TRANSACTIONS of the MALAYSIAN SOCIETY of PLANT PHYSIOLOGY Vol

TRANSACTIONS OF THE MALAYSIAN SOCIETY OF PLANT PHYSIOLOGY Vol. 26

Challenges and Strategies for Plant Productivity and Resilience

Rogayah Sekeli Ahmad Nazarudin Mohd Roseli Normaniza Osman Roohaida Othman Siti Aishah Hassan Siti Hajar Ahmad Lok Eng Hai Nor Mayati Che Husin Tsan Fui Ying Zamri Ishak Puteri Edaroyati Megat Wahab Martini Mohammad Yusoff Nazrul Hisham Nazaruddin Amin Asyraf Tamizi eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

TRANSACTIONS OF THE MALAYSIAN SOCIETY OF PLANT PHYSIOLOGY VOL. 26

Challenges and Strategies for Plant Productivity and Resilience

28th Malaysian Society of Plant Physiology Conference (MSPPC 2018) Held at Hotel Perdana Kota Bharu, Kelantan, Malaysia (28-30 August 2018)

Rogayah Sekeli Ahmad Nazarudin Mohd. Roseli Normaniza Osman Roohaida Othman Siti Aishah Hassan Siti Hajar Ahmad Lok Eng Hai Nor Mayati Che Husin Tsan Fui Ying Zamri Ishak Puteri Edaroyati Megat Wahab Martini Mohammad Yusoff Nazrul Hisham Nazaruddin Amin Asyraf Tamizi

Organised by

Malaysian Society of Plant Physiology

Publisher

Malaysian Society of Plant Physiology Locked Bag No. 282, UPM Post Office, 43409 UPM, Serdang, Selangor, Malaysia URL: http//mspp.org.my

MSPP is a professional scientific body dedicated towards promoting research and development in tropical plant biology

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Contents Page

Table of contents iii

CHAPTER 1: PLANT GROWTH AND DEVELOPMENT 1

1. Seed Dormancy as a Potential Escape Mechanism for Weedy Rice (Oryza sativa) from 2 Imidazolinone Herbicide Application Mispan, M.S., Ishak, M.N., Md-Akhir, A.H.B. and Zulrushdi, A.Q.

2. Preliminary Study on Rice (Oryza sativa L.) var. MRQ 76 Performance Cultivated under 8 Agro-ecological Approach Mohd Fairuz, M.S., Che Radziah, C.M.Z., Mohd Shahrul, M.N. and Muhammad Syamil, M.

3. Alleviation of Salt Stressed Malaysian Indica Rice Seed (cv. MR 263) by using Potassium 14 Chloride, Potassium Nitrate, Salicylic Acid and Gibberellic Acid Nurfatiha, M., Rosimah, N. and Mohd Hafiz, I.

4. Application of Seed Priming Technique by using KCl, Thiourea, Kinetin and Salicylic 21 Acid to Enhance Germination of Malaysian Indica Rice Seed cv. MR 284 under Drought Stress Mahadi, S.N., Nulit, R., Ibrahim, M.H. and Ab. Ghani, N.I.

5. The Potential of Organic Amended Acid Sulphate Soil for MR 220 Rice Cultivation 27 Aizuddin, M.R.K.A., Wahida, N.H., Adzmi, Y. and Nur Firdaus, A.R.

6. Mudflats to Marvel: Soil Health of a Successfully Restored Mangrove Coastline in Sungai 36 Besar, Selangor Jeyanny, V., Mohamad Fakhri, I., Wan Rasidah, K., Rozita, A., Siva Kumar, B. and Daljit, K.S.

7. Growth Performance of Planted Mangrove and Rhu Species in Perak: A Preliminary 40 Result Salleh, M., Wan Mohd Shukri, W.A., Nur Hajar, Z.S., Mohd Danial, M.S., Abdul Aizudden, A.A., Aminudin, A.A. and Muhamad Khairul, E.

8. Growth Performance of Rhizophora Trees at Mangrove Forest in Tanjung Piai, Johor 42 Nur Hafiza, A.H., Wan Rasidah, K., Rosazlin. A., Mohamad Fakhri, I. and Nur Zahirah, Z.

9. Flower Composition of Black Pepper (Piper nigrum L.) Varieties in Bintulu, Sarawak 46 Noorasmah, S., Nurul A’in, J. and Shiamala, D.R.

10. A Propagation Technique of Scindapsus pictus and Piper porphyrophyllum as a New 52 Native Functional Plant for Indoor Landscape Masnira, M.Y., Mohad Hoszaini, R., Mohd Yusmizan, A.M., Zulhazmi, S. and Hanim, A.

iii

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

11. A Preliminary Study on the Effects of Reproductive Growth and Fruit Quality of Mango 55 var. Harumanis from Different Interstock Muhamad Hafiz, M.H., Wan Mahfuzah, W.I. and Ahmad Mahdzir, A.

12. Effect of N-P-K Fertilizer, Biochar and Compost on the Growth of Citrus hystrix 60 Syafiqah Nabilah, S.B., Farah Fazwa, M.A., Norhayati, S., Jeyanny, V., Mohd Zaki, A., Mohd Asri, L. and Samsuri, T.H.

13. Optimizing Immature Oil Palm Growth with Integrated New Developed Biochemical 66 Fertilizer Erwan Syah, T., Izwanizan, A. and Tan Geok, H.

14. Effects of Organic Fertilizer Containing Beneficial Elements GanoCare® on Vegetative 73 Growth and Physiological Responses of Oil Palm Seedlings Mohd Shukri, I., Idris, A.S., Norman, K. and Hanafi, M.M

15. Floral Behaviour and Unique Autonomous Self-pollination of Passiflora Species (Passion 79 Fruit) Ramaiya, S.D., Bujang, J.S. and Zakaria, M.H.

16. Photosynthetic Characteristics and Instantaneous Water-use Efficiency of Sago Palms 85 A’fifah, A.R., Kho, L.K., Zurilawati, Z., Samsul Kamal, R. and Maizan, I.

17. A Preliminary Study on Propagation Systems to Induce Shoot-bud Proliferation of 90 Arundina graminifolia Sakinah, I., Che Radziah, C.M.Z., Ab. Kahar, S. and Wan Rozita, W.E.

18. Microscopic Identification of Two Important Varieties of Labisia pumila in Peninsular 94 Malaysia Syafiqah Nabilah, S.B., Farah Fazwa, M.A., Norhayati, S. and Ummu Hani, B.

19. Air Root Pruning Improves Root Growth Performance of Lettuce (Lactuca sativa L.) 99 Seedling Abid, M.A., Che Radziah, C.M.Z., Ab. Kahar, S. and Farahzety, A.M.

20. Crossability and Compatibility Rate in Crosses Between Semerah Chilli (Capsicum 103 annuum) with Selected Chilli Padi Varieties (Capsicum frutescens) Suhana, O., Norfadzilah, A.F., Mohd Zamri, K. and Siti Nur Hafizah, M.

21. Growth Performance of Acacia Species on Beach Ridges Interspersed with Swales (Bris) 106 Soils Dasrul Iskandar, D., Lok, E.H., Faridah, A.A., Rosdi, K. and Amir, S.

22. Growth and Inflorescence Development of Several Cauliflower (Brassica oleracea var. 109 botrytis L.) Hybrids in Malaysian Environment Norfadzilah, A.F., Suhana, O., Farahzety, A.M., Nur Adliza, B., Nur Syafini, G., Rozlaily, Z., Ilyas, K., Nur Fatin, M.S. and Mohd. Raimi, A.K.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

23. Regulated Deficit Irrigation Technique using Different Crop Coefficients (Kc) at 116 Different Growth Stages Affects the Growth, Yield and Postharvest Quality of Roselle Grown on BRIS Soil Nur Amirah, Y., Nur Iliana, M.R., Adzemi, M.A. and Wan Zaliha, W.S.

24. Fascinating Orchids for Contemporary Understory Landscape 123 Wan Rozita, W.E., Rozlaily, Z., Norhasbulloh, A. and Nurul Enanee, A.K.

25. Biochemical Response of Xanthostemon chrysanthus (Golden Penda) to Paclobutrazol 128 and Potassium Nitrate Ahmad Nazarudin, M.R., Tsan, F.Y. and Normaniza, O.

26. Air Layering Propagation Media of Baeckea frutescens from Setiu, Terengganu 135 Farah Fazwa, M.A., Norhayati, S., Syafiqah Nabilah, S.B., Mohd Zaki, A., Samsuri, T.H., Nor Izatty Atikah, J.S., Fara Shazwanie, O.T. and Mohd Zaini, Z.

27. Evaluation of Biomass Increment and Stand Dynamics of Gonystylus bancanus (Ramin 141 Melawis) in Peat Swamp Forest, Pekan, Pahang, Malaysia Mohd Afzanizam, M., Azman, B. and Philip, E.

28. Effect of Different Fertilizer Application on the Growth of Eucalyptus pellita 147 Rohanie, B. and Phui, S.L.

29. Improvement through Selection of Plus Tree in Shorea roxburghii 151 Nor Fadilah, W., Mohd Zaki, A., Mohamad Lokmal, N., Farah Fazwa, M.A., Muhammad Asri, L. and Ahmad Fauzi, M.S.

CHAPTER 2: ECOPHYSIOLOGY AND STRESS BIOLOGY 159 9 30. Assessment of Growth Performance of Thaumatococcus daniellii, a Natural Sweetener 160 Species Grown under Natural Environment Nurul Hidayah, K., Mohd Yusoff, A. and Shamsiah, A.

31. Effects of Acidic Soil on the Growth of Potential Slope Plants 169 Normaniza, O., Nur Syamimi Syafiqah, M. and Siti Fatimah, S.

32. Physiological Responses, Nutrient Content and Fruit Quality of Mango (Mangifera indica 174 L.) cv. Harumanis at Different Agro-climatic Zones Mohd Aziz, R., Shaidatul, A.A.T., Fauzi, J., Zabawi, M.A.G., Norlida, M.H., Hafiz, M.M.H., Fazlyzan, A., Norfarhah, A.R., Nizam, S.A.B., Subahir, S., Malek, A.K., Ghazali, M.R. and Alif, O.M.M.

33. The Effects of Sodium Chloride on Plant Physiology and Central Carbon Metabolism in 179 Wheat Che-Othman, M.H., Jacoby, R.P., Millar, A.H. and Taylor, N.L.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

CHAPTER 3: POST-HARVEST TECHNOLOGY AND QUALITY CONTROL 186

34. Extending Storage Life of Carambola Fruits (Averrhoa carambola cv. B10) with 187 Dynamic Controlled Atmosphere (DCA) Technology Joanna, C.L.Y., Wan Mohd Reza, W.H., Tham, S.L., Zaipun, M.Z., Razali, M., Nur Izzati, M. and Mohamad Fikkri, A.H

35. Cold Storage Improved Postharvest Life of Durian (Durio zibethinus cv. Musang King) 191 Nur Azlin, R., Zaipun, M.Z., Siti Aisyah, A., Razali, M., Habsah, M. and Siti Khuzaimah, T.

36. Effect of Fruit Maturity Stages on Physiochemical Properties of Lowland Tomato No. 32 195 Stored at Ambient Temperature Nur Syafini, G., Azhar, M.N., Nurul Khdijah, R., Nor Hazlina, M.S., Rahayu, A., Rozlaily, Z. and Zaulia, O.

37. Application of EOnature to Extend Shelf Life of Kuini (Mangifera odorata) Stored at 200 Ambient Temperature Wan Mahfuzah, W.I., Hanif, M.A., Siti Aishah, H., Zulhelmy, A.S., Zaulia, O., Nor Hanis Aifaa, Y., Mohd Shukri, M.A. and Razali, M.

38. Storage Trials of Falcataria moluccana (Batai) Seeds at Different Temperatures 203 Sabrina, A.J. and Mas Dora, T.

39. Dynamic Controlled Atmosphere (DCA) Storage Technique Delays Ripening and Decay 208 Incidence in Stored Chokanan Mango Wan Mohd Reza Ikwan, W.H., Tham, S.L., Mohamad Fikkri, A.H., Zaipun, M.Z. and Habsah, M.

CHAPTER 4: PEST AND DISEASE MANAGEMENT 214

40. Screening for Antifungal Activity of Allamanda cathartica Stem Crude Extracts Against 215 Pyricularia oryzae, Causal Agent of Rice Blast Disease Khairun Nur, A., Neni Kartini, C.M.R., Farah Farhanah, H., Hamimah, M. and Nor Yuziah, M.Y.

41. Biopesticides Approach Against Leaf Roller Caterpillar, Pyrausta panopealis on Misai 222 Kucing, Orthosiphon stamineus in Malaysia Wan Khairul Anuar, W.A., Ahmad Azinuddin, A.R., Nurul Najwa, Z., Badrol Hisham, I., Mohd Nazri, B., Nurin Izzati, M.Z., Rosliza, J., Siti Noor Aishikin, A.H., Masnira, M.Y., Patahayah, M., Aminah, M., Mohd Salleh, S. and Nur Saliha, A.Z.

42. Evaluation of Different Inoculation Techniques for Blossom Blight Disease, 227 Colletotrichum gloeosporioides of Mango Flower Nor Dalila, N.D., Muhamad Hafiz, M.H., Nurul Fahima, M.A. and Nur Aisyah Anis, A.K.

43. Characterization and Evaluation of Fungicides for Control of Phytophthora palmivora on 231 Cocoa (Theobroma cacao) Ong, S.N., Leong, S.S. and Kwan, Y.M.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

CHAPTER 5: PLANT PRODUCTION 237

44. A Preliminary Study on the Carbon Dioxide (CO2) Production from Saccharomyces 238 cerevisiae Fermentation Activity Azzami, A.M.M., Yaapar, M.N., Jusoh, M. and Zulkifli, N.A.

45. Nutritional Analysis and Antioxidant Extraction from Different Parts of Petai Belalang 242 (Leucaena leucocephala) as Functional Food Muhammad, A.S., Khanto, P., Ramli, N.S., Abd Hamid, A., Shukri, R. and Pak Dek, M.S.

46. Soft Flesh Incidence in Harumanis Caused by Carbon Bagging: Truth or Myth? 247 Siti Aisyah, A., Wan Mahfuzah, W.I., Kamal, M.T., Siti Nur Raihan, A., Razali, M., Nur Syafini, G., Fadhilnor, A., Nurul Syazila, A.R., Othman, I., Tham, S.L., Zaipun, M.Z., Habsah, M., Hanif, M.A., Syafikah, R., Siti Aishah, H. dan Zainab, Y.

47. Yield, Antioxidant, Phenolics and Flavonoid of Misai Kucing (Orthosiphon aristatus) at 251 Different Flowering Stage Rosnani, A.G., Samsiah, J., Siti Nurzahidah, Z.A., Noor Safuraa, S. and Hafizol, M.D.

48. Development of Horn-type Dendrobium Orchid Hybrids for Potted and Landscaping 255 Farah Zaidat, M.N., Najah, Y. and Rozlaily, Z.

49. Responses of Chinese Cabbage to DK-20 as Plant Fertilizer Additive 258 Umikalsum, M.B. and Muhamad Radzali, M.

50. The Potential of Terung Telunjuk (Solanum sp.) for Food and Nutritional Security 261 Umikalsum, M.B., Razean Haireen, M.R., Siti Noor Aishikin, A.H., Mohd Zulkhairi, A., Erny Sabrina, M.N. , Aminah, M., Nurul Ammar Illani, J. and Umi Kalsum, H.Z.

51. Employing Stable Isotope to Determine Soil, Water and Origin of Water Taken Up by the 266 Trees in Tropical Rainforest Marryanna, L., Yoshiko, K., Siti-Aisah, S., Satoru, T., Shoji, N., Masayuki, I., Masanori, K. and Naoko, M.

52. Evaluation of Media for Early Growth on Mesta (Garcinia mangostana) Seedling 272 Mohd Ridzuan, M.D. and Ab Kahar, S.

CHAPTER 6: SEED TECHNOLOGY AND QUALITY PLANTING MATERIALS 275

53. Bud Initiation and Stem Diameter of Durio zibethinus var. D168 as Affected by Stem 276 Bending and Different PGR Treatments Muhammad Najib, O.G., Mohd Shaib, J., Faizah Salvana, A.R., Nur Asyira, A. and Noor Shahira, M.Y.

54. Seed Storage Behaviour of Potential Fruit Species (Lepisanthes fruticosa) 280 Suryanti, B., Noor Camellia, N.A., Nur Atisha, S., Abdul Muhaimin, A.K. and Mohd Shukri, M.A.

vii

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

55. Effects of Seed Size on Germination and Early Seedling Growth Performance of 285 Lepisanthes fruticosa Nurhazwani, M., Mohd Shukri, M.A.I., Mohd Saifuddin, I. and Mohd Syakir, B.

56. Tuber Yields of Three MARDI Purple Flesh Sweet Potatoes (Ipomoea batatas [L.] Lam) 289 Varieties as Affected by Different Age of Planting Material Nurul Atilia Shafienaz, H., Muhammad Najib, O.G., Omar, H. and Amat Jupri, A.

CHAPTER 7: BIOTECHNOLOGY 292

57. Vegetative Development of Oil Palm Ramets Established from Different Embryoid 293 Structures Samsul Kamal, R., Tarmizi, A.H., Fadila, A.M. and Marhalil, M.

58. Elucidating Pathological Kinetic of Xanthomonas oryzae Infection in Drought Tolerance 298 Rice (Oryza sativa cv. MR219-4) under Drought Condition Mohd Rased, N., Muhammad Yaman, M.A., Ahmad, A. and Noor Hassim, M.F.

59. Effects of Different Potting Media on the Performance of Eucalyptus Hybrid Tissue 303 Culture Plantlets under Nursery Conditions Mohd Saifuldullah, A.W., Nor Hasnida, H., Nazirah, A., Muhd Fuad, Y., Ahmad Zuhaidi, Y., Rozidah, K., Sabariah, R., Naemah, H., Rukiah, M. and Harith Muhaimin, M.

60. Mass Production of Eucalyptus Hybrid for Commercial Plantation 307 Nazirah, A., Nor Hasnida, H., Muhammad Fuad, Y., Mohd Saifuldullah, A.W., Ahmad Zuhaidi, Y., Rozidah, K., Rohani, A., Sabariah, R., Naemah, H., Rukiah, M., Nor Saffana, B. and Muhammad Hakim, A.H.

61. Particle Size Distribution on Different Incubation Temperatures of Nanofertilisers 311 Mohd Nor, M.R., Khalisanni, K., Noor Azlina, M., Busu, A.G., Madzaki, A.G., Masnan, A.G., Asfaliza, R., Hanisa, H. and Kayathri, K.

62. Immunosensor Development for the Detection of Xanthomonas oryzae pv. oryzicola 315 in Rice Bacterial Leaf Streak Hazana, R., Nur Azura, M.S. and Faridah, S.

63. Screening for Antimicrobial Activity of Essential Oils Against Xanthomonas oryzae pv. 321 oryzicola Noor Azlina, M., Faridah, S., Khalisanni, K., Nur Sabrina, W., Mohd Shahrin, G., Muhamad Shafiq, A.K., Siti Nadzirah, P., Kogeethavani, R. and Siti Norsuha, M.

64. Identification of QTLs Linked to Selected Bunch Components in a DxP Oil Palm 325 Mapping Population Zolkafli, S.Z., Ithnin, M., Ting Ngoot, C., Singh, R., Zainol Abidin, M.I. and Ismail, I.

65. A Preliminary Analysis of RuBisCO among Selected Hevea Clones 330 Norazreen, A.R. and Salmah, M.M.

viii

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

66. Effects of Rooting Substrate on Root Development of Hermaphrodite Carica papaya L. 334 cv. Eksotika Produced Through in vitro Mass Propagation Halimah, H., Uma Rani, S., Rogayah, S., Mohd Hakiman, M., Mohd Norfaizal, G. and Muhammad Najib, O.

67. Sensitive Detection of Pyricularia oryzae using Loop Mediated Isothermal Amplification 339 (LAMP) Lau, H.Y., Faridah, S. and Sohana, R.

68. Development of Early Detection of Dieback Disease (Erwinia mallotivora) by using 343 Lateral Flow Immunoassay (LFIA) Technique Adlin Azlina, A.K., Noriha, A. and Erna Mutiara, M.

69. DNA Extraction and Amplification of rbcL from Bee Breads Collected by Malaysian 348 Stingless Bees (Heterotrigona itama) Amin Asyraf, T., Muhammad Faris, M.R., Mohd Azwan, J., Mohd Norfaizal, G. and Noriha, M.A.

70. Micro-biocontrol of Garlic Skin (Allium sativum) and Peanut Skin (Arachis hypogaea) 352 Extract on Apple Snail (Pomacea caniculata) Khalisanni, K., Mohd Nor, M.R., Noor Azlina, M., Zamri, I., Asfaliza, R., Hanisa, H., Kayathri, K. and Maizatulnisa, O.

71. Optimization of Normal Root Culture Production in Kesum 356 Mohd Azhar, H., Ismanizan, I., Ahmad Hafiz, B., Muhammad Shafie, M.S. and Mohamad Zulkiffely, A.R.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 1

Plant Growth and Development

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Seed Dormancy as a Potential Escape Mechanism for Weedy Rice (Oryza sativa) from Imidazolinone Herbicide Application

Mispan, M.S.1, 2,*, Ishak, M.N.1, Md-Akhir, A.H.B.1 and Zulrushdi, A.Q.1 1Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia. 2Centre for Research in Biotechnology for Agriculture (CEBAR), University of Malaya, 50603 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Weedy rice (Oryza sativa L.) or locally known as ‘padi angin’ is one of the notorious weed species in rice growing areas in Malaysia (Baki, 2010; Azmi et al., 2012). In traditional planting practices, weedy rice was controllable due to water seeding, manual transplanting, intensive crop selection, and manual weeding (Cao et al., 2006; Delaouche et al., 2007). However, in the last few decades, weedy rice has been a global major problem since the shift of rice culture from manual transplant system to direct seeding method and introduction of early maturity or semi-dwarf rice varieties (Cao et al., 2006, Delaouche et al., 2007). In Malaysia, the degree of infestation of weedy rice is worrisome with the yield loss caused by weedy rice was reported at about 64,880 tons per year (Baki, 2004). The herbicide-resistant (HR) Clearfield® rice technology (Croughan, 2003) provides an option to control weedy rice in rice using Imidazolinone herbicides. This technology has been developed in Malaysia by a collaborative project between MARDI and BASF (Malaysia) Sdn. Bhd. and was officially launched in 2010 (Azmi et al., 2012). Although, low levels of natural hybridization are known to occur between the crop and weedy rice with gene flow generally ranges from 0.003% to 0.25% (Gealy, 2005; Shivrain et al., 2008), resistant weedy rice were soon detected in many commercial fields in the United States, generally after two cropping seasons (Burgos et al., 2008; 2014). Similar observations have been reported outside the United States, in other regions adopting the similar technology (Gressel and Valverde, 2009; Busconi et al., 2012; Scarabel et al., 2012; Rosas et al., 2014). Clearfield® Production System (CPS) using the imidazolinone tolerant (IMI-TR) rice varieties (MR220CL1 and MR220CL2) has been introduced in most of rice granaries in Malaysia to control weedy rice infestation since 2010 (Azmi et al., 2012). The use of imidazolinone, the active ingredient in the OnDuty® herbicide, in CPS has successfully control weedy rice infestation and dramatically increase rice production from 3.5 to 7 metrics tons ha-1 (Sudianto et al., 2013). Despite various reports of gene flow and IMI-tolerance weedy rice in the world such as the United States (Burgos et al., 2008) and Italy (Scarabel et al., 2012; Rosas et al., 2014), up-to-date, there is still no solid reports on weedy rice resistant status in Malaysia although CPS was introduced for more than five years since 2010.

A preliminary study at three townships in Kedah reported that there is high likely that weedy rice has developed resistance to IMI herbicide at various level (Hamdani et al., 2015) based on the weedy rice escapes in CPS rice fields in these areas (Jaafar et al., 2014). In addition, Malaysia with tropic condition has high risks of gene flow and evolution of resistant weedy rice populations because of multiple cropping of rice in a year and freezing temperatures, which would reduce the density of volunteer plants, do not occur (Shivrain et al., 2008; Burgos et al., 2014). Weedy rice is known to have longer seed longevity (Diarra et al., 1985; Noldin et al., 2006; Suh, 2008), higher venerability in soil (Vaughan, 1994), and can stay dormant longer (Moldenhauer and Gibbons, 2003) than cultivated rice. Maintaining viability over longer period of time might provide several adaptive advantages for weedy rice to survive from heat and high humidity and escape seed deterioration especially in tropical areas (Roberts, 1961;

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

McDonald, 1999). Seed dormancy is a key trait that promotes the survival of weedy rice (Oryza sativa L.) in the rice seedbank (Gu et al., 2005; Mispan et al., 2013). Weedy rice seeds, usually dormant at maturation, may survive in soil seed banks for months to years, depending on genotypes and environmental conditions in the agro-ecosystems. Integrated weedy rice management strategies should include effective approaches to reduce the weed soil seedbank size, dormancy and longevity (Mispan et al., 2015). Therefore, this study was aimed to evaluate the potential of seed dormancy as an escape mechanism of weedy rice in Malaysia from Imidazolinone (IMI)-herbicide treatment.

Materials and Methods

Plant material

A total of 30 weedy rice biotypes with various morphological characteristics were collected from Muda rice granary areas in Kedah. Seed samples were cleaned, air-dried for 3 days, and stored in -20oC freezer for further germination test (seed dormancy) and Imidazolinone sensitivity assessment.

Germination test for seed dormancy assessment

The dormancy of weedy rice seeds was tested using standard germination method as described in Mispan et al. (2013). A sample of ~30 seeds from each weedy rice biotype was distributed in a 9 cm petri dish lined with a Whatman No. 1 filter paper and wetted with 5 mL distilled water. Samples were placed in an incubator set at 30oC and 100% relative humidity in dark. Germinated seeds were determined by the emergence of radical or coleoptiles. The germination rate was counted at 14 days after imbibition.

Imidazolinone (OnDuty®) sensitivity assessment: Seed bioassay for single-dose IMI-herbicide concentration

Similar weedy rice biotypes (used in seed dormancy test) seeds were air-dried for seven days before the treatments. The resistant of weedy rice seeds to IMI-herbicide was tested by seed bioassay using single- dose herbicide application using standard germination method. A sample of ~30 seeds from each weedy rice biotype was distributed in a 9 cm petri dish lined with a Whatman No. 1 filter paper in an incubator set at 40oC overnight to break the dormancy to eliminate the possibility of false negative germination data. Seeds on each petri dish with three replications were wetted with ~5 mL commercially concentrated (1.1 gL-1) OnDutyTM herbicide for single-dose application. Control treatment was applied with distilled water. Samples were placed in an incubator set at 30oC and 100% relative humidity in light. Germinated seeds were determined by the emergence of radical or coleoptiles. The germination rate and number of viable seedlings (healthy and green seedlings) were counted at 14 days after imbibition.

Results and Discussion

Germination test to determine seed dormancy level demonstrated that majority (96.7%) of weedy rice biotypes collected from Muda rice granaries in Kedah displayed less than 50% germination rate with 66.7% weedy rice biotypes showed a strong dormancy where germination rate was recorded not more than 10% (Figure 1). This indicates that seed dormancy level in weedy rice population in Kedah was relatively high. Naturally, plants tend to have characteristic for seed dormancy and longevity for survival (Walters et al., 2005). These characters are influenced by various environmental conditions and controlled in minor ways by numerous genes scattered all over the genome (Sasaki et al., 2005). Seed dormancy in weedy rice is important for weed fitness in rice agro-ecosystem especially to survive in seed bank, optimize germination time and preventing from pre-harvest sprouting (Gu et al., 2004; 2005).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

45 18

40 16

35 14

30 12

25 10

biotypes for seed biotypes for

biotypes after heat biotypes after 20 8

treatment

of 15 6 of

dormancy evaluation dormancy 10 4

5 2

Frequency

Frequency 0 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 Germination rate (%) at 14d

Figure 1: Frequency distribution of weedy rice (WR) biotypes for germination percentage at 14d for seed dormancy evaluation (column) and after heat treatment (line).

100 a b c 90 80

14d 70 60 50 40 30 20

Germination rate rate at (%) Germination 10 0

Weedy rice biotypes

Figure 2: Germinated seedling percentage for all weedy rice biotypes collected at Muda rice granary. Seed dormancy (germination rate) for each biotype was displayed as dotted line. Grey and white columns represented seedling survival rate for viable and non-viable seedlings, respectively which was divided into, a) viable seedlings were significantly higher than the non-viable; b) viable and non-viable seedlings were not significantly different; and c) non- viable seedlings were significantly higher than the viable.

The germination rate of weedy rice population was significantly increased after heat treatment where 76.6% of the population showed >50% germination rate (Figure 1). However, this cannot be an indication of total dormancy release in the weedy rice. Therefore, determination of seedling survivability after herbicide treatment was verified based on the seedling colour/condition after 14 days. Seedlings failed to develop ‘green’ pigmentation were considered to loss capability to survive as a fully-grown plant or non-

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

viable suggesting susceptibility to Imidazolinone treatment. Interestingly, all biotypes from this population obtained various degree of seedling survival (green seedlings) from 1% to 85% (Figure 2). A total of 16.7% of the population retained seedling viability over 50% indicating seeds of these biotypes have more than half chance to escape Imidazolinone treatment.

Seedling survival rate for post-herbicide application was divided into three categories based on percentage ratio between green (viable) and white (non-viable) seedlings (Figure 2). The statistical significance of the differences between the viable and non-viable seedlings was investigated by the t- test at the 5% level. Figure 2a showed that 33% of weedy rice biotypes have significantly (P<0.05) higher chances to maintain viability from the germinated seedlings suggesting that weedy rice higher probability to escape in the rice field as a matured plant. Figure 2c, on the other hand, displayed the opposite where 37% of biotypes have low probability to survive. This data showed that all weedy rice biotypes have capability to dodge IMI-herbicide application with various degrees in the future.

Seed dormancy was significantly correlated (r = 0.304) with total germination after herbicide application (Table 1) indicating that dormancy is related to Imidazolinone resistant at seedling developmental stage. This analysis also demonstrated that weedy rice with weak dormancy tend to develop susceptibility to Imidazolinone (r = 0.435) while IMI-tolerant weedy rice biotypes displayed no relationship with seed dormancy (r = -0.077). Relationship of seed dormancy and seed longevity (viability) has been widely discussed although there is no conclusive argument about their association. Roberts (1961) revealed that these two traits possessed no association based on the experiments using Indica and Japonica type varieties. On the other hand, Ikehashi (1975) and Siddique et al. (1998) reported that cultivars with low dormancy lost viability very quick unlike the dormant cultivars which retain certain degrees of longevity. Studies on weedy rice also showed that higher dormant seeds generally have higher rate of viable seeds after series of burial and/or storage time (Goss and Brown, 1939; Noldin et al., 2006). Positive correlation between seed dormancy and IMI-tolerance revealed that these traits might be associated together for the viability and longevity of weedy rice. Therefore, seed dormancy might be one of the potential escape mechanisms for weedy rice from Imidazolinone herbicide application.

Table 1: Summary of correlation coefficients (r) between seedling number after standard germination test (seed dormancy) and Imidazolinone (IMI)-treatments. Values significant at P<0.05 are shown with asterisk. Seed dormancy IMI-resistant (Total) IMI-resistant (Viable) IMI-resistant (Total) 0.304* IMI-resistant (Viable) -0.077 0.590* IMI-resistant (Non-viable) 0.435* 0.573* -0.324*

Conclusions

This study demonstrated that weedy rice populations in Kedah displayed strong seed dormancy status and high IMI-resistant potential which can lead to the ineffectiveness of CPS system to control weedy rice. This also suggested that weedy rice with strong dormancy has unknown mechanism/s to avoid herbicidal injuries during seedling development. It is high likely that weedy rice in Kedah has already ‘evolved’ to be resistant to Imidazolinone herbicide (OnDuty™) possibly from consequential conferment of resistant genes from Clearfield® rice to weedy rice (Shivrain et al., 2008; Jaafar et al., 2014). This could cause problems in the sustainability of CPS technology in Malaysia if this resistant pattern keeps building up (Ruzmi et al., 2017). A stringent ecological risk assessment of Imidazolinone application and a weedy rice herbicide-resistant screening are required to avoid future escape of IMI-tolerant weedy rice into rice

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

fields, and worse, weedy rice can turn into the next and major herbicide resistant weed in Malaysian rice agro-ecosystems (Mispan et al., 2015; Ruzmi et al., 2017).

References

Azmi, M., Azlan, S., Yim, K.M., George, T.V. and Chew, S.E. 2012. Control of weedy rice in direct seeded rice using the Clearfield® production system in Malaysia. Pakistan Journal of Weed Science Research 18: 49-53. Baki, B.B. 2004. Invasive weed species in Malaysian agro-ecosystems: Species, impacts, and management. Malaysian Journal of Science 23: 1-42. Baki, B.B. 2010. Shaping the future of weed science to serve humanity in the Asia-Pacific. Pakistan Journal of Weed Science Research 16(2): 123-138. Burgos, N.R., Norsworthy, J.K., Scott, R.C. and Smith, K.L. 2008. Red rice status after five years of Clearfield® rice technology in Arkansas. Weed Technology 22: 200-208. Burgos, N.R., Singh, V., Tseng, T.M., Black, H., Young, N.D., Huang, Z., Hyma, K.E., Gealy, D.R. and Caicedo, A.L. 2014. The impact of herbicide-resistant rice (Oryza sativa L.) technology on phenotypic diversity and population structure of US weed rice. Plant Physiology 166: 1208-1220. Busconi, M., Rossi, D., Lorenzoni, C., Baldi, G. and Fogher, C. 2012. Spread of herbicide-resistant weedy rice (red rice, Oryza sativa L.) after 5 years of Clearfield rice cultivation in Italy. Plant Biology 14: 751-759. Cao, Q., Lu, B.R., Hui, X., Jun, R., Sala, F., Spada, A. and Grassi, F. 2006. Genetic diversity and origin of weedy rice (Oryza sativa f. spontanea) populations found in north-eastern China revealed by simple sequence repeat (SSR) markers. Annals of Botany 98: 1241-1252. Croughan, T.P. 2003. Clearfield rice: It’s not a GMO. Louisiana Agriculture 46: 24-26. Delouche, J.C., Burgos, N.R., Gealy, D.R., de San Martin, G.Z. and Labrada, R. 2007. Weedy rices- origin, biology, ecology and control. Food and Agriculture Organization of the United Nations ROME. Diarra, A., Smith, R. and Talbert, R.E. 1985. Red rice (Oryza sativa) control in drill-seeded rice (O. sativa). Weed Science 33: 703-709. Gealy, D.R. 2005. Gene movement between rice (Oryza sativa) and weedy rice (Oryza sativa): A U.S. temperate rice perspective. In J Gressel, edition, Crop Ferality and Volunteerism. CRC Press, Boca Raton, FL. Pp. 323-354. Goss, W.L. and Brown, E. 1939. Buried rice seed. Journal of the American Society of Agronomy 31: 633-637. Gressel, J. and Valverde, B.E. 2009. A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds. Pest Management Science 65: 723-731. Gu, X.Y., Kianian, S.F. and Foley, M.E. 2004. Multiple loci and epistases control genetic variation for seed dormancy in weedy rice (Oryza sativa). Genetics 166: 1503-1516. Gu, X.Y., Kianian, S.F. and Foley, M.E. 2006. Dormancy genes from weedy rice respond divergently to seed development environments. Genetics 172: 1199-1211. Hamdani, M.S.A., Juraimi, A.S. and Mazlan, N. 2015. Herbicide resistant weeds in Malaysian rice fields: Will weedy rice become the next candidate? 25th Asian-Pacific Weed Science Society Conference. Hyderabad, India. 13-16 October 2015. Ikehashi, H. 1975. Dormancy formation and subsequent changes of germination habits in rice seeds. Journal of Agricultural Research Quarter 9: 8-12. Jaafar, N.F., Juraimi, A.S., Hamdani, M.S.A., Kamaluddin, M. and Man, A. 2014. Distribution of weedy rice escape variants in Clearfield Rice Production System. Research on Crops 15(4): 754-762.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

McDonald, M.B. 1999. Seed deterioration: Physiology, repair and assessment. Seed Science Technology 27: 177-237. Mispan, M.S., Zhang, L., Feng, J. and Gu, X.Y. 2013. Quantitative trait locus and haplotype analyses of wild and crop-mimic traits in U.S. weedy rice. G3: Genes Genomes Genetics 3: 1049-1059. Mispan, M.S., Jalaluddin, A., Majrashi, A.A. and Baki, B.B. 2015. Weed Science in Malaysia: An Analysis. In: Weed Science in the Asian Pacific Region (Rao et al., edition). Asian-Pacific Weed Science Society. Moldenhauer, K.A.K., and Gibbons, J.H. 2003. Rice Morphology and Development. In: Rice. Origin, History, Technology, and Production (edition Smith CW, Dilday RH). John Wiley and Sons, Inc., Hoboken, New Jersey. Pp. 103-127. Noldin, J.A., Chandler, J.M. and McCauley, G.N. 2006. Seed longevity of red rice ecotypes buried in soil. Planta Daninha 24: 611-620. Roberts, E.H. 1961. The viability of rice seed in relation temperature, moisture content, and gaseous environment. Annals Botany 25: 381-390. Rosas, J.E. and Bonnecarrere, de Vida, F.P. 2014. One-step, codominent detection of imidazolinone resistance mutations in weedy rice (Oryza sativa L). Electronic Journal of Biotechnology 17: 95- 101. Ruzmi, R., Ahmad-Hamdani, M.S. and Bakar, B.B. 2017. Prevalence of herbicide-resistant weed species in Malaysian rice fields: A review. Weed Biology and Management 17: 3-16. Sasaki, K., Fukuta, Y. and Sato, T. 2005. Mapping of quantitative trait loci controlling seed longevity of rice (Oryza sativa L.) after various periods of seed storage. Plant Breeding 124: 361-366. Scarabel, L., Cenghialta, C., Manuello, D. and Sattin, M. 2012. Monitoring and management of imidazolinone-resistant red rice (Oryza sativa L. var. sylvatica) in Clearfield Italian paddy rice. Agronomy 2: 371-383. Shivrain, V.K., Burgos, N.R., Gealy, D.R., Moldenhauer, K.A.K. and Baquireza, C.J. 2008. Maximum outcrossing rate and genetic compatibility between red rice (Oryza sativa) biotypes and Clearfield rice. Weed Science 56: 807-813. Siddique, S.B., Seshu, D.V. and Pardee, W.D. 1988. Rice cultivar variability in tolerance for accelerated aging of seed. IRRI Research Paper Series 131: 2-7. Sudianto, E., Song, B.K., Neik, T.X., Saldain, N.E., Scott, R.C. and Burgos, N.R. 2013. Clearfield® rice: Its development, success, and key challenges on a global perspective. Crop Protection 49: 40-51. Suh, H.S. 2008. Weedy rice. Yeungnam University. Korea. Vaughan, D.A. 1994. The Wild Relatives of Rice. A Genetic Resources Handbook. Los Baños, Philippines: International Rice Research Institute. Pp. 137. Walters, C., Wheeler, L.M. and Grotenhuis, J.M. 2005. Longevity of seeds stored in a genebank: Species characteristics. Seed Science Research 15: 1-20.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Preliminary Study on Rice (Oryza sativa L.) var. MRQ 76 Performance Cultivated under Agro-ecological Approach

Mohd Fairuz, M.S.1,*, Che Radziah, C.M.Z.1, Mohd Shahrul, M.N.2 and Muhammad Syamil, M.1 1School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. 2School of Environmental Science and Natural Resources, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Rice is a staple food crop and major income sources especially for small agricultural farmers in Asian countries including Malaysia. Generally, many of rice variety were cultivated under a continuous flooded system worldwide. This method is a favourite method since the early eighties in Malaysia thus has replacing the manual transplanting (Wah, 1998). In Southeast Asia, the method of the continuous flooded system in lowlands contributes to more than 95% of the paddy production (Mutert, 2002). However, continuously flooded of rice cultivation system requires high volume of waters in the field lead to anaerobic conditions and thus one of the important sources of greenhouse gases emission (GHG) which is methane (CH4) emissions (Pathak, 2005) where it will contribute to global warming and climate change. Methane emissions from the continuously flooded irrigation systems in Malaysia showed higher than rainfed system and were forecasted to increase up to 88 Gg by 2030 due to expansion of rice cultivation area (Shaidatul Azdawiyah, 2018).

The System of Rice Intensification (SRI) was introduced for lowland rice to reduce the amount of water used for irrigation (Uphoff, 2003). The method has proven increased both growth and yield of rice plants compared to conventional cultivation methods (Hidayati, 2016). For example, a study in India shows that SRI production systems offer generous environmental benefits by reducing water and energy use, reducing GHG emissions, reducing reliance on nutrient inputs as well as improving farmer returns by over 400% through increasing yields while reducing costs (Gathorne-Hardy, 2016).

In recent years, the demand for fragrant rice in Malaysia has grown due to its distinct characteristics like the taste and aroma. Since the last 10 years, Malaysian Agricultural Research and Development Institute (MARDI) has taken efforts to develop fragrant rice varieties through breeding program (Shahida, 2016). Fragrant rice varieties which have been released by MARDI namely MRQ 76 have the characteristic almost similar to Jasmine rice with soft and sticky rice texture and the cultivation mostly focusing at rainfed and outside of Malaysian central irrigation scheme area. Thus, this study aimed to verify the growth performance of Malaysian fragrant rice variety MRQ 76 cultivated under SRI and conventional continuous flooded rice farming as control.

Materials and Methods

Description of the study

The field experiment conducted at the terrace research plot (R), Plant House, Faculty of Science and Technology, UKM, Bangi, Selangor, Malaysia from July to October 2017. The study aimed to evaluate the crop growth performance using two different methods of rice cultivation which were the direct seeded (conventional) and the SRI method using rice seed variety MRQ 76 obtained from MARDI. The study

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

was conducted using a randomised complete block design with the size of the experimental plots 5 m x 5 m (25 m2), and each treatment replicated three times.

Land preparation and management

The seedling used for transplanting of SRI method is 12 days old after seeding in the tray on nursery bed. The transplanting of single plant was done quickly after the seedlings removed from the nursery bed, and carefully putting the seedling in very shallow (1-2 cm) soil in a square pattern with spacing at 25 cm x 25 cm distances between rows and hills. Commercial organic SRI Soil enhancer and fertilizer (SRI ORGANIK @ SEMPROT) formulated by local SRI farmers which containing nitrogen (N), phosphate (P205), potassium oxide (K2O), magnesium oxide (MgO), Cupper (Cu), Zink (Zn), Mangan (Mn) and Iron (Fe) were used in the SRI cultivation plot and were applied every 10 days until 80 days after transplant (DAT). In the SRI method, plots were kept moist with a water level of about 1-2 cm at the vegetative phase until ripening phase and drained at 20 days before harvest. Weeding was carried out to ensure topsoil aeration at 10, 20, and 30 days after planting using a handmade weeder.

The pre-germinated seeds directly broadcasted at the plots of direct seeded were at rate of 400 seeds per m2 based on a regular practice by the conventional farmers. Flooded water was supplied continuously with a water level of about 5 cm until 14 days before harvest in the direct seeded method. The direct seeded plots were received inorganic NPK fertilizer at rate 15:15:15 at 21 and 34 days after sowing (DAS) and 12:12:17 at 49 DAS. Weeding of the conventional method plots performed at 10 and 20 days after planting by hand.

Measurement of plant growth performance

Rice growth parameters measured at 28 DAS for vegetative phase, 60 DAS for reproductive phase and ripening phase measured at 98 DAS. The plant height (cm) measured from ground level to the tip of the longest leaf of rice plants using the 1 m measuring tape and the size of rice tillers were measured using 0- 150 mm, 0.02 resolution and graduation, Vernier calliper. Tiller number and leaf number per hill for both of the cultivation method; direct seeded and SRI were counted manually. The measurement of leaf chlorophyll content or “greenness” of the rice plants was taken using Soil Plant Analysis Development (SPAD) meter (SPAD-502, Minolta, Japan).

Statistical analysis

A one-way analysis of variance (ANOVA) method was used to analyse all the data statistically using Statistical Analysis System (SAS) software (SAS®, SAS Institute Inc., Cary, NC, USA) release 9.4. Mean separation was carried out for significantly different parameters using Least Significant Difference (LSD) test at p<0.05.

Results and Discussion

Size and number of rice tillers

The results of this study show that growth performance of rice MRQ 76 cultivated under SRI indicates significantly higher (p<0.05) for size and number of rice tillers during all the three phases namely vegetative, reproductive and ripening as in Figure 1 and Figure 2. The rice plants cultivated under the SRI improved strength of tillers and better tiller size, thus enhanced the plants’ growth and tillering ability. The number of phyllochrons completed has a close relationship with the tillering ability in rice before

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

entering the reproductive stage (Stoop, 2002). The main reason of the significantly higher growth performance of rice plants in SRI method during vegetative phase is due to the minimised effect of seedlings transplanting shock in SRI methods due to earlier transplanting of young seedlings, which was 12 DAS in this study. A greater number of phyllochrons was allowed to complete by the plants before the onset of anthesis by the subsequent favourable growing conditions of SRI method (Thakur, 2010). The high growth of the rice cultivated under SRI methods also contributed by the use of organic fertilizer in the area (Shahida, 2016), which will increase the soil biological properties such as a population of microbe, fungi and soil respiration (Subardja, 2016).

Figure 1: Size of rice tillers cultivated under SRI and conventional method in three phases; vegetative, reproductive and ripening. Means with the same letters do not differ significantly according to LSD (p<0.05).

Figure 2: Number of rice tillers cultivated under SRI and conventional method in three phases; vegetative, reproductive and ripening. Means with the same letters do not differ significantly according to LSD (p<0.05).

Plant height and leaf number

Plant height increased with increasing plant age from vegetative to ripening phases for both SRI and conventional method. The plant height of rice cultivated under SRI during vegetative phase shows higher than the conventional method however, during reproductive and ripening phases the plant height were higher under the conventional method compared to SRI as shown in Figure 3. Increase in plant height at reproductive and ripening phases might attribute to higher competition for growth resources especially for light with increasing in leaf number of rice in a direct seeded method although the SRI method shows

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

higher leaf number compared to the conventional method as shown in Figure 4. Thakur et al. (2010) suggested that reducing competition between the plants for uptake of nutrients, water, light, and air by transplanting one seedling per hill, as well as the wider spacing between hills as in the SRI method played a role to increase the growth of individual rice plant (Thakur, 2010). However, the result obtained as shown in Figure 3, might be contributed by other factors which is unknown and further study should be permitted whether the results of higher number of rice tillers for SRI might be one of the factors that reduce the plant height as nutrients were used to improve yield.

Figure 3: Plant height of rice cultivated under SRI and conventional method in three phases; vegetative, reproductive and ripening. Means with the same letters do not differ significantly according to LSD (p<0.05).

Figure 4: Leaf number of rice cultivated under SRI and conventional method in three phases; vegetative, reproductive and ripening. Means with the same letters do not differ significantly according to LSD (p<0.05).

Chlorophyll content

The value of SPAD or the greenness of the rice leaves indicates the chlorophyll level in the rice plants and provides instantaneous on-site information on crop nitrogen status or uptake (Shahida, 2016). It could provide proper management of nitrogen supply in the rice field in the future. As shown in Figure 5, all the chlorophyll content of rice cultivated under SRI method at 3 different growth phases in this study were significantly higher than those in the direct seeded conventional method and also higher than optimum level of 35 for the optimum grain yield for indica varieties as reported by Peng et al. (1996). The higher level of leaf chlorophyll content indicated that the SRI practices induced greater root growth

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

and enhanced root activity of the rice plant via greater xylem exudation rates (Thakur, 2011). The enhancement of nutrient uptake (nitrogen) by the rice under SRI system is indicated by greater and deeper root systems resulted in increasing the root oxidation activity and root-sourced cytokinins (Zhang, 2009), which play a major role in promoting cell division or growth of the rice plant.

Figure 5: SPAD readings of SRI and conventional method under three rice phases; vegetative, reproductive and ripening. Means with the same letters do not differ significantly according to LSD (p<0.05).

Conclusion

This study revealed that performance of rice variety MRQ 76 were dissimilar at different growth phases cultivated under agro-ecological approach (SRI) and direct seeded method. The agro-ecological approach method shows high performance in most of rice plants growth parameters evaluated especially during vegetative and ripening phases as compared to conventional way. Further research on growth performance of the variety under established rice field area on longer cropping season needs to be taken in the future. The results of this preliminary study can be used as a preliminary reference in establishing the rice MRQ 76 cultivation under agro-ecological approach method.

Acknowledgements

The authors are thankful to MARDI for providing the rice seeds and to Universiti Kebangsaan Malaysia for providing the facilities for this study. This research is supported by the UKM Cabaran Perdana research grant, DCP-2017-004/3.

References

Gathorne-Hardy, A., Reddy, D.N., Venkatanarayana, M. and White, B.H. 2016. System of rice intensification provides environmental and economic gains but at the expense of social sustainability - A multidisciplinary analysis in India. Agricultural Systems 143: 159-168. Hidayati, N., Tridiati, T. and Anas, I. 2016. Photosynthesis and transpiration rates of rice cultivated under the system of rice intensification and the effects on growth and yield. HAYATI Journal of Biosciences 23: 67-72. Mutert, E. and Fairhurst, T.H. 2002. Developments in rice production in Southeast Asia. Better Crops International 15: 12-17. Pathak, H., Li, C. and Wassmann, R. 2005. Greenhouse gas emissions from Indian rice fields: Calibration and upscaling using the DNDC model. Biogeosciences 2: 113-123.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Peng, S. Garcia, F.V., Laza, R.C., Sanico, A.L., Visperas, R.M. and Cassman, K.G. 1996. Increased N- use efficiency using a chlorophyll meter on high-yielding irrigated rice. Field Crops Research 47: 243-252. Shahida, H., Siti Norsuha, M., Nur Khairani, A.B., Mohamad Najib, M.Y., Muhammad Naim Fadzli, M.R., Asfaliza, R. and Shajarutulwardah, M.Y. 2016. Effect of organic fertiliser as a basal fertiliser on growth, yield and disease incidence of local fragrant rice varieties. Journal of Tropical Agriculture and Food Science 44(2): 167-178. Shaidatul Azdawiyah, A.T., Mohd Fairuz, M.S., Mohammad Hariz, A.R., Nurul Ain, A.B., Fauzi, J., Azizi, A.A., Mardhati, M. and Mohammad Zabawi, A.G. 2018. Historical and projected methane emission determination in Malaysia (1980-2020). Research in Agriculture 3(1): 19-30. Stoop, W.A., Uphoff, N. and Kassam, A. 2002. A review of agricultural research issues raised by the System of Rice Intensification (SRI) from Madagascar: Opportunities for improving farming systems for resource-poor farmers. Agricultural Systems 71: 249-274. Subardja, V.O., Anas, I. and Widyastuti, R. 2016. Utilization of organic fertilizer to increase paddy growth and productivity using System of Rice Intensification (SRI) method in saline soil. Journal of Degraded and Mining Lands Management 3(2): 543-549. Thakur, A.K., Rath, S., Roychowdhury, S. and Uphoff, N. 2010. Comparative performance of rice with System of Rice Intensification (SRI) and conventional management using different plant spacings. Journal of Agronomy and Crop Science 196(2): 146-159. Thakur, A.K., Uphoff, N. and Antony, E. 2010. An assessment of physiological effects of System of Rice Intensification (SRI) practices compared with recommended rice cultivation practices in India. Experimental Agriculture 46: 77-98. Thakur, A.K., Rath, S., Patil, D.U. and Kumar, A. 2011. Effects on rice plant morphology and physiology of water and associated management practices of the system of rice intensification and their implications for crop performance. Paddy Water Environment 9: 13-24. Uphoff, N. 2003. Higher Yields with Fewer External Inputs? The System of Rice Intensification and potential contributions to agricultural sustainability. International Journal of Agricultural Sustainability 1: 38-50. Wah, C.A. 1998. Direct seeded rice in Malaysia, A success story. APAARI Publications (Food and Agriculture Organization Regional Office for Asia and the Pacific, Bangkok). Pp. 1-33. Zhang, H., Xue, Y., Wang, Z., Yang, J. and Zhang, J. 2009. An alternate wetting and moderate soil drying regime improves root and shoot growth in rice. Crop Science 49: 2246-2260.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Alleviation of Salt Stressed Malaysian Indica Rice Seed (cv. MR 263) by using Potassium Chloride, Potassium Nitrate, Salicylic Acid and Gibberellic Acid

Nurfatiha, M., Rosimah, N.* and Mohd Hafiz, I. Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Rice (Oryza sativa L.) is the most important and primary source of food and one of the top five major carbohydrate crops for more than half of the world’s population (Amirjani, 2011). It is extensively cultivated and grown due to its vital carbohydrate role for human consumption. According to Khush (2005), rice is grown on about 11% of world’s cultivated land and mostly consumed by Asians as their daily calorie intake. Food and Agriculture Organization (FAO, 2017) estimated that the total rice production in early 2017 was 502.6 million metric tons, in which China and India were the leading producers, followed by Indonesia, Bangladesh, and Vietnam. In Malaysia, rice covering an area up to 205,548 hectares as it is the third most important crop grown mainly in eight granaries, especially in Peninsular Malaysia (Azmi and Mashhor, 1995).

Plants are complex and sessile organisms. They tend to confront with different types of both biotic and abiotic stresses by developing a unique mechanism. As a result, they can adapt and survive well under numerous stressful events and environment factors (Rejeb et al., 2014). Among the major abiotic stresses, salinity is the most brutal environmental constraint which is responsible for the reduction of cultivated plants worldwide (Tari et al., 2015). Most crop plants are glycophytes and sensitive to high concentrations of salt in the soil (Hasanuzzaman et al., 2013). This is because high salt concentrations can be toxic to the plants and cause difficulty to extract water (Munns and Tester, 2008). On the other hand, low salt concentrations will delay and suppress the plant growth itself (Peel et al., 2004). Salt-affected land has been reported to increase day by day and up to 20% of the cultivated land was affected (Gupta and Huang, 2014). Some of the saline soil lands were resulted from the human-induced processes or natural cause of salt accumulation over a long period of time (Rengasamy, 2002).

Salinity stress has really given negative impact towards the rice production worldwide. In other words, salinity can reduce crop productivity and its yield production and since rice is considered as the most important staple food for half of the world’s population, salinity problem can actually cause more harm if not supervised. Therefore, it is crucial to maintain the production of rice. Germination stage is very important for a plant as it is an early phase in plant development. There were a lot of studies reporting how salinity stress affected the germination stage of plants. Hence, this study was aimed to overcome these problems by developing a liquid formulation containing potassium chloride (KCl), potassium nitrate (KNO3) and phytohormones as seed germination and growth promoter for rice under salinity stress. Phytohormones such as salicylic acid (SA) and gibberellic acid (GA) have been reported to cope stress in plants by producing proteins and causing resistance. A significant improvement was observed in germination rate, germination percentage, reduction in the mean germination time and even enhanced gaseous exchange parameters of different types of crop under different salinity levels. Application of liquid formulation is seen to be more practical for the production of rice in paddy field. This can be one of the solutions instead of producing new breed of rice cultivar that is resistance to salinity condition in Malaysia. This liquid formulation was designed to increase the seed performance in germination phase and to enhance the plant development of rice under salinity stress.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Therefore, an experiment was conducted to (i) determine the ideal concentration of KCl, KNO3, SA and GA that promotes the germination of salt stressed MR 263 seeds and, (ii) develop a liquid germination enhancer for salt stressed MR 263 seeds.

Materials and Methods

The MR 263 seeds were obtained from the Gene and Seed Bank of Malaysian Agricultural Research and Development Institute (MARDI), Serdang, Selangor. The seed sterilization was done according to a study by Kalhori et al. (2018) with a slight modification. Healthy, strong and uniform size seeds were selected and surface sterilized with 70% (v/v) ethanol solution for 30 seconds. Seeds were then washed with 20% (v/v) sodium hypochlorite solution with a few drops of tween 20 to remove dirt for another 15 minutes. Next, the seeds were washed thoroughly with autoclaved distilled water for 5 times, followed by air drying on a tissue paper.

The treatments used in this study were KCl and KNO3 with addition of two plant hormones, i.e. SA and GA. The concentrations used were altered and modified slightly according to the availability and compatibility of the plant of interest in this study (Table 1).

Table 1: Treatment with KCl, KNO3, SA and GA. Treatment Concentration Proposed by KCL 0, 10, 20, 30 and 40 mM Mohammed (2016) KNO3 0, 10, 20, 40 and 60 mM Zheng et al. (2008) SA 0, 0.25, 0.50, 0.75 and 1.0 mM Mohammed (2016) GA 0, 20, 40, 60 and 80 mg/L Misratia et al. (2015); Guadagnin et al. (2017)

Sterilized rice seeds were osmoprimed with 10 mL of sodium chloride solution with -1.5 MPa osmotic potential (severe) for 3 days at 24°C according to Jisha and Puthur (2016). The method was revised and altered according to the availability and compatibility to the plant of interest in this study, which is rice. The purposed seed priming was to induce the salt stress in seeds.

The first step in development of plant growth enhancer was to select the ideal concentrations of KCl, KNO3, SA and GA for enhancing the germination of salt-stressed rice seeds. The best concentrations were chosen based on their germination growth and other parameters. The second step was to determine the combination of the ideal concentrations of the chemicals as shown in Table 2 below.

Table 2: The combinational treatments with KCl, KNO3, SA and GA. Number Combinational treatments 1 Control 2 20 mM KCl + 0.25 mM SA 3 20 mM KCl + 80 mg/L GA 4 20 mM KCl + 20 mM KNO3 5 80 mg/L GA + 20 mM KNO3 6 0.25 mM SA + 80 mg/L GA 7 0.25 mM SA + 20 mM KNO3 8 20 mM KCl + 0.25 mM SA + 80 mg/L GA 9 20 mM KCl + 0.25 mM SA + 20 mM KNO3 10 20 mM KCl + 80 mg/L GA + 20 mM KNO3 11 0.25 mM SA + 80 mg/L GA + 20 mM KNO3 12 20 mM KCl + 0.25 mM SA + 80 mg/L GA + 20 mM KNO3

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The primed seeds were germinated in petri dishes containing Whatman No. 1 filter paper. The seeds were soaked in 8 mL of the respective treatments as shown in Table 2. Soaking with distilled water was applied as the control. Seven seeds were geminated in one petri dish and sealed to minimize the evaporation and permitted aeration at the same time. Then, it was kept at 24±2°C under 14 hours light and 10 hours dark cycle by Philips fluorescent light arranged in Completely Randomized Design. The germinated seeds were observed daily and data were recorded once the radicle and plumule have come out. At one time experiment, there were two replicates for each treatment and repeated thrice to get credible data. Data collection on germination percentage (%), germination index, seed vigor and early seedling growth parameters were taken and measured. All data collected were tabulated and analysed by using SPSS version 22. A one-way ANOVA at confidence level p≤0.05 was used to find the significance difference among the concentrations and combinational treatments followed by a post-hoc test of Duncan’s Multiple Range Test and Tukey’s HSD for mean comparison at confidence level p≤0.05.

Results and Discussion

The germination index, seed vigor and early growth of salt-stressed MR 263 seeds were shown to have been influenced by the KCl treatments (ANOVA, p≤0.05). The ideal concentration of KCl was found to be 20 mM, whereby it gave higher results in germination percentage (92.75%), germination index (10.32), seed vigor (16.26), shoot length (8.23 cm), seedling length (17.67 cm) and biomass (0.11 g) parameter as compared to control treatment (Table 3).

Table 3: Germination percentage, germination index, seed vigor, shoot length, seedling length and biomass of salt-stressed MR 263 seeds in different concentrations of KCl. Concentration Germination Germination Shoot length Seedling Biomass Seed vigor (mM) percentage (%) index (cm) length (cm) (g) 0 93.00±4.04a 8.66±0.04a 12.57±0.48ab 6.59±0.24a 13.55±0.32ab 0.08±0.00a 10 92.75±7.25a 9.25±0.06b 14.31±1.03bc 7.50±0.28abc 15.49±0.67ab 0.09±0.00a 20 92.75±7.25a 10.32±0.08d 16.26±0.92c 8.23±0.31c 17.67±0.87c 0.11±0.00b 30 89.25±6.92a 9.56±0.05c 13.56±0.88abc 7.77±0.28bc 15.23±0.24b 0.08±0.00a 40 82.00±6.96a 9.28±0.04b 10.18±0.75a 6.77±0.21ab 12.42±0.20a 0.08±0.01a Means having the same letter(s) within column are not significantly different at P≤0.05.

The study found that, germination percentage, germination index, seed vigor and early growth parameter of MR 263 under salinity stress were influenced by the KNO3 treatments (ANOVA, p≤0.05). The ideal concentration of KNO3 was 20 mM, whereby it gave higher results in germination percentage (86%), germination index (9.57), seed vigor (16.35), shoot length (9.96 cm), seedling length (19.07 cm) and biomass (0.11 g) parameter as compared to control treatment (Table 4).

Table 4: Germination percentage, germination index, seed vigor, shoot length, seedling length and biomass of salt-stressed MR 263 seeds in different concentrations of KNO3. Concentration Germination Germination Shoot length Seedling Biomass Seed vigor (mM) percentage (%) index (cm) length (cm) (g) 0 78.50±4.33ab 8.68±0.04b 12.98±0.73b 6.28±0.30a 16.52±0.47b 0.07±0.00a 10 74.75±3.75ab 8.79±0.09b 13.93±0.57bc 9.09±0.03c 18.59±0.14cd 0.09±0.00b 20 86.00±0.00b 9.57±0.09c 16.35±0.06c 9.96±0.06c 19.07±0.07d 0.11±0.00c 40 82.25±3.75b 8.64±0.02b 14.10±0.67bc 9.48±0.12c 17.16±0.18bc 0.09±0.00bc 60 64.00±4.04a 8.01±0.14a 7.65±0.73a 7.74±0.37b 11.84±0.54a 0.06±0.00a Means having the same letter(s) within column are not significantly different at P≤0.05.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 5: Germination percentage, germination index, seed vigor, shoot length, seedling length and biomass of salt-stressed MR 263 seeds in different concentrations of SA. Concentration Germination Germination Shoot length Seedling Biomass Seed vigor (mM) percentage (%) index (cm) length (cm) (g) 0 89.50±3.50a 8.69±0.03b 14.34±0.42c 5.62±0.13a 16.08±0.19c 0.06±0.01a 0.25 96.50±3.50a 10.37±0.05c 17.64±0.59d 7.24±0.03c 18.38±0.21d 0.08±0.00c 0.50 93.00±4.04a 9.28±0.06b 13.66±0.57c 6.45±0.06bc 14.72±0.28c 0.08±0.00ab 0.75 86.00±0.00a 8.93±0.02b 9.41±0.35b 5.66±0.31ab 10.99±0.41b 0.07±0.01ab 1.00 86.00±0.00a 8.05±0.29a 5.05±0.45a 4.94±0.24a 7.16±1.00a 0.06±0.02a Means having the same letter(s) within column are not significantly different at P≤0.05.

Based on the results obtained, germination index, seed vigor and early growth parameters were found to have been influenced by the SA treatments (ANOVA, p≤0.05). The ideal concentration of SA was 0.25 mM, whereby it gave higher results in germination percentage (96.50%), germination index (10.37), seed vigor (17.64), shoot length (7.24 cm), seedling length (18.38 cm) and biomass (0.08 g) parameter as compared to control treatment (Table 5).

Treatment with GA was shown to have influenced the germination percentage, germination index, seed vigor and early growth (ANOVA, p≤0.05). The ideal concentration of GA was 80 mg/L, whereby it gave higher results in germination percentage (96.50%), germination index (9.63), seed vigor (23.58), shoot length (18.11 cm), seedling length (24.53 cm) and biomass (0.08 g) parameter compared to control treatment (Table 6).

Table 6: Germination percentage, germination index, seed vigor, shoot length, seedling length and biomass of salt-stressed MR 263 seeds in different concentrations of GA. Concentration Germination Germination Seedling Seed vigor Shoot length (cm) Biomass (g) (mg/L) percentage (%) index length (cm) 0 86.00±0.00a 8.60±0.05ab 11.90±0.20a 6.25±0.16a 13.89±0.23a 0.06±0.00a 20 82.25±3.75a 8.13±0.15a 14.72±0.66ab 10.57±0.86b 17.97±0.78b 0.06±0.00ab 40 86.00±0.00a 8.65±0.09b 17.42±0.97bc 13.79±1.41bc 20.33±1.13bc 0.07±0.00ab 60 86.00±0.00a 9.08±0.10b 18.95±0.90c 16.19±0.85cd 22.61±1.28cd 0.07±0.00ab 80 96.50±3.50b 9.63±0.14c 23.58±0.50d 18.11±0.58d 24.53±0.77d 0.08±0.00b Means having the same letter(s) within column are not significantly different at P≤0.05.

The ideal concentrations for KCl, KNO3, SA and GA obtained were combined to produce a liquid germination enhancer that induced the germination and early growth of salt-stressed MR 263 seeds. The combinational treatments were mixtures of the chemicals as shown in Table 2 above. From the results obtained, all combinational treatments were shown to have influenced the germination percentage, germination index and seed vigor (ANOVA, p≤0.05) as shown in Table 7. Combination of 20 mM KCl + 20 mM KNO3 + 0.25 mM SA + 80 mg/L GA significantly increased the early growth of salt-stressed MR263 seedling (ANOVA, p≤0.05). On the other hand, 20 mM KCl + 0.25 mM SA + 80 mg/L GA + 20 mM KNO3 resulted in the highest seed vigor, shoot length, seedling length and biomass as compared to control treatment and other combinations (Table 8).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 7: Germination percentage, germination index and seed vigor of salt-stressed MR 263 seedlings in different combinations of plant growth regulators. Germination Germination Number Combination Seed vigor percentage (%) index 1 Control 86.00±0.00a 8.47±0.03a 12.85±0.15a 2 20 mM KCl + 0.25 mM SA 86.00±0.00a 8.68±0.03a 13.45±0.05ab 3 20 mM KCl + 80 mg/L GA 100.00±0.00b 11.26±0.07f 26.52±0.20gh a b cd 4 20 mM KCl + 20 mM KNO3 86.00±0.00 9.20±0.04 16.39±0.18 a a f 5 80 mg/L GA + 20 mM KNO3 86.00±0.00 8.45±0.05 18.14±0.21 6 0.25 mM SA + 80 mg/L GA 86.00±0.00a 9.56±0.08c 15.09±0.08de a cd bc 7 0.25 mM SA + 20 mM KNO3 86.00±0.00 9.80±0.07 21.86±0.24 8 20 mM KCl + 0.25 mM SA + 80 mg/L GA 93.00±4.04ab 9.65±0.08cd 13.90±0.48ab a cd bc 9 20 mM KCl + 0.25 mM SA + 20 mM KNO3 89.50±3.50 9.85±0.11 14.70±0.57 a e ef 10 20 mM KCl + 80 mg/L GA + 20 mM KNO3 89.50±3.50 10.19±0.05 19.82±0.90 a f g 11 0.25 mM SA + 80 mg/L GA + 20 mM KNO3 86.00±0.00 11.57±0.00 24.79±0.15 12 20 mM KCl + 0.25 mM SA + 80 mg/L GA + 20 86.00±0.00a 9.91±0.10de 27.53±0.28h mM KNO3 Means having the same letter(s) within column are not significantly different at P≤0.05.

Table 8: Shoot length, root length, seedling length and biomass of salt-stressed MR 263 seedlings in different combination of plant growth regulators. Shoot length Root length Seedling Biomass Number Combination (cm) (cm) length (cm) (g) 1 Control 6.87±0.33a 7.87±0.17c 15.00±0.18a 0.06±0.00a 2 20 mM KCl + 0.25 mM SA 7.75±0.05ab 7.95±0.03c 15.70±0.06ab 0.08±0.00d 3 20 mM KCl + 80 mg/L GA 19.78±0.28f 6.75±0.20b 26.52±0.20g 0.07±0.00c bc d d e 4 20 mM KCl + 20 mM KNO3 8.64±0.16 10.49±0.15 19.12±0.21 0.09±0.00 f b f e 5 80 mg/L GA + 20 mM KNO3 18.45±0.36 6.65±0.11 25.09±0.25 0.09±0.00 6 0.25 mM SA + 80 mg/L GA 12.57±0.24d 8.60±0.31c 21.16±0.10e 0.07±0.00b bc c c f 7 0.25 mM SA + 20 mM KNO3 8.96±0.19 8.64±0.13 17.60±0.28 0.10±0.00 8 20 mM KCl + 0.25 mM SA + 80 12.15±0.23d 2.84±0.25a 14.99±0.29a 0.06±0.00b mg/L GA 9 20 mM KCl + 0.25 mM SA + 20 9.80±0.25c 6.67±0.08b 16.47±0.22b 0.10±0.00f mM KNO3 10 20 mM KCl + 80 mg/L GA + 20 15.80±0.35e 6.39±0.32b 22.19±0.26e 0.10±0.00g mM KNO3 11 0.25 mM SA + 80 mg/L GA + 20 22.39±0.30g 6.53±0.41b 28.92±0.17h 0.11±0.00h mM KNO3 12 20 mM KCl + 0.25 mM SA + 80 26.15±0.36h 5.97±0.16b 32.12±0.32i 0.12±0.00h mg/L GA + 20 mM KNO3 Means having the same letter(s) within column are not significantly different at P≤0.05.

Potassium (K) plays a critical role in plant growth and metabolism. Recent studies suggested that K is one of the great alternatives in alleviating various biotic and abiotic stresses, especially for plants under salt stress (Wang et al., 2013). For example, in another study of O. sativa, the applications of both KCl and K2SO4 were reported to reduce the osmotic stress in rice through an increased in transpiration rate and production of proline (Zain and Ismail, 2016). SA also has been recognized in providing protection against abiotic stresses such as drought, cold stress and even salinity stress (Miura and Tada, 2014). According to Hara et al. (2012), a low level of SA is a great phytohormone in enhancing antioxidant activities in salt affected plants. Increased in GA was also observed to promote plant growth by promoting cell elongation and cell division (Mahmoody and Noori, 2014) while reduction of GA

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

inhibited plant development. According to Iqbal et al. (2011), these phytohormones were known to have alleviated the negative effects of salt stress on pigment content, hill activity and water use efficiency.

Conclusion

To conclude, salt stress undoubtedly gave negative effects on the germination of MR 263 seeds. Therefore, this study was conducted to find the most suitable treatment to enhance the germination of salt stressed MR 263 seeds by using KCl, KNO3, SA and GA. The study found that 20 mM KCl, 20 mM KNO3, 0.25 mM SA and 80 mg/L GA was the ideal concentration for the germination of salt stressed MR 263 seeds. The combination of ideal concentrations of 20 mM KCl + 0.25 mM SA + 80 mg/L GA + 20 mM KNO3, on the other hand, was the most effective treatment as compared to other combinations and even single treatment to act as the liquid germination enhancer in increasing the seedling growth of salt stressed MR 263 seeds.

References

Amirjani, M.R. 2011. Effect of salinity stress on growth, sugar content, pigments and enzyme activity of rice. International Journal of Botany 7(1): 73-81. Azmi, M. and Mashhor, M. 1995. Weed succession from transplanting to direct-seeding method in Kemubu rice area, Malaysia. Journal of Bioscience 6(2): 143-154. Food and Agriculture Organization. 2017. Food Outlook. Retrieved from http://www.fao.org/3/a- i7343e.pdf on 28th July 2018. Guadagnin, C.M.I., Schuch, L.O.B., Venske, E., Zimmer, P.D. and Aumonde, T.Z. 2017. Seedling growth of irrigated rice as a function of seed treatment with gibberellic acid. Scientia Agraria Paranaensis 16(2): 237-245. Gupta, B. and Huang, B. 2014. Mechanism of salinity tolerance in plants; physiological, biochemical and molecular characterization. International Journal of Genomics 2014: 1-8. Hara, M., Furukawa, J., Sato, A., Mizoguchi, T. and Miura, K. 2012. Abiotic stress and role of salicylic acid in plants. In: Parvaiza, A. and Prasad, M.N.V. (Eds.), Abiotic Stress Responses in Plants. Springer, New York, USA. Pp. 235-251. Hasanuzzaman, M., Nahar, K. and Fujita, M. 2013. Plant response to salt stress and role of exogenous protectants to mitigate salt-induced damages. In: Ahmad, P., Azooz, M.M. and Prasad, M.N.Z. (Eds.), Ecophysiology and Responses of Plants under Salt Stress. Springer, New York, USA. 5- 87. Iqbal, N., Nazar, R., Khan, M.K.R., Masood, A. and Khan, N.A. 2011. Role of gibberellins in regulation of source-sink relations under optimal and limiting environmental conditions. Current Science 100: 7-10. Jisha, K.C. and Puthur, J.T. 2016. Seed priming with beta-amino butyric acid improves abiotic stress tolerance in rice seedlings. Rice Science 23(5): 242-254. Kalhori, N., Ying, T., Nulit, R., Sahebi, M., Abiri, R. and Atabaki, N. 2018. Effects of four different salts on seed germination and morphological characteristics of Oryza sativa L. cv. MR 219. International Journal of Advanced Research in Botany 4(1): 29-45. Khush, G.S. 2005. What it will take to feed 5.0 billion rice consumers in 2030. Plant Molecular Biology 59: 1-6. Mahmoody, M. and Noori, M. 2014. Effect of gibberellic acid on growth and development plants and its relationship with abiotic stress. International Journal of Farming and Allied Sciences 3(6): 717- 721. Misratia, K.M., Islam, M.R., Ismail, M.R., Oad, F.C., Hanafi, M.M. and Puteh, A. 2015. Interactive effects of gibberellic acid (GA3) and salt stress on growth, biochemical parameters and ion

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

accumulation of two rice (Oryza sativa L.) varieties differing in salt tolerance. Journal of Food, Agriculture and Environment 13(1): 66-70. Miura, K. and Tada, Y. 2014. Regulation of water, salinity and cold stress responses by salicylic acid. Frontiers in Plant Science 5(4): 1-12. Mohammed, S.J. 2016. Germination, seedling, growth and anatomical responses of Cucumis sativus cv. MTi2 in different salts and development of germination enhancer. Master Thesis, Universiti Putra Malaysia, Malaysia. Munns, R. and Tester, M. 2008. Mechanisms of salinity tolerance. Annual Review of Plant Biology 59: 651-681. Peel, M.D., Waldron, B.L., Jensen, K.B., Chatterton, J., Horton, H. and Dudley, L.M. 2004. Screening for salinity tolerance in Alfalfa: A repeatable method. Crop Science 44: 2049-2053. Rejeb, I.B., Pastor, V. and Mauch-Mani, B. 2014. Plant responses to simultaneous biotic and abiotic stress: Molecular mechanisms. Plants 3(4): 458-475. Rengasamy, P. 2002. Transient salinity and subsoil constraints to dryland farming in Australian sodic soils: An overview. Australian Journal of Experimental Agriculture 42(3): 351-361. Tari, I., Csiszar, J., Horvath, E., Poor, P., Takacs, Z. and Szepesi, A. 2015. The alleviation of adverse effect of salt stress in the tomato plant by salicylic acid shows a time and organ-specific antioxidant response. Acta Biologica Cracoviensia 57(1): 21-30. Wang, M., Zheng, Q.S., Shen, Q.R. and Guo, S.W. 2013. The critical role of potassium in plant stress respond. International Journal of Molecular Science 14: 7370-7390. Zain, N.A.M. and Ismail, M.R. 2016. Effects of potassium rates and types on growth, leaf gas exchange and biochemical changes in rice (Oryza sativa) planted under cyclic water stress. Agriculture and Water Management 164: 83-90. Zheng, Y., Jia, A., Ning, T., Xu, J., Li, Z. and Jiang, G. 2008. Potassium nitrate application alleviates sodium chloride stress in winter wheat cultivars differing in salt tolerance. Journal of Plant Physiology 165: 1455-1465.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Application of Seed Priming Technique by using KCl, Thiourea, Kinetin and Salicylic Acid to Enhance Germination of Malaysian Indica Rice Seed cv. MR 284 under Drought Stress

Mahadi, S.N., Nulit, R.*, Ibrahim, M.H. and Ab. Ghani, N.I. Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Seed priming is a technology known to enhance seed performance. This technique is relatively simple, low cost and effective for early seedling growth and works well under stressed and non-stressed conditions (Kaur et al., 2015). Despite its better growth, this method also shows faster germination time and higher germination rate during seed germination phase. This phase is crucial since it is the starting point in plant development. According to Kaymakanova (2009), germination stage determines when and where seedling growth begins which makes it the most preeminent stage in life cycle of plants. It is the most sensitive stage to all abiotic stresses including drought stress. Drought stress occurs when the plant’s surrounding is scorching in high temperature with great water deficiency which disrupts the biological process in plants due to low water uptake. It was also reported to cause significant reduction in germination rate, shoot and root length of many plant species (Okcu et al., 2005; Torabi and Ardestani, 2013; Liu et al., 2015).

Rice (Oryza sativa) generally requires a large amount of water to grow (5000 L of water to produce 1 kg of rice). Thus, rice production can severely be affected by drought stress. Reportedly, due to El Nino phenomenon, drought strike had affected Malaysia from September 2015 to April 2016. Consequence, there was a great loss in rice production in Kedah and Penang states. With respect to this issue, treatment using chemical solutions was introduced to alleviate drought stress.

The use of Potassium chloride (KCl), Thiourea (TU), Kinetin (Kin) and Salicylic acid (SA) in the treatment was reported to show improvements in germination rate, germination index, plant growth and crop production of various plant species under drought stress (Syekhbaglao et al., 2014; Eghobor et al., 2015; Al-Shaheen et al., 2016). Hence, this study was conducted to apply seed priming technique and develop a liquid enhancer that consist of KCl, TU, Kin, and SA for rice cv. MR 284 germination under drought stress condition.

Materials and Methods

Plant materials

Rice seeds cv. MR 284 used in the present study were obtained from Malaysian Agricultural Research and Development (MARDI) Parit Station, Perak.

Experimental design

PEG6000 solution (-1.2 MPa) was used to induce drought condition in the seed germination. PEG6000 solution (-12 MPa) has significantly reduced germination percentage and shoot and root growth of pyrethrum (Li et al., 2011). All seeds were germinated in petri dishes containing 8 mL of PEG6000

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

solution and left in a control room with temperature regulated at ±25ºC, and 16/8-hours (light/dark) cycled by Philips fluorescent light. All petri dishes were arranged in a Completely Randomized Design with 15 replications. The first step was to determine the ideal concentration of KCl, TU, Kin, and SA followed by the next step to combine the chemical solutions based on the ideal concentration found in step 1 and determines the ideal concentration of the combination.

Step 1: Determination of ideal concentration of KCl, TU, Kin, and SA

This method was adapted and improvised from Toklu et al. (2015). Rice seeds were surface sterilized with 20% sodium hypochlorite and rinsed 3x with distilled water. The sterilized rice seeds were then primed in KCl (10, 20, 30, 40, 50 mM), TU (10, 20, 30, 40, 50 mM), Kin (0.25, 0.50, 0.75, 1.0 mM), and SA (0.25, 0.50, 0.75, 1.0 mM) for ±16 hours. Primed and unprimed rice seeds (8) were germinated in -1.2 Mpa PEG6000 solution (8 mL) for 10 days, and unprimed seeds were served as control treatment. The germinated seeds were observed daily and growth parameters such as shoot length, root length, dry weight, and fresh weight were taken on day 10. Germination percentage, germination index, and seed vigor were calculated as follows, and analysed using a one-way ANOVA, SAS 9.4.

1. Germination percentage (GP) (%) (Ellis and Roberts, 1981)

Number of germinated seeds GP = x 100 2. Germination index (Anchalee, 2011)Total number of seeds sown

Number of germinated seeds Germination index = ∑ 3. Seed vigor (SV) (Abdul-Baki and Anderson, 1973)Number of days

Step 2: Combination of chemicalSV = (solutionsAverage toshoot produce length liquid + Average enhancer root length) x GP

All ideal concentrations were combined as the followings: A1 (KCl + TU), A2 (KCl + Kin), A3 (KCl + SA), B1 (TU + Kin), B2 (TU + SA), B3 (Kin + SA), C1 (KCl + TU + Kin), C2 (KCl + TU + SA), C3 (TU + Kin + SA), D (KCl + TU + Kin + SA). These treatments were tested using the same rice germination process as in step 1. Measurements and calculations for all parameters were analysed by using a one-way ANOVA, SAS 9.4.

Results and Discussion

Determination of ideal concentration of KCl, TU, Kin, and SA

In this study, seed priming with KCl, TU, Kin, and SA showed significantly higher value of germination percentage, germination index and seed vigor than unprimed seeds (control treatment). Ideal concentration of a chemical solution is the concentration with the highest value of seed vigor index, germination index and germination percentage amongst all concentrations. The ideal concentration for MR 284 was 20 mM KCl, 10 mM TU, 0.50 mM Kin, and 0.25 mM SA as shown in the Tables 1-4.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Effects of different concentrations of KCl on germination percentage (GP), germination index (GI), and seed vigor (SV) on MR 284 rice seed. Treatment KCl (mM) GP (%) GI SV Control 23.3±11.5c 2.94±0.3c 0.59±0.1c 10 29±10.1c 1.93±0.3d 0.96±0.05b 20 43±8.9a 5.77±0.6a 1.74±0.7a 30 17.67±1.9d 1.34±0.2d 0.32±0.02c 40 21.67±9.2c 1.39±0.2d 0.95±0.01b 50 36±6.7b 3.72±0.4b 1.4±0.02a Means with the same letter were not significantly different at P≤0.05.

Table 2: Effects of different concentrations of TU on germination percentage (GP), germination index (GI), and seed vigor (SV) on MR 284 rice seed. Treatment TU (mM) GP (%) GI SV Control 23.3±11.5c 2.94±0.3c 0.59±0.1c 10 50±0a 4.89±0.3a 2.21±0.3a 20 33.3±7.2b 4.44±0.2b 1.4±0.08b 30 53.3±11.5a 5.05±0.6a 1.8±0.2a 40 36.6±10.2b 4.45±0.3b 1.38±0.01b 50 19±8.5d 2.07±0.3c 0.41±0.02c Means with the same letter were not significantly different at P≤0.05.

Table 3: Effects of different concentration of Kin on germination percentage (GP), germination index (GI), and seed vigor (SV) on MR 284 rice seeds. Treatment Kin (mM) GP (%) GI SV Control 23.3±11.5c 0.34±0.3d 0.59±0.1d 0.25 16.1±3.9d 1.83±0.1c 1.25±0.4c a a a 0.50 55.75±5.7 8.59±0.5 3.36±0.5 0.75 48.3±1.7a 9.32±0.4a 1.99±0.24b b b a 1.0 40.7±0.67 6.14±0.2 2.32±0.3 Means with the same letter were not significantly different at P≤0.05.

Table 4: Effects of different concentration of SA on germination percentage (GP), germination index (GI), and seed vigor (SV) on MR 284 rice seeds. Treatment SA (mM) GP (%) GI SV Control 23.3±11.5b 0.34±0.3d 0.59±0.1b 0.25 38±3a 3.34±0.3a 1.62±0.17a 0.50 16.33±3.7c 2.11±0.2b 0.71±0.06a 0.75 15±3c 1.35±0.03c 0.24±0.08b 1.0 34±3.8a 3.16±0.2a 1.21±0.11a Means with the same letter were not significantly different at P≤0.05.

Combination of chemical solutions to produce liquid enhancer

Table 5 shows the germination percentage, germination index, and seed vigor of MR 284 at different combination treatments of 20 mM KCl, 10 mM TU, 0.50 mM Kin, and 0.25 mM SA. It revealed significantly higher value of germination percentage, germination index, and seed vigor for most of the seeds treated with the combination treatment compared to the control treatment at p<0.05. Figures 1-3 show representative of 10 days old MR 284 seedlings in treatment A, B, C, and D. All treatments showed better growth of seedlings compared to those in control.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 5: Germination percentage (GP), germination index (GI), and seed vigor (SV) of MR 284 rice seeds at different combination treatment of KCl (20 mM), TU (10 mM), Kin (0.5 mM), and SA (0.25 mM). Treatments GP (%) GI SV Control 83.7±4.3b 9.7±0.7b 4.6±0.7b A1 (KCl + TU) 96.0±4.0a 11.0±0.6ab 4.8±0.1ab A2 (KCl + Kin) 100±0a 11.2±0.9ab 4.9±0.5ab A3 (KCl + SA) 88±0b 11.4±0.4ab 6.01±0.7ab B1 (TU + Kin) 88±0b 12.9±1.3a 5.5±0.5ab B2 (TU + SA) 100±0a 12.8±1.1a 6.1±0.8ab B3 (Kin + SA) 96.0±4.0a 10.5±0.4ab 4.2±0.9b C1 (KCl + TU + Kin) 100±0a 11.8±0.8ab 6.6±0.8ab C2 (KCl + TU + SA) 100±0a 10.4±0.5ab 4.7±0.9b C3 (TU + Kin + SA) 100±0a 11.3±0.9ab 6.6±0.9ab D (KCl + TU + Kin + SA) 100±0a 11.9±0.3ab 7.3±0.9a Means with the same letter were not significantly different at P≤0.05.

Control A1 A2 A3

Shoot

Figure 1: 10 days old of MR 284 seedlings in treatment A versus control.

Control B1 B2 B3

Shoot

Figure 2: 10 days old of MR 284 seedlings in treatment B versus control.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Control C1 C2 C3 D

Root

Figure 3: 10 days old of MR 284 seedlings in treatment C, and D versus control.

In this study, seed priming technique increases germination percentage, germination index, and seed vigor of MR 284 rice seeds under drought stress condition. This occurred when the primed seeds showed higher results by nearly 2 folds in comparison to unprimed seeds (control treatment). According to Kaya et al. (2006), primed seeds were able to increase the germination rate and gave higher germination percentage. In this technique, the soaking method caused the seeds to be hydrated partially to a point where germination metabolic process began. This was the reason for the seed priming technique to be capable of increasing germination rate.

The ideal concentration selection is the one that gives highest value of seed vigor, germination index, and germination percentage. According to Egli and Rucker (2012), seedlings with high seed vigor showed better germination performance and expected to germinate more uniformly in comparison with seeds of lower vigor. The high values of seed vigor, germination index, and germination percentage were the indicators that the treatment was able to enhance the germination rate of MR 284 rice seeds under drought stress condition. In this study, drought condition was induced by -1.2 Mpa PEG600 solution that act as the germination solution. Almost all treatments showed better result in all parameters compared to control (unprimed seed) which explain that the application of formulation treatments via seed priming is able to enhance MR 284 rice germination under drought condition.

The combination treatments showed better results in comparison to the single treatment. As in this study, amongst all treatments, combination treatment A3 which consisted of 20 mM KCl and 0.25 mM SA was the most effective treatment as it shows no significant different with treatment D that gave the highest value of germination percentage, germination index and seed vigor. Combination of KCl and SA was found to have similar effect with the combination of KCl, TU, Kin and SA. This study reveals that the synergistic effect between KCl and SA has an ability to alleviate drought stress in the germination process and increase the germination rate of the MR 284 rice seeds.

Conclusion

A seed priming technique is found to significantly enhance germination rate and germination performance of MR 284 rice seeds under drought stress. This study found that the combination treatment A3 which consisted of 20 mM KCl and 0.25 mM SA is the best treatments compared to control and other treatments with high seed vigor (6.01±0.7) and germination index (11.4±0.4). Even though combination of treatment D showed the highest mean in seed vigor and germination percentage, there were no significant differences amongst all treatments. Therefore, combination treatment A3 was the best. This treatment is the simplest and cheapest than other treatments, and also able to increase the germination by 1.5 times compared to control treatment of MR 284 seeds under drought condition.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Acknowledgements

The authors would like to thank Universiti Putra Malaysia for the financial support from IPB Putra Grant for this study.

References

Abdul-Baki, A. and Anderson, J.D. 1973. Vigor determination in soybean seed by multiple criteria. Crop Science 13: 630-633. Al-shaheen, M.R., Soh, A. and Ismaaiel, O.H. 2016. Effect of irrigation timing and potassium fertilizing on some growth characteristics and production for mungbean (Vigna radiata L.). International Journal of Scientific and Research Publication 6(3): 525-528. Anchalee, J. 2011. Effects of different light treatments on the germination of Nepenthes mirabilis. International Transaction Journal of Engineering, Management and Applied Science and Technologies 2(1): 83-91. Egli, D.B. and Rucker, M. 2012. Seed vigor and the uniformity of emergence of corn seedlings. Crop Science 52(6): 2774-2782. Eghobor, S., Umar, A.A., Munir, G., Abu Bakar, A. and Collins, O. 2015. Comparative study of Moringa oleifera seed germination enhancement using gibberellic acid in varying concentrations. International Journal of Applied Research 1(13): 79-80. Ellis, R.H. and Roberts, E.H. 1981. The quantification of aging and survival in orthodox seeds. Seed Science and Technology 9: 373-409. Kaur, H., Chawla, N. and Pathok, M. 2015. Effect of different seed priming treatments and priming duration on biochemical parameters and agronomic characters of okra (Abelmoschus esculentus L.). International Journal of Plant Physiology and Biochemistry 7(1): 1-11. Kaya, M.D., Okcu, G., Atak, M., Cikili, Y. and Kolsarici, O. 2006. Seed treatments to overcome salt and drought stress during germination in sunflower (Helianthus annuus L.). European Journal of Agronomy 24: 291-295. Kaymakanova, M. 2009. Effects of salinity on germination and seed physiology in bean (Phaseolus vulgaris L.). Biotechnology and Biotechnological Equipment 23: 326-329. Li, J., Yin, L.Y., Jongsma, M.A. and Wang, C.Y. 2011. Effects of light, hydropriming and abiotic stress on seed germination, and shoot and root growth of pyrethrum (Tanacetum cinerariifolium). Industrial Crops and Product 34: 1543-1549. Liu, M., Li, M., Liu, K. and Siu, N. 2015. Effect of drought stress on seed germination and seedling growth of different maize varieties. Journal of Agriculture Science 7(5): 231-240. Okcu, G., Kaya, M.D. and Atak, M. 2005. Effect of salt and drought stress on germination and seedling growth of pea (Pisum sativum L.). Turkish Journal of Agriculture and Forestry 29: 237-242. Sheykhbaglou, R., Rahimzadeh, S., Ansari, O. and Sedghi, M. 2014. The effect of salicylic acid and gibberellin on seed reserve utilization, germination and enzyme activity of sorghum (Sorghum bicolor L.) seeds under drought stress. Journal of Stress Physiology and Biochemistry 10(1): 6- 13. Torabi, B. and Ardestani, F.G. 2013. Effect of salt and drought stress on germination components in canola (Brassica napus L.). International Journal of Agriculture and Crop Science 5(15): 1642- 1647.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The Potential of Organic Amended Acid Sulphate Soil for MR 220 Rice Cultivation

Aizuddin, M.R.K.A., Wahida, N.H.*, Adzmi, Y. and Nur Firdaus, A.R. Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA Cawangan Melaka Kampus Jasin, 77300, Melaka, Malaysia. *E-mail: [email protected]

Introduction

In Asia, the demand for rice is expected to increase by 70% over the next 30 years, driven primarily by population growth (Muthayya et al., 2014). Acid sulfate soils in Malaysia are found along its coastal plains (Enio et al., 2011). The soil is characterised by pH below 3.5 (Shamshuddin, 2006) caused by pyrite oxidation. It is associated with a high level of aluminum (Al) which in most cases reduce phosphorus (P) availability, increase iron (Fe) toxicity and other nutrients deficiencies (Azman et al., 2014). These features affected rice growth and production lower than the standard yield. Rice yield on acid sulphate soil in Malaysia is lower compared to other types of soil (Suswanto et al., 2007). In Malaysia, they appear mainly in the coastal plains of the west coast states of Peninsular Malaysia (Shamshuddin, 2006) as well as Sarawak (Teng, 2005).

Conventional practice to increase soil pH and ameliorate the soil prior cultivation is liming by using ground magnesium limestone (GML) and/or basalt. Recycling of organic wastes as alternatives to chemical fertilisers is a good approach not just to amend the soil but also to supply major nutrients for crop production. Animal manure gives many beneficial effects in improving soil quality and productivity. Chicken manure has long been known of its high nitrogen (N) content as one of the most necessary fertilizers (Davis et al., 2017). Application of cow manure improved organic matter content by six and seven years in contrast with the area without it (Moreno and Garcia, 2014). Oil palm empty fruit bunch (EFB) compost is a good quality compost which can improve soil pH, increase availability of primary nutrients (N, P and K), as well as Ca and Mg in soil (Kavitha et al., 2013). Organic acids produced from organic matter form stable complexes with Al and Fe thus able to alleviate Al toxicity (Shamshuddin et al., 2004). Therefore, applying organic amendments mixed with low level of lime could increase the pH and nutrients availability. The objectives of the study were to identify the best combination of GML and organic amendments (cow, goat and chicken manures; and EFB compost) which could increase pH of soil, nutrient availability, and also to identify the growth performance of MR 220 rice grown in acid sulphate soil. MR 220 rice variety was chosen as the variety was planted in the soil source area from Merbok. In addition, this variety could produce higher yield and resistant to diseases. It could tolerate unstable water condition at ripening stage and also the problems of improper manuring by the farmers.

Materials and Methods

Soil sampling and soil analyses

Linau Soil Series of acid sulfate soil was sampled randomly in Kampung Segantang Garam Merbok, Kedah (5º39’47.2”N 100º23’41.1”E) from an area recommended by Muda Agriculture Development Authority (MADA). The soil was formerly cultivated with MR 220 rice. Linau Soil Series is clayey type with below 80 cm depth of ground water table. On the top layers of the soil, jarosite mottles can be found during dry season and it is highly acidic.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Soil texture, bulk density, pH, available phosphorus (P), potassium (K), calcium (Ca), magnesium (Mg), iron (Fe) and aluminium (Al) content were determined. The soil texture was identified using the hydrometer method (Jones, 2001), and the standard soil textural triangle devised by the United States Department of Agriculture (USDA, 1951) was used. Bulk density of the soil was measured using the core method. Soil organic matter content was determined using the method of loss on ignition (LOI). Soil colour notation was made based on Munsell Colour Chart. The pH of the soil was determined in a 1:2.5 soil:distilled water suspension. Available phosphorus in the soil was determined using Bray-Kurtz No.2 extracting method. Cation exchange capacity (CEC) and available K, Ca and Mg were extracted using 1M ammonium acetate pH 7.0 whereas Fe and Al content in soil were determined by using Mehlich No.1 method. Extracted solutions were analysed by ICP-OES (Jones, 2001).

Nutrient content of organic amendments

Organic amendments nutrient content was extracted using dry ashing methods (Jones, 2001) and the concentrations were determined by ICP-OES.

Pot experiment preparation

The soil sample was air dried and mixed thoroughly with organic amendments and GML (Table 1). The amount of organic amendments were recommended by MARDI (Malaysian Agricultural Research and Development Institute) while the amount of GML used followed farmers normal practice.

Table 1: Treatment of soil amendments. Treatment Treatment combination T0 (Control) GML (20 g) T1 Cow Manure (690 g) + GML (20 g) T2 Goat Manure (385 g) + GML (20 g) T3 Chicken Manure (565 g) + GML (20 g) T4 EFB (400 g) + GML (20 g) T0 (Control) GML (20 g)

The mixture was left for 30 days in 30 cm diameter pots, before transplanting of MR 220 rice seedlings. Water level was maintained at 5 cm above the soil surface. At 15 and 35 days after planting, NPK compound fertiliser (15:15:15) and urea were applied to all pots. The seedlings were grown for 115 days, the average growing period for MR 220 to reach maturity stage. In this study, all the treatments were arranged using the completely randomised design (CRD) method and planted in a greenhouse.

Measurement of relative chlorophyll content and rice growth

Relative chlorophyll content of the leaves was measured using a portable chlorophyll meter (SPAD 502, Minolta, Japan). The readings were taken around the midpoint at the midrib of each leaf sample and averaged (Yuan et al., 2016). The leaf length (cm) and plant height (cm) were measured using measuring tape while number of tillers and weight of rice (g) were recorded at the end of the experiment. All data were subjected to Analysis of Variance (ANOVA) at p≤0.05 followed by Tukey’s test using Minitab.

Results and Discussion

Characteristics of Linau Series Soil were as shown in Table 2. The bulk density of soil at (1.04 g cm-3) is not optimal for conventional tillage but it is suitable for no tillage among common rice cultivation

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

systems. Optimal bulk density for no tillage on rice cultivation is 1.32 to 1.35 g cm-3 while for conventional tillage is at 1.37 to 1.39 g cm-3 (Motschenbacher et al., 2011). Based on the soil texture triangle, it is clay loam type of soil since Linau Soil Series was located near the river. Clay loam has very small particles, and when it is wet or rain, it could hold and retain water. This is suitable for the cultivation of rice. Water requirement for rice cultivation in Malaysia is normally 775 mm/season which the volume of water required for one season is 1.4 x 104 m3 (Azwan et al., 2010).

Data showed soil pH increment after application of treatments (Table 3). Soil pH in the range of 5.5 to 6.5 indicated an ideal pH for rice cultivation where the availability of macro- and micronutrients needed for rice growth are made available for the plant uptake. Among all treatments, T2 and T4 were significantly higher than T0 (Figure 1). It could be due to high Ca and Mg contents in the EFB and goat manure (Table 4). Mandisi et al. (2016) reported that soil pH increased from 4.77 to 5.14 after application of goat manure. These elements act as the bases to neutralise exchangeable Al and Fe presence in acid sulfate soil (Azman et al., 2014). The manures where were decomposed, releasing basic cations which could raise the initial pH of the soil thus enhance the growth of rice (Uwah and Eyo, 2014). Therefore, organic amendments mixed with GML gave a positive effect on the soil fertility in terms of reducing the Al and Fe concentrations in soil.

Table 5 showed nutrient content in soil after application of the organic amendments. There was an appreciable amount of available P, K, Ca and Mg in treated soils. Besides liming effect, GML also helps to supply Ca and Mg. Organic manures supply essential nutrients formed during mineralisation and improve physical characteristics of the soil thus providing a good medium for rice growth. Soils treated with chicken manure (T3) contained lower nutrients compared to others. It might be due to nutrients in poultry manure which are released slowly and stored for a longer period of time in the soil (Sharma and Mittra, 1991).

Table 2: Soil physical for Linau soil series taken from Merbok, Kedah. Cation Particle distribution Bulk Organic Soil Depth exchange (%) Soil density matter Colour series (cm) capacity Texture (g cm-3) content Sand Silt Clay (meq/100 g) 10YR Clay Linau 1.04 15-30 5.73 % 19.03 26 47 27 4/2 loam

Table 3: Soil pH before and after treatment application. Treatment Soil pH before treatment Soil pH after treatment T0 (Control) 3.99 4.63 T1 (Cow manure) 4.01 5.32 T2 (Goat manure) 4.07 5.62 T3 (Chicken manure) 3.79 5.55 T4 (EFB) 4.17 5.61

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 4: Nutrient content in organic amendments. Nutrient content (mg kg-1) Treatment P K Ca Mg Cow manure 4830 14820 5782 3697 Goat manure 15460 50840 15300 6398 Chicken manure 1216 3055 3055 2691 EFB 10930 14480 14480 6019

Table 5: Soil nutrient content after treatment application. Nutrient content (mg kg-1) Treatment P K Ca Mg T0 (Control) 2.60 304.3 835 352.8 T1 (Cow manure) 2.23 788.8 1043 468.1 T2 (Goat manure) 1.66 872 1106 463.8 T3 (Chicken manure) 1.89 266.7 886 244.1 T4 (EFB) 2.18 542 1267 496.6

The leaf length and plant height showed no significant difference among treatments (Figures 2 and 3). The number of tillers of T3 (GML with chicken manure) was significantly higher than T0 and T2 (GML with goat manure). However, T3 recorded insignificant number of tillers with T1 (GML with cow manure) and T4 (GML with EFB) (Figure 4). In Figure 5, data showed insignificant effects of organic amendments on relative chlorophyll content of rice plants. However, several studies reported higher chlorophyll a and b content as well as SPAD meter readings in rice leaves treated with organic manure along with chemical fertilisers compared to organic manures (Ramesh et al., 2002; Morteza and Shankar, 2013).

