 2002 Jun 15; 11 (13):1505-15. PubMed PMID: 12045204. 85. Perkins DJ, Barber GN. Defects in translational regulation mediated by the alpha subunit of eukaryotic initiation factor 2 inhibit antiviral activity and facilitate the malignant transformation of human fibroblasts. Mol Cell Biol. 2004 Mar; 24 (5):2025-40. PubMed PMID: 14966282; PubMed Central PMCID: PMC350553. 86. Burnett HF, Audas TE, Liang G, Lu RR. Herpes simplex virus-1 disarms the unfolded protein response in the early stages of infection. Cell Stress Chaperones. 2012 Jan 20; PubMed PMID: 22270612. 87. Bi M, Naczki C, Koritzinsky M, Fels D, Blais J, Hu N, Harding H, Novoa I, Varia M, Raleigh J, Scheuner D, Kaufman RJ, Bell J, Ron D, Wouters BG, Koumenis C. ER stress-regulated translation 126

increases tolerance to extreme hypoxia and promotes tumor growth. EMBO J. 2005 Oct 5; 24 (19):3470-81. PubMed PMID: 16148948; PubMed Central PMCID: PMC1276162. 88. Blais JD, Addison CL, Edge R, Falls T, Zhao H, Wary K, Koumenis C, Harding HP, Ron D, Holcik M, Bell JC. Perk-dependent translational regulation promotes tumor cell adaptation and angiogenesis in response to hypoxic stress. Mol Cell Biol. 2006 Dec; 26 (24):9517-32. PubMed PMID: 17030613; PubMed Central PMCID: PMC1698539. 89. Romero-Ramirez L, Cao H, Nelson D, Hammond E, Lee AH, Yoshida H, Mori K, Glimcher LH, Denko NC, Giaccia AJ, Le QT, Koong AC. XBP1 is essential for survival under hypoxic conditions and is required for tumor growth. Cancer Res. 2004 Sep 1; 64 (17):5943-7. PubMed PMID: 15342372. 90. Jamora C, Dennert G, Lee AS. Inhibition of tumor progression by suppression of stress protein GRP78/BiP induction in fibrosarcoma B/C10ME. Proc Natl Acad Sci U S A. 1996 Jul 23; 93 (15):7690-4. PubMed PMID: 8755537; PubMed Central PMCID: PMC38808. 91. Carrasco DR, Sukhdeo K, Protopopova M, Sinha R, Enos M, Carrasco DE, Zheng M, Mani M, Henderson J, Pinkus GS, Munshi N, Horner J, Ivanova EV, Protopopov A, Anderson KC, Tonon G, DePinho RA. The differentiation and stress response factor XBP-1 drives multiple myeloma pathogenesis. Cancer Cell. 2007 Apr; 11 (4):349-60. PubMed PMID: 17418411; PubMed Central PMCID: PMC1885943 92. Gargalovic PS, Gharavi NM, Clark MJ, Pagnon J, Yang WP, He A, Truong A, Baruch-Oren T, Berliner JA, Kirchgessner TG, Lusis AJ. The unfolded protein response is an important regulator of inflammatory genes in endothelial cells. Arterioscler Thromb Vasc Biol. 2006 Nov; 26 (11):2490-6. PubMed PMID: 16931790. 93. Zhang C, Kawauchi J, Adachi MT, Hashimoto Y, Oshiro S, Aso T, Kitajima S. Activation of JNK and transcriptional repressor ATF3/LRF1 through the IRE1/TRAF2 pathway is implicated in human vascular endothelial cell death by homocysteine. Biochem Biophys Res Commun. 2001 Dec 7; 289 (3):718-24. PubMed PMID: 11726207. 94. Cardozo AK, Ortis F, Storling J, Feng YM, Rasschaert J, Tonnesen M, Van Eylen F, Mandrup- Poulsen T, Herchuelz A, Eizirik DL. Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase 2b and deplete endoplasmic reticulum Ca2+, leading to induction of endoplasmic reticulum stress in pancreatic beta-cells. Diabetes. 2005 Feb; 54 (2):452-61. PubMed PMID: 15677503. 95. Lipson KL, Fonseca SG, Urano F. Endoplasmic reticulum stress-induced apoptosis and auto- immunity in diabetes. Curr Mol Med. 2006 Feb; 6 (1):71-7. PubMed PMID: 16472114. 96. Harding HP, Zhang Y, Ron D. Protein translation and folding are coupled by an endoplasmic- reticulum-resident kinase. Nature. 1999 Jan 21; 397 (6716):271-4. PubMed PMID: 9930704. 97. Zhang W, Feng D, Li Y, Iida K, McGrath B, Cavener DR. PERK EIF2AK3 control of pancreatic beta cell differentiation and proliferation is required for postnatal glucose homeostasis. Cell Metab. 2006 Dec; 4 (6):491-7. PubMed PMID: 17141632. 98. Wang J, Takeuchi T, Tanaka S, Kubo SK, Kayo T, Lu D, Takata K, Koizumi A, Izumi T. A mutation in the insulin 2 gene induces diabetes with severe pancreatic beta-cell dysfunction in the Mody mouse. J Clin Invest. 1999 Jan; 103 (1):27-37. PubMed PMID: 9884331; PubMed Central PMCID: PMC407861 99. Scheuner D, Song B, McEwen E, Liu C, Laybutt R, Gillespie P, Saunders T, Bonner-Weir S, Kaufman RJ. Translational control is required for the unfolded protein response and in vivo glucose homeostasis. Mol Cell. 2001 Jun; 7 (6):1165-76. PubMed PMID: 11430820. 100. Ladiges WC, Knoblaugh SE, Morton JF, Korth MJ, Sopher BL, Baskin CR, MacAuley A, Goodman AG, LeBoeuf RC, Katze MG. Pancreatic beta-cell failure and diabetes in mice with a deletion mutation of the endoplasmic reticulum molecular chaperone gene P58IPK. Diabetes. 2005 Apr; 54 (4):1074-81. PubMed PMID: 15793246. 101. De León DD, Stanley CA, Pagon RA, Bird TD, Dolan CR, Stephens K, Adam MP. Permanent Neonatal Diabetes Mellitus . 1993; PubMed PMID: 20301620. 127