From the data collected, the yield in combination of GML and goat manure (T2) was not significantly different with combination of GML with cow manure (T1) and GML with EFB (T4). The grain weight were in the order of goat manure (33.13 g), followed by cow manure (29.1 g), EFB compost (26.81 g), control 16.76 g) and chicken manure (16.59 g) (Figure 6). This result agreed with the hypothesis of this study where there was an increase in the yield of MR 220 rice when organic amendments and GML were applied to acid sulfate soil. Figure 7 showed rice plants at harvesting stage. Generally, soils treated with GML and organic amendments produced better rice plants than control.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

6 a ab a ab

5 b a a 4

Soil Soil pH

0 Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05. T0 T1 T2 T3 T4 Figure 1: Soil pHKCl of acid sulfate soil treated with GML and organic amendments.

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 1: Soil pHKCl of acid sulfate soil treated with GML and organic amendments.

66 a 64

62 a 60 a 58 a 56 a 54

Leaf length (cm) length Leaf 52

48 T0 T1 T2 T3 T4

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 2: MR 220 leaf length on acid sulfate soil treated with GML and organic amendments.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

103 a 102

101 100 a 99 a a

98 97 a (cm) height Plant 96

95 94

93 T0 T1 T2 T3 T4

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 3: Plant height of rice planted on acid sulfate soil treated with GML and organic amendments.

35 a

25 ab b ab 20 b

tillers of Number 10

0 T0 T1 T2 T3 T4

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 4: Number of tillers of rice planted on acid sulfate soil treated with GML and organic amendments.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

60 a

a 50

a a

content chlorophyll Relatuve 10

0 T0 T1 T2 T3 T4

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 5: Relative chlorophyll content of leaves of rice planted on acid sulfate soil treated with GML and organic amendments.

35 a

30 ab

20 b b

10 Weight (g) of Weight Rice

0 T0 T1 T2 T3 T4

Means with the different letter(s) indicate significant difference using Tukey’s Test at p≤0.05.

Figure 6: Weight of rice planted on acid sulfate soil treated with organic amendments after 115 days.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 7: Rice grown on acid sulfate soil amended with different combinations of GML and organic amendments.

Conclusion

Combination of GML and EFB (T4) was found able to improve acid sulfate soil quality and MR 220 rice yields. Combination of GML and EFB raised soil pH up to 5.61 at harvesting period. EFB contained high P, K, Ca, and Mg which helped to add and supply available nutrients for rice growth and yield production. Therefore, it is recommended that combination of GML and EFB (at amount per ha) will give higher yields of rice and better improve Linau Soil Series of acid sulfate soil.

References

Azman, E.A., Jusop, S. and Ishak, C.F. 2014. Increasing rice production using different lime sources on an acid sulphate soil in Merbok, Malaysia. Pertanika Journal of Tropical Agricultural Science 37(2): 223-247. Azwan, Zawawi, Mustapha, S. and Puasa, Z. 2010. Determination of water requirement in a paddy field at Seberang Perak rice cultivation area. The Journal of the Institution of Engineers, Malaysia 71(4): 32-41. Davis, M.A., Sloan, D.R., Kidder, G. and Jacobs, R.D. 2017. Poultry Manure as a Fertilizer 1: 1-2. Enio, M.S.K., Shamshuddin, J., Fauziah, C.I. and Husni, M.H.A. 2011. Pyritization of the coastal sediments in Kelantan plains in the Malay Peninsula during the Holocene. American Journal of Agricultural and Biological Sciences 6: 393-402. Jones, J.B. 2001. Laboratory guide for conducting soil tests and plant analysis. CRC Press, Taylor and Francis Group, London. pp 384. Kavitha, B., Jothimani, P. and Rajannan, G. 2013. Empty Fruit Bunch – a potential organic manure for agriculture. International Journal of Environmental Science and Technology 2: 930-937. Moreno, F.P. and Garcia, F.P. 2014. Effect of the application of manure of cattle on the properties chemistry of soil in Tizayuca, Hidalgo, Mexico Autonomous University of the State of Hidalgo. International Journal of Applied Science and Technology 4(3): 67-72. Morteza, S. and Shankar, L.L. 2013. Role of organic fertilizers on chlorophyll content in rice (Oryza sativa L.). Trends in Life Sciences 2(3): 13-17. Motschenbacher, J.M., Brye, K.R. and Anders, M.M. 2011. Long-term rice-based cropping system effects on near-surface soil compaction. Agricultural Sciences 2(2): 117-124. Muthayya, S., Sugimoto, J.D., Montgomery, S. and Maberly, G.F. 2014. An overview of global rice production, supply, trade and consumption. Annals of the New York Academy of Sciences

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

1324(1): 7-14. Ramesh, K., Chandrasekaran, B., Balasubramanian, T.N., Bangarusamy, U., Sivasamy, R. and Sankaran, N. 2002. Chlorophyll dynamics in rice (Oryza sativa) before and after flowering based on SPAD (chlorophyll) meter monitoring and its relation with grain yield. Journal of Agronomy and Crop Science188: 102-105. Shamshuddin, J. 2006. Acid Sulfate Soils in Malaysia. Serdang, Malaysia: UPM Press. Shamshuddin, J., Muhrizal, S., Fauziah, I. and Husni, M.H.A. 2004. Effects of adding organic materials to an acid sulphate soil on the growth of cocoa (Theobroma cacao L.) seedlings. Science of the Total Environment 323: 33-45. Sharma, A.R. and Mittra, B.N. 1991. Effect of different rates of application of organic and nitrogen fertilizers in a rice-based cropping system. Journal of Agricultural Science 117: 313-318. Suswanto, T., Shamshuddin, J., Syed Omar, S., Mat, P. and Teh, C. 2007. Alleviating an acid sulfate soil cultivated to rice (Oryza sativa) using ground magnesium limestone and organic fertiliser. Jurnal Tanah dan Lingkungan 9(1): 1-9. Teng, C.S. 2005. The characteristics and soil-forming processes in acid sulfate soil in Sarawak, Soil Management Division, Department of Agriculture, Sarawak, Malaysia. USDA (United States Department of Agriculture). 1951. Soil Survey Manual. Agriculture Research Administration, United States Department of Agriculture, pp 503. Uwah, D.F. and Eyo, V.E. 2014. Effects of number and rate of goat manure application on soil properties, growth and yield of sweet maize (Zea mays L. saccharata Strut). Sustainable Agriculture Research 3(4): 75-83. Yuan, Z., Cao, Q., Zhang, K., Ata-ul-karim, S.T., Tian, Y. and Zhu, Y. 2016. Optimal leaf positions for SPAD meter measurement in rice. Frontiers in Plant Science 7: 719.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mudflats to Marvel: Soil Health of a Successfully Restored Mangrove Coastline in Sungai Besar, Selangor

Jeyanny, V.1,*, Mohamad Fakhri, I.1, Wan Rasidah, K.1, Rozita, A.1, Siva Kumar, B.2 and Daljit, K.S.2 1Forest Plantation Programme, Forest Biotechnology Division, Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. 2Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Mangrove forest plays an important part in our ecosystems. Mangroves functions include coastline protection, marine produce, firewood, charcoal production and for the conservation of floral and faunal species. This unique ecosystem is under tremendous stress due to erosion, excessive anthropogenic activities and natural disasters such as tsunamis. The coastlines of Malaysia have witnessed drastic decline in the recent years whereby 29% of the Malaysian coastal areas were reported to be vulnerable to serious erosion (Wan Rasidah et al., 2015). In order to restore this vulnerable ecosystem, efforts have been undertaken by replanting of mangrove seedlings and placing geotubes to control soil erosion and accretion. Geotubes are intended to slow erosion along coast line, breakwater and to provide some protection to mangrove seedlings. It consists of permeable geotextile fabric folded and sewn together and hydraulically filled with dredged sand (Shin et al., 2002). Since the installation of geotubes, we monitored the soil physical and chemical properties of an old growth mangrove forest and a newly regenerating mangrove stands over the years. This paper highlights the important changes that took place from 2007 to 2017 in an established mangrove and a newly regenerating mangrove plots which have been restored.

Materials and Methods

The mangrove forest in Sungai Haji Dorani, Sungai Besar Selangor (3o 38’N, 101o 01’E) is mainly dominated by the Avicennia and Rhizophora species. The annual average temperature is about 26.9°C, with the hottest in October at 27.7°C and lower in July at 26.2°C. The annual rainfall and relative humidity are approximately 130 mm and 70-95%, respectively (Jeyanny et al., 2009). In 2007, four units of geotubes measuring 50 m each were installed as a wave breaker to impede the effects of erosion and the impact of waves on the mangrove coastline. The installation of geotubes was able to allow the regeneration of mangrove forests overlooking the sea. An old growth mangrove stand and a newly regenerating mangrove stand were selected for comparison. The range for diameter at breast height (DBH) for the newly regenerated mangrove and established mangrove stands were 3.7-10.3 cm and 2.8- 11.5 cm, respectively. Each quadrant comprises of 5 x 5 m quadrant and there were 40 quadrants established. For soil profile analysis, samples of up to 120 cm of soil depth were collected in both areas for description purposes using a Jarett auger and modified mud sampler (Table 1). The soil samples that were collected at 0-15 cm depth in each quadrant were transported to FRIM for the determination of soil pH, electrical conductivity (EC), soil nitrogen (N), organic matter (OM) and soil organic carbon (OC) using Walkley and Black Method (1934). Microbial biomass carbon (microbial C) and nitrogen (microbial N) were analysed according to Chloroform Fumigation Direct Extraction Method (CFDM). The soil pH, soil EC, soil C (carbon), soil C:N ratio, microbial biomass C and microbial biomass N were analysed using T test. The mean comparisons were then computed using a Duncan’s Multiple Range Test (DMRT) in Statistical Analysis System (SAS).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

The general soil descriptions for both old growth and restored mangrove area are given in Table 1. Soil pH in the old growth and restored area ranges from 6.12 to 6.93 and 7.8 to 7.75, respectively. Values for OC and N were generally lower in the newly regenerated site but were not far off from the old growth forest. It was noted that cation exchange capacity (CEC) values for the restored mangroves were 1.6 and 2 times lower for the first two upper horizons as compared to the old growth. The proportions of clay content were also elevated at 49-62% and 39-40%, respectively. The availability of microbial N, OM, soil pH, soil C, and ratio of C:N were all significantly higher in the old growth forest as compared to the newly restored mangrove (Table 2).

Table 1: Summary results on the soil profile in the old growth and restored coastline at Sungai Besar, Selangor. Coarse Fine Dry N OC Av. P CEC Silt Clay Soil Profile sand sand pH (%) (%) (ppm) (cmol/kg) (%) (%) (%) (%) Old growth

0-11 cm 6.12 0.29 2.97 47.63 25.58 0 0 37 62 11-28 6.81 0.15 1.71 82.08 22.79 0 1 41 57 28-55 6.93 0.12 1.44 70.38 22.18 0 1 40 59 55-120 6.87 0.20 2.20 41.60 17.48 0 3 48 49 Restored 0-5 cm 7.75 0.16 1.73 59.45 12.68 4 16 35 40 5-45 7.76 0.16 1.83 53.95 13.84 9 8 38 40 45-80 7.80 0.10 1.46 74.50 15.02 7 10 38 40 80-120 7.75 0.10 1.53 89.98 18.33 12 2 43 39

Table 2: Results of selected soil properties (0-15 cm depth) in the old growth and restored Sungai Besar coastline, Selangor. Variables Old growth Restored Microbial N 2.25(0.21)a* 1.64(0.18)b* Microbial C 17.15(2.09)a* 27.64(2.84)b* OM 4.65(0.14)a** 4.05(0.20)b** pH 6.59(0.02)a** 7.63(0.04)b** C 3.62(0.05)a** 2.45(0.14)b** N 0.18(0.01)a** 0.35(0.01)b** CN 13.53(0.65)a** 10.58(0.51)b** EC 11.99(0.26)a** 20.92(0.86)b** Values in parenthesis represents standard error.* Significant at p<0.01; **Significant at p<0.05.

Soil health encompasses soil quality which is further governed by the physical, chemical, biological and ecological processes within a soil (Wall and Bardgett, 2012). Soil health of mangroves is vital to be monitored as they will determine the success of a soil restoration initiative. Previous studies in the mudflats have also shown that there were severe soil degradation, soil erosion, structure less substrates and soil depletion (Jeyanny et al., 2009; Mohamad Fakhri et al., 2009; Jeyanny and Wan Rasidah, 2015). However, with geotubes placement, it was observed that the area cordoned off for restoration has transitioned from bare mudflats to newly regenerating vegetation.

Soil organic matter which is closely related to soil C and N is of primary importance for vegetation growth (Craswell and Lefroy, 2001). It can be seen that the soil C and N in the restored area have increased by 2.45 and 0.35% as compared to the earlier sampling results obtained at 1.38% and 0.12%,

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

respectively, for a similar soil depth in 2008 (FRIM, 2009). However, soil microbial C results do not tally with OM and soil C (Table 2). We believe that microbial C is governed by more complex factors such as the microenvironment-specific microbial species related to the availability of nutrients, hydrocarbons, biodegradation processes, anoxic conditions and substrate types as also discussed by Al- Amoudi et al. (2016). It is also possible that the results could be due to delayed in analysis and prolonged storage that may have influenced the microbial viability.

Soil CEC which was higher in the old growth forest (Table 1) is owed to a better developed soil structure with higher clay content (Table 1), whereby clay minerals are negatively charged sites that assist in holding cations and give higher CEC values. The soil C:N of 10.58 in the restored area is an indicative of good quality organic matter and with stabilized humus (Miller and Donahue, 1990), which will further enhance the state of soil health in the mangroves. The sharp contrast in EC in the restored mangroves was due to the frequent salt water intrusion into the mudflats unlike the old growth forest. Nevertheless, mangrove species were reported to withstand EC levels up to 35 mS/cm (Chan and Baba, 2009) where species such as Avicennia have peg roots that can assist in root respiration.

Conclusions

Although most variables in the old growth forest showed higher values, the gradual increase in soil properties (i.e. OM, C, N, microbial N, CN, EC) in the restored mangroves is an indicative of the capacity of soils in decomposition and nutrient cycling processes in supporting the evolving mudflat zone for vegetative productivity. Soil restoration with wave breakers may benefit the degrading coastline in the long run, provided that the soil environment is conducive for mangrove forest re-establishment. Future work is in progress in delineating the microbial diversity population using metagenomics in the old growth forest and the restored mangroves to gauge their role in soil nutrition processes.

Acknowledgements

We acknowledged the funding from the Ministry of Natural Resources and Environment in conducting this research. The authors are grateful to all assistance rendered by the Soil Management Branch, FRIM in the field and laboratory works.

References

Al-Amoudi, S., Razali, R., Essack, M., Amini, M.S., Bougouffa, S., Archer, J.A., Lafi, F.F. and Bajic, V.B. 2016. Metagenomics as a preliminary screen for antimicrobial bioprospecting. Gene 594(2): 248-258. Chan, H.T. and Baba, S. 2009. Manual on Guidelines for Rehabilitation of Coastal Forests. International Society for Mangrove Ecosystems (ISME), c/o Faculty of Agriculture, University of the Ryukyus, 1 Senbaru, Nishihara, Okinawa, 903-0129 Japan. 66 p. Craswell, E.T. and Lefroy, R.D.B. 2001. The role and function of organic matter in tropical soils. Nutrient Cycling in Agroecosystems 61: 7-18. Fakhri, M.I., Adi, F.A.K., Jeyanny, V., Wan Rasidah, K., Suhaimi, W.C. and Norhisyam, I. 2009. Kadar hakisan tanah kawasan hutan paya bakau di Pantai Sungai Haji Dorani, Sungai Besar, Selangor. Pp. 117-120. In: Abd. Rahman, A.R., Jefri, A.R., Jinis, A., Suhaili, H.R., Norzalyta, M.G., Nora Azlina, M., Nabilah Hamidah, S., Khairunnisa, M.M. and Ain Nur Nadillah, D. (Eds.), Prosiding Seminar Kebangsaan Pemuliharaan Hutan Pesisiran Pantai Negara 2009: Memulihara Pesisiran Pantai Bersama Masyarakat, 1-2 December 2009, Kuching, Sarawak.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Forest Research Institute Malaysia. 2009. Laporan analisis sampel tanah di Sungai Haji Dorani dan Sungai Besar, Selangor. Test Report No: K19/08. 6 p. Jeyanny, V. and Wan Rasidah, K. 2015. The chemistry and fertility. Pp. 59-72. In: Wan Rasidah, K., Mohamad Zaki, M.I., Mohamad Fakhri, I. (Eds.), Muddy Substrates of Malaysian Coasts. 92 pp. FRIM. Kepong. Jeyanny, V., Suhaimi, W.C., Wan Rasidah, K., Adi, F. and Azian, M. 2009. Preliminary analysis of soil properties of an eroding mangrove shore in Selangor, Malaysia. GLOMIS 7(3): 5-6. Available online at http://www.glomis.com/ej/pdf/EJ_7-3.pdf.Verified on 20th August 2009. Martius, C., Tiessen, H. and Vlek, P.L.G. 1999. Managing organic matter in tropical soils: Scope and limitations. Proceedings of a workshop organized by the Centre for Development Research at the University of Bonn (ZEF Bonn)- Germany, 7-10 June, 1999. Kluwer Academic Publishers Dordrecht. Miller, R.W. and Donahue, R.L.1990. Soils- An introduction to soil and plant growth. 6thedition. Prentice Hall International. 768 pp. Shin, E.C., Ahn, K.S. and Oh, Y.I. 2002. Construction and Monitoring of Geotubes. Proceedings of the Twelfth International Offshore and Polar Engineering Conference Kitakyushu, Japan, May 26-31, 2002. The International Society of Offshore and Polar Engineers. Wall, D.H. and Bardgett, R.D. 2012. Soil ecology and ecosystem services. Oxford University Press. 406 p. Walkley, A.J. and Black, I.A. 1934. Estimation of soil organic carbon by the chromic acid titration method. Soil Science 37: 29-38. Wan Rasidah, K., Zaki, M.I. and Fakhri, M.I. 2015. Muddy substrates of Malaysian coasts. 92 p. Forest Research Institute Malaysia.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Growth Performance of Planted Mangrove and Rhu Species in Perak: A Preliminary Result

Salleh, M.*, Wan Mohd Shukri, W.A., Nur Hajar, Z.S., Mohd Danial, M.S., Abdul Aizudden, A.A., Aminudin, A.A. and Muhamad Khairul, E. Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Planting of mangrove and Rhu species at the national coastlines has been implemented in Malaysia since 2005 to 2012 that has managed to plant 6.3 million trees (Anon, 2011; Anon, 2014). The purpose of the planting is to conserve diversity of life and to minimize erosion problems on the coastlines. The planting was carried out by government agencies such as the Forestry Department of Peninsular Malaysia, Forestry Research Institute of Malaysia, State Forestry Departments, and non-Governmental Organizations (Audrey, 2018).

Currently, there are no growth and yield plots established in the planted areas. Therefore, the growth and yield plots have been established for mangrove and Rhu species. Data collected from the plots are very useful for the future planning. Objective of the study is to investigate the growth performance of planted mangrove and Rhu species in Malaysia.

Materials and Methods

Four Rhu areas and two mangroves areas were selected for the initial study in Perak. A study plot size 20 m x 20 m for each species was established and replicated twice. The planting areas have the same characteristics in terms of soil properties.

Results and Discussion

Growth data of Rhu species aged 2 years, 3 years, 4 years and 8 years old were recorded. The Rhu planting areas have the same soil and environmental characteristics. It was found that the average incremental Diameter at Breast Height (DBH) of Rhu per year is 3.49 cm (Table 1). It also shows that incremental DBH for Rhu at age 2 to 4 years are quite high i.e more than 3.0 cm per year compared to age 5 to 8 years i.e at a rate of 1.0 cm per year (Table 1).

Table 1: DBH and height for Rhu species according to year of planting. Rhu species Year of planting DBH (cm) Average height (m) Casaurina equisetifolia 2010 16.21 18.93 Casaurina equisetifolia 2014 12.10 12.38 Casaurina equisetifolia 2015 8.98 8.64 Casaurina equisetifolia 2016 5.74 6.56

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: DBH and height for mangrove species according to year of planting. Year of DBH increment per Average Mangroves species planting DBH (cm) year (cm) height (m) Rhizophora apiculata (Bakau Minyak) 2008 5.43 0.68 11.56 Rhizophora mucronata (Bakau Kurap) 2008 6.84 0.85 7.71

Conclusion

The preliminary results showed that planting of mangrove and Rhu species at the national coastlines is successful. The trees planted will conserve biodiversity and minimise erosion problems at the coastlines.

References

Anon. 2011. Laporan Tahunan: Program penanaman pokok bakau dan spesies-spesies yang sesuai di persisiran pantai Negara. Jabatan Perhutanan Semenanjung Malaysia, Malaysia. Anon. 2014. Kajian penilaian outcome program penanaman pokok bakau dan spesies-spesies yang sesuai di pesisiran pantai negara. Kementerian Sumber Asli dan Alam Sekitar, Wisma Sumber Asli, Malaysia. Audrey, V. 2018. 6.6 million mangrove trees planted nationwide. https://www.nst.com.my/news/nation/2018/07/394778/66-million-mangrove-trees-planted nationwide-says-xavier. 26 July 2018.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Growth Performance of Rhizophora Trees at Mangrove Forest in Tanjung Piai, Johor

Nur Hafiza, A.H.1,*, Wan Rasidah, K.1, Rosazlin. A.2, Mohamad Fakhri, I.1 and Nur Zahirah, Z.2 1Forest Biotechnology Division, Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. 2Institute of Biological Sciences, Faculty of Sciences University of Malaya, 50603 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Mangrove trees need the basic elements same like other plants for their plant growth. This includes organic carbon, macronutrients and micronutrients. Some of these nutrients are readily available to plant from naturally occurring processes from its environment. Macronutrients play an important role in plant growth and development same as micronutrients which essential for plant growth but required in smaller amounts compared to macronutrients (Tripathi et al., 2014). However, some heavy metals elements were present in the environment due to the anthropogenic activities. Several studies proved that mangrove trees and sediments have an extraordinary ability to immobilize the heavy metals which entered to the system (Huang and Wang, 2010). The effects of trace pollutants on mangrove plants under controlled condition, revealed that growth, photosynthesis, and biomass ware reduced and mortality is increased due to the high concentration of heavy metals in the mangrove sediments (Lovelock, 2009).

The objective of this study is to determine the growth of Rhizophora trees (Rhizophora mucronata, Rhizophora apiculata and Rhizophora stylosa) growth and the soil properties at mangrove forest in Tanjung Piai, Johor. Tanjung Piai located at the end point of Asia continent which consists of coastal mangroves and inter-tidal mudflats. Tanjung Piai National Park covers an area of 526 ha and 400 ha of mangroves forest (Jamil, 2016). This park serves as an important site for tourism not only for economic purposes but also to increase the awareness among the tourists on the important of mangrove forest. However, in July 2012, Kosmo’s newspaper reported that Tanjung Piai National Park is facing the problem of oil spills and organic deposit disturbance which had killed approximately 7,000 mangroves trees that have been planted at the mangrove forest (Mazlina, 2012). Therefore, an evaluation on growth performance of Rhizophora trees (R. mucronata, R. apiculata and R. stylosa) in mangrove forest at Tanjung Piai, Johor was carried out by measuring plant height. Soil condition such as total organic carbon and nitrogen content, soil fertility, and the concentration of heavy metals between four treatments based on different categories of organic deposit in the soil was also studied.

Materials and Methods

Research location and list of treatments

Tanjung Piai is the southernmost point of Peninsular Malaysia and it is one of the RAMSAR site which also known as Conservation of International Wetlands. This research includes four treatments with three replicates (Table 1).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: List of treatments. Treatment Description T1 Site without organic deposit T2 Rhizophora trees planted in 2014 with organic deposit T3 Rhizophora trees planted in 2015 with organic deposit T4 Rhizophora trees planted in 2016 with organic deposit

Growth performance

Selected Rhizophora trees were identified and were tagged according to its species (R. mucronata, R. apiculata and R. stylosa). The height of each tree was measured using measuring tape. The data were collected every three months. This study was started in June 2016 till December 2016.

Soil analysis

The soil sediments were taken at the depth from 0 to 10 cm and 10 to 30 cm depth for soil composite by using soil augers. Then the soil samples were oven dried at temperature not exceeding 40C and sieved for further analysis. Total organic carbon (%) was analyzed using Walkey and Black (1934) method. Total nitrogen (%) was determined using the modified method (Bremner and Mulvaney, 1982), while the total elements in soil were determined by using the Aqua Regia method (EPA-ROC, 1994).

Statistical analysis

The relationship between metals in the mangrove sediments were analysed using Statistical Package for the Social Sciences (SPSS).

Results and Discussion

Figure 1 shows the total mean of plant height increment for all Rhizophora species studied. Although T1 recorded an increase in plant height increment from June to September and from September to December, the total mean for plant height increment (June until December) in T1 was not the highest among the treatment plots. The plant height increment in T3 and T4 were higher at almost for all Rhizophora species. This might be due to the present of organic deposit that leads to an increase in nutrient availability thus enhancing the soil fertility (FAO, 2005). However, the height increment between plots were not significant (p>0.05) which might due to the soil contamination (Chibuike and Obiora, 2014).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Plant height increment (with standard errors) of Rhizophora species from June till December 2016.

The total organic carbon (TOC) and total nitrogen (TN) were higher in T3 and T4 compared to T1 and T2 at both soil depth. This is due to the absence of organic deposit which one of the factor that contributes to the organic material content in soil. High organic material will lead to increase in TOC levels in soil and serve as N reservoir (Havlin et al., 2005). Organic matter was also one of the most important properties affecting heavy metal availability in soils for retaining heavy metals in an exchangeable form. In the study site, the mean total heavy metals concentrations in sediments at all treatment plots decreased in the order Mn > Pb > As > Cd > Hg (Table 2).

Table 2: Concentration of heavy metals, TOC and TN ( standard errors) in soil in four treatment plots at Tangjung Piai mangrove forest. Treatment TOC (%) TN (%) As (ppm) Cd (ppm) Hg (ppm) Mn (ppm) Pb (ppm) Soil depth 0 – 10 cm T1 1.870.14b 0.170.00b 5.320.20c 1.820.53a 0.190.02a 212.967.60a 13.890.59bc b b c a a b c T2 4.042.22 0.120.04 3.581.76 0.790.05 0.410.36 103.7113.82 7.961.22 T3 14.920.07a 0.660.01a 18.681.34b 1.470.04a 0.170.05a 59.975.18c 23.541.45a T4 14.891.09a 0.670.05a 13.150.96a 1.400.12a 0.140.11a 77.263.83bc 15.002.01ab Soil depth 10 – 30 cm T1 2.120.08b 0.180.00b 7.070.68a 1.500.06a 0.140.08a 371.643.23a 14.060.50bc T2 5.481.80b 0.130.03b 8.610.78a 0.900.08b 0.130.10a 120.1714.59b 9.951.10c T3 12.670.90a 0.560.03a 13.693.22a 1.390.19a 0.050.10a 63.193.71c 20.151.15a T4 12.142.01a 0.540.07a 15.162.09a 1.290.20ab 0.400.07a 60.427.21c 18.541.50ab

Conclusion

The total mean of height increment for Rhizophora trees showed site with organic deposit recorded a higher increment compared to the site without organic deposit. The present of organic deposit lead to increase in nutrient availability thus enhance the soil fertility. Indirectly, it improved the growth of

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Rhizophora trees at mangrove forest in Tanjung Piai. However, it is recommended that the concentration of heavy metals in the soils be monitored continuously.

References

Chibuike, G. and Obiora, S. 2014. Heavy metal polluted soil: Effect on plants and bioremediation methods. Applied and Environmental Soil Sciences. Volume 2014. Pp.1-12. EPA-ROC, 1994. The Standard Methods for Determination of Heavy Metals in Soils and Plants. National Institute of Environmental Analysis of EPA-ROC, Taipei, Taiwan. FAO. 2005. The importance of soil organic matter: Key to drought-resistant soil and sustained food and production. FAO Soils Bulletin 80. Land and Plant Nutrient Management Service (AGLL), Food and Agriculture Organization of the United Nations (FAO), Rome. Havlin, J.L., Tisdale, S.L., Nelson, W.L. and Beaton, J.D. 2005. Soil Fertility and Fertilizers (7th ed.). Upper Saddle River, N.J.: Pearson Prentice Hall. Huang, G.Y. and Wang, Y.S. 2010. Expression and characterization analysis of type 2 metallothionein from grey mangrove species (Avicennia marina) in response to metal stress. Aquatic Toxicology, 99(1): 86-92. Jamil, A.A. 2016. Related Artikel DBP. Tanjung Piai: End of Asia Continent. Retrieved (10 March 2018) from http;//lamanartikel.dbp.my/p=379. Lovelock, C.E., Ball, M.C., Martin, K.C. and Feller, I.C. 2009. Nutrient enrichment increases mortality of mangroves. PloS one, 4(5), e5600. Mazlina, A.M. 2012. Tanjung Piai mungkin lenyap. Kosmo, July 16, pp. 11. Tripathi, D.K., Singh, V.P., Chauhan, D.K., Prasad, S.M. and Dubey, N.K. 2014. Role of macronutrients in plant growth and acclimation: recent advances and future prospective. Improvement of Crops in the Era of Climatic Changes, pp. 197-216: Springer.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Flower Composition of Black Pepper (Piper nigrum L.) Varieties in Bintulu, Sarawak

Noorasmah, S.*, Nurul A’in, J. and Shiamala, D.R. Department of Crop Science, Faculty of Agricultural and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia. *E-mail: [email protected]

Introduction

Productivity of black pepper is highly dependent on the growth and flowering behavior of the vine (Satheeshan, 2000). Fruit set and flowering in black pepper indicate a number of unique features, not seen in other tropical plantation and spice crops. The critical stages in determining the yield of black pepper occur during flushing and flowering. Hence to exploit the maximum production potential of black pepper, the detailed and deep understanding of growth and flowering pattern is of great importance. Flower composition which is the number of hermaphrodites, male and female flowers in a spike is critical in determining the yield of pepper. High percentage of bisexual flowers is essential for effective pollination and fruit set (Ravindran et al., 2000).

Various cultural practices need to be timed in relation to their critical stages of growth especially during flowering and fruit set in order to achieve high productivity of pepper. Studies done by DeWaard et al. (1969) found that hermaphroditism varied from cultivar to cultivar and determined productivity to a large extent and this character is genetically controlled. A later study by Venugopal et al. (2013) found that the cultivars showed a great variability in the composition of bisexual, female and male flowers in their spikes which would affect the final yield of a vine. Highly packed inflorescences or with larger anther primordial per flower caused the reduction in anther number (Manos and Jaramillo, 2001).

In Piper nigrum stigmas are exerted three to eight days ahead of another dehiscense and receptivity lasts for up to ten days (Kanimazhi and Sujatha, 2015). In spite of differences in sexual expression, it is possible for the pollen of any spike to fertilize the entire spike if properly distributed (Martin and Gregory, 1962). Spike length is another character of importance which controls the pepper production along with increased berry set. Gentry (1955) reported that high fruit set in a dioecious clone of black pepper with no staminate flowers visible resulted in poor fruit set in the absence of staminate flowers (Martin and Gregory, 1962; Menon, 1981).

Therefore, the objectives of this research were to study the morphology of pepper flower in Bintulu and to identify the shading effect on pepper productivity of Kuching, Semongok Aman and Semongok Emas varieties. This was also to identify the composition of flower on the spike of different pepper varieties.

Materials and Methods

The observations of flowers in black pepper (P. nigrum L.) were carried out at the four pepper growing areas around Bintulu, Sarawak. Three black pepper varieties: Kuching, Semongok Aman and Semongok Emas were selected for the study. Nine spikes from each vine were selected randomly to determine the flower composition. All the samples were then soaked in 4% formalin for preservation before the observation of flower composition in the laboratory. The study sites were located in Bintulu: Sg. Asap 1, Sg. Asap 2, Sg. Asap 3 and Samarakan. The selection of vines was based on their height and yielding

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

ability and freedom from pests and diseases. The vines were in the age group of 1 to 5 years old. They were grown under open conditions and were rain fed. The height of the pepper vines varied from 2-5 m.

Observations were made to assess the spike at three different canopy levels, i.e., lower, middle and upper canopy. The spike characters included peduncle and spike length and were measured in at least 27 spikes from 9 vines by using Mitutoya digital calipers and expressed in mm. As for flower composition analysis, three vines were selected randomly for each variety. The number of hermaphrodite, pistillate and staminate flowers and the total number of flowers in spike were observed and recorded using Keyence 3D microscope.

Statistical analysis was carried out using a two-way ANOVA of SAS (Version 9.4) 2010 to test the significant differences existed in spike length, peduncle length and flower composition as among varieties and canopy levels of Kuching, Semongok Aman and Semongok Emas black pepper. This study involved Duncan’s Multiple Range Test (DMRT) for mean comparison (p<0.05).

Results and Discussion

Morphology of spike

The results shown in Figure 1 indicated that there was no significant difference among canopy levels of Kuching, Semongok Aman and Semongok Emas varieties in all studied sites. In this study, the average peduncle length varied between 8.1-11.8 mm, 8.1-11.4 mm and 6.2-11.1 mm in Kuching, Semongok Aman and Semongok Emas variety, respectively. These results of the study support the view of Sasikumar et al. (2007) who reported that peduncle length only varied between species of Piper ranging from 0.2 cm in Piper mullesua to 2.5 cm in Piper argyrophyllum and an unusually long range between 8.0-10.0 cm in Piper barberi.

Spike length is another important character which control pepper production along with the increase of berry set. The spike length was measured and compared in four selected black pepper farms around Bintulu. The observation was made to identify the effect of canopy level within the varieties towards the spike length. The spike lengths of black pepper varieties are presented in Figure 2. The average spike length ranged 69.8-95.4 mm in Kuching variety, 61.2-87.3 mm in Semongok Aman variety and 69.3- 86.3mm in Semongok Emas variety. In this study, spike length was not significantly different among canopy levels of Semongok Aman and Semongok Emas varieties in the four pepper locations. But Kuching variety at Sg. Asap 1 showed significant difference in canopy level and spike length. This implied that light intensity was found to affect spike length of Kuching variety in Sg. Asap 1. This result proved that the varying light intensities of the different canopy levels had significant influence on spike growth (Madhura and Chandini, 2000). Spike length in the upper canopy of Kuching variety at Sg. Asap 1 was significantly less compared to the lower canopy (Figure 2). The increased length obtained under shaded condition may be due to lesser photosynthetically active radiation obtained under the situation (Attridge, 1990). High irradiance results in high rate of transpiration which is likely to result in internal deficiencies of water and a consequent retardation during cell elongation and cell division process. This may be the possible reason for the reduced spike length on the upper part of the canopy. Similar results were reported in black pepper vines done by Senanayake and Kirthisinghe (1983).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

a a . Lower Middle Upper lower Middle Upper 16 100 a a a a a a a 14 b a a a a c a 12 a 80 a a a a a a a a 10 a 60 8 6 40 4

Peduncle length (mm) Pedunclelength 20 2 (mm) Spike length 0 0 Sg.Asap1 Sg.Asap2 Sg.Asap3 Samarakan Sg.Asap1 Sg.Asap2 Sg.Asap3 Samarakan Farm location Farm location b b 16 Lower Middle Upper Lower Middle Upper 100 14 a a a a 90 a a a a a a 12 a a 80 a a a a a a a a a 10 a 70 a 60 a 8 50 6 40 4 30

Spike length (mm) Spike length 20 Peduncle length Peduncle length (mm) 2 10 0 0 Sg.Asap1 Sg.Asap2 Sg.Asap3 Samarakan Sg.Asap1 Sg.Asap2 Sg.Asap3 Samarakan Farm location Farm Location

c Lower Middle Upper c Lower Middle Upper 14 a 100 a a a 12 a a a a a a a a a a 80 a a 10 a a a a a a a 8 a 60 6 40 4

2 (mm) Spike length 20

Peduncle length Peduncle length (mm) 0 0 S.Asap1 S.Asap2 S.Asap3 Samarakan Sg.Asap1 Sg.Asap2 Sg.Asap3 Samarakan Farm location Farm location

Figure 1. Peduncle length of (a) Kuching variety (b) Semongok Figure. 2 Spike length of (a) Kuching variety (b) Semongok Aman variety (c) Semongok Emas variety in different canopy Aman variety (c) Semongok Emas variety in different canopy level at four different location. The bar sharing a common level at four different location. The bar sharing a common letter at same canopy level are not statistically significant letter at same canopy level are not statistically significant between plant material according to DMRT ( p < 0.05), i.e., between plant materials according to DMRT (p<0.05), i.e., a>b a>b (given means + s.e, n=9) (given means + s.e, n=9)

Flower composition

Semongok Emas variety at Sg. Asap 1 had the highest percentage of female flowers (75.5%) followed by Kuching variety with 69.5% of female flowers (Figure 3), whereas, Semongok Aman variety had the lowest female percentage (49.6%) but highest in hermaphrodite flowers (50.2%). Among different varieties at the four locations, the male flowers in a spike varied from 0-9.8% and the proportion of hermaphrodite flowers showed even greater variation 24.7-87.7%. The percentage of hermaphrodite flowers in spike of Kuching, Semongok Aman and Semongok Emas varieties was highest in Sg. Asap 2, Sg. Asap 3 and Samarakan. The percentage of hermaphrodite flowers was in the range of 51.8- 87.7%. The percentage of female flowers in Sg. Asap 2 varied between 38.3-46.6% while in Sg. Asap 3 varied

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

between 21.4-47.9%. Among the three varieties at Samarakan, the percentage of female flowers showed the lowest percentage in the range between 2.5-24.6%.

The present study revealed considerable variability among the genotypes for flower composition in spikes. Among the varieties, variations occurred with regard to the relative proportion of male, female and hermaphrodite flowers in spikes and the composition of flowers in the spike was primarily dependent on the genotype (Venugopal et al., 2013). The percentage of hermaphrodite flowers was in the range of 30.0- 67.4% in Kuching, 50.0-87.7% in Semongok Aman and 49.0-87.0% in Semongok Emas. However, among the varieties, the male flowers in a spike varied from 0-9.8% while the female flowers among the varieties varied from 2.0-90.9%. In the present study hermaphrodite to female phase was noticed in all three varieties studied. However shift towards female phase was drastic in Semongok Aman and Kuching at Sg. Asap 1. This result supports the view of Geetha and Nair (1989) that the proportion of female flowers would increase with increasing intensity of shade. The study agrees with the suggestion of Devasahayam (2006) that the pepper vines need to be exposed to sunlight to induce higher proportion of hermaphrodite flowers instead of having female flowers. This is because high percentage of hermaphrodite flowers is very important for pollination and good fruit set (Ravindran et al., 2000). The present study has provided valuable information for crop production and scientific management in black pepper. Thus, it enables us to reorient crop production technology through manipulation of the limiting factors, both internal and external, to bring forth maximum flowering and fruit set.

a b

120 Female Hermaphrodite Male 100 Female Hermaphrodite Male 100 a a a 80 80 a 60 a a a 60 a a b b 40 40 b 20 20 c b c Flower Flower composition (%) Flower Flower composition (%) b b b 0 0 Kuching Semongok Semongok Emas Kuching Semongok Aman Semongok Emas Aman Variety Variety

c d Female Hermaphrodite Male 100 Female Hermaphrodite Male 100 a a 80 a 80 a ab a 60 a 60 a a 40 40 b 20 20 b b b b Flower Flower composition (%) b b b b Flower Flower composition (%) 0 0 Kuching Semongok Aman Semongok Emas Kuching Semongok Aman Semongok Emas Variety Variety

Figure 3 Flower composition of Kuching variety, Semongok Aman variety and Semongok Emas variety at four different locations (a) Sg.Asap 1 (b) Sg. Asap 2 (c) Sg. Asap 3 (d) Samarakan. The bars sharing a common letter are not statistically significant between plant materials according to DMRT (p<0.05), i.e., a>b>c (given means + s.e, n=9)

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Light intensity as represented in the different canopy levels of the vines appears to be conversely related to production of black pepper. The canopy levels did not significantly affect the peduncle and spike length the black pepper varieties. Phenology studies of pepper in relation to pollination success can be further carried out to identify whether temporal partitioning of the pollinator community in both Piper varieties and between the understory and canopy can be useful in maintaining productivity of many varieties at individual sites.

Acknowledgments

The authors wish to acknowledge the Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, Malaysia for technical support and the laboratory facilities provided. This research was funded by the Universiti Putra Malaysia under Skim Geran Penyelidikan Putra Berkumpulan (IPB) entitled “Sarawak Pepper Farm @ UPM Bintulu”.

References

Attridge, T. 1990. Light and plant response: A study of plant Photophysiology and the Natural Environment. Great Britain: Education Edward Arnold, London. Chandy, K.C., Potty. N.N. and Kannan, K. 1984. Parameters for varietal classification of pepper (Piper nigrum L.). Indian Spices Journal 21(1): 17-22. Devasahayam, S., Anandaraj, M., Thankamani, C.K., Saji, K.V. and Jayashree, E. 2006. Black pepper. In: Major Spices-Production and Processing, Indian Institute of Spices Research, Calicut. Pp.15-61. DeWaard, P.W.F. 1969. Foliar diagnosis, nutrition and yield stability of black pepper (Piper nigrum L.) in Sarawak. Ph.D. Thesis, Royal Tropical Institute, Amsterdam, Netherland. Geetha, C.K. and Nair, P.C.S. 1989. Studies on spke shedding in black pepper (Panniyur- 1). South Indian Horticulture 37: 282-286. Gentry, H.S. 1955. Apoximis in black pepper and Jojoba. Journal of Heridity 46: 8-13. Gowda, C.M., Narayanareddy, M.A., Sivanandan, V.M. and Shankaranarayana, V. 1986. Studies on the flower bud development, anthesis and anther dehiscence in cashew (Anacardium occidentale L.) selections. Journal of Plantation Crops 3(1): 3-5. Hallad, J. 1991. Studies on growth and productivity of cashew nut (Anacardium occidentale L.) cultivars, M.Sc. Thesis, University of Agricultural Science, Dharward. Krishnamurthy, K.S., Kandiannan, K., Sibin, C., Chempakam, B. and Ankegowda, S.J. 2010. Trends in climate and productivity and relationship between climatic variables and productivity in black pepper (Piper nigrum). Indian Journal Agricultural Science 81: 729-733. Madhura, D. and Chandini, S. 2000. Flowering, dry matter production and nutrient uptake in bush pepper as influenced by light and nutrients. Journal of Plantation Crops 28: 99-104. Manos, P.S. and Jaramillo, M.A. 2001. Phylogeny and patterns of floral diversity in the genus Piper (Piperaceae), American Journal of Botany 88(4): 706-716. Martin, F.W. and Gregory, L.E. 1962. Mode of pollination and factors affecting fruit set in P. nigrum L. in Puerto Rico. Journal of Crop Science 2: 295-299. Menon, R. 1981. Growth, flowering, floral biology and spike shedding in pepper (Piper nigrum L.). M.Sc. Thesis, Kerala Agricultural University, Vellanikkara, Pp. 96-101. Menon, R. and Nair, P.E.S. 1989. Growth and flowering in pepper variety Panniyur-1. Indian Cocoa. Arecanut and Spices Journal 12(3): 82-83. Nalini, P.V. 1983. Flower bud differentiation in pepper (Piper nigrum L.). M.Sc. Thesis, Kerala Agricultural University, Vellanikkara.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ravindran, P.N., Nirmal Babu, K., Sasikumar, B. and Krishnamoorthy, K.S. 2000. Botany and crop improvement of blackpepper, In: Ravindran, P.N. (Ed.), Black pepper. Pp. 22-142. Sasikumar, B., Saji, K.V. and Johnson, G.K. 2007. Spike proliferation in black pepper (Piper nigrum L.). Journal of Fruits 62: 325-328. Satheeshan, K. 2000. Physiological and Biochemical aspect of flowering, berry set and development in black pepper. Ph.D. Thesis, University of Kerala, India. Senanayanke, Y.D.A. and Kirthisinghe, J.P. 1983. Effect of shade and irrigation on black pepper (Piper nigrum L.) cutting. Journal of Plantation Crop 11: 105-108. Venugopal, M.N., Prasath, D., Ankegowda, S.J. and Anandaraj, M. 2013. Role of weather parameters and genotypes on flower composition of black pepper in India, Focus on Pepper (Piper nigrum L.). Journal of the Pepper Industry 5: 1-10.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A Propagation Technique of Scindapsus pictus and Piper porphyrophyllum as a New Native Functional Plant for Indoor Landscape

Masnira, M.Y.*, Mohad Hoszaini, R., Mohd Yusmizan, A.M., Zulhazmi, S. and Hanim, A. Horticulture Research Centre, MARDI Headquaters, Serdang, P.O Box 12301, 50774 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Foliage potted plants which consist of various species of beautiful leafy ornamentals have been identified as suitable for usage as interior decoration. Most of these species have attractive shapes and colours and also can survive in the indoor environment. These indoor ornamental plants can improve the aesthetical value and air quality of the surrounding (Hanim et al., 2014). Indoor ornamental plants not only can absorb toxic gases such as formaldehyde and benzene but indirectly can also increase worker's productivity. These types of plants are normally used to decorate space in the building, office or dwelling house. Malaysian Agricultural Research and Development Institute (MARDI) has identified two potential ornamental plants for indoor landscape, which are Scindapsus pictus and Piper porphyropyllum. Both of these potential indoor plants are unique, and they are also native species with an exotic look.

Scindapsus pictus, or its common name Kelampang batik, is native plant that derives from Peninsular Malaysia, Bangladesh, Thailand, Borneo, Jawa, Sumatera, Sulawesi and Philippines. Leaves are oval and entire at young stage of the plants whereas on mature plants, the leaves are pinnately lobed (Figure 1). They are matte green colour and covered in silver blotches.

B C D

Figure 1: Piper porphyropyllum plant (A), single node leafy cutting (B), stem cutting (C) and leaf cutting (D).

Piper porphyrophyllum from the family of Piperaceae, on the other hand, is locally known as Lada hutan, Sire harimau, Kerakap rimau and Akar bugu. It has not only beautiful leaf features with strip pink as shown in Figure 2 but they were also reported to contain seven flavonoid compounds identified as 5- hydroxy-7-methoxyflavanone, 5,7-dimethoxyflavone, 40,5,7-trimethoxyflavone, 30,40,5,7- tetramethoxyflavone, 40-hydroxy-30,5,7-trimethoxyflavone, 5-hydroxy-30,40,7-trimethoxyflavone and 40,5-dihydroxy-30,7-dimethoxyflavone (Rajudin et al., 2010). These phythochemical compounds showed

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

the antimicrobial and anti-inflammatory activities of the extracts and isolated compounds (Farediah et al., 2014).

Scindapsus pictus and P. porphyrophyllum have unique attributes of being capable to absorb volatile organic compounds. However, the related agronomic practices on this plant were limited, especially on the propagation technique. Therefore, this experiment was conducted to identify the most suitable part of stem cutting and growing media for optimum growth of S. pictus and P. porphyrophyllum.

F G H

Figure 2: Scindapsus pictus plant (E), single node leafy cutting (F), stem cutting (G) and leaf cutting (H).

Materials and Methods

The experiments, each with a plant species, were carried out under 50% shaded condition at Flower and Orchid Complex, MARDI. The treatments were laid out using a Randomized Complete Block Design and replicated three times. There were four media (M1: Vermiculate: Perlite (1:1), M2: Vermiculate, M3: Vermiculate: Perlite: Top soil (1:1:2), M4: Peat moss: Vermiculite: Perlite (1:1:1)) and three types of cutting (K1: Leaf, K2: Stem and K3: Single Node leafy) studied. Data obtained during the experiment included number of shoots, days to root appearance, days to shoot appearance and shoot length. Irrigation was applied manually twice a day. Data on the effects of media and type of cutting were analyzed by analysis of variance (ANOVA) using SAS software version 9.4. Mean comparisons were carried out using LSD when applicable.

Results and Discussion

For each experiment on S. pictus and P. porphyrophyllum, respectively, there was no significant interaction between media and type of cutting on the growth of the plants. In each experiment, type of media also gave no significant effect on the plant growth. The type of cutting used, however, significantly affected the plant regeneration and development.

Most suitable cutting for S. pictus was K2 and K3. This was based on the higher number of shoots (K2: 2 and K3: 2), lower number of days to root appearance (K2: 14 and K3: 9), lower number of days to shoot appearance (K2: 29 and K3: 23) and higher shoot length (K2: 2.9 cm and K3: 3.1 cm) shown by this type of cutting. K1 or leaf cutting was not suitable for propagating S. pictus as the leaves became dry after one week (Table 1).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Growth performance of Scindapsus pictus. Type of cutting Number of days Number of days Shoot number Root number Shoot length to shoot to root (cm) appearance appearance Leaf (K1) 0b 0b 0b 0b 0b Stem (K2) 29a 14a 2a 3a 2.9ª Single node leafy (K3) 23a 9a 2a 4a 3.1a Means with the same letter were not significantly different among type of cutting (p<0.05) using LSD.

For P. porphyrophyllum, the most suitable cutting was K3. This was based on higher number of shoots (K3: 2), higher number of roots (K3: 3), lower number of days to root appearance (K3:24), lower number of days to shoot appearance (K3: 25) and higher shoot length (5.2 cm) achieved with this type of cutting. Stem without leaf (K2) was not suitable as a propagation material for this species as the stem turned dry after three days (Table 2).

Table 2: Growth performance of P. porphyrophyllum. Type of Cutting Number of days Number of days Shoot number Root number Shoot length to shoot to root (cm) appearance appearance Leaf (K1) 30a 26a 1b 2a 5.24a Stem (K2) 0b 0b 0b 0b 0b Single node leafy (K3) 25b 24b 2a 3a 5.1a Means with the same letter were not significantly different among type of cutting (p<0.05) using LSD.

Conclusion

Scindapsus pictus can be easily propagated by using single node leafy or stem cutting while P. porphyrophyllum can be done so using single node leafy cutting.

References

Farediah, A., Emrizal, Hasnah, M.S., Fadzureena, J., Nik Musa’adah, M., Rasadah, A., Dayar, A. and Hassan, Y.A. 2014. Antimicrobial and anti-inflammatory activities of Piper porphyrophyllum (Fam. Piperaceae). Arabian Journal of Chemistry 7(6): 1031-1033. Hanim, A., Nazera, A. and Rosniza, K. 2014. Tanaman pasu dedaun untuk hiasan dalaman (Potted foliage plants for interior decoration). Buletin Teknologi MARDI Bilangan 5: 33-37. Rajudin, E., Ahmad, F., Sirat, H.M., Arbain, D. and Aboul-Enein, H.Y. 2010. Chemical constituents from tiger’s betel, Piper porphyrophyllum N.E.Br. (Fam. Piperaceae). Natural Products Research 24: 387-390.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A Preliminary Study on the Effects of Reproductive Growth and Fruit Quality of Mango var. Harumanis from Different Interstock

Muhamad Hafiz, M.H.*, Wan Mahfuzah, W.I. and Ahmad Mahdzir, A. Fruits Department, Horticulture Research Centre, MARDI Sintok, 06050 Bukit Kayu Hitam, Kedah, Malaysia. *E-mail: [email protected]

Introduction

Nowadays, in 11th Malaysia Rolling Plan, fruit production was listed from the government and ministry as one of the most potential industries that need to be developed for our country. Specifically, our National Key Economy Area (NKEA), has targeted to produce 570,000 tonnes in 2020, with 94.7% dominated by tropical fruits. Therefore, some of the initiatives by implementation of Entry Point Project (EPP7) has been made, where fruits and vegetables were targeted to penetrate the premium market such as in Europe and Middle East (Hanis et al., 2015). Mango, specifically as Harumanis is one of the most important tropical fruits in Malaysia and was chosen in this planning, the acreage of the Harumanis plantation and also the production needs to be increased. Harumanis was registered as MA128 from Department of Agriculture Malaysia and it is most the famous variety and widely cultivated in northern region of Malaysia such as Perlis and Kedah states (Hafiz et al., 2016). In fact, it was creating a great demand since a decade ago and it was already commercially exported to Japan. However, the production of the high quality of fruits is still limited due to the great demand from that country. In order to increase and sustain the production of high yield and better quality of Harumanis, there were a few aspects of research area need to be developed like rootstock and interstock scion interaction with the objective to improve the growth, yield and fruit quality of Harumanis. Application of rootstock and interstock to raise a planting material is already commercially applied by the nursery producer and propagator. However, there is limited information on the effect to the scion interaction in Harumanis mango. The other reason to use the specific rootstock or interstock in grafting is for inducing dwarfness. Some of the incompatibility effect between rootstock and scion can be solved by using suitable interstock which the interstock can be act as a bridge between a desirable rootstock and scion by being compatible with both and without a decrease in yield. However, it must be taken into account that the different genetic materials used as unit, it would also generate an interaction that would affect the reproductive behavior and the yield and quality of the fruit (Fanor and Jose, 2009). It was proven in lemon trees where the application of rootstock and interstock would affect the plant growth, tree performance, fruit yield and quality, salinity tolerance, disease tolerance and scion compatibility whether it was grown at any climates and types of soil (Bilge et al., 2015). A similar result was found in mango where, the use of Hilacha and Arauca mango variety has influenced the fruit quality of scion as used Irwin, Tommy Atkin and Davis Haden (Fanor and Jose, 2009). Therefore, the objective of this project was to evaluate the effect of different interstock used to the reproductive growth, yield and quality of fruit, and on the parameters used to determine the Harumanis mango variety.

Materials and Methods

The experiment was conducted in mango farm located at MARDI Sintok, Kedah at mango fruit season from May to June 2017. The variety was observed in this study as Harumanis. The area of the experimental site is about 0.49 hectare with the planting distance used as 8 metre x 8 metre. There are 52 of Harumanis trees which 25 years old were planted in 1993 with used of different interstock mangoes as a treatment. The development of the planting material started by germinating the mango var. Telur as a

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

rootstock at the nursery. Then, there were 7 mango varieties selected and the scion was grafted to the rootstock using top cleft grafting technique. After 5 months old, the plant was regrafted using the Harumanis mango variety using a uniform scion. Hence, the Harumanis seedling which comprises of different interstock was produced and planted into the ground after 5 months old. All trees were managed using proper and standard agronomic practices including fertilization, flower induction, pruning, thining, and pest and disease control.

There were 7 interstock treatments used, while mango var. Telur was selected as control in this study. Every treatment consisted 6 replications which were selected in terms of frequent uniformity of trunk size and canopy structure. All treaed trees were arranged in a Completely Randomized Design (CRD). The treatments (Interstock variety) used were as follows:

T0 - Harumanis with Telur as interstock (control) T1 - Harumanis with Epal Ramasamy as interstock T2 - Harumanis with Malgoa as interstock T3 - Harumanis with Kuini as interstock T4 - Harumanis with Chok Anan as interstock T5 - Harumanis with Epal Rumania as interstock T6 - Harumanis with Epal Tanjung Karang as interstock

The data was analysed using ANOVA (SAS 9.3 TS Level 1M1). Differences within the means were compared by using a Duncan’s Multiple Range Test at 5% probability level.

Several of parameters were taken which classified as reproductive growth, yield and fruit quality assessment. The parameters taken for reproductive growth were consisted as ratio of inflorescence with shoot number and ratio of fruit with flower number. It was done after the fruits was wrapped or 42-45 days after fruit setting. In terms of fruit quality assessment, there were several parameters taken including colour analysis, total soluble solid (TSS), total titratable acidity and ratio of total soluble solid with total titratable acidity. The ratio of TSS to the TTA was measured and calculated using the following formula:-

Total Soluble Solid (TSS)

Total Titratable acidity (TTA)

The sample was harvested by using standard harvesting time which was done after 13 weeks of fruit set. The fruits were ripened using calcium carbide in the close box for 3 days before the data was taken at laboratory.

Results and Discussion

Reproductive growth

In terms of reproductive growth measurements, there are two parameters were taken as ratio of infloresence to shoot number and ratio of fruit number to flower number which reflected to the Harumanis plant as a scion. The inflorescence ratio to shoot number of Harumanis from Figure 1 indicated that, the used of T2 (0.51) has produced the highest and significantly difference amongst the treatment as Control (0.08), T1 (0.17), T3 (0.11), T4 (0.10), T5 (0.14), T6 (0.05). It shows the performance and the ability of the plant to produce flowers by using that interstock, gives the higher interaction in term of inflorescence ratio. Moreover, the ratio of fruit number to flower numbers of Harumanis in Figure 2 was indicated that,

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

all the treatments are not significantly difference. This result indicates that there is no interaction occurred between the interstocks and the bearing fruit of Harumanis. There were similar studies found by the research conducted in apple trees where, the use of the heavy bearing apple trees resulted had no significant effect to the fruit bearing of inflorescence (Claudio et al., 2008).

0.6 0.51a 0.5 0.4 0.3 0.17b 0.2 0.14b 0.11b 0.10b 0.08b 0.05b

shoot number number shoot 0.1 0

Ratio of inflorescence inflorescence to Ratio of T1 - Telur T2 - E. T3 - Malgoa T4 - Kuini T5 – Chok T6 - E. T7 - E. Tg. Ramasamy Anan Rumania Karang Interstock

Figure 1: Effect of different interstock on ratio of inflorescence to shoot numbers of Harumanis at MARDI Sintok in mango fruit season 2017. Means with the different number in the same fruit weight range percentage is significantly difference at p<0.05 according to Duncan’s Multiple Range Test (DMRT).

2 1.68a 1.55a 1.62a 1.5 1.21a 1.13a 1.08a 1 0.84a

0.5

to flower numbers flower to 0 Ratio of fruit numbers fruit numbers of Ratio T1 - Telur T2 - E. T3 - Malgoa T4 - Kuini T5 – Chok T6 - E. T7 - E. Tg. Ramasamy Anan Rumania Karang Interstock

Figure 2: Effect of different interstock on ratio of fruit number to flower numbers of Harumanis at MARDI Sintok in mango fruit season 2017. Means with the different number in the same fruit weight range percentage is significantly difference at p<0.05 according to Duncan’s Multiple Range Test (DMRT).

Fruit quality

Fruit quality assessment has divided into two main sub-parameters as colour analysis and chemical analysis. In terms of fruit colour assessment from Table 1, T4 (211.19) gives the highest value and significantly difference compare to T5 (167.68) for parameters taken as skin hue. The trend was also same with skin chroma which T4 (44.68). However, for the flesh colour analysis as flesh hue and chroma, there is no significantly difference recorded. The result was indicated that, the qualitative characteristic like colour can be transmited into the scion by using the selected interstock (Figure 3). In this case, Chok Anan mango is one of the mango varieties which produce the yellow colour during ripening thus, the result of the skin and chroma colour of Harumanis was turned to yellowish. Furthermore, fruit quality assessment

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

as total soluble solid in Table 2 shows the interaction which Control, T4 and T6 are not significantly difference but these 3 treatments was significantly difference compare to T1, T2, T3, and T5. In total titratable acidity parameter, Control (1.17), T1 (0.96), T3 (1.21), T4 (1.01), T6 (1.26) was recorded not statistical difference among the treatment but the T6 are significantly difference compare to T2 (0.85) and T5 (0.85). In terms of ratio between total soluble solid and total titratable acidity parameter from Table 2, T2 (19.06) and T5 (19.56) are not statistical difference but it was significantly difference compare with other treatments. According to this parameter, it was referred to the actual quality and balanced of soluble solid concentration and acidity level which the highest value would represent the good quality of fruit. According to the present study, the use of Hilacha mango as rootsrock gives the better ratio of TSS to TTA of Davis Haden mango, and it presented the better quality compare with the common rootstock as Arauca mango (Fanor and Jose, 2009).

Table 1: Effect of different interstock on fruit colour analysis of Harumanis at MARDI Sintok in mango fruit season 2017. Fruit colour analysis Interstock Skin hue Skin chroma Flesh hue Flesh chroma Control –Harumanis/ Telur 153.2bc 41.97ab 261.51a 66.16a T1 –Harumanis/ Epal Ramasamy 153.12bc 41.06ab 260.86a 63.29a T2 –Harumanis/ Malgoa 132.85c 37.41b 262.65a 64.9a T3 –Harumanis/ Kuini 133.06c 39.42ab 260.05a 64.73a T4 –Harumanis/ Chok Anan 211.19a 44.68a 260.37a 63.99a T5 –Harumanis/ Epal Rumania 167.68b 38.72ab 259.72a 64.21a T6 –Harumanis/ Epal Tanjung Karang 159.99bc 40.34ab 260.39a 64.67a Treatments with the same letter(s) do not differ significantly (P≤0.05) according to the Duncan’s Multiple Range Test.

Table 2: Effect of different interstock on fruit quality assessment of Harumanis at MARDI Sintok in mango fruit season 2017. Total soluble solid Total titratable acidity Ratio TSS/TTA Treatments (Interstock) (TSS) (TTA) Control –Harumanis/ Telur 18.27a 1.17ab 15.62bc T1 –Harumanis/ Epal Ramasamy 16.02c 0.96ab 16.69b T2 –Harumanis/ Malgoa 16.20bc 0.85b 19.06a T3 –Harumanis/ Kuini 16.73b 1.21ab 13.83c T4 –Harumanis/ Chok Anan 18.03a 1.01ab 17.85b T5 –Harumanis/ Epal Rumania 16.63b 0.85b 19.56a T6 –Harumanis/ Epal Tanjung Karang 17.75a 1.26a 14.09c Treatments with the same letter(s) do not differ significantly (P≤0.05) according to the Duncan’s Multiple Range Test.

1a 1b 1c Figure 3: The appearance of Harumanis fruit from different interstock during fruit quality assessment as Control (1a), T1 (1b) and T4 (1c).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

The use of selected rootstock or interstock is one of the solutions to improve the reproductive growth and quality of Harumanis fruit. However, it is not totally can influence the character in terms of reproductive growth or fruit quality assessment. According to the result, it shows that, the use of different variety of interstock can influence the ratio of inflorescence to shoot number which represented the more developed flower. Malgoa interstock shows the effect to the inflorescence level of Harumanis which is heavy flowering. Moreover, the usage of interstock also can influence the skin colour of the Harumanis. It is proven by using Chok Anan mango as an interstock. Furthermore, the fruit quality assessment for Harumanis was also affected by using other interstock to improve the TSS value as use Chok Anan and Epal Tanjung Karang mango as interstock instead of Telur. In terms of quality and balanced of soluble solid and acidity ratio, the use of Malgoa and Epal Rumania mango as an interstock could be chosen as an interstock because it can increase the ratio of TSS to TTA which resulting the better taste of Harumanis mango. The research will be further evaluated in the following fruiting season.

Acknowledgements

The authors are grateful to the Malaysian Agricultural Research and Development Institute (MARDI) and Dr. Razali Mustaffa for the permission to publish this proceeding. Furthermore, the authors are very grateful to Mrs. Nor Dalila Nor Danial for her supervision in preparing this proceeding.

References

Bilge, Y., Muge, U.K., Berken, C., Meral, I., Turgut, Y. and Onder, T. 2015. Effect of different interstock lengths on the yield, fruit quality and tree size of Kutdiken Lemon trees in Turkey. Journal of Global Agriculture and Ecology 3(2): 91-96. Claudio, D.V., Chiara, C., Marina, B. and Francesco, L. 2008. Effect of interstock (M.9 and M.27) on vegetative growth and yield of apple trees (cv “Annurca”). Scientia Horticulturae 119(3):270- 274. doi 10.1016/j.scienta. 2008.08.019. Fanor, C.P. and Jose, A.G. 2009. Effect of rootstock and intermediate graft on fruit quality in mango (Mangifera indica L.). Colombian Journal of Plant Science 3(7): 188-193. Muhamad Hafiz, M.H., Hartinee, A., Nor Dalila, N.D., Mohd Asrul, S., Mohd Ridzuan, D., Ahmad Mahdzir, A. and Ros Shahidan, A.A. 2016. Transactions of the Malaysian Society of Plant Physiology 23(1): 84-88. Nor Hanis, A.Y. and Suhanna, A. 2015. Effect of Trichoderma on postharvest quality of Harumanis mango. Journal of Tropical Agriculture and Fundamental Science 43(1): 21-28.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effect of N-P-K Fertilizer, Biochar and Compost on the Growth of Citrus hystrix

Syafiqah Nabilah, S.B.*, Farah Fazwa, M.A., Norhayati, S., Jeyanny, V., Mohd Zaki, A., Mohd Asri, L. and Samsuri, T.H. Plant Improvement Program, Forestry Biotechnology Division, Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Citrus hystrix, commonly known as kaffir lime or limau purut is belongs to the family of Rutaceae. This citrus plant is native to Malaysia, Thailand, South East Asia, India and Southern China (Jamilah et al., 2011). It has aromatic leaves and fruits that usually used in Asian cuisine and traditional preparation. The oil from leaves and fruits are used in perfumery and massage oil. Chemical studies have shown that the fruit contains various phytoconstituents that possess antibacterial, antifungal, anticancer, chemopreventive, antioxidant, anticholinesterase, cardio and hepatoprotective effects (Abirami et al., 2014).

In Malaysia, C. hystrix is normally grown in backyard by the locals and there are also some commercial plantations can be found in various parts of the country. According to Yahya et al. (2005), this species is very adaptable and can be cultivated on various soil types, performing well in open area with full sunlight. The leaves can be harvested after 3-5 years of planting. Based on the financial assessment conducted by Farah Fazwa et al. (2007), C. hystrix is a profitable venture with high internal rate of return (15.2%), positive net present value (RM12, 900) and benefit cost ratio (1:1).

Due to the great economic potential of this species, Forest Research Institute Malaysia (FRIM) has come out with several high yielding clones of C. hystrix and establishment of the germplasm. The selection of clones was done based on the quality and quantity of the essential oil produced from the leaves. The selected clones may produce up to 6.5% of essential oil as compared to that of the unselected clones with only 4.0% in one kilogram of fresh leaves. Leaves production per plant is also important as bulk number of leaves is required for sufficient supply of the essential oil to the industry. Suitable fertilizer should be applied to boost the growth of C. hystrix. Therefore, this study was undertaken to investigate the effects of different fertilizer treatments consisting of N, P, K sources, leaf compost and biochar on the growth performance of C. hystrix.

Materials and Methods

Planting materials, experimental site and treatments

The study was conducted at the FRIM’s research station (SPF) at Mata Ayer, Perlis. A total of 300 one- year old C. hystrix plantlets were planted on April 2017 in a 0.27 ha plot at the SPF. Five treatments of organic and inorganic fertilizers were prepared as below:

Treatment 1: NPK Green fertilizer (15% N: 15% P: 15% K) [50 g] Treatment 2: Controlled-release fertilizer (10% N: 6% P: 20% K: 2% Mg + 5% micronutrients) [50 g] Treatment 3: Controlled-release fertilizer (10% N: 6% P: 20% K: 2% Mg + 5% micronutrients) [50 g] + biochar [2.5 kg]

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Treatment 4: Controlled-release fertilizer (10% N: 6% P: 20% K: 2% Mg + 5% micronutrients) [50 g] + leaf compost [2.5 kg] Treatment 5: Controlled-release fertilizer (10% N: 6% P: 20% K: 2% Mg + 5% micronutrients) [50 g] + biochar [2.5 kg] + leaf compost [2.5 kg]

The rate and type of fertilizers selected were according to FRIM standard nursery practices. The plants were fertilized twice per year. The size of planting holes prepared for each plant was 0.3 m x 0.3 m x 0.3 m and the planting distance is 3 m x 3 m. The experimental design used was Randomized Complete Block Design (RCBD) with three replicates (Figure 1). Each treatment consists of 20 plants per replicate.

Figure 1: Experimental design used in the study.

Measurement of vegetative growth

The data was collected from April 2017 to April 2020. Data presented in this report represent the growth performance of C. hystrix one year after planting (April 2017-April 2018). The measurement of plant height, collar diameter and crown diameter were taken every three months. The plant height (cm) was measured from the stem base to the top of the main plant stem using a high stick. The collar diameter (mm) was taken at 1 cm height from the ground surface using a vernier caliper. Crown diameter (cm) was measured using cross-method (Blozan, 2008). The crown diameter is the average of the lengths of the longest spread from edge to edge across the crown and the longest spread perpendicular to the first cross- section through the central mass of the crown.

Statistical analysis

All data were subjected to ANOVA by using statistical analysis system (IBM SPSS Statistics version 22), and Duncan post-hoc multiple comparisons was used to differentiate the means (P<0.05).

Results and Discussion

Effects of different fertilizer on plant height

The effects of five different fertilizers on plant height of C. hystrix are presented in Figure 2. There was a statistically significant difference (p<0.05) on plant height of C. hystrix with the fertilizer treatments at 12

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

months of planting. The plant height increased by 81% in T4 and 45% in T1 after one year of planting. While, T3 showed the lowest plant height increment of 27%.

40.0 a a 35.0 a ab ab ab a a a a a 30.0 a a b a a a 25.0 a a a Month 3 20.0 Month 6 15.0 Month 9 Plant height (cm) height Plant 10.0 Month 12 5.0

0.0 1 2 3 4 5 Treatment

Values followed by the same letter(s) above the bars are not significantly different by Duncan Multiple Range Test (p≤0.05); error bars represent standard errors.

Figure 2: Effects of different fertilizers on plant height in C. hystrix

Effects of different fertilizer treatments on collar diameter

The effects of five different fertilizers on collar diameter of C. hystrix are presented in Figure 3. The statistical analysis revealed significant difference (p<0.05) of the collar diameter at month 12. T4 recorded the highest increment for collar diameter at 16.9% followed by T2 at 16.7%. T3 had the lowest collar diameter with 13.8% increment after one year of planting.

Effects of different fertilizer treatments on crown diameter

The effects of five different fertilizers on crown diameter of C. hystrix are presented in Figure 4. The statistical analysis revealed no significant difference (p<0.05) between the treatment in terms of crown diameter at each month of observation. The results showed there were larger increments of crown diameter showed from month 9 to month 12 in all fertilizer treatments and the highest increment was recorded in T4 at 111%.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

8.0 a 7.0 a a a a a ab b a a 6.0 a a a a a a a a 5.0 a a Month 3 4.0 Month 6 3.0 Month 9

Collar diameter (mm) (mm) diameter Collar 2.0 Month 12

1.0

0.0 1 2 3 4 5 Treatment

Values followed by the same letter(s) above the bars are not significantly different by Duncan Multiple Range Test (p≤0.05); error bars represent standard errors.

Figure 3: Effects of different fertilizers on collar diameter in C. hystrix.

40.0 a a a a a 35.0 a 30.0 a a a a a 25.0 a a a a a a a a Month 3 20.0 a a a Month 6

15.0 Month 9

(cm) diameter Crown 10.0 Month 12 5.0

0.0 1 2 3 4 5

Treatment

Values followed by the same letter(s) above the bars are not significantly different by Duncan Multiple Range Test (p≤0.05); error bars represent standard errors.

Figure 4: Effects of different fertilizers on crown diameter in C. hystrix.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Fertilization is a common practice in agriculture and plantation to increase yield. The combined effects of organic and inorganic fertilizer gave advantages in improving the overall growth and nutrient content of plants (Chen, 2006). The combination of leaf compost with controlled-release fertilizer improved the physical growth of C. hystrix in this study. Improved plant growth in controlled-release fertilizer + compost treatment has also been reported in L. pumila (Norhayati et al., 2017) and Zea mays L. (Rasheed et al., 2010).

The application of inorganic fertilizer alone either NPK green or controlled-release fertilizer showed no significant difference on plant growth, though the N, P, or K ratio was different. However, the controlled- release fertilizer has recorded higher percentage of plant height and collar diameter by 56% and 16.7%, respectively. The addition of 2% Mg and 5% micronutrient in controlled-release fertilizer probably help the plant to grow better.

In contrast, the addition of biochar with controlled-release fertilizer showed poor response to the C. hystrix growth. It is known that biochar is an organic amendment sources which can improve soil quality (Khasifah, 2018) but it response differently in this study and the correlation is still unknown. However, the combination of biochar with chemical fertilizer worked well in other food crop such as pepper and tomato (Graber et al., 2010; Cole et al., 2016).

Conclusion

The combination of controlled-release fertilizer with leaf compost positively increased the growth of C. hystrix rather than the application of inorganic fertilizer alone. Therefore, T4 is recommended to be used in the nursery or plantation of C. hystrix to increase the seedlings growth. Further analysis should be conducted to study the significant effect of these fertilizers on the yield of essential oil and the present of bioactive compound.

References

Abirami, A., Nagarani, G. and Siddhuraju, P. 2014. The medicinal and nutritional role of underutilized citrus fruit-Citrus hystrix (Kaffir Lime): A Review. Drug Invention Today 6(1): 1-5. Blozan, W. 2008. The Tree Measuring Guidelines of the Eastern Native Tree Society.http://www.nativetreesociety.org/measure/Tree_Measuring_Guidelines revised1.pdf. Retrieved on 31 July 2018. Chen, J.H. 2006. The combined use of chemical and organic fertilizers and/or biofertilizer for crop growth and soil fertility. In International Workshop on Sustained Management of the Soil- Rhizosphere System for Efficient Crop Production and Fertilizer Use (Volume 16, p. 20). Land Development Department Bangkok, Thailand. Cole, J.C., Smith, M.W., Penn, C.J., Cheary, B.S. and Conaghan, K.J. 2016. Nitrogen, phosphorus, calcium, and magnesium applied individually or as a slow release or controlled release fertilizer increase growth and yield and affect macronutrient and micronutrient concentration and content of field-grown tomato plants. Scientia Horticulturae 211: 420-430. Farah Fazwa, M.A., Ismail, H., Mohd Noor, M., Ab Rasip, A.G. and Mohd Lokmal, N. 2007. Financial assessment of Citrus hystrix (limau purut) grown on plantation scale: A preliminary analysis. The Planter, Kuala Lumpur 83(980): 719-724. Graber, E.R., Harel, Y.M., Kolton, M., Cytryn, E., Silber, A., David, D.R., Tsechansky, L., Borenshtein, M. and Elad, Y. 2010. Biochar impact on development and productivity of pepper and tomato grown in fertigated soilless media. Plant and Soil 337(1-2): 481-496.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Jamilah, B., Abdulkadir, G. and Suhaila, M. 2011. Phenolics in Citrus hystrix leaves obtained using supercritical carbon dioxide extraction. International Food Research Journal 18(3): 941-948. Khasifah, M. 2018. The effect of biochars application on agricultural soil properties in Cameron Highlands. In Proceedings of the 10th International Symposium on Plant-Soil Interactions at Low pH. Palm Garden Hotel IOI Resort Putrajaya, Malaysia. Norhayati, S., Fazwa, F., Jeyanny, V., Syafiqah Nabilah, S.B., Siti Suhaila, A.R. and Syaliny, G. 2017. Effects of soil amendments on the growth and total phenolic content in Labisia pumila var. alata at nursery stage. International Journal of Agriculture Innovations and Research 6(2): 370-373. Rasheed, M.A., Youssef, R.A., Gaber, E.S.I., Abd El Kader, A.A., da Silva, J.A.T. and Abou-Baker, N.H. 2010. The combined effect of organic and chemical fertilizers under water stress on nutrient uptake of corn and bean plants. Plant Stress 4(1): 64-71. Yahaya, H. and Ahmad Puat, N. 2005. Limau purut (Citrus hystrix). In: Musa, Y., Muhammad Ghawas, M. et al. (Eds.), Penanaman Tumbuhan Ubatan dan Beraroma. Serdang: MARDI, 2005; Pp. 108- 117.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Optimizing Immature Oil Palm Growth with Integrated New Developed Biochemical Fertilizer

Erwan Syah, T.1,*, Izwanizan, A.1 and Tan Geok, H.2 1Felda Global Ventures Research and Development Sdn. Bhd., Pusat Penyelidikan Pertanian Tun Razak, 26400 Bandar Tun Razak, Jengka, Pahang, Malaysia. 2Fakulti Pertanian, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Malaysia producing world demand for oil and fats and is one of the global leading palm oil producer that has oil palm plantation covering 80% of the agricultural land in Malaysia. Crude palm oil production is nearly 20 million tonnes yearly in order to meet the world demand consumptions (Awalludin et al., 2015). The main focus of oil palm plantation is to get optimum fresh fruit bunch (FFB) yield, which is the primary commodity of most plantation and has become a major international commodity with demand remains consistently high (Pirker et al., 2016). Palm oil plays a major role towards human health consumption as usages of chemical fertilizer have routinely been applied at oil palm plantation to maintain optimum growth and to ensure good survival rates. However, excessive use of chemical fertilizer will increase soil acidification and lead to environmental pollution which has become a major concern (Guo et al., 2010).

Therefore, to ensure sustainable agriculture, alternative systems for the applications of limiting nutrients are being sought, and organic farming is considered one achievable way for sustainable agriculture. Fertilizers other than chemical fertilizers such as organic fertilizer, compost and bio-fertilizer shall be used to produce organic products. Amongst, biofertilizers are the most attractive because of their positive impacts to both plant growth and the environment. Previous study have shown biofertilizers can also be a good source of stimulus compounds like 5-aminolevulinic acid (ALA) that can reduce environmental stress, such as salt stress, on rice growth (Nunkaew et al., 2014). Moreover, plant growth promoting rhizo-bacteria (PGPR) assists well in mineralization and channelization of nutrients leading to enhanced plant productivity (Ansari et al., 2017). PGPR adopt various possible ways to accelerate the rate of crop production (Chen, 2006; Rizvi et al., 2015).

Beside, chances of organic fertilizers to meet the requirement is very narrowed, since organic fertilizer releases nutrient slowly, and only fraction of nitrogen and other nutrient become available for palm in the first year after application. However, organic fertilizer has higher organic matter content and richer nutrient elements; it can enhance soil physical properties mainly by improving aggregate stability and decreasing soil bulk density; it can also improve soil biological and biochemical properties and optimize soil microbial community structure (Diacono and Montemurro, 2010).

Taking the advantages and disadvantages of these fertilizers, therefore idea to use inorganics application with living microorganism or biofertilizer has become an effective approach for fertilizer management. The applications of biochemical fertilizer (BCF) are used to increase efficiency in manuring at oil palm plantation. Ansari and Mahmood (2017) also have shown that by using Rhizobium sp. bacteria can offered higher growth, yields and ameliorated soil physio-chemical properties ensuring sustainability. Thus, there is substantial evidence that this might improve the efficacy of nutrient uptake which indirectly enhances palm growth and productivity. This study aims to assess new formulation of BCF with selected fertilizer,

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

integrated with living microorganism and to increase immature oil palm growth in the first two years in replanting area.

Materials and Methods

Study site

Field trial was located at Felda Agricultural Services Sdn Bhd (FASSB) at Telang oil palm plantation located in Kuala Lipis (4°19'35.6"N 102°00'33.2"E), Padang Tengku, Pahang, Malaysia. Considered as undulating area, rainfall and number of raining days during the experimental years are shown in Figure 1 and pH of this area are between 4.2 to 4.3 from 0-30 cm depth.

Experimental fertilizer

Treatment for chemical fertilizer in this experiment was compound fertilizer (N:P:K:Mg, 9%: 9%: 12%: 4%; FPM Sdn Bhd fertilizer). A new formulation of biochemical fertilizer which was developed by Faculty of Agricultural, Universiti Putra Malaysia with biochemical fertilizer, N:P:K:Mg, 11%: 11%: 15%: 4% and comprising of living microorganism was used to enhance nutrient uptake effectiveness.

Experimental material and design

This field trial was conducted for 24 months from January 2015 to December 2016, oil palm plantation was transplanted in December 2014. Yangambi (DxP) planting material was planted for this field experimental site and an area of 3.2 ha was allocated for this experiment. There were two treatments, with six replicates each according to Felda Standard Practices (FSP) and a biochemical fertilizer (BCF). Each replication consists of 30 palms (6 x 5) including buffer row and 12 recording palms (4 x 3).

Broadcast manuring method was used for both treatments, fertilizer was scattered around oil palm within one meter from their girth. Basal fertilizer for FSP treatments were applied four times in the first year and 5 times in the following year. However, basal fertilizer for BCF was applied 3 times in each year.

Growth measurement and sampling

Palm vegetative measurements were taken twice yearly, at June and December. The parameters measured were frond production, frond length, and chlorophyll content. Frond selection for measurement and sampling was according to palm age, 3rd frond used for first year and 9th frond at second year age. Leaf sample and rachis was taken after each measurement.

Rainfall information

The rainfall distribution is very crucial as the general guideline is to avoid fertilizer application during rainfall seasons with high monthly rainfall of more than 250 mm, not that exceeds 16 days and with high intensity rainfall events of more than 25 mm per day (Goh et al., 2003). Timing of the application should also be taken into considerations so as to avoid substantial nutrient losses.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

25 700.0 600.0 20 500.0 15 400.0 10 300.0 200.0 Rainfall (mm)Rainfall Rainfall (Days) Rainfall 5 100.0 0 0.0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

2015 2016 2015 2016

Figure 1: Rainfall distribution at Felda Agricultural Services Telang Sdn Bhd, Pahang.

Results and Discussion

Vegetative measurement

Table 1 showed frond production using BCF and FSP treatments. Frond length was significantly higher in BCF treatment for up to 18 months after treatment (MAT). This indicates that the response of palm growth to the biochemical fertilizer was significantly better as compared to Felda Standard Practices in the early stage. Aduloju et al. (2009) also stated that biofertilizer applications can increase greater amount of light interception by the crop plants due to higher vegetative growth of crop plants and this may the reason BCF treatments showed a better response.

Table 1: Vegetative measurement under different fertilization regime. Months after treatment (MAT) Parameter Treatment 6 MAT 12 MAT 18 MAT 24 MAT Frond Length (cm) FSP 97.09b 158.29b 182.00b 204.19a BCF 111.83a 163.58a 194.40a 205.43a Frond Production FSP 6.67b 21.25a - 14.46a BCF 7.25a 19.36b - 14.75a Chlorophyll (SPAD) (%) FSP 47.74a 65.94a 69.62a 63.40a BCF 57.44b 62.74b 67.20b 64.00a Leaf Area (m2/m2) FSP 0.42b 1.30b 1.62b 2.20b BCF 0.67a 1.44a 1.72a 2.50a Dry weight frond (kg) FSP 0.50b 1.01a 0.46a 1.27a BCF 0.58a 0.88b 0.61a 1.19a

Chlorophyll measurement was taken using SPAD meter. However, the chlorophyll content at months 12 MAT onward showed a significant increased as compared to the lower months of 6 MAT (Table 1). This indicates that the palms started producing bunches and may triggered fruiting with an increased in photosynthetic rate as stimulated by the presence of developing bunches which can act as a carbon sink for assimilation during young palm age (Henson, 1990). Leaf area (LA) measurement reflects the frond measurement of the palm, BCF treatment showed a significantly higher measurement in this experiment. This distinct vegetation results between treatments represent the capability of BCF treatment in order to enhance palm vegetative growth.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

However, dry matter production between treatment do not showed any significant different from 18 to 24 MAT. There are indications that certain microorganisms or fungi that can promote and sustain oil palm growth may not present but are necessary to ensure that new crops establish quickly so as to ensure that soil nutrients do not depleted easily (Jeffries and Barea, 2000; Gianinazzi et al., 2002). There biochemical fertilizers application used in this study also indicate that the palm dry matter in the second years was not affected but likely to promote some vegetative growth.

Foliar nutrients

Range of nutrients status was illustrated in Figure 2. Determination of nutrient content of Total Nitrogen (N), Phosphorus (P), Potassium (K) and Magnesium (Mg) in oil palm leaves by means of Near Spectroscopy (NIRS) and SAMM Accredited Plant Material in house method. The total N decreased between treatments indicated that amount of N supplied to palm in BCF treatment may be reduced due to rainfall at 12 MAT with 2.90±0.07% (mean±se) and 24 MAT at 3.01±0.02% (Figure 2). This is caused by either surface run off or manuring frequency carried out 3 times per year. The optimal frequency of fertilizer application still depends on the crop requirements, tree age, ground conditions, types of fertilizer available and rainfall (Comte, 2013). Compared to FSP, the standard protocol of manuring showed that the total N are constantly available in palm uptake due to frequent fertilizer application in immature trees (Goh and Chew in 1995).

Frequent application at low fertilizer rates is preferred for sandy or sloped land where the risk of nutrient losses through runoff or drainage is high. It is recommended that a single annual application of water insoluble rock phosphate is suitable as soluble fertilizers would be applied at low doses constantly.

In this study, the foliar P determined at constant level of 0.17% of dry matter. Meanwhile rachis P level at 0.10% dropped as the level of Mg increased after 12 month after treatments, Figure 2b. This level was also reported by Foster and Probowo, 2002 where the rachis P concentration of the palms at a critical P level of 0.10%, this duplicates result showed P rachis status was more reflective of the P nutrient status compared to foliar P status. Therefore it can be used to identify a better P fertilizer requirement.

The effects of biochemical fertilizer and Felda standard practices on tissue Mg and K levels are shown in Figure 2c and Figure 2d. The results show that both fertilizers increased foliar Mg levels after 18 month after treatments, with Felda standard practices tending to have the greatest effect. These increases in Mg level also indirectly decreased leaf and rachis K. Foliar K status in both treatments is reduced in the second year of applications Figure 2d. This may derived from bunches pre-form stage is started, palm start to produce bunches and used of K in the process. However, Teoh and Chew (1988) have shown that rachis K is more sensitive than leaf K in detecting K deficiency in oil palm especially when soil exchangeable Ca and Mg are high in relation to soil exchangeable K. Furthermore, from the results it is showed positive correlation pattern of nutrient K between foliar and rachis.

In this recent study, although rounds of application of fertilizers were reduced from either 5 or 4 in FSP to three rounds using biochemical fertilizer, it given non-absolute effect toward palm nutrient status. Ning et al. (2017) in her study also stated even the organic fertilizer treatments were lower than chemical fertilizer, the amount of nutrients were high enough for crop requirement and 20% chemical fertilizer reduction did not influence crop yield. This positive effect of biochemical fertilizer also suggested reducing fertilizer application is possible and may contribute to shrink fertilizer wasted.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

(a) (b)

Total-N (% on dry matter), Foliar P (% on dry matter), Foliar and Rachis

3.30 0.18 0.115

3.20 0.18 0.11 0.17 3.10 0.105 0.17 3.00 0.1

FoliarP (%) 0.16 2.90 Rachis P (%) 0.16 0.095 2.80 Foliar , Total N (%) 0.15 0.09 2.70 FSP BCF FSP BCF FSP BCF FSP BCF

2.60 6 MAT 12 MAT 18 MAT 24 MAT FSP BCF FSP BCF FSP BCF FSP BCF Foliar Rachis 6 MAT 12 MAT 18 MAT 24 MAT

Mg (% on dry matter), Foliar K (% on dry matter), Foliar and Rachis

0.40 1.90 1.9 1.80 0.35 1.75 1.70 0.30 1.60 1.6 0.25 1.50 1.45 1.40 0.20

Foliar K (%) 1.30 1.3 Rachis K (%) 0.15 1.20

FoliarMg (%) 1.15 0.10 1.10 1.00 1 0.05 FSP BCF FSP BCF FSP BCF FSP BCF 0.00 6 MAT 12 MAT 18 MAT 24 MAT FSP BCF FSP BCF FSP BCF FSP BCF Foliar Rachis 6 MAT 12 MAT 18 MAT 24 MAT

Figure 2: Foliar and rachis analysis on dry matter; a-Total-Nitrogen (N), b- Phosphorus (P), Potassium (K), c- Magnesium (Mg), d- Potassium (K).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusions

Biochemical fertilizer can stimulate early growth of oil palm. BCF fertilizer showed a significant higher of vegetative growth of frond length, frond production and especially in leaf area (LA) which were comparable to Felda standard practices conventional programed. The foliar nutrients status between biochemical fertilizer and Felda standard practices also showed both treatment given positive outcome, and no absolute different found between treatments, indicating new developed biochemical fertilizer application contribute to palm health as good as Felda standard practices at a lesser applications. Consequently, new formulation of BCF might be adapted into the industries in other large scale implementation as biochemical fertilizers may enhance soil fertility in long term advantages.

References

Aduloju, M.O., Mahmood, J. and Abayomi, Y.A. 2009. Evaluation of soybean [Glycine max (L.) Merrill] genotypes for adaptability to a southern Guinnea Savanna environment with and without P fertilizer application in north Central Nigeria. African Journal of Agricultural Research (4): 556- 563. Ansari, R.A., Rizvi, R., Sumbul, A. and Mahmood, I. 2017. PGPR: Current Vogue in Sustainable Crop Production. In: Probiotics and Plant Health. Springer, Singapore. Pp. 455-472. Ansari, R.A. and Mahmood, I. 2017. Optimization of organic and bio-organic fertilizers on soil properties and growth of pigeon pea. Scientia Horticulture 226: 1-9. Awalludin, M.F., Sulaiman, O., Hashim, R. and Wan Nadhari, A. 2015. An overview of the oil palm industry in Malaysia and its waste utilization through thermochemical conversion, specifically via liquefaction. Renewable and Sustainable Energy Review. Pp.1469-1484. Chen, J. 2006. The combined use of chemical and organic fertilizers and/or biofertilizer for crop growth and soil fertility. Paper Presented at the International Workshop on Sustained Management of the Soil-Rhizosphere System for Efficient Crop Production and Fertilizer Use, Thailand. Comte, I. 2013. Landscape scale assessment of soil properties, water quality and related nutrient fluxes under oil palm cultivation: A case study in Sumatra. Indonesia: McGill University. Diacono, M. and Montemurro, F. 2010. Long-term effects of organic amendments on soil fertility. A review. Agronomy for Sustainable Development 30: 401-422. Foster, H.L. and Probowo, N.E. 2002. Overcoming the limitations of foliar diagnosis in oil palm. Paper presented at International Oil Palm Conference, Indonesian Oil Palm Research Institute, Bali. Gianinazzi, S., Schu¨epp, H., Barea, J.M. and Haselwandter, K. 2002. Mycorrhizal Technology in Agriculture: From Genes to Bioproducts. Birkhauser, Basel. Pp. 296. Goh, K. and Chew, P. 1995. Managing soils for plantation tree crops I: general soil management. Course on Soil Survey and Managing Tropical Soils, Kuala Lumpur. Pp. 228-245. Goh, K.J., Härdter, R. and Fairhurst, T. 2003. Fertilizing for maximum return. Oil Palm Management for Large and Sustainable Yields, PPI, PPIC and IPI. Guo, J.H., Liu, X.J., Zhang, Y., Shen, J.L., Han, W.X., Zhang, W.F., Christie, P., Goulding, K.W.T., Vitousek, P.M. and Zhang, F.S. 2010. Significant acidification in major Chinese croplands. Science 327: 1008-1010. Henson, I.E. 1990. Photosynthetic and source sink relationship in oil palm (Elaeis guineensis), Transactions of the Malaysian Society of Plant Physiology 1: 165-171. Jeffries, P. and Barea, J.M. 2000. Arbuscular mycorrhiza a key component of sustainable plant soil ecosystems. In: Hock, B. (Ed), The Mycota, Volume IX. Fungal Associations, Springer. Pp. 95- 113.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ning, C.C., Gao, P.D., Wang, B.P., Lin, W.P., Jiang, N.H. and Cai, K.Z. 2017. Impact of chemical fertilizer reduction and organic amendments supplementation on soil nutrient, enzyme activity and heavy metal content. Journal of Integrative Agriculture. Pp. 1819-1831. Nunkaew, T., Kantachote, D., Kanzaki, H., Nitoda, T. and Ritchie, R.J. 2014. Effects of 5-aminolevulinic acid (ALA)-containing supernatants from selected Rhodopseudomonas palustris strains on rice growth under NaCl stress with mediating effects on chlorophyll, photosynthetic electron transport and antioxidative enzymes. Electronic Journal of Biotechnology 17: 19-26. Pirker, J., Mosnier, A., Kraxner, F., Havlík, P. and Obersteiner, M. 2016. What are the limits to oil palm expansion? Global Environmental Change 40: 73-81. Rizvi, R., Ansari, R.A., Safiuddin Agrawal, P., Sumbul, A., Tiyagi, S.A. and Mahmood, I. 2015. Effect of some organic fertilizers and bio-inoculant on growth attributes of tomato in relation to sustainable management of root-knot nematode. Journal of Plant Pathology-Photon Foundation 115: 206-215. Teoh, K.C. and Chew, P.S. 1988. Use of rachis K analysis as an indicator of K nutrient status in oil palm. In: Halim, H.H.A., Chew, P.S., Wood, B.J. and Pushparajah, E. (Eds), Proceedings of the International Oil Palm Conference of 1987 PORIM and Incorporated Society of Planters, Kuala Lumpur. Pp. 262-271.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effects of Organic Fertilizer Containing Beneficial Elements GanoCare® on Vegetative Growth and Physiological Responses of Oil Palm Seedlings

Mohd Shukri, I.1,*, Idris, A.S. 1,*, Norman, K.1 and Hanafi, M.M2 1Ganoderma and Disease Research for Oil Palm (GanoDROP) Unit, Biological Research Division, Malaysian Palm Oil Board, 6, Persiaran Institusi, Bandar Baru Bangi, 43000 Kajang, Selangor, Malaysia. 2Institute of Tropical Agriculture, Universiti Putra Malaysia, Serdang, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]; [email protected]

Introduction

The oil palm, Elaeis guineensis Jacq. is one of the most important oil-producing crop due to production high yield per hectare compare to other edible oil crops. Indonesia and Malaysia are most producers of oil palm in the world. Due to its important in economic, the agronomic practices is favourable use of chemicals fertilizers to improve productivity and yield of oil palm. Many studies reported on plant physiology that involved directly in the modification of nutrition of for growth enhancer and controlling diseases (Peter, 2012). while the investigation on effects of fertilizers as growth enhancer also for crop protection in oil palm especially for Ganoderma disease control were reported (Hanafi et al., 2014; Mohidin et al., 2015; Tengoua et al., 2015), The GanoCare® is an innovative patent technology which is contained balanced nutrients, powdered empty fruit bunches (EFB) and beneficial elements to enhanced plant growth through regulation of plant metabolism such improved nitrogen fixation, rhizobia growth and increase the thickness of plant cells walls (Idris et al., 2005; Sharma, 2006). The use of these beneficial elements in oil palm significantly effective for controlling diseases in oil palm (Hanafi et al., 2014; Mohidin et al., 2015; Sahebi et al., 2015 and Tengoua et al., 2015;). Others used of traced elements as supplementation besides of NPK fertilizer was significantly suppressed basal stem rot disease incidence in oil palm (Sariah et al., 1997; Fang and Kao, 2000; Nur Sabrina et al., 2012; Siti Naimah et al., 2015). Surprisingly, physiological responses on the vegetative growth of oil palm seedlings applied with organic fertilizers has not been extensively studied. The optimum usage of fertilizer on oil palm that has responsive on growth, preventive treatments from the diseases also increase productivity and yield were widely important for the stakeholders of the oil palm industry. The aim of this study to investigate the effects of organic fertilizers containing beneficial elements GanoCare® on vegetative growth and physiological responses of oil palm seedlings in a nursery evaluation.

Materials and Methods

Preparation of planting material and treatments

The study was carried out at an experimental nursery trial at the Seberang Perak, Perak. Three-month old oil palm seedlings, Tenera (Dura x Pisifera) were prepared in the nursery one month before commencing treatment. The experimental design used in this study was a Completely Randomized Design (CRD) with three replications. The rate and fertilizer treatments were applied for this study is given in Table 1.

Table 1: Rate of two different fertilizer treatments. Treatment Type of fertilizer and Rate (per seedling) T1 NPKMg 12-12-17-2 monthly application at 40g per seedling T2 NPKMg 12-12-17-2 + monthly application at at 40g + organic GanoCare® Organic fertilizer at total 450g per seedling

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Oil palm seedlings were planted in parallel polybags (sized 150 mm width x 180 mm heights) and labelled. During the experiment, the oil palm seedlings received regular watering with applications of pesticides as appropriate.

Vegetative growth

Vegetative growth was determine by measuring the total green frond numbers, palm height, pseudostem girth, rachis length, total dry weight and leaf area. The measurements were collected at three, six and nine months after treatment. The palm height was measured using a measuring tape between the ground level and the insertion of leaves number 1. Total plant biomass was taken by calculating the dry weight of roots, stems and leaves per seedling. Destructive sampling was carried out after nine-months treatments completed. The leaves, stems and roots were placed in paper bags and oven dried for 48h at 80°C until constant weight. The weights of samples were weighed using an electronic weighing scale (CDS 125, Mitutoyo Inc, Japan). Leaves area per plant was measured using a leaf area meter (LI-3100, Lincoln Inc, USA).

Physiological properties

The leaf gas exchange paramaters such as photosynthetic rate, stomatal conductance, transpiration rate and instantaneous water use efficiency (WUE) were measured on the leaflets of frond 3 for each seedling. The gas exchange was measured using a portable photosynthesis system (CIRAS-1, PP-System, UK) together with the following benchmarks: the leaf cuvette was controlled at 400 ppm CO2, 70% relative humidity and 1000 µM m-2 sec-1 of Photosynthetically Active Radiation (PAR). Relative chlorophyll content was measured from the intact leaves of frond 3 using a chlorophyll meter (SPAD 502, Minolta, Japan).

Results and Discussion

Effects of GanoCare® organic on the growth of oil palms in the nursery

Optimum fertilizer through nutrients modification of plants such oil palm generally effects on the physical growth properties especially for seedlings in nurseries. Manuring with balanced nutrients in nursery will provide healthy oil palms seedlings as planting material for plantations. In this study, the growth characteristics such as total green frond numbers, palm heights, pseudo girth, rachis length and leaf area were significantly greater in oil palm seedlings treated with GanoCare® (T1) compared to the control seedlings (T1) (Figure 1, Table 2). Previous findings were reported by Shamala et al. (2010) and Zaiton et al. (2008) on the effects of biological microbes as supplementation on oil palm seedlings were almost practically comparable to this study. They reported that biological microbes essentially could enhance the growth of oil palm seedlings, while the applications of optimum-balanced nutrients are highly important in oil palms. Application of balanced nutrients is important for plant growth, increase yield and cost- effectiveness of fertilizer. The use of trace elements in oil palm has been concerned for controlling BSR disease in oil palm. It was reported that use of silicone or calcium as supplementation in oil palm besides of chemical fertilizer was significantly suppressed BSR disease incidence (Sariah et al., 1997). The application of copper as supplementation of NPK fertilizer also influence to control many plant diseases (Fang and Kao, 2000), primarily by decreasing the spread of the disease (Nur Sabrina et al. 2012). The applications of trace elements enhance productivity and increase protection against abiotic and biotic stresses.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Growth characteristics, plant dry weight and relative chlorophyll content of oil palm seedlings under the different fertilizer treatments after nine-months of treatment. Plant Stem Rachis Relative Frond Dry weight Leaf area Treatments Height Girth lengths Chlorophyl Number (grams) (m2) (cm) (mm) (cm) (Chl SPAD) T1 15.0b 149.74b 80.16b 74.81b 57.7a 250.3b 1.277b

T2 16.0a 160.3a 89.45a 84.91a 59.8a 300.0a 1.386a Note: Columns with the same letter indicates no significant differences at p<0.05 using LSD. T1-oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer and T2-oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer and GanoCare® Organic (total 450g / palm).