102. Smith AJ, Taneja TK, Mankouri J, Sivaprasadarao A. Molecular cell biology of KATP channels: implications for neonatal diabetes. Expert Rev Mol Med. 2007 Aug 1; 9 (21):1-17. PubMed PMID: 17666135. 103. Herbach N, Rathkolb B, Kemter E, Pichl L, Klaften M, de Angelis MH, Halban PA, Wolf E, Aigner B, Wanke R. Dominant-negative effects of a novel mutated Ins2 allele causes early-onset diabetes and severe beta-cell loss in Munich Ins2C95S mutant mice. Diabetes. 2007 May; 56 (5):1268-76. PubMed PMID: 17303807 104. Liu M, Haataja L, Wright J, Wickramasinghe NP, Hua QX, Phillips NF, Barbetti F, Weiss MA, Arvan P. Mutant INS-gene induced diabetes of youth: proinsulin cysteine residues impose dominant- negative inhibition on wild-type proinsulin transport. PLoS One. 2010 Oct 11; 5 (10):e13333. PubMed PMID: 20948967; PubMed Central PMCID: PMC2952628. 105. Lipson KL, Ghosh R, Urano F. The role of IRE1alpha in the degradation of insulin mRNA in pancreatic beta-cells. PLoS One. 2008 Feb 20; 3 (2):e1648. PubMed PMID: 18286202; PubMed Central PMCID: PMC2241665. 106. Han D, Lerner AG, Vande Walle L, Upton JP, Xu W, Hagen A, Backes BJ, Oakes SA, Papa FR. IRE1alpha kinase activation modes control alternate endoribonuclease outputs to determine divergent cell fates. Cell. 2009 Aug 7; 138 (3):562-75. PubMed PMID: 19665977; PubMed Central PMCID: PMC2762408. 107. Cnop M, Ladriere L, Hekerman P, Ortis F, Cardozo AK, Dogusan Z, Flamez D, Boyce M, Yuan J, Eizirik DL. Selective inhibition of eukaryotic translation initiation factor 2 alpha dephosphorylation potentiates fatty acid-induced endoplasmic reticulum stress and causes pancreatic beta-cell dysfunction and apoptosis. J Biol Chem. 2007 Feb 9; 282 (6):3989-97. PubMed PMID: 17158450 108. Karaskov E, Scott C, Zhang L, Teodoro T, Ravazzola M, Volchuk A. Chronic palmitate but not oleate exposure induces endoplasmic reticulum stress, which may contribute to INS-1 pancreatic beta-cell apoptosis. Endocrinology. 2006 Jul; 147 (7):3398-407. PubMed PMID: 16601139. 109. Kharroubi I, Ladrière L, Cardozo AK, Dogusan Z, Cnop M, Eizirik DL. Free fatty acids and cytokines induce pancreatic beta-cell apoptosis by different mechanisms: role of nuclear factor- kappaB and endoplasmic reticulum stress. Endocrinology. 2004 Nov; 145 (11):5087-96. PubMed PMID: 15297438. 110. Ritzel RA, Meier JJ, Lin CY, Veldhuis JD, Butler PC (2007) Human islet amyloid polypeptide oligomers disrupt cell coupling, induce apoptosis, and impair insulin secretion in isolated human islets. Diabetes 56 (1):65-71. 111. Sawaya MR, Sambashivan S, Nelson R, Ivanova MI, Sievers SA, Apostol MI, Thompson MJ, Balbirnie M, Wiltzius JJ, McFarlane HT, Madsen AO, Riekel C, Eisenberg D (2007) Atomic structures of amyloid cross-beta spines reveal varied steric zippers. Nature 447 (7143):453-457. 112. Huang CJ, Lin CY, Haataja L, Gurlo T, Butler AE, Rizza RA, Butler PC (2007) High expression rates of human islet amyloid polypeptide induce endoplasmic reticulum stress mediated beta-cell apoptosis, a characteristic of humans with type 2 but not type 1 diabetes. Diabetes 56 (8):2016-2027. 113. Matveyenko AV, Gurlo T, Daval M, Butler AE, Butler PC (2009) Successful versus failed adaptation to high-fat diet-induced insulin resistance: the role of IAPP-induced beta-cell endoplasmic reticulum stress. Diabetes 58 (4):906-916. 114. Von Graefe A, 1858 Ueber die mit Diabetes mellitus vorkommenden Sehstörungen. Dies Arch IV: 230-234. 115. Fraser FC, Gunn T. Diabetes mellitus, diabetes insipidus, and optic atrophy An autosomal recessive syndrome?. J Med Genet. 1977 Jun; 14 (3):190-3. PubMed PMID: 881709; PubMed Central PMCID: PMC1013555. 116. Barrett TG, Bundey SE. Wolfram (DIDMOAD) syndrome. J Med Genet. 1997 Oct; 34 (10):838-41. PubMed PMID: 9350817; PubMed Central PMCID: PMC1051091. 117. Swift RG, Sadler DB, Swift M. Psychiatric findings in Wolfram syndrome homozygotes. Lancet. 1990 Sep 15; 336 (8716):667-9. PubMed PMID: 1975860. 128

118. Barrett TG, Bundey SE, Macleod AF. Neurodegeneration and diabetes: UK nationwide study of Wolfram (DIDMOAD) syndrome. Lancet. 1995 Dec 2; 346 (8988):1458-63. PubMed PMID: 7490992. 119. Inoue H, Tanizawa Y, Wasson J, Behn P, Kalidas K, Bernal-Mizrachi E, Mueckler M, Marshall H, Donis-Keller H, Crock P, Rogers D, Mikuni M, Kumashiro H, Higashi K, Sobue G, Oka Y, Permutt MA. A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). Nat Genet. 1998 Oct; 20 (2):143-8. PubMed PMID: 9771706. 120. Strom TM, Hörtnagel K, Hofmann S, Gekeler F, Scharfe C, Rabl W, Gerbitz KD, Meitinger T. Diabetes insipidus, diabetes mellitus, optic atrophy and deafness (DIDMOAD) caused by mutations in a novel gene (wolframin) coding for a predicted transmembrane protein. Hum Mol Genet. 1998 Dec; 7 (13):2021-8. PubMed PMID: 9817917. 121. El-Shanti H, Lidral AC, Jarrah N, Druhan L, Ajlouni K. Homozygosity mapping identifies an additional locus for Wolfram syndrome on chromosome 4q. Am J Hum Genet. 2000 Apr; 66 (4):1229-36. PubMed PMID: 10739754; PubMed Central PMCID: PMC1288190 122. Amr S, Heisey C, Zhang M, Xia XJ, Shows KH, Ajlouni K, Pandya A, Satin LS, El-Shanti H, Shiang R. A homozygous mutation in a novel zinc-finger protein, ERIS, is responsible for Wolfram syndrome 2. Am J Hum Genet. 2007 Oct; 81 (4):673-83. PubMed PMID: 17846994; PubMed Central PMCID: PMC2227919. 123. Rötig A, Cormier V, Chatelain P, Francois R, Saudubray JM, Rustin P, Munnich A. Deletion of mitochondrial DNA in a case of early-onset diabetes mellitus, optic atrophy, and deafness (Wolfram syndrome, MIM 222300). J Clin Invest. 1993 Mar; 91 (3):1095-8. PubMed PMID: 8383698; PubMed Central PMCID: PMC288064. 124. Yamada T, Ishihara H, Tamura A, Takahashi R, Yamaguchi S, Takei D, Tokita A, Satake C, Tashiro F, Katagiri H, Aburatani H, Miyazaki J, Oka Y. WFS1-deficiency increases endoplasmic reticulum stress, impairs cell cycle progression and triggers the apoptotic pathway specifically in pancreatic beta-cells. Hum Mol Genet. 2006 May 15; 15 (10):1600-9. PubMed PMID: 16571599. 125. Takeda K, Inoue H, Tanizawa Y, Matsuzaki Y, Oba J, Watanabe Y, Shinoda K, Oka Y. WFS1 (Wolfram syndrome 1) gene product: predominant subcellular localization to endoplasmic reticulum in cultured cells and neuronal expression in rat brain. Hum Mol Genet. 2001 Mar 1; 10 (5):477-84. PubMed PMID: 11181571. 126. Hofmann S, Philbrook C, Gerbitz KD, Bauer MF. Wolfram syndrome: structural and functional analyses of mutant and wild-type wolframin, the WFS1 gene product. Hum Mol Genet. 2003 Aug 15; 12 (16):2003-12. PubMed PMID: 12913071. 127. Ueda K, Kawano J, Takeda K, Yujiri T, Tanabe K, Anno T, Akiyama M, Nozaki J, Yoshinaga T, Koizumi A, Shinoda K, Oka Y, Tanizawa Y. Endoplasmic reticulum stress induces Wfs1 gene expression in pancreatic beta-cells via transcriptional activation. Eur J Endocrinol. 2005 Jul; 153 (1):167-76. PubMed PMID: 15994758. 128. Fonseca SG, Ishigaki S, Oslowski CM, Lu S, Lipson KL, Ghosh R, Hayashi E, Ishihara H, Oka Y, Permutt MA, Urano F. Wolfram syndrome 1 gene negatively regulates ER stress signaling in rodent and human cells. J Clin Invest. 2010 Mar; 120 (3):744-55. PubMed PMID: 20160352; PubMed Central PMCID: PMC2827948. 129. Fonseca SG, Lipson KL, Urano F. Endoplasmic reticulum stress signaling in pancreatic beta-cells. Antioxid Redox Signal. 2007 Dec; 9 (12):2335-44. PubMed PMID: 17894546. 130. Riggs AC, Bernal-Mizrachi E, Ohsugi M, Wasson J, Fatrai S, Welling C, Murray J, Schmidt RE, Herrera PL, Permutt MA. Mice conditionally lacking the Wolfram gene in pancreatic islet beta cells exhibit diabetes as a result of enhanced endoplasmic reticulum stress and apoptosis. Diabetologia. 2005 Nov; 48 (11):2313-21. PubMed PMID: 16215705. 131. Hatanaka M, Tanabe K, Yanai A, Ohta Y, Kondo M, Akiyama M, Shinoda K, Oka Y, Tanizawa Y. Wolfram syndrome 1 gene (WFS1) product localizes to secretory granules and determines granule acidification in pancreatic beta-cells. Hum Mol Genet. 2011 Apr 1; 20 (7):1274-84. PubMed PMID: 21199859 129

132. Khanim F, Kirk J, Latif F, Barrett TG. WFS1/wolframin mutations, Wolfram syndrome, and associated diseases. Hum Mutat. 2001 May; 17 (5):357-67. PubMed PMID: 11317350. 133. Gloyn AL, Weedon MN, Owen KR, Turner MJ, Knight BA, Hitman G, Walker M, Levy JC, Sampson M, Halford S, McCarthy MI, Hattersley AT, Frayling TM. Large-scale association studies of variants in genes encoding the pancreatic beta-cell KATP channel subunits Kir62 (KCNJ11) and SUR1 (ABCC8) confirm that the KCNJ11 E23K variant is associated with type 2 diabetes. Diabetes. 2003 Feb; 52 (2):568-72. PubMed PMID: 12540637. 134. Florez JC, Jablonski KA, McAteer J, Sandhu MS, Wareham NJ, Barroso I, Franks PW, Altshuler D, Knowler WC, Diabetes Prevention Program Research Group. Testing of diabetes-associated WFS1 polymorphisms in the Diabetes Prevention Program. Diabetologia. 2008 Mar; 51 (3):451-7. PubMed PMID: 18060660; PubMed Central PMCID: PMC2483955. 135. Nielsen EM, Hansen L, Carstensen B, Echwald SM, Drivsholm T, Glümer C, Thorsteinsson B, Borch-Johnsen K, Hansen T, Pedersen O. The E23K variant of Kir62 associates with impaired post- OGTT serum insulin response and increased risk of type 2 diabetes. Diabetes. 