450 400 350 300 250 T2 200 150 T1 100 50 0 Frond Height, cm Girth, mm Rachis SPAD Dry weight, Leaf Area, Numbers length, cm gm m2

Figure 1: Effect of organic fertilizer containing beneficial elements on frond numbers, heights, girth, rachis length, Chlorophyll SPAD, dry weights and leaf areas of oil palm seedlings at three, six and nine- months after treatment. T1-oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer and T2-oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer and GanoCare® Organic (total 450 g/palm).

At the six-months after treatment (6MAT), seven to nine months old seedlings, were also increased the above-mentioned parameters by 16%, 5%, 12.6%, 14.8%, 9.2% and 38% respectively compared to the T1. When the seedlings approached to 12-months old at nine-months after treatment (9MAT), seedlings treated with T2 increased the number the fronds, plant height, stem girth, rachis length, leaf area, and dry weight by 38.5%, 12.6%, 44.8%, 32.9%, 12.8% and 40% compared T1 as control. The production of root hairs and increase in root mass were significantly enhanced. T2 also improved the physical and root growth of the seedlings. The seedlings treated with NPKMg 12-12-17-2 fertilizer alone recorded the lowest vegetative growth. Generally, the control seedlings developed growth and recorded the lowest increase in height; stem diameter and root mass (Figure 2). This suggested that the GanoCare® organic had positively contributed to the plants in sustaining their growth also to cover the damage caused by G. boninense.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

2A 2B

Figure 2: Effects on the GanoCare® organic applications on the seedlings treated with T2 (2A) have healthier roots as compared to control seedlings at T1 (2B) with less roots production.

Effects of organic fertilizers on the physiology properties of oil palm seedlings

In the study, applications of organic and inorganic fertilizer (T2) significantly improve leaf gas exchange parameters such as photosynthetic rate and stomatal conductance. However, no significant differences between treatments were observed in transpiration rate and instantaneous WUE (Table 3). The higher photosynthetic rate is associated with the increased in stomatal conductance. This result suggests that increase photosynthetic activity is beneficial to the plant growth (Siddiqui et al., 1999; Tayeb et al., 2003; Hanif et al., 2005; Afifah et al., 2018).

Table 3: Effects of GanoCare® organic on photosynthetic rate, stomatal conductance, transpiration rate and instantaneous water use efficiency (WUE) of oil palm seedlings. Treatment Photosynthetic rate Stomatal Transpiration Instantaneous Water use efficiency (WUE) 2 2 -1 (µmol/m /s) conductance (mmol/m /s) (µmol CO2 assimilated mmol H2O loss) (mol/m2/s) T1 11.34b 0.12b 2.01a 6.39a T2 11.68a 0.13a 2.22a 5.65a Note: Treatment means within each column followed by the same letters are not significantly different from each other (n = 40) at p<0.05 using Least Significant Different (LSD), T1-oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer (control) and T2- oil palm seedlings treated with NPKMg 12-12-17-2 fertilizer and GanoCare® Organic (total 450 g /palm).

Conclusion

There was a great increase in growth and leaf gas exchange of oil palm seedlings treated with organic fertilizer containing beneficial elements, GanoCare®. Therefore, it is recommended to use GanoCare® organic fertilizer to enhance growth of oil palm seedlings.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Acknowledgement

The authors would like to thank the Director General of MPOB for permission to publish this paper. The authors also wish to gratefully acknowledge for the research collaboration with UPM and FELCRA Plantation and Services Sdn. Bhd. for this study.

References

A’fifah, A.R, Haniff, M.H., Maisarah, J.N., Hasimah, M. and Kamal, R.S. 2018. Selection of oil palm materials with higher water use efficiency using carbon isotope discrimination. International Journal of Agriculture and Biology 20 (9): 1921-1928. Afiqah, B., Shafar Jefri, M. and Noordin, W.D. 2017. Physiological and morphological responses of rubber (Hevea brasiliensis) RRIM 3001 to different rates of basalt application. Journal of Tropical Plant Physiology 9:24-35. Hammerschmidt, R. and Kuc, J.A. 1995. Induced Resistance to Disease in Plant, Dordrech: Kluwer 182 pp. Hanafi, M.M., Idris, A.S., Mohd Shukri, I., Norman, K., Razali, T. and Zaafar, M.D. 2014. Plants nutrients and Ganoderma control in oil palm. Proceeding of Workshop on Integrated management of Ganoderma disease in oil palm, 3-4 December, Kota Kinabalu, Sabah, MPOB, Malaysia. Hanif, M.H., Ismail, S. and Idris, A.S. 2005. Gas Exchange responses of oil palm to Ganoderma boninense infection. Asian Journal of Plant Sciences 4(4): 438-444. Henson, I. 1991. Limitations to gas exchange, growth and yield of young oil palm by soil water supply and atmospheric humidity. Transactions of the Malaysian Society of Plant Physiology 2: 51-57. Hossner, L.R. and Juo, A. 1999. Soil nutrient management for sustained food crop production in upland farming systems in the tropic. Food and Fertilizer Technology Centre, Taiwan. Juo Soil and Crop Science Department, College Station, TN 77843, USA, Retrieved from http//www.agent.org. Idris, A.S. 2012. Latest research and management of Ganoderma disease in oil palm. Proceeding of the Fourth IOPRI-MPOB International Seminar: Existing and Emerging Pests and Disease of Oil Palm Advances in Research and Management. 13-14 December 2012, Grand Royal Panghegar Hotel, Bandung, Indonesia. p. 1-23. Idris, A.S. 2011. Biology, detection, control and management of Ganoderma in oil palm. Further advances in oil palm research (2000-2010). (Basri, M W; Choo, Y M and Chan, K W eds.). MPOB, Malaysia. p. 485-521. Idris, A.S., Ismail, S. and Ariffin, D. 2005. Reducing risk of Ganoderma in supply palms. MPOB Information Series No. 264. http://palmoilis.mpob. gov.my/publications/TOT/TT-260.pdf Idris, A.S., Kushairi, A., Ariffin, D. and Basri, M.W. 2006. Technique for inoculation of oil palm germinated seeds with Ganoderma. MPOB Information Series No. 321: 4 pp. Khalid, H., Zin, Z.Z. and Anderson, J.M. 1999. Quantification of oil palm biomass and nutrient value in a mature plantation. Journal of Oil Palm Research 11:23-32. Kramer, P. and Boyer, J. 1995. Water Relations of Plants and Soils. Academic Press, California, USA. 482 p. Marschner, H. 1986. Mineral nutrition in higher plants. Academic Press, California, USA. 889 p. Mcmahon, P. 2012. Effect of nutrition and soil function on pathogens of tropical tree crops. Plant Pathology (Cumagun, C J ed.). InTech Publisher, Rijeka, Crotia. p. 241-272. Mohd Tayeb, D., Idris, A.S. and Haniff, H.M. 2003. Reduction of Ganoderma infection in oil palm through balanced fertilization in peat. Proceeding of the PIPOC 2003 International Palm Oil Congress (Agriculture). MPOB, Bangi. p. 193-219.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mohidin, M., Hanafi, M.M., Rafii, Y.M., Abdullah, S.N.A., Idris, A.S., Man, S., Idris, J. and Sahebi, M. 2015. Determination of optimum levels of nitrogen, phosphorus and potassium of oil palm seedlings in solution culture. Bargantia 74:247-254. Sahebi, M., Hanafi, M.M., Wong, M.Y., Idris, A.S., Azizi, P., Jahromi, M.F., Shokryazdan, P. Abiri, R. and Mohidin, H.. 2015. Towards immunity of oil palm against Ganoderma fungus infection via increasing silicon accumulation. Acta Physiol Plantarum 37: 195-211. Sariah, M., Idris, A.S. and Shamala, S. 2011. Current R&D towards better management of Ganoderma Control. Proceeding of The 3rd MPOB-IOPRI International Seminar: Integrated Oil Palm Pests and Disease Management, KLCC, Kuala Lumpur, Malaysia. Shamala, S. 2010. Growth effects by Arbuscular Mycorrhiza fungi on oil palm Elaeis guineensis Jacq. Seedlings. Journal of Oil Palm Research 22: 796-802. Sharma, C.P. 2006. Plant micronutrients. Science Publishers, Enfield, U.K. 265 pp. Siddique, M.R.B., Hamid, A. and Islam, M.S. 1999. Drought stress effects on photosynthetic rate and leaf gas exchange of wheat. Botanical Bulletin of Academia Sinica 40:141-145. Siti Naimah, S., Nashriyah, M. and Mohd Noor, A.G. 2015. Effects of organic and inorganic fertilizers on growth and yield of Vigna Unguiculata subsp. Sesquipedalis L. (Verdc.). Journal of Tropical Plant Physiology 7:1-13 Tengoua, F.F., Hanafi, M.M., Idris, A.S., Sahebi, M. and Syed-Omar, S.R. 2015. Comparative study of lignin in roots of different oil palm progenies in relation to Ganoderma basal stem rot disease. Journal od Oil Palm Research 27:128-134. Zaiton, S., Sariah, M. and Mior, A.Z.A. 2008. Effect of endophytic bacteria on growth and suppression of Ganoderma infection in oil palm. International Journal of Agriculture and Biology 10:127-132.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Floral Behaviour and Unique Autonomous Self-pollination of Passiflora Species (Passion Fruit)

Ramaiya, S.D.1,*, Bujang, J.S.2 and Zakaria, M.H.3 1Department of Crop Science, Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Campus, 97008 Bintulu, Sarawak, Malaysia. 2Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. 3Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Passiflora plants are generally known as passion fruit may well be the most fascinating plant of the tropics. Their unique, almost lavishly beautiful flowers have a mysterious look and convey an exotic ambiance (Vanderplank, 2000). Passion fruit plants belong to the family Passifloraceae, consists of 18 genera including genus Passiflora (Ocampo et al., 2007). Passion fruits are one of the widely grown fruit crops around the world. The main dispersal area extends over Central America and South America (Vanderplank, 2000; Krosnick and Freudenstein, 2005). Although 50 species bear edible fruits, only two forms of Passiflora edulis; i.e., P. edulis (Purple passion fruit) and P. edulis f. flavicarpa (Yellow passion fruit) are widely cultivated in commercial scale for fresh fruit and juice market (Bernacci et al., 2008). In Peninsular Malaysia, Passiflora plants were grown in Ayer Hitam (Johor) and Cameron Highlands (Pahang) which were extended to be a commercial in 1960s (Chai, 1979). Thereafter, the passion fruit production in these regions has been affected by a passion fruit woodiness diseases (PWD) which discouraged further expansion in commercial planting (Chai, 1979). However, this fruit is still cultivated on a small scale due to the prevalence of suitable growing conditions (Ramaiya et al., 2013). There is an immense potentiality of boosting passion fruit industry in Malaysia.

Pollination is essential for fruit production on Passiflora plant. Flowers of the P. edulis vine normally set fruit when the flowers are cross pollinated (Souza et al., 2004). The amount of pollen deposited on the stigma determines the number of seeds set and size of the fruit. The most effective pollinating insects of Passiflora species are carpenter bee (Xylocopa sonorina) and the honeybee (Apis millifera) (Lim, 2012). It has been reported in its native country Brazil, whereby P. edulis are observed to be self-incompatible while in India, Apis cerana is the primary pollinator (Joy and Sherin, 2013). During the preliminary observation, we found there are good fruits being sets although there were not many effective pollinators having visited the flowers. Thus, this led to the interests into researching on the plant’s mode of natural pollination. Therefore, the objective of this study was to assess the detail information on the floral behaviors of Passiflora species for yield, quality improvement and other breeding programs.

Materials and Methods

Study location and plant cultivation

The present study was conducted at the Passiflora small scale farm initiated by Universiti Putra Malaysia Bintulu Sarawak Campus (UPMKB). Planting materials used in this study were seeds acquired from the commercial supplier, Trade Winds Fruit, Windsor, California. Five Passiflora species: P. edulis (Purple), P. edulis (Frederick), P. maliformis, P. quadrangularis and P. incarnate were cultivated and examined in

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

the present study. For planting of Passiflora species, a vertical trellis system with ten rows, each with 25 m apart was constructed. The trellis system consisted of 2.4 m tall post set at 5 m intervals along the rows. Three gauge galvanized wires (2.5 mm) were strung along the posts. Four months old seedlings with uniform height (about 20-25 cm) and leaf number (at 9-13) were chosen for transplanting with a planting distance of 3 x 2.5 m.

Observations on phenological study and fruits productivity

Observations were carried out for a duration of two years and eight months. The plant development phase recorded in the present study was based on extended BBCH scale (Growth stage of plants, BBCH Monograph, Meier et al., 2009). The observations were based on the occurrence, duration and frequency of the vegetative growth, flowering and fruiting. The flowering period was defined as the open flower, as Passiflora species produces flower all year around. This phenology was obtained to verify the blooming pattern. The major and minor blooms were worked out on the basis of number of flowers opened daily. In case of major bloom, more than half of the vines produced five or more number of flowers per day for a duration of 10 days in a month as defined by Kishore et al. (2010). Any other details observed include time of anthesis until closing of flowers, changes in position of pistil and stamen and frequency of visitors.

Statistical analysis

The data recorded for flower biology was statistically analysed using statistical software SAS 9.1. Means were compared using a single factor one way analysis of variance (ANOVA). A post hoc Tukey’s test (p<0.05) was performed if the ANOVA result was significant.

Results and Discussion

Flower development of Passiflora species

The flowering type of Passiflora species classified as “steady-state species” that exhibit constant production of few flowers and, lasting only about 24 hours. There are five main stages of flower development: bracts formation, bud initiation, bud development, complete bud formation and flower blooming.

This behavior however, varied significantly between the studied species. For example, P. incarnate was recorded to have earliest flower initiation. The plant displayed expressive bloom after 14 weeks of transplanting. The maximum bud size was 5.04±0.09 cm and flower opening took about 13.4±0.55 days. In P. edulis (Purple) and P. edulis (Frederick), the first flower initiation was recorded on 5th month after transplanting and the bloom may last for about 160 days. Almost similar results were also recorded in Bangladesh by Banu et al. (2009) with a maximum size bud of 5.15±0.10 cm.

In P. quadrangularis, blooming occurred about 163 days after transplanting. This plant however, may required slightly longer period of 16.8±0.84 days as compare to all other species. Flower bud development normally took 14.0±1.00 days with larger flower bud of 6.79±0.10 cm. It was further reported by Montero et al. (2013) that development period for flower buds was over 13 days with different from outside its origin center, for example, in Malaysia it took 16-18 days and Venezuela, 21 days (Haddad and Figueroa, 1972). The maximum size of flower bud was 6.45±0.07 cm. This species showed late flowering with first blooms only began after 195 days upon transplanting.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Blooming duration

Summary of blooming durations were presented (Table 1). Based on the detail observations, the time of flowering varied between Passiflora species. P. quadrangularis and P. maliformis showed the earliest flower opening. It starts at early hours from 0652±0.17 to late at about 1600-1730. However, full blooming can only be recorded around 0721±0.04 hour but it took only about 30 min for the styles to be completely curved and in contact with the anthers after 0806±0.23 hour.

In contrast, P. incarnata showed the longest blooming duration of about 100 minutes to fully developed while P. edulis only opened and fully bloomed at around noon 1223±0.25 hour with anthesis started only after 1316±0.29 hour till night. This phenomenon was also observed by Banu et al. (2009) which stated that P. edulis (Purple) flowers normally fully bloom around 1052-1240 hour in Bangladesh. This may be due to the variation in phenological differences, environment, adaptability and genetics (Das et al., 2013).

Table 1: Flowering time of Passiflora species observed in n=50 flowers. Blooming events P. edulis P. edulis P. maliformis P. quadrangulars P. incarnata (Purple) (Frederick) Flower started to open 1153±0.20a 1100±0.25a 0820±0.10b 0652±0.17c 1214±0.19a (hr) (1130-1221) (1028-1120) (0802-0849) (0623-7000) (1130-1212) Full bloom (hr) 1223±0.25ab 1123±0.07b 0831±0.20c 0721±0.04d 1229±0.36a (1134-1240) (1102-1140) (0820-0853) (0700-0730) (1148-1315) Style faced anther (hr) 1316±0.29ab 1219±0.28b 0913±0.20c 0806±0.23c 1351±0.20a (1215-1340) (1138-1258) (0834-0912) (0740-0810) (1300-1400) Row with same alphabets indicate differences at p<0.05 (ANOVA, Tukey’s test). Values are given as means (hr) ± SD and values in parenthesis are the range.

Flower blooming stages, the stigma and anther positions

Position of stigma and anther are very important in Passiflora flower due to its natural pollination factor. The example of complete Passiflora flower (P. incarnata) blooming stages is showed in Figure 1. Basically, three phenological stages have been recognized in all the studied Passiflora species but no significant changes in colour and odour were observed. These include:

Phase 1: Pre-anthesis

This is the bud stage prior to anthesis and known as phase 1 which also corresponds to the preceding anthesis floral stage. The gynoecium, androecium and the corona were fully covered by the sepals which then converged toward the center of the flower. Here, the reproductive structure was not visible. The styles are erected (Figure 1a) with anthers dehiscenced facing up (Figure 1b).

Phase 2: Flower homogamous with herkogamy

At this phase, the flower starts to open, the sepals, petals and corona spread out rapidly and the reproductive structures fully exposed to the external environment (Figure 1c). The upright facing anthers during flower opening, were tumbled down and turned around, thus bringing the dehisced side of the anther facing downward (Figure 1d). Styles which are in the upright position began to tilt and reaching the anthers (Figure 1e-g). Simultaneously, the stigma remained receptive and anthers were indehiscent. The receptive stigma will then come into contact with the receptive anthers, donating pollen grains onto the stigmatic surface (Figure 1h-i). This is an important phenomenon in Passiflora flowers for pollination process. As the pollen grains were large and with bright yellow to white in colour the presence of pollen

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

grains on the stigma surface could then be clearly seen. Passiflora flowers are normally homogamous where the anther and stigma mature simultaneously and present herkogamy, showing a distinct spatial separation of anthers and stigma.

Figure 1: Various flower blooming stages of P. incarnata; a) flower bud-ready to be opened, b) flower opening, c) anthers started to tumble down, d) all the anthers facing outwards, e) styles were in horizontal position, f) styles taking curve, g) styles were tilt and stigma started to be in contact with the anthers, h) stigma completely touched the anthers and i) stigma touched the anthers and pollens were transfered.

Phase 3: Flower senescence

This phase is the closure of the flower with the petals and corona wilted, the surfaces lose turgidity and started closing. The sepal returned to an upright position while stigmas were erected backward, while the bracts remained fresh. There was no nectar present after the flowers were closed. Pollinated flowers showed rapid enlargement of the ovary and developing fruit can be recognized in 3 days while non- pollinated flowers abscised within 2-3 days without showing enlargement of the ovary.

In addition, based on the detail observation during the stage 2 of flower blooming, the Passiflora flowers exhibited 3 types of style morphology; a) styles without curvature (WC), where the style stand erect, b) partially curved (PC) style, where the style curved partially, and the stigmas does not touch the anther and c) completely curved (CC) style, where style is curved and the stigmas in contact with the anther. Percentage (%) of different types of styles in Passiflora flower is presented in Figure 2. Among five Passiflora species, CC flowers were commonly found (≥80% except in P. maliformis, 38.33%) and produced more fruits. The WC flowers were relatively less common where such flowers did not get pollinated and did not produce fruits. The maximum WC flowers were recorded in P. edulis and P. quadrangularis (6.67%) while 0% was observed in P. incarnata. Flowers of P. maliformis possessed mostly the PC styles (60.00%).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

As discussed above, the unique movement of styles and position of stigma and anthers are important for self-pollination besides the presence of effective pollinators. In most of its native habitat, the Passiflora species were self-incompatible and carpenter bees were the effective pollinators. In the present study site, there was good fruit sets, although lesser number of pollinators visiting the farm or sometimes absence. The pollinators observed were butterflies, wasps, bees and carpenter bees. As the visitors landed on the flat corona and feeding on nectar, the upper part of the approaching pollinators came into contact with the lower exposed pollen bearing surface of the anther and some pollen grains deposited on their wings and thorax, thus touched the stigma and transferred the pollen grains. The most common visitors were the ants but they are nectar feeders and not the pollinators. In this sense, the studied species mostly exhibited a unique autonomous self-pollination, involving the movement of styles to lead the stigma faced the anthers during flower blooming which provided reproductive assurance to the species.

The plants were self-compatible and able to produce constant fruit sets during the study period when biotic pollination is a limitation. P. edulis growing in its native habitat is usually self-incompatible and can become self-compatible (Cox, 1957). This evolution feature in Passiflora flower is an important factor for its adaptability and survivability. According to Sicard and Lenhard (2011), the changes from self- incompatibility to self-compatibility have frequently occurred in most cultivated flowering plant species. A number of flowering plants such as Roscoea schneideriana and Collinsia verna have evolved various devices to achieve autogamous self-pollination when pollinators are scarce (Zhang and Li, 2008). Self- pollination has also been observed in orchid (Chen et al., 2012) where pollinators are scarce. Evolution of self-compatibility has generally been interpreted as a reproductive assurance in the absence or scarce of pollinators (Sicard and Lenhard, 2011) which is the main feature contributing to a wide distribution of the Passiflora species around the world.

96.67 CC 100 86.67 PC 83.33 80.00 80 WC 60.00 60 38.33 40 15.00 18.33 20 10.00 6.67 5.00 6.67 5.00 3.33 0.00 0 Percentage (%) of flower flower of (%) Percentage P. edulis (Purple) P.edulis (Frederick) P.maliformis P.quadrangularis P.incarnata Passiflora species

Figure 2: Percentage (%) of different types of styles in Passiflora flowers (n=60 flowers). CC- completely curved, PC- partially curved and WC-without curvature (stand erect).

Conclusion

The flower of Passiflora species is known as “steady-state species” that exhibit constant production of few flowers within a day. The flowering behaviors may varied between species. The Passiflora flowers exhibited a unique autonomous self-pollination involving the movement of styles and anthers. This assurance the production of good yield even the pollinators are scarce. The detail floral biology was performed to understand the growth of Passiflora species for farmers to get visual clues for timing of farming operations in local cultivation practices, plant protection practices and to understand the vulnerable periods for the crop. Understanding the whole plant development stages can also lead to better strategies to attain a good stand. Simultaneously, the floral biology information reported in this study will

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

help to enhance for further research on breeding works and environmental adaptation towards increase yields and production of the fruits.

References

Banu, M.B., Matin, M.Q.I. and Hossain, T. 2009. Flowering behaviors and flower morphology of passion fruit. International Journal of Sustainable Crop Production 4: 5-7. Bernacci, L.C., Soares-Scott, M.D., Junqueira, N.T.V., Passos, I.R.D.S. and Meletti, L.M.M. 2008. Passiflora edulis Sims: the correct taxonomic way to cite the yellow passion fruit (and of others colors). Revista Brasileira de fruticultura 30(2): 566-576. Chai, T.B. 1979. Passion Fruit Culture in Malaysia: Fruit Research Branch. Malaysia: Malaysian Agricultural Research and Development Institute (MARDI). Chen, L.J., Liu, K.W., Xiao, X.J., Tsai, W.C., Hsiao, Y.Y., Huang, J. and Liu, Z.J. 2012. The anther steps onto the stigma for self-fertilization in a slipper orchid. PLoSONE 7: e37478. Cox, J.E. 1957. Flowering and pollination of passion fruit. Agricultural Gazette of New South Wales 68: 573-576. Das, M., Hossain, T., Mia, M., Ahmed, J., Kariman, A. and Hossain, M. 2013. Fruit setting behaviour of passion fruit. American Journal of Plant Sciences 4(5): 1066-1073. Haddad, O. and Figueroa, M. 1972. Estudio de la floración y fructificación en parcha granadina P. quadrangularis L. Agronomia Tropical 22: 483-496. Joy, P.P. and Sherin, C.G. 2013. Insect Pests of Passion Fruit (Passiflora edulis): Hosts, Demage, Natural Enemies and Control. India: Kerala Agricultural University. Kishore, K., Pathak, K.A., Shukla, R. and Bharali, A. 2010. Studies on floral biology of passion fruit (Passiflora spp.). Pakistan Journal of Botany 42: 21-29. Krosnick, S.E. and Freudenstein, J.V. 2005. Monophyly and floral character homology of old world Passiflora. Systematic Botany 30: 139-152. Lim, T.K. 2012. Passiflora edulis. In: B.V. Media. Edible Medicinal and Non-Medicinal Plants, Springer Science, Germany. Pp. 47-163. Meier, U., Bleiholder, H., Buhr, L., Feller, C., Hacks, H., Hess, M. and Zwerger, P. 2009. The BBCH system to coding the phenological growth stages of plants-history and publications. Journal fur Kulturpflanzen 61: 41-52. Montero, D.A.V., Meletti, L.M.M. and Marques, M.O.M. 2013. Flowering behavior of five species of Passiflora cultivated at greenhouse in southeast Brazil. International Journal of AgriScience 3: 176-181. Ocampo, J., Coppens, D.G., Restrepo, M., Jarvis, A., Salazar, M. and Caetano, C. 2007. Diversity of Colombia Passifloraceae: Biogeography and an updated list for conservation. Biota Colombiana 8: 1-45. Ramaiya, S.D., Bujang, J.S., Zakaria, M.H., King, W.S. and Sahrir, M.A.S. 2013. Sugars, ascorbic acid, total phenolic content and total antioxidant activity in passion fruit (Passiflora) cultivars. Journal of the Science of Food and Agriculture 93(5): 1198-1205. Sicard, A. and Lenhard, M. 2011. The selfing syndrome: A model for studying the genetic and evolutionary basis of morphological adaptation in plants. Annals of Botany 107: 1433-1443. Souza, M.M., Pereira, S.T.N., Viana, A.P., Pereira, G.M., Junior, A.T.D. and Madureira, H.C. 2004. Flower receptivity and fruit characteristic associated to time of pollination in the yellow passion fruit Passiflora edulis Sims Degener (Passifloracea). Scientia Horticulturae 101: 373-385. Vanderplank, J. 2000. Passion Flowers. Cambridge: MIT Press. Zhang, Z.Q. and Li, Q.J. 2008. Autonomous selfing provides reproductive assurance in an alpine ginger Roscoea schneideriana (Zingiberaceae). Annals of Botany 102: 531-538.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Photosynthetic Characteristics and Instantaneous Water-use Efficiency of Sago Palms

A’fifah, A.R.1,*, Kho, L.K.1, Zurilawati, Z.2, Samsul Kamal, R.3 and Maizan, I.2 1Tropical Peat Research Institute Unit, Biology Research Division, Malaysian Palm Oil Board, 6 Persiaran Institusi, Bandar Baru Bangi, 43000 Kajang, Selangor, Malaysia. 2Crop and Livestock Integration Unit, Integration Research and Extension Division, Malaysian Palm Oil Board, 6 Persiaran Institusi, Bandar Baru Bangi, 43000 Kajang, Selangor, Malaysia. 3Breeding and Tissue Culture Unit, Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board, 6 Persiaran Institusi, Bandar Baru Bangi, 43000 Kajang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

The sago palm (Metroxylon spp.) is a crop that has been considered as an excellent source of starch in the 21st century. It is also an extremely sustainable plant with an ability to thrive in most soil conditions from peat to mineral soil, and from brackish water to fresh water (Rekha et al., 2008). It is an increasingly socioeconomically important crop in South-East Asia (Kjaer et al., 2004). It can be found from 17 S and 15-16 N latitude ranging from Thailand, Peninsular Malaysia and Indonesia to Micronesia, Fiji and Samoa in the Pacific region (McClatchey et al., 2006). It is grown commercially in plantations in Indonesia⁰ and Malaysia.⁰ Sago has been used as a staple food and its starch is commercially used as an ingredient in foods such as fish crackers, baked goods, puddings and used in the manufacture of other food products (Shin and Collins, 2015).

According to Beccari (1918), there are two recognized species of Metroxylon (i.e. Metroxylon sagu, a spineless variety, and Metroxylon rumphii, the spiny variety). In 1986, Rauwerdink merged the two species into M. sagu based on the fact that seeds from spineless palms can produce spiny seedlings (Rauwerdink, 1986; Ehara et al., 1998) or vice versa, spineless seedlings from spiny seeds (Jong, 1995). It grows in the natural peat swamps of Sarawak and elsewhere in the Malay-Indonesian archipelago under wild and semi-wild conditions.

The economic yield of sago is the starch accumulation in the trunk. Starch yield in a sago palm is estimated about 200 kg/trunk and about 10-25 t/ha (Flach, 1980). It can store approximately 300 kg (dry weight) of starch per palm (Ehara et al., 2005; Azhar et al., 2018a). The accumulation of starch in sago palm depends on carbon dioxide (CO2) assimilation in the leaf through the photosynthesis process. Sago palm increases photosynthetic capacity and facilitates stable sago production under sufficient amount of water (Azhar et al., 2018b). During trunk formation, starch accumulation is strongly limited by the leaf photosynthesis under the canopy (Flach and Schuiling, 1991). Previous studies reported that the photosynthetic rate in spineless sago palm after trunk formation was higher than in younger stage and prior to trunk formation in sago (Miyazaki et al., 2007). Very few studies have explored the photosynthetic gas exchange in different sago species. Therefore, the aim of this study was to examine the leaf gas exchange, leaf characteristics and vegetative growth between spineless and spiny sago palms during trunk formation. The findings of this study will help to provide information for the production of different sago palm species.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Experimental site and planting materials

This experiment was conducted at the Malaysian Palm Oil Board (MPOB) Sago Research Station Penor in Pahang, Peninsular Malaysia 3° 41' 4.9992'' N and 103° 15' 53.6472'' E. Sago palms were planted in April 2010 on compacted peat. This area was considered as shallow peat and sago palms were planted at a density of 136 palm/ha. The planting materials used in this experiment consist of the spiny and spineless varieties. Each sago palm species consists of three replications. The spineless and spiny sago palms were obtained from Peninsular Malaysia and Sarawak, respectively. The measurement was made in February 2018. Sago palms were about eight years old during the measurement time.

Vegetative growth

Quantitative morphological variables of sago palm were determined by measuring palm height, trunk diameter, rachis length, number of leaflets and total number of green fronds in the crown. Palm height was measured based on tangen method in three points measurements (i.e first point was shooted at a convenient point on the trunk to get the baseline distance, ii) second point was shooted at the base of palm and iii) third point was shooted to the top of the palm) using a laser rangefinder (Forestry Pro Rangefinder, NIKON). Trunk diameter at 100 cm from soil surface of palm was measured by using a trunk caliper. Rachis length from frond 3 was measured using a measuring tape and similar frond was used to determine the total number of leaflets. The total number of green fronds was determined according to leaf arrangement of sago palm.

Leaf gas exchange

Leaf gas exchange measurement such as photosynthetic rate (PN), stomatal conductance (gs), intercellular CO2 concentration (ci) and transpiration rate (Tr) were made with a portable photosynthesis system (LI- 6400xt, LI-COR, Lincoln, NE, USA) between 0900 and 1100 h local time together with the following - benchmark parameters: 400 μmol CO2 with photosynthetic photon flux density (PPFD) of 1,000 µmol m 2 -1 s . The instantaneous water use efficiency (WUE) was calculated by PN/Tr. The measurement was made on the most active leaflets or the 3rd frond position from the top of the palm. Three different leaflets from the frond 3 were chosen for the measurement.

Leaf characteristics

Leaf relative chlorophyll content

Relative chlorophyll content was measured on the same leaflets for gas exchange measurement by using a portable chlorophyll meter (SPAD 502 Minolta Camera Co., Osaka, Japan).

Relative water content and specific leaf area

Six leaflets from frond 3 were sampled, cut into 20 small leaf discs (diameter 0.55 cm) and immediately weighed to determine their fresh weight. Leaflets discs were subsequently immersed in deionised water for 4 h. The leaf discs were reweighed after blotting using paper towels to dry and then dried in the oven at 70 C for 24 h to determine their dry weight. Relative water content (RWC) was obtained using the following equation: ⁰

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

To estimate푅푊퐶 specific = (퐹푟푒푠ℎ leaf area 푤푒푖푔ℎ푡 (SLA), − 푑푟푦the 푤푒푖푔ℎ푡)similar leaf⁄(푇푢푟푔푖푑 discs 푤푒푖푔ℎ푡for RWC − 푑푟푦determination 푤푒푖푔ℎ푡) x were100 used. The SLA was calculated as the ratio between leaf area and leaf dry mass of the leaf disc with slight modification according to Hoffmann et al. (2005).

Statistical analysis

The comparison of means was performed by T-test method at P<0.05 using the SAS version 9.0.

Results and Discussion

Leaf gas exchange and instantaneous water use efficiency

The photosynthetic gas exchange parameters showed significant differences (P≤0.05) between spineless and spiny sago palm (Table 1). The stomatal conductance (gs), intercellular CO2 concentration and transpiration rate were lower at 30, 16 and 22%, respectively in spiny sago palm compared to the spineless sago palm. However, photosynthetic rate in both sago palms was similar. In this study, lower gs in spiny sago palm reduces water loss through transpiration resulted in higher instantaneous WUE (31%) compared to spineless sago. This result indicates that spiny sago palm uses water efficiently for photosynthesis.

Table 1: Leaf gas exchange parameters of spineless and spiny sago palms. Sago species Photosynthetic Stomatal Intercellular Transpiration Instantaneous WUE rate conductance CO2 rate (μmol CO -2 -1 2 -1 -2 -1 2 (μmolm s ) (molm- s ) concentration assimilated/mmol of -2 -1 (mmolm s ) (μmolm s ) H O loss) 2 Spineless 12.05a 0.20a 270.99a 2.27a 5.42b Spiny 12.46a 0.14b 226.68b 1.75b 7.11a Means within the column with similar letter indicates no significant difference at P≥0.05.

Leaf characteristics and vegetative growth

Relative chlorophyll content in both sago species was not different since both materials received similar nutrient (Table 2). RWC in spiny sago was significantly higher (13%) compared to spineless sago. This result indicates that spiny leaves were more turgid and had higher water content compared to spineless sago. This result also suggests that spiny sago palm might be able to minimize stress by maintaining turgid leaves during stress condition and allows sago palm to grow, maintain photosynthesis and photochemistry in the leaves. Lisar et al. (2012) reported that reduction in the RWC led to decrease in photosynthesis of higher plants. SLA is the ratio of leaf area to dry mass. Spiny sago palm had significantly lower (17%) in SLA as compared to spineless sago palm. This result suggests that spiny sago might be able to reduce water loss from the evaporative surface during stress condition (Hayatu and Mokhtar, 2010). Vegetative growth of both species showed similar characteristics (Table 3).

Table 2: Leaf characteristics of spineless and spiny sago palms. Sago species Relative chlorophyll content Specific leaf area Relative water content (SPAD unit) (cm2/g) (%) Spineless 77.92a 97.94a 73.23b Spiny 73.00a 81.17b 82.98a Means within the column with similar letter indicates no significant difference at P≥0.05.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 3: Morphological characteristics of spineless and spiny sago palms determined in February 2018. Growth characteristics Spineless sago Spiny sago Height (m) 9.13a 9.10a Trunk diameter (cm) 50.33a 55.67a Rachis length (m) 5.24a 5.57a Number of leaflets 133a 135a Total number of green fronds 15a 15a Means within the row with similar letter indicates no significant difference at P≥0.05.

Conclusion

Photosynthetic gas exchanges were significantly different between spineless and spiny sago palm during trunk development. Higher photosynthetic rate with lower transpiration rate in spiny sago palm resulted in high instantaneous WUE may enhance dry matter production. Therefore, spiny sago palm species could be a potential planting material for higher starch productivity.

References

Azhar, A., Makihara, D., Naito, H. and Ehara, H. 2018a. Photosynthesis of sago palm (Metroxylon sagu Rottb.) seedling at different air temperatures. Agriculture 8: 4. Azhar, A., Makihara, D., Naito, H. and Ehara, H. 2018b. Evaluating sago palm (Metroxylon sagu Rottb.) photosynthetic performance in waterlogged conditions: utilizing pulse-amplitude modulated (PAM) fluorometry as a waterlogging stress indicator. Journal of the Saudi Society of Agricultural Sciences. In Press. Beccari, 1918. Asiatic palms, Lepido-cayeae (Part 3): Metroxylon Rottb. Annals of the Royal Botanic Gardens, Calcutta 12: 156-195. Ehara, H., Komada, C. and Morita, O. 1998. Germination characteristics of sago palm seeds and spine emergence in seedlings produced from spineless palm seeds. Principes 42: 212-217. Ehara, H, Naito, H. and Mizota, C. 2005. Environmental factors limiting sago production and genetic variation in Metroxylon sagu Rottb. In: Karafir, Y.P., Jong, F.S. and Fere, V.F. (edition), Sago. Flach, M. 1980. Comparative ecology of the main moisture-rich starchy staples. In: Stanton, W.R. and Flach, M. (edition), Sago, the Equatorial Swamp as a Natural Resource. Proceedings of the Second International Sago Symposium) Martinus Nijhoff (Boston). Pp. 110-127. Flach, M. and Schuiling, D.L. 1991. Growth and yield of sago palms, in relation to their nutritional needs. Towards Greater Advancement of the Sago Industry in the 1990s. Proceedings of the 4th International Sago Symposium, August 6-9, 1990, Kuching, Sarawak, Malaysia. Ministry of Agriculture and Community Development, Sarawak, and Department of Agriculture, Sarawak, Malaysia. Pp. 103-110. Hayatu, M. and Mukhtar. 2010. Physiological responses of some drought resistant cow pea genotypes (Vigna unguiculata (L.) Walp) to water stress. Bayero Journal of Pure and Applied Sciences 3: 69-75. Hoffmann, W.A., Franco, A.C., Moreira, M.Z. and Haridasan, M. 2005. Specific leaf area explains differences in leaf traits between congeneric savanna and forest trees. Functional Ecology 19: 932-940. Jong, F.S. 1995. Research for the development of sago palm (Metroxylon sagu Rottb.) cultivation in Sarawak, Malaysia. Wageningen Agriculture University. Kjaer, A., Barfod, A.S., Amussen, C.B. and Seberg, O. 2004. Invegstigation of genetic and morphological variation in the sago palm (Metroxylon sagu; Arecaceae) in Papua New Guinea, Annals of Botany 94: 109-117.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Lisar, S.Y.S., Motafakkerazad, R., Hossain, M.M. and Rahman, I.M.M. 2012. Water Stress in Plants: Causes, Effects and Responses, Water Stress, Ismail M.M. Rahman, Intech Open, DOI: 10.5772/39363. Available from: https://www.intechopen.com/books/water-stress/water-stress- in-plants-causes-effects-and-responses. McClatchey, W., Manner, H.I. and Eleventh, C.R. 2006. Metroxylon amicarum, M. paulcoxii, M. sagu, M. salomonense, M. vitiense and M. warburgii (sago palm), In: Elevitch, C.R. (edition). Miyazaki, A., Yamamoto, Y., Omori, K., Pranamuda, H., Gusti, R.S., Pasolon, Y.B and Limbongan, J. 2007. Leaf photosynthetic rate in sago palms (Metroxylon sagu Rottb.) grown under field conditions in Indonesia. Japanese Journal of Tropical Agriculture 51: 54-58. Palm Development and Utilization: Proceedings of the 8th International Sago Symposium. Universitas Negri Papua Press, Manokwari. Pp. 93-103. Rauwerdink, J.B. 1986. An essay on Metroxylon, the sago palm. Principes 30: 165-180. Rekha, S.S., John, F.K., Sajilata, M.G., Agnieszka, K., Charles, J.K. and Putri, F.A. 2008. Industrial production, processing, and utilization of sago palm-derived products. Carbohydrate Polymers 72: 1-20. Shin, C. and Collins, J.T. 2015. The sago terminology among the melanau of Sarawak (Malaysia). Mediterranean Journal of Science 6: 136-144.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A Preliminary Study on Propagation Systems to Induce Shoot-bud Proliferation of Arundina graminifolia

Sakinah, I.1,*, Che Radziah, C.M.Z.1, Ab. Kahar, S.2 and Wan Rozita, W.E.2 1School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. 2Horticulture Research Centre, Malaysian Agricultural Research and Development Institute, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Arundina graminifolia is commonly known as bamboo orchid. Bamboo orchid is a terrestrial perennial orchid with erect stem, forming into large clumps growing to a height between 70 cm to 2 m, leaves are long and narrow and flowers are purple red or white petals (Das et al., 2013). It is widely distributed in Southeast Asia, from the Himalayas to western Indonesia (Hong et al., 1983). Currently, Malaysian Agricultural Research and Development Institute (MARDI) had produced a new hybrid of A. graminifolia which has good characteristic and at the same time has the potential to be commercialised (Wan Rozita, and Rozlaily, 2015). The new hybrid of A. graminifolia has a modest height with a more attractive, unique flower colour and shape (Wan Rozita and Rozlaily, 2015). Thus A. graminifolia has received high demand from Kuala Lumpur City Hall (DBKL), local authority and housing developers as a landscape plant. Therefore, a study on mass propagation of the new hybrid of A. graminifolia should be carried out.

Commonly, A. graminifolia is propagated through seed, division of the root mass or aerial plantlet and in vitro culture technique. Propagation through seeds produced the not true-to-type plant. Propagation of Arundina spp. has been reported through seed culture (Bhadra et al., 2005; Chen et al., 2006), while propagation through division of the root mass or aerial plantlet are very limited and requires a longer time. Meanwhile, in vitro culture techniques have been done by many researchers (Bhadra et al., 2005; Chen et al., 2006; Martin, 2007; Das et al., 2013) but take a long growth period and require an effective protocol. However, no researches have been tried through conventional propagation on A. graminifolia.

Stem cutting in the closed capillary propagation system (CCPS) has been shown to be very successful in the propagation of tree species (Ab. Kahar et al., 2009). Similar approach could be adopted in A. graminifolia. The present study aimed to evaluate the shoot-bud proliferation of A. graminifolia using the alternative methods; the capillary propagation system (CPS) and permanent immerse system (PIS).

Materials and Methods

This study was conducted in the nursery with 90% level of shade, at MARDI, Serdang, Selangor. Four different propagation systems were evaluated on A. graminifolia D. Don. Hochr. and the physical properties were showed in Table 1.

Arundina graminifolia was obtained from MARDI, Serdang. Three node cuttings about 10-12 cm long were used as explants. All leaves on the cuttings were removed and washed in running tap water for 20 min. The explants were soaked with 10% (v/v) clorox solution for 10 min and mixed two point of twenty- 20 solution to disinfect the germs in the explants before planting.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Physical properties of propagation systems used in this study. Closed capillary Open capillary Closed permanent Open permanent propagation system propagation system immerse system immerse system (CCPS) (OCPS) (CPIS) (OPIS) Material Clear disposable Clear disposable Clear disposable Clear disposable plastic cup plastic cup plastic cup plastic cup (14.4 x 11.4 cm, (14.4 x 11.4 cm, (14.4 x 11.4 cm, (14.4 x 11.4 cm, 1 L volume) 1 L volume) 1 L volume) 1 L volume)

Medium Peat-moss + Sand Peat-moss + Sand Distilled water Distilled water (8:2 v/v) (8:2 v/v)

Part Two separate part, Two separate part, One part for the One part for the the upper part is for the upper part is for water reservoir water reservoir the medium for the medium for explants planting explants planting material and the material and the lower part is for lower part is for water reservoir water reservoir

Place at nursery In polystyrene box Under In polystyrene box Under (48.2 x 35.6 x 37 cm) 90% (48.2 x 35.6 x 37 cm) 90% under 90% shade level Under 90% shade level shade level shade level

Temperature 37±2 35±2 36±2 35±2 (°C)

Relative humidity 90±3 50±5 94±3 50±5 (%)

Light 50-100 100-200 50-100 100-200 (μmol m2/s1) Measurements for temperature, relative humidity and light were taken on a clear sunny day between 12:00 pm until 2:00 pm in propagation system environment.

The experiment was performed in Randomized Complete Block Design (RCBD) with four replications and each replicate consist of thirty cuttings. The experiments were repeated twice. Data on shoot width and shoot height was measured using a digital caliper (Mitutoyo 0.01 mm). Number of leaves was counted at fourth weeks. Meanwhile, survival rate of cutting and percentage of shoot-bud response were calculated weekly after planting (survival rate of cutting or shoot-bud response divided by total number of cuttings used and multiplied by 100). Data on the effects of different propagation systems was subjected to analysis of variance (ANOVA) using SAS software version 9.3 and tested for significance using Least Significant Difference (LSD) at P≤0.05. Data from the treatments were represented as mean ± standard error.

Results and Discussion

After four weeks of propagation system, the percentage of survival rate and percentage of shoot-bud proliferation response were obtained (Figure 1 and 2). At this stage, CPIS gave the highest percentage of survival rate (100%) followed by CCPS (96%), OPIS (93%) and OCPS (86%). Meanwhile, percentage of shoot-bud proliferation in OPIS gave the highest response (93%) followed by CPIS (88%), CCPS (83%) and OCPS (73%). All systems used in this experiment showed a good finding to improve shoot-bud

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

proliferation within a month compared to Das et al. (2013) and Martin, K.P. (2007). According to Das et al. (2013), only 50% explants showed positive response and took 40-42 days for bud proliferation. Martin, K.P. (2007) has also established micro propagation of Arundina through PLBs using node explant and 89% conversion of PLBs to shoot at two months.

As shown in Table 2, shoot measurements such as shoot width, shoot height and number of leaves initiated, were generally highest and lowest in CPIS and OCPS, respectively. Survival rate of cutting can be enhanced if the cutting propagation was conducted in appropriate season, temperature and humidity, cutting medium and optimal processing of hormone (Shaorong et al., 2013). These results showed that shoot-bud proliferation of A. graminifolia was better in water than in growing media. The close system which maintained high humidity improved the survival.

100 95 90 85 80 75 Survival rate (%) rate Survival 70 1 2 3 4 week OPIS OCPS CPIS CCPS

Figure 1: Survival rate of A. graminifolia in four different propagation systems.

100

20 Shoot-bud respone (%) respone Shoot-bud 0 0 1 2 3 4 week

OPIS OCPS CPIS CCPS

Figure 2: Shoot-bud response in nodal explant of A. graminifolia in four different propagation systems.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Effect of different propagation systems on shoot formation in nodal explant of A. graminifolia (Data collected after four weeks).

Propagation system Shoot width Shoot height Number of leaves Closed capillary propagation system (CCPS) 2.72±0.08ᵇᶜ 9.06±0.81ᵃ 3.16±0.14ᵃᵇ

Open capillary propagation system (OCPS) 2.59±0.08ᶜ 6.79±0.57ᵇ 3.00±0.21ᵇ

Closed permanent immerse system (CPIS) 3.01±0.07ᵃ 10.76±0.85ᵃ 3.43±0.11ᵃ

Open permanent immerse system (OPIS) 2.91±0.06ᵃᵇ 8.93±0.75ᵃᵇ 3.28±0.38ᵃᵇ Means with the same letter(s) within the column do not differ significantly according to LSD (p<0.05) Mean±SE.

Conclusion

Our results showed that the selection of suitable propagation system is vital in propagating A. graminifolia. In this study, Close Permanent Immerse System (CPIS) is an efficient propagation technique derived which may be useful for mass production of A. graminifolia in a short time for commercial purposes at the lowest cost.

References

Ab. Kahar, S., Hanim, A. dan Zulhazmi, S. 2009. Sistem pembiakan kapilari tertutup untuk pembiakan dengan keratan batang. Buletin Teknologi Tanaman. Bilangan 6: 9-14. Bhadra, S.K. and Bhowmik, T.K. 2005. Axenic germination of seeds and rhizome-based micropropagation of an orchid A. graminifolia (D. Don.) Hochr. Bangladesh Journal of Botany 34: 59-64. Chen, Z.l., Zeng, S.J., Wen, T.l. and Duan, J. 2006. Asepsis sowing and in vitro propagation of Arundina graminifolia D. Don. Hochr. Plant Physiology Communications 42: 66. Das, S., Choudhury, M.D. and Mazumder, P.B. 2013. In vitro propagation of A. graminifolia D. Don. Hochir- A bamboo orchid. Asian Journal of Pharmaceutical and Clinical Research 6: 156-158. Hong, D.Y., Lian, Y.S. and Shen, L.D. Orchidaceae. 1983. In Flora of China; Chinese Science Press: Beijing, China Volume 73: 320. Martin, K.P. 2007. In vitro propagation of A. graminifolia through PLBs. Propagation of Ornamental Plants 7(2): 97-100. Shaorong, C., Ying Jing, L.I., Yumeng, H., Ruomin, C., Xuelin, S. and Ning, X. 2013. The study on the cutting propagation system of Lonicera hypoglauca Miq. Medicinal Plant 5(1): 57-63. Wan Rozita, W.E. and Rozlaily, Z. 2015. Assesment of genetic variation in Arundina raminifolia D. Don. Hochir. using AFLP markers. 2ndInternational Congference on Crop Improvement, hlm. 75.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Microscopic Identification of Two Important Varieties of Labisia pumila in Peninsular Malaysia

Syafiqah Nabilah, S.B.*, Farah Fazwa, M.A., Norhayati, S. and Ummu Hani, B. Plant Improvement Program, Forestry Biotechnology Division, Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Labisia pumila is also known as Kacip Fatimah, selusoh Fatimah, rumput Siti Fatimah, kacit Fatimah, pokok pinggang, rumput palis, tadah matahari and mata pelanduk rimba in different parts of Malaysia (Noraida, 2005; Ong, 2006). It is used in Malaysia for many generations to induce and facilitate childbirth, treat menorrhagia and as a post-partum tonic (Intan and Nik, 2015). At least four varieties of L. pumila can be found in Malaysia but only three are regularly reported, namely var. alata, var. pumila and var. lanceolata (Sunarno, 2005; Jamia, 2006; Chua et al., 2011). It was disclosed that either L. pumila var. alata or L. pumila var. pumila could be an effective medicine while the medicinal properties of L. pumila var. lanceolata is less reported. This species can be found in various regions spreading from Thailand, Indochina, Peninsular Malaysia to Sumatra in Borneo, Java, Philippines and New Guinea (Sunarno, 2005).

There are two varieties of L. pumila which can be distinguished by their broad winged petiole (leaf stalk) characteristics for variety alata and marginated winged petiole for pumila (Farah Fazwa and Syahida Emiza, 2015). The differentiation based on petiole characteristics can be confusing due to unfamiliarity with the different parts of leaf structure. This study aims to provide general information on microscopic identification of L. pumila var. alata and L. pumila var. pumila.

Materials and Methods

Microscopic identification

The fresh specimen of leaf and petiole of each varieties used in this study (Figure 1) was collected at Herbs and Tree Branch, FRIM, Kepong, Selangor, Malaysia. Specimens were fixed in a 3:1 Acetyl Alcohol (AA) solution (70% ethanol: 30% acetic acid), sectioned using a sliding microtome through the leaf and petiole parts and stained in Safranin (Sigma-Aldrich, India) and Alcian Blue (R&M Chemical, Essex, UK.). Following dehydration process in a series of ethanol solutions (50%, 70%, 95% and 100%), the sections were mounted on slides using Euparal (R&M Chemical, UK) and placed in the oven at 60ºC for two weeks. Fixation and embedding followed the method by Johansen (1940) and Sass (1958) with suitable modifications. Photomicrographs of the leaf and petiole sections were captured and processed using CellSens Standard software (Olympus Soft Imaging Solutions GmbH, Münster, Germany).

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A B

3 cm 3 cm 3 cm Figure 1: Microscopic characteristic of leaf and petiole: A. Labisia pumila var. alata; B. Labisia pumila var. pumila.

Results and Discussion

Observations were made on the outline structure of the petiole, midrib and margin parts of the two taxa. Findings showed that there are variations in the anatomical characteristics that can be used to differentiate between the two taxa (Table 1). In the petiole cross section (Figure 2), the wings structure of Labisia pumila var. alata approximately ±1200 µm length and 200 µm width compared to Labisia pumila var. pumila ±500 µm length and 200 µm width. Sclerenchyma cells were found abundance in Labisia pumila var. pumila specifically around the vascular bundle, wing and parenchyma cell. The major function of sclerenchyma cells is to provide support in plant through a thick cell wall (Showalter, 1993). Usually, botanist will press the petiole area to recognize the varieties. The one with sturdy petiole were identify as variety pumila while variety alata has slightly soft petiole when pressed with finger (Farah Fazwa and Syahida Emiza, 2015). The presence of sclerenchyma cells at the wing area in variety pumila made the petiole stronger than variety alata.

Labisia pumila var. alata Labisia pumila var. pumila

Petiole Petiole

Wing

Sclerenchyma cells Figure 2: Comparisons of petiole cross section between two important varieties of Labisia pumila.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Cross-section identification of different varieties of Labisia pumila leaf. Labisia pumila No. Microscopic characteristics var. alata var. pumila 1. Petiole cross-section Outer form Adaxial surface Concave Concave Abaxial surface Approaching “U” shape Approaching “U” shape Wing Present, ±1200 µm length and 200 µm width Present, ±500 µm length and 200 µm width Vascular tissue Close system, present of medullary vascular and accessory Close system, present of medullary vascular and bundles accessory bundles Sclerenchyma cell Present around vascular bundle Present, very dense at vascular bundle, wing and parenchyma cell Starch Present, dense distribution Present, very dense distribution Resin ducts Present, dense distribution Present, dense distribution Types of trichomes Glands; capitate and peltate types Glands; capitate and peltate types Types of crystals Solitary and druse form Solitary and druse form 2. Midrib cross section Outer form Adaxial surface Convex Convex Abaxial surface Arc shape Convex about ½ - ¾ circle Vascular tissue Close system, present of medullary vascular and accessory Close system, present of medullary vascular and bundles accessory bundles Starch Present, dense distribution Present, dense distribution Resin ducts Present, dense distribution Present, dense distribution Types of trichomes Glands; capitate and peltate types Glands; capitate and peltate types Types of crystals Solitary and druse form Solitary and druse form 3. Margin Tapering and pointing downward Rounded and straight Outer form 4. Lamina Epidermis layer One layer of cell Height & width ratio 1:2 Clorenchyma cell One layer of palisade cell (=1/4 thickness of cell); sponge mesophyll consist of 5-6 layer of cell; no interval between cell Types of trichomes Peltate Types of crystals Solitary and druse form

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

In midrib cross section, both taxa exhibited convex shaped on the adaxial surface (Figure 3). While, the abaxial surface shows that L. pumila var. alata developed arc shape and variety L. pumila var. pumila ¾ of circle. This finding is in line with the study conducted by Aladdin et al. (2016) on the microscopic analysis of three varieties of Marantodes pumilum (synonym: Labisia pumila).

Labisia pumila var. alata Labisia pumila var. pumila Midrib Midrib

Adaxial

Abaxial

Figure 3: Comparisons of midrib cross section between two important varieties of Labisia pumila.

The two varieties of L. pumila shared similar leaf lamina anatomical characteristics with one layer of epidermis cell in ratio 1:2 of height and width and one layer of palisade cell (1/4 thickness of cell). Both varieties have peltate trichome which functions in absorbing water and minerals. However, the two varieties could be differentiated by the marginal outline: tapering and pointing downwards in L. pumila var. alata while rounded and straight in L. pumila var. pumila. The transverse section of leaf lamina and marginal direction between the taxa is displayed in Figure 4.

Labisia pumila var. alata Labisia pumila var. pumila

Lamina Lamina

Margin Margin

Figure 4: Comparisons of leaf lamina and margin between two important varieties of Labisia pumila.

Conclusions

Results from this study provide important information and data for authentication of the different varieties of L. pumila. Cross section of the fresh plant materials would be one of the identification methods of the two varieties based on the characteristic’s differences in terms of the outline structure of leaf margin, petiole and midrib and the distribution of sclerenchyma cell. Appropriate authentication of raw materials to be used in product manufacturing is important to ensure the consistent quality, safety and efficacy of the herbal products.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Aladdin, N.A., Jamal, J.A., Talip, N., Hamsani, N.A.M., Rahman, M.R.A., Sabandar, C.W. and Jalil, J. 2016. Comparative study of three Marantodes pumilum varieties by microscopy, spectroscopy and chromatography. Revista Brasileira de Farmacognosia 26(1): 1-14. Chua, L.S., Latiff, N.A., Lee, S.Y., Lee, C.T., Sarmidi, M.R. and Aziz, R.A. 2011. Flavonoids and phenolic acids from Labisia pumila (Kacip Fatimah). Food Chemistry 127(3): 1186-1192. Farah Fazwa, M.A. and Syahida Emiza, S. 2015. Panduan Pengecaman Tiga Varieti Kacip Fatimah Melalui Ciri Morfologi Luaran. Institut Penyelidikan Perhutanan Malaysia. Kepong, Selangor. Intan, I.H. and Nik, H.N.H. 2015. Kenapa Kacip Fatimah? Dewan Bahasa dan Pustaka, Kuala Lumpur. Pp. 10-12. Jamal, J.A. 2006. Malay Traditional Medicine. Tech Monitor (Special Feature: Traditional Medicine: S and T Advancement. Pp. 37-49. Noraida, A. 2005. Penyembuhan Semula Jadi Dengan Herba. PTS Millenia Sdn. Bhd. Kuala Lumpur. 22 p. Ong, H.C. 2006. Tumbuhan Liar: Khasiat Ubatan Dan kegunaan Lain. Perpustakaan Negara Malaysia, Kuala Lumpur. 84 p. Showalter, A.M. 1993. Structure and function of plant cell wall proteins. The Plant Cell 5(1): 9. Sunarno, B. 2005. Revision of the genus Labisia (Myrsinaceae). Blumea-Biodiversity, Evolution and Biogeography of Plants 50(3): 579-597.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Air Root Pruning Improves Root Growth Performance of Lettuce (Lactuca sativa L.) Seedling

Abid, M.A.1,*, Che Radziah, C.M.Z.2, Ab. Kahar, S.1 and Farahzety, A.M.1 1Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Billions of seedlings are utilised yearly in various segments of agriculture including vegetables. High value vegetables like lettuce, celery, chilli, bell pepper and melon are practically planted through seedling transplanting. However, they are often transplanted when the roots are spiralling and overgrown. Insufficient production of new hair roots, reduce the acceleration of roots to explore the growing medium, thus increasing abiotic stress and ineffective nutrient absorption (Mathers et al., 2007). Seedling root systems have important physical and physiological roles from the onset of seed germination (radical protrusion) and emergence through subsequent seedling growth and development. Important root functions include shoot anchorage, water and nutrients uptake, and hormones production. The size, morphology or architecture of the root system may influence the relative size and growth rate of the shoot.

High quality seedlings are required to produce superior plants in a greenhouse or in the field. During transplanting, fine roots of seedlings are usually damage, affecting the plant growth (Harris and Gilman, 1993). Root pruning is essential to correct root malformation of transplanted seedlings. Transplanting success is increased with container air prune produced plants due to preservation of intact root systems when handled and transplanted (Mathers et al., 2007). Positive results have been achieved through air root pruning technique where the root tip exposure to air movement desiccates and inhibit the root tip. Marshall and Gilman (1998) also reported that corrugated sides of air root pruning containers caused an increased in number of descending roots compared to smooth sided containers. As roots get pruned, the area behind the root tip is stimulated to produce more secondary roots. The more secondary roots develop, the more efficient of nutrient absorption, enhancing the plant to grow vigorously. In other words, air root pruning inhibits root tip growth, increase secondary root branching, reduces root circling, reduces root to shoot ratio and promotes root regeneration after transplanting (Wolfe and Wolfe, 2018).

Pruning the roots of vegetables seedling through air root pruning can be adopted by using peat cube as sowing medium which can replaces conventional techniques. Very little research and scarce information on air root pruning on vegetables have been done in Malaysia, whereas the production of transplants is increasing year by year. Thus, the aim of this experiment was to evaluate the effectiveness of using peat cube as air root pruning approach compared with plug tray and root pruning container in producing a better quality root system of lettuce (Lactuca sativa L.) seedlings.

Materials and Methods

Planting materials

Commercial loose type of lettuce seed cultivar, Green Parade, produced by Green World Genetic and marketed by Leckat Seeds Sdn. Bhd. was chosen for the experiment. This cultivar is commonly sold to conventional and organic growers and widely planted in Malaysia, especially in Cameron Highlands.

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Experimental condition, treatments and design

The experiment was conducted under a protective structured nursery at the Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Serdang, Selangor, Malaysia. The protective structure was 30% shaded (PAR 889-1124 mol m-2s-1) with average temperatures and relative humidity of 27-35oC and 62-82%, respectively. Lettuce seeds were sown in three sowing conditions; seeding Plug Tray-PT with 89 holes (no air pruned), air Pruned Pot-PP (partially air pruned) and Peat Cube-PC size 38 mm x 38 mm x 38 mm (fully air pruned). Peat cube was made by hand held blocker with a special mould which is pressed into the seed flat mix and then the compressed mix is pushed out on flat trays. A seed is placed on the top of each block with light pressure, and not covered. The cubes are then watered using mist system. For peat cube to function effectively, the seed flat mix must be denser and more cohesive than the plug tray mix. When the plant starts to grow in peat cube, its roots are “air pruned”, because roots will not grow out of block and into the air. Sowing medium used was the mixture of coarse peat moss, cocopeat and fine peat moss (5:3:2, v/v). Treatments were arranged in Randomized Complete Block design (RCBD) with four replicates. A total of 100 seedlings were used for each replicate.

Root sampling and growth measurements

Lettuce seedlings root were analysed at 5 days interval started from day 10 until day 40 after sowing. Three seedlings per plot were sampled in every destructive sampling. Roots were rinsed with running tap water and the shoots were separated from root by using a scissor. Root samples were then analysed using root scanner, WinRHIZO Pro 2007b (Regent Instrument Inc., Quebec, Canada). Root growth parameters such as root weight, root length, average root diameter, root volume, root surface area, number of primary and secondary roots were recorded.

Statistical analysis

All data were subjected to one-way analysis of variance (ANOVA) and tested for significance using Least Significant Difference (LSD) at P≤0.05 (Version 9.1, 2011. SAS Institute, Cary, N.C.)

Results and Discussion

Effect of air root pruning on seedlings root growth performance

Figure 1 shows the air root pruning improved lettuce seedlings root performance (root length, root surface area, root volume, and secondary root/hair root) during 40 days of nursery stage. Root biomass for PC seedling was increased significantly started from 20 to 30 days after sowing (Figure 2). At initial stage, root length (Figure 1a) of all sowing condition was rapidly increased. However, after day 20 the root length was decreasing for all treatments. PC seedlings root was relatively longer due to contribution of secondary roots formation. However, average root diameter (Figure 1c) for PC seedlings was low due to abundant production of hair roots (Figure 1f). Advantage of this, root surface area [Figure (b)] was significantly higher where it can increase the efficiency of water and nutrients uptake (Newman, 1966). Reduced root diameter (Figure 1c) and high secondary root numbers (Figure 1f) indicate the PC seedlings were well air pruned and sufficiently received oxygen. The surrounding of peat cube is exposed to air, and roots get more oxygen, makes seedling grow healthier (Kuack, 2017), but in small container like small plug seedling experiencing insufficient of oxygen (Huang and Scott, 1999). It was suggested that lettuce seedlings are suitable to be transplanted at 15-20 days due to optimum growth condition of root.

100

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

a) b)

c) d)

3.000 a a ) )

3 2.500 a 2.000 ab b b b 1.500 a b b 1.000 b a b b b

Root volume(cm 0.500 a a b ab a 0.000 a 10 15 20 25 30 35 40 Days after sowing e) f)

Figure 1: Effects of air root pruning on seedling root growth performance of lettuce (L. sativa L.) by days after sowing. Error bars are standard errors of means. Means with different letter(s) on the bar indicate a significant difference at p<0.05 using LSD.

101

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

PT PP PC PT PP PC (a) (b) Figure 2: Visual comparison of lettuce seedling size (a) with sowing media and (b) cleaned root at day 30. PT-Plug Tray (no air pruned), PP-Air Pruned Pot (partially air pruned) and PC- Peat Cube (fully air pruned).

Conclusion

Application of air root pruning technique by using peat cube as the sowing medium has significantly improved lettuce seedlings root growth performance. Proper root system is a precondition for a better vegetables growth and establishment after transplanting. This research will increase the quality of vegetables seedling production and open up the potential for new aspects of seedling production technology in Malaysia.

Acknowledgements

The experiment was granted by the Malaysian Agricultural Research and Development Institute (MARDI) under the Ministry of Agriculture (MOA), Malaysia (Project code: P-RH21003004040001; Development of urban farming system for community sustainability). I am also thankful to many individuals who have directly or indirectly assisted me in carrying out the experiment.

References

Harris, J.R. and Gilman, E.F. 1993. Production methods affects growth and post-transplant establishment of ‘East Palatka' holly. Journal of the American Society for Horticultural Science 118: 194-200. Huang, B. and Scott NeSmith, D. 1999. Soil aeration effects on root growth and activity. Acta Horticulture 504: 41-52. Kuack, D. 2017. Dissolved oxygen improves plant growth, reduces crop time. Retrieved on 25 February 2018 from https://hortamericas.com/blog/news/dissolved-oxygen-improves-plant- growth-reduces-crop-time/. Marshall, M.D. and Gilman, E.F. 1988. Effect of nursery container type on root growth and landscape establishment of Acer rubrum L. Journal of Environmental Horticulture 16: 55-59. Mathers, H.M., Lowe, S.B., Scagel, C., Struve, D.K. and Cases, L.T. 2007. Abiotic factors influencing root growth of woody nursery plants in containers. HortTechnology 17(2): 151-162. Newman, E.I. 1966. A method of estimating the total length of root in a sample. Journal of Applied Ecology 3: 139-145. Wolfe, M. and Wolfe, D. The benefits of seed starting in soil blocks. Retrieved on 3 June 2018 from http://theprudentgarden.com/the-benefits-of-seed-starting-in-soil-blocks/2018.

102

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Crossability and Compatibility Rate in Crosses Between Semerah Chilli (Capsicum annuum) with Selected Chilli Padi Varieties (Capsicum frutescens)

Suhana, O.*, Norfadzilah, A.F., Mohd Zamri, K. and Siti Nur Hafizah, M. Horticulture Research Centre, MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Interspecific hybridization is important in developing genetically superior genotypes, it will enable to transfer of genes of interest between different species; especially those involved in disease resistance and other important traits. However, for the success of such a transfer, the species must be genetically close, minimizing incompatibility problems and thus enabling hybridization. In addition, it is important to know about the direction of the cross, because in some species, the interspecific cross is possible in one direction only (Prestes and Goulart, 1995). In this study, interspecific hybridization was carried out between two species, Capsicum annuum (the species encompasses a wide variety of shapes and sizes of peppers, both mild and hot, such as bell peppers, Jalapeno, New Mexico chilli, and cayenne peppers) and Capsicum frutescens (classified as one of the most pungent chillies in the world, next to the habanero; Capsicum chinensis). This hybridization was conducted to improve the capsaicin content of Semerah chilli which was released by MARDI in 2008 as a new ‘cili padi’ with high yielding, excellent fruiting habit and showed some degree of resistance to prevailing diseases. But, chilli Semerah has low capsicin level compared to chilli padi Thai with 6,240 SHU and 41,888 SHU, respectively (Mohd Nazrul Hisham et al., 2014).

Due to the important of interspecific hybridization for improvement of chilli Semerah, especially for increasing of capsaicin level is needed to incorporate of pungency gene from selected chilli padi to Semerah. Therefore, the objectives of this study were to estimate the crossability and compatibility in crosses between Semerah chilli (C. annuum) with selected chilli padi varieties (C. frutescens) viz; C. Kapit, C. Bara, C. Centil, C. Padi and CP02. All information can be used as guidelines for further evaluation and trial.

Materials and Methods

The crosses were performed between March and April 2018 at 8:30 am to 10:00 am. Controlled hand pollinations were performed between Semerah (C. annuum) with selected chilli padi varieties (C. frutescens) such as C. Kapit, C. Bara, C. Centil, C. Padi and CP02 as a pollen donor (male parents). Seeds of these accessions were germinated in a germination tray. After 3 weeks, all seedlings were transplanted at the vegetables experiment plot, MARDI Headquarters with 10 plants per accession per row while Semerah planted alternately with other accessions with total of 50 plants. The layout of an experiment is as in Figure 1.

To obtain the F1 hybrids, flower buds were collected from the male parents and pollen grains transferred to the stigma of the plants whose flower buds had been emasculated before pollination. After this procedure, the flowers were protected by a paper bag to avoid contamination with pollen of the other parents and the crosses were labelled. To evaluate the crossability, the number of crosses was recorded and 3 days after pollination, the crosses were examined for fruit set. Later, the number of seedless fruits and/or abnormal (empty) seeds was recorded. The fruits were picked and seeds extracted were kept for the next F1 evaluation in field.

103

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

KAPIT SEMERAH BARA SEMERAH CENTIL *10 plants/row

SEMERAH CPO2D SEMERAH PADI SEMERAH

Figure 1: Experimental layout of crossability and compatibility in crosses between Semerah (Capsicum annuum) with selected chilli padi varieties (Capsicum frutescens).

Results and Discussion

Based on the results of the 100 hand pollinations involved 20 crossed of five combinations viz; Semerah (C. annuum) x C. Kapit (C. frustescens), Semerah (C. annuum) x C. Bara (C. frustescens), Semerah (C. annuum) x C. Centil (C. frustescens), Semerah (C. annuum) x C. Padi (C. frustescens) and Semerah (C. annuum) x CP02 (C. frustescens), 20 fruits with seeds set were obtained, corresponding 20.0% fruiting rate (Table 1). The highest crossability rate was 50%, recorded between Semerah (C. annuum) x C. Kapit (C. frustescens). In this crossed, 10 fruits with average 40 seeds per fruit were successfully produced. While, Crossability rate between Semerah (C. annuum) x C. Bara (C. frustescens) and Semerah (C. annuum) x C. Padi (C. frustescens) were only 20% and produced 4 fruits for each cross with 18 and 24.5 average number of seeds respectively. The crossability percentage obtained from Semerah (C. annuum) x C. Centil (C. frustescens) was 21% and produced 2 fruits with 21 average seeds number per fruit. However, the crossed between Semerah (C. annuum) x CP02 (C. frustescens) is not successful and no fruit is produced.

Table 1: Number of pollinated flower (NPF), number of seeds set (NSS), crossability (%) (seed set percentage) (CA) and seed number/fruit number (SNF) obtained in the combinations. Female Male parent NPF NSS CA (%) Seed SNF parent Set (Average) Semerah x Semerah C. Kapit 20 10 50 40 C. Kapit Semerah x Semerah C. Bara 20 4 20 18 C. Bara Semerah x Semerah C. Centil 20 2 10 21 C. Centil Semerah x Semerah C. Padi 20 4 20 24.5 C. Padi Semerah x Semerah CP02 20 0 0 0 CP02

104

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Based on these results, it can be concluded that interspecific hybridization between Semerah (C. annuum) and C. Kapit, C. Bara, C. Centil, C. Padi and CP02 (C. frutescens) gives some indication on possibility of interspecific hybridization between C. annuum and C. frutescens for improving chilli quality in terms of pungency level. Further evaluation with more combinations of varieties will be added in future study.

Acknowledgements

The author wishes to thank Mr. Mohd Zamri Kamarudin and Miss Siti Nur Hafizah Masdar for their assistance in conducting the trial. The author also wishes to thank MARDI Development Fund for funding this project (P-RH403-1001).

References

Mohd Nazrul Hisham, D., Mohd Lip, J., Saiful Bahri, S., Norfadzilah, A.F., Suhana, O. and Nurul Nabilah, M.F. 2014. Kaedah mudah penentuan indeks kepedasan cili. Buletin Teknologi MARDI, Bilangan 6: 115-120. Prestes, A.M. and Goulart, L.R. 1995. Transferência de resistência a doenças de espécies silvestres para espécies cultivadas. Revisão Anual de Patologia de Plantas 3: 315-363.

105

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Growth Performance of Acacia Species on Beach Ridges Interspersed with Swales (Bris) Soils

Dasrul Iskandar, D.*, Lok, E.H., Faridah, A.A., Rosdi, K. and Amir, S. Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Acacia species especially Acacia mangium has been planted in forest reserves and state lands throughout the country and was proven very adaptable to a wide range of sites/soils. Besides commercial planting on fertile forest soils, Acacia species were also tested on mining lands in Selangor and Perak and BRIS soils (Beach Ridges Interspersed with Swales) in the states of Terengganu and Pahang. Due to a lack of cultivable land, increasing populations, and urge to improve the standard of living of inhabitants in the coastal area especially in Terengganu, there is a need to develop a viable plantation project. So far not many forest species have been proven to be suitable and economical for BRIS soil. The objective of these studies is to evaluate the growth performance of four years-old A. mangium, A. auriculiformis and Acacia hybrid trees on two different BRIS soil series at Setiu, Terengganu.

Materials and Methods

Study area

The experiment was conducted in Setiu on two types of BRIS soil, Rhu Tapai and Rhu Dua series. The land area was flat formerly occupied by coastal shrubs mainly Melaleuca and Casuarina species. They were cleared off prior to planting. The texture of the soil was more than 98% sand, poor in nutrient content and during the dry period, the soil temperatures of the surfaces can cause leaf scorching and wilting of the plant. The pedological features of Rhu Dua soil series are moderately deep, sandy soils, structureless and single grained, yellowish brown in colour and spodic horizon at 80 cm depth. Whereas, Rhu Tapai soil series is a young soil without a podogenetic horizon. It is found near the sea and has high sand with a quartz composition (Amir et al., 1999; Mohd. Ghazali et al., 2007).

Experimental plots

Five sample plots of 30 m x 30 m were established in the Rhu Tapai series and another five sample plots similar in size were also established in Rhu Dua series. In each sampel plot, the Rhu tapai and Rhu dua series of four years-old A. mangium, A. auriculiformis and Acacia hybrid were mixed planted. Within each plot, the 3 type acacias species were planted with 3 m x 3 m spacing (equivalent to100 trees/plot). Measurement was done at 6 months intervals month. The parameters measured are for total heights and diameters at breast height (dbh). The Yamayo Million 12 Diameter Tape was used for the diameter measurement. Meanwhile, the Haglox Vertex III Measurement Device was used for the total height measurement. Statistical analysis of differences between treatments was analysed using SAS version 9.1 PROC GLM (General Linear Model) and the significant level was set at 0.05.

Results and Discussion

Total height

The mean height performance of four years old A. mangium, A. auriculiformis and Acacia hybrid trees on two different BRIS soil series, Rhu Tapai and Rhu Dua were established (Figure 1). The growth performances of four years old Acacia spp. and Acacia hybrid trees were slightly better on Rhu Tapai

106

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

than Rhu Dua series. The mean height performance of A. mangium trees planted on Rhu Tapai were highly significant at 13.60 mm tall followed by Acacia hybrid and A. auriculiformis, 12.84 m and 12.44 m respectively. A similar pattern was observed on Rhu Dua soil series, where A. mangium (12.83 m) were also significantly different from the rest of the species tested.

Figure 1: Mean height performance of four years old Acacia species and Acacia hybrid trees planted on different BRIS soil series.

Diameter measurement

The mean diameter performance of four years old A. mangium, A. auriculiformis and Acacia hybrid trees on two different BRIS soil series, Rhu Tapai and Rhu Dua were obtained (Figure 2). The mean diameter performance of A. mangium on Rhu Tapai was 11.10 cm, a significantly diffrent in size compared to the mean diameter of Acacia hybrid (10.82 cm) and A. auriculiformis (10.31 cm). Similar results were observed at Rhu Dua soil series where the average diameter of A. mangium was slightly bigger (11.92 cm) than Acacia hybrid and A. auriculiformis trees, 10.81 cm and 10.15 cm.

Figure 2: Mean diameter performance of four years old Acacia species and Acacia hybrid trees planted on different BRIS soil series.

107

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusions

The results of this study demonstrate that A. mangium, A. auriculiformis, and Acacia hybrid can be planted on BRIS soils. The results have shown marked differences among Acacia species in their performances in term of height and diameter growth. A. mangium trees planted on both Rhu Tapai and Rhu Dua series performed better and taller than A. auriculiformis and Acacia hybrid trees. While amongst A. auriculiformis and Acacia hybrid trees, they were relatively uniformed in height growth. The results have also revealed that all Acacia species planted on Rhu Tapai study plots were significantly taller than Rhu Dua series. The results also indicate clear differences in diameter sizes which A. mangium trees were larger in diameter followed by Acacia hybrid and A. auriculiformis. Acacia mangium trees were uniformed in diameter growth on both sites whereas Acacia hybrid and A. auriculiformis performed better on Rhu Tapai series. The results obtained from this study are very important for future reforestation programme on BRIS soils. The ability of A. mangium, A. auriculiformis, Acacia hybrid to grow on BRIS soils will help local farmers to produce general utility timbers and fuel wood for their own consumption.

References

Abd. Wahab, N., Othman, A.B. and Amininuddin, Y. 1990. BRIS soil - Characteristics, Constraint and Methods of Improvement. Paper presented in the National Seminar on Ex - Mining Land and BRIS soil Prospect and Profit. Amir, H.M.S., Suhaimi, W.C., Adzmi, Y. and Mohd. Ghazali, H. 1992. Which Canopy tier should be sample to determine the fertility (nutritional) status of A. mangium on BRIS soil? Journal of Tropical Forest Science 6(1): 48-55. Darus, A. and Ab. Rasip, A.G. 1989. A note on the Acacia hybrids in forest plantation in Peninsular Malaysia. Journal of Tropical Forest Science 2(2): 170-171. Mohd, G.H., Wan Rasidah, K., Rosazlin, A., Rosdi, K. and Ab. Rasip, A.G. 2007. Growth of Acacia hybrid (A. mangium × A. Auriculiformis) on coastal sandy soil. Journal of Tropical Forest Science 19(4): 243-244.

108

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Growth and Inflorescence Development of Several Cauliflower (Brassica oleracea var. botrytis L.) Hybrids in Malaysian Environment

Norfadzilah, A.F.*, Suhana, O., Farahzety, A.M., Nur Adliza, B., Nur Syafini, G., Rozlaily, Z., Ilyas, K., Nur Fatin, M.S. and Mohd. Raimi, A.K. Vegetable Program, Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), P.O Box 12301, General Post Office, 50774 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Cauliflower (Brassica olearacea var. botrytis L.) is one of the various B. olearacea derivatives which were originated from Europe and Asia. In addition to cauliflower, other cultivars in this species are cabbage (B. oleracea var capitata L.), broccoli (B. oleracea L. var. italica Plenck), kale (B. oleracea var. viridis L.), kohlrabi (B. oleracea var. gongylodes) and kailan (B. oleracea var alboglabra). This group of plants is propagated through seeds and widely known as cole crop referring to flower and leaf branches that grow on the stem. Cole crops are herbaceous biennial plants that take two years to complete their biological life cycle: first year for vegetative stage and second year for reproductive stage. Most of these species are self-incompatible and depend on pollinator, usually insects, for seed production. Cauliflowers contain a lot of nutrients. According to U.S Food and Drug Administration, 124 g cooked cauliflower are highly rich with vitamin C, vitamin K, folate, panthothenic acid, and vitamin B6. Besides, cauliflower is also good source for choline, fibre, omega - fats, manganese, phosphorus and biotin.

Cauliflower can be grown in a wide range of climates. However, the precise temperature is needed for normal formation and development of its edible part, the clustered-immature inflorescence that commonly called as curd. Ideal daily temperatures for healthy curd initiation and development are between 17°C and 5°C (Delahaut and Newenhouse, 1997). Higher or lower temperatures will slow down or inhibit the formation of curd and decrease the weight of the curd (Ray and Mishra, 2017). Other abnormalities of curd resulted from high temperature are head buttoning, development of small unmarketable curd, riciness, marked by velvety or granular appearance on the curd surface, interior bract or leaf formation and yellowish of the curd (Masarirambi et al., 2011).

In Malaysia, temperate vegetable cultivation has been established in highland areas such as Cameron Highlands in Pahang and Kundasang in Sabah. However, the explorations of this crop in lowland area are still few and more focused on hobbyists and farmers who are trying their best. There are heat tolerant hybrids developed for lowland and tropical climates (Gopalakrishnan, 2007). The success of hybrid cultivation in Malaysian lowland environment has not been recorded conclusively. The hot and high fluctuation of temperatures in Malaysia gives huge challenges to the successful cauliflower cultivation. For that reason, this study was conducted to evaluate the potential and capabilities of growing and producing good quality cauliflower curd in Malaysian lowland environment. As for a start, nine commercial hybrids were evaluated between April and July 2018 and their performances are discussed in this paper.

Materials and Methods

Nine commercial hybrids as listed in Table 1 were evaluated under rain-shelter structure in Vegetable Research Plot, Horticulture Research Centre, MARDI. Seeds were sown in germination tray and placed in nursery for one month. Experiment was arranged in a completely randomized design. Twenty-five cauliflower seedlings of one month old from each hybrid were transferred into planter boxes of 8 x 1 x 0.3 m (LxWxH) which contain mineral soil, 10 kg GML (12.5 mt/ha) and 20 kg organic materials (25 mt/ha). Seedlings were planted in zig-zag arrangement with plant distant 0.6 cm

109

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

between plant and 0.4 cm between rows (Figure 1). Watering was done using drip system four times daily (400 mL each time). Liquid fertilizers were applied through fertigation until the initiation of curd was established. Pest and disease were controlled using combination of preventive manual techniques and chemical controls.

Table 1: List of cauliflower hybrids used. No. Hybrid code Hybrid original name Company 1 C1 White Flash Sakata 2 C2 1360 Green Eagle 3 C3 Eskimo 6311 Leckat 4 C4 Snow Leopard A60 Leckat 5 C5 White Excel Sakata 6 C6 Snow Crown Takii 7 C7 White Snow 307 Green World 8 C8 Cauliflower #22 GWG 9 C9 Cauliflower #6 GWG

Figure 1: The arrangement of cauliflower plant in the planter box.

Data taken during vegetative stage included the plant height measured from soil surface to the top of stem (in cm) and plant spread (the widest point of the leaf branches). These data were taken twice (at one and two months old) after transplanting. During the reproductive stage, days to curd initiation and days to harvesting were recorded. Time to maturity was calculated from the difference of maturity date and curd initiation date. The curd weight (fresh and dry weight) and size were measured to assess the quality of the hybrid. Temperature and relative humidity (RH) under the rain shelter structure were recorded at three points inside the rain shelter (in front, near the main entrance; middle and at the back), three times daily, i.e. at 8:00 a.m., 12:00 noon and 4:00 p.m. throughout the experiment.

The performance of the hybrids was analysed using analysis of variance (ANOVA) and mean comparison was conducted using Duncan’s new multiple range test (DNMRT). For temperature and RH data inside the rain-shelter, randomized complete block design were used to determine the effect of points where the temperature and RH were taken. The data collected were analysed using SAS software package.

Results and Discussion

Temperature and relative humidity

Highly significant different were obtained for temperature and RH recorded daily in the morning, noon and afternoon (Table 2). This showed high variation of temperature occurring during day time. In the morning, there was no significant difference of temperature under the rain-shelter, but for data in the noon and afternoon, there were significant difference in temperature and RH, respectively, from the front to the back of the rain-shelter. Figure 2 showed graphic picture of the temperature and RH in the morning, noon and afternoon across the rain shelter at three points, i.e. front, middle and at the back.

110

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Mean square, mean and the range of temperature and relative humidity under rain-shelter. Source df Mean squares temperature Mean squares RH Morning Noon Afternoon Morning Noon Afternoon 8:00 a.m. 12:00 p.m. 4:00 p.m. 8:00 a.m. 12:00 p.m. 4:00 p.m. Days 74 4.4** 26.8** 31.8** 117.2** 124.3** 238.0** Points 2 1.2ns 20.4* 41.4** 25.9ns 401.8** 115.9** Mean 26.5 36.5 35.4 96.0 67.5 68.8 Range 23.4 - 31.8 29.3 - 44.2 26.3-41.5 66.1-100 53.9-96.1 51.3-90.8 **, * Significant at ρ≤0.01 and 0.05, respectively. ns = not significant.

a a a 40 a ab b a a b 100 C C ° 30 a a a 80 a a a a a b 60 20 40 10 20 Temperature Temperature 0 0 Morning Noon Afternoon % humidity, Relative Morning Noon Afternoon Front 26.65 36.93 35.92 Front 95.8 69.9 69.9 Midle 26.56 36.66 35.82 Midle 96.7 67.1 68.9 Behind 26.4 35.93 34.58 Behind 95.6 65.5 67.5

Figure 2: Mean temperature and relative humidity under rain shelter in the morning, noon and afternoon. Mean values followed by the same letter in the same column for each time are not significantly different at ρ≤0.05 based on DNMRT (Duncan's New Multiple Range Test).

Plant growth and curd initiation

Highly significant differences were observed among the hybrids for traits of plant height, plant spread at both one and two months after transplant, days to curd initiation, days to harvest and time to mature. Significant differences were also observed for curd diameter as in Table 3. Mean performances for all the hybrids for each trait are presented in Table 4.

Table 3: Mean squares for traits measured on nine cauliflower hybrids. Source df Mean squares PH1 PH2 PS1 PS2 FW DW CD CH Hybrid 7 20.2** 44.2** 336.8** 448.2** 20552.3ns 108.8ns 8.4* 15.1ns Error 33 3.4 15.3 16.2 47.4 9330.1 58.7 3.4 9.3 CV 20 11.9 6.9 7.5 19.8 20.3 11.3 20.8 R-square 0.4 0.24 0.7 0.5 0.3 0.3 0.3 0.3

Source df Mean squares DTC DTH TM Hybrid 7 1969.3** 846.7** 332.2** Error 163 62.6 39.3 23.1 CV 11.4 7.1 25.3 R-Square 0.6 0.5 0.4 Source = Source of variation; CV = Coefficient of variation; PH1= Plant height at one month after transplant; PH2 = plant height at two months after transplant; PS1 = Plant spread at one month after transplant, PS2 = Plant spread at two months after transplant; FW = Fresh weight; DW = Dry weight, CD = Curd diameter; CH = Curd height; DTC = days to curd initiation; DTH = Days to harvest; TM = Time taken to mature.**, * Significant at ρ≤0.01 and 0.05, respectively. ns = not significant.

111

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 4: Mean for traits measured on nine cauliflower hybrids. Hyb Mean

PH1 (cm) PH2 (cm) PS1 (cm) PS2 (cm) DTC (cm) DTH (days) TM (days) FW (g) DW (g) CD (cm) CH (cm)

C1 9.4ab 35.0a 67.0a 97.5ab 66.9bc 85.5bcd 18.7ab 504.3ab 39.1ab 17.1ab 15.2a

C2 11.3a 30.1bc 61.7b 89.8bc 70.0b 85.9bc 15.9bc 490.8ab 38.5ab 17.6ab 12.9a

C3 11.2a 35.5a 63.0ab 98.2a 70.2b 91.7b 21.5ab 516.0ab 37.9ab 16.4ab 17.9a

C4 9.0bc 31.1abc 55.6c 89.6bc 63.3bcd 84.6bcd 21.4ab 517.7ab 41.9a 16.8ab 14.9a

C5 8.4bcd 32.3ab 50.2d 90.2bc n.a n.a n.a n.a n.a n.a n.a

C6 9.5ab 33.4ab 60.8b 104.1a 89.0a 100.9a 11.9c 333.0c 27.2b 13.3c 14.9a

C7 6.6d 26.9c 39.0e 86.1c 57.0d 78.0d 21.0ab 641.1a 46.1a 19.3a 15.7a

C8 8.4bcd 34.9a 58.7bc 81.9c 58.8cd 82.4cd 23.6a 524.4ab 40.6a 16.4ab 13.4a

C9 7.0cd 31.7ab 55.8c 87.3c 67.2bc 87.1bc 19.9ab 459.7bc 34.2ab 16.0bc 13.3a

Hyb. = Hybrid; PH1= Plant height one month after transplant; PH2 = plant height two months after transplant; PS1 = Plant spread one month after transplant, PS2 = Plant spread two months after transplant; FW = Fresh weight; DW = Dry weight, CD = Curd diameter; CH = Curd height; DTC = days to curd initiation; DTH = Days to harvest; TM = Time taken to mature; n.a = Data not available. Mean values followed by the same letter in the same column are not significantly different at ρ≤0.05 based on DNMRT (Duncan's New Multiple Range Test).

112

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The highest mean temperature during day time recorded in this study was 36.5°C and during noon, it could reach up to 44°C. This was very high compared to the recommended temperature for tropical heat tolerant cultivars, which is around 25°C to 30°C (Gopalakrishnan, 2007; Hemphill, 2010). From the data recorded, it was found that temperature under the rain shelter was not homogenous. There was significant gradient of temperature from noon to afternoon resulting in about 1°C reduction of temperature at the back of the rain shelter compared to the middle and front areas. According to Ray and Mishra (2017), the curd weight and temperature were inversely correlated where the weight decreased 6% for each 1°C rise of temperature. In this experiment, no significant difference was, however, detected in terms of fresh weight and dry weight among the hybrids evaluated regardless of the locations of the hybrids planted.

During the first month after transplanting, hybrids C2, C3, C6 and C1 recorded comparably highest plant height range between 9.4 cm to 11.3 cm. The shortest plant was the hybrid C7 with the average of plant height of 6.6 cm. At two months after transplanting, three hybrids, C3, C1 and C6 still recorded as the tallest plants. Hybrid C2, however, did not grow much with the plant height of only 30.1 cm, comparably short as that of the shortest plant C7. For the plant spread, the plant width ranged between 39.0 cm to 67.0 cm at one month after transplanting. The widest plant spread was recorded with hybrid C1 and C3 with average width of 67.0 and 63.0 cm, respectively. The narrowest plant spread was recorded with hybrid C7 at only 39.0 cm canopy width. At two months after transplanting, the hybrid C6 recorded the widest plant canopy, comparably with C3 and C1 with the mean of 104.1 cm, 98.2 cm and 97.5 cm, respectively. The narrowest width was recorded with C8 with 81.9 cm. The wide plant spread in this study indicated the need of blanching procedure. The result on the curd quality discussed below strengthened this suggestion. Without the blanching procedure, the curd of hybrid C4 and C1 developed some irregular purple spots which are due to susceptibility to direct sun light.

Eight hybrids out of nine tested in this experiment were able to form curd despite of the high temperature. The quality of curds was varied by hybrids depending on their endurance to the high temperature. Earliest days for curd initiation started around two months after transplanting, which was obtained with C7 (57 days), C8 (59 days) and C4 (63). Mean temperature recorded during this time was around 34.2°C. Late curd formation was recorded at almost three months after transplanting with hybrid C6 (89 days). Curd development is highly regulated by temperature where vernalization is obligatory to promote the transition from vegetative to reproductive phase (Matschegewski et al., 2015). For temperate cauliflower cultivar, optimum vernalization is usually obtained at temperature between 5°C-17°C (Wurr et al., 1988). However, some tropical cauliflowers did not need vernalization but require uniform cool temperature ranging from 20°C-27°C with moderate humidity (Peter, 2009). In Malaysian environment, Farahzety (2014) recorded cauliflower curd formation from White Shot variety under rain-shelter at temperature 30°C-34°C.

Matured curd could be harvested at 12 to 16 days after curd formation. The fresh weight and dry weight varied within the hybrids and were not significantly different among all the hybrids tested. Mean fresh weight ranged from 333 to 641 g as recorded with C6 and C7, respectively. However, most of the curd harvested from C6 was premature due to susceptibility to fungal disease, while for the C7 hybrid, data was taken only from one single plant that survived. Mean for curd fresh weight for all the hybrids, excluding C6 and C7, was, hence, around 500 g. This result was not far from the weight obtained by Farahzety (2014), who recorded curd weight of 484.4 g. Temperate cauliflower could produce curd around 1.5 to 2 kg. Curd weight exhibited a negative linear function with respect to mean temperature. Warmer temperature reduced total biomass due to later initiation of curd and reduced curd growth rate by producing inhibitory effect on the rate of apex diameter expansion (Nowbuth and Pearson, 1998).

The qualities of curds obtained in this experiment varied among all the hybrids (Figure 3). Most of the hybrids showed distress effect from high growing temperature. The colour of curd obtained varied from

113

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

white to yellowish. Two hybrids, C2 and C7, produced white and compact curd. Hybrid C9 produced white but ricey and loose curds. Riciness and loose curds were also observed with C1, C6 and C8, which also had yellowish curds. The curd of hybrid C4 was pale yellowish and had medium compactness. Hybrid C6 showed susceptibility to fungal disease. Some hybrids, namely C6 and C1, also developed a lot of irregular purple spots. These spots were caused by the presence of anthocyanins due to over exposure to sunlight. For some hybrids, blanching procedure by covering the developing head with surrounding leaves may be needed to get perfect white cauliflower, while other hybrids may be naturally self-blanched or resistant to the sunlight.

C1: Pale yellowish, ricey, C2: White compact curd. C3: Yellowish, abnormal C4: Pale yellowish loose curd. Develop Curd stem very white. loose curd. Curd stem intermediate compact. irregular purple spot. greenish white. Curd stem greenish white. Curd stem greenish white.

C6: Yellowish, loose C7: White compact curd. C8: Yellowish, ricey loose C9: White, ricey loose curd. Develop irregular Curd stem greenish white. curd. Curd stem greenish curd. Curd stem greenish purple and fungal spots. white. white. Curd stem greenish white. Figure 3: The curd of eight cauliflower hybrids evaluated.

Conclusions

This study has provided the information on the possibilities of growing temperate origin crops under Malaysian lowland environment. With no extra treatments other than rain-shelter structure and common fertigation technique, the results showed that growing this crop is very challenging. Selection for the right variety is very crucial to ensure the success of planting cauliflower. Hybrid C2 (1360 Green Eagle) in this study showed it as a good candidate to be used in high temperature range of 25°C-35°C. This hybrid also showed good performance in other traits evaluated. Thus, it is concluded that this hybrid is the most heat tolerant cauliflower hybrid from this evaluation. Other hybrids, such as C1, C4, C8 and C9 also have potential to be explored further. Despite some abnormalities in the curd formation, these hybrids can withstand the fluctuating temperature and successful form curd. With some adjustments in temperature or modification in the environment, these hybrids also possibly produce good yield.

114

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Delahaut, K.A. and Newenhouse, A.C. 1997. Growing broccoli, cauliflower, cabbage and other cole cops in Wisconsin. A guide for fresh-market growers. University of Wisconsin Cooperative Extension. Accessed at http://learningstore.uwex.edu/assets/pdfs/A3684.pdf. Farahzety, A.M. 2014. Effects of compost sources as a component of seedling growing media and fertilizer on growth performance of cauliflower (Brassica oleracea L. var. Botrytis). Master Thesis, Universiti Putra Malaysia. Gopalakrishnan, T.R. 2007. Vegetable Crops. In: Peter, K.V. (Ed.), Horticulture Science Series: Volume 4. New India Publishing Company. Hemphill, D. 2010. Cauliflower. http://horticulture.oregonstate.edu/content/cauliflower-0. Retrieved on 14 August 2018. Masarirambi, M.T., Oseni, T.O., Shongwe, V.D. and Mhazo, N. 2011. Physiological disorders of Brassicas / Cole crops found in Swaziland: A review. African Journal of Plant Science 5(1): 8-14. Matschegewski, C., Zetzche, H., Hasan, Y., Leibeguth, L., Briggs, W., Ordon, F. and Uptmoor, R. 2015. Genetic variation of temperature-regulated curd induction in cauliflower: Elucidation of floral transition by genome-wide association mapping and gene expression analysis. Frontiers in Plant Science 10(6): 720. doi: 10.3389/fpls.2015.00720. Nowbuth, R.D. and Pearson, S. 1998. The effect of temperature and shade on curd initiation in temperate and tropical cauliflower. Acta Horticulturae 459: 79-88. Peter, K.V. 2009. Basics of Horticulture. New India Publishing. Ray, M. and Mishra, N. 2017. Effect of weather parameters on the growth and yield of Cauliflower. Environment Conservation Journal 18(3): 9-19. Wurr, D.C.E., Elphinstone, E.D. and Fellows, J.R. 1988. The effect of plant raising and cultural factors on the curd initiation and maturity characteristics of summer/autumm cauliflower crops. Journal of Agriculture Science 111: 427-434.

115

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Regulated Deficit Irrigation Technique using Different Crop Coefficients (Kc) at Different Growth Stages Affects the Growth, Yield and Postharvest Quality of Roselle Grown on BRIS Soil

Nur Amirah, Y., Nur Iliana, M.R., Adzemi, M.A. and Wan Zaliha, W.S.* School of Food Science and Technology, Universiti Malaysia Terengganu, 21030 Kuala Nerus, Terengganu, Malaysia. *E-mail: [email protected]

Introduction

Roselle (Hibiscus sabdariffa L.) is widely cultivated for its succulent fruits, leaves, and young shoots which are well documented to have many health benefits to human. The anthocyanin pigments that create the fruit colour (Tsai and Ou, 1996) are responsible for the wide range of colouring in many foods. Being high in anthocyanins, roselle fruit is both good colorant and potentially a good source of antioxidant. Many internal and external factors that affect the concentration of anthocyanins such as genetic strain, light intensity, crop load, agronomical practices like pruning and fertilization have been widely studied. However, the information on the effects of irrigation mainly water deficit irrigation technique on the accumulation of anthocyanins, postharvest quality of roselle and its growth development is still scarce. One of the water deficit techniques that had promising outcomes in enhancing growth and quality performance of various fruit crops is regulated deficit irrigation (RDI). However, the information on the effects of RDI on roselle plants grown on Beach Ridges Interspersed with Swales (BRIS) soil is limited. A vast area of BRIS soil found in Terengganu is 67,582.61 hectares (Mohd Ekhwan et al., 2009), which is renowned as a problematic soil. Even though BRIS soil is poor in physical and chemical characteristics, roselle is suitable to be planted because it has a well aerated and deep rooting zone. BRIS soil, on the other hand, does not support plant growth well as it has low water retention, high infiltration rate, low nutrient content, and low organic matter, but this can be avoided by applying optimal irrigation management series.

Currently, there is little information available on the application of RDI based on different crop coefficients (Kc) at different growth stages of roselle plants. Previously, Naimah et al. (2014) has conducted an experiment on roselle plants by applying different amount of irrigation water which was based on the same Kc for the whole growing stages under RDI technique. They found that RDI imposed for up to 91 days on roselle plants had no effects on plant growth and postharvest fruit quality. In addition, Naimah et al. (2014) also reported that 20% RDI increased roselle yield and saved 20% irrigation water. However, in the present study, the application of RDI technique was slightly different from the previous research. Therefore, this study aimed to evaluate the impact of different amount of water, which was calculated based on different Kc, at different growth stages of roselle plant on the growth and its fruit quality. The exact amount of irrigation water applied and its impact on roselle growth and postharvest quality grown on BRIS soil also needs further investigation.

Materials and Methods

Plant material, experimental location and experimental design

Thirty-two roselle plants variety Terengganu (UMKL-1) were used to investigate its responses on the different regimes of irrigation. The experiment was conducted in a greenhouse at the School of Food Science and Technology, Universiti Malaysia Terengganu. BRIS soil was taken from Stesen Pembangunan Komoditi Pertanian, Rhu Tapai, Terengganu. Meanwhile, roselle seeds were purchased

116

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

from Kompleks Pertanian Negeri, Ajil, Terengganu. Roselle seeds were sown on 27th October 2013. Fourteen-day-old seedlings were transferred to polybag containing 30 kg BRIS soil. All plants received similar cultural practices including fertilization, pesticides and fungicides application excluding irrigation water.