2003 Feb; 52 (2):573- 7. PubMed PMID: 12540638. 136. Evans D, de Heer J, Hagemann C, Wendt D, Wolf A, Beisiegel U, Mann WA. Association between the P12A and c1431t polymorphisms in the peroxisome proliferator activated receptor gamma (PPAR gamma) gene and type 2 diabetes. Exp Clin Endocrinol Diabetes. 2001; 109 (3):151-4. PubMed PMID: 11409297. 137. Grant SF, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, Helgason A, Stefansson H, Emilsson V, Helgadottir A, Styrkarsdottir U, Magnusson KP, Walters GB, Palsdottir E, Jonsdottir T, Gudmundsdottir T, Gylfason A, Saemundsdottir J, Wilensky RL, Reilly MP, Rader DJ, Bagger Y, Christiansen C, Gudnason V, Sigurdsson G, Thorsteinsdottir U, Gulcher JR, Kong A, Stefansson K. Variant of transcription factor 7-like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006 Mar; 38 (3):320-3. PubMed PMID: 16415884. 138. Awata T, Inoue K, Kurihara S, Ohkubo T, Inoue I, Abe T, Takino H, Kanazawa Y, Katayama S. Missense variations of the gene responsible for Wolfram syndrome (WFS1/wolframin) in Japanese: possible contribution of the Arg456His mutation to type 1 diabetes as a nonautoimmune genetic basis. Biochem Biophys Res Commun. 2000 Feb 16; 268 (2):612-6. PubMed PMID: 10679252. 139. Minton JA, Hattersley AT, Owen K, McCarthy MI, Walker M, Latif F, Barrett T, Frayling TM. Association studies of genetic variation in the WFS1 gene and type 2 diabetes in UK populations. Diabetes. 2002 Apr; 51 (4):1287-90. PubMed PMID: 11916957. 140. Kawamoto T, Horikawa Y, Tanaka T, Kabe N, Takeda J, Mikuni M. Genetic variations in the WFS1 gene in Japanese with type 2 diabetes and bipolar disorder. Mol Genet Metab. 2004 Jul; 82 (3):238- 45. PubMed PMID: 15234338. 141. Sandhu MS, Weedon MN, Fawcett KA, Wasson J, Debenham SL, Daly A, Lango H, Frayling TM, Neumann RJ, Sherva R, Blech I, Pharoah PD, Palmer CN, Kimber C, Tavendale R, Morris AD, McCarthy MI, Walker M, Hitman G, Glaser B, Permutt MA, Hattersley AT, Wareham NJ, Barroso I. Common variants in WFS1 confer risk of type 2 diabetes. Nat Genet. 2007 Aug; 39 (8):951-3. PubMed PMID: 17603484; PubMed Central PMCID: PMC2672152. 142. Franks PW, Rolandsson O, Debenham SL, Fawcett KA, Payne F, Dina C, Froguel P, Mohlke KL, Willer C, Olsson T, Wareham NJ, Hallmans G, Barroso I, Sandhu MS. Replication of the association between variants in WFS1 and risk of type 2 diabetes in European populations. Diabetologia. 2008 Mar; 51 (3):458-63. PubMed PMID: 18040659; PubMed Central PMCID: PMC2670195. 143. Florez JC, Burtt N, de Bakker PI, Almgren P, Tuomi T, Holmkvist J, Gaudet D, Hudson TJ, Schaffner SF, Daly MJ, Hirschhorn JN, Groop L, Altshuler D. Haplotype structure and genotype- phenotype correlations of the sulfonylurea receptor and the islet ATP-sensitive potassium channel gene region. Diabetes. 2004 May; 53 (5):1360-8. PubMed PMID: 15111507. 144. Chistiakov DA, Khodyrev DS, Smetanina SA, Bel'chikova LN, Suplotova LA, Nosikov VV. A WFS1 haplotype consisting of the minor alleles of rs752854, rs10010131, and rs734312 shows a 130

protective role against type 2 diabetes in Russian patients. Rev Diabet Stud. 2010 Winter; 7 (4):285- 92. PubMed PMID: 21713316; PubMed Central PMCID: PMC3143543 145. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004 Jan 23; 116 (2):281-97. PubMed PMID: 14744438. 146. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009 Jan 23; 136 (2):215- 33. PubMed PMID: 19167326. 147. Lee RC, Feinbaum RL, Ambros V. The C elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993 Dec 3; 75 (5):843-54. PubMed PMID: 8252621. 148. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin- 4 mediates temporal pattern formation in C elegans. Cell. 1993 Dec 3; 75 (5):855-62. PubMed PMID: 8252622. 149. Guo H, Ingolia NT, Weissman JS, Bartel DP. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature. 2010 Aug 12; 466 (7308):835-40. PubMed PMID: 20703300; PubMed Central PMCID: PMC2990499. 150. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M. A pancreatic islet-specific microRNA regulates insulin secretion. Nature. 2004 Nov 11; 432 (7014):226-30. PubMed PMID: 15538371. 151. Baroukh N, Ravier MA, Loder MK, Hill EV, Bounacer A, Scharfmann R, Rutter GA, Van Obberghen E. MicroRNA-124a regulates Foxa2 expression and intracellular signaling in pancreatic beta-cell lines. J Biol Chem. 2007 Jul 6; 282 (27):19575-88. PubMed PMID: 17462994. 152. El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D, van Obberghen E. miR-375 targets 3'-phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells. Diabetes. 