Various RDI treatments were arranged in a Randomized Complete Block Design (RCBD) with treatment comprising of four different regimes of irrigation, i) control (100% I full irrigation), ii) 20% RDI (80% irrigation), iii) 40% RDI (60% irrigation) and iv) 60% RDI (40% irrigation). Two roselle plants represented as an experimental unit. The experimental period was 84 days which started from October 2013 and ended in January 2014. The dripper (pressure Compensating Dripper, DIY) with a flow rate at 4Lh-1 was used for irrigation. Irrigation was applied twice a day at 0930-1000 hours and 1630-1700 hours. The amount of irrigation water was based on crop water use calculation: Etc=ETo x Kc; where ETc=crop evapotranspiration, ETo=reference crop evapotranspiration and Kc= crop coefficient. Kc values vary with crop phenological stages to accommodate crop changes (Naimah et al., 2014). The Kc used was 0.78, 1.2 and 0.6 for vegetative (0-45 days after transplanting (DAT)), flowering (46 - 69 DAT) and harvesting (70 - 84 DAT) stages, respectively (Wan Zaliha et al., 2014), while, ETo was 1.99 mm/day (Niazuddin, 2007). The ETo was calculated from Penman-Monteith equation according to Allen et al. (1998). Full irrigation or control was 1.40 L, 2.15 L and 1.07 L per day for vegetative, flowering and harvesting stages, respectively.

Parameter evaluation

The preharvest parameters evaluated were volumetric water content (θ), leaf water potential (ψleaf), plant height, stem diameter and number of branches. ψleaf and θ were determined by using pressure chamber (Model 3000, Soil Moisture Equipment Corp., Santa Barbara CA, U.S.A) and moisture sensor (TRIME- PICO64), respectively at 11:00 and 14:00 solar time. ψleaf and θ were expressed in (-) Mega Pascal (MPa) and percentage (%), respectively. The assessments were taken at 7 days intervals viz 0, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77 and 84 days after transplanting (DAT). Meanwhile, postharvest parameters were fresh and dry weight of individual plant organs, fruit fresh weight, colour (lightness (L*), chromaticity value a*, chromaticity value b* chroma (C*) and hue angle (h°)) and firmness, number of fruits, titratable acidity (TA), total anthocyanins and soluble solid concentration (SSC) (Wan Zaliha, 2009). Cumulative fresh weight and number of roselle fruits were recorded on 70, 77, 84 DAT.

Statistical analysis

The data were subjected to the analysis of variance (ANOVA) using General Linear Models (GLM) procedures and further separated by LSD for least significance at P≤0.05 (SAS Institute Inc., 1999).

Results and Discussion

No significant difference was recorded for both ψleaf and θ of the roselle plants grown on BRIS soil (Figures 1 and 2). Regardless of RDI treatments, ψleaf and θ showed fluctuating trends throughout the 84 days experimental period. Even though all treatments had similar values of ψleaf and θ, the RDI treatments (40%-60% RDI) showed moderate stress according to the classification of Hsiao (1973). This was based on the values of ψleaf recorded on 42, 56 and 70 DAT. The fluctuations in ψleaf may be attributed to the rainy days as the experiment was conducted from mid-November 2013 to January 2014. The decreasing amount of ψleaf mainly for 40% and 60% RDI treated plants might be ascribed to the dry part of the rhizosphere, which limits the plants’ ability to meet the transpirational demand due to a lowering of root hydraulic conductivity and water deficit in the root zone (Lafolie et al., 1999).

117

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The moderate water stress imposed on the roselle plants grown on BRIS soil did not significantly affect plant height, stem diameter and number of branches (Figures 3 and 4). Previously, Qiang et al. (2016) claimed that RDI technique with mild water stress had minimal effect on the yield. El-Boraie et al. (2009) also claimed that similar size and height of roselle plants might be attributed to the competition between plants for obtaining more light. This was also in agreement with Alias et al. (2013), Nur Razlin (2013) and Naimah et al. (2014). As observed in the current study, regardless of irrigation treatments, roselle plant followed a sigmoid pattern of growth based on all growth performance parameters evaluated. The growth and development of roselle plants grown on BRIS soil were not affected with the application of water stress treatments. Furthermore, roselle capsule diameter followed a sigmoid growth curve which was characterised by a lag phase, wherever the growth rate is negligible. Similar growth pattern was also recorded in other Malvaceae plants such as kenaf, okra, hibiscus and others.

12 0.00

-0.20 10 -0.40

8 -0.60

-0.80

Water Content (%) Content Water

6 -1.00

4 -1.20

-1.40 Leaf Water Potential (mPa)Potential Water Leaf

Volumetric Soil Volumetric 2

Control 20% RDI 40% RDI 60% RDI -1.60 Control 20% RDI 40% RDI 60% RDI 0 -1.80 0 7 14 21 28 35 42 49 56 63 70 77 84 14 21 28 35 42 49 56 63 70 77 84 Days After Transplanting (DAT) Days After Transplanting (DAT)

Figure 1: Effects of RDI on volumetric water Figure 2: Effects of RDI on leaf water potential of content of roselle grown on BRIS soil. roselle grown on BRIS soil. The vertical The vertical bars=LSD at P≤0.05. bars=LSD at P≤0.05.

25 100% I 20% RDI 40% RDI 60% RDI 140 Control 20% RDI 40% RDI 60% RDI

20 120

100 15 80

60 10 Plant Height(cm)Plant

Stem Diameter (mm) Stem Diameter 40 5 20

0 0 0 7 14 21 28 35 42 49 56 63 70 77 84 0 7 14 21 28 35 42 49 56 63 70 77 84 Days After Transplanting (DAT) Days After Transplanting (DAT)

Figure 3: Effects of RDI on the plant height of Figure 4: Effects of RDI on the stem diameter of roselle grown on BRIS soil. The roselle grown on BRIS soil. The vertical vertical bars=LSD at P≤0.05. bars=LSD at P≤0.05.

118

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The fresh and dry weights of different roselle plant parts were not affected by irrigation water scheduling (Tables 1 and 2). The non-stressed plants showed higher values of fresh and dry weight of different roselle plant parts for all RDI treatments. The 20% RDI treated plants had higher values for the above-mentioned parameters rather than other stressed plants but overall, were lower than those of the non-stressed controls. These results were supported by Pulupol et al. (1996) who claimed that the whole plant fresh and dry weights were higher in control plants (100% I) than in water deficit plants. In contrast, El-Boraei et al. (2009) reported that fresh and dry weight of different plant organs and the whole plants were significantly increased under different irrigation regimes. Hsiao (1973) reported that water stress has a wide range of effects on plant growth, anatomy, morphology, physiology, and biochemistry. Possibly, this might be the reason on sporadic outcomes on fresh and dry weight of water stressed plants. Another reason might be due to the accumulation of hormone in plant organs. Ober and Sharp (2007) reported that the ABA accumulation in roots has been clearly proved in enhancing root growth in a drying soil. Havlova et al. (2008) claimed that cytokinins were also involved in inhibiting root branching and thus enhancing primary root growth by preventing formation of auxin gradient (Laplaze et al., 2007) in which needed for pattern lateral root primordia. Thus, the long primary root growth can be seen in water stressed-plants.

Table 1: Effects of RDI on fresh weight of leaves, stems and roots of roselle plants grown on BRIS soil. Fresh weight (g) Treatment Leaves Stems Roots 100% I 235.81a 350.29a 319.26a 20% RDI 197.66a 344.35a 353.30a 40% RDI 204.35a 311.89a 274.75a 60% RDI 184.34a 281.54a 254.06a Means with the same letter within column are not significantly different at the 5% level according to LSD test. I = fully irrigation and RDI = regulated deficit irrigation.

Table 2: Effects of RDI on dry weight of leaves, stems and roots of roselle plants grown on BRIS soil. Dry weight (g) Treatment Leaves Stems Roots 100% I 24.10a 85.69a 58.60a 20% RDI 23.81a 82.33a 66.05a 40% RDI 23.69a 71.15a 45.43a 60% RDI 19.58a 61.79a 43.21a Means with the same letter within column are not significantly different at the 5% level according to LSD test. I = fully irrigation and RDI = regulated deficit irrigation.

Table 3: Effects of RDI on fresh weight and number of fruits of roselle grown on BRIS soil. Treatments Fresh weight of fruits (g) Number of fruits 100% I 505.34a 58a 20% RDI 689.84a 76a 40% RDI 546.93a 67a 60% RDI 543.11a 60a Means with the same letter within column are significantly different at the 5% level according to LSD test. I = fully irrigation and RDI = regulated deficit irrigation.

In the present study, plants subjected to the under study RDI treatments had no significant difference in weight and number of fruits with control plants (Table 3). Despite no significant difference observed, the 20% RDI plants showed a tendency to increase the cumulative fresh weight as well as roselle fruit number. The increase in fruit fresh weight might be attributed to the mild water stress imposed. This was in agreement with the reports of Nur Razlin et al. (2013) and Nur Amirah et al. (2015). Furthermore, Dorji et al. (2005) claimed that the yield of RDI-treated tomato plants was reduced in terms of fresh weight but

119

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

total dry mass was similar to control plants. This may be ascribed to the movement of water into the fruits, however, the translocation of dry matter into the fruits may not be affected. In addition, Behboudian et al. (2005) claimed that deficit irrigation system managing soil water supply to impose periods of predetermined plant or soil water deficit can result in some economic benefits.

For postharvest quality, the RDI treatments applied based on different Kc did not significantly influence the fruit colour attributes, TA, total anthocyanin, and SSC (Tables 4 and 5). Similarly, Nur Razlin et al. (2013) claimed that the colour attributes of water stressed-roselle fruits in terms of L*, chromaticity values a*, and b* were similar to control plants. Moreover, Mandour et al. (1979) claimed that excess or lack of water supply during the vegetative growth and developmental stage of some plants possibly decreased the chlorophyll and carotenoids while medium supply of irrigation water increased the pigmentation in the leaf and other organ. As shown in Table 5, TA and SSC of water-stressed roselle fruits were similar to 100% I control fruits. Similar findings were also recorded in water deficit experiment conducted by Naimah et al. (2014) and Nur Amirah et al. (2015). Similarly, Behboudian et al. (2005) reported that there was no effect of deficit irrigation on TA of apple fruit. In contrast, El-Boraie et al. (2009) reported that SSC in roselle fruit increased as irrigation water decreased. Likewise, Dorji et al. (2005) also noticed the high SSC at final harvest in water deficit-treated-tomato plants as it reduced fruit water content and greater hydrolysis of starch into sugar. In addition, Wan Zaliha and Singh (2010) also claimed the higher TA was recorded in water-deficit Cripps Pink apple which might be ascribed to the higher concentration of acid contents such as tartaric, fumaric and succinic acid which were presented as an indicator of the contribution of organic acid to the fruit osmotic adjustments. However, the non-significant effects of RDI on TA and SSC warrant further investigations.

There was no adverse effect of RDI on total anthocyanin concentration of roselle fruit. The mild water stress imposed might possibly not be sufficient to enhance the red skin colouration of roselle fruit. The results obtained were similar with the reports of Nur Razlin et al. (2013). However, Wan Zaliha and Singh (2010) claimed that the increased red skin colour of Cripps Pink apple coincided with the increased in total anthocyanin concentration. Mandour et al. (1979) reported that excess or lack of water supply during the vegetative growth and developmental stage of roselle plants decreased the chlorophyll and carotenoids while medium supply of irrigation water increased the pigmentation in the leaf and other organs.

Table 4: Effects of different irrigation treatments on lightness (L*), chromaticity value a*, b* and hue angle (h°) of roselle fruits. Treatment L* a* b* h° 100% I 28.00a 20.68a 6.53a 17.62a 20% RDI 28.40a 22.13a 6.74a 16.90a 40% RDI 28.43a 20.02a 5.92a 16.37a 60% RDI 28.86a 21.16a 6.63a 17.3.6a Means with the same letter within column are not significantly different at the 5% level according to LSD test. I = full irrigation and RDI = regulated deficit irrigation.

120

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 5: Effects of different irrigation treatments on total anthocyanins, fruit firmness, titratable acidity (TA) and soluble solid concentration (SSC) of roselle fruits. Treatment Total anthocyanins TA SSC Fruit firmness (mg/100g fresh weight) (% malic acid) (%) (N) 100% I 310.02a 5.30a 7.4a 0.36a 20% RDI 223.71a 5.23a 7.1a 0.39a 40% RDI 275.66a 4.74a 7.3a 0.42a 60% RDI 182.80a 5.32a 6.9a 0.37a Means with different letters are significantly different at the 5% level according to LSD test. I = full irrigation and RDI = regulated deficit irrigation.

Conclusion

Three levels of RDI applied based on different crop Kc at different growth stages on roselle plant grown on BRIS soil had similar values of pre- and postharvest performances with fully irrigation or 100% irrigation plants. Roselle plants experienced moderate water stress (-0.50 MPa to -1.50 MPa) as resulted from plant water relation parameters. The treatment, 60% RDI (40% irrigation) that applied on different Kc at different growth stages increased yield as well as water use efficiency and maintained other quality attributes such as fresh weight, dry weight and minerals in roselle plant parts. Consequently, the 60% RDI could be the best irrigation scheduling for roselle plantation on BRIS soil as it increased water use efficiency, saved 60% irrigation water and, at the same time, enhanced profit for local farmers. The exact amount of water to be applied for roselle plants were 7 m³/ha or 0.61 L/tree/day. In conclusion, the application of RDI treatments based on different Kc had a potential to increase water use efficiency without adversely affecting the productivity as well as pre- and postharvest performances as compared with non-stressed roselle plants.

Acknowledgements

The authors wish to thank the Universiti Malaysia Terengganu and the Ministry of Education Malaysia for the grant provided under Exploratory Research Grant Scheme (ERGS) (55054).

References

Alias, A.A., Wan Zaliha, W.S., Nur Amirah, Y. and Adzemi, M.A. 2013. The effects of partial rootzone drying on the yield, growth and postharvest performance of roselle (Hibiscus sabdariffa L.) grown on BRIS soil in lysimeter. Transactions of the Malaysian Society of Plant Physiology Vol. 22: 63- 68. 27-29 August 2013. Prinz Park Resort, Terengganu. Allen, R.G., Pereira, L.S., Raes, D. and Smith, M. 1998. Crop Evapotranspiration: Guidelines for Computing Crop Water Requirements. Irrigation and Drainage Paper 56. FAO, Rome. Behboudian, M.H., Mpelasoka, B.S., Singh, Z. and Mills, T.M. 2005. Quality responses of deciduous fruits to deficit irrigation. In: Dris, R. (Ed.), Fruits. Helsinki, Finland. Pp: 33-43. Dorji, K., Behboudian, M.H. and Zegbe-Dominguez, J.A. 2005. Water relations, growth, yield, and fruit quality of hot pepper under deficit irrigation and partial rootzone drying. Scientia Horticulturae 104: 137-149. El-Boraie, F.M., Gaber, A.M. and Abdel-Rahman, G. 2009. Optimizing irrigation schedule to maximize water use efficiency of Hibiscus sabdariffa under Shalatein conditions. World Journal of Agriculture Sciences 5(4): 504-514. Havlová, M., Dobrev, P.I., Motyka, V., Štorchová, H., Libus, J., Dobrá, J., Malbeck, J., Gaudinová, A. and Vanková, R. 2008. The role of cytokinins in responses to water deficit in tobacco plants

121

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

over-expressing trans-zeatin O-glucosyltransferase gene under 35S or SAG12 promoters. Plant Cell Environment 31: 341-353. Hsiao, C.T. 1973. Plant responses to water stress. Annual Reviews of Plant Physiology 24: 519-570. Lafolie, F., Bruckler, L., Ozier-Lafontaine, L., Tournebize, R. and Mollier, A. 1999. Modeling soil- root water transport and competition for single and mixed crops. Plant and Soil 210: 127-143. Laplaze, L., Benkova, E., Casimiro, I., Maes, L., Vanneste, S., Swarup, R., Weijers, D., Calvo, V., Parizot, B. and Herrera-Rodriguez, M.B. 2007. Cytokinins act directly on lateral root founder cells to inhibit root initiation. Plant Cell 19: 3889-3900. Mandour, M.S., Abou-zied, E.N. and Hassib, M. 1979. Effects of irrigation treatments upon the chemical constituents of Hibiscus sabdariffa L. Plant and Soil 52: 485-490. Mohd Ekhwan, T., Mazlin, M., Barzani, M.G. and Nor Azlina, A.A. 2009. Analysis and physical charateristics of BRIS soil in Coastal Kuala Kemaman, Terengganu. Research Journal of earth Sciences 1(1): 1-6. Naimah, R., Wan Zaliha, W.S., Nur Amirah, Y. and Adzemi, M.A. 2014. Quality and growth development of roselle grown on BRIS soil in relation to regulated deficit irrigation. Journal of Tropical Plant Physiology 6: 23-34. Niazuddin, M.D. 2007. Water Requirements, Water Distribution Pattern and Potassium Substitution with Sodium from Seawater for Pineapple Cultivation on BRIS Soil. Ph.D. Thesis, Universiti Putra Malaysia. Nur Amirah, Y., Alias, A.A. and Wan Zaliha, W.S. 2015. Growth and water relations of roselle grown on BRIS soil under Partial Rootzone Drying. Journal of Malaysian Applied Biology 44(1): 61- 65. Nur Razlin, R., Wan Zaliha, W.A., Yusnita, H. and Zuraida, A.R. 2013. Effects of deficit irrigation on growth and postharvest performance of roselle (Hibiscus sabdariffa L.) grown on BRIS soil. Proceedings of Soil 2013. Bukit Gambang Resort City, Gambang, Pahang, 16-18 April 2013. 164-169. Ober, E.S. and Sharp, R.E. 2007. Regulation of root growth responses to water deficit. In: Jenks, P.M., Hasegawa, P.M. and Jain, S.M. (Eds.), Advances in Molecular Breeding Toward Drought and Salt Tolerant Crops. Dordrecht: Springer 33-53. Pulupol, L.U., Behboudian, M.H. and Fisher, K.J., 1996. Growth, yield and postharvest attributes of glasshouse tomatoes produced under water deficit. HortScience 31: 926-929. Qiang, C., Yantai, G., Cai, Z., Hui-Lian, X., Reagan, M., Waskom, Y., Niu, K. and Siddique, H.M. 2016. Regulated deficit irrigation for crop production under drought stress. A review. Agronomy Sustainable Development Journal 36: 3-21. SAS Institute Inc., 1999. SAS Procedure guide, Version 9.1. Cary. NC. Tsai, P.J. and Ou, A.S.M. 1996. Colour degradation of dried roselle during storage. Food Science 23: 626 640. Wan Zaliha, W.S. 2009. Regulation of Fruit Colour Development, Quality, and Storage Life of ‘Cripp’s Pink’ apple with deficit irrigation and Bioregulators. Ph.D. Thesis, Curtin University of Technology; Australia. Pp. 1-246. Wan Zaliha, W.S. and Singh, Z. 2010. Fruit quality and postharvest performance of 'Cripps Pink' apple in relation to witholding irrigation. Acta Horticulturae 877: 147-154. Wan Zaliha, W.S., Nadzri, M.R. and Nur Amirah, Y. 2014. Effects of partial rootzone drying at different growth stages on the yield, growth and postharvest performance of roselle (Hibiscus sabdariffa L.) grown on BRIS soil. Proceedings of the soil science conference of Malaysia 2014. Putra Palace, Kangar, Perlis, 8-10 April 2014. Pp. 218-223.

122

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Fascinating Orchids for Contemporary Understory Landscape

Wan Rozita, W.E.1,*, Rozlaily, Z.2, Norhasbulloh, A.1 and Nurul Enanee, A.K.1 1Urban Agriculture and Floriculture Program of Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Vegetable Program of Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Spathoglottis species is a wild terrestrial orchid and has potential to be developed as a landscape plant in tropical garden due to its unique beauty and ‘heat-tolerance’ plant characteristics. To date, utilization of orchids in urban landscape design has become popular and the demand on this type of orchid has increased tremendously in the last few years. Research on landscape orchids has begun since 2013 in order to produce new hybrids with desired ‘heat tolerance’ characteristics. Malaysian Agricultural Research and Development Institute (MARDI) has successfully identified several wild orchid species having potential as outdoor plants and one of them is Spathoglottis species (Rozlaily and Wan Rozita, 2012). Spathoglottis is a beautiful orchid species which makes a great understory plant. It has the potential to be incorporated in landscape planting. This orchid species is easy to flower and sufficiently shade tolerant to thrive under canopies of other taller plants/trees. This species has been evaluated and documented based on findings from morphological and adaptation studies. In an attempt to create genetic variability, hybridization work has been conducted by crossing the species of Spathoglottis plicata Blume with Spathoglottis kimballiana. Spathoglottis plicata Blume has attractive bright purple flowers of small size while S. kimballiana exhibits attractive bright yellow petal shaving the largest flower size in the spathoglottis genus.

Materials and Methods

Collection and hybridization programme

Collection of orchid species around Peninsular Malaysia as a source of genetic materials for the hybridization work has been done since 1979 (Fadelah and Hanim, 1993; Hanim and Fadelah, 1994). The plants are grown in an orchidarium where the environment is created to be almost similar to the natural habitat of the species. These species have been documented and evaluated based on their morphological and adaptation characteristics (Rozlaily and Wan Rozita, 2014). Based on these evaluation and selection works, Spathoglottis sp. is found to have a potential to be utilized as a garden plant because of its ‘heat- tolerance’ characteristics. While, crosses between S. plicata Blume and S. kimballiana have been produced since 2013.

Media preparation and seed culturing

Capsules from successful crosses were harvested 30 days after pollination and germinated on various basal strengths of Murashige and Skoog (MS) medium (Murashige and Skoog, 1962). Four different concentrations of MS (¼ MS, ½ MS, ¾ MS and full strength MS) supplemented with 20 g/L sucrose, 200 mL/L coconut water and 4 g/L gelrite were used in this study. The pH of the medium was adjusted to 5.2 before autoclaving at 12oC for 20 minutes. Harvested capsules were surfaced sterilized by a dip in 70% ethanol for 15 seconds followed by flaming for 3-4 seconds and were dissected longitudinally with the sterilized forceps and scalpel. Then, the seeds were tapped gently onto the medium. Seeds were

123

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

maintained in the culture until germinated, formed green protocorm and developed to complete plantlets. The rate of seed germination percentage was recorded. Sub-culturing was carried out every two weeks at plantlet stage to prevent contamination. Cultures were maintained at 25±2ºC under 16 hours of light daily, provided from cool white fluorescent lamp (Philips).

F1 evaluation and selection

Matured seedlings which had reached in height above 5 cm with at least four initial roots were transferred to the nursery. The F1 seedlings were transplanted in 2.5 cm-diameter pots using wood shaving and perlite as the planting medium. The plants were placed on benches under 80% netted shade structure at MARDI Orchid Complex in Serdang, Selangor, Malaysia until flowering, then were transferred under 50% netted shade for further evaluation. Plants were arranged in a Completely Randomised Design (CRD).

Fertilization was applied once a week and watering was done twice a day using sprinkler irrigation system. Seven selected F1 hybrids coded WR01, WR02, WR03, WR04, WR05, WR06, WR07 and their parents were chosen in this study. The parameters measured were flower morphological characteristics such as adaptability to sunlight, flower size, flower colour, flower shelf life, plant growth performance such as plant height, response to fertilizer and tolerance to major pests and diseases. Flower colour was determined using a standard colour chart of The Royal Horticultural Society, London.

Results and Discussion

Seed germination

Stages of seed germination and plantlet development in culture condition of Spathoglottis crosses are shown in Figure 1. Percentage of seed germination showed varied result depending on strength of germination medium. Germination begun 14 days after seed culture in ¼ MS medium, followed by ½ MS at 17 days, ¾ MS at 19 days and the most delayed germination was found on full strength of MS medium. Result indicated that 1⁄4 strength of MS medium showed the highest percentage of seed germination (90%) within five weeks from inoculation day (Table 1). Hence, MS medium having the lowest content of macro elements favoured the best condition for the earlier in vitro germination of Spathoglottis.

A B C D

Figure 1: Different stages of in vitro seed germination and seedling development of F1 progenies. A) Seeds were sown in MS culture medium. B) Seed germination formed green PLB’s. C) Multiple plantlets formed on MS medium. D) Matured seedlings with 5 cm in height ready to be transferred to the nursery.

124

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Percentage of seed germination of Spathoglottis crosses using various strengths of MS medium.

Treatment 1st germination (days) Percentage of seed germination (%)

Week 3 Week 4 Week 5 Full strength 21 0 16.67 17.5 3/4 19 12.5 52.5 63.75 1/2 17 23.75 65 90 1/4 14 8.75 38.3 50

F1 evaluation and selection

Flower morphological characteristics and plant size of seven potential F1 progenies and parents (SK= S. kimballiana; SP= S. plicata Blume) are presented in Table 2. The flower size, inflorescence length, flower colour and plant size varied between progenies. F1 population produced smaller sized plants compared to both parents. Results showed that plant sizes (plant height and canopy spread) of F1 population were smaller compared to both parents. The highest plant height was recorded by F1 progeny coded WR07 with 35.7 cm while the broadest canopy spread was found on WR01with 66 cm. Flower size of F1 progenies was smaller compared to S. kimballiana but inherited the size of male parent, S. plicata Blume. The biggest flower size among F1 progenies was recorded by WR05 with horizontal and vertical dimensions of 6.2 and 7 cm, respectively. The smallest flower was produced by WR04 with 3.4 cm x 3.1 cm dimension. F1 progenies inherited flower colour from their parents and some of them having colour combination of yellow with purplish splashes. Colour morphology of the F1 population and their parents are shown in Table 3.

A B C D E

F G H I

Figure 2: Variation of F1 progenies and parents. A) Spathoglottis kimballiana (SK), B) Spathoglottis plicata Blume, C) WR01, D) WR02, E) WR03, F) WR04, G) WR05, H) WR06 and I) WR07.

125

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Plant growth and flower characteristics of seven F1 progenies and their parents. Plant Canopy Leaf Flower Petal Midlobe Inflorescence Accensions height spread (cm) (cm) Length Width Horizontal Vertical length (cm) Length Width Length Width (cm) (cm) (cm) (cm) (cm) (cm) (cm) (cm) WR01 31 66 28 4.45 3.8 3.2 46.9 2.4 1.7 2.2 1.9 WR02 12.2 28.3 18 1.9 3.8 3.5 16.5 2.3 1.1 1.7 1.1 WR03 12.8 34.3 22.1 2.6 3.7 3.2 26.7 2.0 0.9 1.1 1.5 WR04 18.9 37.4 25.5 2.4 3.4 3.1 25.3 1.8 1.5 1.4 1.2 WR05 23 74 47.6 3.0 6.2 7 51 3.5 2.2 2 1.3 WR06 25.7 39.4 73.4 3.7 5.9 6.0 90.2 3.4 2.3 2.5 2.1 WR07 35.7 30.7 99 3.9 4.7 3.9 105 3.1 2.1 2.4 2.0 S. Kimballiana 68.43 106.40 82.53 3.46 8.16 7.93 77.50 4.43 1.90 2.20 1.03 (parent) S. Plicata 71.13 149.20 80.23 5.20 3.10 3.30 95.6 2.20 1.26 1.30 0.76 Blume (parent)

Table 3: Flower colour characteristics of F1 progenies and the parents. Acc Color of sepal Color of petal Color of lip WR01 Red purple Group 67 A + Yellow Group 10 A Red purple Group 67 A + Yellow Group 10 A Yellow Group 9 A WR02 Yellow Group 9 B Yellow Group 9 B Yellow Group 9 B + Red-purple Group 58 B WR03 Red purple Group 7 A + Yellow Group 1 D Red purple Group 7 A + Yellow Group 1 D Red purple Group 71 A + Yellow Group 7 D WR04 Red Purple Group 74 N + Yellow Group 13 B Red Purple Group 74 N + Yellow Group 13 B Red Purple Group 60 A + Yellow Group 9 A WR05 Red Purple Group 12B + Yellow Group 64 C Red Purple Group 12B + Yellow Group 64 C Red Purple Group 61B + Yellow Group 9 A WR06 Red Purple Group 63B + Yellow Group 4 B Red Purple Group 63B + Yellow Group 4 B Red Purple Group 64A + Yellow Group 6 A WR07 Yellow Group 4 B Yellow Group 4 B Red Purple Group 58B + Yellow Group 7 B S. Kimballiana Yellow Group 5 A Yellow Group 5 A Yellow Group 5 A + Red-Purple 72C (parent) S.Plicata Purple-violet Group N81 B Purple-violet Group N81 B Purple-violet N81 Group N81 A + Yellow Blume (parent) Group 6 A

126

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

For the conclusion, colours produced were varied among the F1 population. From the observation and ecstatic value, WR01 had a unique flower combination of bright yellow and bright purple petals and seemed to be of high potential as a landscape plant. Seed germination protocol is useful for selection of best condition for mass propagation of other orchid hybrids. Besides having attractive flowers, these F1 progenies are easy to manage and maintain due to respond well to fertilizers and are free flowering. The information on this study could be useful for future breeding programme.

References

Fadelah, A.A. and Hanim, A. 1993. Collection of orchid and ornamental plant species from Belum, Northen Perak, Special Report. Hanim, A. and Fadelah, A.A. 1994. Sudah ke Belum? Berita Penyelidikan Bilangan 33: 10-11. Holttum, R.E. 1953. A revised Flora of Malaya: An illustrated systematic account of the Malayan flora, including commonly cultivated plants, volume I Orchids of Malaya, Government Printing Office, Singapore. Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15:473-497. Rozlaily, Z. and Wan Rozita, W.E. 2012. Exotic orchid for landscaping. Confertec. Persidangan Kebangsaan Pemindahan Teknologi 2012. Agroindustri Dalam Model Baru Ekonomi. Ekosistem Penyampaian Berimpak Tinggi. Rozlaily, Z. and Wan Rozita, W.E. 2014. Orchid Breeding Programme in MARDI. The 2nd International Orchid Symposium 2014 (IOS2014) Book of Abstracts p.3, 18-21 Feb. 2014, Golden Tulip Sovereign Hotel, Bangkok, Thailand. https://www.researchgate.net/publication/282438368_Orchid_breeding_programme_in_MARDI [accessed Aug 13 2018]. Seidenfaden, G. and Wood, J.J. 1992. The Orchids of Peninsular Malaysia and Singapore. Olsen and Olsen, Fredensburg, Denmark.

127

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Biochemical Response of Xanthostemon chrysanthus (Golden Penda) to Paclobutrazol and Potassium Nitrate

Ahmad Nazarudin, M.R.1,*, Tsan, F.Y.2 and Normaniza, O.3 1Forestry and Environment Division, Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. 2Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA (UiTM), 40450 Shah Alam, Selangor, Malaysia. 3Institute of Biological Sciences, Faculty of Science, University of Malaya (UM), 50603 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

In current scenario where climate change becomes a global challenge, plant defensive abilities should be more emphasised. Drastic changes of the growth factors would affect plants’ performances, though plants had abilities to adapt with the environment. Thus, the use of proper techniques to promote plant resilience towards environmental changes is essential particularly for the highly economical crops and ornamental species grown within harsh urban environment.

A well-known plant growth retardant, paclobutrazol (PBZ) modifies plant growth in terms of morphology, physiology as well as the biochemical contents (Fletcher et al., 2000; Ahmad Nazarudin et al., 2012; Wanderley et al., 2014). PBZ should be considered as one of the mitigation approaches to enhance stress tolerance in plants as it can ameliorate the phenolic contents. It is well documented that phenolics play important roles in defense mechanism against various types of stresses caused by pathogens, pests or unfavourable growth conditions (Treutter, 2001; Agrios, 2005). Previous research demonstrated that PBZ increased the levels of proline (Mackay et al., 1990), antioxidants (Bañón et al., 2003) and chlorophyll content (Watson and Himelick, 2004). A study conducted on Arachis hypogaea found increased of antioxidant levels and activities of scavenging enzymes as response to PBZ and it then minimised the water stress condition in those plants (Sankar et al., 2007). Increased phenolic content was also occured in leaves, stems and roots of PBZ-treated Catharanthus roseus (Jaleel et al., 2009).

Furthermore, PBZ also improves carbohydrate content in plant which further enhances the reproductive performance. For instance, in Mangifera indica, PBZ increased the total non-structural carbohydrate content in the shoots before flowering stage, enhancing the number of flowers and improving yield and quality of fruit (Yeshitela et al., 2004). Yim et al. (1997) also found a significant accumulation of carbohydrate in leaves, stems, and roots of PBZ-treated Oryza sativa seedlings. PBZ application reduced gibberellins (GA) but enhanced indole acetic acid which probably stimulate carbohydrate accumulation in bulb, and also increased the sucrose contents in the leaves of Lilium sp. (Zheng et al., 2012). Upreti et al. (2013) indicated that besides affecting GA, PBZ also increased abscisic acid and cytokinin contents concomitant with C:N ratio in leaf and leaf water potential in mango buds to elicit flowering responses. In other words, augmented carbohydrate content will further benefit the plant’s growth performance.

Other element, potassium (K) is also vital in plant growth and development. It affects most of the biochemical and physiological processes that influence plant growth and metabolism. It is mainly required for the activation of over 80 enzymes throughout the plant (Mengel, 2007). In addition, K plays essential roles in protein synthesis, photosynthesis, osmoregulation, stomatal behaviour, energy transfer, phloem transport, cation-anion balance and stress resistance in plants (Marschner, 2012). Thus, it helps in

128

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

improving plants’ ability to withstand extreme environments such as cold and hot temperatures, prolong drought, and pest and disease attacks (Umar, 2006; Mengel, 2007).

Thus, this study aimed to determine the effects of PBZ and potassium nitrate (KNO3) on total phenolic content (TPC) and total non-structural carbohydrate content (TNC) at flushing, flowering and fruiting stages in Xanthostemon chrysantus (F. Muell.) Benth. (Myrtaceae) planted in urban site which usually exposed to various circumstances.

Materials and Methods

Establishment of study site

The study was carried out at an urban park, Metropolitan Batu Park, Kuala Lumpur (3° 12' 49" N; 101° 40' 43" E). A total of 81 roadside trees of X. chrysantus (about six year-old after planting) were randomly selected prior to PBZ and KNO3 treatments. Nine treatment combinations of PBZ (0, 0.125 and 0.25 g/l/tree) and KNO3 (0, 100 and 200 g/tree) were replicated nine times in a completely randomised design. ® Cultar formulation containing 250 g a.i. PBZ/l and KNO3 (13.7:0:46.3) were used. PBZ was applied as soil drench at root collar, at an application volume of 1 l per tree while, control plants were applied with 1 l tap water. PBZ was applied once at the start of the study. KNO3 was applied into the soil using pocket system technique. The allocated amount of KNO3 was equally applied in four holes for each tree. The holes of 15 cm in depth were dug under the drip-line of the tree canopy. The holes were then back-filled with the original soil to prevent runoff. KNO3 was applied at three months intervals from the start of the study.

Determination of total phenolic content and total non-structural carbohydrate

Assessment on TPC and TNC were conducted at six months after the treatment. The first three fully developed leaves from randomly selected flushing, flowering and fruiting branches of each tree were collected for both analyses. About 200 g of leaf samples were cut into small pieces and soaked in 1:6 w/v ethanol in a sealed conical flask. It was then kept at room temperature for 72 h on orbital shaker at a speed of 100 rpm. Later, it was filtered using Whitman no. 4 filter paper. The filtrate was then poured into an evaporating flask and subjected to water bath (45oC), followed by refrigeration (15oC), vacuum pumped (54 mBar), and stirred by using a rotary evaporator at 100 rpm for 20 min. The crude extract was then used for TPC analysis. Determination of TPC was performed using Folin-Ciocalteu reagent (Singleton and Rossi, 1965) with slight modifications (Vimala et al., 2003). Absorbance was measured at 725 nm by using a UV-spectrophotometer (UV-2600, Shimadzu, USA). A calibration curve was generated by using the gallic acid standard absorbance (optical density) and the levels of TPC in the leaves samples were expressed as milligram equivalent gallic acid per g sample dry weight (mg GAE/g). The TPC was calculated by using the following equation:

TPC (mg GAE/g) = (A/GA) x D / 100

Where: A : absorbance (optical density) of the sample GA : 0.0049 (gallic acid standard) D : 5 (dilution factor)

As for TNC, the freshly collected leaves were oven-dried at 70oC for 24 h. It was then ground into small pieces, soaked in 400 mL of boiled water in sealed a conical flask, and rotated for 2 h with a magnetic

129

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

stirrer. It was later filtered using Whitman no. 4 filter paper. The filtrate was then poured into an evaporating flask and subjected to water bath (100oC), refrigerated (15oC) and vacuum pumped (54 mBar), and rotated by using a rotary evaporator at 5 rpm for 30 min. The crude extract was then used for TNC test. The sum of soluble sugars and starch were determined. The determination of the TNC was performed using phenol sulphuric acid method (Masuko et al., 2005). The TNC was calculated according to the formula below:

(Absorbance of sample) x (weight of standard glucose) % TNC = x 100 (Absorbance of glucose x weight of sample)

Data analysis

Data obtained was subjected to one-way ANOVA and the treatment means were then compared using a Duncan’s Multiple Range Test (DMRT) (p<0.05).

Results and Discussion

Total phenolic content

There was a significant difference found in TPC in the leaf of X. chrysanthus after PBZ and KNO3 treatments at flushing, flowering and fruiting branches, respectively (Table 1). With flushing branch, 0.25 g/L PBZ gave the highest TPC. On the other hand, 0.125 g/L PBZ resulted in the highest TPC in the leaf on the flowering branch. Meanwhile, the control tree contained the lowest TPC in all growth stages. These results imply that PBZ was effective to increase the TPC in all growth stages of X. chrysanthus, while the addition of KNO3 did not give much effect on TPC. There was no difference in TPC observed between the control and KNO3-treated trees on the flowering and fruiting branches, respectively. However, 200 g/tree KNO3 resulted in significantly higher TPC as compared to the non-treated tree at flushing stage.

In general, greater TPC at flowering branch was recorded than flushing branch. TPC was also declined at fruiting branch regardless of the treatments. For instance, combination of 0.125 g/L PBZ and 100 g/tree KNO3 had lower TPC during flushing and higher at flowering stage, showing 16.3% increment. However, the TPC reduced at fruiting stage. A similar pattern of TPC was also recorded in all treatments.

Table 1: Effects of paclobutrazol and potassium nitrate on total phenolic content at different branches in X. chrysanthus. Total phenolic content (mg GAE/g) at different growth branches Treatment Flushing Flowering Fruiting Control 16.13±1.66c 16.82±0.65c 16.26±2.41b bc bc b 100 g KNO3 17.37±1.44 19.96±0.68 18.77±0.38 ab bc b 200 g KNO3 19.16±0.98 19.71±0.15 18.96±0.07 0.125 g/l PBZ 19.07±0.93ab 24.74±2.01a 19.82±2.07a ab ab a 0.125 g/l PBZ + 100 g KNO3 18.78±1.15 22.45±4.08 19.92±0.91 ab ab a 0.125 g/l PBZ + 200 g KNO3 18.90±0.26 21.44±4.41 19.08±0.44 0.25 g/l PBZ 20.33±1.44a 23.75±0.95ab 20.45±2.15a ab abc a 0.25 g/l PBZ + 100 g KNO3 18.92±0.50 21.03±1.43 19.75±1.94 ab abc ab 0.25 g/l PBZ + 200 g KNO3 18.45±0.51 20.47±1.49 18.84±0.07 Means followed by the same letter(s) within column do not differ (p<0.05) by DMRT; Mean ± standard deviation.

130

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Increased phenolic compounds were also reported in PBZ-treated C. roseus (Jaleel et al., 2006), Ocimum sanctum (Gopi et al., 2009) and Rosa hybrid (Schmitzer et al., 2010). In plants, phenolics are greatly important for pigmentation, reproduction and resistance to pathogens (Lattanzio et al., 2006). Enhancement of phenylopropanoid metabolism and the amount of phenolic compounds can be observed under different environmental and stress conditions (Lavola et al., 2000; Diáz et al., 2001; Sakihama and Yamasaki, 2002). Synthesis of isoflavones and some other flavonoids was induced when plants are infected or injured (Takahama and Oniki, 2000; Ruiz et al., 2003), or under extreme temperature and poor nutrient condition (Sakihama and Yamasaki, 2002; Ruiz et al., 2003). It has been discovered that water shortage led to an increase in the concentration of the blue fluorescence originating from plant phenolics, mostly from ferulic acid (Morales et al., 2005; Hura et al., 2006). Phenolics are able to counteract light falling on the foliage through its conversion into blue fluorescence, which is no longer harmful and can even be utilised for photosynthetic quantum adaptation (Bilger et al., 2001). Fletcher et al. (2000) stated that triazole-treated plants showed reduction in transpiration, used less water and was able to withstand drought better than untreated plants. In this study, single application of KNO3 at both rates was not effective to increase TPC. Significant different in TPC was only found between the control and 200 g KNO3 at flushing stage. This could be due to lacking of nutrients in the urban soil as reported by Russo et al. (2005), including K element. Hence, higher amount of KNO3 is required to enhance TPC content for the species planted in such condition. Moreover, the physical character of the urban soils is of poor quality as they are highly modified and compacted (Lorenz and Lal, 2009).

Total non-structural carbohydrate content

Observation on all growth stages showed that TNC was significantly higher in the control and KNO3- treated trees as compared to other treatments where PBZ existed (Table 2). At flushing stage, a great difference in TNC was found between the control and tree treated with 0.25 g/l PBZ, showing 87.9% difference. A similar pattern of TNC in both treatments was also measured at flowering and fruiting stages, respectively. These results suggested that, the existence of PBZ reduces the TNC in the newly expanded leaves of the species.

Table 2: Effects of paclobutrazol and potassium nitrate on total non-structural carbohydrate at different growth branches in X. chrysanthus. Total non-structural carbohydrate (%) at different growth branches Treatment Flushing Flowering Fruiting Control 11.36±0.95a 11.47±1.86a 13.12±4.17a a a a 100 g KNO3 12.22±0.67 11.01±0.51 10.69±0.59 a a a 200 g KNO3 11.58±1.02 11.11±1.21 10.28±0.06 0.125 g/l PBZ 1.25±0.07d 1.52±0.27c 1.14±0.10c b b c 0.125 g/l PBZ + 100 g KNO3 4.25±1.12 3.15±0.10 2.62±0.44 bc bc c 0.125 g/l PBZ + 200 g KNO3 2.99±0.61 2.90±0.53 2.04±0.17 0.25 g/l PBZ 1.37±0.06d 1.67±0.38bc 1.52±0.30c cd c c 0.25 g/l PBZ + 100 g KNO3 1.88±0.55 1.50±0.64 2.02±0.07 cd c c 0.25 g/l PBZ + 200 g KNO3 1.93±1.11 1.52±0.60 1.67±0.55 Means followed by the same letter(s) within column do not differ (p<0.05) by DMRT; Mean ± standard deviation.

Some of the earlier studies indicated that carbohydrate content in various plant tissues were enhanced by PBZ (Assuero et al., 2012; Zheng et al., 2012). For example, PBZ dramatically enhanced the retention of carbohydrate contents in O. sativa (Das et al., 2005). Total soluble sugar, sucrose and starch content in the bud organs, leaf and stem in Brasscia napus were also improved by PBZ at the initial flowering phase (Hua et al., 2014).

131

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Nevertheless, several researches have published contradict results. Insignificant differences were found in TNC concentrations in the leaves of PBZ-treated M. indica during vegetative and reproductive stages (Urban et al., 2008). Watson (2006) also indicated that TNC was not enhanced by PBZ in Quercus alba. These results showed that there is possibility of having different outcome regarding TNC due to PBZ treatment with different plant species. Some of the possible reasons are improper dosages of PBZ applied, or it could be due to different responses to the treatment from each plant species. In this study, TNC in the leaves of X. chrysanthus was not induced by PBZ or combined treatment of PBZ and KNO3. However, single application of KNO3 resulted in higher TNC than those treated with combination of both elements. KNO3 supplied K which is essential to activate various enzymes responsible for synthesis of protein and carbohydrate in plant (Mengel, 2007; Patil, 2011; Zheng et al., 2012). K element is also known to enhance plant tolerance to drought conditions (Thomas and Thomas, 2009; Kim et al., 2010), a typical situation in urban soils. Nevertheless, the effects of KNO3 may be interfered by PBZ as shown in the combined treatments. It is well known that PBZ has growth regulating properties which are mediated by changes in the balance of essential plant hormones, including the GAs, abscisic acid and cytokinins (Hajihashemi et al., 2007). These changes would affect the growth and development of plants.

Conclusion

In conclusion, TPC was greatly enhanced with combined treatment of PBZ and KNO3 at all growth stages of X. chrysanthus. Meanwhile, TNC was significantly higher in the non-treated trees and trees treated with single application of KNO3 than other treatments. Increased TPC might be beneficial to improve the tolerance of the tree species planted in the harsh urban environment.

Acknowledgements

Thanks are due to the Kuala Lumpur City Hall for site permission. Financial support for this project was granted by the Ministry of Agriculture and Agro-based Industry Malaysia (05-03-10-SF1030).

References

Agrios, G.N. 2005. Plant Pathology (5th edition). New York: Academic Press. Ahmad Nazarudin, M.R., Tsan, F.Y. and Mohd Fauzi, R. 2012. Morphological and physiological response of Syzygium myrtifolium (Roxb.) Walp. to paclobutrazol. Sains Malaysiana 41(10): 1187-1192. Assuero, S.G., Lorenzo, M., Pérez Ramírez, N.M., Velázquez, L.M. and Tognetti, J.A. 2012. Tillering promotion by paclobutrazol in wheat and its relationship with plant carbohydrate status. New Zealand Journal of Agricultural Research 55(4): 347-358. Bañón, S., Ochoa, J., Martínez, J.A., Fernández, J.A., Franco, J.A., Sánchez-Blanco, M.J., Alarcón, J.J. and Morales, M.A. 2003. Paclobutrazol as aid to reducing the effects of salt stress in Rhamnus alaternus seedlings. Acta Horticulturae 609: 263-268. Bilger, W., Johnsen, T. and Schreiber, U. 2001. UV-excited chlorophyll fluorescence as a tool for the assessment of UV-protection by the epidermis of plants. Journal of Experimental Botany 52: 2007-2014. Das, K.K., Sarkar, R.K. and Ismail, A.M. 2005. Elongation ability and non-structural carbohydrate levels in relation to submergence tolerance in rice. Plant Science 168: 131-136. Diáz, J., Bernal, A., Pomar, F. and Merino, F. 2001. Induction of shikimate dehydrogenase and peroxidase in pepper (Capsicum annum L.) seedlings in response to copper stress and its relation to lignification. Plant Science 161: 179-188. Fletcher, R.A., Gilley, A., Sankhla, N. and Davis, T.D. 2000. Triazoles as plant growth regulators and stress protectants. Horticultural Reviews 24: 55-138.

132

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Gopi, R., Jaleel, C.A., Divyanair, V., Azooz, M.M. and Panneerselvam, R. 2009. Effect of paclobutrazol and ABA on total phenol contents in different parts of holy basil (Ocimum sanctum). Academic Journal of Plant Sciences 2(2): 97-101. Hajihashemi, S., Kiarostami, K., Saboora, A. and Enteshari, S. 2007. Exogenously applied paclobutrazol modulates growth in salt-stressed wheat plants. Plant Growth Regulation 53: 117-128. Hua, S., Zhang, Y., Yu, H., Lin, B., Ding, H., Zhang, D., Ren, Y. and Fang, Z. 2014. Paclobutrazol application effects on plant height, seed yield and carbohydrate metabolism in Canola. International Journal of Agriculture and Biology 16: 471-479. Hura, T., Grzesiak, S., Hura, K., Grzesiak, M.T. and Rzepka, A. 2006. Differences in the physiological state between triticale and maize plants during drought stress and followed rehydration expressed by the leaf gas exchange and spectrofluorimetric methods. Acta Physiologiae Plantarum 28: 433- 443. Jaleel, C.A., Gopi, R. and Panneerselvam, R. 2009. Alterations in non-enzymatic antioxidant components of Catharanthus roseus exposed to paclobutrazol, gibberellic acid and Pseudomonas fluorescens. Plant Omics Journal 2(1): 30-40. Jaleel, C.A., Gopi, R., Alagulakshmanan, G.M. and Panneerselvam, R. 2006. Triadimefon induced changes in the antioxidant metabolism and ajmalicine production in Catharanthus roseus (L.) G. Don. Plant Science 171: 271-276. Kim, T.H., Bohmer, M., Hu, H., Nishimura, N. and Schroeder, J.I. 2010. Guard cell signal transduction 2+ network: advances in understanding abscisic acid, CO2, and Ca signaling. Annual Review of Plant Biology 61: 561-591. Lattanzio, V., Lattanzio, V.M.T. and Cardinali, A. 2006. Role of phenolics in the resistance mechanisms of plants against fungal pathogens and insects. In: F. Imperato (Ed.). Phytochemistry: Advances in research. Research Signpost, Kerala, India. Pp. 23-67. Lavola, A., Julkunen-Tiitto, R., de la Rosa, T.M., Lehto, T. and Aphalo, P.J. 2000. Allocation of carbon to growth and secondary metabolites in birch seedlings under UV-B radiation and CO2 exposure. Physiologia Plantarium 109: 260-267. Lorenz, K. and Lal, R. 2009. Biochemical C and N cycles in urban soils. Environment International 35: 1- 8. Mackay, C.E., Christopher Hall, J., Hofstra, G. and Fletcher, R. 1990. Uniconazole-induced changes in abscisic acid, total amino acids and proline in Phaseolus vulgaris. Pesticide Biochemistry and Physiology 37(1): 74-82. Marschner, P. 2012. Marschner’s Mineral Nutrition of Higher Plants (3rd Edition) Academic Press: London, UK. Pp. 178-189. Masuko, T., Minami, A., Iwasaki, N., Majima, T., Nishimura, S. and Lee, Y.C. 2005. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Analytical Biochemistry 339(1): 69-72. Mengel, S. 2007. Potassium. In: A.V. Barker and D.J. Pilbean (Eds.), Handbook of plant nutrition. CRC Taylor and Francis, New York. Pp. 395-402. Morales, F., Cartelat, A., Alvarez-Fernández, A., Moya, I. and Cerovic, Z.G. 2005. Time-resolved spectral studies of blue-green fluorescence of artichoke (Cynara cardunculus L. var. Scolymus) leaves: Identification of chlorogenic acid as one of the major fluorophores and agemediated changes. Journal of Agricultural and Food Chemistry 53: 9668-9678. Pasqualini, V., Robles, C., Garzino, S., Greff, S., Bousquet-Melou, A. and Bonin, G. 2003. Phenolic compounds content in Pinus halepensis Mill. needles: A bioindicator of air pollution. Chemosphere 52: 239-248. Patil, R.B. 2011. Role of potassium humate on growth and yield of soybean and black gram. International Journal of Pharma and Bio Sciences 2(1): 242-246.

133

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ruiz, J.M., Rivero, R.M., Lopez-Cantarero, I. and Romero, L. 2003. Role of Ca2+ in metabolism of phenolic compounds in tabacco leaves (Nicotiana tabacum L.). Plant Growth Regulation 41: 173- 177. Russo, S.E., Davies, S.J. King, D.A. and Tan, S. 2005. Soil-related performance variation and distributions of tree species in a Bornean rain forest. Journal of Ecology 93: 879-889. Sakihama, Y. and Yamasaki, H. 2002. Lipid peroxidation induces by phenolics in conjunction with aluminium ions. Biologia Plantarum 45: 249-254. Sankar, B., Jaleel, A., Manivannan, P., Kishorekumar, A., Somasundaram, R. and Panneerselvam, R. 2007. Effect of paclobutrazol on water stress amelioration through antioxidants and free radical scavenging enzymes in Arachis hypogaea L. Colloids and Surfaces B: Biointerfaces 60: 229-235. Schmitzer, V., Veberic, R., Osterc, G. and Stampar, F. 2010. Color and phenolic content changes during flower development in groundcover rose. Journal of the American Society for Horticultural Science 135(3): 195-202. Singleton, V.L. and Rossi, J.A. 1965. Colorimetry of total phenolics with phosphomolybdic- phosphotungstic acid reagents. American Journal of Enology and Viticulture 16: 144-158. Takahama, U. and Oniki, T. 2000. Flavonoid and some other phenolics as substrates of peroxidase: physiological significance of the redox reactions. Journal of Plant Research 113: 301-309. Thomas, T.C. and Thomas, A.C. 2009. The vital role of potassium in the osmotic mechanism of stomata aperture modulation and its link with potassium deficiency. Plant Signaling and Behavior 4: 240- 243. Treutter, D. 2001. Biosynthesis of phenolic compounds and its regulation in apple. Plant Growth Regulation 34: 71-89. Umar, S. 2006. Alleviation adverse effects of water stress on yield of sorghum, mustard and groundnut by potassium application. Pakistan Journal of Botany 38: 1373-1380. Upreti, K.K., Reddy, Y.T.N., Prasad, S.R.S., Bindu, G.V., Jayaram, H.L. and Rajan, S. 2013. Hormonal changes in response to paclobutrazol induced early flowering in mango cv. Totapuri. Scientia Horticulturae 150: 414-418. Urban, L., Jegouzo, L., Damour, G., Vandame, M. and Francois, C. 2008. Interpreting the decrease in leaf photosynthesis during flowering in mango. Tree Physiology 28: 1025-1036. Vimala, S., Mohd Ilham, A., Abdull Rashih, A. and Rohana, S. 2003. Nature’s Choice to Wellness: Antioxidant Vegetable/Ulam. Siri Alam dan Rimba No.7. Kepong: Forest Research Institute Malaysia. Wanderley, C.D.S, Faria, R.T.D, Ventura, M.U. and Vendrame, W. 2014. The effect of plant growth regulators on height control in potted Arundina graminifolia orchids (Growth regulators in Arundina graminifolia). Acta Scientiarum Agronomy 36(4): 489-494. Watson, G.W. 2006. The effect of paclobutrazol treatment on starch content, mycorrhizal colonization, and fine root density of White Oaks (Quercus alba L.). Arboriculture and Urban Forestry 32(3): 114-117. Watson, G.W. and Himelick, E.B. 2004. Effects of soil pH, root density, and tree growth regulator treatments on pin oak chlorosis. Journal of Aboriculture 30(3): 172-177. Yeshitela, T., Robbertse, P.J. and Stassen, P.J.C. 2004. Paclobutrazol suppressed vegetative growth and improved yield as well as fruit quality of ‘Tommy Atkins’ mango (Mangifera indica) in Ethiopia. New Zealand Journal of Crop and Horticultural Science 32: 281-293. Yim, K.O., Kwon, Y.W. and Bayer, D.E. 1997. Growth responses and allocation of assimilates of rice seedlings by paclobutrazol and gibberellins treatment. Journal of Plant Growth Regulation 16: 35- 41. Zheng, R., Wu, Y. and Xia, Y. 2012. Chlorocholine chloride and paclobutrazol treatments promote carbohydrate accumulation in bulbs of Lilium oriental hybrids ‘Sorbonne’. Journal of Zhejiang University Science B 13(2): 136-144.

134

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Air Layering Propagation Media of Baeckea frutescens from Setiu, Terengganu

Farah Fazwa, M.A.*, Norhayati, S., Syafiqah Nabilah, S.B., Mohd Zaki, A., Samsuri, T.H., Nor Izatty Atikah, J.S., Fara Shazwanie, O.T. and Mohd Zaini, Z. Plant Improvement Programme, Forestry Biotechnology Division, Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Baeckea frutescens or locally known as Cucur atap is a small tree which is found in Peninsular Malaysia and Sumatra. It is also found distributed along the coastal areas of Southern China and Australia. It grows wild on arid soils in the mountain and midlands. In Peninsular Malaysia, it is found both on the mountain and sandy coasts such as in Terengganu and Pahang states. The tree trunk is short with several upright branches that spread out and droop at the ends as fine twigs. The leaves are opposite, small and very narrow, needle-like, only about 6-15 mm long. In traditional usage, it is claimed to be effective in treating influenza, dyspepsia, jaundice, dysentery, measles and irregular menstrual cycles. Its external usage is in treating furunculosis and impetigo (Herbal Medicine Research Centre, 2002). They are also used in massaging postpartum women for the treatment of body aches and numbness of the limbs. Baeckea frutescens leaf extract has been reported to have var-ious pharmacological activity such as cytotoxic (Fujimoto et al., 1996), anti-cariogenic (Hwang et al., 2004) and anti babesial activities (Murningsih et al., 2005). Chemical studies on the leaves of B. frutescens have indicated the presence of volatile oil (Ibrahim et al., 1998), sesquiterpenes (Tsui and Brown, 1996), chromone C-glycosides (Satake et al., 1999), phloroglucinols (Fujimoto et al., 1996) and flavanones (Makino and Fujimoto, 1996).

Due to its great potential, the over exploitation of the species from abundant and along the coastal areas may resulted to the unsustainable supply of the species from the wild. In ensuring adequate and regular supply of planting stocks, an appropriate vegetative propagation method should be investigated. Vegetative propagation through cutting, grafting, budding and air layering has been a vital tool in tree improvement activities and used for multiplying desirable the species without genetic segregation (Zobel and Talbert, 1984). Air layering can be used as an effective method to obtain roots. Air layering is fairly common and used to propagate guava, under the same family of B. frutescens (Rahman et al., 2014). The propagation of B. frutescens through seeds should not be encouraged because the process will take more than 12 months for the seedlings to fully develop. Therefore, this experiment is conducted to investigate the best rooting media for air layering of ten selected mother trees of B. frutescens from Setiu, Terengganu. The results of the study will benefit the industries for quick and effective method in order to produce mass planting materials.

Materials and Methods

The experiment was conducted at Setiu, Forest Research Institute Malaysia, Kepong, Selangor by air layering of ten B. frutescens mothers’ trees. A few phenotypically superior trees showing good growth, full of branches, superior height and bole diameter were selected for the study (Figure 1).

By using a scrapping knife, healthy branches of trees were girdled at a width of 2.5 cm from position 25 cm from the tip of the branch. The cut must deep enough to get through the cambium layer and scraped the branch well to remove the soft material. Dust the bases of the layering limb with growth commercial

135

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

hormone powder, Seradix 3 (0.8% indole butyric acid-IBA) (Figure 2). Six types of wet rooting media, squeezed out well, placed in the middle of a piece of plastic and covered around the ringbarked area. The ringed area was then wrapped tightly with plastic film and tied above and below the ball of media. Two to three holes were made on the film for aeration and the medium was kept moist by spraying water once a week. The air layering media treatments were i) M1: 100% top soil (control), ii) M2: 100% jiffy peat, iii) M3: 50% top soil + 50% sand, iv) M4: 50% top soil + 50% sawdust, v) M5: 50% top soil + 50% jiffy peat, and vi) M6: 50% top soil + 50% coconut husk (Figure 3).

The six treatments were replicated in two blocks with a total number of five samples were used for each treatment. After 17 weeks of rooting period and new roots emerged and visible, the layer was ready to be taken from the parent tree. Data on percentage of success rooting (no of layers survived/no of samples x 100%), number of roots per layer, length and diameter of longest root were recorded using ruler. The data were analyzed using Analysis of Variance (SPSS Statistics version 22), and Tukey post-hoc was calculated at difference value P<0.05 to differentiate the mean treatments. The detached rooted layers were then planted in polybags (10 x 10 cm) containing a mixture of topsoil and river sand at the ratio of 1:2 and the plants were maintained at nursery.

Figure 1: Mother trees of Baeckea frutescens at Setiu, Terengganu.

Figure 2: Process of girdling and application of hormone to Baeckea frutescens branches.

136

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 3: Six types of rooting media used for propagation of Baeckea frutescens.

Results and Discussion

Analysis of variance revealed that there were significant differences between the applied media after 17 weeks. Baeckea frutescens propagated in M5: 50 % topsoils + 50% jiffy media produced the highest rooting percentage, 60.0% compared to other media treatments. Muhamad Fuad et al. (2015) in his study used jiffy media in acclimatization of Eurycoma longifolia plants to increase the survival rates of the plants. The lowest rooting percentage was recorded by air layering using M4: 50% topsoil + 50% sawdust at 10.0% (Table 1). Sawdust was found to have high capacity in holding moisture and may contribute to low air porosity. Under this condition, the plants do not receive sufficient air and oxygen for respiration during the rooting process (Frenck and Kim, 1995).

Table 1: Root percentage in air layering of Baeckea frutescens as affected by different media.

Rooting media (v/v) Root percentage (%)

M1: 100% topsoil (control) 40.0 M2: 100% jiffy peat 30.0 M3: 50% topsoils + 50% sands 40.0 M4: 50% topsoil + 50% sawdust 10.0 M5: 50 % topsoils + 50% jiffy 60.0 M6: 50% top soil + 50% coconut husk 20.0

Number of roots produced from layers for each treatment was significantly different. Figure 4 indicated that M5: 50 % topsoils + 50% jiffy gave the highest root numbers followed by M6: 50% top soil + 50% coconut husk. However, M1, M2, M3 and M4 showed no significantly differences in terms of their roots number. Combination of topsoil and jiffy composed of peat moss is also found to be the best rooting media for air layering of Guava (Psidium guajava) which is from the same family of B. frutescens (Rymbai and Sathyanarayana, 2010). This is due to its capacity to retain higher moisture retention with high porosity for better aeration. The finding was also similar with Singh and Jawanda, (1981) in propagation of Litchi species.

137

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

In terms of roots length, M4: topsoil + sawdusts (1:1) gave the highest roots length (7.80 cm), whereas M1: 100% jiffy gave the lowest roots length (2.45 cm). Jiffy composed of peat moss cells are thin-walled cells with large holes and their function is to absorb and transport water. However, it is important to keep the media wet in order to maintain the moisture condition and aeration (Lawson, 2017). Since Setiu, Terengganu is identified as dry area, jiffy media used in the study are exposed to heat, and therefore are not suitable for air layering propagation. Other than that, it is also suggested to use higher concentration of IBA hormone to stimulate faster growth of roots (Tyagi and Patel, 2004). The highest root diameter was also obtained from the propagation using M5: topsoil + sawdusts (1:1) at 0.79 mm. However it is not significantly different with M1, M2 and M4. Combination of media topsoil and coconut husk indicated the lowest roots diameter (0.56 mm).

Figure 4: Roots number produced from six types of rooting media in air layering of Baeckea frutescens mother trees from Setiu, Terengganu.

Figure 5: Roots length (cm) produced from six types of rooting media in air layering of Baeckea frutescens mother trees from Setiu, Terengganu.

138

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 6: Roots diameter (mm) produced from six types of rooting media in air layering of Baeckea frutescens mother trees from Setiu, Terengganu.

Conclusion

In conclusion, it can be stated that rooting media treatments have tremendous effect on the success of air layering in B. frutescens. The overall results obtained from this study revealed that the better rooting of air layering in B. frutescens when topsoil and jiffy are used as rooting media. However, further investigation should be carried out by studying the effects of different concentrations of IBA and time of layering. The results of the study will benefit the industries for quick and effective method in order to produce mass planting materials for the species.

References

Frenck, F.B.R. and Kim, K.S. 1995. EBB and flow cultivation of Chrysanthemum cuttings in different growing media. Acta Horticulturae 401: 193-200. Fujimoto, Y., Usui, S., Makino, M. and Sumatra, M. 1996. Phloroglucinols from Baeckea frutescens, Phytochemistry 41: 923-925. Herbal Medicine Research Centre. 2002. Compendium of Medicinal Plants Used in Malaysia, 1, Herbal Medicine Research Centre, Institute for Medical Research, Kuala Lumpur. Pp. 98-99. Hwang, J.K., Shim, J.S. and Chung, J.Y. 2004. Anticariogenic activity of some tropical medicinal plants against Streptococcus mutans. Fitoterapia 75: 596-598. Jantan, I., Ahmad, A.S., Abu Bakar, S.A., Ahmad, A.R., Trockenbrodt, M. and Chak, C.V. 1998. Constituents of the essential oil of Baeckea frutescens L. from Malaysia, Flavour Fragrance Journal 13: 245-247. Lawson, L. 2017. Sphagnum peat moss influence on physical properties of growing media. https://www.pthorticulture.com. Makino, M. and Fujimot, Y. 1998. Flavanones from Baeckea frutescens. Phytochemistry 50: 273-277. Muhammad Fuad, Y., Hassan, N.H., Abdullah, N., Rahman, A., Suhaila, S., Ismail, H. and Koter, R. 2015. Acclimatization of Eurycoma longifolia (Tongkat Ali) plantlets to ex vitro conditions. Journal of Tropical Resources and Sustainable Science 3(1): 129-131. Murningsih, T., Subekti, H., Matsuraa, K., Takahasi, M., Yamasaki, O., Yamato, M., Maede, K., Katakura, M., Kobayashi, S. and Yushihara, T. 2005. Evaluation of the inhibitory activities of the

139

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

extracts of Indonesia traditional medicinal plants against Plasmodium falciparum and Babesia gibsoni. Journal of Veterinary Medical Science 67: 829-831. Rahman, M.M., Das, A.C., Rob, M.M., Debnath, B. and Islam, M.S. 2014. Effects of time and rooting media on success of air layering in Guava. Journal of Sylhet Agricultural University 1(1): 23-27. Rymbai, H. and Sathyanarayana, R. 2010. Effect of IBA, time of layering and rooting media on air layers and plantlets survival under different growing nursery conditions in guava. Indian Journal of Horticulture 67: 99-104. Satake, T., Kamiya, K., Saiki, Y., Hama, T., Endang, H. and Umar, M. 1999. Chromone C-glycosides from Baeckea frutescens. Phytochemistry 50: 303-306. Singh, S. and Jawanda, J.S. 1981. Propagation studies in Litchi. Punjabi Horticulture Journal 21: 184-187. Tsui, W.Y. and Brown, G.D. 1996. Chromones and chromanones from Baeckea frutescens. Phytochemistry 43: 871-876. Tyagi, S.K. and Patel, R.M. 2004. Effect of growth regulators on rooting of air layering of guava (Psidium guajava L.) Orissa Journal of Horticulture 32: 58-62. Zobel, B. and Talbert, J. 1984. Applied Forest Tree Improvement. John Wiley and Sons, New York.

140

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Evaluation of Biomass Increment and Stand Dynamics of Gonystylus bancanus (Ramin Melawis) in Peat Swamp Forest, Pekan, Pahang, Malaysia

Mohd Afzanizam, M.*, Azman, B. and Philip, E. Climate Change and Forestry Program, Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

The genus Gonystylus consists of about 30 species that are distributed throughout the Malesian region with the exception of Central and East Java and the Lesser Sunda Islands Eastward (Soerianegara and Lemmens, 1994). The distribution area extends towards the Solomon Islands, Nicobar and Fiji. The vast majority of species are found in Borneo (27 species), especially in Sarawak. Peninsular Malaysia and Sumatra come second with 7 species each (Whitmore, 1972), and the Philippines possess 2 species. Other areas are each occupied by a single species. According to Shaw (1954), Ramin is a local trade name for the species of Gonystylus bancanus, G. velutinus, G. intoranffius, and G. xylocaipus. However, in this study, ramin refers mainly to G. bancanus Kurz, a species that naturally grows in peat swamp forest (PSF) as its habitat. Six species are currently known to be commercially valuable. These species include G. affinis, G. bancanus, G. forbesii, G. macrophyllus, G. maingayi and G. velutinus. Gonystylus bancanus is the most commonly traded of the species. Due to the concern on unsustainable exploitation or harvesting of Ramin, an assessment to identify current distribution and ecological status of this threatened genus has been addressed. This will relate to the current status of growing stock, biological and ecological condition of Ramin. Forest ecosystems can modify the atmospheric carbon dioxide (CO2) through biomass accumulation mostly in tree stems with diameter at breast height (DBH) of ≥10 cm (Do et al., 2017). Aboveground biomass increment (ΔAGB), and changes in stand AGB, number of stems and basal area (BA) were calculated from growth data of tree in tropical PSF, Pekan Forest Reserve (FR). Data were derived from a 1 ha permanent ecological plot established in 2016, where all stems with DBH ≥10 cm were tagged, identified to species, and measured for DBH in 2017 and 2018.

In Peninsular Malaysia, the extent of PSF coverage area was 255,080 ha (Forestry Statistics Peninsular Malaysia, 2014). Forestry Statistics showed that PSF coverage area under Permanent Reserve Forest by forest type in 2014 was as follow: Johor (5,429 ha), Pahang (140,830 ha), Selangor (82,890 ha), Terengganu (25,931 ha) using digital satellite data. No value was recorded in other states. The Southeast Pahang PSF (SEP PSF) is the largest remaining PSF in Malaysia. Khali et al. (2007) described stand characteristics of tree communities in Ramin-Bintangor forest subtype in SEP PSF as rich with commercial timber species To date, there were 93,477 ha of remaining virgin peat swamp under pristine condition in Peninsular Malaysia (IHN-5, 2014) Among prominent tree species normally inventoried in PSF are G. bancanus (Ramin melawis), Calophyllum ferrugineum (Bintangor gambut), Shorea platycarpa (Meranti paya), Tetramerista glabra (Punah), Durio carinatus (Durian paya), Koompassia malaccensis (Kempas), Syzygium sp. (Kelat), Santiria sp. (Kedondong) etc. Being listed as ‘critically endangered’ in the International Union for Conservation of Nature (IUCN) Red List of Threatened Species, it is crucial to conserve G. bancanus to ensure its survival and important growing stock, especially in swamp forest. Ramin has been listed on CITES Appendix II since 2005 to curb the illegal trade of the species and encourage the use of quotas and permits to the trade of the species in a range of countries, which are now thoroughly used and applied (CITES, 2005).

141

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

In this preliminary study, tree biomass and carbon (C) stock for G. bancanus in Pekan FR was quantified. The objectives of the study were:

1. To conduct biomass and C stock assessment studies of G. bancanus in PSF in natural/pristine condition. 2. To quantify biomass accrual and C stock increment for tropical PSF.

Materials and Methods

The study site is located at Compartment 75, Pekan FR, in the Southeast of Pahang, Malaysia (Figure 1). Compartment 75 is a 200-ha area currently classified as “production forest” by Forest Department of Pahang.

Ecological plot establishment

Twenty-five (25) plots of 20 x 20 m were established for population profile assessments. It is important to acquire information and examine changes in forest structure and species composition through time, and to examine changes in stand density and basal area. All trees ≥10 cm DBH were measured to describe the stand structure and density.

Figure 1: Establishment of 25 permanent plots sized 20 x 20 m in Compartment 75, Pekan FR, for biomass assessment and C stock study.

142

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Forest stand metrics

All living trees and dead trees were enumerated in each plot. The merchantable height and DBH were recorded and metrics of abundance, including basal area and stand density, were also recorded. The growth parameter used for this study was DBH.

Tree basal area and tree volume was calculated as follows:

Basal area, ba = [π (DBH2)/40000] (unit in m2), Tree volume, vol = ba x mht x 0.65 (unit in m3), where mht is merchantable bole height in meters. The 0.65 value is a presumed form factor applied to all trees (JPSM, 1997). Only trees with ≥10 cm DBH were analysed.

Tree biomass and C stock

Allometric function used for biomass calculation in tropical peat swamp was developed by Manuri et al. (2014) based on mixed species PSF and lowland dipterocarp forest in Kalimantan using three variables/predictors, namely DBH, merchantable height (H) and wood density (WD).

Biomass (aboveground), AGB = AGB=0.0494 x D1.7961 X H1.2292x WD0.9170, DBH in cm, H in metre and WD as oven dry mass/fresh volume in (g/cm3), R2 = 99

Biomass (belowground), BGB = 20.1% of AGB

Total Plant Biomass = Biomass (aboveground) + Biomass (belowground)

C stock was calculated by multiplying the sum of biomass with C fraction. The C fraction of dry matter in biomass used for this study is 0.47 (IPCC, 2006)

Results and Discussion

This paper highlights stand characteristics of a PSF based on our ecological plot established in VJR at Compartment 75, Pekan FR, Pahang. From the inventory, we recorded a total of 61 tree species from 48 genera and 33 families among all trees of 10 cm DBH and above. In the 1-ha ecological plot, a total of 17 of 465 trees enumerated were G. bancanus (Table 1).

143

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Flora inventory in Compartment 75 of PSF in Pekan FR, Pahang. Family Scientific name (Local name) No. of No. of species trees Anacardiaceae Campnosperma coriaceum (Terentang simpoh) 1 10 Annonaceae Xylopia ferruginea (Jangkang) 1 7 Aquifoliaceae Ilex cymosa (Mensirah) 1 14 Bombacaceae Durio carinatus (Durian paya) 1 6 Burseraceae Santiria rubiginosa (Kedondong kerantai), Santiria tomentosa 5 36 (Kedondong bulu), Santiria laevigata (Kedondong kerantai licin), Dacryodes macrocarpa (Kedondong matahari), Dacryodes crassifolia (Kedondong matahari) Calophyllaceae Calophyllum molle (Bintangor), Calophyllum ferrugineum 3 51 (Bintangor gambut), Calophyllum sclerophyllum (Bintangor jangkang) Celastraceae Lophopetalum multinervium (Mata ulat) 1 6 Chrysobalanaceae Parastemon urophyllus (Nyalas) 1 18 Ctenolophonaceae Ctenolophon parvifolius (Mertas) 1 1 Dipterocarpaceae Shorea platycarpa (Meranti paya), Shorea leprosula (Meranti 15 tembaga) 2 Ebenaceae Diospyros lanceifolia (Kayu arang), Diospyros maingayi (Kayu 2 9 arang) Elaeocarpaceae Elaeocarpus floribundus (Mendong) 1 8 Euphorbiaceae Blumeodendron tokbrai (Gaham badak), Pimelodendron 4 15 griffithianum (Perah ikan), Macaranga hypoleuca (Mahang), Neoscortechinia philippinensis (Agar-agar) Fabaceae Koompassia malaccensis (Kempas), Dialium indum (Keranji paya) 2 13 Fagaceae Lithocarpus ewckii (Mempening), Castanopsis sp. (Berangan) 2 7 Guttiferae Cratoxylum formosum (Geronggang), Garcinia urophylla (Kandis), 3 8 Garcinia parvifolia (Kandis) Lauraceae Litsea grandis (Medang daun lebar), Actinodaphne sesquipedalis 4 14 (Medang payung), Crytocarya impressa (Medang kunyit), Litsea sp. (Medang) Malvaceae Heritiera elata (Mengkulang jari) 1 3 Meliaceae Aglaia rubiginosa (Bekak), Sandoricum beccarianum (Sentol) 2 11 Moraceae Parartocarpus venenosus (Ara bertih paya) 1 5 Myristicaceae Gymnacranthera farquhariana (Penarahan), Horsfieldia crassifolia 5 32 (Penarahan), Horsfieldia wallichii (Penarahan), Knema sp. (Penarahan), Myristica lowiana (Penarahan arang gambut) Myrtaceae Syzygium cerinum (Kelat gelam), Syzygium kiahii (Kelat), Syzygium 5 71 lineatum (Kelat), Syzygium napiforme (Kelat), Syzygium sp. (Kelat) Ochnaceae Campylospermum serratum (Mata ketam) 1 2 Pittosporaceae Pittosporum ferrugineum (Belalang puak) 1 1 Rhizophoraceae Carallia brachiata (Meransi), Pellacalyx axillaris (Membuloh) 2 3 Rubiaceae Diplospora malaccensis (Gading-gading) 1 2 Rutaceae Maclurodendron sp. 1 3 Sapindaceae Nephelium maingayi (Redan) 1 20 Sapotaceae Pouteria maingayi (Nyatoh nangka merah) 1 10 Sapotoideae Palaquium sp.(Nyatoh ) 1 2 Stemonuraceae Stemonorus secundiflorus (Sampul keris) 1 30 Tetrameristaceae Tetramerista glabra (Punah) 1 15 Thymelaeaceae Gonystylus bancanus (Ramin melawis) 1 17 Total 61 465

144

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Stocking density was the highest in the DBH class of 55.0-69.9, represented by 10 stems (56.07%). Both basal area and volume were the largest in the DBH class 55.0-69.9 with 27.07m2/ha and 0.9282 m3/ha, respectively. The stocking density was relatively high out of the total for this DBH class which is considered mature trees. Basal area is useful measurement for site occupancy and to forecast future development of tree stand at a given time. Total basal area and volume was 30.56 m2/ha and 1.0465 m3/ha, respectively (Table 2). Khali et al. (2009) recorded Ramin stocking in different compartment in Pekan FR in 2007 as follow: 25 stems/ha (Cmpt 100), 5 stems/ha (Cmpt 156) and 3 stems/ha (Cmpt 200).

Table 2: Stand structure of Gonystylus bancanus by DBH classes in Compartment 75, Pekan FR, in 2017. DBH class (cm) Stocking density (stems/ha) Basal area (m2/ha) Volume (m3/ha) 10.0-24.9 1 0.03 0.0003 25.0-39.9 1 0.06 0.0008 40.0-54.9 3 1.77 0.0600 55.0-69.9 10 27.07 0.9282 ≥70 2 1.64 0.0572 Total 17 30.56 1.0465

Table 3 shows aboveground and belowground biomass according to DBH class. Total biomass was the highest in the DBH class of 55.0-69.9 (almost 66.77%). Regeneration will take longer duration for small trees (DBH 10.0-24.9 & 25.0-39.9) to reach mature phase. Total biomass and C stock contributed by this timber species were 35.45 t/ha and 19.15 t C/ha, respectively. A significant accrual of total biomass for the study area from 193.30 t/ha in 2017 to 248.03 t/ha in 2018 contributed almost 20% of overall biomass increment. On the other hand, the C stock estimated was 90.85 t C/ha in 2017 and 116.57 t C/ha in 2018. Previous study has not mentioned figure for any increment for biomass and C stock for G. bancanus in tropical peat swamp in Peninsular Malaysia.

Table 3: Tree biomass for Gonystylus bancanus in Compartment 75, Pekan FR in 2017. DBH class (cm) Aboveground biomass (t/ha) Below ground biomass (t/ha) Total biomass (t/ha) 10.0-24.9 0.19 0.04 0.22 (0.63%) 25.0-39.9 0.43 0.09 0.52 (1.47%) 40.0-54.9 2.70 0.54 3.24 (9.14%) 55.0-69.9 19.71 3.96 23.67 (66.77%). ≥70 6.49 1.31 7.80 (22%) Total 29.52 5.93 35.45 (100%)

Under pristine condition, our ecological plot has the potential as a growing stock of G. bancanus since no forest harvesting activity has taken place at the study site. The measured Leaf Area Index (LAI) to characterize the forest canopy in Compartment 75 ranged between 3.5 to 3.69 indicating a relatively low canopy light conditions providing a suitable breeding ground for ramin seedlings since they are light- intolerant during growing phase.

Table 4: Stand inventory (SI) and field survey for Gonystylus bancanus in Compartment 75, Pekan FR in year 2017 and 2018. Year Biomass (t/ha) Total C stock (t C/ha) Increment (t/ year) 2017 35.45 (18.3%) 13.87 (15.2%) 11.22 t/ha (for biomass) 2018 48.93 (19.7%) 19.15 (16.4%) 5.28 t c/ha (C stock)

In a 2-year study period, the Ramin biomass accrued from 35.45 t/ha in 2017 to 48.93 t/ha in 2018 (Table 4). The increment of 1.4% or 11.22 t/ha per year of total biomass in the study area is estimated from Ramin timber. The total biomass calculated for Compartment 75 (based on a 1-ha plot) is as follow:

145

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

193.30 t/ha in 2017 and 248.03 t/ha in 2018. C stock of 90.85 t C/ha in 2017 and 116.57 t C/ha in 2018 showed a 1.2% increment. The diameter growth for Ramin ranged from 0.2 cm to 2.5 cm per year based on species inventory.

Conclusion

The accumulation of biomass during stand development was accompanied by C accretion stored at the study site under pristine condition. A series of diameter increment function should be developed to model Ramin growth in the future. Apart from tree diameter, mortality rate and stand recruitment (new growth) should be assessed simultaneously to determine forest productivity and stand dynamic in the long run.

Acknowledgements

Authors would like to thank the Malaysia Palm Oil Board (MPOB) for providing research grant to undertake “The Study of Carbon Stock Assessment in Permanent PSF in Pekan Pahang” collaboration project (Vot No.: 51310705006). Appreciation also goes to the Forestry Department of Pahang and FRIM staff for technical assistance and data collection.

References

CITES. 2005. Report on Conservation and Management of Ramin (Gonystylus spp.) in Malaysia (SC57 Inf. 4). Fifty-seventh Meeting of the Standing Committee Geneva (Switzerland), 14th-18th July 2008. Pp. 33. Do, T.V., Phung, D., Yamamoto, M., Kozan, O., Thang, N., Thuyet, D.V., Thang, H.V., Thu, P.N.T., Ninh, V. and van Cam, N. 2017. Aboveground biomass increment and stand dynamics in tropical evergreen broadleaved forest. Journal of Sustainable Forestry 10.1080/10549811.2017.1375959. Forestry Statistics Peninsular Malaysia. 2014. Forestry Department Peninsular Malaysia. 233pp. IHN-5. 2014. Laporan Inventori Hutan Nasional Kelima. Forestry Department Peninsular Malaysia. 288pp. IPCC, 2006. 2006 IPCC Guidelines for National Greenhouse Gas Inventories. In: Eggleston, H.S., Buendia, L., Miwa, K., Ngara, T. and Tanabe K. (edition). The National Greenhouse Gas Inventories Programme, Institute for Global Environmental Strategies (IGES), Japan. JPSM, 1997. Manual Kerja Luar: Sistem Pengurusan Memilih (Selective Management System). Forestry Department of Peninsular Malaysia, Kuala Lumpur. 323pp. Khali Aziz, H., Ismail, P., Abd Rahman, K., Che Hashim, H. and Grippin, A. 2007. Stand characteristics of one hectare peat swamp forest ecological plot in Pahang, Malaysia. Unpublished report. Khali Aziz, H., Ismail, P., Abd Rahman, K., Che Hashim, H., Grippin, A. and Nizam, M.S. 2009. Ecological characteristics of a Gonystylus bancanus-rich Area in Pekan Forest Reserve Pahang, Malaysia. Tropical Life Sciences Research 20(2): 15-27. Manuri, S., Brack, C., Nugroho, N., Hergoualc'h, K., Novita, N., Dotzauer, H., Verchot, L., Agung, S.P., Chandra and Widyasari, E. 2014. Tree biomass equations for tropical peat swamp forest ecosystems in Indonesia. Forest Ecology and Management 334: 241-253. Shaw, A. 1954. Thymelaeaceae-Gonystyloideae, In: van Steenis, C.G.G.J. (Ed.), Flora Malaysiana. Ser. I. Vol. IV. Noordhoff-Koef. NV. Jakarta. 358-365. Soerianegara, I.E.N. and Lemmens, R.H.M.J. 1994. PROSEA, Plant Resources of South East Asia 5 (1). Timber Trees: Major Commercial Timbers. PROSEA. Bogor. Whitmore, T.C. 1972. Tree Flora of Malaya. Longman Group, London.

146

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effect of Different Fertilizer Application on the Growth of Eucalyptus pellita

Rohanie, B.* and Phui, S.L. 1SARAWAK FORESTRY Corporation, Sarawak Forest Tree Seed Bank, KM20, Jalan Puncak Borneo, 93250 Kuching, Sarawak, Malaysia. *E-mail: [email protected]

Introduction

Eucalyptus pellita is afast growing species that has been recognized as one of the potential plantation species in Sarawak. The species has attracted the attention of forest plantation industry in Sarawak because of its straight bole form with limited branching and well known to be more disease resistance. It has also been identified as an ideal species to complement native hardwoods for solid wood and appearance-grade veneer production (Hii et al., 2016). With the increasing interest on E. pellita by forest plantation industry in Sarawak, SARAWAK FORESTRY through its Planted Forest Research Program (PFRP) has carry out several R&D activitieson this species includingdeveloping suitable silvicultural technique to increase plantation productivity in which nutrient management is one of the vital components. Past research has indicated the important of applying fertilizer to increase Eucalyptus plantation productivity in Australia, South Africa, China, Indonesia and Sabah (Mendhamet et al., 2008; du Toit et al., 2010; Siregar et al., 2015). Although E. pellita is well researched and documented in some other country like Australia, not much field study has been carried out in Sarawak to demonstrate its nutrient requirement under local condition. As such, under the PFRP, six fertilizer trials have been established at different location in Sarawak to study the growthresponse of E. pellita to different fertilizer application.

Materials and Methods

Seven trial plots have been established between 2016 and 2017 at five different locations in Sarawak using open planting technique. The study site comprised of mineral soil and peat soil respectively. The details of each plot are shown in Table 1.

Table 1: Summary of location, date of establishment, soil type and fertilizer treatment for each of trial plot. No Location Date planted Soil type Fertilizer Treatment 1 Tg Manis 1, Sibu 18 /5/16 Peat soil 14N, 26P, 1B 2 Sempadi1, Kuching 27/8/16 Mineral soil 14N, 26P, 1B 3 Naman, Sibu 10/10/16 Peat soil 14N ,26P, 15K, 1B & other micro 4 Tg Manis 2, Sibu 17 /1/17 Peat soil 14N, 26P, 15K, 1B & other micro 5 Sempadi 2, Kuching 10/2/17 Mineral soil 14N, 26P, 15K, 1B & other micro 6 Seping, Bintulu 15/4/17 Mineral soil 14N, 26P, 15K, 1B 7 BTSS, Bintulu 10/10/17 Mineral soil 14N, 26P, 15K & other micro

The trials were established in Randomized Complete Block design with four replicates. Each treatment plot consisted of 5 rows x 5 trees at 3m x 3m spacing and only 14 inner trees were assessed. For all the trials, N was applied in a form of urea, TSP for P, while K is applied in a form of MOP. Early assessment is only based on height (m) and DBH (cm). Effect of treatments on the parameters were analysed in ANOVA at 95% confidence level and further mean comparisons were carried out using Duncan Test.

147

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

Early assessment showed that application of Phosphate (P) during planting gave a significant growth response to E. pellita tree planted at mineral soil. In all four trials planted at mineral soil, trees applied with single or combination of P ranked significant higher in term of height and DBH as compared to control and fertilizer treatment without P. A very significant result can be observed at 20 months old plot in Sempadi-1 in which all the treatment without P ranked the lowest with a significant height and DBH different (Table 2). Another plot was established at Sempadi and BTSS in 2017 that include additional of micronutrient fertilizer in the treatment. For both trials, treatment with application of single N was excluded since the results from the earlier trials showed that it has no significant effect to the growth of E. pellita. Assessment from trial plot in Sempadi-2 showed that combination of P with Zn and Cu gave the highest mean height and DBH with 6.51m and 6.07cm respectively after 1-year planting. However, it was not significantly different with single P treatment that ranked second, which attained 6.39 m mean height and 6.04 cm DBH. Summary of results is shown in Table 3. For both trials, additional of other different micronutrient does not demonstrate any significant higher results than treatment with macronutrient only. Nevertheless, regardless the type of treatment, all trees that applied with fertilizer gave a significant higher growth as compared to control.

Table 2: Summary of 20 months old E. pellita planted at Sempadi-1 trial plot. Rank (on height) Treatment Height (m) DBH (cm) 1 P only 6.74a 6.90a 2 N+P+B 6.68a 6.76a 3 N+P 6.13a 6.39a 4 N only 4.26b 3.82b 5 Control 4.23b 3.55b 6 B only 4.10b 3.72b *Treatments that do not share a common letter are significantly different.

Table 3: Summary of 12 months old E. pellita planted at Sempadi-2 trial plot. Rank (on height) Treatment Height (m) DBH (cm) 1 N+P+Zn+Cu 6.51a 6.07a 2 P only 6.39ab 6.04a 3 N+P+K 6.31abc 5.96a 4 N+P+Cu 6.24abc 5.96a 5 N+P 6.00abc 5.92a 6 N+P+B 5.82abcd 5.83a 7 N+P+Fe 5.72bc 5.66a 8 N+P+Zn 5.64bc 5.74a 9 N+P+Mg 5.58cd 5.38ab 10 N+P+DuoB 4.91d 5.13b 11 Control 2.80e 2.40c *Treatments that do not share a common letter are significantly different.

Meanwhile, inconsistent results were found at trial plots planted in peat soil area. First trial of peat soil area was established in 2016 at Tanjung Manis, which only include single or combination of N, P and B as treatment. It was found that application of fertilizer at early planting does not affect the growth of E. pellita tree. With control ranked first, the 2-years E. pellita did not show any significant growth response to the application of fertilizer at planting (Table 4). Meanwhile, like other trials at mineral soil, the results obtained from the peat soil area also demonstrated the insignificant of single N application to the early growth of E. pellita. The same trend was also found at another peat soil area in Naman (Table 5) Second trial in Tanjung Manis was established in 2017 as repetition to the first trial with micronutrient treatments

148

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

were included. As shown in Table 6, the 1-year results also showed that Control was not ranked the lowest, while single N treatment at early planting also not given any significant effect to the growth of E. pellita. Moreover, similarly with trial at Sempadi-2, treatment with Cu also ranked higher than other micronutrient.

Table 4: Summary of 24 months E. pellita planted at Tanjong Manis-1 trial plot. Rank (on height) Treatment Height (m) DBH (cm) 1 Control 6.81a 8.01a 2 N+P only 6.78a 7.91a 3 N+P+B 6.53a 7.78a 4 P only 6.51a 7.98a 5 N only 6.30a 7.20a *Treatments that do not share a common letter are significantly different.

Table 5: Height (m) and DBH (cm) of 12 months old E. pellita planted at Naman trial plot. Rank (on height) Treatment Height (m) DBH (cm) 1 K only 4.60ab 4.79a 2 N+P+K 4.36ab 4.49ab 3 P only 4.29ab 4.56a 4 N+P+K+B 4.28ab 4.59a 5 Control 4.24abc 4.47ab 6 Compound NPK 4.22abc 4.36abc 7 N+P+K+B+MM 4.14abc 4.16abcd 8 N+P 3.72bc 3.74bcd 9 N only 3.70c 3.72cd *Treatments that do not share a common letter are significantly different.

Table 6: Height (m) and DBH (cm) of 12 months old E. pellita planted at Tanjung Manis-2 trial plot. Rank (on height) Treatment Height (m) DBH (cm) 1 N+P+Cu 6.02a 6.79a 2 N+P+B+Zn 5.81ab 5.82bc 3 N+P+Zn+Cu 5.31bc 5.35cd 4 N+P+B 5.15cd 5.10cde 5 K only 5.00cd 4.95de 6 Control 4.99cd 4.84def 7 N+P+K 4.65de 4.90de 8 N+P 4.65de 4.45ef 9 N+P+Zn 4.64de 4.72def 10 N+P+Fe 4.60de 4.91de 11 P only 4.27e 4.33ef 12 N+P+Mg 4.21e 4.03f 13 N only 4.13e 4.25ef *Treatments that do not share a common letter are significantly different.

Conclusions

The results from this study demonstrated that applying fertilizer especially Phosphate is critically important to increase tree growth. Although some of the nutrient like Nitrogen and Boron showed no benefit when applied as a single treatment, combination of these nutrients with Phosphate also may significantly increase the growth of E. pellita. More study will be done to determine the need for re- application of the critical fertilizer as well as the amount for optimum productivity until the trials ready for harvesting.

149

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References duToit, B, Smith, C.W., Little, K.M., Boreham, G. and Pallet, R.N. 2010. Intensive site specific silviculture: manipulating resource availability at establishment for improved stand productivity. A review of South African research. Forest Ecolology and Management 259: 1836-1845. Hii, S.Y., Ha, K.S., Ngui, M.L., Penguang Jnr, A. Duju, A., Teng, X.Y. and Meder, R. 2017. Assessment of plantation-grown Eucalyptus pellita in Borneo, Malaysia for solid wood utilization. Journal of Australian Forestry 80(1): 26-33. Mendham, D.S., Grove, T.S., O’Connell, A.M. and Rance, S.J. 2008. Impacts of inter-rotation site management on soil nutrients and plantation productivity in Eucalyptus globulus plantations in South Western Australia. In: EKS Nambiar (ed.). 2008. Site Management and Productivity in Tropical Plantation Forests. Center for International Forestry Research. Bogor, pp. 79-92. Siregar, S.T.H., Wawan and Adiwirman 2015. Effect of fertilization on the growth and biomass of Acacia mangium and Eucalyptus hybrid (E. grandis x E. pellita). Journal of Tropical Soils 20(3): 157- 166.

150

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Improvement through Selection of Plus Tree in Shorea roxburghii

Nor Fadilah, W.*, Mohd Zaki, A., Mohamad Lokmal, N., Farah Fazwa, M.A., Muhammad Asri, L. and Ahmad Fauzi, M.S. Plant Improvement Programme, Forestry Biotechnology Division, Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Shorea roxburghii or also known as white meranti or meranti temak nipis is belongs to the family of Dipterocarpaceae. The species is native to Southeast Asia region such as Peninsular Malaysia, Thailand, Cambodia, Vietnam, Laos, Myanmar and east of India (Pooma et al., 2017). It can be found in lowland dipterocarp forest, semi-evergreen forests and limestone forests (Chua et al., 2010). It has been reported that this species can grow up to 40 m tall (Raju et al. 2011) and highly tolerant to hot weather conditions (Pooma et al., 2017).

Generally, this species is harvested for its timber and resin (Pooma et al., 2017). In Malaysia, even though logging activities have been recorded, the data from the Peninsular Malaysia Fourth National Forest Inventory in 2007 showed approximately 232, 200 stems with a diameter at breast height above 30 cm (Chua et al., 2010). The IUCN Red List classified S. roxburghii as Vulnerable (VU) species (Pooma et al., 2017) but under Malaysia Plant Red List, this species is classified as Near Threatened (NT) (Chua et al., 2010).

Pooma et al., (2017) has suggested that the ex situ collections of S. roxburghii should be made. Furthermore, the species has also been identified as a conservation priority in Southeast Asia. Monitoring and management of the harvest of this species have also been recommended in order to ensure the sustainability.

Thus, an improvement through selection of plus tree study has been initiated with the main objective to provide high-quality planting materials needed for the plantation industry. Plus tree is defined as the selected tree that has been graded for the sources on production for further breeding study (Hettasch et al., 2002). However, the genetic superiority of the selected plus tree is still needed to be tested. But, the probabilities of the progenies from selected plus tree to have good genotype is high due to reasonable heritability. Seeds collected from the selected plus tree is grown and planted in progeny trial. Conceptually, in progeny trial, the seedlings are planted in the replicated field trial. Growth performance of the trial is evaluated regularly. On the other hand, the established trial plots can be converted into a Seedlings Seed Orchard (SSO) in the future.

Materials and Methods

Selection of superior plus tree

Initially, 51 Candidate Plus Trees (CPTs) were selected for grading. Among the criteria used for the assessment are height, diameter at breast height, crown size, straightness, stem form, crown dominancy, angle of the third branch, size of the third branch, the ability of the tree to self-pruning, non-forking, and wood properties. The data were recorded on standard tree grading form and the assessment was made

151

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

based on the scoring. The sampling activities were conducted at natural forest areas in Perlis as S. roxburghii is native to north Peninsular Malaysia. The GPS coordinate of the locations was also recorded.

Seeds germination

A total of 27 plus trees were selected out of 51 CPTs, based on the tree grading evaluation. Seeds were collected at the end of April 2017. Seeds obtained were about 600 gto 5 kg depending on the families (1 kg contains about 1000 seeds). After dewinging, seeds were germinated on 100% sand bed. The seeds were considered germinated when the plumule emerged from the sowing media. For each family, a total of 100 seeds were evaluated to determine variations among the families’ germination rate. Growth data (height) was taken started in the first month after there was no further seeds germination and every three months before planting.

Table 1: Details of the 27 selected mother trees. No. Family Longitude and latitude Altitude 1 RTN 4 N6 33.085 E100 14.289 36 m 2 RTN 5 N6 33.210 E100 14.318 53 m 3 RTN 11 N6 30.871 E100 14.618 27 m 4 RTN 16 N6 29.671 E100 13.907 22 m 5 RTN 22 N6 39.228 E100 14.828 64 m 6 RTN 23 N6 39.392 E100 18.941 66 m 7 RTN 27 N6 39.198 E100 14.872 59 m 8 RTN 28 N6 39.165 E100 14.870 62 m 9 RTN 31 N6 39.259 E100 14.951 61 m 10 RTN 33 N6 39.333 E100 15.079 74 m 11 RTN 34 N6 39.282 E100 14.889 63 m 12 RTN 35 N6 39.429 E100 14.760 57 m 13 RTN 36 N6 39.430 E100 14.788 58 m 14 RTN 37 N6 39.660 E100 14.592 60 m 15 RTN 38 N6 39.223 E100 13.728 -3 m 16 RTN 39 N6 39.253 E100 13.544 22 m 17 RTN 40 N6 39.287 E100 13.556 35 m 18 RTN 42 N6 39.064 E100 14.202 51 m 19 RTN 43 N6 39.060 E100 14.217 53 m 20 RTN 44 N6 39.165 E100 14.114 62 m 21 RTN 45 N6 39.371 E100 13.984 55 m 22 RTN 46 N6 39.017 E100 14.279 54 m 23 RTN 47 N6 36.197 E100 12.923 49 m 24 RTN 48 N6 35.820 E100 13.072 43 m 25 RTN 49 N6 31.840 E100 12.964 26 m 26 RTN 50 N6 38.992 E100 14.403 59 m 27 RTN 51 N6 39.165 E100 14.224 39 m

152

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Planting activities at three different locations

At the age of one-year old, the seedlings were planted at FRIM’s research station (SPF), Mata Ayer (Perlis) and Jeli (Kelantan). Planting activities at both sites were conducted at the onset of rainy season. Another respective location is at SPF Setiu (Terengganu) but the planting activities have been held due to extremely hot weather conditions. Planting activities at Setiu site were then commenced on October 2018. The progeny trial plots were laid out in Randomized Complete Block Design (RCBD) with four trees per family (27 families in total), replicated by 12 blocks, by the distance of 4 x 4 m, making the total number of trees planted were 1296 trees with the total areas of 2.1 ha.

The three locations were selected based on the different environmental and soil properties. SPF Mata Ayer has sandy loam type of soil, extremely hot weather condition, and most importantly north Peninsular is native to S. roxburghii. Second, SPF Jeli, on the other hand, has silty clay loam type of soil and higher annual rainfall. Third, the main reason for choosing SPF Setiu is to experiment with the Beach Ridges Interspersed with Swales (BRIS) type of soil.

Statistical analysis

For phenotypic assessment of superior plus tree, each mother tree was evaluated and graded based on superior plus tree grading criteria’s; straightness, stem form, forking, crown size (measured using haglof metre for distance, the average of X and Y axis), crown dominancy, the size of the third branch and the angle of the third branch. Each criterion was given a score based on the following index: (i) Straightness 1 to 4 (ii) Stem form 1 to 4 (iii) Forking 1 to 4 (1 = ¼ ; 2 = ½ ; 3 = ¾ ; 4 = top) (iv) Crown dominancy 1 to 3 (1 = lower, 2 = equal, 3 = dominant) (v) Size of the third branch 1 to 4 (1 = ½ - ¾ ; 2 = ½ ; 3 = ¼ - ½ ; 4 = ¼ ) (vi) Angle of the third branch 1 to 4 (1 = 25˚; 2 = 45˚; 3 = 65˚; 4 = 90˚) The scores assigned for the selected Candidate Plus Tree (CPT) were then calculated in percentage (%).