2008 Oct; 57 (10):2708-17. PubMed PMID: 18591395; PubMed Central PMCID: PMC2551681. 153. Hennessy E, Clynes M, Jeppesen PB, O'Driscoll L. Identification of microRNAs with a role in glucose stimulated insulin secretion by expression profiling of MIN6 cells. Biochem Biophys Res Commun. 2010 May 28; 396 (2):457-62. PubMed PMID: 20417623. 154. Melkman-Zehavi T, Oren R, Kredo-Russo S, Shapira T, Mandelbaum AD, Rivkin N, Nir T, Lennox KA, Behlke MA, Dor Y, Hornstein E. miRNAs control insulin content in pancreatic β-cells via downregulation of transcriptional repressors. EMBO J. 2011 Mar 2; 30 (5):835-45. PubMed PMID: 21285947; PubMed Central PMCID: PMC3049206. 155. Behrman S, Acosta-Alvear D, Walter P. A CHOP-regulated microRNA controls rhodopsin expression. J Cell Biol. 2011 Mar 21; 192 (6):919-27. PubMed PMID: 21402790; PubMed Central PMCID: PMC3063143. 156. Bartoszewski R, Brewer JW, Rab A, Crossman DK, Bartoszewska S, Kapoor N, Fuller C, Collawn JF, Bebok Z. The unfolded protein response (UPR)-activated transcription factor X-box-binding protein 1 (XBP1) induces microRNA-346 expression that targets the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regulatory genes. J Biol Chem. 2011 Dec 2; 286 (48):41862-70. PubMed PMID: 22002058; PubMed Central PMCID: PMC3308892. 157. Belmont PJ, Chen WJ, Thuerauf DJ, Glembotski CC. Regulation of microRNA expression in the heart by the ATF6 branch of the ER stress response. J Mol Cell Cardiol. 2012 Feb 1; PubMed PMID: 22326432. 158. Byrd AE, Aragon IV, Brewer JW. MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response. J Cell Biol. 2012 Mar 19; 196 (6):689-98. PubMed PMID: 22431749; PubMed Central PMCID: PMC3308703. 159. Ishigaki S, Fonseca SG, Oslowski CM, Jurczyk A, Shearstone JR, Zhu LJ, Permutt MA, Greiner DL, Bortell R, Urano F. AATF mediates an antiapoptotic effect of the unfolded protein response through transcriptional regulation of AKT1. Cell Death Differ. 2010 May; 17 (5):774-86. PubMed PMID: 19911006; PubMed Central PMCID: PMC2854298. 131

160. Sparsø T, Andersen G, Albrechtsen A, Jørgensen T, Borch-Johnsen K, Sandbaek A, Lauritzen T, Wasson J, Permutt MA, Glaser B, Madsbad S, Pedersen O, Hansen T. Impact of polymorphisms in WFS1 on prediabetic phenotypes in a population-based sample of middle-aged people with normal and abnormal glucose regulation. Diabetologia. 2008 Sep; 51 (9):1646-52. PubMed PMID: 18568334. 161. Cheurfa N, Brenner GM, Reis AF, Dubois-Laforgue D, Roussel R, Tichet J, Lantieri O, Balkau B, Fumeron F, Timsit J, Marre M, Velho G. Decreased insulin secretion and increased risk of type 2 diabetes associated with allelic variations of the WFS1 gene: the Data from Epidemiological Study on the Insulin Resistance Syndrome (DESIR) prospective study. Diabetologia. 2011 Mar; 54 (3):554-62. PubMed PMID: 21127832. 162. Wasson J, Permutt MA. Candidate gene studies reveal that the WFS1 gene joins the expanding list of novel type 2 diabetes genes. Diabetologia. 2008 Mar; 51 (3):391-3. PubMed PMID: 18197395. 163. Mita M, Miyake K, Zenibayashi M, Hirota Y, Teranishi T, Kouyama K, Sakaguchi K, Kasuga M. Association study of the effect of WFS1 polymorphisms on risk of type 2 diabetes in Japanese population. Kobe J Med Sci. 2008 Oct 30; 54 (4):E192-9. PubMed PMID: 19258739. 164. Lyssenko V, Jonsson A, Almgren P, Pulizzi N, Isomaa B, Tuomi T, Berglund G, Altshuler D, Nilsson P, Groop L. Clinical risk factors, DNA variants, and the development of type 2 diabetes. N Engl J Med. 2008 Nov 20; 359 (21):2220-32. PubMed PMID: 19020324. 165. Yebra M, Montgomery AM, Diaferia GR, Kaido T, Silletti S, Perez B, Just ML, Hildbrand S, Hurford R, Florkiewicz E, Tessier-Lavigne M, Cirulli V. Recognition of the neural chemoattractant Netrin-1 by integrins alpha6beta4 and alpha3beta1 regulates epithelial cell adhesion and migration. Dev Cell. 2003 Nov; 5 (5):695-707. PubMed PMID: 14602071. 166. De Breuck S, Lardon J, Rooman I, Bouwens L. Netrin-1 expression in fetal and regenerating rat pancreas and its effect on the migration of human pancreatic duct and porcine islet precursor cells. Diabetologia. 2003 Jul; 46 (7):926-33. PubMed PMID: 12819897. 167. Yang YH, Szabat M, Bragagnini C, Kott K, Helgason CD, Hoffman BG, Johnson JD. Paracrine signalling loops in adult human and mouse pancreatic islets: netrins modulate beta cell apoptosis signalling via dependence receptors. Diabetologia. 2011 Apr; 54 (4):828-42. PubMed PMID: 21212933. 168. Lesperance MM, WFS1 gene mutation and polymorphism database. http://www.khir.med.umich.edu/research/lesperance_lab/low_freq.pho 169. Alimadadi A, Ebrahim-Habibi A, Abbasi F, Amoli M, Sayahpour FA, Larijani B. Novel mutations of wolframin: a report with a look at the protein structure. Clin Genet. 