Seeds viability were assessed based on the complete count of germinated seeds originally sowed for each family. Germination rate was recorded every week once the seeds started to germinate until there was no further germination observed. Growth performance based on height (cm) data at 10 months old were analysed using the Statistical Package for the Social Sciences (IBM SPSS Statistics 22). Analysis of Variances (ANOVA) was used and variations among families were evaluated by Tukey post-hoc test.

Results and Discussion

Phenotypic assessment

Selected mother trees for seeds sources scored ranged from as high as 86.3% (RTN 40) and as low as 66.3% (RTN 4) (Figure 1). The ideal plus tree based on phenotypic characteristics; has non-forking, straight stem, non-twisting bole, narrow crown, and thin branches with wide branch angle. Additionally, the ideal plus tree also has good wood properties (high wood density and long fibre) and resistance to pests and diseases. These additional criteria, usually being tested on the sites after the trial plots establishment. On the other hand, the main reasons for the unselected CPTs are the forking traits, poor stem form, and poor straightness.

153

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Nevertheless, in conducting tree grading for selection of plus tree, the experienced grader is needed. This is due to the scoring marks in the tree grading form were determined by the grader. In our study, the grading of CPTs was conducted by two experienced foresters with the supervision of the experienced researcher. All the CPTs were evaluated by the same grader to avoid subjective views of different individuals.

Viability and germination rate

Based on the observation, the seeds started to germinate in the second week and most of the families showed vigorous germination rate in the third week (Figure 2). During the third week, 87% of the seeds from family RTN 11 has already germinated and the family also has the highest viability rate, 97%. The lowest viability rate is family RTN 36 with 51%.

100

90 86.3 85.0 83.8 83.8 81.3 81.7 80.4 78.5 78.8 78.8 78.8 78.8 77.5 77.5 77.9 80 77.0 77.2 75.5 76.3 75.0 74.2 73.8 74.2 75.0 70.4 69.2 70 66.3

40 Total Score (%) Score Total

Selected mother trees Figure 1: Total score (%) of 27 selected mother trees based on tree grading system.

154

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

120

100

40 Germination rate (%)rate Germination 20

Selected mother trees

Week-2 Week-3 Week-4 Week-5 Week-6

Figure 2: Germination rate (%) of 27 families of S. roxburghii.

Growth performances of S. roxburghii seedlings at 10 months old

ANOVA on the growth trait of height (cm) showed a highly significant difference among the 27 half-sib families (Table 2). RTN 45 showed the highest height (52.35a) of all 27 families (Table 3). The mean indicated that the RTN 45 family significantly performed better compared with other families.

Table 2: Analysis of Variance. Sum of Squares df Mean F Sig. Square Between 120685.729 26 4641.759 60.631 .000* Groups Within 135659.070 1772 76.557 Groups Total 256344.799 1798 *- significant (p≤0.05).

Tukey’s HSD test showed that the top four families (RTN 45, RTN 44, RTN 48 and RTN 51) and the lowest scored family (RTN 28) significantly differed among the 27 families. However, there was no significant difference among the families RTN 44, RTN 48 and RTN 51. Whereas for the rest of the families, there was a slightly significant difference in height (Table 3).

Seedlings from each family used for planting activities, however, were selected uniformly based on height, healthy leaves and free from pests and diseases. This practice was to ensure that there will be no initial variation on the growth of the seedlings.

155

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 3: Mean for height (cm) of 27 half-sib families at 10 months old after germination. No. Family N Mean* ± STDEV

1. RTN 45 80 52.35a 15.05

2. RTN 44 61 35.93b 8.86 3. RTN 48 74 35.52b 12.35 4. RTN 51 85 35.31b 12.15 5. RTN 47 59 33.36bc 9.91 6. RTN 50 77 32.46bcd 10.08 7. RTN 49 50 29.04cde 10.45 8. RTN 43 73 28.85cde 8.78 9. RTN 38 58 27.73cdef 12.66 10. RTN 40 79 27.35defg 8.24 11. RTN 39 81 26.72efgh 11.39 12. RTN 46 63 25.61efghi 7.03 13. RTN 22 76 24.00efghij 6.70 14. RTN 4 49 23.01fghijk 6.75 15. RTN 35 63 21.81ghijk 5.74 16. RTN 16 78 21.61hijkl 6.29 17. RTN 23 55 21.05hijkl 5.08 18. RTN 33 53 20.06ijkl 6.45 19. RTN 31 81 19.92ijkl 6.20 20. RTN 27 57 19.88jkl 6.97 21. RTN 36 43 19.77jkl 6.12 22. RTN 11 93 19.75jkl 7.14 23. RTN 42 64 19.25jkl 7.69 24. RTN 34 66 18.46jkl 5.71 25. RTN 37 57 17.96kl 5.93 26. RTN 5 76 17.57kl 5.23 27. RTN 28 48 16.38l 5.09 *Mean with the same alphabet showed no significant difference at 0.05.

156

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Establishment of the progeny trial plots

Progeny trial plots at SPF Jeli and SPF Mata Ayer were established during the early and end of May 2018, respectively. As the planting activities at SPF Setiu was conducted in October, once the rainy season has started, initial growth data was taken immediately after the planting activities were done, following by every three months interval.

Figure 3: Progeny trial plot of S. roxburghii at SPF Jeli (Kelantan), the different colour of blocks indicated different replicates and the level of blocks represented the different geographical locations.

Figure 4: Progeny trial plot of S. roxburghii at SPF Mata Ayer (Perlis), the different colour of blocks indicated different replicates.

157

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 5: Progeny trial plot of S. roxburghii at SPF Setiu (Terengganu), the different colour of blocks indicated different replicates.

Conclusion

The establishment of the progeny trial plots of S. roxburghii is an effort to improve the quality of the planting materials. This is also an effort to introduce the indigenous species for industrial scale plantation in the long run. Furthermore, these trial plots have the capacity to be converted into a Seedlings Seed Orchard (SSO) which would provide selected materials (seeds sources) for future studies and also as conservation plots.

References

Chua, L.S.L, Suhaida, M., Hamidah, M. and Saw, L.G. 2010. Malaysia Plant Red List. Subang Jaya, Malaysia. Straits Digital Sdn. Bhd. Hettasch, M.H., Lunt, K.A., Pierce, B.T., Snedden, C.L., Steyn, D.J., Venter, H.M. and Verryn, S.D. 2002. Tree Breeding Course Manual. Environmentek, CSIR. Pretoria, South Africa. Pooma, R., Newman, M. and Barstow, M. 2017. Shorea roxburghii. The IUCN Red List of Threatened Species 2017: e.T33028A2831736. Retrieved from http://dx.doi.org/10.2305/IUCN.UK.2017- 3.RLTS.T33028A2831736.en. Downloaded on 09 August 2018. Raju, A.J., Ramana, K.V. and Chandra, P.H. 2011. Reproductive Ecology of Shorea roxburghii G. Don (Dipterocarpaceae), an Endangered Semievergreen Tree Species of Peninsular India. Journal of Threatened Species 3(9): 2061-2070.

158

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 2

Ecophysiology and Stress Biology

159

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Assessment of Growth Performance of Thaumatococcus daniellii, a Natural Sweetener Species Grown under Natural Environment

Nurul Hidayah, K.*, Mohd Yusoff, A. and Shamsiah, A. Faculty of Plantation and Agrotechnology, Universiti of Teknologi MARA (UiTM), 40450 Shah Alam, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Thaumatococcus daniellii is a Marantaceae species known with various local names such as katempfe, miracle berry, miracle fruit or prayer plant (Lim, 2012). This species is originated from the tropical forest of West Africa and found abundantly on forest floor under forest canopies (Lim, 2012 and Yeaboh et al., 2002). The species was introduced to many tropical countries such as Australia and Malaysia mostly for landscape purposes (Waliszewski et al., 2005). Thaumatococcus daniellii is a natural sweetener species with wide application as sweetener agent and flavour enhancer (Keerthi et al., 2011). It is also a multipurpose species with many plant parts are used for various purposes such as leaf (food wrapping, herbs), petiole (pulp, mat woven), root and rhizome (herbs) (Ogunsanwo et al., 2012; Shalom et al., 2014; Sotannde and Oluwadare 2014). All these products provide additional income to local people which can be as high as up to USD 12,310.24 per hectare (Boadi et al., 2014; Oluwatayo, 2014; Arowosoge and Popoola, 2006).

The fruit consists of fleshy arils enclosing black hard seed which contain sweetening agent known as thaumatin with the degree of sweetness ranging from 1000 to 3000 times sweeter than sucrose (Surana et al., 2006; Lim, 2012). As a forest floor species, it grows well under low to moderate irradiance regimes (Waliszewski et al., 2012). Akinleye and Omolara (2012) found that irradiance significantly increased the growth performance of T. daniellii grown in Ibadan, Nigeria with total biomass production and leaf area increased under 45% and 65% irradiance regimes. However, under irradiance extremes, the growth tends to be reduced or stunted (Waliszewski et al., 2005).

The long-term objective of this study is to introduce this species into an existing plantation as an intercrop that could generate additional income to smallholder farmers. Rubber plantation seems to be a potential candidate because of the suitable light environment (Mohamed Senawi et al., 2001), and furthermore it is dominated by smallholder’s sector that contribute about 88% of the total Malaysian rubber production from the cultivation area of 0.99 Mha. Crop integration within rubber has been a common practice within smallholders as a source of additional income in this country and various types of intercropping and its economic benefit have been reported (Abdul Ghani and Zulkefly, 2003).

The information on the cultivation of T. daniellii as a commercial crop is limited (Yeaboah et al., 2002). However, Waliszewski et al. (2005) had gathered some basic information pertinent to cultivation practices by interviewing plant collectors and farmers in Ghana which can be used as cultivation guidelines of T. daniellii as a commercial crop. Recently, it was shown that T. daniellii was successfully cultivated as an intercrop in rubber and cocoa plantations in Cameroon (Waliszewski et al., 2012).

The objective of the study was to make comparative assessment of the overall growth and physiological performance of this species under local environment with those grown under the native habitat.

160

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

The experiment was carried out on a small population of this species currently thriving vigorously under forest canopy at the Taman Botani Negara Shah Alam, Selangor (TBNSA), from 2013 to 2014. Ten clumps of various sizes ranging from 5 to a maximum of 76 tillers per clump were randomly selected from a natural population within a 0.05 ha of study area.

Photosynthetically active radiation (PAR) characterization

The irradiance environment within the forest floor at TBNSA varied greatly depending on canopy gaps and the vegetation types. To precisely characterise the irradiance environment within this forest floor, the irradiance measurements were carried out diurnally using thirty-five of three point transects to cover the whole of the experimental area. Photosynthetically active radiation (PAR) was measured using a ceptometer (LP-80, Decagon, Pullman, USA). The PAR transmission ratio measurements were calculated based on the ratio between the irradiance impinging on canopy top of T. daniellii grown on the forest floor with the irradiance under the open area with clear sky, using the formula;[(PAR above T. daniellii canopy - under forested area)/(PAR in the open clear sky) x 100].

Growth performance

Ten clumps were selected from the experimental area and different growth characteristics such as plant height (cm), and numbers of tiller, shoot bud, inflorescence and fruit were recorded. The plant height (cm) was measured using the tallest tiller in a clump. The various plant parts were separated, and biomass samples were oven dried at 72ºC for 48 hours for dry mass determination. Leaf area was measured using an image capturing method of Adobe Photoshop CS6 following Jarou (2009).

Physiological performance

Seven matured clumps were used for physiological measurements. The relative chlorophyll content of four fully matured expanded leaves were measured by averaging 6 readings per leaf sample, using a chlorophyll meter (SPAD 502 Plus, Minolta, Japan). Whilst, stomatal conductance (gs) was measured diurnally, from 0800 to 1800 hr, using a steady state leaf porometer (model SC-1, Decagon, USA).

Fruit components and yield

Fruits were collected from populations grown naturally without any proper cultural practices at two different locations; Taman Botani Negara Shah Alam (TBNSA) and Kebun Rimau Sdn. Bhd., Balong, Tawau, Sabah. Most of the fruit samples were obtained from the experimental area. Fruits were separated into various components and biomass was determined after oven dried at 72ºC for 48 hours. Fresh weight basis was also determined for overall fruit and aril components.

Results and Discussion

Photosynthetically active radiation (PAR) characterization

Irradiance is important as an energy sourcefor many physiological processesin plant andmay become a limiting factor under shade environment. T. daniellii grew vigorously under forested area in the natural environment at the Taman Botani Negara Shah Alam (TBNSA) with photosynthetically active radiation (PAR) transmission ratio between 30 to 50% diurnally (Figure 1). Based on overall crop response to

161

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

irradiance (Figure 2, 3, 4 and 5), this species has a great potential to be introduced as an intercrop under major plantation crops with similar level of irradiance environment. Oil palm and rubber are the two major plantation crops in Malaysia, with total planting area of 5.8 Mha and 1.1 Mha, respectively (Mohd Azraie, 2018 and Lembaga Getah Malaysia (LGM), 2018). The canopy gaps of rubber trees are generally getting smaller and eventually closed as plants aged. Depending on the planting system and stand density used, rubber canopies are considered less dense with PAR transmission ratio varied between 20 to 50%. Some species may be suitable to be introduced within rubber ecosystem as an intercrop especially from the ginger species (Langenberger et al., 2016). Thaumatococcus daniellii has been shown to grow well and successfully established under rubber plantation in Africa (Waliszewski et al., 2012). However, under oil palm plantation, with denser canopy gaps, a PAR transmission ratio was generally much lower ranging between 5 to 30% (Abdul Awal et al., 2005) which may not be suitable for successful growth of T. daniellii.

PAR tranmission ratio PAR tranmission 10 8 10 12 14 16 18 Time (hour)

Figure 1: Diurnal PAR transmission ratio on the forest floor at TBNSA.

Growth and biomass production

The overall growth of T. daniellii was generally prolific under the forest floor environment receiving 30 to 50% of diurnal PAR transmission ratio. Based on the vigorous growth of the species grown under this growing environment, it is assumed that this local environmental condition similar the native habitat of the species in the West Africa (Waliszewski et al., 2005). The plant or clump increases in size through an increase in tiller number, and tiller number increased through self-propagating rhizome as the crop aged (Figure 2). Each tiller consisted of short stem (Ley and Claßen-Backhoff, 2012), long petiole, pulvinus and a single large, ovate dark green leaf blade (Andersson, 1998 and Tomlinson, 1961). A tiller with a fully expanded matured leaf was referred as a functional tiller while the folding, unopened light green leaf and without visible petiole was designated as shoot buds (Figure 3). The reproductive structures such as fruit and flower were only found on clumps with thirty or greater tiller number. Clumps with higher functional tiller number resulted in greater plant height ranging from 0.3 to 2.5 m (Figure 2).

162

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

100 3.0 Leaf number Shoot bud number 2.5 80 Flower number Fruit number Plant high 2.0 60

1.5

number 40

Plant high (m) high Plant 1.0

0.5

0 0.0 0 10 20 30 40 50 60 70 80 Functional tiller number/ clump

Figure 2: Growth performance of T. daniellii under forested area, as indicated by number of leaf, shoot bud, flower, fruit and plant height in relation to functional tiller number.

Functional tiller Shoot bud

Root Rhizome Figure 3: Morphological characteristic of selected clump of T. daniellii.

Total leaf area and biomass production of various plant parts increased linearly as the number of functional tillers increased (Figure 4a). The clump with highest functional tiller number (68) had the maximum biomass of about 1.1 kg and leaf area of 4.6 m2 whilst the smallest clump with only five tillers had the lowest biomass production of 5.37 g and leaf area of 0.06 m2 (Figure 4a). Similarly, with the incremental pattern of total biomass, the rhizome dry mass increased with increasing in clump size, ranging between 1.8 to 84.1 g (Figure 4a). Clumps with more than 25 tillers showed significantly greater biomass allocation to the aboveground than to the belowground (Figure 4b). In general, both above and belowground biomass per clump basis also exhibited increasing trend with an increase in functional tiller

163

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

number (Figure 4b). The amount of reproductive biomass observed in the clump with highest tiller number was relatively small, ranging from 0.6 to 1.65g (Figure 4a).

Figure 4: Dry mass of (a) various plant parts (leaf, petiole, shoot, rhizome, root and reproductive) and leaf area, (b) total, above and belowground, dry mass in relation to functional tiller number.

Thaumatococcus daniellii is considered as a shade loving species in which growth is most favourable under moderate shade level (Waliszweski et al., 2005; Most et al., 1978), however, under irradiance extremes such as heavy shade or full sun, the growth may be inhibited or stunted. Under favourable condition, the plant produces dark green, hard textured matured leaf with petiole length ranged between 2 to 3 m (Waliszewski et al., 2005; Lim, 2012). The irradiance level within the forest floor varied depending on the canopy denseness of the above upper strata. Areas where irradiance was limited, the plants adapted by producing many tillers with new developed tillers were usually taller than those formed earlier. This is a form of plant strategy to ensure enough irradiance is captured by newly formed leaves to sustain growth, similar observation was also reported under species native environment in the West and Central Africa (Waliszewski et al., 2005). Other shade loving or understory species also increased their plant heights in response to the irradiance limitation to ensure sufficient irradiance for normal photosynthesis process (Vikram and Hedge, 2014; Kittur and Sudhakara, 2015; Santelices et al., 2015). In general, clumps with more than 30 tillers were considered matured and enter the reproductive phase. At this stage, the rhizome is considered fully matured and each tiller capable of producing flower and fruit (Waliszewkiet al., 2005; Most et al., 1978). The flowers were formed in a complex synflorescene, consisting of several to three inflorescences (Andersson, 1998; Tomlinson, 1961), and emerge from the lowest node of the short stem (Ley and Claßen-Backhoff, 2012). The onsets of reproductive stage when a clump has more than thirty tillers were also reported in the native area. Once the clump enters into reproductive stage, the plant will continue to flower and bear fruits twice per year especially after the rainy season (Waliszewski et al., 2005).

Physiological performance

In general, stomata conductance was higher during midday with values ranging between 140 to 400 mmolm-2s-1 as compared to morning and afternoon readings (Figure 4a). A regression of pooled data of stomatal conductance with air temperatures (Figure 4b) indicated the decrease in stomata conductance was associated with an increase in temperature. Temperature below 30°C is suitable for better growth of the plant. The specific leaf weight (SLW) increased linearly with an increase in SPAD value (Figure 4c).

164

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Higher SLW of greater than 60 gm-2 corresponded to SPAD value of above 50, while SLW lower than 60 corresponded to lower SPAD value below than 50.

350 600 a. Diurnal stomata conductance b. Relationship between stomata conductance 300 500 and temperature

) 250 400

-1

-2

2 200 300

150 200

gs (mmol/m gs

gs (mmolgs m 100 100 50 gs=750.2 - (19.5)Temp. 0 r2=0.046 n = 84 0 6 8 10 12 14 16 18 26 27 28 29 30 31 32 Time Temperature (C)

) c. Relationship between Spad and SLW -2 80

20 SLW=30.3 + (0.51)Spad r2 = 0.185

Specific leaf weight (g m (g Specific leaf weight n = 304 0 0 20 40 60 80 SPAD Reading

Figure 5: Physiological performance of T. daniellii grown under forested area, a) Diurnal stomata conductance, b) Relationship between stomata conductance and temperature and c) Relationship between SPAD value/reading and SLW.

The leaf chlorophyll content as reflected by the SPAD value increased with the increase in SLW, this could be accomplished by thicker leaf width due to leaf structural or anatomical changes as the result of the surrounding growth irradiance. Stomata responsible for plant and environment gas exchange and stomata regulation are affected by several factors such as irradiance intensity and quality, temperature, carbon dioxide concentration and relative humidity (Taiz and Zeiger, 2008). The increase in irradiance level was reported to increase the stomata conductance of several shade loving species (Yasuhiko, 2013; Gaurav et al., 2015).

Fruit component and yield

Matured fruit of T. danielii is red coloured with black hard seed covered with a layer of sticky and transparent gel. At the top end of the seed is a soft fleshy aril with pale yellow in colour. The fruit maturity period varies with environmental factors as well as fruit size (Waliszewski et al., 2005). Each fruit may contain one, two or three seeds, however, one seeded fruit is the most commonly found (Table 1). Seed constitute the biggest component of the fruit drymass with a range of 0.6 to 1.7 g, while aril is the smallest component of the fruit (Dahal and Xu, 2012) with fresh weight values ranging between 0.6 to 1.8 g (Table 1) but it is the most valuable part due to its sweetening protein thaumatin content. The fresh weight of aril, however, increased with the increase in the seed number (Table 1). In this study, fruits

165

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

obtained from Balong, Sabah where T. daniellii were grown under shade of teak and agarwood species (Tectona and Aquilaria) were compared with fruits from the Botanical Garden Shah Alam. Generally, fruits from both locations did not differ very much with respect to biomass allocation within fruit components (Table 1). There was a linear positive relationship between fruit and aril on the fresh weight basis, where an increase in the total fresh weight increased the aril fresh weight content (Figure 6). Other fruit parts such as pericarp and seed also have the potential to be used as animal feed (Elemo et al., 2011).

25 Relationship between FW fruit and FWaril (TBNSA) 20

Fresh weight fruit (g) fruit weight Fresh

5 Fw fruit=5.08 + (7.14 * FWaril) r2=0.86 n= 259 0 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Fresh weight aril (g) Figure 6: Relationship between fresh weight fruit and fresh weight aril (TBNSA).

Table 1: Descriptive statistics of biomass components of T. daniellii’s fruits grown at two different locations (TBNSA and Balong, Tawau, Sabah). Area TBNSA Balong, Sabah Total average Seed number 1 2 3 Overall 1 2 3 Overall fruit fruit average average Fruit number/area (n) 148 79 32 259 5 10 5 20 Fresh weight fruit (g) 9.06 14.15 17.8 11.69 8.60 15 16.46 13.76 ±0.74 ±1.6 ±3.47 ±0.70 ±3.84 ±4.74 ±7.36 ±3.07 Fresh weight aril (g) 0.60 1.21 1.75 0.93 0.82 1.99 2.41 1.80 ±0.04 ±0.14 ±0.31 ±0.05 ±0.36 ±0.63 ±1.08 ±0.40 Dry weight pericarp (g) 0.70 1.02 1.17 0.85 0.58 0.94 1.01 0.87 ±0.05 ±0.11 ±0.21 ±0.05 ±0.26 ±0.29 ±0.45 ±0.19 Dry weight seed (g) 0.62 1.16 1.70± 0.92 0.67 1.23 1.72 1.21 ±0.05 ±0.13 0.30 ±0.05 ±0.30 ±0.38 ±0.77 ±0.27 Dry weight aril (g) 0.12 0.23 0.32 0.18 0.09 0.24 0.29 0.21 ±0.01 ±0.03 ±0.06 ±0.01 ±0.04 ±0.07 ±0.13 ±0.05 Total dry weight (g) 1.44 2.41 3.20 1.95 1.35 2.41 3.02 2.29 ±0.12 ±0.27 ±0.56 ±0.12 ±0.60 ±0.76 ±1.35 ±0.51

Conclusion

Based on the overall growth and physiological performance, T. daniellii has been shown to be well adapted and can grow well and vigorously under local environment with moderate irradiance of PAR transmission ratio ranging between 30-50%. The possibility of this species to do well under rubber plantation is promising based on the similar growing environment characteristics of both ecosystems.

166

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Abdul Awal, W.I., Haniff, H. and Juhari, E. 2005. Methodology of radiation interception by quatum sensor of the oil palm plantation. Songklanakarin Journal of Science and Technology 27(5): 1083-1093. Abdul Ghani, I. and Zulkefly, S. 2003. Pertanian Integrasi Berasaskan Getah. Lembaga Getah Malaysia (LGM) Monograf No. 13. Akinleye. and Omolara, C. 2012. Effect of shading on growth of Thaumatococcus daniellii. A project submitted to Department of Horticulture, University of Agriculture Abeokata, Ogun State. Andersson, L. 1998. Marantaceae. In: Kubitzki, K. (Ed.), The Families and Genera of Vascular Plants 3. Berlin: Springer-Verlag. Pp. 278-293. Arowosoge, O.G.E. and Popoola, L. 2006. Economic analysis of Thaumatococcus daniellii (Benn.) Benth. (Miraculous berry) in Ekiti State, Nigeria. Journal of Food, Agriculture and Environment 4(1): 264-269. Boadi, S., Baah-acheamfour, M., Ulzen-appiah, F. and Jamro, G.M. 2014. Nontimber forest product yield and income from Thaumatococcus daniellii under a mixed tree plantation system in Ghana. International Journal of Forestry Research. Volume 2014, Article ID 524863. 8 pages. Dahal, N.R. and Xu, X.M. 2012. Sweetest Protein- Thaumatin. Journal of Food Science and Technology Nepal 7: 112-118. Elemo, B.O., Adu, O.B., Ogunrinola, O.O., Efuwape, T.O., Olaleya, K.O. and Kareem, A.A. 2011. Biological evaluation of Thaumatococcus daniellii waste protein. Pakistan Journal of Nutrition 10(11): 1048-1052. Gaurav, A.K., Raju, D.V.S., Janakiram, T., Bhupinder, S., Jain, R. and Gopalakrishnan. 2015. Effect of shade level on the quality of cordyline (Cordyline terminalis). Indian Journal of Agricultural Science 85(7): 931-935. Jarou, Z.J. 2009. Measuring leaf area with Adobe Photoshop 3. Retrieved August 29, 2012, from http://www.chlorofilms.org/index.php/crpVideo/display /videoid/46. Keerthi, P., Vankandari, R.M.G. and Kalakoti, S. 2011. Natural Sweetener: A complete review. Journal of Pharmacy Research 4(7): 2034-2039. Kittur, B.H. and Sudhakara, K. 2015. Bamboo based agroforestroy system in Karela, India; performance of turmeric (Curcuma longa L.) in the subcanopy of differentially spaced seven years-old bamboo stand. Agroforest Systems 90(2): 237-250. Langenberger, G., Cadisch, G. and Martin, K. 2016. Rubber intercropping: A viable concept for the 21st century? Agroforestry System 91(5). doi 10.1007/s10457-016-9961-8. Lembaga Getah Malaysia. 2018. Persidangan Industri Getah Kebangsaan 2018. Pamphlets. Retrieved August 20, 2018. www.lgm.com. Ley, A.C. and ClassenBockhoff, R. 2012. Five new species of Marantaceae endemic to Gabon. Andasonia 34(1): 37-52. Lim, T.K. 2012. Thaumatococcus daniellii. In: Fruits - Edible Medicinal and Nonmedicinal Plant Volume 3. Pp. 252-258. Mohd Azraie, Y. 2018. 100 tahun industri sawit di Malaysia.Utusan online. Retrieved August 20, 2018, from m.utusan.com.my/berita/nasional/100-tahun-industri-sawit-di-malaysia-1-659845. Mohamed Senawi, M.T., Mohd Yusoff, A., Mohd Rani, M.Y., Vimala, P., Yuen, P.M., Liew, K.L., Abdul Ghani, I., Zulkefly, S., Ahmad Faiz, M.A., Shamsuri, M.H., Tunku Mahmud, T.Y., Nik Masdek, N.H., Hussan, A.K., Ahmad Shokri, O., Hassan, S., Mohamad, A.B., Mohd. Shukor, N. and Fauziah, I. 2001. Establishment of herbs under rubber ecosystem: Research challenges and direction. Proceedings of the National Seminar on Agroforestry 24-26 April 2001.

167

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Most, B.H., Summerfield, R.J. and Boxall, M. 1978. Tropical plant with sweetening properties: Physiological and agronomic problems of protected cropping- 2. Thaumatococcus daniellii. Economy Botany 32: 321-35. Ogunsanwo, O.Y., Adedeji, G.A. and Ajibabi, A.S. 2012. Pulping potential of Thaumatococcus daniellii (Benn) Benth, in Omo and Oban forest reserves of Nigeria. International Journal of Science and Nature 3(3): 580-585. Oluwatayo, I.B. 2014. Socioeconomic contributions of neglected and underutilized species to livelihood security in rural Southwest Nigeria: Thaumatococcus daniellii as a test case 5(27): 311-317. Santelices, R., Espinoza, S. and Antonio, M.C. 2015. Effects shading and slow release fertilizer on early growth of Nothofagus loonii seedlings from its northernmost distribution in Central Chile. BOSQUE 36(2): 179-185 Shalom, N.C., Adetaya, Y.O. and Popoola, S.T. 2014. Analyses of the leaf, fruit and seed of Thaumatococcus daniellii (Benth.): Exploring potential uses. Pakistan Journal of Biological Sciences 17(6): 849-854. Sotannde, O.A. and Oluwadare, A.O. 2014. Fiber and elemental contents of Thaumatococcus daniellii stalk and its implications as a non-wood fiber source. International Journal of Applied Science and Technology 4(1): 178-185. Surana, S.J., Gokhale, S.B., Rajmane, R.A. and Jadhav, R.B. 2006. Non saccharide natural intense sweeteners - An overview of current status. Natural Product Radiance 5(4): 270-278. Taiz, L. and Zieger, E. 2010. Plant Physiology, Fifth Edition. Sinauer Associates, Inc. Publishers. Chicago. Tomlinson, P.B. 1961. Morphological and anatomical characteristics of the Marantaceae. Journal of the Linnean Society (Lond.) 58: 55-78. Vikram, H.C. and Hegde, N.K. 2014. Performance of turmeric in cashew plantation as intercrop compared to sole cropping. The Asian Journal of Horticulture 9(2): 496-499. Waliszewski, W.S., Sinclair, F.L. and Steele, K.A. 2012. Morphological and AFLP diversity in Thaumatococcus daniellii, the source of the protein sweetener thaumatin. Genetic Resources and Crop Evolution 59: 151-161. Waliszewski, W.S., Oppong S., Hall, J.B. and Sinclair, F.L. 2005. Implication of local knowledge of the ecology of a wild super sweetener for its domestication and commercialization in west and central Africa. Economic Botany 59: 231-234. Yasuhiko, K. 2013. Effect of Irradiance level on the growth and photosynthesis of Salvia. International Journal of Environmental Science and Development 4(5): 479-482. Yeaboah, S.O., Hilger, T.H. and Kroschel, J. 2002. Thaumatococcus daniellii (Benn.) Benth. - A natural sweetener from the rain forest zone in West Africa with potential for income generation in small scale farming. Institute of Plant Production and Agroecology of the Tropics and Subtropics, Hohnenheim University, Stuttgart.

168

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effects of Acidic Soil on the Growth of Potential Slope Plants

Normaniza, O.*, Nur Syamimi Syafiqah, M. and Siti Fatimah, S. Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Acidic soil has become a major problem to soil fertility and productivity of the slope soil in Malaysia. Soil acidification is a natural process caused by soil respiration, production of organic acids and plant uptake of base cations (Hovmand and Bille-Hansen, 1999). Acidification of soil has also caused by atmospheric deposition of sulphur (S), and nitrogen (N) compounds, originating from anthropogenic activities. Soil acidity plays an important role in the formation of plant communities, their species and structural diversity in ecosystems (Koptsik et al., 2001). In most cases, soil acidity will suppress the plant growth and eventually the plant die off due to lack of buffering capacity and insufficient nutrients, which would leave the slope soil’s surface barren and prone to erosion.

A typical plant is not favoured to grow at highly acidic condition because some nutrients cannot be efficiently absorbed by plant roots and overload a plant’s system which causes it to languish and die (Shan et al., 1997). Hence, this study is aimed to investigate the effects of the acidic condition on the plant growth of five different potential slope plants.

Materials and Methods

Experimental site and design

A short-term pot experiment had been carried out with saplings of Murayya paniculata, Syzygium campanulatum, Melastoma malabathricum, Cinnamomum iners and Hibiscus rosa-sinensis, cultivated at sandy-loam soil in an open-ended PVC in four replications. Three treatments were applied; T1 (pH 2-3), T2 (pH 3.1-4), T3 (pH 4.1-5) and control treatment, T4 (pH 6-7). Soil samples were treated with diluted 1M sulphuric acid (H2SO4) to get the required pH and were arranged in a Completely Randomized Design (CRD). The research was carried out in the glasshouse at Rimba Ilmu Botanical Garden, Institute of Biological Sciences, Faculty of Science, University of Malaya. The glasshouse receives a range of Photosynthetically Active Radiation (PAR) of 300-200 E m-2 s-1, relative humidity (RH) of 65-90% and atmospheric temperature of 25-28oC.

Soil samples were prepared by using the red and black garden soil mixture in ratio of 2:1, respectively. The soil samples were then mixed with the diluted 1M sulphuric acid (H2SO4) with the aim to induce rapid changes in soil pH. The experimental design was adapted from Yuan et al. (2015). Homogenized soil samples of 2 kg were placed in open-ended PVC with 3.39 dm3 volumes. The saplings were watered once in 3 days for about 200 mL-300 mL to achieve maximum soil moisture. The pot experiment lasted for 84 days without further fertilisation. Soil samples were air dried, homogenized, sieved on 2 mm sieves th and characterised for soil pH (H2O). At the end of the experiment, on 84 day, we collected all plant samples from each container, oven dried and weighted.

The soil pH was measured by suspending soil in water (ratio 1:2.5) by using a pH/mV meter with 0.01 resolution (HI2211-01, Hanna Ins., Italy). Plant growth parameters taken were the photosynthetic rate

169

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

(A), transpiration rate (E) and total biomass. The photosynthetic rate (A) and transpiration rate (E) were determined by using a portable Photosynthesis System (Li6400XT, LI-COR, U.S.A.) once in 4 weeks of observation. The total biomass was determined through the dry weight of the plants which need to be dried in the oven at 60°C for at least 72 hours or at least until the weight of the plant is constant. Plant survival rate is calculated as follows:

Number of Plant Survived Survival Rate = × 100% Statistically we evaluated results by usingTotal a Two-Way Number Analysi of Plants of Grown Variance (ANOVA) with soil pH and species as factors. The correlations between soil pH and growth parameters were also deduced using Microsoft Excel.

Results and Discussion

Generally, only two species can withstand severe acidic conditions (T1), which are C. iners and H. rosa- sinensis. These two species have 100% of survival rate in comparison with S. campanulatum, M. malabathricum and M. paniculata which only had 80% of survival rates. The soil pH was proven to significantly influence the growth of these plants. The results also imply that all the species studied can withstand severe (C. iners and H. rosa-sinensis) to moderate (others) acidic conditions, prominent indicator as potential slope plants. The effects of acidic conditions on the growth and development of plants are complex, nevertheless visible injuries and yield losses can be observed. Young rootlets, leaves and shoots are typically more sensitive to low pH condition, but other metabolic aspects of the plants can be harmed as well (Lal and Singh, 2012; Lal, 2016).

The highest increment in photosynthetic rate was observed in S. campanulatum in moderate acidic condition (T3) with 76% increment (Figure 1). This species also showed the highest increment of transpiration rate (E) as much as 67% in T3 (Figure 2), indicating the moderate acidic could be the optimum conditions for the growth of the species.

In severe acidic conditions (T1), H. rosa-sinensis showed the highest increment in both photosynthetic rate and transpiration rate, with 50% and 53% of increment, respectively (Figure 1 and Figure 2). Based on the plant shoot system, this species was affected by the severe acidic condition; however, it was able to survive the acidic condition which indicates that this species have the mechanism to live in extreme conditions. This species tolerates the severe acidic condition by reducing the number of leaves which eventually reduced the photosynthetic rate and transpiration rate by 41% and 36%, respectively, in comparison with control. The previous study had also revealed that H. rosa-sinensis could live in acidic soil and can be used as phytoremediation plant (Bada and Kalejaiye, 2010).

170

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: The initial and final measurement of photosynthetic rate for every species in each treatment.

Figure 2: The initial and final measurement of transpiration rate for every species in each treatment.

The highest total biomass was S. campanulatum in weak acidic condition (T3) followed by H. rosa- sinensis in control (T4) with 59 g and 50 g, respectively (Figure 3). These results reflected that these plants do not suffer stress by moderate acidic conditions. Thus, it implies that high performance in photosynthetic rate and transpiration rate resulted in high plant biomass production and enhanced the plant growth (Saifuddin et al., 2015). In severe acidic condition (T1), H. rosa-sinensis showed declination of total biomass by 41% in comparison with control (T4), potentially as a survival mechanism of the species such as reducing the number of leaves (Figure 3).

171

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 3: The total biomass of each species in every treatment.

The photosynthetic rate and transpiration rate show positive correlations with the soil pH (Figure 4 and Figure 5, respectively). However, the lowest values of both growth indicators are not as low as expected in severe to moderate acidic conditions, proving the moderate effects of the lower soil pH on the growth of all the species studied.

Figure 4: The correlation between soil pH and photosynthetic rate.

172

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 5: The correlation between soil pH and transpiration rate.

Conclusions

This study showed that the low soil pH has moderate effects on most of the plant growth studied. This may be due to the moderate adaptation and adjustment process of plants in acidic condition. The best plant to live in acidic condition is H. rosa-sinensis as it could grow in wide range of soil pH (severe to moderate). Therefore, based on this study, it is highly recommended that H. rosa-sinensis to be planted in acidic slope as it can also increase the slope stability via root anchorage to prevent soil erosion and soil degradation. Other plants could also help in slope stabilization program in moderate acidic conditions. More detailed mechanisms on the plant resistance and adaptation towards acidic conditions is indeed essential.

References

Bada, B.S. and Kalejaiye, S.T. 2010. Response of kenaf (Hibiscus cannabinus L.) grown in different soil textures and lead concentrations. Research Journal of Agriculture and Biological Sciences 6(5): 659-664. Hovmand, M.F. and Bille-Hansen, J. 1999. Atmospheric input to Danish spruce forests and effects on soil acidification and forest growth based on 12 years measurements. Water, Air, and Soil Pollution 116(1-2): 75-88. Koptsik, S., Berezina, N. and Livantsova, S. 2001. Effects of natural soil acidification on biodiversity in boreal forest ecosystems. Water, Air, and Soil Pollution 130(1-4): 1025-1030. Lal, N. 2016. Effects of Acid Rain on Plant Growth and Development. Journal of Science and Technology 11(5): 85-108. Lal, N. and Singh, H. 2012. The effects of simulated acid rain of different pH-levels on biomass and leaf area in Sunflower (Helianthus annuus). Current Botany 3(5): 45-50. Saifuddin, M., Osman, N., Idris, R.M. and Halim, A. 2016. The effects of pre-aluminum treatment on morphology and physiology of potential acidic slope plants. Kuwait Journal of Science 43(2): 199-220. Shan, Y., Izuta, T., Aoki, M. and Totsuka, T. 1997. Effects of O3 and soil acidification, alone and in combination, on growth, gas exchange rate and chlorophyll content of red pine seedlings. Water, Air, and Soil Pollution 97(3-4): 355-366. Yuan, C., Fitzpatrick, R., Mosley, L.M. and Marschner, P. 2015. Sulphate reduction in sulfuric material after re-flooding: effectiveness of organic carbon addition and pH increase depends on soil properties. Journal of Hazardous Materials 298: 138-145.

173

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Physiological Responses, Nutrient Content and Fruit Quality of Mango (Mangifera indica L.) cv. Harumanis at Different Agro-climatic Zones

Mohd Aziz, R.1,*, Shaidatul, A.A.T.1, Fauzi, J.1, Zabawi, M.A.G.1, Norlida, M.H.1, Hafiz, M.M.H.2, Fazlyzan, A.1, Norfarhah, A.R.1, Nizam, S.A.B.1, Subahir, S.1, Malek, A.K.1, Ghazali, M.R.1 and Alif, O.M.M.1 1Agrobiodiversity and Environment Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 2Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Magnifera indica cv. Harumanis has gained popularity as one of the best tasting mango varieties in Malaysia. However, the fruit supply never meets the high market demand due to low production. Harumanis is highly sensitive to the climate variability as it requires a significant dry weather period to initiate flowering, therefore it is commercially grown in Perlis and some part of Kedah (agro-climatic zone 1). Harumanis also needs a hot and dry environment (high temperature with less rain) during reproductive stage (Shaidatul et al., 2018). Harumanis is available only for a limited period, which is from the middle of April until the middle of June annually, making the cultivar the most sought-after in the country (Farook et al., 2012). Perlis exported 3.1 metric tons of Harumanis to Japan in 2010, and projected that the export demand will increase up to 100 metric tons by 2020. Currently, MARDI is conducting a study to produce Harumanis fruits in agro-climatic zone 2 in Jelebu, Negeri Sembilan, using grafting of matured budding on mango var. Chokanan trees. Air temperature and rainfall distribution are the main climatic variables that influence the vegetative, flowering and other phenological phases in mango (Shailendra, 2012). Both climatic variables are the most important factors in determining suitability of an area’s climate for mango production. This study evaluates the effects of climate variability at two agro-climatic zones on physiological responses, flowering, carbohydrate content and fruit quality of Harumanis.

Materials and Methods

The study was conducted at 3 locations in 2 agro-climatic zones with different age of Harumanis matured budding (Table 1). The Harumanis matured budding was grafted on 2-4 years old Chokanan mango tress. The physiological responses were determined during vegetative and reproductive phase using a portable photosynthesis system (Li6400XT, LICOR Inc., USA). Fruits were harvested after reaching maturity and ten fruits from each location were analysed for fruit nutrient and quality. Data obtained were subjected to statistical analysis, using a one-way Analysis of Variance (ANOVA) to test the significance effect of all variables investigated. Means separation was performed using the least significant difference (LSD) method at 5% (P = 0.05) by the statistical package of SAS 9.3 Institute Inc. USA.

Table 1: Location and Harumanis budding age. Agro-climatic zones Location Age of matured budding 1 Chuping, Perlis 3 years 1 Sintok, Kedah 18 months 2 Jelebu, N.Sembilan 18 months

174

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

Climatic variability, phenological phase and fruit yield

Agro-Climatic zone 1 (Chuping) has a longer duration of drought/low precipitation from December 2017 to March 2018 (Figure 1) that induced higher rate of flowering and fruiting (Table 2) as compared to other locations. Higher rate of flowering in Chuping was also due to older age of matured budding branches as compared to other locations. The flowering of Harumanis branches in Chuping started in the first week of January 2018. Low precipitation was recorded in February and March 2018 for Sintok and Jelebu; and the flowering for both locations started in the third week of February 2018. Fruit buds were developed 4 weeks after flowering. It showed that Harumanis required at least 3-4 weeks of drought or very low precipitation to initiate flowering. The rate of flowering for Harumanis branches in Chuping, Sintok and Jelebu was 100, 56 and 39%, respectively. Chuping, Sintok and Jelebu produced 13.2, 6.32 and 3.35 kg of fruits per tree, respectively.

Figure 1: Monthly precipitation and mean maximum and minimum air temperature at Chuping (A), Sintok (B) and Jelebu (C) from August 2017-June 2018.

Table 2: Plant phenological phase and fruit yield of mango Harumanis. Location Plant No. of plants Plants flowered Fruit no. Fruit no. / Yield / Fruit yield / no. flowered (%) plant plot (kg) plant (kg) Chuping 250 250 100 7000 28.00 2,500.00 13.2 Sintok 45 25 56 352 14.08 157.95 6.32 Jelebu 28 11 39 89 8.09 36.9 3.35

175

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Plant growth

Higher plant height and canopy size of mango trees in Chuping as compared to other location was due to older age of branches from matured budding. However, leaf area index (LAI) in Chuping was lower due to agronomic practices where farmers cut the upper canopy of the trees to allow more sunlight to reach lower canopy. This practice will allow higher photosynthesis of leaves at lower canopy for better yield and quality of mango fruits. Plant height, canopy size and LAI of trees in Jelebu were higher as compared to Sintok although the age of branches from matured budding was the same. This was due to higher precipitation in Jelebu that induce higher biomass growth and plant vegetative development.

Table 3: Plant height, canopy size and leaf area index of mango trees. Location Plant height (m) Canopy size (m2) Leaf area index (LAI) Chuping 4.54a 35.00a 2.07b Sintok 2.91c 9.34c 1.27c Jelebu 3.94b 17.57b 3.80a *Means followed by the same letter within column are not significantly different by DMRT at P≤0.05.

Physiological responses

Net photosynthetic rate of mango leaves were not significantly different between locations (Figure 2). However, net photosynthetic rate of mango during flowering was significantly lower than during vegetative phase. The reduction was probably due to the accumulation of inhibitors (abscisic acid) that responsible for the reduction in the carboxylation efficiency that affects the fixation of CO2 in the mesophyll cells (Raschke and Fischer, 1987). Respiration rate measured during night time showed that higher temperature induced rates of leaf dark respiration, thus higher amount of glucose was used in the process (Table 4). Agro-climatic zones with lower mean night temperature reduces respiration rate, thus will support higher amount of carbohydrate accumulation and fruit yield. However, between August 2017 to June 2018, mean daily minimum temperature of all locations were not significantly different (22.32a, 21.79a and 21.77a at Chuping, Sintok and Jelebu, respectively). Therefore, minimum temperature did not have significant influence on the respiration rate of Harumanis at these locations.

a a 10 a 10 ) 8 ) -1 -1

s 8 s a a a -2 -2 6 6 4 4

2 (µmol m (µmol m 2 0 0 Net photosynthesis rate photosynthesis Net Net photosynthesis rate photosynthesis Net Chuping MARDI MARDI Chuping MARDI MARDI Sintok Jelebu Sintok Jelebu

Figure 2: Net photosynthesis rate the leaves from Harumanis branches at vegetative (left) and flowering (right) growth stages.

176

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 4: Physiological responses of mango. Temp. (oC) Net photosynthesis (µmol m-2 s-1) Glucose production (%) 30 9.68 100 Respiration (µmol m-2 s-1) Glucose usage (%)

20 2.50 25.87 22 2.59 26.82 24 2.83 29.3 26 3.10 32.11 28 3.32 34.35

Fruit nutrient and carbohydrate content

Carbohydrate content in mango fruits from Chuping was significantly higher than Sintok. Mango trees with older Harumanis branches in Chuping were taller and bigger canopy size probably support more carbohydrate accumulation to fruits and total yield. Lower fruit number per plant (8.09) in Jelebu as compared to Sintok (14.08) probably supports higher carbohydrate content in fruits. However, starch and total sugar content in fruits of all locations was not significantly different.

Table 5: Fruit nutrient and carbohydrate of mango Harumanis. Location Fruit Energy Fat Protein Mois- Ash Starch Carbo- Total weight (kcal/ (g/100g) (g/100g) ture (g/ (g/ (g/ hydrate sugar (g) 100g) 100g) 100g) 100g) (g/ (g/ 100g) 100g) Chuping 472.8a 71.60a 0.34a 0.54a 81.95b 0.34a 2.75a 17.05a 7.62a Sintok 435.8ab 58.50b 0.21a 0.47a 85.42a 0.14b 1.88a 13.84b 7.31a Jelebu 401.5b 66.30a 0.16a 0.54a 83.02b 0.42a 1.97a 16.01a 8.07a *Means followed by the same letter(s) within column are not significantly different by DMRT at P≤0.05.

Fruit quality

High TSS of mango fruits were recorded in both agro-climatic zones (14.1-16.8oBrix) although Sintok showed slightly higher TSS. However, the sweetness of fruits is also affected by the handling during postharvest ripening. This indicates that production of Harumanis in agro-climatic zone 2 will produce good quality fruits as agro-climatic zone 1.

Table 6: Total soluble solids, pH and titratable acidity of mango fruits. Total soluble solids (TSS) oBrix pH Total titratable acidity (TTA) Chuping 14.09b 5.11ab 1.05a Sintok 16.77a 5.45a 1.10a Jelebu 14.80b 4.98b 1.26a *Means followed by the same letter(s) within column are not significantly different by DMRT at P≤0.05.

Conclusions

Agro-Climatic zone 1 especially in Chuping has a longer duration of drought/low precipitation that induced higher rate of flowering and fruiting as compared to zone 2. Lower flowering rate and fruits yield in zone 2 indicated that agronomic manipulation or water stress treatment is required to induce the flowering rates. High TSS value of fruits produced in zone 2 indicates the potential of Harumanis production in another agro-climatic zone besides zone 1.

177

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Farook, R.S.M., Aziz, A.H.A. and Harun, A. 2012. Data mining on climatic factors for Harumanis mango yield prediction. Proceedings of the Third International Conference on Intelligent Systems Modelling and Simulation, Kota Kinabalu. Pp. 115-119. Raschke, K. and Fischer, E. 1987. Carboxylation of Ribulose 1,5-bisphosphate inhibited after application of the phytohormone ABA to whole leaves of Xanthium strumarium (C3) and Zea mays (C4). In: Biggins, J. (Edition) Progress in Photosynthesis Research, Volume IV: Martinus-Nijhoff (publ). Netherlands. Shaidatul, A.A.T., Hafiz, M.M.H., Helmey, Z.M.S., Zamir, M.A.R., Norziana, Z.Z., Nurul Ain, A.B., Syazwan, M.F.M., Mohd Aziz, R., Fairuz, M.M.S., Fauzi, J., Hariz, M.A.R., Norfarhah A.R., Fazlyzan, A., Norlida, M.H., Zabawi, M.A.G. and Mohd Ghazali, R. 2018. Preliminary study on the effects of daily temperature and rainfall distribution pattern towards reproductive stage of Magnifera indica cv. harumanis mangoes. Proceedings of the 15th Symposium Malaysian Society of Applied Biology, Melaka, Malaysia, 29 June-1 July, 2018. Shailendra, R. 2012. Phenological Responses to Temperature and Rainfall: A Case Study of Mango. In: Bhuwon, S.V., Rao, R. and Sthapit, S. (Eds.), Tropical Fruit Tree Species and Climate Change. Bioversity International, New Delhi, India. Pp. 71-93.

178

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The Effects of Sodium Chloride on Plant Physiology and Central Carbon Metabolism in Wheat

Che-Othman, M.H.1,*, Jacoby, R.P.2, Millar, A.H.2 and Taylor, N.L.2 1Centre for Biotechnology and Functional Food, Faculty of Science and Technology, The National University of Malaysia, 43600 Bangi, Selangor, Malaysia. 2ARC Centre of Excellence in Plant Energy Biology, School of Molecular Sciences, The University of Western Australia, WA 6009, Australia. *E-mail: [email protected]

Introduction

Soil salinity is one of the major environmental degradation problems affecting the sustainability of crop production around the world (Hasegawa, 2013). Developing salt tolerant varieties is one of the essential developments needed to overcome this future food security crisis. A number of previous studies have attempted to gain information on how plants respond in saline environments. Attention has been given to the roles of signalling pathways, ion homeostasis, reactive oxygen species detoxification and osmoprotectant biosynthesis in conferring salt tolerance (Che-Othman et al., 2017). Many of the processes mentioned above are intertwined with the central metabolism network through carbohydrate metabolism, glycolysis, and the TCA cycle activities in energy metabolism and amino acid metabolism. Even though a considerable number of observations have been obtained regarding how these components respond to salinity stress, there is still very little known regarding the sites of impact of rising salinity on central carbon metabolism and how these impacts is important in influencing salinity tolerance in plants. This is probably due to the complexity of metabolism networks and limitations in available analysis technologies to define its cause and effect.

Energy metabolism is a critical component of interest when investigating plant salinity responses as it plays a significant role in salt stress adaptation as a number of salt stress adaptation mechanisms are energy consuming processes including ion homeostasis, reactive oxygen species (ROS) defence mechanisms, and osmotic adjustment by accumulating inorganic ions and compatible solutes (Azevedo Neto et al., 2004; Wu et al., 2014; Donà and Mittelsten-Scheid, 2015). Energy metabolism beyond photosynthesis, consists of three main components that are glycolysis, tricarboxylic acid (TCA) cycle and mitochondrial electron transport chain (ETC) (Fernie et al., 2004). The structural organization of glycolysis has been well characterised. In glycolysis, glucose that derived from starch and sucrose is degraded to produce pyruvate (Fernie et al., 2004). The TCA cycle utilises pyruvate to produce reducing equivalents such as NADH and FADH2 to be used by the ETC. The ETC builds a proton gradient across the inner mitochondrial membrane (Fernie et al., 2004). The flow of the protons back to the matrix through ATP synthase produces adenosine triphosphate (ATP), an energy-rich compound that can be utilised by a range of cellular energy consuming processes. Besides its role in energy metabolism, the TCA cycle is also important in linking energy metabolism with other metabolic pathways as TCA cycle intermediates can be used as sources of carbon skeletons for the biosynthesis of amino acids and compatible solutes (Jacoby et al., 2011). Proteins that are involved in energy metabolism in plants have been shown to differentially change in abundance under salinity stress (Che-Othman et al., 2017). There is also considerable variations in respiratory rates observed in different plant species under salt stress (Jacoby et al., 2011). Since energy metabolism interacts with carbohydrate metabolism, amino acid metabolism, and compatible solute biosynthesis that in turn influenced by the environmental conditions, the variations in respiration rates could be due to the different strategies adopted by each plant to adapt to

179

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

salinity stress. In the present study, systematic physiology and metabolomics analyses were conducted to explore the response of central carbon metabolism to salinity stress in wheat.

Materials and Methods

Plant growth

Wheat plants (Triticum aestivum var. Wyalkatchem) were grown in a supported hydroponic system according to (Munns and James, 2003) with some modifications. The seedlings were grown in a laboratory growth chamber with 16/8 light/dark cycle, light intensity 500 μmolm-2s-1, 28/22°C day/night temperature and constant 65% humidity. For salt treatment plants, the salt treatment was commenced immediately after the emergence of the third leaf. NaCl was added to the nutrient solution at 25 mM increment at around 9:00 a.m. and 4:00 p.m. every day for three consecutive days to reach a final NaCl concentration of 150 mM. NaCl concentration remained 150 mM until harvest.

Measurements of gas exchange

CO2 fluxes of the leaves were measured using a portable infrared gas analyser (IRGA) systems (Li- 6400; LI-COR Inc., USA) using a 6 cm2 leaf chamber. The third fully emerged leaf harvested from the control and salt-treated plants at days 1, 2, 8 and 15 after salt addition (SA) completed.

Global metabolite analysis

The third fully emerged leaf harvested from the control and salt-treated plants at days 1, 2, 8 and 15 after salt addition (SA) completed. Metabolites were extracted according to a procedure developed by Shingaki-Wells et al. (2011). Raw GC-MS data preprocessing and statistical analysis was performed using Metabolome Express software (version 1.0; http://www.metabolome-express.org). Only metabolites of known structures that have been automatically identified in Metabolome Express and present in all replicates were considered in comparisons.

Results and Discussion

Physiological performance of wheat under salinity

The rate of photosynthesis, stomatal conductance and transpiration were measured on leaf 3 while the respiration rate was measured using several green leaves to get sufficient material for the measurement. Overall, the result showed that the photosynthesis rates of salt treated plants were lower compared to control plants, which is consistent with the general response of the salt sensitive plants to salt stress by affecting positive carbon balance that is crucial for plant growth (Chaves et al., 2009). The key factors that could limit photosynthesis rate under salt stress include reduced stomatal conductance, impaired activity of carbon fixation enzyme, reduced photosynthetic pigments, and destruction of the photosynthetic apparatus (Farooq et al., 2015). The rates of photosynthesis of salt treated plants were slightly lower than control plants from day 2 to day 8 after the SA. Interestingly, from day 8 to day 15 after SA, while photosynthetic levels in control plants were maintained, the photosynthetic levels of salt treated plants were markedly decreased. The slight reduction in the photosynthesis rate of salt treated plants from day 2 to day 8 could be due to the early osmotic stress phase of salt stress. At this stage, the water content in the leaves is decreased which could lead to the reduction in turgor pressure of the cell and causing stomatal closure (Abideen et al., 2014).

180

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mitochondrial respiration is vital during salinity stress as it provides energy to fuel salinity tolerance mechanisms including ion homeostasis, ROS defence mechanisms, and osmotic adjustment by accumulating inorganic ions and compatible solutes (Donà and Mittelsten-Scheid, 2015). The dark respiration levels of salt treated plants were significantly higher compared to control plants from day 1 to day 8 after SA (Figure 1). The increased respiration level in salt treated plant might be due to the increased energy demand for maintenance processes. However, the reduction in the growth rate might indicate that more carbon was utilised for energy metabolism which in turn, affected the carbon balance of the plants.

Metabolites responses to salinity in wheat

The physiological changes seen in wheat plants exposed to salinity may be due to changes in biochemistry at the molecular level. To study these molecular responses, changes in metabolites and proteins that are involve in central carbon metabolism, including respiratory energy metabolism were investigated. The abundance of the identified targeted metabolites that were involved in starch and sucrose metabolism, the TCA cycle and amino acids metabolism in control and salt-treated plants are shown in Figure 2 A-C respectively. Metabolites that are involved in starch and sucrose metabolism that were identified and considered for comparison between control and salt-treated plants include fructose, sucrose, trehalose, glucose, and maltose. In this study, these water-soluble carbohydrates were found to accumulate differentially during salinity stress, probably due to the various factors including photosynthetic capacity, carbon use efficiency, and carbon partitioning between growth and maintenance respiration (Xue et al., 2008).

30 100 ) ) -1 -1 25 80 sec sec * -1 -2 20 g

m * * * 2 60

2 * 15 CO CO 40 10 Respiration mol Photosynthesis

(nmol 20 (µ 5 0 0 0.6 6 ) ) -1 * 0.5 * -1 5 sec * sec -2 0.4 * * -2 4 O m O m 2

0.3 2 3 0.2 2 Transpiration rate Transpiration (mmol H 0.1 1 (mmol H Stomatal conductance Stomatal 0 0 0 5 10 15 20 0 5 10 15 20 Days after salt addition Days after salt addition

Figure 1: Average of the photosynthesis rate, respiration rate, stomatal conductance and transpiration of control (blue line) and salt treated (red line) wheat seedlings. Error bars represent standard error of the mean. Star indicates significant differences between control and salt treated plants with P<0.05, n=4.

181

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Metabolites that are involved in the TCA cycle or are direct products from it that have been identified and considered in this comparative analysis include the organic acids: aconitate, citric acid, 2-oxoglutaric acid, succinate, fumarate and malic acid. Organic acids and TCA cycle intermediates are also well known sources of carbon skeletons for the biosynthesis of many molecules such as amino acids and compatible solutes (Carillo et al., 2008). The reduction of organic acids and TCA cycle intermediates could be correlated with an increased demand for the carbon skeletons to be used in nitrogen assimilation producing amino acids and compatible solutes as an adaptive mechanism during salt stress. This postulation is also consistent with the increases in 2-oxoglutarate and aspartate abundance in leaf 3. Both 2-oxoglutarate and aspartate represent metabolic branch points connecting the TCA cycle with nitrogen assimilation (Nunes-Nesi et al., 2013).

In general, the levels of quantified amino acids were higher in the leaf 3 of the salt-treated plants at all time points (Figure 2C). Interestingly, the average of proline content in salt-treated plants was more than 160-fold higher compared to control plants at day 15 after SA. The high accumulation of proline might be one of the adaptive mechanisms employed by plants during salt stress. Proline accumulation is known to occur widely in plants under abiotic stresses and has been reported in soybean (Yin et al., 2015), maize (Farooq et al., 2015), barley and wheat (Puniran-Hartley et al., 2014). Like other osmolytes, besides having a role in osmotic adjustment, proline is believed to contribute to salt tolerance by stabilizing membranes and protein structure and function. Proline also plays an important role in scavenging free radicals and buffering cellular redox potential under stress conditions (Ashraf and Foolad, 2007).

The TCA cycle shows an interesting result as there are decreases in metabolites pool despite an increase in respiration rate. The big depletion in aconitate level under salinity stress might indicate a reduction of reduced pyruvate uptake into the TCA cycle. This pyruvate uptake involves the activity of mitochondrial pyruvate carrier and pyruvate dehydrogenase complex (PDC) (Fernie et al., 2004). During stress condition, the TCA cycle might not operate in its normal circular form while requiring the anaplerotic role of amino acid (Sweetlove et al., 2010; Akçay et al., 2012). Also, there is an increased role of GABA as the alternative carbon source for TCA cycle as it can be converted into succinate through the activity of GABA transaminase and succinyl semialdehyde dehydrogenase (Akçay et al., 2012; Renault et al., 2013). Since the TCA cycle process is located in mitochondria, mitochondrial protein enrichment and quantification the TCA cycle related proteins may provide vital information about TCA cycle activity under salt stress in wheat and how it influences the overall carbon metabolism in the plant.

182

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A 6 Fructose 6 Sucrose B 1.5 Fumarate3 Citric acid * * * 4 4 1 * * 2 * * 2 2 0.5 1 *

0 0 0 0 1.5 Trehalose 2 D- Glucose 10 2-oxoglutaric acid 2 Malic acid * * * * 1 1.5 * 1 5 * 1 * 0.5 0.5 * 0 0 0 0 1.5 Maltose 0 5 10 15 20 6 Succinate4 Aconitate Days after salt addition * 3 1 4 * 2 * 0.5 2 1

Relative abundance to ribitolto abundance Relative standard) (internal *

Relative abundance to ribitolto abundance Relative standard) (internal 0 0 0 * 0 5 10 15 20 0 5 10 15 20 0 5 10 15 20 Days after salt addition Days after salt addition

C 4 Alanine10 * Aspartate 1.5 Proline * 1.5 GABA * * 1 1 2 * 5 * * * * * 0.5 * 0.5 0 0 0 * 0 2 1 Arginine 3 Glutamine* * * L-ornithine2 L-serine 2 * 1.5 1 0.5 * * 1 * * * 1 * * * 0.5 0 0 0 * 0 6 2 Tyrosine 0 5 10 15 20 0 5 10 15 20 ** Glutamate 1.5 * Days after salt addition 4 1 2 * 0.5

Relative abundance to ribitolto abundance Relative standard) (internal 0 0 0 5 10 15 20 0 5 10 15 20 Days after salt addition

Figure 2: Abundance of metabolites that are involved in starch and sucrose metabolism (A), TCA cycle (B) and amino acid metabolism (C) in leaf 3 of control (blue line) and salt treated wheat plants (red line). Error bars represent standard error of the mean. Star indicates significant differences between control and salt treated plants at P<0.05, n=4.

Conclusion

Salinity stress in wheat is characterised by a decrease in growth, reduction in photosynthetic rate, which is related to osmotic and ionic stress responses. Increases in CO2 release in the dark might indicate an increase in respiration rate and thus an adaptation in energy metabolism. Increased respiration and decreased photosynthesis lead to reduced carbon balance and growth rate. Integration of metabolite and proteomics data indicate that the TCA cycle might operate through alternative routes in favour of consuming glucose for energy metabolism while enhancing soluble sugar and amino acid accumulation during salt stress in wheat. However, further study of TCA cycle activity involving mitochondrial protein enrichment step is necessary to gain more information on the operation of the TCA cycle under salt stress.

183

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Abideen, Z., Koyro, H.W., Huchzermeyer, B., Ahmed, M.Z., Gul, B. and Khan, M.A. 2014. Moderate salinity stimulates growth and photosynthesis of Phragmites karka by water relations and tissue specific ion regulation. Environmental and Experimental Botany 105: 70-76. Akçay, N., Bor, M., Karabudak, T., Özdemir, F. and Türkan, İ. 2012. Contribution of Gamma amino butyric acid (GABA) to salt stress responses of Nicotiana sylvestris CMSII mutant and wild type plants. Journal of Plant Physiology 169: 452-458. Ashraf, M. and Foolad, M.R. 2007. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environmental and Experimental Botany 59: 206-216. Azevedo Neto, A.D.D., Prisco, J.T., Enéas-Filho, J., Lacerda, C.F.D., Silva, J.V., Costa, P.H.A.D. and Gomes-Filho, E. 2004. Effects of salt stress on plant growth, stomatal response and solute accumulation of different maize genotypes. Brazilian Journal of Plant Physiology 16: 31-38. Carillo, P., Mastrolonardo, G., Nacca, F., Parisi, D., Verlotta, A. and Fuggi, A. 2008. Nitrogen metabolism in durum wheat under salinity: Accumulation of proline and glycine betaine. Functional Plant Biology 35: 412-426. Chaves, M.M., Flexas, J. and Pinheiro, C. 2009. Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Annals of Botany 103: 551-560. Che-Othman, M.H., Harvey Millar, A. and Taylor, N.L. 2017. Connecting salt stress signalling pathways with salinity induced changes in mitochondrial metabolic processes in C3 plants. Plant, Cell and Environment 40(12): 2875-2905. Donà, M. and Mittelsten-Scheid, O. 2015. DNA damage repair in the context of plant chromatin. Plant Physiology 168: 1206-1218. Farooq, M., Hussain, M., Wakeel, A. and Siddique, K.M. 2015. Salt stress in maize: Effects, resistance mechanisms, and management. A review. Agronomy for Sustainable Development 35(2): 461- 481. Fernie, A.R., Carrari, F. and Sweetlove, L.J. 2004. Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Current Opinion in Plant Biology 7: 254-261. Hasegawa, P.M. 2013. Sodium (Na+) homeostasis and salt tolerance of plants. Environmental and Experimental Botany 92: 19-31. Jacoby, R.P., Taylor, N.L. and Millar, A.H. 2011. The role of mitochondrial respiration in salinity tolerance. Trends in Plant Science 16: 614-623. Munns, R. and James, R. 2003. Screening methods for salinity tolerance: A case study with tetraploid wheat. Plant and Soil 253: 201-218. Nunes-Nesi, A., Araújo, W.L., Obata, T. and Fernie, A.R. 2013. Regulation of the mitochondrial tricarboxylic acid cycle. Current Opinion in Plant Biology 16: 335-343. Puniran-Hartley, N., Hartley, J., Shabala, L. and Shabala, S. 2014. Salinity-induced accumulation of organic osmolytes in barley and wheat leaves correlates with increased oxidative stress tolerance: In planta evidence for cross-tolerance. Plant Physiology and Biochemistry 83: 32-39. Renault, H., El Amrani, A., Berger, A., Mouille, G., Soubigou-Taconnat, L., Bouchereau, A. and Deleu, C. 2013. γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. Plant, Cell and Environment 36: 1009-1018. Shingaki-Wells, R.N., Huang, S., Taylor, N.L., Carroll, A.J., Zhou, W. and Millar, A.H. 2011. Differential molecular responses of rice and wheat coleoptiles to anoxia reveal novel metabolic adaptations in amino acid metabolism for tissue tolerance. Plant Physiology 156: 1706-1724. Sweetlove, L.J., Beard, K.F.M., Nunes-Nesi, A., Fernie, A.R. and Ratcliffe, R.G. 2010. Not just a circle: flux modes in the plant TCA cycle. Trends in Plant Science 15: 462-470.

184

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Wu, D., Shen, Q., Qiu, L., Han, Y., Ye, L., Jabeen, Z., Shu, Q. and Zhang, G. 2014. Identification of proteins associated with ion homeostasis and salt tolerance in barley. Proteomics 14: 1381-1392. Xue, G.-P., McIntyre, C.L., Jenkins, C.L.D., Glassop, D., van Herwaarden, A.F. and Shorter, R. 2008. Molecular dissection of variation in carbohydrate metabolism related to water-soluble carbohydrate accumulation in stems of wheat. Plant Physiology 146: 441-454. Yin, Y., Yang, R., Han, Y. and Gu, Z. 2015. Comparative proteomic and physiological analyses reveal the protective effect of exogenous calcium on the germinating soybean response to salt stress. Journal of Proteomics 113: 110-126.

185

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 3

Post-harvest Technology and Quality Control

186

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Extending Storage Life of Carambola Fruits (Averrhoa carambola cv. B10) with Dynamic Controlled Atmosphere (DCA) Technology

Joanna, C.L.Y.*, Wan Mohd Reza, W.H., Tham, S.L., Zaipun, M.Z., Razali, M., Nur Izzati, M. and Mohamad Fikkri, A.H. Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

In a static control atmosphere (CA) environment, fruits are stored in which temperature, the oxygen (O2) and carbon dioxide (CO2) levels are maintained on a certain level during storage (Tran et al., 2015). Recent research findings in improvements of gas monitoring equipment and storage room structure have identified an improved version of CA termed dynamic controlled atmosphere (DCA), a potential replacement for chemical methods (Mditshwa et al., 2017).

DCA uses technologies that allow continuous monitoring and adapting O2 levels in response to changes of fruits metabolism tolerated by the fruit in their metabolic stage during storage (Zanella, 2003). By storing fruits at the lowest oxygen limit (LOL) tolerated by the fruit could slow down oxidative reactions and senescence processes thus preventing the development of physiological disorders and quality degradation. Hence, allowing exporters to maximize fruit storage potential for distant markets while maintaining good quality fruits. This system has been tested in controlling physiological disorders and maintaining postharvest quality in apples (Mditshwa et al., 2017), pears (Mattheis and Rudell, 2011) and avocado (Burdon et al., 2008).

The use of DCA for long term storage for tropical fruits has not been studied extensively in Malaysia. Given the beneficial effects of storage under DCA reported for apples, pears and avocado, this study aimed to evaluate the potential of this technology for the Malaysian fruits. As one of the important premium fruits of Malaysia, carambola fruits (Averrhoa carambola cv. B10) were chosen for this study. Carambola fruits is an important export fruit with an annual export value of RM30 million and is mainly exported to Europe. This research objective was to investigate the effect of DCA on the postharvest quality of carambola fruits during storage.

Materials and Methods

Carambola (A. carambola cv. B10) used in this study were obtained from a farm in Slim river, Perak, Malaysia. Fruits were harvested at commercial stage; colour index 2 (fruit colour is light green with tinge of yellow) and transported on the same day to the MARDI Postharvest Complex at Serdang, Selangor. Fruits were packed in one layer in paperboard boxes before storage.

Storage conditions

Fruits were stored at 7°C (85-90% relative humidity; RH) in static controlled atmosphere (SCA) condition (3% O2 + 8% CO2) and DCA condition (1.6% O2 + 0.03% CO2) and compared with fruits stored in air as a control. For DCA, the chlorophyll fluorescence non-destructive monitoring system (HarvestWatch, Satlantic Inc, Halifax, Canada) with an ability to predict and indicate LOL was used to

187

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

determine DCA set points (Prange et al., 2003). The fruit quality was assessed alternately at 0, 4, 6 and 9 weeks of storage.

Physical evaluation

Colour of fruit peel (L*, a* and b*) were measured by using a portable chromameter (model CR-400 Minolta Corp., Osaka, Japan) and interpreted as follows: L* for lightness range from black = 0 to white = 100, the a* and b* values indicate chromatic coordinates or colour directions (McGuire, 1992). A positive a* value indicates redness (-a* is greenness) and a positive b* value indicates yellowness (-b* is blueness) on the hue circle.

Chemical properties

The fruit was peeled and homogenized for chemical analysis. The soluble solids concentration (%SSC) of juice from homogenate was measured using a digital refractometer. Total titratable acidity (TTA) was determined using the titration method and expressed in % citric acid. Ascorbic acid (AA) content was also determined using titration method and expressed in mg/100g of fresh weight (FW).

Statistical analysis

The experiment was conducted using the completely randomized design (CRD) with three replicates consisting of four fruits each replicate. Data was subjected to analysis using general linear model procedure (GLM) and means were separated using Duncan’s Multiple Range Tests (DMRT) using SAS 9.4 (SAS Institute Inc., USA).

Results and Discussion

The mean values of the color parameters L*, a* and b* of the fresh carambola fruits were 24.82, -8.04 and 24.19, respectively. These values showed that fresh carambola fruits at colour index 2 were characterized with their bright green and glossy skin. From Table 1, it was clearly shown that the L*, a*, and b* values had changed significantly for all treatments during nine weeks of storage. As storage weeks progressed, Table 1 showed the decrease of L* value and the increase of both a* and b* values indicated the skin began to turn from green to yellow. Value of a* and b* increased during storage, however the increase was minimal in DCA stored fruit compared to SCA and control fruits (Table 1). These results suggest that low O2 level in DCA was able to delay ripening of the carambola fruits during storage by slowing the process of chlorophyll degradation (loss of green) and biosynthesis of carotenoids (yellow) (Wills et al., 2007). It has also been reported that DCA maintained greener skin colouration in apples (Zanella, 2003; Tran et al., 2015). The ability of DCA to retain fruit green colour is a highly desired quality attribute especially after shipment.

There was no significant differences in TTA, SSC:TTA and AA content among treatments except for SSC (p<0.05) (Table 2). Upon removal, higher SSC value (p<0.05) was observed in fruits kept in SCA and DCA compared to fruits kept in normal air (p>0.05) (Table 2). These results indicated that with combination of low temperature and low oxygen levels in storage environment effectively inhibits the rate of biological reactions of fruits (Tran et al., 2015). Whereas for control fruits, SSC value is significantly lower in control fruits could be explained by high respiratory activities of these fruit (Wills et al., 2007). As storage weeks progressed, there was a significant increase of SSC content at week 9 (p<0.05) (Table 2).

188

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

There was a significant increase of AA content in all stored carambola fruits as storage weeks progressed from week 0 to week 4 (p<0.05) (Table 2). However, the AA content did not vary significantly (p>0.05) at week 4, 6 and 9. It was observed that the ascorbic content is found higher in ripe carambola fruits (Pauziah et al., 2010). During storage, ripening process of carambola fruits is still occurring at a much slower phase as the fruits turned slightly yellow from green which resulted in higher SSC and AA content as storage week progressed.

Table 1: Effects of different storage conditions on colour development (L*, a* and b*) of carambola fruits (Averrhoa carambola L. cv. B10) during storage. Fruits were stored at 7°C in air, static controlled atmosphere (SCA) and dynamic controlled atmosphere (DCA) for 9 weeks. L* a* b* Storage condition (SC) Normal air 34.60a -0.88a 25.19a Static CA (3% O2, 8% CO2) 36.47a -1.37a 24.14ab Dynamic CA (1.6% O2, 3.2% CO2) 35.58a -4.63b 22.98b F-sig ns ** *

Storage week (W) 0 24.82c -8.04c 24.19b 4 30.00b -1.86b 20.85c 6 30.08b -2.62b 25.53ab 9 37.32a 3.35a 25.82a F-sig * ** **

SCxW * ** * Mean values with different letter(s) in the same column indicate statistically significant differences (p<0.05) according to DMRT.

Table 2: Effects of different storage conditions on soluble solids concentration (SSC), total titrable acidity (TTA), SSC:TTA ratio and ascorbic acid (AA) content of carambola fruits (Averrhoa carambola L. cv B10) during storage. Fruits were stored at 7°C in air, static controlled atmosphere (SCA) and dynamic controlled atmosphere (DCA) for 9 weeks. SSC (%) TTA (mg/100g) SSC/TTA AA (mg/100g) Storage condition (SC)

Normal air 5.87b 0.24a 24.40a 12.51a a a a a Static CA (3% O2, 8% CO2) 6.47 0.24 26.77 14.49 a a a a Dynamic CA (1.6% O2, 3.2% CO2) 6.38 0.25 25.52 15.02 F-sig * ns ns ns

Storage week (W) 0 6.11b 0.23a 27.25a 9.30b 4 6.03b 0.24a 24.73a 16.58a 6 6.07b 0.25a 24.69a 15.28a 9 7.18a 0.24a 26.16a 14.77a F-sig ** ns ns *

SCxW ns ns ns ns Mean values with different letter(s) in the same column indicate statistically significant differences (p<0.05) according to DMRT.

189

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

The storage of carambola fruits (A. carambola cv. B10) in DCA maintained unripe colour, less physiological disorder and longer storage life (9 weeks) compared to conventional SCA storage (6 weeks) and normal air (4 weeks).

References

Burdon, J., Lallu, N., Haynes, G., McDermott, K. and Billing, D. 2008. The effect of delays in establishment of a static or dynamic controlled atmosphere on the quality of ‘Hass’ avocado fruit. Postharvest Biology and Technology 49: 61-68. Mattheis, J. and Rudell, D. 2011. Responses of ‘d’Anjou’ pear (Pyrus communis L.) fruit to storage at low oxygen set points determined by monitoring fruit chlorophyll fluorescence. Postharvest Biology and Technology 60: 125-129. McGuire, R.G. 1992. Reporting of objective colour measurements. HortScience 27(12): 1254-1255. Mditshwa, A., Fawole, O.A., Vries, F., van Der Merwe, K., Crouch, E. and Opara, U.L. 2017. Minimum exposure period for dynamic controlled atmospheres to control superficial scald in ‘Granny Smith’ apples for long distance supply chains. Postharvest Biology and Technology 127: 27-34. Pauziah, M., Tarmizi, S.A., Mohd Salleh, P. and Norhayati, M. 2010. Quality of starfruit harvested at advanced maturity stage. Acta Horticulturae 880: 231-235 Prange, R.K., DeLong, J.M., Harrison, P.A., Leyte, J.C. and McLean, S.D. 2003. Oxygen concentration affects chlorophyll fluorescence in chlorophyll-containing fruit and vegetables. Journal of American Society of Horticultural Science 128: 603-607. Tran, D.T., Verlinden, B.E, Hertog, M. and Nicolai, B.M. 2015. Monitoring of extremely low oxygen control atmosphere storage of ‘Greenstar’ apples using chlorophyll fluorescence. Scientia Horticulturae 184: 18-22. Wills, R.B.H., Lee, T.H., Graham, D., McGlasson, W.B. and Hall, E.G. 2007. Postharvest: An Introduction to the Physiology and Handling of Fruit and Vegetables. 5th edition New South Wales University Press Limited, Australia. Zanella, A. 2003. Control of apple superficial scald and ripening-a comparison between 1- methylcyclopropene and diphenylamine postharvest treatments, initial low oxygen stress and ultra-low oxygen storage. Postharvest Biology and Technology 27: 69-78.

190

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Cold Storage Improved Postharvest Life of Durian (Durio zibethinus cv. Musang King)

Nur Azlin, R.*, Zaipun, M.Z., Siti Aisyah, A., Razali, M., Habsah, M. and Siti Khuzaimah, T. Horticultural Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Durian (Durio zibethinus) is in order Malvales, family of Bombacaceae and belongs to the genus of Durio. It is a climacteric tropical fruit, and available during its season through out of South East Asia (Thailand, Malaysia, Indonesia and Philippines). Durian is famous for its strong and unique taste and aroma as well as nutritional content (Ho and Bhat, 2015). The durian fruit is covered with thorny thick husk. As durian ripens, abscission area naturally develops at the centre of each locule that weakens and allows the fruit to easily open. The fruit typically has five locular units and each contain 1-5 pulps. The pulp consists of seed, which covered by a white, yellow or orange aril, the edible portion of the fruit (Voon et al., 2006).

Due to its popularity, durian is now having demand all over the world. Thailand is the largest producer of durian followed by Indonesia and Malaysia. The largest producers of durian in Malaysia are Pahang, Johor, and Sarawak (DOA, 2017). In 2017, the total hectarage covered in Malaysia were about 72,391.34 hectares with production of 210,873.99 metric tonnes. The value of production was estimated about RM 2,794,080.33 in 2017. The common durian which are familiar to Malaysia are includes D24, D159 (Mon Thong), D175 (Udang Merah), D168 (Hajjah Hasmah), and D197 (Musang King).

Nowadays, Durian D197 (Musang King) is one of the popular variety due it thick flesh, small core and melts-in-your-mouth goodness. However, postharvest life of this durian is still limited because of it’s a type of climacteric fruit and its tropical condition. Different from Thailand’s durian that harvest by cutting them before drop, Malaysian durian for example Musang King are matured drop, thus they are easily cracked and its short postharvest life affect its market distribution. Cold storage has plenty of benefits in prolonging shelf life of fresh produce after harvest by reducing respiration and water loss as well as controlling decaying process. However, fruits like durian are susceptible to chilling injury when exposed to temperatures lower than their optimum temperatures (Kader, 2002). In Thailand, durian has extended shelf-life when stored at 15°C with relative humidity of 85% to 95% (Booncherm and Siriphanich, 1991). The objective of this study was to prolong the postharvest quality of Musang King durian, by determining the lowest safe temperature that does not induce chilling injury.

Materials and Methods

Musang King durian were purchased from Top Fruit Sdn. Bhd. in Batu Pahat, Johor, Malaysia and fruit were kept in 7°C after arrived in Postharvest Complex, MARDI Serdang. Fruit were sorted for sound and not crack as well as free of visual defects. Fruit were randomized into three groups for storage at 13°C, 10°C or 7°C. Fruit (n=3) were analysed initially at day 1 and each seven days during 21 days’ storage. At each analysis, fruit were transferred to 25ºC for 24 hours to allow for the development of any chilling injury symptoms.

191

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

At each evaluation days, individual fruit were subjectively rated for external chilling injury symptoms, red lesions area, dehiscence incidence (yes or no) and overall acceptability rating (Table 1).

Table 1: Percentage of chilling injury symptoms, red lesions area and overall acceptability ratings. Chilling injury symptoms and red lesions area (% surface area) Overall acceptability ratings 0% = No trace 5. Excellent <25% = Slightly affected 4. Good 16-25% = Moderately affected 3. Acceptable 25-50% = Badly affected 2. Poor >50% = Severely affected 1.Very poor

The experimental setup was a completely randomized design and performed for each variable. For this purpose, a one-way ANOVA test was used to evaluate the effects of the treatments on each measurement day. The Duncan Multiple Range Test (DMRT) was used for means difference testing. A 95% confidence interval was used for all calculations (p≤0.05). SAS statistical software version 9.4 was used to perform the statistical analyses.

Results and Discussion

According to Siriphanich (1994), chilling injury in durian shows symptom like dark color development along the groove between spines, and later the whole rind will turn black. The aril may remain hard or ripen abnormally. In this study, visual appearances of the rind after left for 24 hours in ambient temperature showed that there were no chilling injury symptoms occurred as described above and among treatments during 21 days of storage. Thus, the storage temperature of durian can be reduced to 7°C without any chilling injury symptoms observed on the rind of durian.

Chilling injury occurs when commodities are held at temperature below their optimum temperature but above their freezing points. Commonly, chilling injury symptoms are including discoloration, pitting, water-soaked appearance, failure to ripen, internal breakdown, off flavor and tissue decay (Wang, 2010). In durian, chilling injury symptoms were observed as red lesions along the suture (wet core) at the centre of the fruit. After 7 days storage, there were no red lesions area was observed in all storage temperature tested. However, after 14 days storage, fruit stored at 7°C (T3) started to develop red lesions incidence at the wet core near the stem-end.

After 7 days of storage, fruit stored at 13°C (T1) had highest incidence of fungal infection (28.3%) and it was significantly higher compared to fruit stored at 7°C, only (6.7%). When the storage was extended to 14 days, fruit stored at 10°C (T2) (40%) had significantly higher fungal infection at stem compared to fruit at 7°C (27%). This can be concluded that fruit may still be infected by fungus in cold environment and storage in low temperature can only slow it down.

Husk dehiscence or cracking is a primary problem limiting the shelf life of durian (Khurnpoon, et al., 2008). The table showed that at day 7, most durian stored at 13°C already dehisced. On day 14, most durian at treatment 10°C also already dehisced while durian stored at 7°C still did not dehisced. On day 21, most durian at 7°C was already dehisced. The results indicate that storage temperature of 7°C was suitable for durian storage for at least 14 days. According to Sriyook (1994), water loss and ethylene production are the two main factors that caused the mature durian fruit to dehisce. Water losses caused the husk to shrink and pull the carpel from each other along the suture at the middle of each locule. Ethylene weakens the cells in the dehiscence region that consists of parenchyma cell which does not contain chlorophyll.

192

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Percentage of chilling injury symptoms, red lesions area, disease at stem (% surface area), dehiscence (yes or no) and overall acceptability rating (scale 1-5) for durian during 21 days storage at 13°C, 10°C and 7°C based on each fruit (n=3). Treatment Day 0 Day 7 Day 14 Day 21 Chilling injury on the rind 13°C (T1) 0.0a 0.0a . . (%) 10°C (T2) 0.0a 0.0a 0.0a . 7°C (T3) 0.0a 0.0a 0.0a 0.0 Red lesions 13°C (T1) 0.0a 0.0a . . (%) 10°C (T2) 0.0a 0.0a 0.0a . 7°C (T3) 0.0a 0.0a 3.3a 3.3 Disease at stem 13°C (T1) 0.0a 28.3a . . (%) 10°C (T2) 0.0a 15ab 40.0a . 7°C (T3) 0.0a 6.7b 26.7b 36.7 Dehiscence zone 13°C (T1) No Yes . . 10°C (T2) No No Yes . 7°C (T3) No No No Yes Overall acceptability 13°C (T1) 5.0a 3.0c . . 10°C (T2) 5.0a 4.0b 2.5a . 7°C (T3) 5.0a 5.0a 3.3a 2.7 Means in each column with the same letter are not significantly different at p≤0.05.

For overall acceptability, after 7 days storage, durian at 7°C scored as excellent, durian at 10°C scored as good and durian at 13°C is acceptable up to 7 days. The fruit at 13°C were then been discarded due to fungal infection and most of them were already dehisced. At day 14, fruit stored at 10°C were scored poor while fruit at 7°C were still acceptable.

Figure 1 shows the percentage of weight loss during 21 days storage for different storage temperature. The percentage of weight loss of fruit stored at 13°C was highest (4.07%) after 7 days storage as compared to fruit stored at 10°C and 7°C, i.e. 3.68% and 2.30% respectively. This can be concluded that percentage of weight loss is correlated with storage temperature. Increase of storage temperature will increase the weight loss of the fruit. After 2 weeks of storage, the fruit stored at 10°C lost 6.61% of its weight while fruit at 7°C lost only 4.86%.

Figure 1: Weight loss of durian at three different storage temperatures (13°C, 10°C, 7°C) with 85-90% relative humidity.

193

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Cold storage at 13°C is not suitable for Musang King durian because of the short storage life (less than 7 days) while storage at 10°C can last not more than 14 days. Durian at 13°C also easily infected by fungus and has recorded for highest weight loss. Cold storage at 7°C is the most suitable temperature to store durian Musang King as it delays the dehiscence of the fruit for more than 14 days.

References

Booncherm, P. and Siriphanich, J. 1991. Postharvest physiology of durian pulp and husk. Kasetsart Journal: Natural Science 25: 119-125. Department of Agriculture (DOA) Malaysia 2017. Hectareage, Production and Value of Production of Fruit Crops by Type, Malaysia, 2017 in Fruit Crops Statistic. Ho, L.H. and Bhat, R. 2015. Exploring the potential nutraceutical values of durian (Durio zibethinus L.) - An exotic tropical fruit. Food Chemistry 168: 80-89. Kader, A.A. 2002. Postharvest Technology of Horticultural Crops, University of California, Division of Agriculture and Natural Resources, CA. Pp. 135-144. Khurnpoon, L., Siriphanich, J. and Labavitch, J.M. 2008. Cell wall metabolism during durian fruit dehiscence. Postharvest Biology and Technology 48(3): 391-401. Siriphanich, J. 1994. Durian (Durio zibethinus Merr.). Postharvest biology and technology of tropical and subtropical fruits: Volume 3: Cocona to mango. Woodhead Publishing Limited. Sriyook, S., Siriatiwat, S. and Siriphanich, J. 1994. Durian fruit dehiscence - Water status and ethylene. HortScience 29(10): 1195-1198. Voon, Y.Y., Hamid, N.S.A., Rusul, G., Osman, A. and Quek, S.Y. 2006. Physicochemical, microbial and sensory changes of minimally processed durian (Durio zibethinus cv. D24) during storage at 4 and 28°C. Postharvest Biology and Technology 42(2): 168-175. Wang, C.Y. 2010. Alleviation of chiling injury in tropical and subtropical fruits. Acta Horticulturae 864: 267-274.

194

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effect of Fruit Maturity Stages on Physiochemical Properties of Lowland Tomato No. 32 Stored at Ambient Temperature

Nur Syafini, G.1,*, Azhar, M.N.1, Nurul Khdijah, R.1, Nor Hazlina, M.S.1, Rahayu, A.1, Rozlaily, Z.1 and Zaulia, O.2 1Horticulture Research Center, Malaysian Agricultural Research and Development (MARDI), 43400 Serdang, Selangor, Malaysia. 2Genebank and Seed Centre, MyGeneBankTM Complex, Malaysian Agricultural Research and Development (MARDI), 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Tomato (Lycopersicon esculentum L.) is known for high nutritional resources, especially antioxidants, namely lycopene and beta-carotene (Canene-Adams et al., 2005). In Malaysia, tomatoes are produced from the very limited highland areas in Cameron Highlands. Due to high demand of tomato (Perangkaan Agromakanan, 2015), the technology of lowland tomato cultivation has been emphasized to cater for the local demand of this temperate vegetable thus, enabling to reduce the extreme usage of limited land areas in the Cameron Highlands (Rozlaily et al., 2016). Therefore, MARDI has developed a new hybrid lowland tomato that suitable for tropical climate and capable to produce high yield and resistant to bacterial rot disease (Nor Hazlina et al., 2017). Tomato can be stored at ambient temperature for a period of up to 7 days. It is generally agreed that for longer storage tomato can be stored at 10-15°C and 85-95% relative humidity (Shewfelt et al., 1988; Castro et al., 2005). However the effect of storage temperature on physiochemical quality and quantity changes in tomatoes, varies with cultivar (Abou-Aziz et al., 1976), exposition time (Hobson, 1981) and harvesting conditions (Autio and Bramlage, 1986). Thus, this study was conducted to determine the fruit quality of the newly developed hybrid lowland tomato No. 32 harvested at different maturity when stored at an ambient temperature.

Materials and Methods

Lowland tomato No. 32 was grown using soilless culture system under rain shelter. To determine the day of harvesting, full bloom flowers were tagged. After 35-45 days of tagging, fruits at different maturity indices were harvested. Samples were placed at ambient condition for 10 days. The fruits were sampled at 3-day intervals to determine the changes in quality. The postharvest quality of tomato was judged visually and the criteria used were retention of original colour, freshness and postharvest disease. The colour of tomato was measured using a chromameter (Model CR-400 Minolta, Japan). Each colour value of lightness (L*), chroma (C*), and hue angle (h°) was expressed as the means of three measurements. Texture of tomatoes was measured using a texture analyzer (Model 1140 Instron Universal Testing Machine) with needle probe. Soluble solids content (SSC) was determined with a digital refractometer (Model DBX-55, Atago Co., Ltd, Japan). Titratable acidity (TTA) was determined by titrating 20 mL of extraction with 0.1 mol l-1 NaOH to pH 8.2 (Shaw et al., 1987). Ascorbic acid content was determined by extraction of 10 g of sample with the addition of 100 ml of 3% metaphosphoric acid. Then, 10 mL of extraction was titrated immediately with a standard dye solution to first permanent pink endpoint. Rates of respiration and ethylene production were measured using a closed system. The lids of the containers were tightly closed for 2 h prior to the gas measurement. Three containers were used to represent a replication for each index. The respiration rate (CO2 concentration and O2 consumption) and ethylene production were measured by gas chromatograph (Perkin Elmer Auto System XL, USA). The experimental design was a completely randomized design with three replications. The data was analyzed

195

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

using analysis of variance (ANOVA) and mean comparison was conducted by Duncan’s Multiple Range Test (DMRT) at the 5% level of significant. Unless otherwise specified, all significant differences in this paper were p≤0.05.

Results and Discussion

Lowland tomato No. 32 matured about 35-37 days after flowers were tagged at full bloom. The most appropriate maturation index is the colour change of the skin. Fruit colour for index 1 showed shiny green whereas for index 2 the fruit were green with trace of pink colour. It is also called as breaker stage. At ambient condition, breaker stage tomato was able to ripen uniformly after 3-4 days. Thus, breaker stage was the earliest rank suitable for harvesting. While for Index 3 (skin is greener than reddish pink/turning stage) and Index 4 (reddish pink with spot green) were suitable for export market. The fruit was turn into orange-red (Index 5) and deep-red colour/full ripen (Index 6) after 40-45 days of flowering and suitable for the local market. Tomato at this stage can be served for better eating quality. However it had short storage life and near to deterioration. Figure 1 showed appearance of lowland tomato after harvesting according to maturity indices.

The colour of tomato changed from green to red during storage period. After 7 days of storage, the matured green fruits (Index 1) reached the deep-red/red-ripe stage (Index 6). The quality of Index 6 tomatoes was maintained with slightly lighter weight due to respiration process. According to Shewfelt et al. (1988), colour development in tomato is characterized by lower L* value (lightness) readings, decrease in hue angle and increase in chroma. Similarly was found in this study where L* and hue angle and chroma values were high in green colour tomato but slowly decreased when tomato reached to Index 5 and 6. In addition, there were slightly significant differences (p≤0.05) observed in L*, chroma and hue angle among all the maturity indices during storage (Table 1). The colour change of tomato during storage was correlated with ripening process from degradation of chlorophyll and incapacity to synthesize lycopene (Gnanasekharan et al., 1992). During storage period, firmness was highly significant affected by fruit maturity stage. The tomato firmness also decreased gradually when the fruit start to ripen from mature green to deep-red tomato (Table 1). Tomatoes had a high respiration rate at ±28°C, initially at 18.83 mgCO2/kg-hr and increased at 35.69 mgCO2/kg-hr after 7 days storage. The ethylene production also slightly increased from 72.62 mL/kg-hr to 118.19 mL/kg-hr due to the ripening process.

The combine effect of maturity and storage temperature have also significantly influenced on chemical changes of tomato during ripening. Changes in SSC, TTA, sugar/acid ratio and ascorbic acid content were showed high significantly affected (Table 1). During storage duration, SSC slightly increased (from 4.11 to 5.44°Brix) and decreased at day 7 (4.79-4.97°Brix). Tomato harvested at deep-red stage showed higher SSC whereas breaker stage to orange-red stage slightly increased and showed higher significant among maturity indices, respectively. Value of TTA was slowly decreased within maturity indices. According to Table 1, deep-red tomato had high sugar/acid ratio (11.02) compare other indices. It is probably the reduction rate of sugar content was increased with the advancement of fruit ripening (Moneruzzaman, et al., 2009) and gave better eating quality. Ascorbic acid content of tomato was affected by maturity. Breaker stage to orange-red stage showed high content of ascorbic acid (range 30.31-31.96 mg/100g) and slightly decreased at deep red stage (28.44 mg/100g) and also during storage, respectively (Table 1). Meanwhile, there were highly significant interaction for chemical changes between maturity indices and storage period.

196

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Colour indexes for lowland tomato No. 32 after harvesting.

197

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Changes in soluble solids content (SSC), total titratable acidity (TTA), sugar/acid ratio, ascorbic acid content (AAC), firmness, fruit colour, respiration rate and ethylene production of lowland tomato No. 32 at different maturity indices in ambient temperature storage. TTA Sugar/ Factor SSC AAC Firmness Fruit colour CO O C H (% citric acid 2 2 2 4 (°Brix) (mg/100g) (N) L* C* ho mL/kg-hr mL/kg-hr µL/kg-hr acid) ratio Maturity indices (M) 1- Mature green 4.74bc 0.66a 7.23d 29.50b 10.40a 60.71a 40.94a 96.89a 27.06b 876.89a 43.26c 2- Breaker 4.50c 0.56b 8.20c 30.31a 7.85b 54.17b 41.20a 77.14b 28.84b 674.06b 87.97b 3-Turning 4.78bc 0.55b 8.78c 31.90a 6.67c 47.65c 36.79b 68.46b 23.64b 842.20a 93.56ab 4- Pink 4.88ab 0.52c 9.85b 30.49a 5.83d 42.11d 35.77b 51.24c 18.75b 690.28b 104.36ab 5- Orange-red 4.92ab 0.49d 9.49b 31.96a 5.53d 40.89d 33.82b 49.60c 28.28b 874.08a 133.79a 6- Deep-red 5.15a 0.47e 11.02a 28.44b 4.33e 40.64d 35.68b 48.97c 38.60a 899.66a 99.77ab F-Test significant * ** ** ** ** ** * ** * * * Storage period (Day) 0 4.11c 0.50c 8.54b 32.08a 8.93a 50.75a 35.08b 79.96a 18.83c 720.75b 72.62b 3 5.44a 0.56a 9.75a 30.10b 6.68b 49.11ab 37.05b 69.40b 28.05b 792.43b 90.55ab 7 4.79b 0.58a 8.46b 31.51a 5.73c 47.58b 36.30b 64.23b 35.69a 915.41a 118.19a 10 4.97b 0.53b 9.63a 27.36c 5.73c 43.35c 41.03a 47.95c . . . F-Test significant ** ** ** ** ** ** * ** ** * * Interaction * ** * ** * * ns ** * ns ns M*D Means separation within columns and main effect by DMRT at p≤0.05. L*= lightness, C*= chroma and h° = hue angle ns,*, ** Non significant or significant or highly significant at p≤0.05, respectively.

198

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Mature green and breaker stages capable to maintain the best quality fruits during storage up to 7-10 days at ambient condition. This will allow the highest percentage of the marketable fruits. The orange- red and deep red stages tomato were the best for fresh consumption however, it had short shelf life when stored at ambient temperature.

Acknowledgments

This work is a part of the research supported by MARDI Development Fund (P-RH403). The author would also like to thank all the postharvest staff at the Fruits and Vegetables Programme, Horticulture Research Centre, MARDI, Serdang.

References

Abou-Aziz, A.B., El-Nataway, S.M., Adel-Wahab, F.K. and Kader, A.A. 1976. The effect of storage temperature on quality and decay percentage of 'Pairi' and 'Taimour' mango fruit. Science Horticulture 5: 65-72. Auito, W.R. and Bramlage, W.J. 1986. Chilling sensitivity of tomato fruits in relation to ripening and senescence. Journal of the American Society for Horticultural Science 111(2): 201-205. Canene-Adams, K., Campbell, J.K., Zaripheh, S., Jeffery, E.H. and Erdman, J.W. 2005. The tomato as a functional food. Journal of Nutrition 135: 1226-1230. Castro, L.R., Vigneault, C., Charles, M.T. and Cortez, L.A.B. 2005. Effect of cooling delay and cold- chain breakage on 'Santa Clara' tomato. Journal of Food, Agricultural and Environment 3: 49- 54. Gnanasekharan, V., Shewfelt, R.L. and Chinnan, M.S. 1992. Detection colour changes in green vegetables. Journal of Food Science 57: 149-154. Hobson, G.E. and Grierson, D. 1993. Tomato. In: Seymour, G.B., Taylor, J.E. and Tucker, G., (Eds.), Biochemistry of Fruit Ripening. Chapman and Hall, London. Pp. 405-442. Moneruzzaman, K.M., Hossain, A.B.M.S., Sani, W., Saifuddin, M. and Alenazi, M. 2009. Effect of harvesting and storage conditions on the post harvest quality of tomato (Lycopersicon esculentum Mill) cv. Roma VF. Australian Journal of Crop Science 3(2): 133-121. Nor Hazlina, M.S., Rozlaily, Z., Sharizan, A., Nur Syafini, G., Rahayu, A., Nuradliza, B., Farahuda, S., Zaulia, O., Sebrina Shahniza, S. and Selmiah, M. 2017. MT3: Varieti tomato baharu tanah rendah. Proceeding of Persidangan Kebangsaan Pemindahan Teknologi, pp. 225-230. Perangkaan Agromakanan, 2015. Kementerian Pertanian dan Industri Asas Tani Malaysia, pp. 45. http://www.moa.gov.my/documents/10157/0e0596cf-203b-474e-ba02-8e018ce68433. Rozlaily, Z., Suhana, O., Nor Hazlina, M.S., Norfadzilah, A.F., Farahzety, A.M., Rahayu, A., Mohamad Abid, A., Zaulia, O., Nur Syafini, G. and Illias, M.K. 2016. Research and development of vegetables towards adaptation to climate change in Malaysia. Book of Abstract of Southeast Asia Vegetable Symposium, Putrajaya, 6-8 September 2016, pp 37. Shaw, D.V., Bringhurst, R.S. and Voth, V. 1987. Genetic variation for quality traits in an advanced- cycle breeding population of strawberries. Journal of the American Society for Horticultural S cience 112(4): 699-702. Shewfelt, R.L., Thai, C.N. and Davis, J.W. 1988. Prediction of changes in colour of tomatoes during ripening at different constant temperatures. Journal of Food Science 53: 1433-1437.