2011 Jan; 79 (1):96-9. PubMed PMID: 21143470. 170. Kadowaki T, Kadowaki H, Accili D, Yazaki Y, Taylor SI. Substitution of arginine for histidine at position 209 in the alpha-subunit of the human insulin receptor A mutation that impairs receptor dimerization and transport of receptors to the cell surface. J Biol Chem. 1991 Nov 5; 266 (31):21224-31. PubMed PMID: 1657953. 171. Barbetti F, Raben N, Kadowaki T, Cama A, Accili D, Gabbay KH, Merenich JA, Taylor SI, Roth J. Two unrelated patients with familial hyperproinsulinemia due to a mutation substituting histidine for arginine at position 65 in the proinsulin molecule: identification of the mutation by direct sequencing of genomic deoxyribonucleic acid amplified by polymerase chain reaction. J Clin Endocrinol Metab. 1990 Jul; 71 (1):164-9. PubMed PMID: 2196279. 172. Geffner ME, Su F, Ross NS, Hershman JM, Van Dop C, Menke JB, Hao E, Stanzak RK, Eaton T, Samuels HH. An arginine to histidine mutation in codon 311 of the C-erbA beta gene results in a mutant thyroid hormone receptor that does not mediate a dominant negative phenotype. J Clin Invest. 1993 Feb; 91 (2):538-46. PubMed PMID: 8381821; PubMed Central PMCID: PMC287976. 173. Shalev A, Pise-Masison CA, Radonovich M, Hoffmann SC, Hirshberg B, Brady JN, Harlan DM. Oligonucleotide microarray analysis of intact human pancreatic islets: identification of glucose- responsive genes and a highly regulated TGFbeta signaling pathway. Endocrinology. 2002 Sep; 143 (9):3695-8. PubMed PMID: 12193586. 132

174. Wallace TM, Levy JC, Matthews DR. Use and abuse of HOMA modeling. Diabetes Care. 2004 Jun; 27 (6):1487-95. PubMed PMID: 15161807. 175. Srinivasan K, Strickland P, Valdes A, Shin GC, Hinck L. Netrin-1/neogenin interaction stabilizes multipotent progenitor cap cells during mammary gland morphogenesis. Dev Cell. 2003 Mar; 4 (3):371-82. PubMed PMID: 12636918. 176. Salminen M, Meyer BI, Bober E, Gruss P. Netrin 1 is required for semicircular canal formation in the mouse inner ear. Development. 2000 Jan; 127 (1):13-22. PubMed PMID: 10654596. 177. Tessier-Lavigne M, Placzek M, Lumsden AG, Dodd J, Jessell TM. Chemotropic guidance of developing axons in the mammalian central nervous system. Nature. 1988 Dec 22-29; 336 (6201):775-8. PubMed PMID: 3205306. 178. Liu Y, Stein E, Oliver T, Li Y, Brunken WJ, Koch M, Tessier-Lavigne M, Hogan BL. Novel role for Netrins in regulating epithelial behavior during lung branching morphogenesis. Curr Biol. 2004 May 25; 14 (10):897-905. PubMed PMID: 15186747; PubMed Central PMCID: PMC2925841. 179. Lejmi E, Leconte L, Pédron-Mazoyer S, Ropert S, Raoul W, Lavalette S, Bouras I, Feron JG, Maitre-Boube M, Assayag F, Feumi C, Alemany M, Jie TX, Merkulova T, Poupon MF, Ruchoux MM, Tobelem G, Sennlaub F, Plouët J. Netrin-4 inhibits angiogenesis via binding to neogenin and recruitment of Unc5B. Proc Natl Acad Sci U S A. 2008 Aug 26; 105 (34):12491-6. PubMed PMID: 18719102; PubMed Central PMCID: PMC2518829. 180. Lu X, Le Noble F, Yuan L, Jiang Q, De Lafarge B, Sugiyama D, Bréant C, Claes F, De Smet F, Thomas JL, Autiero M, Carmeliet P, Tessier-Lavigne M, Eichmann A. The netrin receptor UNC5B mediates guidance events controlling morphogenesis of the vascular system. Nature. 2004 Nov 11; 432 (7014):179-86. PubMed PMID: 15510105. 181. Larrieu-Lahargue F, Welm AL, Thomas KR, Li DY. Netrin-4 induces lymphangiogenesis in vivo. Blood. 2010 Jul 1; 115 (26):5418-26. PubMed PMID: 20407033; PubMed Central PMCID: PMC2902137. 182. Kang JS, Yi MJ, Zhang W, Feinleib JL, Cole F, Krauss RS. Netrins and neogenin promote myotube formation. J Cell Biol. 2004 Nov 8; 167 (3):493-504. PubMed PMID: 15520228; PubMed Central PMCID: PMC2172498. 183. Ly NP, Komatsuzaki K, Fraser IP, Tseng AA, Prodhan P, Moore KJ, Kinane TB. Netrin-1 inhibits leukocyte migration in vitro and in vivo. Proc Natl Acad Sci U S A. 2005 Oct 11; 102 (41):14729- 34. PubMed PMID: 16203981; PubMed Central PMCID: PMC1253572. 184. Ishihara H, Takeda S, Tamura A, Takahashi R, Yamaguchi S, Takei D, Yamada T, Inoue H, Soga H, Katagiri H, Tanizawa Y, Oka Y. Disruption of the WFS1 gene in mice causes progressive beta-cell loss and impaired stimulus-secretion coupling in insulin secretion. Hum Mol Genet. 2004 Jun 1; 13 (11):1159-70. PubMed PMID: 15056606. 185. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol. 2009 Feb; 10 (2):126-39. PubMed PMID: 19165215. 