199

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Application of EOnature to Extend Shelf Life of Kuini (Mangifera odorata) Stored at Ambient Temperature

Wan Mahfuzah, W.I.1,*, Hanif, M.A.1, Siti Aishah, H.1, Zulhelmy, A.S.2, Zaulia, O.3, Nor Hanis Aifaa, Y.4, Mohd Shukri, M.A.3 and Razali, M.4 1Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Sintok, 06050 Bukit Kayu Hitam, Kedah, Malaysia. 2Genebank and Seed Centre, Malaysian Agricultural Research and Development Institute (MARDI), Sintok, 06050 Bukit Kayu Hitam, Kedah, Malaysia. 3Genebank and Seed Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 4Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Kuini or kwini is a local name of Mangifera odorata that considered as underutilised fruit in Malaysia. Befitting the scientific names, this fruit is known for it’s intense, earthy aroma with slightly fibrous flesh (Campbell, 2007) and often consume as fresh fruits or semi cooked in traditional cuisine such as sambal. For purpose of upscaling or commercialization of this fruits, postharvest studies need to be conducted to obtain basic data on this fruits. This is crucial as implementing good postharvest handling can improve fruits quality. From previous study conducted to determine optimum harvesting time (Wan Mahfuzah et al., 2018), fruits that harvested at week 11-12 will have a good quality but fruits harvested later than that resulting in more fibrous flesh which is unappealing to the consumer. Thus, this study was planned as continuation to evaluate storage life and also chemical treatments to prolong shelf life of Kuini. Propiconazole is a fungicide that often used to prevent major postharvest diseases on mango such as stem end rot and anthracnose while EOnature is an oil palm based fruit coating develop by MARDI as an alternative to the synthetic fungicide to combat diseases, preserves cosmetic values of fruits and able to delay ripening process (Nor Hanis Aifaa et al., 2015).

Materials and Methods

Samples preparation

Mangifera odorata elite accession plot in Sintok, Kedah was used in this study and only trees from same accession were selected. Fruits were tagged at fruit set stage and harvested after 12 weeks. Fruits were wrapped with paper bag to protect from pest and disease problems and to preserve cosmetic values of fruits skin. Harvested fruits were brought to postharvest laboratory for postharvest handling activities such as trimming, sorting and cleaning with clean water. Samples were dipped for 1 minute in propiconazole 250 ppm (T2) and in EOnature solution (T3). Control samples were only washed with clean tap water (T1). All fruits were air dried before packed into corrugated fibre board box (CFB).

Quality assessment

Quality assessments were done at a 4-day interval starting from the day of harvest (day 0) until day12 to evaluate soluble solid contents (SSC), pH, titratable acidity (TA), ascorbic acid and sugar acid ratio. Total soluble solid was measured by using digital handheld refractometer (ATAGO CO. LTD PAL-α) while pH was taken by using pH meter (HANNA Instrument HI2211). Titratable acidity content was measured by titrating 20 mL extract from sample with 0.1 M 1-1NaOH until reach 8.2 pH while for ascorbic acid, 10 mL extract from 10 g and 100 mL 3% metaphosporic acid were titrated

200

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

with standard dye until extract turn into faint pink colour. Fruits were also observed to note any visible changes such as disease incidence and external quality.

Statistical analysis

Experiment was designed using a completely randomized design (CRD) with three replications. Statistical analysis was performed by using ANOVA and difference of means was determined by the Duncan’s Multiple Range Test (DMRT) at 5% level.

Results and Discussion

Based on chemical analysis shown in Table 1, only ascorbic acid content was not significantly different between treatments. However, the ascorbic acid content at day 0 was significantly different from other removals. This is due to ripening process of kuini where the fruits only started to ripen from day 4. Kuini is a climacteric fruit that can ripen after harvest. Hence other chemical contents were change from day 0 until day 12. The SSC and pH were increased while TTA was decreasing along with the ripening process. Fruits maturity can be judged based on sugar acid ratios (Li et al., 2018) where the unripe fruits will have higher acids but low in soluble solid content. During ripening process, acidity will start to decrease and fruit sugar (SSC) will increase (Anon, 2017). Based on these criteria, fruits that treated with propiconazole 250 ppm ripen more rapidly as compared to EOnature and control where it started to ripen as early as 4 days after harvest. The control fruits could maintain their quality for 12 days. In regards to diseases, 33% of control fruits were infected at day 12 and the flesh had become tenderer compared to other treatments. Fruits coated with EOnature were able to delay the ripening process but caused the lenticels on fruits skin turns into brown colour. This could due to the fruit response to the biotic or abiotic stress signals to release polyphenol oxidase causing discoloration of lenticels however had not affect fruits internal quality (Du Plooy et al., 2006) because the lenticels were blocked by lipid in the formulation that functions to reduce respiration process. Fruit coating are able to reduce water loss and modifying CO2 and O2 concentration in the fruits that cause stress signals to the lenticels (Li et al., 2018). Thus, kuini treated with EOnature can extend the shelf life of fruits compared to control and propiconazole 250ppm.

Table 1: Changes in soluble solid concentration (SSC), pH, total titratable acidity (TTA), ascorbic acid content (AA), and sugar acid ratio of Kuini treated with propiconazole and EOnature at 25°C storage temperature. Sugar acid Treatments SSC (Brix°) pH TTA (g/L) AA (mg/mL) ratio Chemical treatments (CT)

Control 14.727a 3.588ab 16.913b 4.662a 0.871a Propiconazole 250 ppm 15.400a 3.696a 15.864b 4.388a 0.971a EONature 11.536b 3.427b 23.373a 4.710a 0.494b

Storage duration (SD)

0 Days 7.733d 3.317b 25.384a 1.608b 0.305c 4 Days 12.867c 3.323b 20.841b 4.629a 0.618bc 8 Days 15.278b 3.468b 18.672b 5.248a 0.818b 12 Days 17.622a 4.090a 12.192c 5.869a 1.445a Interaction (CT x SD) * * * ns * Each value was the mean of three replicates. ns, *, Non significant, significant at P≤0.05, respectively. Means with the same letter are not significantly different by DMRT (p≤0.05),

201

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Results suggested that EOnature can be used to prolong the shelf life of Kuini up to 12 days compared to control and propiconazole. Propiconazole can maintain the fruit quality only for 8 days in ambience temperature.

References

Anonymous. 2017. Mango Handling and Ripening Protocol, National Mango Board. Campbell, R.J. 2007. The potential of new Mangifera species in Florida. Proceedings of the Florida State Horticultural Society 120, pp. 11-12. Du Plooy, G.W., van Der Merwe, C.F. and Korsten, L. 2006. Lenticel discolouration in mango (Mangifera indica L.) fruit - cytological study of mesophyll cells from affected tissue. Journal of Horticultural Science and Biotechnology 81(5): 869-873. Emmy Hainida, K.I., Khoo, H.E., Abbe Maleyki, M.J., Amin, I., Salma, I., Azrina, A., Halimatul Saadiah, M.N., Norzatol Akmar, M.D. and Ruzaidi Azli, M.M. 2009. Antioxidant capacity and total phenolic content of Malaysian underutilized fruits. Journal of Food Composition and Analysis 22: 388-393. Ibarra-Garza, I.P., Ramos-Parra, P.A., Hernandez-Brenes, C. and Jacoba-Velazq ez, D.A. 2015. Effects of postharvest ripening on the nutraceutical and physicochemical properties of mango (Mangifera indica L. cv. Keitt). Postharvest Biology and Technology 103: 45-54. Nor Hanis Aifaa, Y., Nor Dalila, N.D., Semiah, R. and Md. Radzi, A.M. 2015. Effectiveness of EONature against Colletotrichum gloeosporiodes on ‘Sekaki’ Papaya (in vitro and in vivo). HRC Technical Report, pp. 88-93. Nur Azlin, R., Nurul Izzati, S., Siti Aisyah, A., Pauziah, M., Zaipun, M.Z., Hairiyah, M., Tham, S.L. and Habsah, M. 2015. Effects of Different Packaging on Quality of Chokanan Mango During Storage. HRC Technical Report, pp. 99-105. Wan Mahfuzah, W.I., Hanif, M.A., Siti Aishah, H., Zulhelmy, A.S., Zaulia, O., Mohd Shukri, M.A. and Razali, M. 2018. Postharvest quality of Kuini (Mangifera odorata) in relation to time of harvesting. Proceedings of the National Conference on Agricultural and Food Mechanization 2018, pp. 214-215.

202

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Storage Trials of Falcataria moluccana (Batai) Seeds at Different Temperatures

Sabrina, A.J.* and Mas Dora, T. Sarawak Forestry Corporation, Sarawak Forest Tree Seed Bank, KM 20, Jalan Puncak Borneo, 93250 Kuching, Sarawak, Malaysia. *E-mail: [email protected]

Introduction

Falcataria moluccana or formerly known as Albizia falcataria is a species of fast-growing tree with a massive trunk and an open crown in the legume family, Fabaceae. In natural forests it can reach up to 40 m tall with the first branch at a height of up to 20 m. This tree is considered to be invasive in Hawaii, American Samoa and several other island nations in the Pacific and Indian Oceans. However it is cultivated for timber throughout South Asian and Southeast Asian countries including Malaysia.

Falcataria moluccana has many common names. These include: albizia (Hawaii), Moluccan albizia, sengon (Java), batai (Malaysia), sau and falcata (Wikipedia, 2018). This species, like other fast- growing tree species, is becoming increasingly important for wood industries as supplies for plywood from natural forests decrease. It is one of the tree species preferred for industrial forest plantations because of its very fast growth, its ability to grow on varieties of soils, its favourable silvicultural characteristics and its acceptable quality of wood for the panel and plywood industries. On good sites it can attain a height of 7 m in just over a year. Trees reach a mean height of 25.5 m and a bole diameter of 17 cm after six years, 32.5 m high and 40.5 cm diameter after nine years, 38 m high and 54 cm diameter after 12 years, and 39 m high and 63.5 cm diameter after 15 years (Useful Tropical Plants Database, 2014).

Batai trees start to flower as early as three years after planting. The flowering and fruiting seasons differ according to geographical location. In general, ripe pods appear approximately two months after flowering. The pods start to open when ripe, often when they are still attached to the tree, scattering the seeds on the ground. The seeds can be picked from the tree after they have changed colour from green to straw-coloured or from the ground by shaking the branches. The seeds are sometimes easily collected by cutting down branches bearing ripe brown pods or from felled trees if the fruits are in the right condition.

A healthy 5-8-year-old Batai plantation can produce 12,000 viable seeds per ha. The weight of 1000 seeds is approximately 16-26 g (Soerianegara and Lemmens, 1993). There are approximately 38,000- 44,000 cleaned seeds per kg (Parrotta, 1990; Soerianegara and Lemmens, 1993). Batai seeds can be easily dried to about 8-10% moisture content. Dried seeds can be stored for at least 1.5 years at 4-8°C with no loss of viability. The germination rate may be still high (70-90%) after 18 months of storage (Soerianegara and Lemmens, 1993).

Seed storage is the preservation of seeds under controlled environmental conditions which will prolong the viability of the seeds for long periods. Seldom are seeds harvested and immediately planted without undergoing at least a brief storage period. According to Larry and Miller (1995), the optimum temperature may be defined as the temperature giving the greatest percentage of germination within the shortest time. If the storage environment is not suitable, it will reduce the quality and viability of the seeds. Among the importance of seed storage is to secure the supply of good quality seed for a planting program whenever needed, especially during non-fruiting seasons.

In view of the increasing demand for quality seeds imposed by expanding forestry as well as agroforestry planting programs, there is an imperative need to know the proper seed handling and

203

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

management in order to maintain a good source of seeds for a long period. Therefore, the aim of this research is to assess the germination performance of Batai seeds after being stored at different temperatures which are 4C, 8C, 12C, 16C and room temperature (25-27°C).

Materials and Methods

This experiment was conducted in the Seed Lab of Sarawak Forest Tree Seed Bank, Kuching. Effect of seed viability against different storage temperatures and storage duration were investigated over a period of six years. Seeds for the experiment which originated from East Java were purchased from CV. Berkah Lestari, Indonesia in the year 2012 with initial moisture content 9.58% and seed germination 70.0% upon receipt.

Received seeds were mixed thoroughly and five seed lots were taken out and sealed separately to prevent further moisture content changes. These seed lots were then kept separately at 4°C, 8°C, 12°C, 16°C and 25-27°C which is ambient room temperature as control. Seeds were taken out at a three-month-interval for germination and moisture content tests. For moisture content test, 4 replications of around 2 g of Batai seeds were placed in aluminum foil saucers and weighed using analytical balance. The aluminum foil saucers were then put in an oven for 17±1 hours at 103±2C and reweighed. Moisture content was expressed as percentage of the wet weight basis.

For germination test, 4 replications of 100 seeds were used to assess the viability of seeds. Seeds were soaked in hot water (90°C) for one minute and later soaked in distilled water overnight for 17 hours. The next morning, seeds were rinsed with premix 1 g/100 mL fungicide solution (Benocide 50WP) prior to sowing. Rinsed seeds (100 seeds) were placed on top of three layers of damp filter papers in a Petri dish. The Petri dishes were finally placed into plant growth chamber set at an alternating temperature of 30°C and 20C (12 hours each temperatures) with 45-50% relative humidity and were exposed to 12 hours light and 12 hours darkness. Seeds were checked for germination on the 7th and 14th day after sowing. Germination was defined by emergence of radicle (at least 5 mm protruded) through the testa. The data were –subjected to analysis of variance (ANOVA) and Duncan’s Multiple Range Test (DMRT). Results of the analysis are considered significant if the probability level is equal or less than 5% (p0.05).

Results and Discussion

Results are shown in terms of mean germination percentages in Table 1. Initial germination and moisture content of the seed was 70.0% and 9.58% respectively. First visible seed germination for different treatments were mostly observed on the second day after sowing. The duration for seed germination was 14 days; whereby most treatments reached maximum germination within this period. Some fluctuations in germination percentage is exhibited with time instead of monotonic decreases which might be expected. This is the same case with seed moisture content. There were slight changes on the moisture content of stored seeds compared to initial moisture content which was 9.58%. These fluctuations are possibly due to some variation from month to month in the sampling technique used. No logical explanation relating to seed behavior can be suggested.

From the results, it is apparent that viability of Batai seeds can be retained regardless of the storage temperatures for the first six years of storage, as long as they are being kept in air-tight jars and in total darkness. In other words, storage temperatures and storage duration were found to have not much influence on Batai seed germination. However, there are some decreasing trend monitored on seed germination with every increase of temperatures and time of storage. This is contrary from other seed species like Neolamarckia cadamba (Kelampayan) whereby it rapidly loses its viability within one year after being stored at 16C and room temp (Joe, 2007).

204

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Germination of Batai seeds stored up to six years. Moisture content reading was only available until 36 months due to limited amount of seed. Storage Storage temperature time Year 4C 8C 12C 16C Room temp. (Months) Germination (%), MC (%) 0 70.0, 9.58

3 69.5, 8.84 72.5, 8.70 71.5, 9.34 70.0, 8.95 70.3, 9.64

6 1 73.3, 9.30 74.8, 8.45 71.8, 8.77 76.5, 8.63 72.0, 9.11 9 71.5, 8.93 70.8, 9.02 67.8, 7.87 70.0, 8.64 59.8, 6.91 12 71.0, 9.25 73.8, 8.74 66.8, 8.61 58.8, 8.39 65.0, 10.22

15 72.3, 9.28 80.0, 9.09 70.5, 9.00 72.3, 9.01 59.3, 9.48 18 74.0, 8.99 67.3, 8.95 72.8, 9.25 70.5, 9.12 63.3, 9.32 2 21 73.0, 9.41 74.5, 9.04 74.8, 9.09 69.3, 9.30 64.5, 9.35 24 64.3, 8.99 67.0, 9.00 67.8, 9.08 64.8, 9.28 62.3, 9.25

27 76.3, 9.19 72.3, 9.24 68.8, 9.47 57.5, 9.73 55.3, 9.28 30 60.5, 10.23 68.8, 9.19 74.3, 7.22 58.5, 8.83 61.5, 9.12 3 33 71.5, 9.86 68.3, 8.89 66.3, 9.08 65.8, 8.88 55.5, 9.55 36 69.0, 9.55 69.8, 9.09 64.8, 8.95 59.8, 8.70 49.3, 9.11

39 68.3 72.0 71.5 66.3 55.5 42 66.5 68.5 70.8 67.8 57.0 4 45 72.8 72.5 60.8 60.8 64.3 48 67.8 77.8 67.3 64.0 60.0

51 70.5 67.8 63.8 61.3 56.5 54 65.8 59.0 62.8 59.3 52.0 5 57 68.8 68.0 68.0 65.8 58.5 60 66.0 66.8 66.3 65.8 61.8

63 70.5 66.8 71.0 55.5 58.8 66 63.0 64.0 66.0 61.8 59.5 6 69 67.0 67.0 56.5 53.5 61.3 72 71.0 69.3 62.3 58.0 61.3 Each germination percentage is the mean of four 100-seed test samples while each moisture content percentage is the mean of four wet-weight basis tests.

From Table 1 and 2 it is apparent that after six years of storage, the reduction of seed germination is not much for the first two storage temperatures, i.e. 4C and 8C. For seeds stored at 12C, 16C and room temperature, the reduction of germination is around 8-12% with fluctuations as per mentioned before. For this species, storage temperature seems to be not as crucial as other species like Kelampayan (Sabrina, 2007). They can be stored at any temperatures even up to ambient room temperatures for six years.

205

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Summary of Batai seed germination percentage at the end of each year. Storage temperature Storage 4C 8C 12C 16C Room temp. time (Year) Germination (%) 0 70.0 1 71.0ABa 73.8Aab 66.8ABCa 58.8Ca 65.0BCa 2 64.3Aa 67.0Ab 67.8Aa 64.8Aa 62.3Aa 3 69.0Aa 69.8Aab 64.8Aa 59.8ABa 49.3Bb 4 67.8Ba 77.8Aa 67.3Ba 64.0Ba 60.0Ba 5 66.0Aa 66.8Ab 66.3Aa 65.8Aa 61.8Aa 6 71.0Aa 69.3Aab 62.3Ba 58.0Ba 61.3Ba Means followed by the same capital letters in the row and lowercase in the column did not differ by DMRT at 5% probability.

Some tree species produced flowers and fruits once a year and some do every few years. Vertucci et al. (1996) observed that seed production, both in quality and quantity is not stable from year to year. Factors influencing this might be genetic, climate, pests and diseases, animal, human interference and also forest fire. Therefore, consideration must be given to the processing and appropriate storage of seeds collected.

For certain plantation companies, storage of seeds is crucial if they imported seeds in bulk, 20 to 30 kg per purchase as the importation process might take some time to complete and of course, the importers first have to make sure that they are buying quality seeds from the right source. For certain planters who produced their own seed, seed storage is still crucial as they might not be able to finish planting or selling the seeds within the same year. Maintaining of seed vigour during storage is also important as it influences subsequent nursery performance.

Conclusions

Accepting that these results are based on one experiment with one seedlot, it is tentatively concluded that Batai seed can be stored under a wide range of storage temperatures which is in the range of 4C to room temperature (25-27C) with small impairment of viability for up to six years, provided it is stored under air-tight conditions and in total darkness at moisture content 8-10%. However, to maintain the seeds at its highest viability, it is better if the seeds are stored at lower temperatures, i.e. at 4C-8C. As Batai seed can suffer rapid loss of viability if both MC and temperature are high, it is important that it be placed in air tight storage under the conditions indicated by this work as soon as practicable after collection.

Acknowledgements

The authors would like to thank Mr. Lai Jiew Kok (SFC Timber Training Centre) for his assistance in data sorting as well as the Sarawak Forest Tree Seed Bank’s staff for their kind assistance during the production of this work.

References

Larry, O.C. and Miller, B.M. 1995. Seed Germination. Principles of Seed Science and Technology. Chapman and Hall Ltd., New York. Pp. 59-110. Parrotta, J.A. 1990. Paraserianthes falcataria (L.) Nielsen. Silvics of Forestry Trees of the American Tropics. SO-ITF-SM-31. Forest Service, USDA, Rio Piedras, Puerto Rico.

206

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Sabrina, A.J. 2007. Determination of optimum storage temperature for Neolamarckia cadamba (Kelampayan) seed. Proceedings of Conference on Natural Resources in the Tropics: Development and Commercialization of Tropical Natural Resources 1: 237-241. Soerianegara, I. and Lemmens, R.H.M.J. 1993. Plant Resources of South-East Asia 5(1): Timber trees: Major commercial timbers. Pudoc Scientific Publishers, Wageningen, Netherlands. Useful Tropical Plants Database. 2014 (http://tropical.theferns.info/viewtropical.php?id=Falcataria+moluccana). Vertucii, C.W., Crane, J. and Vane, N.C. 1996. Physiological aspects of Taxus brevifolia. Physiologia Plantarum 98: 1-12. Wikipedia - Falcataria moluccana (https://en.wikipedia.org/wiki/Falcataria_moluccana).

207

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Dynamic Controlled Atmosphere (DCA) Storage Technique Delays Ripening and Decay Incidence in Stored Chokanan Mango

Wan Mohd Reza Ikwan, W.H.*, Tham, S.L., Mohamad Fikkri, A.H., Zaipun, M.Z. and Habsah, M. Horticulture Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Controlled atmosphere (CA) storage technique involves keeping fresh produce especially fruits in atmospheric composition that is different from air composition, typically by reducing oxygen (O2) and increasing carbon dioxide (CO2) (Thompson, 2010). CA storage has been long used to prolong storage life of fruits by lowering their respiration rate, as storage life increase when respiration rate decrease. In conventional static CA (SCA), O2 is maintained at pre-determined safe level throughout storage period, higher than optimum requirement. Need of lowest possible O2 levels tolerated by fruit to maximize the CA benefits has resulted in development of dynamic controlled atmosphere (DCA). In DCA, the O2 level is set at the lowest safe level by determining the low O2 stress point, which can be detected by measuring ethanol production, fruit respiration or chlorophyll fluorescence. The most successful strategy to date is based on sensing of chlorophyll fluorescence changes (Stephens and Tenner, 2005). As the O2 level in the storage decreases over time, a stress point is reached when the chlorophyll fluorescence signal increases. In response, the O2 level can be increased to just above the stress point. Hence, the atmosphere in DCA is changing (dynamic) rather than being static throughout storage as in conventional CA. The present study was carried out to evaluate the effects of chlorophyll fluorescence based-DCA on storage life and quality of mango var. Chokanan (MA224). Chokanan mango has a short storage and shelf life; it only can last for three weeks when stored at 13ºC and only a few days at ambient temperature (Ahmad Tarmizi et al., 1996; Wan Reza et al., 2007;). Longer storage life is needed to allow sufficient time for marketing of the fruit to distant market and to have a prolonged availability even during the off-season.

Materials and Methods

Chokanan mango fruits at mature green stage; 10 weeks after fruit set (Ahmad Tarmizi and Pauziah, 2005) were purchased from a commercial farm in Bidor, Perak and were brought to the Postharvest Laboratory in MARDI, Serdang on the same day. After an overnight precooling, fruits were sorted, washed, air-dried and packed in corrugated fibre board. They were then placed in gas-tight cabinets and subjected to three different atmosphere compositions, namely air (control), SCA and DCA at a temperature of 13ºC for up to 8 weeks. Air and SCA composition were set at 21% O2 + 0.03% CO2 and 2% O2 + 5% CO2 respectively. DCA composition was set at 0.7% O2 + 1.4% CO2 according to the fruit’s fluorescence response to low oxygen stress, implemented by using by HarvestWatch System (Satlantic Inc., Halifax, N.S., Canada). Chlorophyll fluorescence (F-α) was assessed hourly using Fluorescence Interactive Response Monitor (FIRM) sensors throughout the entire storage period on a sample of six fruits for each cabinet. The experiment was laid out in a completely randomized design with three replications. Each replicate consists of 18 fruits. In order to promote uniform ripening, fruits were subjected to ethylene treatment at 200 mg/L upon removal from storage, and subsequently transferred to ambient temperature (25ºC) to simulate commercial shelf life. Physiological and quality evaluations were done every week interval immediately upon fruits removal from storage and when fruits ripen at ambient. Parameters measured were respiration rate, ethylene production rate, total soluble solids (TSS), total titratable acidity (TTA), ascorbic acid, flesh firmness, skin and flesh colour, disease incidence and severity, ethanol, acetaldehyde and ethyl acetate content. The data were

208

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

subjected to one-way analysis of variance using GLM (General Linear Models, SAS Institute Inc., 1994) procedures. Mean separation was done by using Duncan multiple range test at P≤0.05.

Results and Discussion

Chlorophyll fluorescence signal indicating fruits response to low O2 stress as well as subsequent stress release conditions are represented in Figure 1. It is clearly seen that there was a spike in F-α value once the fruit were exposed to O2 below critical value (0.6%). When stress was released by increasing the O2 concentration to 0.7%, F-α value was restored to its previous base level. Therefore, O2 level at 0.7% was used in DCA composition. On the other hand, CO2 level was set 1.4%; twice as much O2 level based on finding from a preliminary experiment which found that a ratio of 1 O2 : 2 CO2 is the best DCA composition for Chokanan mango (Data not shown).

Extremely low O2 level in DCA techniques has resulted in significantly decreased respiration rate upon removal from storage followed by shelf life. Figure 2 shows respiration rate of fruits from each storage treatment measured soon after removal from storage (day 0) and during subsequent ripening at ambient for 4 days (day 1-4). At removal, DCA-stored fruits showed the lowest respiration rate, whereas CA-stored fruits an intermediate and air-stored fruits showed the highest respiration rate, which about two-fold difference between each storage condition. Regardless of storage condition, fruit demonstrated dramatic increase of respiration rate after 1 day of shelf life, suggesting a climacteric rise; as mango is a climacteric fruit characterized by increased respiration and ethylene production during ripening (Sivakumar et al., 2012). Nevertheless, DCA and SCA-stored fruits showed residual inhibitory effect of low O2 atmosphere as they both remained lower than that air- stored fruits during ripening. No significant ethylene burst was observed in fruit irrespective of storage conditions (Table 1). This might be due to the fact that ethylene gas sampling was done only once a day throughout shelf life; and the gas might have been given off at different time for different individual fruits, thus resulting in high deviation among replicates. Nevertheless, it is noteworthy that no ethylene was detected from fruits removed from DCA storage until 3 days of shelf life, suggesting that ethylene production was suppressed by extreme low O2 in DCA.

Lowering O2 below its threshold point could induce anaerobic respiration to maintain the fruit’s energy supply (Kader, 1986; Weichmann, 1987), prompting an increase in CO2 production and accumulation of ethanol and acateldehyde; eventually resulting in off-flavours and tissue breakdown (Kubo et al., 1996; Golias et al., 2008). The result showed that there was a considerable high accumulation of acetaldehyde and ethanol production in the flesh of DCA-stored fruit (Table 2A). Whether this accumulation was caused by anaerobic respiration could not be derived at this time, but it was more likely a transient accumulation after fruits were kept in the gas-tight cabinet for several weeks. These products decline to the level similar to that of air-stored fruit when fruit ripened at ambient (Table 2B). In addition, CO2 level remained at very minimal level in DCA throughout storage period, and no tissue breakdown and off-flavours were detected, thus ruling out aerobic respiration was shifted to anaerobic respiration in DCA-stored fruits.

In line with respiratory activity, ripening process was most delayed in DCA-stored fruits followed by SCA- and air-stored fruits. As described by Kader, (1996) low O2 resulted in inhibition of expression of senescence related genes; hence delay loss of chlorophyll, indicated by higher hueº; slowed-down activity of cell wall degrading enzymes that caused fruit softening, as indicated by high firmness level; slowed-down starch conversion to sugar as indicated by higher TSS content; reduced loss of acidity, indicated by higher TTA; as well as enhanced retention of ascorbic acid. All aforementioned data are shown in Table 2A. Of the parameters, all storage condition did not differ much in TSS and ascorbic acid content. Despite ripening suppression, DCA- and SCA-stored fruits were able to undergo the compositional changes upon transfer to ambient air, which were previously suppressed during storage. Nevertheless, the changes took place at slower pace with a smaller magnitude than that of air-stored fruits (Table 2B). It is noteworthy that, increase of TSS in DCA-stored fruits, was

209

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

not concomitant with a decrease in TTA, resulting in lower TSS:TTA ratio which generally reflects sugar to acid ratio, thus suggesting that fruits were less sweet even though they contain high TSS (Khaliq et al., 2016). TSS is correlated to degradation of cell walls and hydrolysis of starch to sucrose, whereas TTA is associated with the respiration process which using organic acid as substrate and may contribute to decline in fruit acidity (Hossain et al., 2014). Constant low respiration rate of DCA- stored fruits during storage which persist even after ripened might explain high retention of acidity in the fruit. Apart from low O2, delayed ripening could be a result of high accumulation of acetaldehyde in DCA-stored fruit. According to Beaulieu et al. (1997), acetaldehyde which is a result of conversion of ethanol, could be involved in fruit ripening delay.

DCA-stored fruits had significantly lower incidence and severity of anthracnose disease; whereby slight symptom was first appeared on 7 weeks of storage (Table 2A) and only become severe on week 8. On the other hand, severe anthracnose symptom was observed in SCA- and DCA-stored fruits on week 4 and week 6, respectively. Disease severity coupled with senescence render air-stored fruits only can be kept up to 3 weeks, whereas SCA- and DCA-stored fruits can be kept up to 5 and 7 weeks, respectively. This result was anticipated as pathogen respires and so does fruit, thus lowering O2 suppresses pathogenic growth in the host (Makino and Hirata, 1997). In addition, lower incidence of anthracnose in both CA-stored fruit may be attributed to their slower ripening process; considering the fact that anthracnose is a latent infection, which is initially dormant until it is triggered by dramatic physiological changes such as ripening which induce its reactivation of infection and eventually appearance of symptoms (Coates and Johnson, 1997).

100

2 60

20 CO kg/hrmg 0 0 1 3 4 Days at shelf life Air SCA DCA

Figure 1: Chlorophyll fluorescence signal Figure 2: Respiration rate (mL kg/hr CO2) of (Fα) increased (in circle) Chokanan mango after 3 weeks of indicating that the fruit is under storage and subsequent ripening at low O2 stress. ambient temperature. Bars represent standard error.

Table 1: Ethylene production rate (µL kg/hr) of Chokanan mango after 3 weeks of storage and subsequent ripening at ambient temperature. Means followed by letters within respective storage period are significantly different (p<0.05). Storage period1

Storage condition 3 weeks + 0 day 3 weeks + 1 day 3 weeks + 3 days 3 weeks + 4 days Ethylene production rate (µL kg/hr) Air 0.24a 0.56a 0.91a 0.91a SCA 1.01a 0.00a 0.77a 0.58a DCA 0.00a 0.00a 1.74a 1.68a 1Storage period represents number of weeks after storage followed by number of days at shelf life.

210

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Chemical changes (total soluble solids (TSS), total titratable acidity (TTA), TSS:TTA, ascorbic acid, ethanol and aldehyde content); colour changes (skin and flesh hue); firmness and disease severity of Chokanan mango fruit upon removal from storage (A) and after ripen at ambient (B). (A) (B) Storage Storage period period Storage Week Week Week Week Storage Week Week Week Week condition 0 3 5 7 condition 0 3 5 7 Total soluble solid – TSS (Brixº) Total soluble solid – TSS (Brixº) Air 9.16a 13.37a - - Air 17.97a 14.23a - - SCA 9.16a 14.20a 12.3a - SCA 17.97a 13.43a 12.53a - DCA 9.16a 12.63a 13.4a 16.1 DCA 17.97a 14.23a 12.53a 14.9 Total titratable acidity – TTA (%) Total titratable acidity – TTA (%) Air 1.02a 0.48b - - Air 0.5a 0.25b - - SCA 1.02a 0.68b 0.30b SCA 0.5a 0.30ba 0.22b - DCA 1.02a 0.92a 0.77a 0.51 DCA 0.5a 0.35a 0.37a 0.41 TSS : TTA ratio TSS : TTA ratio Air 9.08a 28.13a - - Air 88.33a 57.52a - - SCA 9.08a 21.33ba 41.50a - SCA 88.33a 45.16b 66.24a - DCA 9.08a 13.81b 18.11b 32.6 DCA 88.33a 38.64b 33.63b 36.42 Ascorbic acid (mg/100g fresh weight) Ascorbic acid (mg/100g fresh weight) Air 37.02a 28.66a - - Air 12.38a 10.16ba - - SCA 37.02a 30.07a 25.4a - SCA 12.38a 6.89b 8.07b - DCA 37.02a 29.25a 27.29a 28.11 DCA 12.38a 12.34a 10.97a 9.19 Ethanol (mg/L) Ethanol (mg/L) Air 1.03a 28.6b - - Air 1.43a 81.09a - - SCA 1.03a 93.6a 83.5a - SCA 1.43a 71.86a 93.21a - DCA 1.03a 235.5a 112.9a 137.6 DCA 1.43a 95.87a 90.62a 86.69 Acetaldehyde (mg/L) Acetaldehyde (mg/L) Air 3.07a 1.92b - - Air 0.95a 1.37a - - SCA 3.07a 1.97b 1.07a - SCA 0.95a 1.61a 0.74a - DCA 3.07a 5.63a 3.79a 3.69 DCA 0.95a 1.37a 0.55a 0.78 Skin colour (Hueº)1 Skin colour (Hueº)1 Air 116.07a 94.28c - - Air 81.5a 89.51a - - SCA 116.07a 109.87b 92.69b - SCA 81.5a 89.61a 86.42b - DCA 116.07a 115.58a 111.86a 105.85 DCA 81.5a 92.26a 86.85b 85.55 Flesh colour (Hueº)1 Flesh colour (Hueº)1 Air 97.81a 92.97b - - Air 85.5a 92.22a - - SCA 97.81a 95.83a 93.38b - SCA 85.5a 92.66a 91.64a - DCA 97.81a 97.35a 96.57a 95.89 DCA 85.5a 92.54a 93.04a 93.32 Firmness (N) Firmness (N) Air 100.7a 6.09b - - Air 9.46a 3.96b - - SCA 100.7a 53.29a 28.11b - SCA 9.46a 5.81ba 5.23b - DCA 100.7a 58.58a 40.27a 21.72 DCA 9.46a 6.32a 6.51a 5.16 Disease severity score2 Disease severity score2 Air 1.0a 1.08a - - Air 1.0a 2.08a - - SCA 1.0a 1.00b 1.8a - SCA 1.0a 1.50b 2.23a - DCA2 1.0a 1.00b 1.3b 1.3 DCA2 1.0a 1.19b 1.27b 1.97 1Skin and Flesh Hueº: Generally higher hueº indicates more green. 2Disease severity score: 1=No symptom; 2=Slight; 3=Moderate; 4=Severe. Means followed by different letters within respective storage period are significantly different (p <0.05) by DMRT.

211

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusions

Chokanan mango showed positive response to storage under DCA, whereby DCA-stored fruit can be kept up to 7 weeks, compared to only 5 and 3 weeks for SCA- and air-stored fruit, respectively. This was brought about by significant reduction of respiration rate, slow ripening process and delayed disease incidence during storage and persist even after transfer to ambient air. However, slow metabolic process resulted in a residual inhibitory effect; whereby TTS increase was not coupled with concomitant decrease in TTA, resulting in relatively high acidity retention in DCA-stored fruit. Fine- tuning is needed to optimize DCA implementation on Chokanan mango to overcome such problem so that extending the storage life would not be at the expense of eating quality.

Acknowledgements

We would like to acknowledge the Ministry of Agriculture and Agro-based Industry Malaysia for funding through MARDI Development Fund.

References

Ahmad Tarmizi, S. and Pauziah, M. 2005. Panduan Kematangan dan Penuaian Buah-buahan. Penerbit MARDI (In Malay). Ahmad Tarmizi, S., Lam, P.F. and Mohamed, M.S. 1996. Pemetikan hasil dan pengendalian lepas tuai. In: Panduan penanaman mangga (Tengku Ab. Malik, T.M., Ahmad Tarmizi, S., Zainal Abidin, M. and Teng, C.S., edition), pp. 56-63. Serdang: MARDI (In Malay). Beaulieu, J.C., Peiser, G. and Saltveit, M.E. 1997. Acetaldehyde is a causal agent responsible for ethanol-induced ripening inhibition in tomato fruit. Plant Physiology 113(2): 431-439. doi:10.1104/pp.113.2.431. Coates, L.M. and Johnson, G.I. 1997. Postharvest diseases of fruits and vegetables. Pp. 533-547. In: Brown, J.F. and Ogle, H.K. (Eds.), Plant Pathogens and Plant Diseases. Australasian Plant Pathology Society. Goliáš, J., Němcová, A., Čaněk, A. and Kolenčíková, D. 2008. Storage of sweet cherries in low oxygen and high carbon dioxide atmospheres. Horticultural Science 34(1): 26-34. doi:10.17221/1843-hortsci. Hossain, M.A., Rana, M.M., Kimura, Y. and Roslan, H.A. 2014. Changes in biochemical characteristics and activities of ripening associated enzymes in mango fruit during the storage at different temperatures. BioMed Research International, 2014, 1-11. doi:10.1155/2014/232969. Kader, A.A. 1986. Biochemical and physiological basis for effects of controlled and modified atmospheres on fruits and vegetables. Food Technology 40: 99-104. Khaliq, G., Mohamed, M.T.M., Ding, P., Ghazali, H.M. and Ali, A. 2016. Storage behaviour and quality responses of mango (Mangifera indica L.) fruit treated with chitosan and gum arabic coatings during cold storage conditions. International Food Research Journal 23(Suppl): S141-S148 (December 2016). Kubo, Y., Inaba, A. and Nakamura, R. 1996. Extinction point and critical oxygen concentration in various fruits and vegetables. Engei Gakkai Zasshi, 65(2): 397-402. doi:10.2503/jjshs.65.397. Makino, Y. and Hirata, T. 1997. Modified atmosphere packaging of fresh produce with a biobased laminate of chitosan-cellulose and polycaprolactone. Postharvest Biology and Technology 8: 179-190. Sivakumar, D., Deventer, F.V., Terry, L.A., Polanta, G.A. and Korsten, L. 2012. Combination of 1 methylcyclopropene treatment and controlled atmosphere storage retains overall fruit quality and bioactive compounds in mango. Journal of the Science of Food and Agriculture 92: 821- 830. Stephens, B.E. and Tanner, D.J. 2005. The Harvest Watch System - Measuring Fruit´s Healthy Glow. Acta Horticulturae 687: 363-364., doi:10.17660/actahortic.2005.687.49.

212

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Thompson, A.K. 2010. Controlled atmosphere storage of fruits and vegetables. Wallingford, Oxfordshire, UK: CABI. Wan Reza, W.H, Ahmad Tarmizi, S. and Tham, S.L. 2007. Storage of Chokanan mango at different temperatures. HRC Technical Report MARDI. Malaysian Agricultural Research and Development Institute (MARDI). Weichmann, J. 1987. Low oxygen effects. p. 231-237. In: Weichmann, J. (Ed.), Postharvest Physiology of Vegetables. Mercel Dekker, New York.

213

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 4

Pest and Disease Management

214

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Screening for Antifungal Activity of Allamanda cathartica Stem Crude Extracts Against Pyricularia oryzae, Causal Agent of Rice Blast Disease

Khairun Nur, A.1, Neni Kartini, C.M.R.2, Farah Farhanah, H.3,*, Hamimah, M.1 and Nor Yuziah, M.Y.4 1Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA Shah Alam, 40450 Selangor, Malaysia. 2Faculty of Plantation and Agrotechnology, Universiti Teknologi MARA Pahang, 26400 Bandar Tun Abdul Razak, Jengka, Pahang, Malaysia. 3Genebank and Seed Centre, Malaysian Agricultural Research and Development Institute, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 4Faculty of Applied Science, Universiti Teknologi MARA Pahang, 26400 Bandar Tun Abdul Razak, Jengka, Pahang, Malaysia. *E-mail: [email protected]

Introduction

One of the major diseases caused by the fungi in rice plantation in Malaysia is rice blast. Rice blast is caused by ascomycete fungus, Magnaporthe grisea Barr (anamorph Pyricularia grisea (P. oryzae) Sacc., synonyms to Pyricularia oryzae C a v.), which is the most destructive and aggressive fungus under favorable condition in rice field (Couch and Kohn, 2002). Rice blast disease is capable of destroying rice crops severely due to P. oryzae. Rice blast pathogen can attack all plant growth stages from seedlings, vegetative stage or even stage of harvest (productive stage). Besides that, this pathogen can also affect all parts of paddy plant including parts of panicle, collar, neck, leaf, node and leaf sheath. Neck blast gives the most contribution in yield losses of rice production and the most serious phase of the blast disease that cause unfilled grain (Khan et al., 2014). According to Kihoro et al. (2013), P. oryzae attacks the rice plants and will reduce the quality of the rice and there are many other cases that resulting in 100% of the plants destroyed. Despite this, a bulk of the research on blast has been focusing on reducing the severity of rice blast disease.

Rice blast disease is commonly controlled by chemical fungicides, which are applied as foliage sprays. It gives effects in a short time and farmers tend to use chemical fungicides in a large dosage as it kills the pathogen. On the other hand, the regular use of fungicide can possibly pose a risk to the environment particularly if residue persists in the soils and enter the rivers (Kibria et al., 2010). Overuse of fungicide can cause the pathogen becoming more resistance in the long run (Deising et al., 2008). It is also hazardous to human, animals and environment. However, due to a growing concern about the harmful effects of the chemical fungicides on human health and environment, efforts have been made to develop environmentally friendly strategies to control pathogen and pest (Paul and Sharma, 2002). Besides micro biocontrol agents, plant extracts have also been found effective against various types of pathogen.

Allamanda cathartica or known as golden trumpet is a type of shrubs and evergreen trees from the Apocynaceae family that grow well in Malaysia. Some chemical contents of A. cathartica are tannins, flavonoids, carbohydrates, proteins, phenols, steroids and glycosides, which are rich in microbial activity, anti-inflammatory and other activities. Crude extracts of A. cathartica have also been found to be effective against a range of fungal pathogens. This may be due to the presence of bioactive compounds that could break the hyphal and spores that were agglutinated, while some of them were ruptured due to lysis. Hence, the present study was carried out to evaluate the potential use of A. cathartica stem extracts on P. oryzae. The information generated from this research could be beneficial for further studies on the specific compounds that could lead to the inhibitory of P. oryzae.

215

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Isolation of of P. oryzae

Pyricularia oryzae was isolated from the infected paddy plant. The lesions were cut into small pieces (about 2 mm) and the surface was sterilized in 10% Clorox. It was then rinsed twice with distilled water and blotted dry. The samples were placed on the potato dextrose agar (PDA) and incubated for 12 hours at room temperature. Fungal pathogen was sub-cultured and maintained in PDA. The fungal colonies growing on the PDA plates were morphologically identified under a light microscope at 40× magnification.

Plant sample preparation

Allamanda cathartica plants were collected from Jengka, Pahang, Malaysia. About 5 kg of fresh weight of stems were collected and were air-dried at room temperature (20 to 26°C with an average of 23°C) for a week. The stems were then ground using an electric grinder into a powder form and kept in an air tight container until further use.

Plant extracts preparation

A 200 g ground stem tissues of A. cathartica were extracted using sequential extraction by solvents with the increasing polarity; hexane, chloroform and methanol. The samples were soaked by increasing the polarity. The samples were first soaked in hexane for 48 hours, and then were filtered to obtain hexane filtrates. The hexane filtrates were dried using a rotary evaporator. The residues were left to dry and were soaked again using chloroform and methanol solvent. The same procedures were repeated to gain the chloroform and methanol crude extracts.

Preparation of treatment

Five concentrations (10000, 7500, 5000, 2500 and 1000 ppm) of stem crude extracts were prepared. Hexane and chloroform crude extracts were dissolved in 5 mL of methanol: dimethyl sulpahate (DMSO) (4:6) while methanol crude extracts were dissolved in 100% methanol, then sterilized through a 0.45 µm sterile filter (Sartorius® Syringe Filter). Methanol: dimethyl sulpahate (DMSO) (4:6) solvent was used as a negative control for hexane and chloroform crude extracts while methanol (100%) was used for methanol crude extracts. Mancozeb fungicides served as the positive control treatment.

Antifungal activity screening of A. cathartica stems extract against rice blast pathogen

The antifungal activities of A. cathartica stem extract were tested by using well diffusion method (Shinwari et al., 2009). Two holes of 5 mm were made at 2.5 cm from fungal plug in PDA plate by using sterile core borer. About 10 µL of the plant extract was pipetted into each hole. The plates were then incubated at room temperature for seven days with 10 replicates for each treatment. Fungitoxicity was recorded in terms of percentage colony inhibition and calculated according to the following formula:

PIRG = Rc - Rt × 100% Rc

Where, PIRG : percentages of radial growth Rt : radial growth of the fungal pathogen in the treatment Rc : radial growth of the fungal pathogen in the control

216

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Preliminary phytochemical tests

Phytochemical analyses of A. cathartica stem extracts were conducted according to the methods by Pavithra et al. (2009) with slight modification. The analysis was conducted to screen the presence of active ingredients in the stem extract.

Test for alkaloids

One percent of hydrochloric acid was added in 1 mL of methanol extracts of A. cathartica on a steam bath. The mixtures were filtered, and the filtrate was treated with six drops of Mayer’s reagent. The formation of cream white precipitate showed the presence of alkaloids.

Test for tannins

Positive test for tannins was represented by the appearance of precipitate. This precipitate was formed by the addition a few drops of 10% lead acetate into the methanol extract.

Test for saponin

One mL of methanol extract was shaken with 9 mL of distilled water. The appearance of stable froth indicated the presence of saponin.

Test for steroids

Two mL of methanol extract was mixed with chloroform, a few drops of acetic anhydride and concentrated sulfuric acid along the side of test tube. A reddish-brown coloration of the interface was formed to show the presence of triterpenoids.

Test for cardiac glycosides

A few drops of acetic acid, ferric chloride and three to four drops of concentrated sulfuric acid were added into 1 mL methanol extracts. A blue-green color was formed, which indicated the presence of glycosides.

Test for flavonoids

Two mL of methanol extract was dissolved with concentrated hydrochloric acid and magnesium ribbon. The appearance of pink-red color indicated the presence of flavonoids.

Statistical analysis

The treatments were arranged in a completely randomized design (CRD) with ten replications with types of extracts and different concentrations of stem crude extracts of A. cathartica as factors. All the data were subjected to analysis of variance (ANOVA) where significant (P<0.01) differences between means were determined by Tukey’s Standardized Range Test. The Minitab 16 software was used to perform all analyses.

Results and Discussion

Antifungal activity of A. cathartica against P. oryzae

Hexane, chloroform and methanol crude extracts of A. cathartica were screened via in vitro for their antifungal activity against P. oryzae. Results showed that the stem crude extracts of A. cathartica

217

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

significantly (P<0.05) inhibited the growth of P. oryzae after seven days of incubation. Among the crude extracts evaluated, chloroform stem crude extracts showed the highest percentage of inhibition followed by methanol and hexane. Antifungal activity of A. cathartica against P. oryzae increased as the concentration of extract increased from 1000 to 10000 ppm. Hexane crude extracts of A. cathartica showed the lowest antifungal activity on growth of P. oryzae as compared to chloroform and methanol crude extracts. The smallest radial growth was observed on fungus treated with 10000 ppm chloroform and methanol crude extracts except for hexane crude extracts at 700 ppm (Table 1). Figure 1 showed that hexane extracts inhibited the radial growth of P. oryzae with 3.12 cm (22% inhibition), chloroform with 1.60 cm (60% inhibition) and methanol with 1.70 cm (57.50% inhibition). However, chloroform stem crude extracts gave the strongest activity compared to other crude extracts, thus, proved that intermediate polar compounds from stem of A. cathartica exhibited the greatest inhibition on radial growth of P. oryzae. Result found that chloroform stem crude extracts at concentration of 10000 ppm gave the highest antifungal activity (60%) followed by the concentration of 7500 ppm, which gave 59% of inhibition, 5000 ppm gave 52.75% inhibition, 2500 ppm gave 38% inhibition and 1000 ppm gave 28.25% inhibition. Islam et al. (2010) stated that the crude extracts of A. cathartica has mild to moderate antimicrobial activity where chloroform crude extract showed a significant antimicrobial activity (10-13 mm zone of inhibition) against Shigella dysenteriae.

Chloroform crude extracts of A. cathartica was proven to contain glycosides, coumarins, phytosterols, toxic iridoid lactone, allamandin and carbohydrates that may contribute to the antifungal activities (Joseline et al., 2012; Prabhadevi et al., 2012). The antifungal activity of plant extracts may not be due to the action of a single active compound, but the synergistic effect of several compounds. Methanol crude extracts also showed good inhibition against P. oryzae as shown in table 1 whereby at 10000 ppm, the methanol crude extracts gave the highest percentage inhibition as compared to other concentrations with 57.5% followed by 7500 ppm, which gave 57.25 % inhibition, 5000 ppm gave 48.75% inhibition, 2500 ppm gave 44.5% inhibition and 1000 ppm gave 44.25 % inhibition (Table 1). According to the Britto et al. (2011), the methanol extracts of A. cathartica showed active inhibitions against Salmonella paratyphi, Salmonella typhi, Klebsiella vulgaris, Streptococcus aureus, Shigella dysenteriae, Escherichia and Shigella boydii. Previous study showed that chloroform and methanol of Allamanda species gave the strongest antifungal activity against Colletotrichum gloeosporioides where more than 80% colony growth inhibition was observed (Farah et al., 2013). Based on Figure 2, A. cathartica stem crude extracts significantly suppressed the mycelial growth and the production of hyphae and sporangia of P. oryzae were stunted. The mycelial growth of P. oryzae was significantly decreased as concentrations increased.

Table 1: The percentage of inhibition of A. cathartica stem extracts against P. oryzae. Concentration Hexane Chloroform Methanol (ppm) Percentage inhibition (%) Percentage inhibition (%) Percentage inhibition (%) 1000 14.75b 28.25d 44.25b 2500 20.00a 38.00c 22.50c 5000 13.75b 52.75b 48.75b 7500 22.00a 59.00a 57.25a 10000 19.00a 60.00a 57.50a zMeans within columns followed by the same letters are not significantly different (Tukey’s Test; P<0.05).

218

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

4.5 a 4 b 4 (cm) (cm) 3.24 3.5 c 3 2.36 2.5 d

P.oryzae d 2 1.6 1.7 1.5 1 0.5 0

Radial growth of growth Radial hexane chloroform methanol control + control - Type of solvents

Figure 1: Effects of different solvent extractions (hexane, chloroform, methanol, negative control and positive extract) of Allamanda cathartica stem on radial growth of P. oryzae.

aA bB

dD Cc d

Figure 2: Microscopic observation of antifungal activity of A. cathartica crude extracts against rice

blast disease under 40x magnifications (a) Healthy hyphae (b) Healthy sporangia (c) Stunted hyphae (d) Stunted sporangia.

Phytochemical tests

The result from the antifungal activities of stem crude extracts of A. cathartica showed the presence of bioactive constituents. Methanol extracts were used to determine the active compound found in A. cathartica since methanol is a polar solvent and able to attract most active compounds. The results of the phytochemical test in the stem extract of A. cathartica are summarized in Table 2.

219

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Phytochemical screening test of A. cathartica stem extracts. Compound Methanol stem extracts Alkaloids - Tannins + Saponin + Steroids and triterpenoids - Cardiac glycosides + Flavonoids - Fatty acid + Key: - Absent + Present

Various bioactive constituents, which can be found in plants have the potentials for the development as a medical agent (Noorshilawati et al., 2015). The phytochemical analysis of stem methanol extract demonstrated the presence of phytochemical constituents such as tannins, saponin, cardiac glycosides and fatty acid. The phytochemical analysis was aligned with the reports of other studies (Essiett and Udo, 2015).

Conclusions

Allamanda cathartica stem crude extracts possessed a potent antifungal activity to control the growth of P. oryzae that stunted the growth of hyphae and spore. The phytochemical analysis revealed the presence of tannins, saponin, cardiac glycosides and fatty acid that contributed to antifungal activity.

References

Britto, J.D. 2011. Phytochemical and antibacterial creening of even pocynaceae pecies against human pathogens. International Journal of Pharmacy and Pharmaceutical Sciences 3(5): 278-281. Couch, B.C. and Kohn, L.M. 2002. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 94(4): 683-693. Deising, H.B., Reimann, S. and Pascholati, S.F. 2008. Mechanisms and significance of fungicide resistance. Brazilian Journal of Microbiology 39(2):286-95. Essiett, A.U. and Udo, E. 2015. Comparative phytochemical screening and nutritional potentials of the stems, leaves and flowers of Allamanda Cathartica (Apocynaceae). International Journal of Science and Technology 4: 248-253. Farah, F.H., Kamaruzaman, S., Dzolkhifli, O. and Mawardi, R. 2013. Chemical composition and screening for antifungal activity of Allamanda spp. (Apocynaceae) crude extracts against Colletotrichum gloeosporioides, causal agent of anthracnose in papaya. Australian Journal of Basic and Applied Sciences 7(1): 88-96. Islam, M.R., Ahamed, R., Rahman, M.O., Akbar, M.A., Al-Amin, M., Alam, K.D. and Lyzu, F. 2010. In vitro antimicrobial activities of four medicinally important plants in Bangladesh. European Journal of Scientific Research 39(2): 199-206. Joselin, J., Brintha, T.S.S., Florence, A.R. and Jeeva, S. 2012. Screening of select ornamental flowers of the family Apocynaceae for phytochemical constituents. Asian Pacific Journal of Tropical Disease 2: 260-264. Khan, M.A.I., Bhuiyan, M.R., Hossain, M.S., Sen, P.P., Ara, A., Siddique, M.A. and Ali, M.A. 2014. Neck blast disease influences grain yield and quality traits of aromatic rice. Coptes Rendus Biologies 337(11): 635-641. Kibria, G., Yousuf Haroon, A.K., Nugegoda, D. and Rose, G. 2010. Climate change and chemicals: environmental and biological aspects. pp. 460 pp. ref.7. Kihoro, J., Bosco, N.J., Murage, H., Ateka, E. and Makihara, D. 2013. Investigating the impact of rice blast disease on the livelihood of the local farmers in greater Mwea region of Kenya. SpringerPlus 2(1): 308.

220

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Noorshilawati, A.A., Umi Nadhirah, H. and Nur Suraya, A. 2015. Phytochemical screening and in vitro antibacterial activity of Elaeis guineensis leaves extracts against human pathogenic bacteria. Malaysian Journal of Analytical Sciences 19(4): 775-780. Paul, P.K. and Sharma, P.D. 2002. Azadirachta indica leaf extract induces resistance in barley against leaf stripe disease. Physiological and Molecular Plant Pathology 61(1): 3-13. Pavithra P.S., Sreevidya, N. and Verma, R.S. 2009. Antibacterial and antioxidant activity of methanol extracts of Evolvulus Nummularius. Indian Journal of Pharmacology 41(5): 233-236. Prabhadevi, V., Sahaya, S.S., Johnson, M., Venkatramani, B. and Janakiraman, N. 2012. Phytochemical studies on Allamanda cathartica L. using GC-MS. Asian Pacific Journal of Tropical Biomedicine 2(2): 550-554. Shinwari, Z.K., Khan, I., Naz, S. and Hussain, A. 2009. Assessment of antibacterial activity of three plants used in Pakistan to cure respiratory diseases. African Journal of Biotechnology 8(24): 7082-7086.

221

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Biopesticides Approach Against Leaf Roller Caterpillar, Pyrausta panopealis on Misai Kucing, Orthosiphon stamineus in Malaysia

Wan Khairul Anuar, W.A.1,*, Ahmad Azinuddin, A.R.1, Nurul Najwa, Z.1, Badrol Hisham, I.2, Mohd Nazri, B.3, Nurin Izzati, M.Z.1, Rosliza, J.1, Siti Noor Aishikin, A.H.1, Masnira, M.Y.1, Patahayah, M.4, Aminah, M.1, Mohd Salleh, S.4 and Nur Saliha, A.Z.3 1Malaysian Agricultural Research and Development Institute, 43400 Serdang, Selangor, Malaysia. 2Malaysian Agricultural Research and Development Institute, 86009 Kluang, Johor, Malaysia. 3Malaysian Agricultural Research and Development Institute, 16310 Bachok, Kelantan, Malaysia. 4Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Orthosiphon stamineus Bentham, with a common name of cat’s whiskers or misai kucing is a shrubby perennial belonging to the family Lamiaceae. The herbs have been notably free of serious insect problems until recently. The herbs planted in Subang Jaya, Selangor, were heavily attacked by lace bug, Cochlochila bullita (Stal) (Ahmad Saip and Tan, 2010). Pyrausta panopealis and Pycnarmon cribata (Lepidoptera: Crambidae) also become one of the main pests for this herb that attacked the plants in several locations such as Serdang, Bachok, Raub and Pontian. Pyrausta panopealis (Lepidoptera: Crambidae) is distributed in South-East Asia including China, Japan, India and South America (Hyung Keun Oh et al., 2010). They are holometabolous, which undergo complete metamorphosis (completed all four stages: eggs, larvae, pupae and adult). As the leaves are damaged, the crop dies and thus affects herbal production. Young leaves become the shelter and food source of the Crambidae larvae. Uncontrollable distribution of this species affects the production of O. stamineus. The objective of the study was to determine the effectiveness of different types of biopesticides against Leaf Roller Caterpillar, P. panopealis.

Materials and Methods

Plant material and extracts

Plant extracts were prepared using water extraction method at the Product Development Laboratory, Crops and Soils Sciences Research Centre, MARDI, Serdang. One type of laboratory-reared insect pests, viz, the leaf roller caterpillars, P. panopealis that was collected from misai kucing plants in the field were used in the insecticidal tests. All the various stages of the test insects were reared in the laboratory at MARDI, Serdang, under ambient conditions. Two botanical oil-based biopesticides, neem oil ((B’Green® (a.i. Azadirachta indica) and neem oil (1.2% a.i. Neemix® 4.5 - Azadirachtin)) and four natural biopesticides (Garlic extract, tobacco leaves extract, citronella leaves and neem leaves extract) were evaluated against the four instar stages of the insect pests based on the leaf-dip and residue bioassay methods in the laboratory with different concentrations (0, 0.5, 1.0 and 1.5%). Ten insects pests of P. panopealis (4 instar larvae) were placed in a petri dish and each treatment consisted of four replications. The treatments were examined for larva mortality by prodding for any movement using a fine brush. Mortality was recorded at 0 hour before treatment and at 24, 48 and 72 h after treatment. In the field, ten insects of P. panopealis species (4 instar stages larvae) were selected and labeled on misai kucing plants with the symptom and incidence of pests and each treatment had four replications was sprayed. Data analyses were done using two-way ANOVA and Tukey’s test. Both of these data analyses were obtained through the MINITAB Statistical Version, Version 16. Mean of mortality rate were being transformed √ x square root of before analyzing the data.

222

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

Direct dip method as well as their interaction

The results of the two-way ANOVA showed that all two independent variables or factors (treatment and concentration) showed some significant differences (P<0.05) on the number of larvae mortality of P. panopealis on O. Stamineus against different biopesticides using the direct dip method but not significantly different on their interaction (P>0.05) (Table 1). Generally, the mortality of P. panopealis (leaf roller caterpillar) increased as the concentration of biopesticide increased. The mean mortality was higher when the pests were treated with commercial biopesticides (Neemix® 4.5 and B’Green® neem oil – a.i: Azadirachtin) than garlic extract, neem leaves extract, citronella extract and tobacco leaves extract at all concentrations of biopesticide (Figure 1). At concentrations of 0.5 to 1.0 (% of active ingredient), the effect of Neemix® was stronger and mortality rate of P. panopealis was higher compared to B’Green® neem oil (Figure 1). However, both biopesticides killed all pests which recorded 100% of mortality when treated at 1.0 (% of active ingredient) of concentration. For plant- based biopesticide, garlic + sticker was more effective in killing P. panopealis by recording a significant higher percentage of mortality (P<0.05) of pests at all concentrations compared to other leaf extract. However, in contrast to commercial bio pesticides, all plant based-bio pesticides were unable to record 100% mortality at concentrations of 1.5 (% of active ingredients).

Table 1: The larvae mortality of P. panopealis on O. stamineus with different biopesticides using direct dip method. Source Df F-value P-value Treatment 11 10.09 < 0.05 Concentration 2 4.91 < 0.05 Treatment*Concentration 22 0.60 0.908 Error 72 Total 107

100 Garlic 90 80 Citronella 70 Neem 60 50 Garlic+Sticker (%) (%) 40 Neem+Sticker 30 Citronella +

Mean mortality death mortality Mean 20 Sticker 10 Tobacco+Sticker 0 0 0.5 1 1.5 Filtered Tap Water Concentration (%)

Figure 1: Mean number of mortality death (%) of P. panopealis with different treatment and concentration using direct dip method.

Khan and Wassilew (1987) reported that A. indica is a strong plant pesticide of decision for natural horticulture and it is generally utilized in a few nations around the globe today either independently in Integrated Pest Management (IPM) or related to synthetic pesticides. Neem based pesticide is better than other herbal pesticides (Charleston et al., 2005) for example, Rotenone and Pyrethrins. It has a place with the class of medium to expansive range pesticides. Bhattacharyya (2007) revealed that in

223

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Egypt, the colossal measure of data appearing plant remove based pesticides particularly neem is exceptionally dynamic against the number of various irritation species under research facility, greenhouse, semi-field, and field conditions and in various situations. They indicated impact on wide scope of irritation creepy crawlies, bugs, nematodes, snails, shellfish and parasitic types of person, residential creatures and family unit bug just as plant maladies (Rembold, 2005; Charleston et al., 2006; Nathan et al., 2006; Peveling and Ely, 2006; Seljasen and Meadow, 2006).

Residual method

The results of the two-way ANOVA showed that all two independent variables or factors (treatment and concentration) as well as their interaction showed some significant differences (P<0.05) on the number of larvae of P. panopealis mortality on O. stamineus against different biopesticides using the residual method (Table 2). This study indicated that the number of P. panopealis larvae mortality increased when the concentration of the pesticide used increased (Figure 2). The mortality of P. panopealis larvae was higher when treated with Neemix® 4.5 and B’Green® neem oil (commercial biopesticides) compared with garlic extract, neem leaves extract, citronella extract and tobacco leaves extract at all concentrations (Figure 2). Neemix® 4.5 (a.i azadirachtin) of commercial biopesticide recorded the highest mortality rate at 0.5 to 1.0 (% of a.i.). While, the tembakau leaves extract + sticker showed the lowest percentage of mortality in all concentrations of biopesticides.

Table 2: The larvae mortality of P. panopealis on O. stamineus with different biopesticides using residual method. Source Df F-value P-value Treatment 11 12.19 <0.05 Concentration 2 27.93 <0.05 Treatment*Concentration 22 1.77 <0.05 Error 72 Total 107

Residual Method Garlic

100 Neem 90 80 Citronella 70 Tobacco 60 50 Garlic+Sticker 40 Neem+Sticker 30 20 Citronella + Sticker

Mean Mortality Death (%) Death Mortality Mean 10 Tobacco+Sticker 0 0 0.5 1 1.5 Filtered Tap Water Concentration (%)

Figure 2: Mean number of mortality (%) of P. panopealis with different treatment and concentration using residual method.

Sara et al. (2004) was reported that, neem-based pesticide is suited for blending with other manufactured pesticides and in fact upgrades their activity. Charleston et al. (2006) portrayed that natural concentrates effectively affected survival, fertility, improvement, oviposition, and bolstering of Plutella xylostella, yet no immediate negative consequences for the survival and rummaging of the parasitoids. At the point when neem mixes, particularly Azadirachtin entered in the collection of bug

224

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

hatchlings, the movement of ecdysone (adolescent hormone) was smothered and the hatchlings neglected to shed and stayed in the larval stage and eventually kicked the bucket (Seljasen and Meadow, 2006) (Oviposition Deterrent Insect Growth Regulation). The neem compound produces something like retching sensation; as a result of this sensation, the bug does not benefit from the neem treated surface (Villanueva-Jimenez et al., 2000) (Feeding deterrent).

Field application

The mean mortality percentage of P. panopealis on O. stamineus with different treatments by foliar spray in the field application are shown in Figure 3. The commercial biopesticide, neem oil (1.2% a.i: Neemix® - Azadirachtin) showed 100% of mortality of P. panopealis but not significantly different (P>0.05) compared to other biopesticides in the field (Figure 3). Interestingly, all the natural biopesticides had potential to control the pests in the field application. The azadirachtin had no reactions on birds and other animals. There is no lethal buildup left to debase the earth and bugs do not create protection from neem (Sara et al., 2004). Bhattacharyya (2007) announced that a neem pesticide is a characteristic item, completely non-dangerous, 100% biodegradable and condition cordial. Sara et al. (2004) surveyed on wellbeing assessment of neem pesticide and security evaluations for the different neem-inferred arrangements that were made contrasted with the ingestion of deposits on nourishment treated with neem arrangements as bug sprays.

100.0 100 93.3 90.0 90.0 93.3 93.3 90 80 70 60 50 40 30 20 10 0.0 0 Garlic Citronella Tobacco Neemix X Control Africa Mean of mortality death (%)death mortality of Mean leaf Types of treatment

Figure 3: Mean percentage P. panopealis of mortality (%) on O. stamineus with different treatment by foliar spray in the field.

Conclusions

The potential for using botanical based biopesticides as a natural biopesticdes against the larval stages of P. panopealis, was suggested by the results of this study. The laboratory and field studies found that, the commercial biopesticides were more effective in killing P. panopealis pest. However, the extraction of garlic extract used in this study had the potential to be biopesticides against this pest. This is because the extraction of some plant species has a toxic effect on P. panopealis and can act as a natural biopesticides. In addition, the results of the laboratory study showed that Neemix® 4.5 (1.2% of a.i.) was able to record a relatively high percentage of P. panopealis mortalities despite low dose concentrations. This makes Neemix® 4.5 (1.2% of a.i.) can be used as a commercial biopesticides on the P. panopealis with low concentration of dose and reduces the risk of toxic effects on the environment due to excessive use of chemical pesticides.

225

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Acknowledgements

Gratitude goes to God always. The author wishes to express appreciation to the Director of Crops and Soil Sciences Research Center, MARDI and financial from NKEA Research Grant Scheme (NRGS) for the support, advice and grant (K-RPNA2-1001).

References

Ahmad Saip, S. and Tan Li, P. 2010. The lace bug Cochlochila bullita (Stal) (Heteroptera: Tingidae), a potential pest of Orthosiphon stamineus Bentahm (Lamiales: Lamiaceae) in Malaysia. Insecta Mundi 654. Asmanizar, Djamin, A. and Idris, A.B. 2012. Effect of four selected plant powder as rice grain protectant against Sitophilus zeamais (Coleoptera: Cucurlionidae). Sains Malaysiana 41(7): 863-869. Bhattacharyya, N., Chutia, M. and Sarnia, S. 2007. Neem (Azadirachta indica A. Juss), a potent biopesticide and medicinal plant: A Review. Journal of Plant Sciences 2(3): 251-259. Charleston, D.S., Kfir, R., Dicke, M. and Vet, L.E.M. 2005. Impact of botanical pesticides derived from Melia azedarach and Azadirachta indica on the biology of two parasitoid species of the diamondback moth. Biological Control 33: 131-142. Charleston, D.S., Kfir, R., Dicke, M. and Vet, L.E.M. 2006. Impact of botanical extracts derived from Melia azedarach and Azadirachta indica on populations of Plutella xylostella and its natural enemies: A field test of laboratory findings. Biological Control 39: 105-114. Khan, M. and Wassilew, S.W. 1987. In: Schmutterer, H. and Asher, K.R.S. (Eds.), Natural Pesticides from the Neem Tree and Other Tropical Plants. GTZ, Eschbom, Germany. Pp: 645-650. Lee Hong, T., Chai Ting, L., Soon Leong, L., Chin Hong, N. and Kevin Kit, S.N. 2014. Development and characterization of microsatellites of an important medicinal plant Orthosiphon stamineus (misai kucing). Biochemical Systematics and Ecology 55: 317-321. Nathan, S.S., Kalaivani, K. and Murugan, K. 2006. Behavioural responses and changes in biology of rice leaffolder following treatment with a combination of bacterial toxins and botanical insecticides. Chemosphere 64: 1650-1658. Pevelmg, R. and S.O. Ely, 2006. Side-effects of botanical insecticides derived from Meliaceae on coccinellid predators of the date palm scale. Crop protection 25: 1253-1258. Rembold, H. 2005. Control of the house dust mite, Dermatophagoides farinae, by neem seed extracts. Journal of Allergy and Clinical Immunology 115(2):S131. doi: 10.1016/j.jaci.2004.12.538. Sara, J.B., Marelle, G.B., Gerrit, M.A., Joop, J.A.L., Huis, A., Dicke, M. and Rietjens, I.M.C.M. 2004. Safety evaluation of neem (Azadirachta indica) derived pesticides. Journal of Ethnopharmacology 94: 25-41. Seljasen, R. and Meadow, R. 2006. Effects of neem on opposition and egg and larval development of Mamestra brassicae L: Dose response, residual activity, repellent effect and systemic activity in cabbage plants. Crop Protection 25: 338-345. Suddee, S., Paton, A.J. and Parnell, J.A.N. 2005. Taxonomic Revision of Tribe Ocimeae Dumort. (Lamiaceae) in Continental South-East Asia III. Ociminae. Kew Bulletin Volume 60: 3-75. Villanueva-Jimenez, J.A., Hoy, M.A. and Davies, F.S. 2000. Field evaluation of integrated pest management-compatible pesticides for the citrus 1 eaffniner Phyllocnistis citrella (Lepidoptera: Gracil-lariidae and its parasitoid Ageniaspis citricola (Hymenoptera: Encyrtidae). Journal of Economic Entomology 93: 357-367.

226

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Evaluation of Different Inoculation Techniques for Blossom Blight Disease, Colletotrichum gloeosporioides of Mango Flower

Nor Dalila, N.D.*, Muhamad Hafiz, M.H., Nurul Fahima, M.A. and Nur Aisyah Anis, A.K. Horticulture Research Centre, MARDI Sintok, 06050 Bukit Kayu Hitam, Kedah, Malaysia. *E-mail: [email protected]

Introduction

The mango plant is abundantly grown in Malaysia with a planted area of 5,772.7 ha with a value estimated at RM 75,951,868 in 2015 (Department of Agriculture, Malaysia, 2018). Even though the mango plant is established here in Malaysia, it is prone to attacks of diseases such as anthracnose and stem-end rot (Akhtar et al., 2002). Anthracnose is recognized as the most important pre and postharvest fungal disease of mango worldwide caused by Colletotrichum gloeosporioides Penz (Sundravadana et al., 2007). The post-harvest phase is the most damaging and economically significant phase of the disease. This phase is directly linked to the field phase where initial infection usually starts on young twigs and leaves and spreads to the flowers, causing blossom blight and destroying the inflorescences and even preventing fruit' set.

The reduced efficacy of chemicals due to pathogen resistant strains, has forced producers to evaluate safer alternatives for controlling diseases in the context of sustainable agriculture. These alternatives include antagonistic microorganisms, natural compounds, organic and inorganic salts, and physical methods to ensure optimal fruit quality (Ippolito and Sanzani, 2011; Youssef et al., 2012; Youssef and Roberto, 2014).

In developing a safer control for the disease, a procedure in blossom blight inoculation is needed to verify whether the product developed is well equipped in controlling the disease. Hence, this study was done to evaluate different inoculation techniques for blossom blight disease, C. gloeosporioides of mango flower for future reference.

Materials and Methods

The pathogen causing blossom blight on mango plants, C. gloeosporioides, was isolated from infected mango flowers in the Malaysian Agricultural Research and Development Institute (MARDI) Sintok, Kedah. Five samples of diseased tissues were washed and dipped for 10 minutes in 10% clorox. Consequently, the tissue was re-washed with sterile distilled water for three times and subsequently dried. Then it was placed on potato dextrose agar (PDA). The isolates were identified by using the morphological characteristics and molecular polymerase chain reaction (PCR) (Figure 1).

A B

Figure 1: (A) C. gloeosporioides; Culture plate on PDA and (B) Spore under microscope observation (40x).

227

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Flowering of the mango plant is triggered by stress due to drought season. Thus, this experiment was done in February 2018, which was the drought season in Sintok, Kedah. Standard farm practices were done throughout the experiment minus fungicide and pesticide sprays on the experimental plants. The flower panicles used for this experiment was from 12 years old mango Var. Raja. The flower stage chosen is inflorescence development stage where the flower buds are ready to open. Three approaches (Figure 2); injection inoculation, filter paper inoculation and spray inoculation were done to inoculate C. gloeosporioides artificially on mango flowers. Each method used C. gloeosporioides spore suspension 106 spore/mL. Culture plates, 10 days old, were flooded with 20 mL sterile water and slightly shaken to suspend conidia. Conidial suspensions were adjusted to 106 conidia/mL with the use of a haemocytometer.

Injection inoculation method

C. gloeosporioides spore suspension is harvested and 1 mL of spore suspension is put into syringe. At field, the flower panicle chosen were injected with 1 mL of C. gloeosporioides spore suspension 106 spore/mL at middle part of the flower panicle. It was then covered with translucent plastic to promote moisture for the development of the blossom blight disease. After 24 hours, the plastic cover was removed, and symptoms of blossom blight were observed daily.

Filter paper inoculation method

Filter papers were prepared by punching a 90 mm filter paper to 6 mm diameter size. They were then sterilized before use. After the spore suspension 106 spore/ml is prepared, filter papers are soaked in the spore suspension for an hour. At field, chosen flower panicle was first injured by inserting a sterile needle at the middle part of the flower panicle. Filter paper soaked with spore suspension is then placed onto wounded area. The whole flower panicle is covered with translucent plastic for 24 hours. The symptoms of blossom blight were observed daily for 7 days.

Spray inoculation method

Ten milliliters of spore suspension were put into sterile sprayers in sterile conditions in the laboratory. At field, the flower panicles are wounded by poking the middle part of the flower panicle using sterile needles. The whole flower is then sprayed with the spore suspension and immediately enclosed in translucent plastic bags after inoculation.

A B C

Figure 2: Inoculation method; (A) Injection inoculation method, (B) Filter paper inoculation method, and (C) Spray inoculation method.

228

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Observations were recorded daily for 7 days after inoculation were done. Disease severity were recorded by percentage of blossom blight symptoms mainly; infection on the flowers causing black and necrotic spots on the bud, flowers, flower stalks and the entire flower panicle. When the condition is damp, the spots will grow and unite. Eventually the whole flower becomes black and dry. Isolation of the disease was then done for each experimental unit to uncover the causal agent for the symptoms. The experiment consisted of 3 treatments with 8 replications in a randomized complete block design (RCBD). Disease occurrence were analysed by ANOVA using SAS 9.3 TS Level 1M1. Differences within the means were compared by using Least Significant Difference (LSD).

Results and Discussion

The efficacy of different inoculation method; injection inoculation, filter paper inoculation and spray inoculation were tested to prove the pathogenic ability of C. gloeosporioides. The results are presented in Table 1. Disease appearance was seen after 24 to 48 hours after inoculation was done. Where filter paper inoculation showed a faster appearance of symptom on the flower panicle (Table 1). From a study done by Kumari, et al. in 2017, symptoms of C. gloeosporioides on mango leaves and fruits were seen 36 hours after inoculation. In this experiment, earliest symptoms are seen at 24 hours after inoculation. This is due to mango flower tissue being more delicate than that of mango leaves and fruits. For this experiment, appressoria presence was in the 24 hours timeframe as the earliest disease appearance was at 24 hours. Whereas for mango fruit infection reported by Dinh, S. et al. (2003), after 48 hours, 60% of fungal propagules present were appressoria, as it took more time for disease infection to appear in mango fruits.

B C

Figure 3: Isolation of blossom blight symptoms on experimental units (A) Symptoms of blossom blight on mango flower, (B) Isolated C. gloeosporioides culture plate on PDA and (C) C. gloeosporioides spore under microscope observation (40x).

Disease percentage occurrence was seen for all the treatments after 7 days after inoculation was done at different degrees of severity. To confirm the causal agent for the blossom blight symptoms, isolation of disease was done to all experimental units. Here, it was identified by morphological characteristics that they were spores of C. gloeosporioides (Figure 3).

From SAS analysis (Table 1), no significant difference was seen by these treatments. The treatments; injection inoculation, filter paper inoculation and spray inoculation were all group together as one

229

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

having a disease occurrence of 83.33%, 75% and 66.67% respectively. All the 3 treatments were successfully infected the matured flower samples with C. gloeosporioides artificially.

Table 1: Effect of different inoculation methods on disease development of mango flowers. Time after appearance of symptoms on Inoculation methods Disease severity (%) flower panicle (h) Injection inoculation 48 83.33a Filter paper inoculation 24 75.00a Spray inoculation 48 66.67a

Conclusions

The fungus, C. gloeosporioides was able to infect the flower panicle by all three methods applied; injection inoculation, filter paper inoculation and spray inoculation method. The spray inoculation method is superior as less steps are included in the inoculation procedure. Nevertheless, all the methods can be done to achieve artificial inoculation of blossom blight on mango flowers at field level.

Acknowledgement

This study was funded by MARDI (Research Grant No. P-RH405-21003004050001-2018-E).

References

Akhtar, K.P. and Alam, S.S. 2002. Mango assessment keys for some important diseases of mango. Pakistan Journal of Biological Sciences 5(2): 246-250. Department of Agriculture Malaysia. 2018. (Online). Fruit Crops Statistic [Accessed 13 June 2018]. Available from World Wide Web: http://www. doa.gov.my/. Dinh, S., Chongwungse, J., Pongam, P. and Sangchote, S. 2003. Fruit infection by Colletotrichum gloeosporioides and anthracnose resistance of some mango cultivars in Thailand. Australasian Plant Pathology 32: 533-538. Ippolito, A. and Sanzani, S.M., 2011. Control of postharvest decay by the integration of pre- and postharvest application of nonchemical compounds. Acta Horticulturae 905: 135-143. Kumari, P., Singh, R. and Punia, R. 2017. Evaluation of different inoculation methods for mango anthracnose disease development. International Journal of Current Microbiology and Applied Science 6(11): 3028-3032. Youssef, K., Ligorio, A., Nigro, F. and Ippolito, A. 2012. Activity of salts incorporated in wax in controlling postharvest diseases of citrus fruit. Postharvest Biology and Technology 65: 39-43. Youssef, K. and Roberto, S.R. 2014. Applications of salt solutions before and after harvest affect the quality and incidence of postharvest grey mold of ‘Italia’ table grapes. Postharvest Biology and Technology 87: 95-102.

230

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Characterization and Evaluation of Fungicides for Control of Phytophthora palmivora on Cocoa (Theobroma cacao)

Ong, S.N.1, Leong, S.S.2 and Kwan, Y.M.1,* 1Department of Crop Science, Faculty of Agriculture and Food Sciences, UPM Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia. 2Department of Animal Science and Fishery, Faculty of Agriculture and Food Sciences, UPM Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia. *E-mail: [email protected]

Introduction

Phytophthora palmivora is a highly destructive plant pathogen in the tropics, favoring its warm temperature, high rainfall, and high relative humidity. This fungus has a complex disease cycle involving the production of a number of different spores including sporangiospores, zoospores, oospores and chlamydospores that are water borne, air borne, soil borne and vector borne (Drenth and Guest, 2013). The pathogen attacks multiple plant parts, including roots, stems, branches, flowers, leaves, and fruit of susceptible hosts such as coconut, cocoa, durian, papaya and rubber (Widmer, 2014). The pathogen attacks the branch fork and cocoa pod at all growing stages, causing stem canker and black pod diseases. Black pod disease causes up to 30% of pod losses and stem canker annually kills up to 10% of the cocoa trees, with an annual impact of one billion US dollars (Drenth and Guest, 2016).

Cultural practices and fungicide application are the most common disease management strategies. The fungicide metalaxyl and its active isomer, mefenoxam, demonstrate good oomycete disease control. It is a protectant and curative fungicide that inhibits mycelium growth and sporulation (Ware and Withacre, 2004). However, the extensive and prolonged use of this fungicide has resulted in the emergence of resistant Phytophthora isolates (Qi et al., 2008). The objective of this study was to i) characterize P. palmivora isolates collected from cocoa using morphological and molecular characteristics, and ii) to determine in vitro antifungal activity of selected fungicides against the mycelial growth of P. palmivora isolates.

Materials and Methods

Sampling and fungal isolation

Sampling of cocoa pods showing black pod disease symptoms (Figure 1) were conducted in a cocoa farm in Bintulu, Sarawak. Five cocoa pods were collected from KKM22 and PBC123 clones, respectively. The pods were cut into small pieces (0.5 x 0.5 x 0.5 cm), soaked into 10% sodium hypochlorite for 1 min, and rinsed twice for 1 min in several changes of distilled water. The surface- sterilized pieces were plated onto Potato Dextrose Agar (PDA) amended with 50 ppm ampicillin, 50 ppm streptomycin, 100 ppm pentachloronitrobenzene (PCNB) and 25 ppm Benocide. The plates were incubated at 25°C under florescent light for 72 hours.

231

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Symptom of black pod disease on cocoa. The first symptom is a brown to black spot on the pod, which rapidly spread over the whole pod.

Morphological identification and characterization

Species identification was based on the morphological characteristics of sporangiospore and chlamydospore as described by Bush et al. (2006). Sporangiospore and chlamydospore morphology were evaluated using seven day old and two week old cultures, respectively. The plates were evaluated at 1000X (100X objective and 10X eyepiece) magnification using a Leica DM2500 microscope (Leica Microsystems, Germany) and the images were analyzed using Leica LAS EZ software. Twenty sporangia and chlamydospores were photographed and measured for each isolate. Colony diameter of every isolate was recorded daily for ten days. Growth rate was calculated as mean daily growth (mm per day). Differences in mean morphological characteristics between isolates were compared using Duncan’s Multiple Range Test, SAS software.

Polymerase chain reaction (PCR)

DNA was extracted from 0.1 g fungal mycelium using Fungi Genomic DNA Extraction Kit (BioTeke Corporation, China) according to instruction from the manufacturer. Nucleic acid concentration and quality were quantified using Pico200 PicoDrop Spectrophotometer (Bionner Corporation, Korea). Primers were designed to flank the Internal transcribed spacer (ITS) and mitochondrial encoded cytochrome c oxidase 2 (COX-II) regions. All primer sequences were as listed in Table 1. PCR amplification was performed in a total volume of 25 µL consisting 2x Power Taq MasterMix (BioTeke Corporation, China), 0.4 µM forward and reverse primer and 50 ng DNA template. PCR programs were as follows: initial denaturation at 95°C for 5 min; 35 cycles of 95°C for 30 s, 55°C annealing for 30 s, 72°C extension for 1 min and, 10 min of final extension at 72°C. PCR products were verified on 1% (w/v) agarose gel and purified using Gel Extraction and PCR Purification Combo Kit (BioTeke Corporation, China) according to the instructions from the manufacturer. DNA sequences were analyzed using Basic Local Alignment Search Tool (BLASTn).

Table 1: List of primers used for PCR amplification. Primer Primer sequence (5-3’) ITS1 TCCGTAGGTGAACCTTGCGG ITS4 TCCTCCGCTTATTGATATGC Cox2-F GGCAAATGGGTTTTCAAGATCC Cox2-R CCATGATTAATACCACAAATTTCACTAC

232

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Phylogenetic analysis

ITS and COX-II region sequence of five P. palmivora isolates from cocoa and sequences available at National Center for Biotechnology Information (NCBI) database were compared for genetic diversity. Sequences were aligned with ClustalW followed by construction of phylogenetic tree using maximum parsimony method. The bootstrap consensus tree was inferred from 1000 replicates using Molecular Evolutionary Genetic Analysis (MEGA) software, ver. 7.0 (Tamura et al., 2011).

Fungicide sensitivity assay

Agar discs (5 mm in diameter) were removed from the edge of a seven day old culture and placed in the center of a Petri dish containing PDA amended with test fungicides at various concentrations. Three fungicides, including copper oxychloride (Pipertox, 84% a.i.), metalaxyl (Sensor 25WP, 25% a.i.), benzalkonium chloride (PhytoClean, 10% a.i.) and a bio-fertilizer, Bacillus subtilis (Bacto 10) were evaluated for their ability to inhibit the mycelium growth of P. palmivora isolates. The final concentrations tested for copper oxychloride and metalaxyl were 0, 0.1, 0.5, 1, 2 mg/mL and 0, 0.5, 1, 5, 10 and 50 µg/mL, respectively. Benzalkonium chloride and B. subtilis were tested at final concentration of 0, 0.2, 0.4, 0.6, 0.8, 1% and 0.5, 1, 2, 4 and 8%, respectively. Two perpendicular measurements were made for each treatment and the average colony diameter was determined. The mycelial growth at each fungicide concentration was plotted and the effective concentration (EC50) was determined.

Results and Discussion

Morphological characterization of P. palmivora isolates

A total of ten Phytophthora isolates were recovered and identified. P. palmivora isolates had uniformly shaped colony pattern, with white scanty fluffy mycelia and no pigmentation (Figure 2) on Potato Dextrose Agar (PDA) at an average growth rate of 4.0±1.8 mm/day. P. palmivora isolates produced coenocytic mycelia, chlamydospores and sporangiospores on PDA. Chlamydospores were round shape with an average diameter of 33.59±1.30 µm (n = 20 for each isolate). Sporangia were caducous and papillate with pedicle. Sporangia can exist in various shapes includes obpyriform, globose, ovoid, limoniform and ellipsoid. Ovoid form was the most common sporangial morphology (Figure 3). The average sporangial length and breadth was 61.12±20.85 µm and 17.13±6.07 µm (n = 20 for each isolate), respectively. However, significant differences in mycelium growth rate, chlamydospores and sporangia were not observed.

Figure 2: Colony morphology of P. palmivora on PDA. Colony pattern was characterized as uniform.

233

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

PCR and phylogenetic analysis

PCR products obtained from the ITS and COX-II regions measured approximately 809 bp and 527 bp, respectively (Figure 4). Basic local alignment search tool (BLAST) analysis showed 98% to 100% similarity with P. palmivora from NCBI GenBank database. ITS sequence-based phylogeny revealed that P. palmivora isolates from cocoa is distinct from other P. palmivora isolated from rubber and durian. However, Phylogeny generated from the ITS sequences of P. palmivora isolates from cocoa, rubber and durian (Figure 5). However, all the P. palmivora isolates from cocoa has grouped in one cluster (clade I). Sequence analysis from the ITS and COX-II regions did not provide a clear indication of possible phylogenetic relationships for isolates characterized by similar morphological grouping (based on mycelium growth rate and spore shape). However, genetic variation was observed in P. palmivora isolates from different host plants (durian and rubber).

Figure 3: Morphological characteristics of P. palmivora. a) Chlamydospore and, b) Obpyriform sporangiospore under 1000x magnification.

Figure 4: PCR product of a) ITS and b) COX-II. PCR products were run on 1% (w/v) TAE agarose gel mixed with Gelview nucleic acid dye. PCR product of expected size was indicated by arrow. M: 100 bp DNA Ladder (BioTeke Corporation, China), Lane 1: no template control and Lane 2: PCR products.

234

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 5: Phylogenetic tree generated from a maximum parsimony analysis of P. palmivora ITS sequences. Values above branching nodes represent percentage bootstrap calculated from 1000 replicates. Branch lengths are proportional to the number of nucleotide substitutions and are measured by scale bars.

Fungicide sensitivity assay

Benzalkonium chloride and metalaxyl exhibited 100% inhibitory effect against P. palmivora in vitro, at effective concentration (EC50) of 0.2% and 0.3 µg/mL, respectively. Bacillus subtilis and copper oxychloride provided over 85% efficacy, with EC50 estimated at 0.35% and 1500 µg/mL, respectively. Therefore, benzalkonium chloride and B. subtilis are a good alternative for rotation with the commonly used active ingredients (metalaxyl and copper oxychloride) for P. palmivora control and management of resistance. The in vitro study has demonstrated good control of P. palmivora but in vivo study is required to account the environment factor and systemic response of the plant.

Conclusions

The present study contributed to the knowledge on the morphological and molecular characteristics of P. palmivora causing black pod disease of cocoa. The use of fungicides requires precise management to limit emergence of resistant isolates.

Acknowledgements

This study was partly financed by Universiti Putra Malaysia via Putra Young Initiative grant (9554500).

References

Bush, E.A., Stromberg, E.L., Hong, C., Richardson, P.A. and Kong, P. 2006. Illustration of key morphological characteristics of Phytophthora species identified in Virginia nursery irrigation water. Plant Health Progress DOI:10.1094/PHP-2006-0621-01-RS. Drenth, A. and Guest, D.I. 2016. Fungal and oomycete diseases of tropical tree fruit crops. Annual Review of Phytopathology 54: 373-395. Drenth, A. and Guest, D.I. 2013. Phythothora palmivora in tropical tree crops. In: Lamour, K. (Ed.) Phytophthora: A Global Perspective 1 ed., Wallingford, Oxfordshire, UK: CABI. Pp. 187- 196.

235

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Qi, R., Ding, J., Gao, Z., Ni, C., Jiang, J. and Li, P. 2008. Resistance of Phytophthora capsici isolates to metalaxyl in Anhui Province. Acta Phytophylacica Sinica 35: 245-250. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739. Torres, G.A., Sarria, G.A., Martinez, G., Varon, F., Drenth, A. and Guest, D.I. 2016. Bud rot caused by Phytophthora palmivora: A destructive emerging disease of oil palm. Phytopathology 160(4): 320-329. Ware, G.W. and Withacre, D.M. 2004. The pesticide book. Mesiter Publications, Willoughby. Widmer, T.L. 2014. Phytophthora palmivora. Forest Phytophthoras 4(1). doi:10.5399/osu/fp.4.1.3557.

236

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 5

Plant Production

237

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A Preliminary Study on the Carbon Dioxide (CO2) Production from Saccharomyces cerevisiae Fermentation Activity

Azzami, A.M.M.1,*, Yaapar, M.N.2, Jusoh, M.2 and Zulkifli, N.A.2 1Gene Bank and Seed Centre, Persiaran MARDI-UPM, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Carbon dioxide (CO2) enrichment has shown to increase biomass as well as the photosynthetic rate of crops (Kowlosky et al., 1991; Kim et al., 2001) including rice. Based on a study by Abzar et al. (2017), CO2 has proven to give positive impact on rice seed germination, vigour index and seedling growth. Kimball and Idso (1983) also reported that doubling of CO2 concentration was able to reduce transpiration rate and increased yield and water use efficiency.

CO2 gas cylinders are often used in CO2 enrichment experiments on plants. However, this method is expensive and difficult to be implemented by farmers. A cheaper and easier technique to supply CO2 can be applied by using the fermentation process of the baker’s yeast, Saccharomyces cerevisiae (Fugelsang, 2007). CO2 is the by-product of metabolic processes in S. cerevisiae such as fermentation (anaerobic) and oxidative phosphorylation (aerobic) which depend on the presence or absence of oxygen. The metabolic fate of sugars in yeast fermentative metabolism is outlined in Figure 1.

Figure 1: The fate of sugars during S. cerevisiae metabolism (Walker and Steward, 2016).

Information on CO2 enrichment techniques and procedures are still lacking especially in the tropics. Therefore, a preliminary study was conducted to examine the effect of three different sucrose concentrations on the rate of CO2 production from S. cerevisiae metabolism activity and investigate the S. cerevisiae metabolism activity in a closed CO2 chamber in the field. The findings of this study can be used to develop a suitable method or technique for CO2 enrichment experiment using baker’s yeast by improving the CO2 chamber setup.

Materials and Methods

Effect of different sucrose concentrations on CO2 production

In the experiment, three sucrose concentrations of 12.5% (w/v), 25% (w/v) and 50% (w/v) were prepared with two replications for each concentration. CO2 generator as shown in Figure 2(a) was prepared in laboratory prior to the experiment. A total of 11 g baker’s yeast (S. cerevisiae) was used in

238

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

each bottle containing sucrose medium. The amount of CO2 produced by S. cerevisiae in media with different sucrose concentrations were measured within a week, at 5-minute intervals using CO2 data logger (Century Harvest, Model TH2000). The data logger was placed into a 26 cm (diameter) x 34 cm (height) closed cylinder container with a small opening of 3 cm in diameter. This experiment was carried out in a laboratory at temperatures between 28-30°C.

Suitability of CO2 chamber to sustain CO2 production

The suitable sucrose concentration obtained from the first experiment in the lab was later used in the field using the CO2 generator in a 2 m (width) x 2 m (length) x 1 m (tall) closed chamber (Figure 2(b)). CO2 production rate was recorded at 5-minute intervals for 6 days using carbon dioxide data logger (Century Harvest, Model TH2000).

a) b)

Opening (CO2 out)

CO2 Data logger

Figure 2: a) Experiment setup in the lab and b) Experiment setup in CO2 chamber.

Results and Discussion

Effect of different sucrose concentrations on CO2 productions

Based on the results (Figure 3), S. cerevisiae with sucrose concentration of 12.5% (w/v) was capable of producing CO2 up to 74 hours only (3 days). The highest CO2 concentration recorded was 3,800 ppm and remained above 1,000 ppm until 62 hours. However, this rate later continued to decrease until 74 hours showing CO2 concentration of below 500 ppm.

Saccharomyces cerevisiae with 25% (w/v) sucrose concentration showed the longest CO2 production compared to 12.5% (w/v) and 50% (w/v) sucrose. The concentration of CO2 remained above 1,500 ppm at 120 hours (5 days) with the highest CO2 concentration of 6,800 ppm.

Saccharomyces cerevisiae with 50% (w/v) sucrose concentration recorded the highest CO2 produced (8,003 ppm) at 21 hours. However, it showed a decreased in CO2 production of below 1,000 ppm at 100 hours and decreased further below 700 ppm at 110 hours. Although the yeast with 50% (w/v) sucrose concentration showed the highest CO2 production, it could not be sustained for a longer period of time. This might be due to active yeast activity causing the mixture to break out of the CO2 generator bottle into the filter bottle. This in turn caused CO2 production to decrease and could not last long. Therefore, 25% (w/v) sucrose concentration was later used in the field experiment.

239

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

9000 8000 7000 6000 5000 4000 3000 concentration (ppm) concentration

2 2000

CO 1000 0 1 6 11 16 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 106 111 116 Hour

12.5% sucrose conc. 25% sucrose conc. 50% sucrose conc.

Figure 3: CO2 concentration (ppm) from S. cerevisiae metabolism activity in three different sucrose concentrations (12.5% (w/v), 25% (w/v) and 50% (w/v)) for 120 hours.

Suitability of CO2 chamber to sustain CO2 production

The result in Figure 4 showed that the fermentation of S. cerevisiae in 25% (w/v) sucrose maintained the rate of CO2 production at 700 ppm to 1,200 ppm when temperature was between 26 and 40°C. Meanwhile, an increase in temperature of >40°C reduced the rate of CO2 to below 700 ppm. This experiment showed that S. cerevisiae in 25% (w/v) sucrose could provide the required CO2 concentration of between 700 ppm to 1,000 ppm in a closed chamber (2 m width x 2 m length x 1 m tall) for a week. However, some improvements on the chamber setup are necessary to reduce the temperature during the day. CO2 enrichment should not go beyond 1,000 ppm, as it is not beneficial for plants and unnecessarily expensive. Too high CO2 levels could cause partial closure of the pores in the leaves, which is not good. In addition, a higher CO2 concentration can cause a higher risk of accumulation of other noxious gases that can be present in the CO2 gas.

Figure 4: CO2 concentration (ppm) from S. cerevisiae metabolic activity in 25% (w/v) sucrose inside closed chamber in 120 hours.

240

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

Saccharomyces cerevisiae and sucrose mixtures can be used as an alternative CO2 generator to the conventional commercial CO2 sources. This method was also found to be suitable in supplying carbon dioxide at the rate required by the plant at 700 ppm to 1,000 ppm. Overall, the yeast system for CO2 source is a cheap, functional and sustainable method for enriching plants with CO2.

References

Abzar, A., Mohd Nizam, M.S., Wan Juliana, W.A., Wan Mohtar, W.Y., Doni, F., Fathurrahman, F. and Che Radziah, C.M.Z. 2017. Elevated CO2 concentration enhances germination, seedling growth and vigor of rice. Ecology, Environment and Conservation 23(3): 1286-1290. Fugelsang, K.C. 2007. Wine microbiology: Practical Applications and Procedures. Chapter 8: Fermentation and post-fermentation processing, pp. 115-138. New York, NY: Springer. Kim, H.Y., Leiffering, M., Miura, S., Kobayashi, K. and Okada, M. 2001. Growth and nitrogen uptake of CO2-enriched rice under field conditions. New Phytologist 150: 223-229. Kimball, B.A. and Idso, S.B. 1983. Increasing atmospheric CO2: Effects on crop yield, water use and climate. Agricultural Water Management 7: 55-72. Kowlosky, T.T., Kramer, P.J. and Pallardy, S.G. 1991. The Physiological Ecology of Woody Plant: Carbon dioxide (Chapter 10). Academic Press: New York. Walker, G.M. and Stewart, G.G. 2016. Saccharomyces cerevisiae in the production of fermented beverages. Beverages 2: 30.

241

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Nutritional Analysis and Antioxidant Extraction from Different Parts of Petai Belalang (Leucaena leucocephala) as Functional Food

Muhammad, A.S.1, Khanto, P.1, Ramli, N.S.1, Abd Hamid, A.1, Shukri, R.2 and Pak Dek, M.S.1,* 1Department of Food Science, Faculty of Food Science and Technology Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. 2Department of Food Technology, Faculty of Food Science and Technology Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Petai belalang (Leucaena leucocephala) belongs to the family Fabaceae, of the subfamily Mimosoideae (Brewbaker et al., 1985). As mentioned by D’Mello and Acamovic (1989), this species is widely distributed in the high-rain fall regions of Central America, Africa, Asia and Northern Australia. This plant can be found in the several countries including Malaysia, Mexico and so on. Petai belalang is a long-lived tree and could grow up to 7-18 meters height. The leaf is bipinnate with 6-8 pairs of pinnae. The leaf‘s length can expand up to 35 cm. According to Brewbaker et al. (1985), the inflorescence of petai belalang has a cream color with globular shape. The influence produces a cluster of flat brown pods at 13-18 mm long containing up to 15-30 seeds. Current application of petai belalang is used as timber and to control erosion (Brewbaker and Sorensson, 1990).

Studies conducted by Dubois et al. (1990) measured several nutrient compositions of petai belalang including crude protein, amino acid, and total nitrogen and free amino acids. Other studies showed the proximate value of petai belalang’s leaf. However, the nutritive value of mature and old seeds and the antioxidant properties of different parts of petai belalang have not been extensively studied. Antioxidant refers to a compound that can delay the oxidation of lipids or other molecules by inhibiting the initiation of oxidative chain reactions.

Antioxidant can be used to prevent the damage caused by radical oxygen. Therefore, the study was carried out to evaluate the nutritional value, antioxidant properties and bioactive compounds of L. leucocephala‘s leaf, mature seed and old seed.

Materials and Methods

Sample preparation

The leaves, mature seed and old seed of petai belalang were collected from Faculty of Food Science and Technology, Universiti Putra Malaysia, Selangor, Malaysia. Unlike seeds, the leaves were cleaned and washed under running tap water prior to oven-dried (Memmert UFB-50, GmbH, Germany) at 35°C for 72 hours. Next, the dried samples were ground into powder and stored at -20ºC for future analysis.

Proximate analysis

The analysis of moisture, ash, crude fiber, fats, carbohydrates and proteins were determined according to AOAC standard method (2000).

Solvent extraction

The solvent extraction was carried out based on modified conditions previously proposed Chang et al. (1977).

242

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Antioxidant evaluation

The free radical scavenging capacity was determined using stable free radical, 2,2-diphenyl-1- picrylhdrazyl (DPPH) according to the modified method of Brand-Williams et al. (1995), while the ability of the plant extracts to reduce ferric ions was determined by ferric reducing antioxidant potential (FRAP) according to a modified method by Benzie and Strain (1996).

Antioxidant component

Total phenolic content (TPC) was determined using Folin–Ciocalteu reagent by the method described by Singleton and Rossi (1965) while total flavonoid content (TFC) was determined using aluminium chloride colorimetry procedures described by Chang et al. (2002) with some modifications.

Statistical analysis

All data were expressed as mean ± standard deviation and were done in triplicate of the independent analyses. Data were analyzed by one-way analysis of variance (ANOVA) using SPSS version 16 (SPSS Inc., Chicago, Illinois, USA). A Duncan’s Multiple Range Test was used for mean comparison at p<0.05.

Results and Discussion

Proximate analysis

Result of the study showed the mature seed contained significant amount of protein, crude fiber, crude fat, and moisture at 16.72%, 3.55%, 5.19% and 71.48%, respectively as showed in Table 1. However, the old seed contained significantly higher amount of the protein, crude fat and crude fiber as compared to the mature seed with the value at 51.88%, 18.76%, and 14.06%, respectively. The protein, crude fat and crude fiber in the leaf were at 19.74%, 6.96%, and 2.60%, respectively.

Table 1: Proximate composition from Leucaena leucocephala mature seed, old seed and leaf. Mature seed Old seed Leaf %Moisture 71.48±0.15a 11.61±0.02c 67.74±0.98b %Ash 1.05±0.01a 3.59±0.09c 1.37±0.19b c a b %Protein 16.72±0.32 51.88±0.60 19.74±0.62 b a b %Fat 5.19±0.57 18.76±2.35 6.96±0.03 %Crude fiber 3.55±0.47b 14.09±0.37a 2.60±0.05c a c b %NFE 2.01 0.07 1.59 Values are the mean ± Standard Deviation (n=3); means that do not share a letter are significantly different (p<0.05) as measured by Duncan’s Multiple Range test. NFE calculated by subtracting from 100%.

This finding emphasized that old seed of petai belalang contained more crude protein, fiber and fat as compare to the leaf. This concluded that the leaf and old seed of petai belalang can be considered as highly nutritious and have potential applications food industries. Moisture content was significantly highest in mature seed. Therefore, it can be used as the parameter for physiochemical characteristic because it could influence the flavour, texture and appearance and shelf life of fruit (Yuniastuti et al., 2018). From this study, the lowest moisture content was found in old seed suggest that the old seed will have highest shelf life. High moisture content in the fruit needs to be handled carefully after harvesting. Meanwhile, high fiber content may suggest the old seed as hypocholestrolaemic agent for people with cholesterol illness (Olagbemide and Ogunnusi, 2015). Besides, high protein contains with low fat and carbohydrate showed the old seed as potential food for someone who intend to facilitated their weight loss. To conclude, old seed are highly nutritious then mature seed and leaf.

243

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Antioxidant activity

The result of study showed that mature seed contained that the highest free radical scavenging activity with IC50 value at 4.20 µg/mL, followed by leaf (5.43 µg/mL) and old seed (7.06 µg/mL) as shown in Figure 1. DPPH is a stable free radical. When reacts with antioxidants, it changes the colour from purple to yellow. The IC50 measures the concentration of extract needed to scavenge half of the free radicals present in the sample. A lower IC50 value indicates that the extracts contained higher antioxidant activity. In this study, methanolic extract of mature seed showed the lowest IC50, indicating it had the highest antioxidant activity.

Ferric ion reducing antioxidant potential (FRAP) showed the highest antioxidant activity exhibited by leaf, then followed by mature seed, and old seed. The result indicated that the leaf extract could donate the electron to Fe (III) better then old seed and mature seed, thus reducing it to Fe (II) (Maqsood and Benjakul, 2010). The reducing capacity measures the ease of the compounds in donating electrons (Medina et al., 2007). This determined that leaf have higher reducing power to react with ferric tripyridyl triazine (Fe3+-TPTZ) complex and yielded a final product of ferrous tripyridyl triazine (Fe2+- TPTZ) as compared to the controls (ascorbic acid).

800 b 9 c 700 8 ab 600 7 6 500 a 5 400 4 300 a µg FeSO4 b 3 200 2 Reduction antioxidant value, antioxidant Reduction 100 1 (µg/ml)IC50 Concentration, 0 0 Mature seed Old seed Leaf

FRAP Reduction antioxidant value, µg FeSO4

Figure 1: Free radical scavenging activity and FRAP value of methanolic extract of L. leucocephala old seed, mature seed and leaf. Data represent mean ± Standard Deviation (n=3); means that do not share a letter are significantly different (p<0.05) as measured by Duncan’s multiple range test.

Analysis of antioxidant component

The total phenolic content (TPC) analysis showed the leaf extract contained the highest value of TPC as shown in Figure 2. Then the value was followed by old seed and mature seed. Based on previous study, the plant extracts that contain high total phenolic content also show the high antioxidant activity (Bolling et al., 2010). The leaf contained highest total phenolic content thus showed the highest FRAP value. However, the free radical scavenging was not in diligent with TPC value. This could be due to the presence of antioxidant compounds such as polyphenols that are reactive ferric iron but do not react efficiently with DPPH free radicals (Reihani and Azhar, 2012).

Total flavonoid content (TFC) analysis showed old seed had the highest value with 1.35 mg/g followed by mature seed (1.07 mg/g extract) and leaf (0.85 mg/g extract) as shown in Figure 2. According to Maisuthisakul et al. (2007), flavonoids are ubiquitous in plants, while quercetin and rutin

244

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

are the most distributed flavonoid. Based on previous study by Sharma and Chaurasia (2014), L. leucocephala leaf contains flavonoid content up to 1.550±.008 mg QE/g. However the results were different with previous study. This could be explained due to several factors such as soil composition, temperature, and light may affect the level of total flavonoid content (Kouki and Manetas, 2002).

2000 b 1.6 b 1800 1.4 1600 1.2 1400 a 1200 c 1 1000 0.8

800 0.6 600 0.4 400 200 a a 0.2 Total flavonoid content, mg QE/gmg content,flavonoid Total

Total phenolic content, mg GAE/g mg content, phenolic Total 0 0 Mature seed Old seed Leaf

Total phenolic content Total flavonoid content

Figure 2: Total phenolic content (TPC) and total flavonoid content (TFC) of L. leucocephala old seed, leaf and mature seed extracts. Values are the mean ± Standard Deviation (n=3); means that do not share a letter are significantly different (p<0.05) as measured by Duncan multiple range test.

Conclusions

In conclusion, the proximate analysis showed all part of the studied L. leucocephala had high nutritional value. The antioxidant property of leaf and mature seed was better than old seed. Therefore, both leaf and mature seed can be suggested as a potential source of food with high antioxidant property. It can be concluded that the maturity process may reduce the functional properties of the seed.

Acknowledgements

The authors would like to thanks the lecturer of Faculty of Food Science and Technology for their guidance and Universiti Putra Malaysia for the laboratory facilities.

References

AOAC, 2000. Official Methods of Analysis of AOAC International. 17th edition; Gaithersburg, MD, USA Association of Analytical Communities. Benzie, I.F.F. and Strain, J.J. 1996. The ferric reducing ability of plasma (FRAP) as a measure of "antioxidant power": The FRAP assay. Analytical Biochemistry 239: 70-76. Bolling, B.W., Dolnikowski, G., Blumberg, J.B. and Chen, C.Y. 2010. Polyphenol content and antioxidant activity of California almonds depend on cultivar and harvest year. Food Chemistry 122 (3): 819-825. Brand-Williams, W., Cuvelier, M.E. and Berset, C. 1995. Use of a free radical method to evaluate antioxidant activity. LWT- Food Science and Technology 28: 25-30.

245

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Brewbaker, J.L. and Sorensson, C.T. 1990. New tree crops from interspecific Leucaena hybrids. In: Janick, J. and Simon, J.E. (Eds.), Advances in New Crops. Timber Press, Portland: 283-289. Brewbaker, J.L., Hegde, N., Hutton, E.M., Jones, R.J., Lowry, J.B., Moog, F. and van den Beldt, R. 1985. Leucaena - Forage Production and Use. NFTA, Hawaii: 39. Chang, S.S., Ostric-Matijasevic, B., Hsieh, O.A.L. and Huang, C.L. 1977. Natural antioxidant from rosemary and sage. Journal of Food Science 42: 1102-1106. Chang, C.C., Yang, M.H., Wen, H.M. and Chern, J.C. 2002. Estimation of total flavonoid content in propolis by two complementary colorimetric methods. Journal of Food and Drug Analysis 10: 178-182. D’Mello, J.P.F. and Acamovic, T. 1989. Leucaena leucocephala in poultry nutrition - A review. Animal Feed Science and Technology 26: 1-28. DuBois, J.D., Winter, H.C. and Dekker, E.E. 1990. Free amino acid pools, 15N nitrogen fixation and fixed nitrogen assimilation in Leucaena leucocephala var. K-8. American Journal of Botany 77: 316-322. Kouki, M. and Manetas, Y. 2002. Resource availability affects differentially the levels of gallotannins and condensed tannins in Ceratonia siliqua. Biochemical Systematics and Ecology 30(7): 631- 639. Maisuthisakul, P., Suttajit, M. and Pongsawatmanit, R. 2007. Assessment of phenolic content and free radical-scavenging capacity of some Thai indigenous plants. Food Chemistry 100: 1409-1418. Maqsood, S. and Benjakul, S. 2010. Comparative studies of four different phenolic compounds on in vitro antioxidative activity and the preventive effect on lipid oxidation of fish oil emulsion and fish mince. Food Chemistry 119: 123-132. Medina, I., Gallardo, J.M., Gonzaalez, M.J., Lois, S. and Hedges, N. 2007. Effect of molecular structure of phenolic families as hydroxycinnamic acids and catechins on their antioxidant effectiveness in minced fish muscle. Journal of Agricultural and Food Chemistry 55: 3889- 3895. Olagbemide, P.T. and Ogunnusi, T.A. 2015. Proximate Analysis and Chemical Composition of Cortinarius Species. European Journal of Advanced Research in Biological and Life Sciences 3(3): 1-9. Reihani, S.F.S. and Azhar, M.E. 2012. Antioxidant activity and total phenolic content in aqueous extracts of selected traditional Malay salads (Ulam). International Food Research Journal 19(4): 1439-1444. Sharma, P. and Chaurasia. 2014. Evaluation of total phenolic, flavoid contents and antioxidant activity of Acokanthera oppositifolia and Leucaena leucephala. International Journal of Pharmacognosy and Phytochemical Research 7(1): 175-180. Singleton, V.L. and Rossi, J.A. 1965. Colorimetry of total phenolics with phosphomolybdic- phosphotungstic acid reagents. American Journal of Enology and Viticulture 16: 144-158. Yuniastuti, E., Anggita, A., Nandariyah. and Sukaya. 2018. Local durian (Durio zibethinus Murr.) exploration for potentially superior tree as parents in Ngrambe District, Ngawi. IOP Conference Series: Earth and Environmental Science 142(1):012029 DOI: 10.1088/1755- 1315/142/1/012029.

246

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Soft Flesh Incidence in Harumanis Caused by Carbon Bagging: Truth or Myth?

Siti Aisyah, A.1,*, Wan Mahfuzah, W.I.2, Kamal, M.T.1, Siti Nur Raihan, A.1 , Razali, M.1, Nur Syafini, G.1, Fadhilnor, A.3, Nurul Syazila, A.R.3, Othman, I.3, Tham, S.L.1, Zaipun, M.Z.1, Habsah, M.1, Hanif, M.A.2, Syafikah, R.1, Siti Aishah, H.2 and Zainab, Y.1 1Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Horticulture Research Centre, MARDI Sintok, 06050 Bukit Kayu Hitam, Kedah, Malaysia. 3MARDI Arau, Lot PT3747 Tambun Tulang, 02600 Arau, Perlis, Malaysia. *E-mail: [email protected]

Introduction

‘Harumanis’ mango is the most popular mango cultivar widely planted in the northern part of Malaysia especially in Perlis and Kedah. It is gaining popularity in the local market due to its sweetness, delicate taste and aroma (Rosidah et al., 2010). The skin of this mango remained green even after the fruit has ripened. Thus, carbon bagging was used by farmers in Perlis to change the colour of Harumanis from green to yellow when it ripened. However, farmers get complaints from customers that the eating quality of fruit bagged by carbon paper has a mushiness taste is watery. Mushiness taste in mango usually happens when the fruit is overippen but in this case it may be caused by carbon bagging. Mango is considered mature enough to be picked and will ripen properly with a good flavor when it has 14% dry matter content (Walsh et al., 2016). Dry matter is an index of starch and sugar content of fruits and it is an indicator of physiological and harvest maturity. Dry matter content of hard green fruit is well correlated with Brix of ripe fruit and thus Brix is a determinant of eating quality. It is related to eating quality if the fruit ripened properly. Therefore, this study was conducted to investigate either carbon bagging affects the quality of Harumanis mango.

Materials and Methods

Harumanis mango obtained from a farm in Kg. Alor Ara, Arau, Perlis, was used in this study. Fruits with a diameter of 16-18 cm were bagged using three different types of paper bags. Fruits in treatment 1 (T1) were bagged with an old newspaper which served as a control, treatment 2 (T2) with a white paper, and treatment 3 (T3) with a carbon paper. The experiment was conducted using a completely randomized design arranged in a factorial treatment (three types of bagging materials and five storage days) with three replications. Thirty fruits for each treatment were bagged using 30 randomly selected trees. Mature fruits were harvested manually then transported directly to the Postharvest Complex at MARDI Serdang within 24 h after 8 weeks of bagging. After one night of being precooled at 10oC, fruits were washed and rinsed with clean water then were to undergo ripening process by using ethylene gas (200 ppm) at 25ᴏC. After that, fruits were stored at ambient for 3 days. Fruits were analysed at day 1, 3, 5, 7 and 10 days after ripening initiation. Three fruits from each treatment were used to analyse for skin and flesh colour, dry matter content (DM), water content, firmness, soluble solids concentration (SSC), pH, titratable acidity (TA), vitamin C, soluble solids concentration (SSC), titratable acidity (TA), pH, sugar/acid ratio and vitamin C. Statistical analysis was performed by using ANOVA and the differences between means were determined by using Duncan’s Multiple Range Test (DMRT) at 5% probability level.

Results and Discussion

Quality assessments in Table 1 showed that there were no significant differences on ascorbic acid content, titratable acidity, pH, sugar/acid ratio, dry matter content and water content among all treatments. This result also been proved by Ding and Shahirah (2010) on influence of fruit bagging on postharvest quality of Harumanis, who found that bagging did not affect Harumanis mango pulp

247

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

firmness, SSC, TA, pH and vitamin C. For dry matter content, there is no significant difference among treatments. This result is in line with Joyce et al. (1997) who reported that bagging of ‘Kensington’ mangoes and pears (Amarante et al., 2002) did not affect fruit dry matter content or weight at harvest. For skin colour, it showed that carbon paper produced significantly higher values of lightness (L), a and b followed by newspaper bag. This result showed that carbon bagging produced light orange skin compared to other types of baggings, with newspaper and white paper producing more greenish skin than fruits bagged with carbon paper. There was also an interaction between treatment and storage which is significantly higher effect on b value. This result is in line with Hwang et al. (2004) whereby the skin of ‘Ruby’ grape fruit bagged using black paper has light reddish orange color as compared to bright yellow in control fruit. From chemical parameter results in Table 1, it was observed that dry matter content was not significantly affected by bagging at harvest and at ripe stages.

These results are in line with results obtained by Nagaharshitha et al. (2014) in mango fruit. However, in this study found bagging with newspaper give significantly higher on soluble solid concentration compared to white and carbon papers. This could probably be that the newspaper contains low amount of carbon and this low amount could increase the sugar of fruit itself when it had ripened. For sugar/acid ratio, there are non-significant among treatment. Rathore et al. (2007) reported that the eating quality of a mango fruit is determined by sugars, acids and sugars/acids ratio and bagging may not have affected the fruit’s content. This result showed that different types of bagging did not affect the taste of Harumanis.

248

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Changes in soluble solids concentration (SSC), pH, total titratable acidity (TTA), ascorbic acid content, dry matter content (%), colour of mango skin (L*, a, b) sugar acid ratio, texture and water content (%) of mango Harumanis with different bagging treatments (newspaper, white paper and carbon paper) at 25°C storage temperature. Main SSC pH TTA Ascorbic Dry matter Colour of skin Texture Sugar acid Water effects (%) (% citric acid content content (L*) (a) (b) (N) ratio content acid) (mg/100g) (%) (%) Bagging treatments (T) Newspaper 17.67a 5.20a 0.26a 4.65a 19.96a 51.77b -11.81b 25.77b 2.57a 84.07a 80.04a White 16.54b 5.03a 0.21a 5.68a 19.76a 50.54b -11.27b 23.16b 4.03a 105.26a 80.24a Carbon 15.70b 4.82a 0.17a 6.17a 19.19a 59.62a -2.98a 34.72a 2.39a 99.62a 80.81a Storage life (D)

1 18.77a 4.72a 0.31a 3.04b 24.01a 53.77a -7.67a 26.54a 6.11a 62.61b 72.99a 3 16.58bc 4.75a 0.08b 6.09a 18.98bc 53.55a -8.77a 27.70a 2.34b 147.68a 81.01a 5 17.04b 5.46a 0.20ab 6.66a 19.29bc 53.70a -9.49a 30.32a 3.13b 96.06ab 80.70ab 7 16.23bc 5.18a 0.21ab 6.67a 19.97b 56.65a -6.52a 29.88a 2.12b 104.46ab 80.03b 10 15.69c 4.87a 0.27a 4.58ab 16.85c 52.22a -10.39a 24.96a 2.15b 62.15b 83.14a

Interaction NS NNS NS NS NS NS * ** * NS NS T X D Each value was the mean of three replicates. Means with the same letter are not significantly different at 5% level (p<0.05) according to Duncan Multiple Range Test. (DMRT), L*= lightness, NS=Non-significant, * =Significant, **=Highly Significant.

249

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusion

In conclusion, the results of this study proved that soft flesh incidence in Harumanis mango is not cause by a carbon paper bag. However, the bagging produced Harumanis with orange skin colour.

References

Amarante, C., Banks, N.H. and Max, S. 2002. Preharvest bagging improves packout and fruit quality of pears (Pyrus communis). New Zealand Journal of Crop and Horticultural Science 30:93-98. Ding, P. and Syakirah, M.N. 2010. Influence of fruit bagging on post-harvest quality of ‘Harumanis’ mango. Acta Horticulturae 877: 169-174. Hwang, A.S., Huang, K.L. and Hsu, S.H. 2004. Effect on bagging with black paper on coloration and fruit quality of ‘Ruby’ grapefruit. Journal of Agricultural Research of China 53: 229-238. Joyce, D.C., Beasley, D.R. and Shorter, A.J. 1997. Effect of preharvest bagging on fruit calcium levels, and storage and ripening characteristics of ‘Sensation’ mangoes. Australian Journal of Experimental Agriculture 37: 383-389. Nagaharshitha, D., Khopkar, R.R., Haldankar, P.M., Haldavanekar, P.C. and Parulekar, Y.R. 2014. Effect of bagging on chemical properties of mango (Mangifera indica L.) cv. Alphonso. Agrotechnology 3: 124. Rathore, H.A., Masud, T., Shehla, S. and Aijaz, H.S. 2007. Effect of storage on physico-chemical composition and sensory properties of mango (Mangifera indica L.) variety Dosehari. Pakistan Journal of Nutrition 6 (2): 143-148. Rosidah, M., Faridah, H., Jamaliah, M.Y. and Norzaidi, M.D. 2010. Examining market accessibility of Malaysia’s Harumanis mango in Japan: Challenges and potentials. Business Strategy Series 11(1): 3-12. Walsh, K., Subedi, P., Anderson, N., Wang, Z. and Anderson, N. 2016. Multiscale monitoring: Estimation of mango fruit quality and quantity in field and in store. www. ntfarmers.org.au.

250

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Yield, Antioxidant, Phenolics and Flavonoid of Misai Kucing (Orthosiphon aristatus) at Different Flowering Stage

Rosnani, A.G.*, Samsiah, J., Siti Nurzahidah, Z.A., Noor Safuraa, S. and Hafizol, M.D. Plant and Soil Science Research Centre, MARDI Headquarters, P.O. Box 12301, 50774 Kuala Lumpur, Malaysia. *E-mail address: [email protected]

Introduction

One of the high value herbs in Malaysia is Orthosiphon aristatus or misai kucing from Lamiaceae family. It has been used for many countries in South-East Asia and widely used in Malaysia for treating hypertension, urinary system ailments and kidney stone disease (Awale et al., 2003). There are increasing demands for misai kucing raw material for production of herbs-based product due to its medicinal properties. However, misai kucing is not cultivated widely in Malaysia and unable to meet the demand of the raw material. The total cultivated area of misai kucing in Malaysia is only 12.27 ha with a production of about 80.28 mt (DOA, 2016).

MARDI has identified two potential varieties of misai kucing which are MOS 1 and MOS 2. The MOS 1 is white flowered which has rapid growth performance compared to the MOS 2 which is purple flowered (Musa et al., 2005). Lack of technology in cultivation practicing is one of the main issues that the growers not interested to cultivate misai kucing. It is because the biomass and quality of the raw material produced was inconsistent and unfulfilled the standard.

One of the important criteria in cultivation of misai kucing is harvesting stage. Basically, the quality of herbs is higher during flowering stage. However, the exact of flowering stage is not yet identified for high yield and quality of misai kucing. Thus, a study was conducted to determine the optimum time of harvesting at flowering stage for high yield and quality of misai kucing.

Materials and Methods

The experiment was conducted under semi-controlled environment at MARDI Headquarters, Serdang, Selangor. The plants were propagated using stem cuttings. Cuttings of 2-3 nodes were taken from mother plants that were planted in MARDI. These cuttings were raised under 25% shade in germination trays (104 plugs) that contained commercial medium of Holland peat. The seedlings were ready to be transplanted after 5 weeks of propagation. Soil from the field at MARDI (Serdang Series) was used as a planting medium for this pot experiment to gain the results as near as planted under field condition. The chemical properties of the soil are presented in Table 1. At five days before transplanting, processed chicken dung was applied at 5 t/ha as basal fertilizer. Matured, healthy and uniform seedlings of five weeks old were selected and transferred to the pots. The crop was irrigated using a drip irrigation system two times a day.

Ten treatments comprised of different flowering stages which were T1: before flowering 1-25 days after transplanting (DAT), T2 : before flowering 2-30 DAT, T3 : green flower 1-35 DAT, T4 : green flower 2-40 DAT, T5 : green flower 3-45 DAT, T6 : flowering 1-50 DAT, T7 : flowering 2-55 DAT, T8 : flowering 3-60 DAT, T9 : flowering 4-65 DAT and T10 : flowering 5-70 DAT. Three plants were planted for every treatment with one plant per pot. All treatments were applied with processed chicken dung and compound fertilizer of NPK 10:10:10 at the rate of 5 t/ha and 70 kg/ha respectively as combination application at 30 and 60 days after transplanting (DAT). The plant was harvested at different flowering stage according to the treatments by cutting 30 cm from the top of the plant using secateurs. The experimental design was Randomized Complete Block Design (RCBD) with five replications.

251

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The harvested plants were washed using filtered tap water and fresh weight was recorded. The fresh samples were oven dried immediately at 50oC until moisture content has dropped to 10-12%. Immediate drying is important as phytochemical content in fresh samples will decline after a few days. The dried samples were weighed and recorded as a dried yield. The dried samples then were grounded and extracted for phytochemical analysis. Phytochemical such as antioxidant activity, total phenolic and total flavonoid content were analyzed and recorded. Total phenolic and total flavonoid yield then were calculated by multiplied the content with the dried yield. Determination of antioxidant activity was done using method developed by Brand-Williams et al. (1995) with minor modifications. Meanwhile, analysis of total phenolics and total flavonoid content were determined using method of Swain dan Hillis (1959) with minor modifications and Kiranmai et al. (2011) respectively. Analysis of data was carried out using SAS statistical package 9.1 (SAS, 2002). When the ANOVA was significant, mean separation using t-test was done.

Table 1: Chemical properties of soil. Soil properties Values N (%) 0.12 P (%) 0.02 K (%) 0.21 Total Carbon (%) 1.06 Ex. Ca (meq/g) 0.02 Ex. Mg (meq/g) 0.01 CEC (meq/g) 0.08 Conductivity (Us/cm) 35.62 Base Saturation (%) 43.31

Results and Discussion

The biomass yield response

The fresh yield of misai kucing was significantly different at different flowering stage. The fresh yield increased from 50 kg/ha (T1) to 1500 kg/ha (T10) (Figure 1). The increasing of fresh yield from T1 to T10 was about 67%. Meanwhile, the dry yield of misai kucing at different flowering stage also was significantly different. The dry yield increased from 12 kg/ha to 332 kg/ha respectively at T1 and T10 (Figure 1). The biomass yields increased due to the plants were actively growing from 25 DAT (T1) until 70 DAT (T10).

FY - Fresh yield; DY- Dry yield

Figure 1: Biomass yield at different flowering stage.

252

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The antioxidant activity response

Result on antioxidant activities (AO) showed that T5 were the highest followed by T6, T8, T7, T4, T9, T10 and T3 but not significantly different to each other (Figure 2). The trend showed an increase of AO from T1 (52%) until T5 (80%) and decrease from T6 (79%) until T10 (71%). It is means that antioxidant activities in misai kucing is optimum started at green flowering stage 2 to flowering stage 5 which at age of 40 to 70 DAT.

Figure 2: Antioxidant activities at different flowering stage.

The total phenolic and total flavonoid content response

Total phenolic content was significantly different and higher at T2 (7.79 mg/mL), T3 (7.38 mg/mL) and T7 (6.89 mg/mL) (Figure 3). However, total phenolics content at all treatments was below than 10 mg/mL which the lowest was at T4 (4.64 mg/mL). Results on total flavonoid content showed that T2 was the highest with 72.41 mg/mL followed by T1 (61.89 mg/mL) (Figure 3). Phenolics and flavonoids, are widely found in food products derived from plant sources, and they have been shown to possess significant antioxidant activities (Ebrahimzadeh et al., 2009).

Figure 3: Total phenolics and flavonoid content at different flowering stage.

253

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The total phenolic and total flavonoid yield response

Results on total phenolics and flavonoid yield showed that T10 was the highest for both of the total phenolic and flavonoid yield with 1635 kg/ha and 62593 kg/ha, respectively (Table 2). Although the total phenolics and flavonoid content were lower at T10, but the biomass yield at this treatment was higher that resulted in increasing of phenolics and flavonoid yields.

Table 2: Total phenolic and flavonoid yield at different flowering stage. Treatment Yield (kg/ha)

Total phenolic Total flavonoid T1 68f 4226e T2 248ef 18032d T3 168ef 8073e T4 137ef 4478e T5 283e 6266e T6 524d 17219d T7 672cd 28290c T8 740c 26339c T9 1217b 44719b T10 1635a 62593a

Conclusion

Based on this study, the optimum flowering stage was at 70 days after transplanting which at late flowering (flowering stage 5) based on biomass yield, total phenolics and total flavonoid yield.

References

Awale, S., Tezuka, Y., Banskota, A.H., Adnyana, I.K. and Kadota, S. 2003. Nitricoxide inhibitory isopimarane-type diterpenes from Orthosiphon stamineus of Indonesia. Journal of Natural Products 66: 255-258. Brand-Williams, W., Cuvelier, M.E. and Berset, C. 1995. Use of a free radical method to evaluate antioxidant activity. LWT - Food Science and Technology 28(1): 25-30. Ebrahimzadeh, M.A, Nabavi, S.M. and Nabavi, S.F. 2005. Correlation between the in vitro iron chelating activity and poly phenol and flavonoid contents of some medicinal plants. Pakistan Journal of Biological Sciences 12(12): 934-938. Jabatan Pertanian Malaysia (DOA). 2016. Statistik tanaman herba dan rempah ratus Malaysia 2016. p: 5. retrieved May 16 2018 from http://www.doa.gov.my/index/resources/aktiviti_sumber/sumber_awam/maklumat_pertanian/ perangkaan_tanaman/perangkaan_herba_rempah_ratus_2016.pdf. Kiranmai, M., Mahendra, C.B.K. and Ibrahim, M. 2011. Comparison of total flavonoid content of Azadirachta indica root bark extracts prepared by different methods of extraction. Research Journal of Pharmaceutical, Biological and Chemical Sciences 2(3): 254-255. Musa, Y., Muhamad Gawas, M. and Mansor, P. 2005. Penanaman Tumbuhan Ubatan dan Beraroma. MARDI, pp. 57-62. SAS (Statistical Analysis System). 2002. SAS/STAT. The Practical Application of Guide Version 9. Institute Inc. Raleigh: North Carolina, USA. Swain, T. and Hillis, W.E. 1959. The phenolic constituents of prunus domestica. I.-The quantitative analysis of phenolic constituents. Journal of the Science of Food and Agriculture 10: 63-68.

254

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Development of Horn-type Dendrobium Orchid Hybrids for Potted and Landscaping

Farah Zaidat, M.N.1,*, Najah, Y.1 and Rozlaily, Z.2 1Urban Agriculture and Floriculture Programme, Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Vegetables Programme, Horticulture Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Dendrobium is the second largest genus in the Orchidaceae after Bulbophyllum. Dendrobium is so massive that its more than 1,000 species are divided into several sections and subsections based on both floral and vegetative characteristics (Ronald, 2001). One of it is in the section Spatulata which are commonly called Antelope-types or Horn-types orchid. It calls horn because twisted petals resemble the shape like horns of antelope. Orchid hybrids made between the two species are referred to as semi-antelope types. Horn types or semi-antelope types are one of the easiest orchids to grow under most conditions and is a ‘heat-tolerance’ Dendrobium orchid which required more sun-light (70-80%) for free-flowering (Fadelah, 2004 and 2007). Usually vandaceous orchids such as Mokara, Vanda and Renanthera were mostly used as landscape due to their hardy and heat-tolerant characteristics. Most of Dendrobium hybrids need more shade and not very suitable to be used in landscaping. A heat-tolerant characteristic of horn-type Dendrobium makes it ideal for landscape decoration. These horn-type orchids it requires more sun and less shaded compared to other Dendrobium. However, the lack of heat-tolerant orchid variety limit its usage in landscaping. Development of new hybrids on horn-type Dendrobium are required locally. This study was initiated to increase the variety of horn-type Dendrobium hybrids in the industry. The objective of this study is to evaluate and select new orchid hybrids with heat-tolerance and good characteristics such as hardy, vivid color, good shape, long shelf-life and free flowering suitable for potted and landscaping.

Materials and Methods

Evaluation on flower morphological characteristics, shelf life and plant growth habit were carried out on F1 progenies from four crosses of Dendrobium horn-types orchid. The crosses are Dend. Margaret Thatcher x Dend. Helic 2, Dend. Margaret Thatcher x Jeffrey Tan, Dend. Merdeka Golden Anniversary x Dend. Siah Ko-Ko and Dend. Taiping x Dend. Siah Ko Ko. The female parent, Dend. Margaret Thatcher is twisted and spiky, with two horns on the top of the flower. Petals and sepals are greyed-purple with purple lips. The male parent, Dend. Jeffrey Tan has greyed-orange flower and flowers of Dend. Helix 2 has purple with light brown flower. Both paternal parents have red-purple group lips. Another group of crosses used Dend. Siah Ko-Ko as a paternal parent. The flowers has yellow colour with strong twisted horns.

A total of 2000 pots of these F1 progenies being observed in the MARDI’S orchid nursery in Serdang. Subsequent transplanting into bigger pots was necessary, so as to allow space for further side shoots to develop (William and Brian, 2010). Evaluation and selection of potential progenies were conducted at the flowering stage, mainly based on desirable flower color, size, shape, length of flower stalk and frequency of flowering. Flower morphology and shelf life data were recorded as well.

Results and Discussion

All F1 progenies were transferred into nursery and were further transplanted into bigger pots. Flowers initiated after 18 to 24 months and data on plant and flower characteristics were recorded. Three

255

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

progenies HT12.07, HT23.29 and HT64.03 were selected based on their desirable characteristics. HT12.07 and HT14.07 were progeny from a cross between Dend. Margaret Thatcher x Dend. Helix 2. HT23.29 and HT25.29 were progeny from a cross between Dend. Margaret Thatcher x Dend. Jeffery Tan and HT64.03 was a potential progeny resulting from a cross between Dend. Merdeka Golden Anniversary x Dend. Siah Ko-Ko (Table 1 and Figure 1).

Flowers of HT12.07 were greyed orange purple with a twisted horn-type shape petals and sepals. While HT23.29 have red and greyed purple flowers and bearing up to 18 flowers per inflorescense. Flowers of HT64.03 was a combination of purple and yellow colour, bearing up to 22 flowers per inflorescence.

Table 1: Five potential progenies of horn-type Dendrobium selected based on their desirable characteristics.

RHSCC = Royal Horticulture Society Colour Chart.

a) b) c) d) e)

256

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

b) a) c)

d) e)

Figure 1: Five potential progenies: a) HT12.14, b) HT14.07, c) HT23.13, d) HT25.29 and e) HT64.03.

Conclusions

The emphasis of selection for heat-tolerance character was made due to the lack of orchids can be used as landscape in the current market. The availability of these new hybrids will help to solve the problem of a lack heat-tolerance orchid in the orchid industry and provide a new variety orchid to be used in landscape decoration.

References

Fadelah, A.A. 2004. Selection of miniature Dendrobium orchids as potential potted plants. Journal of Tropical Agriculture and Food Science 32(1): 1-8. Fadelah, A.A. 2007. Selection of yellow Dendrobium orchid flowers as potential cut flower hybrids. Journal of Tropical Agriculture and Food Science 35(1): 9-20. Fadelah, A.A., Inthirani, R.R., Mohd, Y.T. and Norhayati, A. 2007. Development of potential hybrids of Cattleya alliances. Horticulture Centre Technical Report. Pp. 6-15. Ronald, J.M. 2001. Amazing minicatts. Not a new phenomenon, these colourful orchids continue to charm. http://www.theaos.org/publications/bulletin/issues/ju100/minicatts.html. William and Brian, R. 2010. Practical Gardening Handbook Orchids. Pp. 44-49.

257

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Responses of Chinese Cabbage to DK-20 as Plant Fertilizer Additive

Umikalsum, M.B.* and Muhamad Radzali, M. Agrobiodiversity and Environment Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

The basic requirement of growing plant which includes water, oxygen, carbon dioxide, temperature, light, medium and nutrients is essential for the physiologic processes. A significant amount of plant fertilizer additive (plant hormone), macronutrient as well as micronutrient are required to support its roots, stems, leaves, flowers and fruits for maximum plant growth and yield. Nowadays many fertilizers sold in the market provide a ready-made formula containing additives and nutrients to help simplify the plant growth process and yield. The products including pre-fertilized soils, quick-release fertilizers, slow-release fertilizers, fish emulsion and many more.

DK-20 is a natural plant nutrition product containing trace amount of plant growth enhancers or plant fertilizer additive with properties of plant hormones namely auxins and cytokinins. These natural enhancers work in unison to trigger the plant’s own biochemical and physiological pathways (Bielach et al., 2017). DK-20 may be applied as a seed treatment, foliar spray, soil enhancer or a combination of these treatment methods. Responses of a plant to DK-20 are dependent on dose, method of application, and the plant’s developmental stage. Foliar application offers a specific advantage over soil application when plant demand for nutrients exceeds the capacity of the roots to absorb nutrient and when environmental conditions limit the effectiveness or prevent the application of nutrients to the soil. This study evaluated the effect of DK-20 as plant fertilizer additive on Chinese cabbage growth and yield.

Materials and Methods

The study was conducted at Malaysian Agricultural Research and Development Institute. Chinese cabbage seeds were sown in sowing tray filled with peatmoss media in the glasshouse. After one week of germination, the seedlings were transplanted into 2 m x 0.5 m tray filled with mix soil (top soil and manure; 3:1) under rain shelter.

A total of 350 mL DK-20 solution was diluted into 3.5 L of water as a stock solution. There were two levels of DK-20 tested: 50% and 100% concentrations of DK-20 stock solution. A control treatment: water without DK-20 solution, application was also included. The treatments were arranged in completely randomized design with 3 replicates. Each replicates consist of 10 plants per treatment. Application was done by foliar spray at 1st week and 3rd weeks after transplanting. Data for plant height and leaf diameter were recorded at 2nd week after transplanting and 4th weeks after transplanting. Plant weight and leaf number were recorded upon harvesting. Data obtained were subjected to analysis of variance to test the significant effect of all the variables investigated. Significant differences (P<0.05) between means were determines by Duncan Multiple Range Test.

Results and Discussion

A plant exogenous hormone is a synthetic substance that similar to natural plant hormones. It is normally used to regulate plant growth to ensure optimum agricultural production. Currently, there are five recognized groups of plant hormones namely auxins, gibberellins, cytokinins, abscisic acid (ABA) and ethylene that coordinating the growth and development of plant cells.

258

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Plant height

The plant height of Chinese cabbage at 14 days after transplanting (DAT) is presented in Table 1. The height was ranged from 9.9 cm to 14.4 cm. Plant treated with 100% DK-20 concentration was significantly taller than control. However, plant height at 50% concentration did not differ significantly except with the control. The plant height upon harvesting was found to increase up to 53% when 100% DK-20 concentration was applied to the Chinese cabbage (Table 2). There were significant differences in the height of the Chinese cabbage between the treatments. It was observed that DK-20 rates appear to influence the height and weight of Chinese cabbage. Figure 1A-C showed the Chinese cabbage plants at 28 days after transplanting with 100%, 50% and 0% DK-20 concentration rates application respectively.

Leaf diameter and leaf number

The mean leaf diameter and leaf number are presented in Table 1 (14 DAT) and Table 2 (28 DAT). It was observed that there was no significant difference in leaf diameter and leaf number between 100% and 50% rates application with exception to the control treatment. However, the DK-20 application has increased significantly the leaf number and diameter of the plant.

Plant weight

Results on plant weight for the 3 treatments are presented in Table 2. There was significant difference in plant weight between the treatments. Plant weight was increased by 165% when 100% DK-20 concentration was applied to the Chinese cabbage against control (without DK-20 application). DK-20 plant growth regulator found to be significantly affect on plant weight with the highest 54.8 g obtained with 100% concentration rate. This is not surprising, considering the large amounts of hormones (from the DK-20) applied.

Table 1: Plant height and leaf diameter of Chinese cabbage at 100% and 50% DK-20 concentration rates after 14 days transplanted. DK-20 rates Plant height (cm) Leaf diameter (cm) 100% 14.4a 10.1a 50% 13.3a 9.3a 0% (control) 9.9b 7.1b Means followed by the same letter in each column did not differ at p<0.05 by DMRT.

Table 2: Plant height, leaf diameter, leaf number and plant weight of Chinese cabbage at 100% and 50% DK-20 concentration rates after 28 days transplanted. DK-20 rates Plant height (cm) Leaf diameter (cm) Leaf number (cm) Plant weight (g) 100% 19.3a 12.9a 9.9a 54.8a 50% 17.5b 12.0a 9.5a 41.8b 0% (control) 12.6c 9.2b 7.1b 20.7c Means followed by the same letter in each column did not differ at p<0.05 by DMRT.

259

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A B C Figure 1: Chinese cabbage at different DK-20 plant growth regulator concentration rates application after 28 days transplanted. A: 100%; B: 50%; C: 0% Control.

Conclusion

It is concluded that DK-20 plant growth regulator enhanced Chinese cabbage growth. The growth and plant weight were significantly increased with the DK-20 supplement. Study will be carried out at the lower concentrations to determine the optimum rates that will give positive effect on plant growth and yield.

Reference

Bielach, A., Hrtyan, M. and Tognetti, V.B. 2017. Plants under stress: Involvement of auxin and cytokinin. International Journal of Molecular Sciences 18(7): 1427. http://doi.org/10.3390/ijms18071427.

260

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The Potential of Terung Telunjuk (Solanum sp.) for Food and Nutritional Security

Umikalsum, M.B.1,*, Razean Haireen, M.R.1, Siti Noor Aishikin, A.H.1, Mohd Zulkhairi, A.1, Erny Sabrina, M.N.1, Aminah, M.1, Nurul Ammar Illani, J.1 and Umi Kalsum, H.Z.2 1Agrobiodiversity and Environment Research Centre, 2Food Science Technology Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

The world will be facing a challenge of sufficient food supply to feed the population which estimated to hit 9.5 billion people by 2050. Although increasing the agricultural productivity is an important development goal, it does not ensure food security or improved food nutrition. Growing more food is necessary but usually not sufficient to achieve good nutrition and health. Agriculture interventions do not always contribute to positive nutritional outcomes. People need to take adequate quality food rather than quantity so that will not affect nutritional requirement. There are numerous sources of nutritious food especially from the vegetables that can be added into the food dietary.

Eggplant (Solanum sp.) is a popular vegetable crop in the world especially in central southern, south- eastern Asia and also African (Li et al., 2010). This edible crop is known as brinjal and aubergine in many countries (Daunay, 2008). It was reported that the origin of eggplant was from India due to the diversity of eggplants in the country (Kalloo, 1988). Another report indicates that eggplant originates from the African country (Lester and Hasan, 1991). Both countries claim that they have greatest wild relative eggplants that can still be found. This vegetable was reported to contain low calories (Hossein et al., 2010) and the fruit is rich in essential vitamins and minerals. It contains 89.0 g of water, 1.4 g protein, 1.0 g fat, 8.0 g carbohydrate, 1.5 g celloluse, 130 mg calcium, 105 mg vitamin c and 1.6 mg Iron. In particular, eggplant is a good source of calcium, phosphorus and iron salts for bone and blood cell formation in the body, as well as a reasonable source of vitamin A (Carotene), Vitamin B- complex and vitamin C, all essential for good health (Romain, 2001).

There are many eggplant varieties that are different from their shapes, sizes and colours. Among them are Terung Telunjuk, Terung Rapuh, Terung Susu, Terung Pipit, Terung Bulu, Terung Meranti, and Terung Asam. Terung Telunjuk, or its scientific name Solanum sp., is a kind of wild relatives of eggplant cultivars. Unlike commercial eggplant in the market, this crop is typically neglected and disregarded as a primary food crop due to lack of consumer awareness, promotion and inconsistent seed supply. Whilst being a cheap source of food and fibre, these plants also serve medicinal and nutritional purposes. A study was conducted at Malaysian Agricultural Research and Development Institute (MARDI), Serdang to evaluate the potential of Terung Telunjuk to contribute to food and nutritional security. The study showed that Terung Telunjuk has a good nutritional value in line with commercial eggplant. In fact, this variety has minimal in pests and diseases issues and require less agriculture inputs. Typically, this variety is grown in home garden for their own food. However, it has the potential to be cultivated substantially for high production and thus can increase the farmers’ household income. Findings from this study are well-aligned in vegetables industry to increased production and finally reduce our dependency on imported vegetables.

261

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Field experimental procedure

The study was conducted to evaluate the food production potential of Terung Telunjuk (Solanum sp.). Three varieties were used in the experiments which were Terung Telunjuk, Terung Bulat (MTE) and Terung Panjang. All seeds were sown in the glasshouse and transferred to the field 3 weeks after germination. They were planted on raised bed measuring 60 cm height and 100 cm wide. The trial was established as single row planting with 240 cm between plants in the row and 200 cm between rows using Randomised Complete Block Design with three replicates. Standard culture practices were applied. Data for days to flowers, plant height, fruit number per plant, fruit weight and fruit yield were recorded. Analysis of variance was used to distinguish the plant means (SAS software). Significant differences (P<0.05) between means were determines by Duncan Multiple Range Test.

Inventory of pests

A total of three insect sampling techniques were carried out i.e. scoring, yellow sticky traps (YST) and sweeping (using sweep net). All techniques were applied according to the growth stage of each kind of eggplants. All insects obtained have been identified at MARDI Insect Museum. Data were analysed by using Minitab 18.

Isolation and identification of bacteria, fungi and viruses in eggplant

Inventory of plants that infected by bacteria, fungi and viruses was done routinely based on the symptom’s development. Samples of infected plants will be collected and washed with 10% Clorox followed by 70% alcohol and three times rinse with distilled water. The clean samples were then used for bacteria and fungus isolation. To isolate the bacteria, sample was crushed using mortar and pestle. Subsequently, the sap was spread on Nutrient Agar (NA) plate prior to incubation at 25°C for 1-2 days. Meanwhile for isolation of fungus, a cut of clean sample was placed on the Potato Dextrose Agar (PDA) media which then incubated at room temperature for 3-7 days. Isolation of virus was done by inoculating host plants with the sap of infected plants. Formation of lesion was observed and the infected leaves were then used in virus identification.

For species identification, DNA samples of bacteria, fungi and viruses were extracted using DNA and/or extraction kit following manufacturer's instruction manual. Polymerase chain reaction (PCR) was performed using universal primers; 16S rRNA and 18S rRNA respectively for bacteria and fungi whilst specific primer was used for identification of virus.

Determination of antioxidant activity (2,2-diphenyl-1-picrylhydrazyl (DPPH))

Scavenging activity of the Solanum extracts on 2,2-diphenyl-1-picrylhydrazyl (DPPH) radicals was assayed according to Molyneux (2004) with slightly modifications with minimum exposure of light. Various concentrations of the Solanum crude extracts in methanol were prepared to give a final volume of 7 µL and were mixed with 280 µL of methanolic solution containing DPPH (Sigma, USA) radicals resulting in a final concentration of 0.06 mM. The mixture was vigorously shaken and left to stand for 30 min. in the dark. The absorbance was measured at 517 nm. Meanwhile, ascorbic acid (Sigma, USA) was used as the positive control. The results were expressed as IC50 value (mg/mL), which is the inhibitory concentration at which DPPH radicals were scavenged by 50%.

Determination of total phenolic content (TPC)

Total phenolic content of the Solanum extracts was estimated by a colorimetric assay as described by Singleton and Rossi (1965) with slightly modifications with minimum exposure of light. Crude

262

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

extracts (50 µL) were mixed with 100 µL of Folin Ciocalteau’s phenol reagent (Merck, Germany). After 3 minutes, 100 µL of 10% sodium carbonate (Na2CO3) (Sigma Aldrich, USA) was added to the reaction mixture and allowed to stand in the dark for 60 minutes. The absorbance was measured at 725 nm and the total phenolic content was obtained from a calibration curve using gallic acid (0-10 µg/mL) as a standard reference. The test was run in triplicate. The results were mean values ± standard deviations and expressed as mg gallic acid per 100 g samples.

Results and Discussion

Yield traits

Analysis of variance showed that the three varieties were not significantly different for days to flower and their plant height. However, it showed significantly different for fruit number per plant, fruit weight and yield (Table 1). The mean of fruit number per plant was 34.5 for Terung Telunjuk. Besides, the mean of Terung Telunjuk fruit weight and total fruit harvested was 17.37 g and 596.60 g respectively. Note that the fruit size of Terung Telunjuk is much smaller than Terung Bulat (MTE) and Terung Panjang. The size is about 12 cm long and 2 cm wide giving it a light weight compared with others two varieties. Although the total yield of Terung Telunjuk is lower than the larger-sized commercial eggplant, its market price is more expensive than the commercial eggplant. Rasmuna et al. (2018) reported that the analysis of cost of production showed that these traditional vegetables are viable and able to generate relatively high net profit.

Table 1: Mean of days to flowers, plant height, fruit number, fruit weight and yield of Terung Telunjuk and two commercial varieties. Days to Plant height Fruit Fruit weight Varieties Yield/ plant (g) flower (cm) no./plant (g)

Terung Telunjuk 60.37ab 30.10cd 34.50a 17.37g 596.60f

Terung Bulat 56.30bcd 31.47bcd 19.80bcde 123.97a 1880.70ab (MTE)

Terung Panjang 55.13cd 36.87abc 15.17e 96.20c 1912.70ab Mean values with the same letter(s) are not significantly different at p<0.05.

Inventory of pests and diseases on eggplant varieties

Five major types of pests have been identified as red spider mites, thrips (Thrips sp.), green leafhoppers (Amrasca sp.), fruitfly (Bactrocera dorsalis) and whitefly (Bemisia tabaci). It was found that the percentage of green leafhopper infestation on Terung Telunjuk was lower than Terung Panjang and Terung Bulat (MTE2) which was 58% compared to 61% and 69% respectively (Figure 1). The percentage of thrips infestation on Terung Telunjuk is significantly lower than the Terung Panjang and Terung Bulat (MTE2). No infestations of red spider mites, fruitfly and aphids have been found on Terung Panjang.

Terung Panjang was observed to be most susceptible to virus whilst Terung Bulat most susceptible to fruit borer. This is indicated in Figure 2 with 45% and 47% of disease incidence respectively. Observation of rust and anthracnose that caused by fungi were least occurred in Terung Telunjuk when compared to Terung Bulat and Terung Panjang. Moreover, Terung Telunjuk also shows of lowest percentage attacked by the fruit borer. Findings of this study show that Terung Telunjuk is a potential species to be cultivated based on its minimal issue of diseases occurrence.

263

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Percentage of pest attack on eggplant varieties.

Figure 2: Percentage of disease symptom on eggplant varieties.

Nutritional and antioxidant activity on eggplant varieties

All the crude extracts were sent to accredited laboratory (Unipeq, UKM) for the mineral testing. Among three crude extracts, Terung Telunjuk was found rich in essential micronutrients (Ca = 262 mg/kg; Fe = 52 mg/kg; Mg = 251 mg/kg; Na = 276 mg/kg and Zn = 22 mg/kg) (Figure 3). Meanwhile, radical scavenging test showed that, Terung Telunjuk has the strongest antioxidant activity with IC50 = 6.11 mg/mL compared to others eggplant varieties (Figure 4). Lowest value of IC50 indicates the strongest antioxidant activity. In addition, total phenolic content (TPC) obtained from Terung Telunjuk was 35.61 mg/g, highest compared to others eggplant varieties. Hence it is suggested that the high amount of phenolic content presence in the Terung Telunjuk responsible to its strongest antioxidant activity.

Figure 3: The concentration of mineral content in eggplant varieties.

264

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 4: The antioxidant activity IC50 values and total phenolic content (TPC) of eggplant varieties.

Conclusions

The study showed that Terung Telunjuk was found rich in essential micronutrients in line with commercial eggplant. Furthermore, it has the strongest antioxidant activity compared to others eggplant varieties. In fact, this variety has minimal in pests and diseases issues and require less agriculture inputs. Typically, these varieties are grown in home garden for their own food. However, it has the potential to be cultivated substantially for high production and thus can increase the farmers’ household income. Findings from this study are well-aligned in vegetables industry to increased production and finally reduce our dependency on imported vegetables.

References

Daunay, M.C., Laterrot, H. and Janick, J. 2008. Iconography and history of Solanaceae: Antiquity to the 17th century. In: Janick, J. (Ed.), Horticultural Reviews, Volume 34, John Wiley and Sons, Inc., Hoboken. Hossain, M.E., Alam, M.J., Hakim, M.A., Amanullah, A.S.M. and Ahsanullah A.S.M. 2010. An assessment of physicochemical properties of some tomato genotypes and varieties grown at Rangpur. Bangladesh Research Publications Journal 4: 235-243. Kalloo, G. 1988. Vegetable Breeding, Volume III. CRC Press, Boca Raton, FL. Li, H., Chen, H., Zhuang, T. and Chen, J. 2010. Analysis of genetic variation in eggplant and related Solanum species using sequence-related amplified polymorphism markers. Scientia Horticulturae 125(1): 19-24. Molyneux, P. 2004. The use of the stable free radical diphenylpicryl-hydrazyl (DPPH) for estimating antioxidant activity. Songklanakarin Journal of Science and Technology 26(2): 211-219. Rasmuna, M.M., Noorlidawati, A.H., Siti Zaharah, P., Nor Azlina, S. and Nur Liyana, M. 2017. Kajian penilaian ekonomi dan penerimaan sayuran tradisional di kalangan penduduk Malaysia. Laporan kajian sosioekonomi. Pusat Penyelidikan Ekonomi dan Sains Sosial, MARDI, Serdang. Romain, H.R. 2001. Crop production in Tropical Africa. DGIC, Brussels, Belgum, pp. 4444-4449. Singleton, V.L. and Rossi, J.A. 1965. Colorimetry of total phenolics with hosphomolybdic- phosphotungstic acid reagents. American Journal of Enology and Viticulture 16: 144-158.

265

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Employing Stable Isotope to Determine Soil, Water and Origin of Water Taken Up by the Trees in Tropical Rainforest

Marryanna, L.1,*, Yoshiko, K.2, Siti-Aisah, S.1, Satoru, T.3, Shoji, N.4, Masayuki, I.2, Masanori, K.2 and Naoko, M.5 1Forest Research Institute Malaysia, 52109 Kepong, Selangor Darul Ehsan, Malaysia. 2Kyoto University, Kyoto 606-8502, Japan. 3Kansai Research Center, Forestry and Forest Products Research Institute, Kyoto 612-0855, Japan. 4Forestry and Forest Products Research Institute (FFPRI), Tsukuba, Ibaraki 305-8687, Japan. 5Graduate School of Bioresources, Mie University, Tsu, Mie 514-8507, Japan. *E-mail: [email protected]

Introduction

Research has demonstrated that tropical rainforests maintain evapotranspiration (ET) even during dry period (Tani et al., 2003). Pasoh Forest Reserve (FR), which is located in a dry zone of Peninsular Malaysia, had received the lowest yearly rainfall amount among adjacent south-eastern tropical rainforests and maintained relatively stable ET even during the driest period, based on 7 years of continuous eddy covariance (EC) measurement (Kosugi et al., 2012a). Consequently, stable annual ET rates (1,287±52 mm) were obtained despite the relatively small annual rainfall amount (1,805±280 mm, from 1995 to 2015) (Kosugi et al., 2012a) compared to other Southeast Asian tropical rainforests (Kume et al., 2011; Noguchi et al., 2003). No obvious decline in monthly ET variability was detected even during the driest month, although the amount of rainfall was much lower than ET (Kosugi et al., 2012a). The Amazonian tropical forest, which has distinct dry and wet periods, had also consistently demonstrated this characteristic (da Rocha et al., 2004; Costa et al., 2010). The stability of ET in dry periods and in the dry season seen in tropical rainforests should be supported by stable water sources in the soil throughout the seasons. Hence, investigation should be conducted to determine the source of water for this.

Stable isotope such as hydrogen and oxygen isotopes (δ18O and δ2H) is a tracer which is useful for investigating soil water residence time and water uptake by the trees (Ehleringer and Dawson, 1992; Evaristo et al., 2015). Isotope is any two or more forms of a chemical element, having the same number of protons but different number of neutrons. According to International Atomic Energy Agency (IAEA), stable isotopes are non-radioactive forms of atoms. The deuterium excess (or d- excess), is defined by d (‰) = δ2H-8*δ18O and is a proxy for continental moisture recycling (Dansgaard, 1964).

Here we assessed the values of hydrogen (δ2H) and oxygen (δ18O) isotopes in precipitation, soil water at different depths, and xylem water of Dipterocarpus sublamellatus, Xanthophyllum stipitatum, Ptychopyxis caput-medusae, Syzygiium rugosum, Diplospora malaccensis, Homalium dictyoneurum, Baccaurea parviflora and Macaranga lowii at Pasoh FR. The goal of this assessment was to determine how the seasonal variability of δ18O and δ2H in precipitation is integrated in soil water and in xylem water of trees; to resolve the distribution of precipitation in the soil; and to identify the temporal origin of a tree’s source water, that is, to determine which rain event is used by the trees throughout a season.

Materials and Methods

Site description

The study was conducted in a lowland dipterocarp forest within the 6 hectares of Pasoh FR located at 2° 58’ N, 102° 18’ E at approximately 75 to 150 metres above sea level (m.a.s.l.). The soil in this area

266

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

belonged to the local Durian series, which was classified as an ultisol with a yellowish silt-clay layer (40-80 cm thick), overlaying a blocky indurated lateritic horizon (30-40 cm thick) on top of mottled white clay that overlaid weathered shale down to a depth of 130-150 cm (Leigh, 1982). The maximum depth of tap roots was about 4 m (Niiyama et al., 2010); most of the fine roots were found at the A horizon (Amir Husni, 1989). The canopy height ranged between 30 and 40 m with emergent trees of ~45 m. Rainfall distribution in Pasoh FR was short duration and high intensity, with a mean annual rainfall of 1,805 mm (1995–2015) and mean annual air temperature of 25.4°C (1997-2011) (Noguchi et al., 2003, 2016; Marryanna et al., 2017).

Soil water content and evapotranspiration

The volumetric soil water content (VSWC) was measured using time domain reflectrometry (TDR) sensors (CS615 or CS616, Campbell Scientific) at depths of 0.1, 0.2 and 0.3 m at three points around the tower logged at the 30-minute intervals (Noguchi et al., 2016). The daily average value of these nine sensors were used as a reference VSWC for the surface layer between 0 and 0.5 m. Eddy covariance (EC) fluxes of sensible heat and water vapour were measured at a height of 54 m on the flux tower. ET measured from the flux tower included of transpiration, interception evaporation, and soil evaporation. Four years of data from January 1, 2012 to December 31, 2015 was used in this study, which is compatible with water sampling for isotope analysis. The antecedent precipitation index (API60) also used as a wetness index for the study area. The API60 is defined as: where is daily precipitation (mm), and i is the number of preceding days (Kosugi et al., 2007).60 ∑푖=1 푃푖/푙 i Precipitation,P stream, plants, and soil sampling

Rainwater samples for isotope analysis were collected daily at 8:00-9:00 a.m. from September 2012 to December 2015 from a storage-type rain gauge installed at the observatory station. Stream water samples were collected on 19 occasions between January 2013 and December 2015 from the main stream between the 6-ha plot and the 50-ha plot (about 2000 m away from the flux tower). Soil and plant samples were obtained from the area surrounding the flux tower at Pasoh FR. Four sampling events were conducted for eight species of plants of different sizes and soils at different depths. Water extraction was conducted using a cryogenic vacuum distillation system (West et al., 2006) which is the most widely utilised method for plant and soil water extraction (Orlowski et al., 2013). A cavity ring- down spectrometer (CRDS) (L2120-i, Picarro, CA, USA) was used to analyse the isotope composition of the samples. The delta (δ) notation indicates the isotopic ratio value of a water sample with respect to the Vienna Standard Mean Ocean Water (VSMOW).

Results and Discussion

Temporal trend of ET in Pasoh FR

Temporally, it was found that there was no decrease in ET even in dry period. The percentage ratio of ET to precipitation ranged between 62% in 2014 and 74% in 2015. The annual average ET for four years was 1182 mm per year. Generally, ET has stable trend although several declining values detected in the rainy season at the end of the year (Marryanna et al., 2017). Water evaporated from forest every day even in the driest period with the average of 3.24 mm (SD 0.86) per day. Temporally, one-month antecedent water supply showed water supply not sufficient for plant consumption. Additional two-month antecedent water supply was also not sufficient to accommodate plant water use for dry period. We looked for the four-month antecedent water supply and found that it was still insufficient for plant water use. During the severe dry period (12-13 March 2014), at least four months of reserved water was required in Pasoh FR to accommodate ET demand (Figure 1).

267

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Spatial trend of ET in Pasoh FR

After analysing the temporal trend of ET in this forest, we looked at the spatial trend to investigate water source of the ET during wet and dry period in this forest. Spatially, plants in Pasoh FR usually obtained their water supply from the surface soil layer (0-0.5 m) and from the deeper layer when the soil water content at 0-0.5 m decreased. The declining slopes of evaporative demand in June 2013 and March 2014 were greater than the declining slopes of soil water storage at 0-0.5 m. The ET demand in June 2013 was approximately 50%, and in March 2014 only 10% of ET was supplied from surface soil layers. This indicated that water was supplied from deeper soil layers during prolong dry period. The stable isotope used to verify the spatial and temporal water source and usage of forest environment in Pasoh FR. Figure 2 shows the isotopes signature of precipitation, stream, and soil and plant water.

Figure 1: Temporal trend of precipitation and evapotranspiration demand in Pasoh FR.

268

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 2: Isotope signatures of precipitation, stream, soil, and plant water at Pasoh Forest Reserve. (A) Time series fluctuation in δ18O of precipitation, stream, and soil water at 0.05, 0.3, and 3.0 m. The relationship between δ18O and δ2H for (B) rainfall, stream, soil, and plant water; (C) soil water; and (D) plant water.

During the dry period, for 30-day antecedent rainfall, most plant water isotopic contents were different from rainwater, while for longer (60-day) antecedent rainfalls, rainwater isotopic contents corresponded with plant and soil water, although plant water still deviated slightly from the rainwater meteoric water line. During the very dry period (12-13 March 2014), most rainwater values were larger than soil and plant water values for 60-day antecedent rainfall, and 120-day antecedent rainfall should be analysed to identify the source water for plants and soils. The isotope values of plant water became closer to those of soil water in this very dry period, and both soil and plant water (except at 3.0 m soil) deviated from the rainwater meteoric water line. The isotope values of plant water can be explained by the soil water mixture. During very wet periods in the rainy season the soil and plant water isotopic signature corresponded with the rainwater meteoric water line for 30-day antecedent rainfall, but did not fall within the range of antecedent rainfall between 31 and 60 days. Soil water at all depths did not show any deviation from rainwater. Most water (except P. caput-medusae) did not show any deviation from the local meteoric water line (LMWL); however, some plant species had more negative values and was out of the range of soil water. Isotope signals from different tree heights and species at different periods did not show any clear tendency towards a specific water uptake depth. Plant water isotope values were mostly deviated to the right side of the rainwater LMWL. They also differed from the values of soil water at any depth, and became closer to those of soil only in the very dry period.

Conclusion

ET during the observation years was lower than in previous studies however, a stable pattern was observed. Temporally at least four months of water storage is needed to accommodate ET needs during a very dry season. Spatially, plants in Pasoh FR typically obtained their water supply from the surface soil layer (0-0.5 m), and sourced further water from deeper layers during the dry period. Deep rooting and stomatal control are two well-known mechanisms that allow plants to cope with periods of high atmospheric demand and low water availability. Isotope analysis results show that plants, soil, and stream have different sources of water in this forest. Similarity in rainwater and stream water,

269

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

indicating the dominance of ‘new’ water runoff. The source of water for this forest does not have a distinct pattern corresponding to soil depth and tree height suggesting the existence and use of water storage in tree xylem. Occasional isotopic differences between plants and soil water, was probably due to difference in plant water source and water strongly bounded to the soil.

Acknowledgements

We would like to acknowledge the contribution of RONPAKU Fellowship grant, Japanese Society for the Promotion of Sciences (JSPS), JSPS KAKENHI grant number 24255014, 17H01477, and the Coca-Cola Foundation. Appreciation extended to the Forestry Department Peninsular Malaysia (FDPM) and the Forest Research Institute Malaysia (FRIM) for allowing the study to be conducted at Pasoh FR.

References

Amir Husni, M.S. 1989. Site fertility and carrying capacity in two Malaysian tropical forest reserves. University of Aberdeen. Ph.D. Thesis. 391p. Costa, M.H., Marcia, C.B., Sanches, L., Ana, C.M.M., Hutyra, L.R., da Rocha, H.R., Aguiar, R.G. and Araujo A.C. 2010. Atmospheric versus vegetation controls of Amazonian tropical rain forest evapotranspiration: Are the wet and seasonally dry rain forest any different? Journal of Geophysical Research 115. G04021, https://doi.org/10.1029/2009JG001179. da Rocha, H.R., Goulden, M.L., Miller, S.D., Menton, M.C., Pinto, L.D.V.O., Freitas, H.C. and Figueira, A.M.S. 2004. Seasonality of water and heat fluxes over a tropical forest in eastern Amazonia. Ecological Application 14: S22-S32. https://doi.org/ 10.1890/02-6001. Dansgaard, W. 1964. Stable isotopes in precipitation. Tellus 16: 436-468. Ehleringer, J.R. and Dawson, T.E. 1992. Water uptake by plants: perspectives from stable isotope composition. Plant, Cell and Environment 15: 1073-1082. https://doi.org/10.1111/j.1365- 3040.1992.tb01657.x Evaristo, J., Jasechko, S. and Mcdonnell, J.J. 2015. Global separation of plant transpiration from groundwater and streamflow. Nature 525: 91-94. https://doi.org/10.1038/nature14983. Kosugi, Y., Mitani, T., Itoh, M., Noguchi, S., Tani, M., Matsuo, N., Takanashi, S., Ohkubo, S. and Abdul Rahim, N. 2007. Spatial and temporal variation in soil respiration in a Southeast Asian tropical rainforest. Agricultural and Forest Meteorology 147: 35-47. https://doi.org/ 10.1016/j.agrformet.2007.06.005. Kosugi, Y., Takanashi, S., Tani, M., Ohkubo, S., Matsuo, N., Itoh, M., Noguchi, S. and Abdul Rahim, N. 2012a. Effect of inter-annual climate variability on evapotranspiration and canopy CO2 exchange of a tropical rainforest in Peninsular Malaysia. Journal of Forest Research 17: 227- 240. https:// doi.org/10.1007/s10310-010-0235-4. Kume, T., Tanaka, N., Kuraji, K., Komatsu, H., Yoshifuji, N., Saitoh, T.M., Suzuki, M. and Kumagai, T. 2011. Ten-year evapotranspiration estimates in a Bornean tropical rainforest. Agriculture and Forest Meteorology 151: 1183-1192, https://doi.org/10.1016/j.agrformet.2011.04.005. Leigh, C.H. 1982. Sediment transport by surface wash and throughflow at the Pasoh Forest Reserve, Negeri Sembilan, Peninsular Malaysia. Geografiska Annaler 64 A (3-4): 171-180. https://doi.org/ 10.2307/520644. Marryanna, L., Kosugi, Y., Itoh, M., Noguchi, S., Takanashi, S., Katsuyama, M., Tani, M. and Siti Aisah, S. 2017. Temporal variation in stable isotopes in precipitation related with rainfall pattern in a tropical rainforest in Peninsular Malaysia. Journal of Tropical Forest Sciences 29(3): 349-362. https://doi.org/10.26525/jtfs2017.29.3.349362. Marryanna, L., Kosugi, Y., Takanashi, S., Noguchi, S., Itoh, M., Katsuyama, M., Matsuo, N. and Siti- Aisah, S. 2017. Evapotranspiration and water source of a tropical rainforest in Peninsular Malaysia. Hydrological Processes 31: 4338-4353. Niiyama, K., Kajimoto, T., Matsuura, Y., Yamashita, T., Matsuo, N., Yashiro, Y., Azizi, R., Abd Rahman, K. and Nur Supardi, N. 2010. Estimation of root biomass based on excavation of

270

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

individual root systems in a primary dipterocarp forest in Pasoh Forest Reserve, Peninsular Malaysia. Journal of Tropical Ecology 26: 271-284. https://doi.org/10.1017/S0266467410000040. Noguchi, S., Abdul Rahim, N. and Tani, M. 2003. Rainfall characteristics of tropical rainforest at Pasoh Forest Reserve, Negeri Sembilan, Peninsular Malaysia. In: Okuda, T., Manokaran, N., Matsumoto, Y., Niiyama, K., Thomas, S.C. and Ashton, P.S. (Eds.), Pasoh: Ecology of a Lowland Rainforest in Southeast Asia, Springer, Tokyo. Pp. 51-58. Noguchi, S., Kosugi, Y., Takanashi, S., Tani, M., Niiyama, K., Siti Aisah, S. and Marryanna, L. 2016. Long term variation in soil moisture in the Pasoh Forest Reserve, a lowland tropical rain forest in Malaysia. Journal of Tropical Forest Science 28: 324-333. Orlowski, N., Frede, H.G., Brüggemann, N. and Breuer, L. 2013. Validation and application of a cryogenic vacuum extraction system for soil and plant water extraction for isotope analysis. Journal of Sensor and Sensor System 2: 179-193. https://doi.org/10.5194/jsss-2-179-2013. Tani, M., Abdul Rahim, N., Ohtani, Y., Yasuda, Y., Sahat, M.M., Baharuddin, K., Takanashi, S., Noguchi, S., Zulkifli, Y. and Watanabe, T. 2003. Characteristics of energy exchange and surface conductance of a tropical rain forest in Peninsular Malaysia. In: Okuda, T., Manokaran, N., Matsumoto, Y., Niiyama, K., Thomas, S.C. and Ashton, P.S. (Eds.), Pasoh: Ecology of a Lowland Rain Forest in Southeast Asia, Springer, Tokyo. Pp. 73-88. West, A.G., Patrickson, S.J. and Ehleringer, J.R. 2006. Water extraction times for plant and soil materials used in stable isotope analysis. Rapid Communication in Mass Spectrometry 20: 1317-1321. https://doi.org/10.1002/rcm.2456.

271

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Evaluation of Media for Early Growth on Mesta (Garcinia mangostana) Seedling

Mohd Ridzuan, M.D.1,* and Ab Kahar, S.2 1Horticulture Research Centre, Malaysian Agriculture Research and Development Institute (MARDI), 06050 Bukit Kayu Hitam, Kedah, Malaysia. 2Horticulture Research Centre, Malaysian Agriculture Research and Development Institute (MARDI), 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Mangosteen (Garcinia mangostana Linn.) cultivation has very long history in Malaysia, the area of production is remaining almost stagnant in the entire country (Jabatan Pertanian Semenanjung Malaysia, 1999). Mangosteen is a fruit with good potential both for processing and fresh consumption. Production mangosteen into the form of juice and functional food product would be a course change the scenario of the mangosteen industry from a neglected species to a high value crop. Thus, good planting materials should be enough to supply the need for farmer to increase the acreage of mangosteen cultivation. Mesta refers to the oblong variant of mangosteen. Mesta originated from Pahang, Malaysia has been registered with the registration number GA2 in 1993 by Department of Agriculture, DOA (Jabatan Pertanian Semenanjung Malaysia, 1999).

Fruits are ovate in shape, the flesh is sweet and less juicy. Mesta is a perennial tree and well known as a crop with very long juvenile period (6-9 years). Trees are slightly smaller and shorter than mangosteen. At the early stage of growth Mesta has long main root. However, the development of lateral roots which responsible for water and nutrient is very poor. The slow growth of Mesta is most probably due to the poor rooting system. Based on plant characteristic, high quality media with proper physical and chemical properties can result good plant growth (Verdonck et al., 1992; Muhammadi A., 2015). The growth of the Mesta can be accelerated and shorted the juvenile period due to the suitable media combination and management in the nursery. This experiment can be a formula in making for Advance Planting Material (APM) in Mesta industry through media aspect. Thus, these experiments were conducted to determine suitable media combination to encourage the growth of Mesta at early stage.

Materials and Methods

The experiment was conducted at MARDI Jelebu, Negeri Sembilan. For this experiment, the Mesta seedlings were obtained from Jabatan Pertanian, Pahang aged about 12 months old. The media combinations were being tested in this experiment contain soil, sand, peat and empty fruit bunch (EFB) with certain ratio shown in Table 1. The T1 are the control treatment. The seedling is transplanted into 45cm x 60 cm polybags with different media combination and placed at Nursery under 50% shaded netting. During experiment, all seedlings watered once every day. The experiment was using RCBD design with 3 replications which each replication consists of 9 seedlings. The parameters such as height (from media surface beside plant stem to plant tip) and girth (1in from the media surface facing one direction) were taken every month for 12 months and soil properties were taken once at 3 months after planting. Experimental data were analysed using SAS software and the means were compared using Duncan multiple range test.

272

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Description of the treatments. Treatments Types of media T1 – soil + sand + peat (3:2:1) (Control) T2 soil + EFB (5:1) – Soil base T3 – soil + EFB (3:1) T4 – soil + peat (3:1) T5 – peat + EFB (5:1) T6 – peat + EFB (3:1) Soilless base T7 – Peat (1)

Results and Discussion

For bulk density, the readings for T1, T2, T3 and T4 give higher values than T5, T6 and T7 because the media are containing the soil (Table 2). Therefore, the low values such T5, T6 and T7 indicate that the media are a light media. The relationship of the treatments for bulk density was as follow T1>T4>T3>T2>T6>T7>T5. For porosity, T7 gave higher percentage with 71.08% and T4 gave the lowest percentage with 37.45%. The relationship of the treatments for porosity was as follow T7>T6>T5>T4>T1>T2>T3. The porosity of the media was significant factor affecting plant growth (Jarvis et al., 1996; Mary et al., 2004). After irrigation and drainage, the current guidelines for media in container at nursery should have 0.19-0.70 g/cm3 in bulk density and 50-85% in porosity (Yeager et al., 2007). When the media are high in porosity value, root can be easy to establish and grow compare to lower value of porosity. It is due to more room to expend, the root can easier to elongate. The slow growth of the Mesta plant is due to the poor growth of the root system (Roedhy P., 2002). It has no root hair, grows slowly and is easily to broken by adverse environments (Cox, 1988). Based on this fact, we expected that an improvement root system using soilless base media would increase the growth of Mesta.

Treatment 4 gave the highest result in height and girth with respectively 123.20 cm and 20.30 mm but there is no significant difference with T1 (Table 3). Treatment 5 gave the lowest result in height with 71.30 cm while T6 gave the lowest result in girth with 16.69 mm where there has a significant difference with T1. Also, there has a significant different in height between soil base media with soilless base media. Soil base media have slightly steeper increasing in height compared to soilless base media where the growths are a bit flatter (Figure 1). However, when we relate the results from soil properties with the growth of the plants, media with lower porosity has better growth than high porosity media. These results show an opposite finding from the prediction with a significant difference between these two types of media. This is because the media with lower in porosity are containing soil. Soil has the ability to hold nutrient better than other substrates. From the growth rate, it also indicates that the soil base media can accelerate the growth of Mesta at early growth.

Table 2: Soil properties of the media at 3 months after planting. Treatments Bulk density (g/cm3) Porosity (%) T1 1.79 42.72 T2 1.62 38.28 T3 1.63 37.45 T4 1.65 49.01 T5 0.67 63.39 T6 0.93 66.33 T7 0.87 71.08

273

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 3: Effect of media combination on Mesta seedlings growth at 12 months after planting. Treatments Height (cm) Girth (mm) T1 116.82ab 20.10a T2 99.12c 18.36bc T3 108.07bc 19.36ab T4 123.20a 20.30a T5 71.30d 17.12cd T6 74.82d 16.69d T7 76.54d 17.89cd Mean with the same letter(s) are not significant different by DMRT at P≤0.05.

140 120 T1 T2 100 T3 80 T4 60 T5 Height, cm Height, 40 T6 20 T7 0 1 2 3 4 5 6 7 8 9 10 11 12 Months Figure 1: Growth pattern of plants in different media for 12 months.

Conclusions

Based on the result, media containing soil and peat (3:1) are the suitable media combination for Mesta. Therefore, it show that Mesta still need soil in the media combination at early grow for better growing.

References

Cox. J.E.K. 1988. Garcinia mangostana – Mangosteen. The propagation of tropical fruit trees p. 361- 375. Jabatan Pertanian Semenanjung Malaysia, 1999. Pakej teknologi manggis Pp. 1-2. Jarvis, B., Calkins, J.B. and Swanson, B.T. 1996. Compost and rubber tire chip as peat substitutes in nursery container media: Effects on chemical and physical media properties. Journal Environment Horticulture 14:122-129. Mary, H.M. and Bruce, A.C. 2004. Effects of media porosity and container size on overwintering and growth of ornamental grasses. HortScience 39(2):248-250. Mohammadi, A. 2015. Effect of plant growth on some physical properties of potting culture media. International Journal Recycle Organic Waste Agriculture 4:205-209. Roedhy, P. 2002 Nurse stock plant–A new technique to enhance mangosteen (Garcinia mangostana) growth. Acta Horticulturae Pp. 575 Verdonck, O. and Gabriels, R. 1992. Reference method for the determination of physical properties of plant substrate. Acta Horticulturae 302:169-179. Yeager, T.H., Fare, D.C., Lea-Cox, J., Ruter, J., Bilderback, T.E., Gilliam, C.H., Niemiera, A.X., Warren, S.L., Whitewell, T.E., Wright, R.D. and Tilt, K.M. 2007. Best management practices: guide for producing container-grown plants, 2nd Edison. Southern nurserymen’s Association, Marietta.

274

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 6

Seed Technology and Quality Planting Materials

275

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Bud Initiation and Stem Diameter of Durio zibethinus var. D168 as Affected by Stem Bending and Different PGR Treatments

1,* 2 1 1 Muhammad Najib, O.G. , Mohd Shaib, J. , Faizah Salvana, A.R. , Nur Asyira, A. and Noor Shahira, M.Y.3 1Gene Bank and Seed Centre, Persiaran MARDI-UPM, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Director General Office, MARDI Klang, 42450 Klang, Selangor, Malaysia. 3School of Food Science and Technology, Universiti Malaysia Terengganu, 21300 Kuala Terengganu, Terengganu, Malaysia. *E-mail: [email protected]

Introduction

Durian, Durio zibethinus is one of the important fruit crops in Malaysia. The export value of durian had reached RM74.4 million for 2016 and is projected to reach RM80 million by 2018 (Charon, 2017). This creates a big demand for supply of quality durian planting material. Durian is propagated mainly via vegetative propagation which is bud grafting technique (Brown, 1997). Grafting is the bringing together of two similar, yet genetically distinct plant parts that can form a composite plant. This technique includes two main parts of the plant which are scion and rootstock. Scion is the cultivar that makes up the top of the plant while rootstock is the lower portion of the grafted plant that will serve as the rooting system. The success of clonal propagation of fruit trees via grafting techniques depends, among others, on a timely supply of high-quality scion materials. The current practice is to produce scions from open-field grown plants which sometimes are old fruiting trees which have been around for too long (Brown, 1997). This causes difficulty in collection of scions as trees are tall but more than this, scions obtained could possibly carry the risks of diseases such as canker and anthracnose. In addition, the quality of these scions might vary according to the environment where the budwood trees were grown (Mohd Shaib et al., 2014).

In promoting bud development of fruit trees, several treatments had been studied previously. Among others, the most common techniques are mechanically stressing the plants and introduction of exogenous plant growth regulators. Previous studies showed that shoot bending was an effective measure widely used for promoting flower bud formation in many fruit trees, such as pear (Ito et al., 2004) and apple (Lauri and Lespinasse, 2001). Plant hormones play the main role to stimulate or inhibit the plant growth. Plant growth regulators (PGRs) are very important growth factors affecting the growth of plant such as regulating cell division and promoting cell elongation (Bari and Jones, 2009). Usage of PGRs such as paclobutrazol (PAC), benzylaminopurine (BAP) and gibberelic acid (GA3) is a common practice in altering plant conformation. For durian, usage of PGRs needs to be evaluated for potential impacts of stimulating new bud initiation which could lead to healthy scion. Thus, this study was conducted to investigate the effects of stem bending and different PGR treatments on production of new buds in D168 clone durian.

Materials and Methods

Plant materials and growth conditions

Two-year old D168 durian clones were grown in 16 in x16 in polybags at a distance of 1.2 m x 0.8 m under a 3400 ft2 shade house with 50% light penetration and watered via an overhead sprinkler system (Figure 1(a)). The total number of plants grown was 144. Plant maintenance was carried out according to the normally recommended practices as recommended by Department of Agriculture (DOA, 2012).

276

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Stem bending and PGR treatments

Plants were bent by tying the main stem of the plants to a pole which was placed approximately two feet from the polybags (Figure 1(b)). Three types of PGR were used in this study namely paclobutrozol, BAP and GA3. For each type of PGR, three different levels of PGR concentrations of 0, 50 and 100 ppm were given by spraying the leaves and manually drench the media with 30 mL of the solution.

Buds number and growth of stem

Stem growth (diameter) and number of new buds were calculated by the difference between readings before and after 12 weeks of treatment. Stem diameter was taken by measuring the lowest part of stem using Electronic Digital Caliper (Model SCM DIGV-6) while number of new buds was counted manually.

Experimental design and data analysis

The treatments comprising two plant structures, three PGR types and three PGR levels were arranged in a split-split plot design with structure as the main plot, PGR types as the sub-plot and PGR levels as sub-sub plot with 8 replications. The data obtained were analysed using ANOVA in the SAS software (Version 9, SAS Institute Inc. Cary, North Carolina, USA) and differences between treatment means were compared using Duncan’s Multiple Range Test (DMRT) at P≤0.10.

(a) (b)

Figure 1: D168 clones grown under shade house (a) and stem bending (b).

Results and Discussion

Among all the main effects tested, number of buds for D168 durian was significantly affected only by PGR level (P<0.10) with no significant interaction recorded between the main effects. Plants treated with 100 ppm PGR, regardless of PGR type, had significantly higher number of buds compared to those without PGR with percentage a difference of 50.88% (Table 1).

High bud initiation in plants treated with high level of PGR is due to the functions of PGR in promoting plant growth, particularly for BAP and GA3. Paramita et al. (2018) reported that increasing number of leaves per plant is associated with GA3 (100 ppm) function in increasing internodal length, promoting cell division, cell enlargement and enhanced apical dominance which can indirectly increase the auxin content. The same results were obtained by Moon et al. (2003) where application of GA3 at 100 ppm on Satsuma mandarin was reported to considerably increase the number of vegetative shoots. Results obtained in this study were also in accordance with a study reported by Brennan et al.

277

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

(2015) where high levels of BAP at 100 or 500 ppm significantly increase the rate of bud rate and shoot elongation of four Quercus species. Being one of the gibberellins inhibitors, application of Paclobutrazol at optimum rate normally inhibited plant growth by decreasing the internode length (Yeshitela et al., 2004). In this study, application of higher paclobutrazol rate at 100 ppm significantly increased the bud’s initiation instead of inhibiting them. This is due to the action of plant growth regulators which is strongly dependent on its rate of application and environmental conditions (Kishore et al., 2015). Paclobutrazol was reported to enhance photosynthetic pigments and leaf photosynthesis in various crops such as cucumber seedling, oak, stevia and corn (Soumya et al., 2017. Presumably, increase of photosynthetic efficiency led to increase of bud number reported in this study.

The results also revealed that plant structure had significant effect (P<0.05) on stem growth (diameter) with bent plants having 18.02% more stem growth compared to straight plants. On the other hand, no significant effect of plant structure was recorded on number of buds. This result contradicted with what had been reported previously by Xing et al. (2016), where shoot bending significantly promoted bud growth in apple (the length, width and fresh weight per buds) during the flower induction process. Besides that, Ito et al. (1999) also stated that bud development was more rapid on bent than on control shoot regardless of bud position. In apple, pear and rose, bending shoots were also reported to have positive significant effects on bud growth (Xing et al., 2016). These results are associated with the change of phytohormones content in buds in response to shoot bending which promotes the bud growth (Xing et al., 2016). In durian, presumably changes of phytohormones are not affected by the bending treatment thus had no significant effect on the bud initiation.

Table ‎1: Main and interaction effects of structure, PGR and PGR level concentrations on bud number and stem diameter. Factor Bud number Stem growth (mm)

Bent 2.06a 4.78a Structure Control 2.24a 4.05b

PAC 2.48a 4.80a a a PGR GA3 2.10 4.48 BAP 1.85a 3.97a

0 1.71b 4.51a PGR level (ppm) 50 2.15ab 4.71a 100 2.58a 4.02a

Structure ns ** PGR ns ns PGR level * ns Structure*PGR ns ns Structure*PGR level ns ns PGR*PGR level ns ns Structure*PGR*PGR level ns ns **Significant at 5% probability level, *Significant at 10% probability level, ns: Not significant Means in each column with the different letters within each factor indicate significant differences at P≤0.10% level according to Duncan’s Multiple Range Test.

Conclusions

In durian D168 clone, usage of Paclobutrazol, BAP and GA3 at 100 ppm significantly increased bud formation by 50.88%. Stem bending was found to significantly increased 18% of the stem diameter but had no significant effect on inducing new buds.

278

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Acknowledgements

This research work was supported by Short Grant Scheme MARDI (JP-RC-0329). The authors thank the staff of Unit Biji Benih MARDI for setting up the plot and collecting the data.

References

Bari, R. and Jones, J.D. 2009. Role of plant hormones in plant defence responses. Plant Molecular Biology 69: 473-488. Brennan, A., Pence, V., Taylor, M., Trader, B. and Westwood, M. 2016. The effect of 6- benzylaminopurine, a cytokinin, on bud-forcing of twelve oak species. Acta Horticulturae 1140: 331-334. Brown, M.J. 1997. Durio - A Bibliographic Review (R.K. Arora, V. Ramanatha Rao and A.N. Rao, Editors). IPGRI Office for South Asia, New Delhi. Charon W.M. 2017. King of fruit. https://www.thestar.com.my/business/business- news/2017/05/13/the-china-factor-in-durian-prices/. Date accessed on 21 June 2018. Department of Agriculture. 2012. Pakej Teknologi Durian. Ario Press. Federal Agricultural Marketing Authority (FAMA). Statistik Utama Pemasaran FAMA. 2017. http://www.fama.gov.my/web/pub/dokumen. Date accessed on 3 January 2019. Ito, A., Yoshioka, H., Hayama, H. and Kashimura, Y. 2004. Reorientation of shoots to the horizontal position influences the sugar metabolism of lateral buds and shoot internodes in Japanese pear (Pyrus pyrifolia (Burm.) Nak.). Journal of Horticultural Science and Biotechnology 79: 416- 422. Kishore, K., Singh, H.S. and Kurian, R.M. 2015. Paclobutrazol use in perennial fruit crops and its residual effects: A review. Indian Journal of Agricultural Sciences 85(7): 863-72. Lauri, P.E. and Lespinasse, J.M. 2001. Genotype of apple trees affects growth and fruiting responses to shoot bending at various times of year. Journal of the American Society for Horticultural Science 126: 169-174. Mishra, P.P., Pandey, G., Kumura, A., Naik, R. and Pujahari, L.P. 2018. Effect of foliar application of gibberellic acid (GA3) concentrations and spraying frequencies on vegetative and floral attributes of China aster [Callistephus chinensis (L.) Nees.]. International Journal of Current Microbiology and Applied Sciences 7(01): 1889-1894. Moon, Y.E., Kim, Y.H., Kim, C.M. and Ko, S.O. 2003. Effects of foliar application of GA3 on flowering and fruit quality of very early-maturing satsuma mandarin. Korean Journal of Horticultural Science and Technology 21(2): 110-113. Mohd Shaib, J., Shahdan, M., Faizah Salvana, A.R., Ahmad Hafiz, B. and Muhammad Najib, O.G. 2012. Production of durian scions under protected agriculture system. Paper presented at the National Seed Symposium, Putrajaya, Malaysia. Soumya, P.R., Kumar, P. and Pal, M. 2017. Paclobutrazol: A novel plant growth regulator and multi- stress ameliorant. Indian Journal of Plant Physiology 22(3): 267-278. Xing, L., Zhang, D., Zhao, C., Li, Y., Ma, J., An, N. and Han, M. 2016. Shoot bending promotes flower bud formation by miRNA-mediated regulation in apple (Malus domestica Borkh.). Plant Biotechnology Journal 14: 749-770. Yeshitela, T., Robbertse, P.J. and Stassen, P.J.C. 2004. Paclobutrazol suppressed vegetative growth and improved yield as well as fruit quality of ‘Tommy Atkins’ mango (Mangifera indica) in Ethiopia. New Zealand Journal of Crop and Horticultural Science, 32(3): 281-293.

279

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Seed Storage Behaviour of Potential Fruit Species (Lepisanthes fruticosa)

Suryanti, B.*, Noor Camellia, N.A., Nur Atisha, S., Abdul Muhaimin, A.K. and Mohd Shukri, M.A. Program of Genetic Resource and Germplasm Conservation Management, Genebank and Seed Centre, MyGeneBankTM Complex, MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Ceri terengganu or Lepisanthes fruticosa are underutilised fruit trees from the Sapindaceae family that can be found in the Southeast Asia regions such as Malaysia, Thailand, Indonesia, Myanmar, Indo- china and Borneo. In Malaysia, this species is widely distributed in the state of Johor and Terengganu (Abd. Latif et al., 2016). The trees are often used as shading and ornamental trees due to its esthetical value that lies on its attractive tree shapes, light purple young foliage and long purple inflorescences which can then turning into clusters of remarkable shiny bright red fruits (Rukayah, 2006). The fruit can be consumed fresh when fully ripen (Abd. Latif et al., 2016). Lepisanthes fruticosa is also used in traditional medicine by rural folks. The seed is consumed when roasted and the root is used to treat itching and to reduce body temperature during fever. The fruits are rich with anti-oxidant and the value is higher as compared to popular commercialized fruits such as guavas, oranges and apples (Mirfat and Salma, 2015). This species has the good prospect in future to be exploited for commercial production by farmers in Malaysia. Recognizing its importance and potential, storage methods of the seeds should be developed to provide useful information for researchers and growers who working with this species.

One of the conservation methods that possibly can be used is by storing the seeds. Through this method, seeds are normally being dried and kept in the low temperature in order to achieve long storage life. Seeds of species with orthodox seed storage behaviour can be maintained satisfactorily over the long term in such storage conditions (Hong and Ellis, 1996). However, there are also seeds that are drying and chilling sensitive. These types of seeds are known as recalcitrant seeds. Recalcitrant seeds are normally short-lived and the germination rate will decrease rapidly even after a short period of storage (Bajaj, 1995). Recently, the information on the seed storage behaviour of L. fruticosa is scarce. Therefore, this study was conducted to determine the seed storage behaviour of the species by identifying the sensitivity of seed to drying and also storage at different temperature.

Materials and Methods

The effect of different moisture content on the germination of seeds

Seeds (Figure 1b) of Ceri Terengganu (L. fruticosa) were extracted from the ripen fruits (Figure 1a) obtained from the MARDI Serdang Field Genebank. The initial moisture content of seeds was determined by drying the seeds at 103°C for 17 hours. The moisture content on wet weight basis was determined as loss in weight and expressed as percentage (%) of the initial fresh weight of the embryo (Cromarty et al., 1982). Three replications of 10 seeds were used for moisture content determination. The other batches of seeds were dried in desiccator containing silica gel to the desired moisture content (DMC %) namely 50, 40, 30, 20 and 10%. To determine whether seed have reached the DMC %, seed moisture content can be monitored by weighing before (initial weight) and during desiccation. The following fomula was applied to determine the weight of seeds at 50, 40, 30, 20 and 10% of moisture content (Hong and Ellis, 1996):

280

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Weight of seed (g) at DMC% :

(100 – initial moisture content %) ------X Initial Seed weight (g) (100 – Desired Moisture Content %)

After the seeds reached the weight at every DMC, seeds were taken out from the desiccator and 10 seeds were sown on sterilized sand media for germination and replicated for 3 times. The germination was done in an air-conditioned room (25°C±2, 55% relative humidity). Seeds without desiccation (initial moisture content) were used as a control treatment. Weekly observations were done on germination percentage of seeds for 4 weeks.

The effect of storage temperature on the germination of seeds

Seed were desiccated to the DMC of 40%, and kept in an air tight container stored at commercial refrigerator (8°C±2) and air conditioned room (25°C±2). Seed were taken out after 1, 2, 3, 4, 5, 6 and 7 weeks of storage and 10 seeds were sown on sterilized sand media for germination and replicated for 3 times. The germination was done in an air-conditioned room (25°C±2, 55% relative humidity). Seeds without storage at 40% moisture content were used as a control treatment. Weekly observations were done on germination percentage of seeds for 4 weeks.

The effect of low temperature storage of fruit on the germination of seeds

Ripe fruits were kept in the ziplock plastic bag and stored at commercial refrigerator (8°C±2). Fruits were taken out after 1, 2, 3, 4, 5, 6 and 7 weeks of storage. Seeds were extracted from the stored fruits. Ten seeds were sown on sterilized sand media for germination and replicated for 4 times. The germination was done in an air-conditioned room (25°C±2, 55% relative humidity). Fresh non-stored fruits were used as a control treatment. Weekly observations were done on germination percentage of seeds for 4 weeks.

Data analysis

All data were analyzed by analysis of variance (ANOVA) using Statistical Analyses System Software (SAS) release 9.4. This study adopted the Completely Randomized Design (CRD). Means was differentiated at P≤0.05 level of significance using Duncan's Multiple Range Test (DMRT).

Results and Discussions

a b

Figure 1: Fruits (a) and seeds (b) of Lepisanthes fruticosa.

Seeds with initial moisture content of 54% (without drying) recorded 100% germination proved that seeds of L. fruticosa are can be easily germinated (Figure 2). However, germination percentages were

281

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

declined from 93, 83 and 17% when the seeds were dried to the moisture content of 50, 40 and 30% respectively. The critical moisture content (CMC), which is the moisture content below which there is a rapid fall in viability, for L. fruticosa is 30%. The seeds were completely losing viability dried to moisture content at or less than 20%. Similar results were found in G. gummi-gutta where the critical moisture content for seeds is around 34% and seeds were completely lost viability at 24 and 17% moisture content (Joshi et al., 2017). This current study revealed that L. fruticosa seeds are not tolerant to desiccation. Thus, the seeds might be classified into the seeds with the recalcitrant seed storage behaviour. According to Chin and Robert (1980), when fresh recalcitrant seeds begin to dry, viability is first slightly reduced as moisture is lost, but then begins to be reduced considerably at certain moisture content. If drying continues further, viability is eventually reduced to zero.

120 a 100 a b 80 60 40 c 20

Germination (%) (%) Germination d d 0 10 20 30 40 50 54

Moisture content (%) Figure 2: The effect of moisture content on the germination percentage of seeds. Means with different letters within the germination percentage are significantly different at p≤0.05.

Partially dried seeds (40% moisture content) are highly sensitive to low storage temperature (8°C±2) as the germination percentage declined from 83% to 43% after 0 to 1 week of storage (Figure 3). Drastic decline in the germination percentage during 3rd weeks of storage (10%) and the germination percentage continued declining until seeds were completely lose viability when seeds were stored at or more than 5 weeks of storage. Storage at high temperature (25°C±2) was also unsuccessful where the germination percentage declined to 47% when stored even only for 1 week. Although germination percentage of seeds stored at 25°C±2 reduced after 1 week of storage however, the values were maintained around 40-47% for up to 7 weeks of storage. The value was higher as compared to storage at 8°C±2 (0-43%). Similar result was also found by Normah and Chin, (1989) where the best storage temperature for Hevea brasiliensis was 27°C as compared to 10°C.

Lepisanthes fruticosa seeds could be calssified into recalcitrant as a result of studies showing drying damage in the seeds. The germination percentage decreased rapidly even after a short period of storage thus, long-term germplasm cannot be maintained through seeds. Besides seeds, fruits could also be an option to be used for short-term storage of L. fruticosa. Based on Figure 3, fruits could be stored for up to 5 weeks in low temperature (8°C±2) without any decline in the germination percentage. There was slight decline in germination percentage after 6th and 7th weeks of storage with 80 and 78% of germination percentages respectively.

282

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

100 a a a a a a a a b b 80

60 b b Seeds at 8 °C ±2 b b b b b b b Seeds at 25 °C ±2 40

Germination (%) (%) Germination Fruits at 25 °C ±2 20 c d d d d 0 0 1 2 3 4 5 6 7 Storage duration (week)

Figure 3: The germination percentages of seeds with 40% moisture content stored at 8°C±2 and 25°C±2 and seeds from fruits post-stored at 8°C±2 for 0, 1, 2, 3, 4, 5, 6 and 7 weeks of storage. Means with different letters within the same bar colour are significantly different at p≤0.05.

Conclusions

Ceri Terengganu seeds can be classified into the seeds which have the recalcitrant seeds storage behaviour due to its highly sensitivity to drying and chilling. Storage of fruits together with the seeds in 8°C±2 could be an option for short-term storage of L. fruticosa where it can be stored for up to 5 weeks without losing the germination capability

Acknowledgements

The work was made possible through financial support from Malaysian Agricultural Research and Development Institute (MARDI) under the 11th Malaysia Plan (RMKe-11) Development Fund. Gratitude also goes to the project leader Dr. Mohd Shukri Bin Mat Ali@Ibrahim for including this work in his project entitled “Peningkatan penerokaan buah-buahan baharu dan produk berkaitan untuk jaminan makanan, nutrisi dan perubahan cuaca”.

References

Abd. Latif, M., Ahmad Zuhaidi, Y., Zawiyah, N., Nik Zanariah, N.M. and Othman, H. 2016. Sinonim Nama Tempat Dengan Nama Tumbuhan. FRIM Special Publication No. 12, Kepong Malaysia. Pp. 108-109. Bajaj, Y.P.S. 1995. Cryopreservation of plant germplasm I. Biotechnology in Agriculture and Forestry 32: 3-512. Chin, H.F. and Roberts, E.H. 1980. Recalcitrant Crop Seeds. Tropical Press Sdn. Bhd., Kuala Lumpur. Pp. 38-104. Cromarty, A.S., Ellis, R.H. and Robert, E. 1982. Handbooks for Genebank No. 1-The Design of Seeds Storage Facilities for Genetic Conservation. Hong, T.D. and Ellis, R.H. 1996. A Protocol to Determine Seed Storage Behavior. The International Plant Genetic Resources Institute (IPGRI) Publications. Pp. 46-50. Joshi, G., Phartyal, S.S. and Arunkumar, A.N. 2017. Non-deep physiological dormancy, desiccation and low-temperature sensitivity in seeds of Garcinia gummi-gutta (Clusiaceae): A tropical evergreen recalcitrant species. Tropical Ecology 58(2): 241-250.

283

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mirfat, A.H.S., and Salma, I. 2015. Ceri Terengganu: The future antioxidant superstar. MARDI Scientia 6: 6. Normah, M.N., and Chin, H.F. 1989. Recalcitrant seed storage by partial desiccation technique. Acta Horticulturae 253: 258-59. Rukayah, A. 2006. Buah-buahan Nadir Semenanjung Malaysia. 3rd Edition. Dewan Bahasa dan Pustaka Kuala Lumpur, Malaysia. Pp. 127-129.

284

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effects of Seed Size on Germination and Early Seedling Growth Performance of Lepisanthes fruticosa

Nurhazwani, M.*, Mohd Shukri, M.A.I., Mohd Saifuddin, I. and Mohd Syakir, B. Genebank and Seed Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Lepisanthes fruticosa or locally known as ‘Ceri Terengganu’ are underutilized trees belong to family Sapindaceae. It is a non-seasonal tree and can be found in Soth East Asia such as Malaysia, Myanmar, Indo-China, Thailand, Philippines and Indonesia. This species produces fruits throughout the year and widely distributed in Johor and the East Coast of Peninsular Malaysia (Abd. Latif et al., 2016). Ceri Terengganu is found growing naturally in the forests and only occasionally cultivated. The tress are often used as ornamental and shading trees due to its esthetical values that lies on its attractive shape, light purple young foliage and long purple inflorescence which can then turning to shiny bright red fruits (Rukayah, 2006). L. fruisticosa fruits can be consumed fresh when fully ripen and also used in traditional medicine by rural folk. The seed is consumed when roasted and the root is used in a compound poultice to relieve itching and to reduce body temperature during fever (Mirfat and Salma, 2015). Recently, this species has valuable due to rich antioxidant capacity in fruit as compared to commercial fruits such as orange, lime, apple and guava. Therefore, Ceri Terengganu has a good prospect in future to be exploited for commercial production in Malaysia. The interest of agronomist and farmer now is to develop the cultural practices for Lepisanthes growing plant. Generally, seed germination is controlled by many internal and external factors. Seed size is among of them. Seed size is an important parameter, which influences the germination, growth and biomass of the nursery seedlings and that trend leads to the future crop. Sowing of the mixed seed of a species may result in non-uniform density of seedlings. Studies carried out to investigate the influence of three different seed sizes on germination Lepisanthes.