186. Dai R, Li J, Liu Y, Yan D, Chen S, Duan C, Liu X, He T, Li H. miR-221/222 suppression protects against endoplasmic reticulum stress-induced apoptosis via p27(Kip1)- and MEK/ERK-mediated cell cycle regulation. Biol Chem. 2010 Jul; 391 (7):791-801. PubMed PMID: 20624000. 187. Vigorito E, Perks KL, Abreu-Goodger C, Bunting S, Xiang Z, Kohlhaas S, Das PP, Miska EA, Rodriguez A, Bradley A, Smith KG, Rada C, Enright AJ, Toellner KM, Maclennan IC, Turner M. microRNA-155 regulates the generation of immunoglobulin class-switched plasma cells. Immunity. 2007 Dec; 27 (6):847-59. PubMed PMID: 18055230 188. Huang X, Ding L, Bennewith KL, Tong RT, Welford SM, Ang KK, Story M, Le QT, Giaccia AJ. Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. Mol Cell. 2009 Sep 24; 35 (6):856-67. PubMed PMID: 19782034; PubMed Central PMCID: PMC2782615. 189. Yeung ML, Bennasser Y, LE SY, Jeang KT. siRNA, miRNA and HIV: promises and challenges. Cell Res. 2005 Nov-Dec; 15 (11-12):935-46. PubMed PMID: 16354572. 133

190. Kim VN. Small RNAs: classification, biogenesis, and function. Mol Cells. 2005 Feb 28; 19 (1):1-15. PubMed PMID: 15750334 191. Croce CM, Calin GA. miRNAs, cancer, and stem cell division. Cell. 2005 Jul 15; 122 (1):6-7. PubMed PMID: 16009126. 192. Niu Y, Mo D, Qin L, Wang C, Li A, Zhao X, Wang X, Xiao S, Wang Q, Xie Y, He Z, Cong P, Chen Y. Lipopolysaccharide-induced miR-1224 negatively regulates tumour necrosis factor-α gene expression by modulating Sp1. Immunology. 2011 May; 133 (1):8-20. PubMed PMID: 21320120; PubMed Central PMCID: PMC3088963. 193. Kriegel AJ, Liu Y, Fang Y, Ding X, Liang M. The miR-29 family: genomics, cell biology, and relevance to renal and cardiovascular injury. Physiol Genomics. 2012 Feb 27; 44 (4):237-44. PubMed PMID: 22214600; PubMed Central PMCID: PMC3289120. 194. Williams AE, Moschos SA, Perry MM, Barnes PJ, Lindsay MA. Maternally imprinted microRNAs are differentially expressed during mouse and human lung development. Dev Dyn. 2007 Feb; 236 (2):572-80. PubMed PMID: 17191223; PubMed Central PMCID: PMC2582151. 195. Wang X, Zhang X, Ren XP, Chen J, Liu H, Yang J, Medvedovic M, Hu Z, Fan GC. MicroRNA-494 targeting both proapoptotic and antiapoptotic proteins protects against ischemia/reperfusion-induced cardiac injury. Circulation. 2010 Sep 28; 122 (13):1308-18. PubMed PMID: 20837890; PubMed Central PMCID: PMC2956502 196. Vallejo DM, Caparros E, Dominguez M. Targeting Notch signalling by the conserved miR-8/200 microRNA family in development and cancer cells. EMBO J. 2011 Feb 16; 30 (4):756-69. PubMed PMID: 21224847; PubMed Central PMCID: PMC3041954. 197. Kennell JA, Gerin I, MacDougald OA, Cadigan KM. The microRNA miR-8 is a conserved negative regulator of Wnt signaling. Proc Natl Acad Sci U S A. 2008 Oct 7; 105 (40):15417-22. PubMed PMID: 18824696; PubMed Central PMCID: PMC2563117. 198. Hyun S, Lee JH, Jin H, Nam J, Namkoong B, Lee G, Chung J, Kim VN. Conserved MicroRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K. Cell. 2009 Dec 11; 139 (6):1096-108. PubMed PMID: 20005803. 199. Zheng GX, Ravi A, Gould GM, Burge CB, Sharp PA. Genome-wide impact of a recently expanded microRNA cluster in mouse. Proc Natl Acad Sci U S A. 2011 Sep 20; 108 (38):15804-9. PubMed PMID: 21911408; PubMed Central PMCID: PMC3179086. 200. Oslowski CM, Urano F. The binary switch that controls the life and death decisions of ER stressed β cells. Curr Opin Cell Biol. 2011 Apr; 23 (2):207-15. PubMed PMID: 21168319; PubMed Central PMCID: PMC3078183. 201. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA, Olson EN. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. Proc Natl Acad Sci U S A. 2008 Sep 2; 105 (35):13027-32. PubMed PMID: 18723672; PubMed Central PMCID: PMC2529064. 202. Cushing L, Kuang PP, Qian J, Shao F, Wu J, Little F, Thannickal VJ, Cardoso WV, Lü J. miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am J Respir Cell Mol Biol. 2011 Aug; 45 (2):287-94. PubMed PMID: 20971881; PubMed Central PMCID: PMC3175558. 203. Roderburg C, Urban GW, Bettermann K, Vucur M, Zimmermann H, Schmidt S, Janssen J, Koppe C, Knolle P, Castoldi M, Tacke F, Trautwein C, Luedde T. Micro-RNA profiling reveals a role for miR-29 in human and murine liver fibrosis. Hepatology. 2011 Jan; 53 (1):209-18. PubMed PMID: 20890893. 204. Qin W, Chung AC, Huang XR, Meng XM, Hui DS, Yu CM, Sung JJ, Lan HY. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29. J Am Soc Nephrol. 2011 Aug; 22 (8):1462- 74. PubMed PMID: 21784902; PubMed Central PMCID: PMC3148701. 205. Liu S, Wu LC, Pang J, Santhanam R, Schwind S, Wu YZ, Hickey CJ, Yu J, Becker H, Maharry K, Radmacher MD, Li C, Whitman SP, Mishra A, Stauffer N, Eiring AM, Briesewitz R, Baiocchi RA, Chan KK, Paschka P, Caligiuri MA, Byrd JC, Croce CM, Bloomfield CD, Perrotti D, Garzon R, Marcucci G. Sp1/NFkappaB/HDAC/miR-29b regulatory network in KIT-driven myeloid leukemia. 134

Cancer Cell. 2010 Apr 13; 17 (4):333-47. PubMed PMID: 20385359; PubMed Central PMCID: PMC2917066. 206. Wang H, Garzon R, Sun H, Ladner KJ, Singh R, Dahlman J, Cheng A, Hall BM, Qualman SJ, Chandler DS, Croce CM, Guttridge DC. NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. Cancer Cell. 2008 Nov 4; 14 (5):369-81. PubMed PMID: 18977326. 207. Li Z, Hassan MQ, Jafferji M, Aqeilan RI, Garzon R, Croce CM, van Wijnen AJ, Stein JL, Stein GS, Lian JB. Biological functions of miR-29b contribute to positive regulation of osteoblast differentiation. J Biol Chem. 2009 Jun 5; 284 (23):15676-84. PubMed PMID: 19342382; PubMed Central PMCID: PMC2708864. 208. Ma F, Xu S, Liu X, Zhang Q, Xu X, Liu M, Hua M, Li N, Yao H, Cao X. The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ. Nat Immunol. 2011 Jul 24; 12 (9):861-9. PubMed PMID: 21785411. 209. Han YC, Park CY, Bhagat G, Zhang J, Wang Y, Fan JB, Liu M, Zou Y, Weissman IL, Gu H. microRNA-29a induces aberrant self-renewal capacity in hematopoietic progenitors, biased myeloid development, and acute myeloid leukemia. J Exp Med. 2010 Mar 15; 207 (3):475-89. PubMed PMID: 20212066; PubMed Central PMCID: PMC2839143 210. Gebeshuber CA, Zatloukal K, Martinez J. miR-29a suppresses tristetraprolin, which is a regulator of epithelial polarity and metastasis. EMBO Rep. 2009 Apr; 10 (4):400-5. PubMed PMID: 19247375; PubMed Central PMCID: PMC2672883. 211. Mott JL, Kobayashi S, Bronk SF, Gores GJ. mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13; 26 (42):6133-40. PubMed PMID: 17404574; PubMed Central PMCID: PMC2432524. 212. Park SY, Lee JH, Ha M, Nam JW, Kim VN. miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42. Nat Struct Mol Biol. 2009 Jan; 16 (1):23-9. PubMed PMID: 19079265. 213. Pullen TJ, da Silva Xavier G, Kelsey G, Rutter GA. miR-29a and miR-29b contribute to pancreatic beta-cell-specific silencing of monocarboxylate transporter 1 (Mct1). Mol Cell Biol. 2011 Aug; 31 (15):3182-94. PubMed PMID: 21646425; PubMed Central PMCID: PMC3147603. 214. He A, Zhu L, Gupta N, Chang Y, Fang F. Overexpression of micro ribonucleic acid 29, highly upregulated in diabetic rats, leads to insulin resistance in 3T3-L1 adipocytes. Mol Endocrinol. 2007 Nov; 21 (11):2785-94. PubMed PMID: 17652184. 215. Kole AJ, Swahari V, Hammond SM, Deshmukh M. miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev. 2011 Jan 15; 25 (2):125-30. PubMed PMID: 21245165; PubMed Central PMCID: PMC3022258. 216. Li J, Lee B, Lee AS. Endoplasmic reticulum stress-induced apoptosis: multiple pathways and activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. J Biol Chem. 2006 Mar 17; 281 (11):7260-70. PubMed PMID: 16407291. 217. Reimertz C, Kögel D, Rami A, Chittenden T, Prehn JH. Gene expression during ER stress-induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway. J Cell Biol. 2003 Aug 18; 162 (4):587-97. PubMed PMID: 12913114; PubMed Central PMCID: PMC2173793. 218. Rabinowits G, Gerçel-Taylor C, Day JM, Taylor DD, Kloecker GH. Exosomal microRNA: a diagnostic marker for lung cancer. Clin Lung Cancer. 2009 Jan; 10 (1):42-6. PubMed PMID:19289371. 219. Karasik A, O'Hara C, Srikanta S, Swift M, Soeldner JS, Kahn CR, Herskowitz RD. Genetically programmed selective islet beta-cell loss in diabetic subjects with Wolfram's syndrome. Diabetes Care. 1989 Feb; 12 (2) :135-8. PubMed PMID:2649325. 220. Hardy C, Khanim F, Torres R, Scott-Brown M, Seller A, Poulton J, Collier D, Kirk J, Polymeropoulos M, Latif F, Barrett T. Clinical and molecular genetic analysis of 19 Wolfram syndrome kindreds demonstrating a wide spectrum of mutations in WFS1. Am J Hum Genet. 1999 Nov; 65 (5) :1279-90. PubMed PMID:10521293; PubMed Central PMCID: PMC1288280 135

221. Rankin MM, Kushner JA. Aging induces a distinct gene expression program in mouse islets. Islets. 2010 Nov 1; 2 (6) :345-52. PubMed PMID:21099336; PubMed Central PMCID: PMC3062249. 222. Akiyama M, Hatanaka M, Ohta Y, Ueda K, Yanai A, Uehara Y, Tanabe K, Tsuru M, Miyazaki M, Saeki S, Saito T, Shinoda K, Oka Y, Tanizawa Y. Increased insulin demand promotes while pioglitazone prevents pancreatic beta cell apoptosis in Wfs1 knockout mice. Diabetologia. 2009 Apr; 52 (4) :653-63. PubMed PMID:19190890. 223. Atouf F, Czernichow P, Scharfmann R. Expression of neuronal traits in pancreatic beta cells Implication of neuron-restrictive silencing factor/repressor element silencing transcription factor, a neuron-restrictive silencer. J Biol Chem. 1997 Jan 17; 272 (3) :1929-34. PubMed PMID:8999882.