Materials and Methods

Matured Lepisanthes sp. fruits were collected from 10 years old trees at MARDI, Serdang. Extracted seeds were visually separated into three size classes determined by seed weight; small (0.2-0.6 g), medium (0.7-1.1 g) and large (1.2-1.6 g) and evaluated for the following parameters: (i) 100-seed weight; (ii) seed size in terms of length, thickness; (iii) percentage germination; (iv) shoot length (v) stem collar diameter; and (vi) vigour index (Table 1). For estimation of germination, four lots (replications) of 25 seeds each were sown in germination boxes (28 cm x 14 cm x 14 cm) with peat moss medium under greenhouse condition and laid out in a Completely Randomised Design (CRD). Regular watering was done as per requirement. Germination percentage was calculated by dividing the number of germinated seeds with the total number of seeds and multiplied by hundred (Gharieneh et al., 2004). The number of normal seedlings was counted on the 14th day and expressed as percentage. All the seedlings per treatment were measured shoot length and stem collar diameter. Seedling vigour index of seed size classes was calculated as germination percentage multiplied by seedling total length and divided by 100. Data collected being subjected to Analysis of Variance (ANOVA). Least Significant Difference (LSD) at 5% probability level was used to compare the significantly different treatment means.

285

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Lepisanthes seeds with three size classes; small, medium and large.

Results and Discussions

Influence of seed size on germination rate

Irrespective of the seed source, large seeds proved distinctly superior in terms of both percentage germination and vigour and a positive relationship between seed size and quality attributes was manifest. The result from the study showed significant increase in germination percentage with increasing seed sizes (Table 2) with the highest mean germination percentage recorded in large seed size with 84.5%, followed by medium sized seed which had 80.25% and small sized seed was found to have the least mean germination percentage of 65.5%. Large seeds recorded 29% increased germination over the small-sized seeds. Generally, bigger seeds germinate quicker and would take lesser duration when compare to that of smaller seed (Manonmani et al., 1996, Negi and Todaria, 1997, Gunaga et al., 2007). Mosseler et al. (2009) and Ahirwar et al. (2012) also reported that germination percentage was significantly influenced by seed size and that such germination percentage was highest in large size compared to medium and small seed of loblolly pine (Pinustaeda) and Alangiumlamarckii seeds respectively. The better performance of large seeds may be ascribed to the availability of greater food reserves and the presence of larger embryo (Siddiqui et al., 1991).

Influence of seed size on seedling growth

The different seed sizes varied in their shoot length values as large seed recorded the highest mean shoot length of 21.00 mm followed by medium seed size having 20.25 mm while small seed had the shortest mean shoot length of 14.73 mm (Table 2). Large seed size was no significant different compared to medium seed size in term of shoot length. In contrast to the present study, Roshanak et al. (2013) reported that the medium seed size of soybean had the highest value of shoot length followed by the small seed size while the large seed size had the lowest value of shoot length. Stem collar diameter was not significantly affected by three different seed size. Seed size is one of the important growth components which have an effective role on cultivar adaptation of different condition which affects seedling vigour (Morrison and Xue, 2007). Large and medium sized seed showed significantly higher seedling vigour compared to small sized seed. Gonzalez (1993) stated that seed size effect plant vigour as seeds with greater mass-produced vigorous plants. This finding agrees with the observations of Ponnammal et al. (1993) was recorded a strong positive association of seed size with seedling vigour attributes in Leucaena leucocephala.

286

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Average value of seed morphology with different seed size. Treatment Small Medium Large 100 seeds weight (g) 50.80 98.20 138.40 Seed length (mm) 10.73 12.91 15.82 Seed thickness (mm) 7.52 9.23 11.42

Table 2: The influence of seed size on seed germination and seedling growth. Germination Shoot length Stem collar Vigour Seed size percentage (mm) diameter (mm) index b b a b Small 65.5 14.73 2.29 964.8 a a a a Medium 80.25 20.25 2.58 1625.1 a a a a Large 84.5 21.00 2.62 1768.2 Means in each column with the different letters within each factor indicate significant differences at P≤0.05% according to LSD.

Conclusion

Seed size is an important physical indicator of seed quality that affects germination rate and vegetative growth. The study indicated that the large seed sizes gave the best germination indices in terms of germination percentage, seedling length, girth and vigour compared to medium and small seed sizes. Higher germination and vigour seedling in bigger sized seeds could be due to the presence of higher amount of carbohydrates and other nutrients than in medium and small sized seed. The overall result showed that the seed grading in an essential step to improve the quality of nursery stock as well as their performance at field condition.

References

Abd. Latif, M., Ahmad Zuhaidi, Y., Zawiyah, N., Nik Zanariah, N.M. and Othman, H. 2016. Sinonim nama tempat dan nama tumbuhan. FRIM Special Publication; No. 12, Kepong Malaysia pp.108-109. Ahirwar, J.R. 2012. Effect of seed size and weight on seed germination of Alangiumlamarckii. Research Journal of Recent Science 1: 320-322. Ganzalez, J.E. 1993. Effect of seed size on germination and seedling vigour of Virola Koschnyi Warb. Forestry Ecology and Management 57: 275-281. Gharineh, M.H., Bakhshandeh, A.M. and Ghassemi-Golezani. K. 2004. Effects of viability and vigor of seed on establishment and grain yield of wheat cultivars in field conditions. Seed and Plant Production 20(3): 383-400. Gunaga, R.P., Hareesh, T.S. and Vasudura, R. 2007. Effect of fruit size on early seedling vigour and biomass in white dammer (Vateriaindica): A vulnerable and economically important tree species of The Western Ghals. Journal of Non-Timber Forest Products 14: 197-200. Mirfat, A.H.S. and Salma, I. 2015. Ceri Terengganu: The future antioxidant supertar. MARDI Scientia 6: 6. Moosseler, A., Major, J.E., Simpson, J.D., Daigle, B., Lange, K. and Park, Y.S. 2000. Indicators of population viability in red spruce, Picearubens. I: Reproductive Traits and Fecundity. Canadian Journal of Botany 78(7): 928-940. Morrison, M.J. and Xue, A.G. 2007. The influence of seed size on soybean yield in short-season region. Canadian Journal of Plant Science 87: 89-91. Negi, A.K. and Todari, N.P. 1997, Effect of seed size and weight on germination pattern and seedling development of some multipurpose tree species of Garhwal Himalaya. Indian Forester 123: 32-36. Ponnammal, N.R., Arjunan, M.C. and Antony, K.A. 1993. Seedling growth and biomass production in Hardwickia binata Roxb. as affected by seed size. Indian Forester 119: 58-62.

287

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Roshanak, R., Hamdollah, K., Mehrdad, Y. and Parisa, Z. 2013. Effect of seed size on germination and seed vigour of two soybeans (Glycin Max. L). International Research Journal of Applied and Basic Sciences 4(11): 3396-3401. ISSN 2251-838. Rukayah, A. 2006. Buah-buahan nadir Semenanjung Malaysia. 3rd Edition. Dewan Bahasa dan Pustaka. Kuala Lumpur, Malaysia. pp. 127-129. Siddiqui, N.A., Shahiduka, M. and Shalyabal, M.A.H. 1991. Studies on seed viability and germination of seeds of sundra. Indian Journal of Forestry 14(2): 119-124.

288

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Tuber Yields of Three MARDI Purple Flesh Sweet Potatoes (Ipomoea batatas [L.] Lam) Varieties as Affected by Different Age of Planting Material

Nurul Atilia Shafienaz, H.1,*, Muhammad Najib, O.G.2, Omar, H.3 and Amat Jupri, A.1 1Genebank and Seed Centre, MARDI Klang, 41720 Klang, Selangor, Malaysia. 2Genebank and Seed Centre, MARDI Headquaters, 43400 Serdang, Selangor, Malaysia. 3Genebank and Seed Centre, MARDI Kundang, 48020 Rawang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Sweet potato (Ipomoea batatas sp.) is one of world’s most important root crops and ranks as the 7th major food crops in the world (FAO, 2009). In Malaysia, sweet potato is mainly produced in Perak at the area of Kinta, Batang Padang and Kuala Kangsar. The production of sweet potato in 2015 decreased 18% from 50,607.48 Mt to 43,211.84 Mt in 2016. In addition, the production area also decreased by 13% from 2015 to 2016 (DOA, 2016). Among factors contributed to this scenario are usage of low yielding varieties and low-quality planting materials. In Malaysia, sweet potato is mainly propagated via cuttings. Type, length, age and health of cuttings are four important factors determining quality of sweet potato planting material (Jill, 1988). However, effects of these factors, especially the age of cuttings on tuber yield production were rarely studied previously. In 2017, MARDI had released 3 purple flesh sweet potatoes viz. Anggun 1, Anggun 2 and Anggun 3. These varieties are different to each other in term of morphological characteristics and anthocyanin contents (Rosnani et al., 2017). Nevertheless, information on the best age to harvest the cuttings from the mother plant in order to get high yield planting material is still lacking in these 3 varieties. Therefore, this study was conducted to determine the effects of planting material age on tuber yield production of three MARDI purple flesh sweet potato cultivars.

Materials and Methods

Preparation of stock plant

Three MARDI varieties of purple flesh sweet potato viz. Anggun 1, Anggun 2 and Anggun 3 were planted on tin tailing soil at MARDI Kundang using healthy and firm tip cuttings taken from their mother plants with length of 1 foot (approximately 30 cm). The cuttings were grown with spacing of 30 cm between plants and 30 cm between rows. Fertilizer was applied three times per cycle at 3rd, 5th and 8th week after planting and plants were irrigated twice daily using sprinkler system.

Different age of cuttings and growth conditions

After 2.5, 3.0, 3.5, 4.0, and 4.5 months of planting (MAP) of the stock plants, cuttings with length of 1 foot and consist around 7-8 nodes were collected from the shoot tips of the stock plants in each treatment. The tip cuttings were planted with spacing of 30 cm between plants and 30 cm between rows. The size of each sub plot was 5.0 m2. Fertilizer was applied three times per cycle at 3rd, 5th and 8th week after planting and plants were irrigated twice daily using sprinkler system.

Tuber yield

Data on tuber yield was taken randomly from 5 plants of each treatment at 3.5 months after planting the tip cuttings.

289

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Experimental design and data analysis

The treatments comprising 3 varieties and 5 different ages of cuttings were arranged in a split plot design with age of cuttings as the main plot and varieties as sub-plot with 4 replications. The data obtained was analysed using ANOVA in the SAS software (Version 9, SAS Institute Inc. Cary, North Carolina, USA) and differences between treatments means were compared using Least Significant Difference Test (LSD) at P≤0.05%.

Results and Discussion

Results revealed that tuber yield was significantly affected (P<0.001) by both main effects; variety and cutting’s age, with no significant interactions recorded between them. Regardless of the cutting’s age used, tuber yield of Anggun 3 was significantly higher compared to Anggun 1 and Anggun 2 with percentage differences of 49.1 and 30.6, respectively and yield conversion of 47.4 Mt/hectare (Figure 1). The differences of yield between the varieties might be explained by the complexity of the trait since yield is complex genetically and physiologically, and differs considerably even among varieties and cultivars of the same species (Mbusa et al., 2018). Kenneth (2012) reported that tuber yields of six sweet potato cultivars were significantly different among cultivars even though they were planted under the same agronomic practices at the same time and area. In this study, the differences of yield between the varieties also can be associated with results obtained by Nurul Atilia and Omar (2016) where Anggun 3 was reported to have significantly higher leaf area index (LAI) and crop growth rate (CGR) as compared to Anggun 1. Presumably, these attributes lead to higher photosynthetic and assimilation activities which consequently results in higher tuber yield production.

2 1.58a 1.5 1.21b 1.06b 1

0.5 Tuber yield (kg/plant)yield Tuber 0 Anggun 1 Anggun 2 Anggun 3

Figure 1: Shoot and tuber yield of three purple flesh sweet potato cultivars. Means with similar letter are not significantly difference at P≤0.05% level according to LSD.

Results also showed that regardless of variety, plants planted with tip cuttings obtained from its mother plants at 3 to 3.5 months after planting (MAP) produced significantly higher yield compared to other cutting’s age tested with yield conversion of 44.7 and 48 Mt/hectare, respectively (Figure 2). In addition, plants planted with tip cuttings from older plants (4 and 4.5 MAP) and younger plants (2.5 MAP) had significantly lower tuber yield compared to yield of plants produced from 3 and 3.5 MAP. This is in accordance with study reported by Martin (1984) on three sweet potato cultivars where plants planted from tip cuttings of older plants (4-5 MAP) had significantly low yield (0.43 to 1.05 kg/plant) compared to plants planted with tip cuttings of younger plants (2-3 MAP). Plants planted from cuttings of very young mother plant (<2 MAP) having low tuber yield might be because the plants are still in early vegetative stage and is not matured enough for tuber production, thus having low tuber yield. However, plants planted from cuttings of 2.5 MAP having low tuber yield because at that age, plants putting its energy in tuber formation and enlargement, therefore their vine tips are weak and growing slowly.

290

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

For plants derived from cuttings of very old mother plant, the low tuber yield can be associated with the cutting’s health. It was observed that cuttings from older plants with age more than 4 months were not healthy and carried disease and weevils which consequently affecting its growth and tuber production.

1.70 1.49a 1.60a 1.50 1.12b 1.30 1.03b 1.04b 1.10 0.90 0.70 0.50 Tuber yield (kg/plant)yield Tuber 2.5 MAP 3 MAP 3.5 MAP 4 MAP 4.5 MAP Age of planting materials (months after planting, MAP)

Figure 2: Tuber yield of three purple flesh sweet potato cultivars planted from five different age of planting materials (2.5, 3, 3.5, 4, and 4.5 months after planting, MAP). Means with similar letter are not significantly difference at P≤0.05% level according to LSD.

Conclusions

Usage of Anggun 3 variety with age of cuttings between 3-3.5 MAP (mother plants) is recommended as it would lead to high yield production compared to other varieties and age of planting materials.

References

Department of Agriculture (DOA). 2016. Vegetables and Cash Crops Statistics 2016. Department of Agriculture Peninsular Malaysia. Retrieved from http://www.doa.gov.my/index/resources/aktiviti_sumber/sumber_awam/maklumat_pertanian/ perangkaan_tanaman/perangkaan_sayur_tnmn_ladang_2016.pdf. Food and Agriculture Organization (FAO). 2009. FAO Statistics. FAO, Rome. Jill, E.W. 1988. Sweet potato (Ipomoea batatas) planting material. USP Institute for Research, Extension and Training in Agriculture. Agro-facts-publication No. 2/88. Kenneth, V.A.R. 2012. Tuber quality and yield of six sweet potato varieties evaluated during 2012. Crop Research Report No. 13. Retrieved from https://www.bahamas.gov.bs/wps/wcm/connect/9705e34a-4809-4a75-9583- bbad5801d8f4/Tuber+Quality+Yield+Sweet+Potato++Varieties+2012+%2813%29.pdf?MOD =AJPERES&CONVERT_TO=url&CACHEID=9705e34a-4809-4a75-9583-bbad5801d8f4. Martin, F.W. 1984. Effect of age of planting material on-yields of sweet potato from cuttings. Tropical Root and Tuber Crops Newsletter 15: 22-25. Mbusa, H., Ngugi, K., Olubayo, F., Kivuva, B., Muthomi, J. and Nzuve, F. 2018. The inheritance of yield components and beta carotene content in sweet potato. Journal of Agricultural Science, 10(2): 71-81. Retrieved from http://dx.doi.org/10.5539/jas.v10n2p71. Nurul Atilia, S.H. and Omar, H. 2016. Influence of different fertilizer rates on planting material production of purple fleshed sweet potato (Ipomoea batatas L.). Poster presented at 9th National Seed Symposium. Rosnani, A.G., Anuar, A., Hairuddin, M.A., Md. Akhir, H., Mohd. Nazri, B., Nur Izalin, M. Z., Nurul Afza, K., Nurul Atilia, S.H., Rosalizan, M.S., Thiyagu, D. and Wan Khairul, A.W.A. 2017. Manual Teknologi Pengeluaran Ubi Keledek Ungu Anggun. ISBN: 9789679366556. Pp. 1-4.

291

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Chapter 7

Biotechnology

292

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Vegetative Development of Oil Palm Ramets Established from Different Embryoid Structures

Samsul Kamal, R.*, Tarmizi, A.H., Fadila, A.M. and Marhalil, M. Breeding and Tissue Culture Unit, Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, 43650 Bandar Baru Bangi, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Tissue culture of oil palm begins with the culturing of leaf explant sourced from selected ortets followed by the formation of undifferentiated callus cells. The calli undergo repeated subcultures in fresh media until formation of primary embryoids. Embryoids obtained during this process act as the embryo equivalent of oil palm seedlings. At this in vitro stage, it is quite common to obtain various types of embryoids. They can be nodular, torpedo-shaped (single or fused), globular, heart and haustoria shapes as well as germinating (Samsul et al., 2006). It was reported that, the nodular, torpedo-shaped (fused) and germinating types are generally more prolific (Ramakrishna and Shasthree, 2016). These structures were continuously subcultured and established as polyembryoids with subsequent successful regenerants into small plantlets and ramets. However, it is not known whether the different structures will give rise to abnormality when planted in the field (Ahmad et al., 2018). Hence, the main objective of the study is to investigates the effect of different embryoids morphotypes on the vegetative development and yields of oil palm clones. Due to somaclonal variations that occurred during tissue culture processes, it was predicted that it will be translated into an increased of oil palm yield by 20-30% (Khushairi et al., 2006). However, in this trials, based on 10 years of observations, in nodular structure clones, frond production (FP) and oil yield (O/B) increases by 10% and 27% successively as compared to commercial DxP.

Materials and Methods

Primary embryoids were manually selected during the oil palm tissue culture process and were divided into six categories based on their morphological structures known as torpedo, fused torpedo, nodular, haustoria, heart and germinating (Figure 1). These morphotypes were continuously subcultured in the same modified Basal MS (Murasige and Skoog, 1962) media, and established as polyembryoids followed by formation of ramets. Ramets from each category were selected in the field nursery, individually tagged and field-planted in 2008 at the MPOB Research Station Bagan Datuk, (trial number 0.478) (Figure 2).

Bunch yields were recorded from 36 months after field planting at two rounds per month up to 2017. Bunch weight (BWT) and bunch number (BNO) were recorded per individual palm. Fresh fruit bunch (FFB) refers to the weight of bunches produced by an individual palm (BWT x BNO). Vegetative measurements using non-destructive methods were carried out in 2016. Growth parameters including petiole cross section, rachis length, palm height and frond number were recorded according to standard procedures described by Corley and Breure (1981). Data was analysed using ANOVA (SAS version 9.0).

293

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A B C

D E F

Figure 1: Heterogeneous embryoids from the oil palm tissue culture process. A = Torpedo, B = Fused Torpedo, C = Nodular, D = Haustoria, E = Germinating, F = Heart

Figure 2: Different types of embryoids planted in 2008 at the MPOB Research Station Bagan Datuk.

294

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

After 10 years of field planting, no severely mantled palms were observed in this trial. Close to 10% of the palms were mildly mantled initially but revert to normal phenotypes after 5 years. There was no significant difference in FFB yields observed between ramets from the different embryoid structures. In addition, no significant difference in petiole cross section (PCS), rachis length (RL), height (HT) and leaf area index (LAI) were recorded amongst these ramets. However, ramets regenerated from the nodular-shaped embryoids showed significantly higher frond production (FP) (Table 1) and 27% better yield (O/B) when compared to the DxP standard cross (Table 2).

Table 1: Vegetative performance ramets generated from different embryoid structures at MPOB Research Station Bagan Datuk. Family mean for vegetative measurement of Teneras in trial 0.478 Date planted : Jan 2008 Material : Clones Breeding design : RCBD Year 2016 No Embryoid types Pedigree n FP PCS (cm2) RL (m) HT (m) LAI (m2)

1 Torpedo 0.277/106 32 24.31 36.99 5.87 3.99 5.93 2 Fused torpedo 0.277/106 63 27.57 37.15 5.76 4.09 6.19 3 Nodular 0.277/106 63 27.87 36.39 5.76 4.09 6.03 4 Haustorium 0.277/106 62 26.21 36.78 5.78 4.06 6.12 5 Germinating 0.277/106 63 25.51 36.47 5.70 4.00 6.27 6 Heart 0.277/106 63 25.98 37.92 5.82 4.00 6.36 7 DxP std cross 31 24.94 36.63 5.79 3.75 6.10

Mean 346 25.51 36.95 5.77 4.04 6.17

Source of variation df MS MS MS MS MS Between family 5 23.24** 19.51ns 0.151ns 0.12ns 1.27n s Within family 340 3.85 33.48 0.152 0.25 0.59 n= Number of palms, FP= Frond production, PCS= Petiole cross section, RL= Rachis length, HT= Height, LAI= Leaf area index, RCBD= Randomised complete block design. **= Significant at P≤0.01, otherwise non-significant (ns).

295

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Yield performance of ramets generated from different embryoid structures at MPOB Research Station Bagan Datuk. Family mean for bunch yield of Teneras in trial 0.478 Date planted : Jan 2008 Materials : Clones Breeding design : RCBD No Progeny Pedigree Cross n Mean 2011-2017 O/B Code Type MFFB MBNO MABW (%) (kg) (No) (kg)

1 Torpedo 0.277/106 Clones 32 153.99 19.95 7.56 18.40 2 Fused torpedo 0.277/106 Clones 63 154.89 20.37 7.36 25.46 3 Nodular 0.277/106 Clones 64 177.80 21.83 7.59 26.77 4 Haustorium 0.277/106 Clones 63 155.00 20.54 7.36 24.93 5 Germinating 0.277/106 Clones 64 173.14 21.74 7.88 24.38 6 Heart 0.277/106 Clones 64 155.96 20.42 7.52 26.07 7 DxP std cross DxP 31 172.78 21.35 8.06 21.11

Mean 350 160.72 20.89 7.55 25.31

Source of variation df MS MS MS MS Between family 5 4036.15ns 33.81ns 2.33ns 23.17** Within family 344 2454.59 33.29 1.06 6.60 n= Number of palms, MFFB= Mean fresh fruit bunch, MBNO= Mean bunch number, MABW= Mean average bunch weight, O/B= Oil to bunch, RCBD= Randomised complete block design. **= Significant at P≤0.01, otherwise non-significant (ns).

Conclusions

No difference in yields was recorded amongst the different morphotypes studied when planted in the field except for an increase of 27% O/B was observed for the nodular embryoids. Future studies would include the use of more clones and planting at different soil types.

Acknowledgements

The authors would like to thank the Director General of MPOB for the permission to present this study, Puan Norhariani Ismail, Puan Jamaliah Ahmad, and all MPOB’s tissue culture staff for their assistance.

References

Ahmad, T.H., Zamzuri, I., Samsul, K.R., Ong-Abdullah, M., Siew-Eng, O., Mohd, N.H. and Dalilah, A.B. 2018. Chapter 18 Oil Palm (Elaeis guineensis Jacq.) Somatic Embryogenesis. In: Jain. Corley, R.H.V. and Breure, C.J. 1981. Measurements in oil palm experiments. Internal Report. Unipamol Malaysia and Harisons Fleming Advisory Services. Pp. 17. Kushairi, A., Tarmizi, A.H., Zamzuri, 1., Ong-Abdullah, M., Rohani, O., Samsul Kamal, R., Ooi Se, Ravigadevi, S. and Mohd. Basri, W. 2006. Current status of oil palm tissue culture: Issues and challenges. Proceedings of the Clonal and Quality Replanting Material Workshop. 10 Aug 2006. Pp 3-14. Sri Kembangan. Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum 15(3): 473-497.

296

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ramakrishna, D. and Shasthree, T. 2016. High efficient somatic embryogenesis development from leaf cultures of Citrullus colocynthis (L.) Schrad for generating true type clones. Physiology and Molecular Biology of Plants 22(2): 279-285. Samsul, K.R., Tarmizi, A.H. and Rohani, O. 2006. Single plantlet formation from variousmorphotypes derived from oil palm liquid culture. Abstract in Trend Biotechnology 3, UPM 4- 9 September 2006. Putrajaya. S.M. and Gupta, P. (Eds.), Cham: Springer International Publishing. Step Wise Protocols for Somatic Embryogenesis of Important Woody Plants: Volume II, pp. 209-229.

297

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Elucidating Pathological Kinetic of Xanthomonas oryzae Infection in Drought Tolerance Rice (Oryza sativa cv. MR219-4) under Drought Condition

Mohd Rased, N.1, Muhammad Yaman, M.A.1, Ahmad, A.1,2 and Noor Hassim, M.F.1,2,* 1Biological Security and Sustainability Research Group, School of Fundamental Science, Universiti Malaysia Terengganu, 21030 Kuala Nerus, Terengganu, Malaysia. 2Institute of Marine Biotechnology, Universiti Malaysia Terengganu, 21030 Kuala Nerus, Terengganu, Malaysia. *E-mail: [email protected]

Introduction

Rice is a staple food for a majority of the human population and it is the preferable source of carbohydrate among Asian. Planting rice has its own challenges due to frequent exposure to the biotic and abiotic stresses. One of the abiotic stresses commonly faced by rice plantation in Malaysia is water stress induced by drought. The plant would experience water stress when the water supply to their root becomes limited. Our domestic rice production system would be badly affected by drought due to high dependency on the irrigated lowland production system (Ibrahim et al., 2013). Usually, plants that are under abiotic stress are susceptible to bacterial infection (biotic stress). The most common infection is by Xanthomonas oryzae that is pathogenic to most variety of rice. The infection causes bacterial leaf blight and leaf streak symptoms.

Despite all biotic and abiotic stress, the rice plant is well known for its great adaptation to grow and survive during an enormous range of situation. Current technologies provide us with many varieties of rice strain that are able to adapt to various situations. In this study, MR219-4 was used as a subject due to its drought tolerance ability (Harun et al., 2013). MR219-4 is a local rice mutant line of MR219, developed under rice radiation mutagenesis for adaptability to aerobic condition (Abd Wahid et al., 2016). However, the degree of resistance of MR219-4 to X. oryzae infection is yet to be reported. Therefore, the main question being addressed in this study was how the infection of X. oryzae would affect the growth and development of drought-tolerant paddy MR219-4 in drought condition.

Materials and Methods

MR219-4 in hydroponic solution

The germinated MR219-4 was put in hydroponic solution. The hydroponic solution was prepared with the chemical composition of micronutrients and macronutrients according to Podar (2013). In the hydroponic container, the filter paper was folded and cut into a bridge-like form to hold the seedlings in 4 mL of hydroponic solution. Drought condition was simulated; the seedlings got the water and nutrient supply from the nutrient solution that was absorbed by bridge-like filter paper using water capillary action mechanism. The seedlings were grown in hydroponic solution before being transferred to soil in a greenhouse. At the greenhouse, the container was set up to simulate drought condition; the water level was always 10 cm below soil level. The drought-simulation container consisted of 47 cm of height container, 50 cm PVC pipe, and soil.

Bacterial infection

MR219-4 was infected with X. oryzae (UPM, Malaysia) bacterial suspension with optical density 0.8 with concentration approximately 4.0 x 109 cfu/mL. Sucrose Peptone was selected as a medium for X. oryzae bacterial suspension. The bacterial suspension infected half of the total paddy. Therefore,

298

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

another half of total paddies were left uninfected as the controlled variables. The hydroponic solution was autoclaved for precaution and to avoid unnecessary other bacterial contamination.

Morphological trait observation

A total of five replicates (n = 5) were taken from each infected and non-infected MR219-4 for morphological observation on day 20, 23, 26, 29, 39 and 75. The samples were taken at seedlings, vegetative phase (45 days after seeding) and reproductive phase (70 days after seeding) (Ahmad et al., 2015). The MR219-4 on day 20, 23 and 26 were planted in a hydroponic system while the MR219-4 on day 29, 39 and 75 had been transferred to the drought-simulation container in a greenhouse. The morphological trait (plant height, stem length, root length and fresh weight) were measured and recorded. The mean value of every morphological trait was calculated and being compared between the infected and non-infected MR219-4. The variance of the morphological trait was also being calculated for pathological pattern observation.

Bacterial kinetic observation

A total of five replicates (n = 5) of infected MR219-4 on day 20, 23 and 26 were taken randomly as samples. The MR219-4 on day 20, 23 and 26 were chosen for the bacterial observation as they were planted in hydroponic solution. In hydroponic solution, the unnecessary bacterial contamination had been avoided for precise bacterial kinetic calculation result. The root parts were observed under a microscope. The localization of bacterial colonies in the roots’ part was recorded. The distance between the bacterial colonies was measured and the velocity was calculated. The observation was done using a light microscope together with Dino-eye to view and capture the image.

Total fatty acid content comparison

A total of five samples (n = 5) from every growth phase were taken. The 0.5 g of dried paddy leaves were mixed with 10 mL of concentrated HCl and vortexed for 2 minutes. After that, the samples were left incubated in a water bath for half an hour (Ahmad et al., 2015). Then, the sample was extracted twice in 25 mL of hexane. The hexane residue was vaporized using the double boiling technique at 80ºC in a rotary evaporator until the constant weight of oil obtained. After complete drying in the oven, the weight of oil was measured. The oil weight would represent fatty acid content. The variance of oil weight between infected and non-infected MR219-4 was calculated and compared.

Results and Discussion

Xanthomonas oryzae infections did not pathologically affect the morphology and physiology of MR219-4 under drought stress

MR219-4 has better morphological traits and higher grain production than the parent, MR219 (Ibrahim et al., 2013). Although how the MR219-4 responds to the bacterial infection is unknown. Measurement of the plant heights (Figure 1A) showed that the average height of the infected MR219- 4 was higher than the non-infected across growth phases. However, the differences are not significant (Pvalue >0.05) except on day 75. For detail measurements of the stem length (Figure 1B), shows that the stems of infected MR219-4 were longer in average than the non-infected MR219-4 except the measurements on day 26 and 29 which shows the non-infected paddy has longer stem length, however, the differences are not significant except on day 29. Comparative assessment of the root length (Figure 1C) showed that there are no significant differences (Pvalue>0.05) between the infected and the non-infected MR219-4. Although on average, the infected have shorter root length than the non-infected MR219-4 except on day 23 and 26 observations which show the infected paddies have longer root length. For physiology measurement; oil weight which representing the fatty acid content (Figure 3.1E), the results showed that the infected MR219-4 had lower average oil weight compared

299

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

to the non-infected MR219-4. However, the differences are only significant (Pvalue<0.05) on day 23, 26 and 29.

Xanthomonas oryzae are pathogenic bacteria that commonly cause bacterial blight and bacterial leaf streak on rice plant which affects the morphology and the production of grain (NiñO-Liu et al., 2006). However, based on the result in this study, the rice variety MR219-4 is seen to be not highly affected by the presence of X. oryzae. These due to there are no significant differences between the infected and the non-infected MR219-4 in most of the morphological and physiological comparison. The infected MR219-4 still manages to grow in drought overcoming the infection from the root. Plus, the majority of mean in morphological and physiological traits of the infected is higher than the non- infected MR219-4. This indeed indicates that the X. oryzae did not pathologically affect the growth of MR219-4.

(A) (B)

Figure 1: Morphological trait (height (A), stem length (B), root length (C) and weight (D)) and Physiological trait (oil weight (E) representing fatty acid content) of the infected and non- infected MR219-4. The P-value of two-tailed heteroscedastic Student’s T-test, n = 5. MR219-4 exhibit stochastic response to X. oryzae infection

In a dynamical sense, the variance could tell whether the response at the population level is stochastic or deterministic. The higher variance indicates a stochastic response while small variance indicates deterministic. Based on the oil weight variance, the infected MR219-4 exhibit higher variance during the early and late period of life cycle thus indicates stochastic responses to the infection. The variance becoming smaller over days of observation indicating the response becoming more deterministic. Thus, indicating the plant has adapted or immune to the infection. Upon inspection on the presence of

300

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

bacteria colony on day 20, day 23 and day 26, the number of bacterial colonies increases although the plant did not exhibit any symptoms (Figure 3).

Figure 2: The variance of oil weight comparison between the infected and non-infected MR219-4, n = 5.

(A) (B)

Figure 3: (A) The distance of Xanthomonas oryzae per days in the infected MR219-4 on day 20, 23 and 26 and (B) representative image of bacterial colonies observation with 40x magnifications on day 75.

Conclusions

The infection of Xanthomonas oryzae in MR219-4 that are under drought stress is asymptomatic at the morphological and physiological level. Dynamically, the plants respond to the infection is stochastic during the early period of infection due to the large increase in variance in comparison to the non- infected. This study indicates that MR219-4 is a better rice variety than the parent, MR219, due to higher tolerance to common pathogenic bacterial infection even under drought stress.

References

Abd Wahid, A.N., Abdul Rahim, S., Abdul Rahim, K. and Harun, A.R. 2016. Nitrogen use efficiency in MR219-4 and MR219-9 rice mutant lines under different water potentials and nitrogen levels using 15N isotopic tracer technique. Malaysian Journal of Analytical Science 20: 500- 509.

301

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ahmad, A., Siti-Fairuz, Mat Zain, A., Ma, N.L. and Mahmood, M. 2015. Fatty acid profile of salinity tolerant rice genotypes grown on saline soil. Malaysian Applied Biology Journal 44(1): 119- 124. Harun, A.R., Kamarudin, Z.S., Bhuiyan, M.A.R., Narimah, M.K., Wickneswari, R., Abdullah, M.Z., Anna, L.P.K., Hussain, S., Ibrahim, R. and Rahim, K.A. 2013. Evaluation and characterization of advanced rice mutant line of rice (Oryza sativa), MR219-4 and MR219-9 under drought condition. Research and Development Seminar 2012; Bangi (Malaysia); 26-28 Sep 2012. Ibrahim, R., Harun, A.R., Hussein, S., Zin, A.M., Othman, S., Mahmud, M., Yusof, M.R., Mohd Nahar, S.H., Kamaruddin, Z.S. and Ling, P.A. 2013. Application of mutation techniques and biotechnology for minimal water requirement and improvement of amylose content in rice. In Mutation Breeding Project Forum for Nuclear Cooperation in Asia (FNCA), pp. 46-59. NiñO-Liu, D.O., Ronald, P.C. and Bogdanove, A.J. 2006. Xanthomonas oryzae pathovars: Model pathogens of a model crop. Molecular Plant Pathology 7: 303-324. Podar, D. 2013. Plant Growth and Cultivation. In Plant Mineral Nutrients, (Humana Press, Totowa, NJ), pp. 23-45.

302

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effects of Different Potting Media on the Performance of Eucalyptus Hybrid Tissue Culture Plantlets under Nursery Conditions

Mohd Saifuldullah, A.W.1,*, Nor Hasnida, H.1, Nazirah, A.1, Muhd Fuad, Y.1, Ahmad Zuhaidi, Y.1, Rozidah, K.1, Sabariah, R.1, Naemah, H.1, Rukiah, M.1 and Harith Muhaimin, M.2 1Forestry Biotechnology Division, Forest Research Institute Malaysia (FRIM), 52109 Kepong, Selangor, Malaysia. 2Universiti Malaysia Kelantan, Kampus Jeli, Beg Berkunci No. 100, 17600 Jeli, Kelantan, Malaysia. *E-mail: [email protected]

Introduction

Eucalyptus sp. belongs to family Myrtaceae and was introduced from Australia in the 1770’s (Hiwale, 2015). This species was cultivated in the temperate and tropical countries like the Americas, Africa, Europe and Asia. But only in 1990’s this species was brought and planted in South East Asia region. According to Assis (2000), E. urophylla x E. grandis is the most used hybrid in tropical climates for sawmills, essential oil and pulp and paper for having short and uniform fiber with low coarseness compared with other hardwood. Eucalyptus sp. is one of the most fast-growing timber species and worth for investments (Coppen, 1992). This tree may grow until 15 years but it can be harvested within 3 years after planted for plywood and veneer purposes and 6 years for fiber and pulp industry (Eucalyptus Online Book and Newsletter, 2009).

The modern concept of competitiveness includes generating products to meet the industry demand in sustainable manners and with minimum environmental impact. Therefore, the development of tree breeding and tissue culture programs needed to obtain quick gains and well-established trees (Labate et al., 2008). This paper presents the performance of Eucalyptus hybrid tissue culture plantlets in nursery scale in order to produce sustainable supply of Eucalyptus hybrid for industrial purposes.

Materials and Methods

The experiment was conducted at the FRIM tissue culture nursery. Eucalyptus hybrid plantlets from the ex-lab were brought to a nursery for acclimatization process in the acclimatization chamber. After the acclimatization stage completed, plantlets were transferred into different potting media. Potting media were prepared according to the experiments and Completely Randomized Block Design (CRBD) was applied with the factorial of 4 treatments x 15 replicate plantlets.

Each treatment contained 15 plantlets respectively. Figure 1 shows the design experiment for the Eucalyptus hybrid. There were 4 treatments applied, which were Treatment 1 (Burnt soil: Sand), Treatment 2 (Topsoil: Sand: Peat: Compost), Treatment 3 (Sand: Coir), last but not least Treatment 4 (Burnt soil: Peat moss) (Figure 2). During the experiment, NPK 15:15:15 + TE fertilizer and fungicides were applied to the Eucalyptus hybrid plantlets to enhance the growth performance of the Eucalyptus hybrid in the nursery and also to prevent the plantlets from fungal diseases.

303

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Design experiment for the Eucalyptus hybrid potting medium.

Data of Eucalyptus hybrid growth performance in different potting media was measured by shoot height and number of leaves produced. For the shoot, it was measured from the top of the soil in the polybag until the terminal shoots of Eucalyptus hybrid and the numbers of leaves produced were counted every week until week 7.

a b

Figure 2: a) Potting media and plantlets were prepare, b) Eucalyptus hybrid growth in Week 4.

Results and Discussion

Eucalyptus hybrid shoot height

Based on the data collected, it was observed that the shoot increment in Week 1 until Week 3 for all treatments did not show much difference since the plantlets were still adapting in the nursery environment. An obvious difference in shoot height among all treatments could be observed in Week 4 (Treatment 4) which had the highest increment of shoot height for Eucalyptus hybrid plantlets followed by Treatment 1, Treatment 2 and Treatment 3. Even though in Week 4 the shoot showed obvious height increment, the data was continuously collected until Week 7. Results obtained showed that Treatment 4 which contained burnt soil and peat moss supported the highest growth rate of Eucalyptus hybrid plantlets compared to other treatments (Table 1 and Figure 3).

304

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Average increment of Eucalyptus hybrid shoots height from Week 1 until Week 7. Different potting medium/ shoot height (cm) Week Treatment 1 Treatment 2 Treatment 3 Treatment 4 (Burnt soil : Sand) (Topsoil : Sand : Peat : Compost) (Sand : Coir) (Burnt soil : Peat moss) W1 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 0.00 ± 0.00 W2 2.23 ± 0.29 1.55 ± 0.70 2.07 ± 0.31 2.43 ± 0.55 W3 3.97 ± 0.78 2.77 ± 0.76 2.85 ± 0.48 4.77 ± 1.15 W4 6.55 ± 1.40 4.70 ± 1.75 4.54 ± 0.69 8.54 ± 2.37 W5 9.51 ± 2.08 8.18 ± 2.60 7.09 ± 1.76 12.76 ± 3.67 W6 16.91 ± 3.28 17.99 ± 6.54 15.51 ± 7.23 20.66 ± 4.94 W7 19.62 ± 4.24 18.96 ± 8.30 17.70 ± 8.53 22.69 ± 5.16

25.00

20.00 EH ( Seedling Height ) T1 15.00 EH ( Seedling Height ) T2 10.00 EH ( Seedling Height ) T3

Shoot Height (cm) (cm) Height Shoot 5.00 EH ( Seedling Height ) T4

0.00 W1 W2 W3 W4 W5 W6 W7

Figure 3: Shoot height increment of Eucalyptus hybrid plantlets.

Eucalyptus hybrid leaf number

In terms of Eucalyptus hybrid leaf numbers, (Table 2 and Figure 4) showed Treatment 4 which contained of burnt soil and peat moss produced the highest numbers of leaves compared with other treatments.

Table 2: Average increment of Eucalyptus hybrid leaf numbers from Week 1 until Week 7. Different potting medium/ leaf numbers Week Treatment 1 Treatment 2 Treatment 3 Treatment 4 (Burn soil : Sand) (Topsoil : Sand : Peat : Compost) (Sand : Coir) (Burn soil : Peat moss) W1 0 ± 0.00 0 ± 0.00 0 ± 0.00 0 ± 0.00 W2 2 ± 0.74 3 ± 1.27 3 ± 1.34 4 ± 1.45 W3 5 ± 1.65 4 ± 2.13 5 ± 1.96 7 ± 2.02 W4 10 ± 4.45 7 ± 2.67 8 ± 2.62 10 ± 2.51 W5 17 ± 3.85 10 ± 3.03 10 ± 3.02 13 ± 3.23 W6 17 ± 3.85 14 ± 3.85 14 ± 3.71 18 ± 3.36 W7 19 ± 3.50 19 ± 5.18 18 ± 4.18 23 ± 4.42

305

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

20 EH ( Number of Leaves ) T1 15 EH ( Number of Leaves ) T2 10 EH ( Number of Leaves ) T3

Leaves Numbers Leaves 5 EH ( Number of Leaves ) T4

0 W1 W2 W3 W4 W5 W6 W7

Figure 4: Average increment of Eucalyptus hybrid leaf numbers.

Based on the results obtained for both parameters, Treatment 4 was the best potting media for the growth performance of Eucalyptus hybrid for nursery condition. The combination of burnt soil and peat moss was the perfect media for an improved Eucalyptus hybrid growth performance. This burnt soil and peat moss combination is also suitable for forest tree species because peat moss has the ability to manage water efficiency and released moisture to the plant’s needs (Carroll, 2018). Carroll also stated, Peat moss also can hold the soil nutrients and overcome leaching incidence. With good water system and application of fertilizer, the growth of Eucalyptus hybrid could be improved or increased in the nursery condition as well as in plantation.

Conclusion

The potting media which is treatment 4 with burnt soil and peat moss gave the best results for Eucalyptus hybrid growth performance in the nursery condition. Burnt soil and peat moss gave stability to the plantlets to adapt and grow well in nursery condition. Further study on Eucalyptus hybrid growth performance in plantation plot is needed to support this study. Furthermore, the sustainable supply of Eucalyptus hybrid planting material for forest plantation is crucial to cater the demand for Eucalyptus hybrid raw materials and also for conservation.

References

Carroll, J. 2018. Peat Moss and Gardening - Information About Sphagnum Peat Moss. Retrieved August 9, 2018, from https://www.gardeningknowhow.com/garden-how-to/soil- fertilizers/peat-moss-information.htm. Coppen, J.J. 1992. Production, trade and markets for eucalyptus oils. Eucalyptus, 365-383. doi:10.4324/9780203219430_chapter_17. de Assis, T.F. 2000. Production and use of Eucalyptus hybrids for industrial purposes. In Hybrid breeding and genetics of forest trees. Proceedings of QFRI/CRC-SPF Symposium. Pp. 63-74. Eucalyptus 2018. Goldenscape Tree Africa. Retrieved on 30 July 2018 from https://www.goldenscapetreeafrica.org/eucalyptus.html. Eucalyptus Online Book and Newsletter 2009. Papermaking Properties of Eucalyptus Trees, Woods, and Pulp Fibers. Eucalyptus Online Book and Newsletter, 5-7. Retrieved August 8, 2018, from http://www.eucalyptus.com.br/eucaliptos/ENG14.pdf. Hiwale, S. 2015. Sustainable Horticulture in Semiarid Dry Lands. Chapter 23 Eucalyptus (Eucalyptus sp.) Springer India 2015. Pp. 301-307. Labate, C.A., Assis, T.F., Oda, S., Mello, E.J., Mori, E.S., Moraes, M.L.T., Barrueto Cid, L.P., Gonzalez, E.R., Alfenas, A.C., Valverde, Z., Ediva, l.A., Foelkel, C. Moon, D.H., Carvalho, M.C.C.G., Caldas, D.G.G., Carneiro, R.T., Andrade, A. and Salvatierra, G.R. 2008. A Compendium of Transgenic crop Plants: Forest Tree Species. Eucalyptus. Edited by Chittaranjan Kole and Timothy C. Hall.

306

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mass Production of Eucalyptus Hybrid for Commercial Plantation

Nazirah, A.1,*, Nor Hasnida, H.1, Muhammad Fuad, Y.1, Mohd Saifuldullah, A.W.1, Ahmad Zuhaidi, Y.1, Rozidah, K.1, Rohani, A.1, Sabariah, R.1, Naemah, H.1, Rukiah, M.1, Nor Saffana, B.2 and Muhammad Hakim, A.H.3 1Forestry Biotechnology Division, Forest Research Institute Malaysia, 52109 Kepong, Selangor, Malaysia. 2Kulliyah of Science, International Islamic University Malaysia, 25710 Kuantan, Pahang, Malaysia. 3Politeknik Nilai, Kompleks Pendidikan Bandar Enstek, 71760 Bandar Enstek, Negeri Sembilan, Malaysia. *E-mail: [email protected]

Introduction

The genus Eucalyptus is a versatile fast-growing hardwood tree originated from Australia. Eucalyptus produces wide range of valuable product including essential oil from the leaves and timber product (Batish et al., 2008). This genus consists of more than 600 varieties where Eucalyptus hybrid (E. urophylla x E. grandis) and E. pellita are the most common varieties planted in Malaysia mostly in Sabah and Sarawak. The potential of Eucalyptus sp. in plantation has been recognised due to its ability to grow fast, adaptation to their unnatural habitat with critical conditions and most importantly for its timber. The rotation period of Eucalyptus sp. is 5 years to produce veneer, 7 to 8 years for fiber/pulpwood and 15 years for sawlog (Ahmad Zuhaidi, 2018).

The sustainable production of raw material is crucial since dependency on one source from the wild was not enough to cater all the demand. Production of plantlets through cutting and tissue culture were considered however cutting for some valuable Eucalyptus genotype has been reported challenging due to poor rooting response (Mokotedi et al., 2010).

Production of Eucalyptus hybrid using tissue culture techniques is very promising. Successful tissue culture protocol development of other Eucalyptus sp. has been reported previously (Trueman et al., 2018). This paper has discussed the tissue culture protocol developed for Eucalyptus hybrid (E. urophylla x E. grandis) by using semi-solid media in the bottle and liquid media in temporary immersion bioreactor (TIB) system. Eucalyptus hybrid was selected due to its well performance in the field (Ahmad Zuhaidi, 2018). The production of Eucalyptus hybrid tissue culture plantlets were successful determined by the clean culture initiation until planting stock ready to be transplanted into the field.

Materials and Methods

Clean culture establishment

Tissue culture for Eucalyptus hybrid was performed by using nodal segment as explants. Eucalyptus hybrid young shoot, around 30 cm lengths from shoot tips were collected from Bukit Hari, Kepong and processed for culture initiation. Fungicide at a concentration of 1 g/L, 70% ethanol and 50% Chlorox® were the sterilizing agents used in the surface sterilization process. The success rate was measured according to the percentage of clean culture obtained and visual observation of shoots viability.

Shoot multiplication and root induction in semi solid and in liquid media in TIB system

The semi-solid Murashige and Skoog (Murashige and Skoog, 1962) media was prepared with 30 g/L sucrose and solidified using 3 g/L Gelrite (Duchefa Biochemie). For shoot multiplication, MS basal

307

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

media supplemented with 0.1 mg/L BAP was used and MS supplemented with 1.0 mg/L IBA was used for rooting media. For shoot multiplication in liquid media in the temporary immersion bioreactor system (RITA®, Saint-Mathieu-de-Tréviers, France), MS media supplemented with 0.1 mg/L BAP and 30 g/L sucrose without addition of solidifying agent was prepared and poured into the TIB vessel. The pH for all media was set at 5.8 and autoclaved at 121°C for 15 min. Nodal segments at ±2.0 cm length were sub cultured into semi-solid and liquid MS media supplemented with 0.1 mg/L BAP for shoot multiplication and incubated for 4 weeks. For root initiation, the regenerated Eucalyptus hybrid shoots at ±3.0 cm length were cultured into the root induction media for 4 weeks. For TIB, immersion time was set at 15 minutes every six hours. The temperature of the growth room was set at 22±0.2°C and photoperiod was 16 h light and 8 h dark.

Acclimatization

Complete plantlets produced after one month cultured in rooting media were transferred to a controlled weaning chamber for acclimatization process. The controlled weaning chamber was set at 85-95% humidity and temperature 28°C. Jiffy7® pellet (containing a compressed mixture of coconut peat and peat moss) was soaked in water for 10 minutes to let it expanded. The Eucalyptus hybrid plantlets were removed from the culture vessel and carefully washed with water to remove excess media. The plantlets were kept in the acclimatization chamber for 4 weeks. Percentage of survivability during acclimatization process was recorded. The survived plantlets were transferred into a polybag filled with burnt soil: peat moss (1:1).

Results and Discussion

Establishment of Eucalyptus hybrid clean culture was successful by using Chlorox® (commercial bleach) and ethanol as surface sterilizing agents. The clean culture produced new shoots after 3 weeks in culture and multiplied vigorously. The shoot multiplication of Eucalyptus hybrid in semi-solid media is preferable in MS basal media supplemented with 0.1 mg/L BAP and this species showed its remarkable growth even in the bottle culture compared with other woody species such as Tectona grandis and Dyera costulata in our laboratory (personal observation and communication). The plant growth regulator i.e. BAP (Benzyl-aminopurine) commonly used for shoot multiplication was required only in low concentration since the use of high concentration BAP affect the new shoot growth. The height of Eucalyptus hybrid new shoots reduced when cultured in MS media supplemented with more than 0.1 mg/L BAP. Even though new shoot increased abundantly in numbers, however the quality of the new shoot induced in high BAP concentration is low since the shoots were stunted and fragile and also difficult to subculture. During sub culturing process, this explant withered and died quickly due to water loss if exposed too long in the laminar airflow. Hence, proper techniques during sub culturing are required to obtain optimum result and minimizing the loss of the explants.

As for liquid culture, Eucalyptus hybrid shows multiple shoot regeneration and elongation in the temporary immersion bioreactor system (TIB). The numbers of new shoot produced were increased about 3 folds and elongated about 2 to 4 cm in height after 1 month in culture. Both semi-solid and liquid cultures are suitable for Eucalyptus hybrid shoot multiplication and showed no obvious differences in the shoot morphology. Eucalyptus hybrid culture in other temporary immersion bioreactor system, TIB also produced positive result even different culture medium and different immersion time used (Businge et al., 2017; Maximo et al., 2018).

Complete plantlets of Eucalyptus hybrid were successfully acclimatized in a weaning chamber after 4 weeks with more than 90% survival rate. The survived plantlets were transferred into polybags filled with burnt soil: peat moss (1:1) and kept under shades before transplanting in the field to avoid shock effect. Figure 1 shows the process flow of tissue culture protocol development for Eucalyptus hybrid.

308

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

1 cm 1 cm

Figure 1: The process flow of Eucalyptus hybrid tissue culture protocol development A) Sample collection at Bukit Hari, Kepong; B) Shoot multiplication in semi-solid media (MS supplemented with 0.1 mg/L BAP); C) Shoot multiplication in liquid media, temporary immersion bioreactor system (TIB) (MS supplemented with 0.1 mg/L BAP); D) Rooting media (½ MS supplemented with 0.1 mg/L IBA) and E) Eucalyptus hybrid plantlets in polybags ready to be transplanted in the field.

Conclusions

In our lab, we have successfully developed the protocol for micropropagation of Eucalyptus hybrid (E. urophylla x E. grandis). The technology produced is available to be taken up by interested industries and the plantlets produced are ready to be sold in large quantity for plantation purposes. This effort was taken to support the industrial needs for sustainable raw materials of Eucalyptus hybrid.

Acknowledgements

The authors would like to thanks all staff from Forest Biotechnology Division, FRIM for their assistance during sample collection and also kind and informative guidance we received throughout completing this study. We also like to give our deepest gratitude to FRIM for providing fund and facilities to complete this study.

References

Ahmad Zuhaidi, Y. 2018. Information paper on Commercial Planting of Eucalyptus in Malaysia (not published). Batish, D.R., Singh, H.P., Kohli, R.K. and Kaur, S. 2008. Eucalyptus essential oil as a natural pesticide. Forest Ecology Management 256: 2166-2174. Businge, E., Trifonova, A., Schneider, C., Rödel, P. and Egertsdotter, U. 2017. Evaluation of a new temporary immersion bioreactor system for micropropagation of cultivars of Eucalyptus, birch and fir. Forests 8(6): 196.

309

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Máximo, W.P.F., Santos, P.A.A., Martins, G.S., Mendonca, E.G. and Paiva, L.V. 2018. In vitro multiplication of Eucalyptus hybrid via temporary immersion bioreactor: Culture media and cytokinin effects. Crop Breeding and Applied Biotechnology 18(2): 131-138. Mokotedi, M.E., Watt, M. and Pammenter, N. 2010. Analysis of differences in field performance of vegetatively and seed-propagated Eucalyptus varieties II: Vertical uprooting resistance. Southern Forests 72: 31-36. Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassays with tobacco tissue culture. Plant Physiology 15: 473-497. Trueman, S.J., Hung, C.D. and Wendling, I. 2018. Tissue culture of Corymbia and Eucalyptus. Forests 9(2): 1-42.

310

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Particle Size Distribution on Different Incubation Temperatures of Nanofertilisers

Mohd Nor, M.R.1,*, Khalisanni, K.1, Noor Azlina, M.1, Busu, A.G.2, Madzaki, A.G.2, Masnan, A.G.2, Asfaliza, R.3, Hanisa, H.3 and Kayathri, K.1,4 1Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 2KPG Resources Sdn. Bhd, 10-3S, Ukay Boulevard, MRR2, 68000 Ampang, Selangor, Malaysia. 3Paddy and Rice Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 4Faculty of Food and Agriculture Sciences, Universiti Putra Malaysia, Bintulu Campus, 97008 Bintulu, Sarawak, Malaysia. *E-mail: [email protected]

Introduction

All fertilisers are more or less hygroscopic which means that they start absorbing moisture at a specific humidity or at a certain water vapour pressure. Some very hygroscopic fertilisers attract moisture much more readily and at lower humidity than others. Water absorption takes place if the water vapour pressure of the air exceeds the water vapour pressure of the fertiliser (Adam and Merz, 1929).

Nanostructured formulation of fertilisers might increase fertiliser efficiency and uptake ratio of the soil nutrients in crop production, and can save fertiliser resources. Controlled release modes have properties of both release rate and release pattern of nutrients for water-soluble fertilisers. It might be precisely controlled through encapsulation in envelope forms of semi-permeable membranes coated by resin-polymer, waxes and sulphur (Solanki et al., 2015).

Effective duration of nutrient release that has desirable property of nanostructure formulation can extend effective duration of nutrient supply of fertilisers into soil. Nanostructured formulation of fertiliser can reduce loss rate of fertiliser nutrients into soil by leaching and/or leaking (Xie et al., 2011). This experiment was carried out to study the effect of temperature on the particle size of Nano NPK and iron chelate Nano fertilisers.

Materials and Methods

In this study, 1g Nano NPK and Nano Iron were dissolved with 500 mL deionizer water, respectively. A total of 20 mL Nano NPK and Nano Iron were poured into Schott Duran bottle (100 mL) and placed into water bath at 35oC, 40oC and 45oC for 15- and 30-minute incubation periods. After each incubation period, the particle size was recorded using particle size analysis machine.

Results and Discussion

The initial reading of nanofertiliser particle size at ambient temperature (25oC) showed that the average size of the nanofertilisers were 2300.98 nm and 1131.34 nm for Nano NPK and Nano Iron, respectively.

Results in Table 1 showed that the particle size increased from 35oC, 40oC and 45oC for Nano NPK and Nano Iron. The results also suggested that temperature increased the kinetic movement of particle especially counterions and caused changes to the size of the fertiliser compound.

311

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Based on Statistical Analysis from ANOVA Test-Tukey B in Table 2, it was found that the findings for the effects of temperature on the nanofertiliser growth were significant (p<0.05). The results showed that 30oC incubation temperature for Nano NPK and Nano Iron fertiliser growth were significantly better than 40oC and 45oC. The particle size of aggregated nanofertilisers at 35oC = [Nano NPK]T and [Nano Iron]T were found at 752.78±60.5 nm and 667.07±147.02 nm respectively.

Table 1: Particle size at different incubation temperatures. Temperature (oC) Nano NPK Nano NPK Nano iron Nano iron (particle size) (particle size) (particle size) (particle size) (nm) (nm) (nm) (nm) Time 15 minutes 30 minutes 15 minutes 30 minutes 30oC 593.04±6.64 662.64±169.69 1375.27±826.01 762.39±132.06 35oC 752.78±60.5 567.12±55.44 667.07±147.02 615.49±52.58 40oC 804.36±83.22 706.69±50.4 693.65±24.29 696.65±69.55 45oC 12494.51±1020.12 5048.37±1117.22 4912.79±2495.33 6589.57±2838.68

Table 2: Anova (Oneway) for the particle size distribution on different incubation temperatures of nanofertilisers. Sum of squares df Mean square F Sig. NanoNPK Between groups 194854538.236 7 27836362.605 5.197 .003 Within groups 85705963.847 16 5356622.740 Total 280560502.084 23 NanoIRON Between groups 4076242.033 7 582320.290 5.361 .003 Within groups 1738060.633 16 108628.790 Total 5814302.666 23

Figures 1 and 2 showed significant increase of nanofertiliser (nanoNPK and nanoIron) at 40oC and 45oC for 15- and 30-minute incubation temperatures (Kim et al., 2000). The development of large particles size of nanoNPK and nanoIron at 15 minutes and 30 minutes initially started at 40oC and increased at 45oC. The increase in nanofertiliser particle size was due to the binding affinity of counterions toward the headgroup of fertilisers.

312

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: The graph of nanofertiliser particle size (nm) for nanoNPK(- - -) and nanoIron ( ) at different incubation temperatures and 15 minutes interval.

Figure 2: The graph of nanofertiliser particle size (nm) for nanoNPK(- - -) and nanoIron ( ) at different incubation temperatures and 30 minutes interval.

In Figure 3, the particle size of nanofertilisers swelled up from 35oC to 45oC due to the increase of kinetic forces leading to the distance of counterions to the headgroup (Veekens and Hamelers, 1999).

313

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 3: Swelling phenomenon of nanofertiliser for counterion (C+) affinity to the headgroup (HG) at different T = 45oC (a) and 35oC (b).

Conclusion

The present study showed the effect of different incubation temperatures and time on the particle size of different nanofertilisers. The surface area of the nanofertiliser particles increased significantly with increasing incubation temperatures.

Acknowledgements

The authors would like to thank the Sodour Ahrar Shargh Company (Iran) and KPG Sdn. Bhd. for granting the research.

References

Adams, J.R. and Merz, A.R. 1929. Hygroscopicity of fertiliser materials and mixtures. Industrial and Engineering Chemistry 21(4): 305-307. Kim, I.S., Kim, D.H. and Hyun, S.H. 2000. Effect of particle size and sodium ion concentration on anaerobic thermophilic food waste digestion. Water Science and Technology 41(3): 67-73. Solanki, P., Bhargava, A., Chhipa, H., Jain, N. and Panwar, J. 2015. Nano-fertilisers and their smart delivery system. In Nanotechnologies in food and agriculture (pp. 81-101). Springer, Cham. Veeken, A. and Hamelers, B. 1999. Effect of temperature on hydrolysis rate of selected biowaste components. Bioresource Technology 69(3): 249-254. Xie, L., Liu, M., Ni, B., Zhang, X. and Wang, Y. 2011. Slow-release nitrogen and boron fertiliser from a functional superabsorbent formulation based on wheat straw and attapulgite. Chemical Engineering Journal 167(1): 342-348.

314

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Immunosensor Development for the Detection of Xanthomonas oryzae pv. oryzicola in Rice Bacterial Leaf Streak

Hazana, R., Nur Azura, M.S. and Faridah, S.* Biodiagnostic-Biosensor Programme, Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), MARDI Headquarters, Persiaran MARDI- UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Bacterial leaf blight and bacterial leaf streak of rice are destructive rice diseases caused by Xanthomonas species. The discovery of bacterial leaf streak (BLS) caused by Xanthomonas oryzae pv. oryzicola (Xoc) is more recent compared to the bacterial leaf blight (BLB) disease that had been known to exist over a century (Mohd Said et al., 2018). Although BLS is seldom reported in Malaysia, BLS was prevalent in some parts of Asia and Africa, decreasing yield as high as 32% in 1000-grain weight (Li et al., 2014). The BLS occurrence was significantly higher in China where hybrid rice cultivars were found to be more susceptible to this disease (Zhao et al., 2012).

Symptoms of BLS infection at early stage consist of water-soak lesions that develop into translucent, yellow interveinal streaks of various lengths, initially restrict to the leaf blades (Figure 1). These lesions will enlarge, turn yellowish-orange to brown and eventually coalesce. Tiny amber droplets of bacterial exudates are often present on the lesions. Finally, lesion margins form lines parallel to the vein hence called leaf streak rather than wavy formation as for leaf blight. However, at advanced stages, both BLB and BLS are difficult to distinguish from each other. Although direct observation of the bacteria is preferred, the indication is not scientifically proven or confirm.

Figure 1: Pictures of a healthy paddy leaf (left) and Xoc infected paddy leaf with bacterial leaf streak symptoms (right).

Currently, both conventional and real-time PCR have been widely used to detect or verify the presence of Xanthomonas oryzae pv. oryzae ( Xoo) and Xoc. However, both methods require skilled and trained personnel apart from being time consuming. Under this circumstance, an antibody-based biosensor or immunosensor is becoming tool of interest in sensing owing to its versatility and sensitivity that allow rapid and sensitive detection of pathogens. Antibody-based biosensors were remarked to hold great potential for agricultural plant pathogen detection as it enabled pathogen detection in air, water and seeds with on-site application (Fang and Ramasamy, 2015).

315

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

In this study, an electrochemical immunosensor for the detection of Xoc in rice bacterial leaf streak was developed based on screen-printed carbon electrode (SPCE). The detection was adapted from sandwich enzyme-linked immunosorbent assay (ELISA) employing chronoamperometry (CA) technique. Among parameters studied in the immunosensor construction include set potential analysis and selection of suitable blocking agents. By carefully designing and optimizing the sensor development, this will eventually lead to a robust and reliable sensor for future on-field applications.

Materials and Methods

Chemicals and reagents

Polyclonal antibody against Xoc was developed in-house at Animal Complex, MARDI using culture isolates from National Collection of Plant Pathogenic Bacteria (strain 1585 and 2921) as described by Mohd Said et al. (2017). Pyrrole, 3,3’,5,5’-tetramethylbenzidine (TMB) substrate solution, bovine serum albumin (BSA), ethanolamine, ferrocenecarboxylic acid (FCA), sodium bicarbonate (NaHCO3), sodium carbonate (Na2CO3) and phosphate buffer saline (PBS) tablets were purchased from Sigma- Aldrich, USA. N-(3-Dimethylaminopropyl) - N’- ethylcarbodiimide hydrochloride (EDC) and N- hydroxysuccinimide (NHS) were purchased from Sigma-Aldrich, Japan. Functionalized multi-walled carbon nanotubes (MWCNT-COOH) and ceramic-based screen-printed carbon electrodes (SPCE) were from Dropsens, Spain. Blotto Non-Fat Dry Milk and EZ-Link™ Plus Activated Peroxidase Kit were supplied by Santa Cruz and Thermo-Scientific, USA, respectively. Phosphate buffered saline (PBS) solution was prepared by dissolving one PBS tablet in 200 mL deionized (DI) water yielding 0.01 M phosphate buffer, pH 7.4 at 25°C. All solutions were prepared using DI water from Milli-Q Ultrapure water system with a resistivity of 18.2 MΩcm.

Bio-functionalization of carbon surface

Electrodeposition of polypyrrole (Ppy)/functionalized-MWCNT was performed by electropolymerization of 0.075 M pyrrole in the presence of 0.1 mg/mL functionalized-MWCNT (MWCNT-COOH) onto SPCE by chronoamperometry technique. Electropolymerization potential of +1.0 V was applied and the mixtures were deposited for 900 s in PBS as electrolyte. SPCE was then rinsed with DI water and dried under nitrogen (N2) flow. The carboxylic group of MWCNT-COOH was activated in 10 µL mixture of 0.4 M EDC and 0.1 M NHS (1:1) for 15 min. The excess unbound linker was washed out using PBS, N2 dried and SPCE was immediately incubated with 5 uL of anti- Xoc antibody 1 hour. The SPCE surface was then washed with PBS and blocked for 30 min using different types of blocking agents, i.e. bovine serum albumin (BSA) and ethanolamine. A Xoc cell at concentration 100 to 108 CFU/mL was placed on the SPCE’s WE and incubated for 1 hour. The antigen was diluted in 0.1 M carbonate-bicarbonate, pH 9.6. The unbound antigen was washed away with PBS and 5 µL of purified anti-Xoc antibody conjugated with HRP was dropped onto working electrode, incubated for 30 min and washed again with PBS. All modification steps were performed at room temperature.

Electrochemical set-up and measurements

Autolab PGSTAT 20 potentiostat (Eco Chemie, Netherlands) was used for the sensor analysis. Electrochemical measurements for the modified SPCEs with bounded antibody and Xoc cells were carried out by placing 50μL of TMB solution onto SPCEs covering all three-electrode and measured using chronoamperometry at optimized potential for 300 s. All electrochemical measurements were carried out at room temperature using NOVA 1.10 software.

Results and Discussion

The electrochemical immunosensor system developed in this work was based on direct competitive 316

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

immunoassay format with horseradish peroxidase (HRP) as the enzyme label and TMB/H2O2 as the substrate/mediator system (Figure 2). The screen printed carbon electrode (SPCE) was modified with electrodeposited pyrrole and carboxylic functionalized-multiwall carbon nanotube (MWCNT-COOH) onto working electrode. The electrodeposition was performed at applied potential of +1.0 V for 15 minutes. The major advantage of polymer film formation achieved via electrodeposition technique is that electrochemical deposition allows precise and controllable formation of the polymer coating on the electrode surface. Polypyrrole (Ppy) was favourable in this study owing to its applications’ versatility and stability (Cosnier, 2003). The mild conditions used for Ppy polymerizations were ideal for immobilization most of the biological elements from enzymes to whole living cells. MWCNT on the other hand was able to induce carbon enhancement for signal amplification due to the conductive properties of polypyrrole and high surface area of MWCNT-COOH (Swati et al., 2016).

Figure 2: Schematic diagram of electrochemical immunosensor format used for bacterial lea streak detection (adapted from Salam and Tothill, 2009).

Cyclic voltammetry (CV) response of a bare and modified SPCE was measured in the presence of 1 mM ferrocenecarboxylic acid (FCA) in PBS 0.01 M, pH 7.4 as redox solution (Figure 3). The peak current was found to significantly increase after modification with Ppy/MWCNT-COOH indicating the active surface area also has been successfully increased. Large binding site of carboxylated MWCNT allowed more immobilization of antibody onto modified electrode surface through EDC-NHS crosslink thus increased the sensitivity of the immunosensor (Nurul ain et al., 2016).

Figure 3: Cyclic voltammetry (CV) response for bare (blue line) and modified screen printed electrode with electrodeposited Ppy/MWCNT-COOH (red line).

A potential scanning study of Xoc detection at range potential from -0.6 V to +0.6 V is shown in Figure 4. The immunosensor exhibited the highest performance at set potential of -0.1 V. It was exhibited by a

317

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

high signal current to background current ratio (S/B) for all concentration of Xoc cells. Potential of -0.1 V was thus optimized as set potential for all measurements in chronoamperometry study for sensor development.

Figure 4: Set potential optimization by scanning the potential from -0.6V to +0.6V.

Non-specific binding which interfere with the real detection signals also a critical problem in the development of immunosensor. Eliminating the non-specific binding on a sensor surface was one of the greatest challenges for the development of a specific and robust immunosensor (Tam and Hieu, 2011). In this study, the performances of ethanolamine and bovine serum albumin (BSA) as blocking agents were studied and compared (Figure 5). A lower background current was observed when ethanolamine was used as blocking agent compared to BSA by 70%. This indicated that ethanolamine had successfully deactivated all the remaining active carboxylic acid groups while BSA was not favourable in this particular application.

Figure 5: Effect of 0.1% ethanolamine (blue legend) and 0.5% BSA (red legend) as blocking agents.

Standard curve for Xoc detection was performed via chronoamperometry (CA) analysis using mix culture of 1585 and 2921 Xoc strains in carbonate buffer pH 9.6. After Xoc cells concentrations of 100 to 108 were added, conjugated anti Xoc antibody-enzyme (HRP) were dropped to allow binding onto the Xoc cells. TMB was finally dropped onto electrode and the current was recorded. Figure 6 shows the calibration plot of Xoc in the mixed culture. The absolute current values increased accordingly with Xoc concentrations in both linear regression graph and logarithmic graph with linear correlation coefficient of 0.9607 and 0.9772 respectively. Limit of detection (LOD) is at 102 CFU/mL. These 318

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

results highlighted the success and sensitivity of the developed immunosensor.

Figure 6: Calibration plot (a) Linear Regression graph; (b) Logarithmic graph of Xanthomonas oryzae pv. oryzicola (Xoc) using Xoc mixed culture of 1585 and 2921 Xoc strains.

Conclusions

The successful development of electrochemical immunosensor for the detection of Xoc in rice disease was presented here. A sandwich type format was adapted to produce a sensitive immunosensor. Set potential was first scanned to obtain the best potential for the immunosensor reaction. It was found that potential of -0.1 V gave the highest signal current to background current ratio (S/B) and was selected for all chronoamperometry measurements for immunosensor development. The interference attribute to non-specific binding was investigated by using ethanolamine and BSA as blocking agents. Ethanolamine reduced the non-specific binding by 70% compared to BSA at 100 CFU/mL of Xoc (control negative study). Calibration plot was successfully developed showing a good linear relationship between number of Xoc cells and the current signal response. This biosensor can thus represent a promising bioanalytical tool for early warning system for detection of Xanthomonas oryzae pv. oryzicola in rice bacterial leaf streak.

Acknowledgements

The authors would like to thank the Malaysian Agricultural Research and Development Institute (MARDI) for funding this research project (Development Fund code P-RI401-1001).

References

Cosnier, S. 2003. Biosensors based on electropolymerized films: new trends. Analytical and Bioanalytical Chemistry 377(3): 507-520. Fang, Y. and Ramasamy, R.P. 2015. Current and prospective methods for plant disease detection. Biosensors 5(3): 537-561. Li, P., Shi, L., Yang, X., Yang, L., Chen, X.W., Wu, F., Shi, Q.C., Xu, W.M., He, M., Hu, D.Y. and Song, B.A. 2014. Design, synthesis, and antibacterial activity against rice bacterial leaf blight and leaf streak of 2,5-substituted-1,3,4-oxadiazole/thiadiazole sulfone derivative. Bioorganic and Medicinal Chemistry Letters 24: 1677-1680. Mohd Said, N.A., Abdul Talib, M.A., Masdor, N.A., Ghazali, M.S. and Salam, F. 2017. Penghasilan antibodi terhadap Xanthomonas oryzae pv. oryzicola untuk pembangunan kit pengesan penyakit jalur daun dalam sistem pengurusan penyakit padi. Prosiding Persidangan Padi Kebangsaan 2017. Pp. 337-341.

319

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Nurul Ain, A.T., Siti Nur Jannah, S.Z.A., Faridah, S. and Yusran, S. 2016. Clenbuterol immunosensors based poly(3,4-ethylenedioxythiophene)/multiwall carbon nanotube (PEDOT/MWCNT) hybrid composite. Procedia Chemistry 20: 29-32. Salam, F. and Tothill, I.E. 2009. Detection of Salmonella typhimurium using an electrochemical immunosensor. Biosensors and Bioelectronics 24(8): 2630-2636. Swati, S., Nimisha, J. and Rajeev, J. 2016. Next-generation polymer nanocomposite-based electrochemical sensors and biosensors: A review. Trends in Analytical Chemistry 82: 55-67. Tam, P.D. and Hieu, M.V. 2011. Conducting polymer film-based immunosensors using carbon nanotube/antibodies doped polypyrrole. Applied Surface Science 257: 9817-9824. Zhao, S., Poulin, L., Rodriguez-R, L.M., Serna, N.F., Liu, S.Y., Wonni, I., Szurek, B., Verdier, V., Leach, J.E., He, Y.Q., Feng, J.X. and Koebnik, R. 2012. Development of a variable number of tandem repeats typing scheme for the bacterial rice pathogen Xanthomonas oryzae pv. oryzicola. Phytopathology 102(10): 948-956.

320

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Screening for Antimicrobial Activity of Essential Oils against Xanthomonas oryzae pv. oryzicola

Noor Azlina, M.1,*, Faridah, S.1, Khalisanni, K.1, Nur Sabrina, W.1, Mohd Shahrin, G.1, Muhamad Shafiq, A.K.1, Siti Nadzirah, P.1, Kogeethavani, R.2 and Siti Norsuha, M.2 1Biotechnology and Nanotechnology Research Centre, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 2Paddy and Rice Research Centre, MARDI Seberang Perai, 13200 Seberang Perai, Penang, Malaysia. *E-mail: [email protected]

Introduction

Rice diseases are among the most significant limiting factors that affect rice production, causing annual yield losses conservatively estimated from 5 to 30% (Savary et al., 2012). One of the most destructive rice diseases is the bacterial leaf streak (BLS) disease caused by Xanthomonas oryzae pv. oryzicola (Xoc). Xoc is an intercellular pathogen that enters plants through wounds or by invading the open stomata. Once inside the plants, Xoc multiplies between the mesophyll parenchyma cells, spreading up and down the leaf between the vascular bundles (Mew, 1993).

Rice disease management strategies are mainly aimed at the prevention of outbreaks or epidemics through the use of chemical and antibiotics. However, continuous, inappropriate and non- discriminative use of chemicals is known to cause undesirable effects such as residual toxicity, development of pathogen resistance, environmental pollution, health hazards to humans and animals and increased expenditure for plant protection (Singh et al., 2015). Nowadays, plant pathologists have focused their attention on developing environmentally safe, long-lasting and effective biocontrol methods based on plant essential oils (EOs) for the management of major diseases in crops.

Essential oils (EOs) are promising alternative compounds which have an inhibitory activity on the growth of pathogens. EOs are synthesized naturally in different plant parts during the process of secondary metabolism in secretary opening of the cell wall of plants or glandular hairs and these survive as fluid droplets in roots, stems, leaves, bark, flowers, and fruits in various plants (Rehman et al., 2016). In nature, EOs play important role in the protection of plants as anti-bacterial, anti-viral, anti-fungal, insecticides and also against herbivores by reducing their appetite for such plants. Consist of volatile compounds, the reactivity of EOs are depended upon the nature, composition, and orientation of its functional groups (Wazir et al., 2014). The presence of different types of aldehydes, phenolics, terpenes, and other antimicrobial compounds means that the EOs are effective against a diverse range of pathogenic bacteria. EOs contains a wide range of secondary metabolites that are capable of inhibiting or slowing the growth of bacteria against a variety targets, particularly the membrane and cytoplasm, and in some cases, they completely change the morphology of the cells (Nazzaro et al., 2013).

The objective of this work is to evaluate the effects of plant essential oils (EOs) on the growth of Xoc. Essential oils from the tea tree (Melaleuca alternifolia), lemongrass (Citronella naradus), paper bark (Melaleuca cajaputi), garlic (Allium sativum), and nelam (Pogostemon cablin) were evaluated in vitro using disc diffusion assay method for inhibitory activity testing against bacteria Xoc.

321

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Essential oils

Essential oils from tea tree (M. alternifolia), lemongrass (C. naradus), paper bark (M. cajaputi), and nelam (P. cablin) were obtained from MARDI Kuala Linggi, Negeri Sembilan while garlic (A. sativum) was bought from the local supermarket.

Bacteria

The strain of X. oryzae pv. oryzicola (NCPPB 1585) was obtained from the culture collection of the National Collection of Plant Pathogenic Bacteria. The strain was cultured on potato sucrose agar (PSA) at 30°C for 48 hrs. Large quantities of the mass-produced bacterium on PSA agar were collected by washing the colony surface on the agar plate with 1 mL of ultra-pure water. Cells were harvested by centrifugation at 5,000 × g for 15 min at 4C on a benchtop centrifuge. The pelleted cells were then washed with 0.01 M phosphate buffered saline (PBS) at pH 7.4 and the procedures were repeated three times. The bacterial cells were then re-suspended in PBS and the bacterial suspensions were adjusted to optical densities (OD) at 600 nm of between 1.0 and 1.3 to obtain bacterial concentrations at 1×109 CFU mL-1 on a UV/VIS spectrophotometer. The bacterial concentrations were confirmed by a spread plate method on PSA agar.

Antimicrobial activity

The antimicrobial study involved the paper disc diffusion assay method. The agar plates were inoculated with 100 μL of a suspension containing 109 CFU mL-1 of Xoc spread on PSA agar. Then, 6 mm diameter of filter paper disc was individually impregnated with 5 μL of essential oils and placed in the centre of the inoculated agar. Negative controls samples were prepared by replacing essential oils with mineral oil while positive controls were prepared using the streptomycin at the concentration of 0.5 mg mL-1. Petri dishes were then incubated at 30°C for 48 hrs. After incubation, the essential oils diffuse into the agar and inhibits the germination and growth of Xoc. The antimicrobial activities of the essential oils were evaluated by measuring the zone of inhibition in diameter (mm) around the discs against Xoc. Each test assays were repeated in triplicate. The inhibition zones developed in and around sample indicate the antimicrobial activity. The experiment was repeated five times.

Statistical analysis

Results are given as mean ± standard deviation. Differences were considered statistically significant at p<0.05 using Student’s t-test with a Tukey post Hoc test through GraphPad Prism software (v 5.0) available from www.graphpad.com.

Results and Discussion

The antimicrobial activities of crude EOs against Xoc are summarized in Table 1. The results show the diameter of the inhibition zone including the diameter of the paper disk (6 mm) after 48 hours. A broad variation in antimicrobial properties of the analysed EOs was observed in this study.

The EO of paper bark (M. cajaputi) shows strong antimicrobial activity against Xoc with the inhibition zones of 20±0.7 mm, whereas lemongrass (C. naradus) and tea tree (M. alternifolia) show a minimum inhibitory reaction with an inhibition zone of 11±1.9 and 9.2±0.40 mm, respectively. On the other hand, the EOs of nelam (P. cablin) and garlic (A. sativum) were found to be weak or failed to inhibit the growth of Xoc.

322

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 1: Antimicrobial activity of EOs against Xoc using paper disk diffusion method. Essential oils (EOs) Diameter of inhibition zone (mm) Positive control 22.3±1.52 Negative control No inhibition Lemongrass (Citronella naradus) 11±1.9 Paper bark (Melaleuca cajaputi) 20±0.7 Tea tree (Melaleuca alternifolia) 9.2±0.4 Nelam (Pogostemon cablin) No inhibition Garlic (Allium sativum) No inhibition *Values are mean diameter of the inhibitory zone (mm), ±SD of five replicates. *Significantly different (p>0.05). *The diameter is included of the paper disk (6 mm).

(a) (b) (c)

(d) (e)

Figure 1: Inhibition diameter zones obtained by paper disc diffusion method for; (a) Nelam (Pogostemon cablin), (b) Garlic (Allium sativum), (c) Tea tree (Melaleuca alternifolia), (d) Lemongrass (Citronella naradus) and Paper bark (Melaleuca cajaputi).

The results of this study may be served as a guide for selecting EOs for future work. The data obtained in the present work suggest that EO of paper bark (M. cajaputi) could be applied as an inhibitor to prevent the growth of Xoc in paddy field. In accordance with numerous previous reports, paper bark (M. cajaputi) had been characterized by a high content of eugenol-type phenylpropanoids or terpenoids, of which γ-terpinene and terpinolene predominate among the monoterpenes. The 1,8- cineole chemotype of paper bark (M. cajaputi) leaf EO has been found to be active against Bacilus cereus and Staphylococcus aureus and a series of other fungi while the methyl eugenol chemotype is an effective virucide against Herpes simplex virus type 1 (De Silva at al., 2017).

323

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Conclusions

Development of natural antimicrobial agents is a major step towards reducing the negative effects associated with chemicals and antibiotics such as toxic residues in agricultural products, resistance development in targeted microorganisms and general harmful effects on the environment, humans, and animal. In vitro studies revealed that the EOs of paper bark (M. cajaputi) had remarkable antimicrobial activity against Xoc, and its potential in the management of pathogenic bacteria in agriculture will be validated in the future.

References

De Silva, B.C.J., Jung, W.J., Hossain, S., Wimalasena, S.H.M.P., Pathirana, H.N.K.S. and Heo, G.J. 2017. Antimicrobial property of lemongrass (Cymbopogon citratus) oil against pathogenic bacteria isolated from pet turtles. Laboratory Animal Research 33(2): 84-91. Mew, T.W. 1993. Xanthomonas oryzae pathovars on rice: Cause of bacterial blight and bacterial leaf streak. In: Swings, J.G. and Civerolo, E.L. (Eds.), Xanthomonas. Chapman and Hall, London. Pp. 30-40. Nazzaro, F., Fratianni, F., De Martino, L., Coppola, R. and De Feo, V. 2013. Effect of essential oils on pathogenic bacteria. Pharmaceuticals 6: 1451-1474. Rehman, R., Hanif, M.A., Mushtaq, Z., Mochona, B. and Qi, X. 2016. Biosynthetic factories of essential oils: The aromatic plants. Natural Products Chemistry and Research 4: 227. doi:10.4172/2329-6836.1000227 Savary, S., Ficke, A., Aubertot, J.N. and Hollier, C. 2012. Crop losses due to diseases and their implications for global food production losses and food security. Food Security 4: 519-537. Singh, R., Singh, R., Yadav and Javeria, S. 2015. Management of bacterial leaf blight of Basmati rice caused by Xanthomonas oryzae pv. oryzae with some available antibiotics and plant products. International Journal of Innovative Research and Development 3(11). Wazir, A., Mehjabeen, Jahan, N., Sherwani, S.K. and Ahmad, M. 2016. Antibacterial, antifungal and antioxidant activities of some medicinal plants. Pakistan Journal of Pharmaceutical Sciences 27(6): 2145-52.

324

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Identification of QTLs Linked to Selected Bunch Components in a DxP Oil Palm Mapping Population

Zolkafli, S.Z.1, Ithnin, M.1,*, Ting Ngoot, C.1, Singh, R.1, Zainol Abidin, M.I.2 and Ismail, I.3 1Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board, No. 6, Persiaran Institusi, 43000 Kajang, Selangor, Malaysia. 2Plant Breeding Laboratory, Lot 2135, Batu 23½, Jalan Johor Bahru, 81900 Kota Tinggi, Johor, Malaysia. 3Institute of Systems Biology (INBIOSIS), Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. *E-mail: [email protected]

Introduction

The palm oil exports in 2017 generated significant revenue for the Malaysian economy, totally RM 46.12 billion from India and European Union market (Kushairi et al., 2018). This was partly contributed by the increase of oil palm planted area in the country, which reached over 5.7 million hectares (Kushairi et al., 2017). However, moving forward, the increasing due to global demand of palm oil and reduced available land for expansion necessitates improving oil palm productivity. The tenera is the commercial oil palm, producing outstanding yield compared to dura and pisifera. Yield components such as mean bunch number, mean fresh fruit bunch, oil to fruit and mesocarp to fruit ratios are the major yield characteristics in oil palm genetic studies. In recent decades, molecular markers have been employed to identify quantitative trait loci (QTLs) for these important yield components and agronomic traits (Billotte et al., 2010; Pootakham et al., 2015; Teh et al., 2016; Seng et al., 2016), stem height (Lee et al., 2015) and fatty acid composition (Jeenor and Volkaert, 2014; Ting et al., 2016;). Marker-trait association has therefore made it possible to apply Marker Assisted Selection (MAS) technology for early selection of parental palms to accelerate genetic improvement efforts (Collard and Mackill 2008). To assist with these on-going efforts, we identified QTLs for moisture content (MC) and mean nut weight (MNW) using a selected dura x pisifera (DxP) mapping population.

Materials and Methods

Mapping family

The leaf samples of elite DxP mapping family were provided by Kulim Plantations Bhd. (KULIM). They consisted of 135 tenera palm progenies. The family was created by crossing the Ex-Ulu Remis Deli dura (KT 910512/0804) x AVROS pisifera (KT 911101/1203). The trial was laid down at Tereh Utara Plantation, Johor, Malaysia.

Yield phenotypic data

The phenotypic data for moisture content, (MC) and mean nut weight (MNW) was measured from 2006 to 2010. Distribution analysis according to Kolmogorov-Smirnov, descriptive statistic and Pearson correlation was carried out using the statistical software SPSS16.0.

Genomic DNA extraction

Genomic DNA extraction was carried out using the modified CTAB method (Doyle and Doyle, 1990). Quality of DNA was verified by EcoRI and HaeIII digestion. DNA was considered acceptable when spectrometric reading ranged from 1.8-2.0 obtained using the NanoDrop spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE).

325

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

SNP and SSR analyses

The DNA obtained was genotyped using single sequence repeats (SSR) and single nucleotide polymorphism (SNP) markers. For SSR genotyping, the PCR product was separated using ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). The data was scored according to Billotte et al (2005) assisted by GeneMapperv4.1 (Applied Biosystem). Meanwhile, The SNP genotyping was performed on Illumina Infinium II Bead-Chip array (Illumina Inc., San Diego, CA) containing 4,451 SNPs. The SNP and SSR genotyping and analysis procedures employed were as described by Ting et al. (2013).

Linkage map construction

Polymorphic SSRs and SNPs were used to construct a DxP genetic map using JoinMap® 4.1 (van Ooijen 2006) as described by Ting et al. (2013). The linkage map was constructed using ML mapping algorithm and Haldane map function. Each linkage group was formed at RF≤0.2 and marker with N.N Stress >4cM and with ≥10% missing data were excluded from the genetic map.

QTL analysis

Quantitative trait loci (QTL) analyses for MNW and MC were carried out using MapQTL6.0 software (van Ooijen, 2009). Interval mapping (IM) and the Kruskal-Wallis non-parametric ranking tests (KW) were performed to link polymorphic markers to genomic regions influencing MNW and MC. Permutation test was carried out to estimate threshold value for each trait at 95% with 1000 iterations. The individual genotype effect of each marker was further identified using mean comparison of the genotype class in SPSS16.0.

Results and Discussion

Yield components statistical analysis

For MNW, the values obtained ranged from 1.25 g to 3.21g with the variance and mean of 0.17 and 2.37±0.03 respectively. Meanwhile, MC ratio was between 75.31 and 82.79% with the variance and mean of 4.66 and 36.24±0.19 respectively. Both of the traits were normally distributed according to Kolmogorov-Smirnov at p>0.05 (Figure 1). Correlation analysis revealed that MC was positively correlated with MNW (p = 0.01) with the r value of 0.222. This indicates increasing MNW would also increase MC value and vice versa. Nonetheless, for selection of higher oil yield, palms with low MC are likely preferred as reported by Parodi et al. (2007) in avocado, where the oil content decreased with the increase in pulp moisture content.

326

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Distribution of selected traits in DxP mapping population.

QTL identification in DxP mapping population

Using permutation test implemented via the MapQTL6 software, the threshold value obtained was LOD = 3.1. Thus, any markers with LOD above the threshold value can be considered as significant QTL. At 95.0% chromosome-wide level, QTLs for MNW and MC were identified on linkage group (LG) 9 (Table 1 and Figure 2). The QTL for MNW was identified at map interval ranging from 26.7 to 29.6 cM. For MC, two QTLs were found at 29.7 cM and map interval between 62.7 and 65.4 cM. The variation explained by the QTL for MBW was 10.9%. As for MC, the QTL explained 9.9% of the trait variation. These finding were validated using KW analysis (p = 0.05 and 0.001). Association of a marker with two different traits or co-located QTLs might be due to pleiotropic effect. We found one marker (SNPM00923) that was significantly associated with both traits, MC and MNW. The study by Seng et al. (2016) also reported the pleiotropic effect where QTLs detected in LG9 were associated with mean shell weight (MSW), mean kernel weight (MKW), wet pericarp to fruit ratio (WPF), shell to fruit ratio (SF) and dry pericarp to fruit ratio (DPF). In another region of LGDP9, QTL for MC was also identified at 62.7-65.4 cM with mEgCIR3363 as the closest flanking marker which is likely a result of epistasis where two or more loci interact to determine a phenotype (Miko, 2008).

SNPM00923 () falls into two genotype classes, aa and ab, where the mean of both genotypes were significantly different for MNW and MC. The mean of MNW for homozygous aa group (2.4±0.4) was higher than heterozygous ab group (2.3±0.4). However for MC, the trait mean for heterozygous ab group (36.9±2.1) was higher than homozygous aa group (35.7±2.1). This suggests that MNW is contributed by the maternal palm meanwhile MC is contributed by the paternal palm. With respect to marker mEgCIR3663, four genotype classes were obtained namely aa, ab, ac and bc. Palms showing genotype ac revealed the lowest mean MC (35.1±1.9). The means of the MC among aa (37.0±2.2), ab (36.6±1.9) and bc (36.9±2.3) groups were not significantly different.

Table 1: QTL analysis output at chromosome-wide level (p=95%). IM KW Trait Marker QTL interval Variation LOD K-value p-value (cM) (%)

MNW SNPM00923 26.7 - 29.6 10.9 3.4 5.3 0.05 SNPM00923 MC 29.7 9.9 3.1 11.1 0.001 mEgCIR3363 62.7 – 65.4 13.0 4.1 20.4 0.0005

327

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

SNPM00923 mEgCIR3363

Figure 2: LOD distribution graph of MNW and MC in linkage group 9.

Conclusions

In the present study, QTLs for MC and MNW were detected in linkage group 9. The identification of QTL is an important first step towards the application of marker assisted selection to shorten the breeding cycle. However, identified QTLs should be validated across different genetic background or environment prior to application in oil palm breeding.

References

Bernardo, R. 2013. Genomewide markers as cofactors for precision mapping of quantitative trait loci. Theoretical of Applied Genetics 126: 999-1009. Billotte, N., Marseillac, N., Risterucci, A.M., Adon, B., Brottier, P., Baurens, F.C., Singh, R.S., Herraàn, A., Asmady, H., Billot, C., Amblard, P., Durrand Gasselin, T.,Courtois, B. Asmono, D., Cheah, S.C., Rohde, W., Ritter, E. and Charrier, A. 2005. Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theoretical Applied Genetics 110(4): 754- 65. Billotte, N., Jourjon, M.F., Marseillac, N., Berger, A., Flori, A., Asmady, H., Adon, B., Singh, R., Nouy, B., Potier, F., Cheah, S.C., Rohde, W., Ritter, E., Courtois, B., Charrier, A. and Mangin, B. 2010. QTL detection by multiparent linkage mapping in oil palm (Elaeis guineensis Jacq.). Theoretical Applied Genetics 120(8): 1673-87. Collard, B.C.Y and MacKill, D.J. 2008. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B: Biological Sciences 363(1491): 557-572. Doyle, J.J. and Doyle, J.L. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Jeenor, S. and Volkaert, H. 2014. Mapping of quantitative trait loci (QTLs) for oil yield using SSRs and gene based markers in African oil palm (Elaeis guineensis Jacq.). Tree Genetics and Genomics 10(1): 1-14. Kushairi, A., Soh, K.H., Azman, I., Elina, H., Meilina, O-A., Zainal Bidin, M.N.I., Razmah, G., Shamala, S. and Ghulam Kadir, A.P. 2018. Oil palm economic performance in Malaysia and R&D Progress in 2017. Journal of Oil Palm Research 30(2): 163-195. Kushairi, A., Singh, R. and Ong-Abdullah, M. 2017. The oil palm industry in Malaysia: Thriving with transformative technologies. Journal of Oil Palm Research 29(4): 431-439. Lee, M., Xia, J.H. Zou, Z., Ye, J., Rahmadsyah, Alfiko, Y., Jin, J., Lieando, J.V., Purnamasari, M.I., Lim, C.H., Suwanto, A., Wong, L., Chua, N.H. and Yue, G.H. 2015. A consensus linkage map of oil palm and a major QTL for stem height. Scientific Report. Nature 5: 8232. Miki, I. 2008. Epistasis: Gene interaction and phenotype effects. Nature Education 1(1): 197.

328

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Parodi, G., Sanchez, M. and Daga, W. 2007. Correlation of oil content, dry matter and pulp moisture as harvest indicators in hass avocado fruits (Persea americana Mill) grown under two conditions of orchards in Chincha-Perú. Proceedings VI World Avocado Congress (Actas VI Congreso Mundial del Aguacate). Viña Del Mar, Chile, 12-16 Nov. Pootakham, W., Ruang-Areerate, P., Jomchai, N., Sonthirod, C., Sangsraku, D., Yoocha, T., Theerawattanasuk, K., Nirapathpongporn, K., Romruensukharom, P., Trangoonrung, S. and Tangphatsornruang, S. 2015. Construction of a high-density integrated genetic linkage map of rubber tree (Hevea brasiliensis) using genotyping-by-sequencing (GBS). Frontiers in Plant Science 6: 367. Seng, T.Y., Ritter, E., Mohamed Saad, S.H., Leao, L.J. Harminder Singh, R.S. Qamaruz Zaman, F., Tan, S.G. Syed Alwee, S.S.R. and Rao, V. 2016. QTLs for oil yield components in an elite oil palm (Elaeis guineensis) cross Euphytica 212(3): 399-425. Teh, C.K., Ong, A.L., Kwong, Q.B., Apparow, S., Chew, F.K., Mayes, S., Mohamed, M., Appleton, D. and Kulaveerasingam, H. 2016. Genome-wide association study identifies three key loci for high mesocarp oil content in perennial crop oil palm. Scientific Reports. Nature 6: 19075. Ting, N.C., Jansen, J., Nagappan, J., Ishak, Z., Chin, C.W., Tan, S-G, Cheah, S.C. and Singh, R. 2013. Identification of QTLs associated with callogenesis and embryogenesis in oil palm using genetic linkage maps improved with SSR Markers. PLoSONE 8(1). Ting, N.C., Yaakub, Z., Kamaruddin, K., Mayes, S., Massawe, F., Sambanthamurthi, R., Jansen, J., Low, L.E.T., Ithnin, M., Kushairi, A., Arulandoo, X., Rosli, R., Chan, K.L., Amiruddin, N., Sritharan, K., Lim, C.C., Nookiah, R., Amiruddin, M.D. and Singh, R. 2016. Fine-mapping and cross-validation of QTLs linked to fatty acid composition in multiple independent interspecific crosses of oil palm. BMC Genomic 17: 289. doi.org/10.1371/journal.pone.0053076. van Ooijen, J.W. 2009. MapQTL® 6, software for the mapping of quantitative trait loci inexperimental populations of diploid species. Kyazma, B.V., Wageningen, the Netherlands.

329

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A Preliminary Analysis of RuBisCO among Selected Hevea Clones

Norazreen, A.R.* and Salmah, M.M. Genetic Resources and Improvement Unit, Production Development Division, RRIM Experimental Station, Malaysian Rubber Board, 47000 Sungai Buloh, Selangor, Malaysia. *E-mail: [email protected]

Introduction

RuBisCO is the most abundant soluble protein in the chloroplast and makes up to 50% or more of all proteins in plant leaves. It has a very important role in the photosynthesis which catalyzes two competing reactions, CO2 fixation and 2-phosphoglycolate production in photosynthesis and photorespiratory pathways, respectively. RuBisCO is a rate-limiting factor for both photosynthesis and photorespiration under conditions of saturating light (Makino et al., 1988). Higher plant RuBisCO consist of eight small subunits (~14 kDa), coded by the nuclear RBCS multigene family, comprising between 2 to 22 members depending on species (Manzara and Gruissem, 1988) and eight large subunits (~56 kDa), coded by a single gene (rbcL) in the plastome (Malkin and Niyogi, 2000). The active site which is responsible for almost all carbon fixations on earth is in the large subunit and over 30% of the 476 amino acids in the large subunits are involved in intermolecular associations (Kellogg and Juliano, 1997).

Photosynthesis is a fundamental component of plant productivity and intensification of photosynthesis could improve yield production (Zhu et al., 2010). RuBisCO has been studied intensively as a prime target for manipulation to ‘supercharge’ photosynthesis and improve both productivity and resource use efficiency (Parry et al., 2012). High amount of RuBisCO and chlorophyll is very important to achieve high yields in crops such as rice, wheat, maize, soybean and potato (Osaki et al., 1993). As for rubber tree (Hevea), its yield and productivity are also important to ensure the sufficient and sustainable supply for various industries such as tyre and rubber glove. Hence, this preliminary analysis investigates the presence of RuBisCO protein in the leaves from seven selected Hevea clones namely; RRIM 600, RRIM 928, PB 260, RRIM 2002, RRIM 2023, RRIM 2007 and RRIM 3001. Results from this analysis could be further explored for improvement and manipulation of latex yield and production in the future.

Materials and Methods

Newly expanded Hevea leaves were collected from seven rubber tree clones which were planted at the nursery namely RRIM 600, RRIM 928, PB 260, RRIM2002, RRIM 2023, RRIM 2007 and RRIM 3001. Following that, an approximately 1.0 g leaves were ground until finely powdered in liquid nitrogen. Leaf tissue was ground to extract total protein using the protocol described in Lebrun and Chevalier (1990). Protein quantitation present in the leaf extracts was performed using the Bradford assay (Bio-Rad). Subsequently, protein separation was then performed in a 15% SDS-PAGE and the gels were stained using Coomassie Brilliant Blue.

For this experiment, concentration of total B serum proteins was made equal at 50 µg/mL. Separated proteins from the SDS-PAGE were blotted onto a nitrocellulose membrane using electrophoresis method for 16 h. Subsequently, the nitrocellulose membrane was blocked with 5% non-fat milk in phosphate buffered saline (PBS) and then incubated for 90 min with polyclonal antibodies anti- Rbc-L (Agrisera) as the primary antibody. After three washes with PBS-milk, the nitrocellulose membrane was incubated for 1 h with the secondary antibody; rabbit anti-goat IgG (Sigma Aldrich) conjugated to alkaline phosphatase. After three washes with PBS-milk, the nitrocellulose membrane was incubated for 10 min in Tris buffered saline (TBS) before being immersed in 5-bromo-4-chloro-3-indolyl phosphatase for visualization.

330

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

Total protein of leaves extract from selected rubber tree clones was analysed on SDS-PAGE (Figure 1a) at equal concentration to observe the protein quality. Even the amount of protein loaded was made equal, apparently the results showed that the protein intensity were different among the samples. Following to SDS-PAGE, immunoblot analysis using polyclonal anti-rbcL was performed to further detect the presence and profile of RuBisCO in the selected rubber tree clones. The profile of detected protein was referred to the protein profile of RRIM 600 as control. RRIM 600 has been widely used in various analyses as the model rubber tree (Chow et al., 2007; Sunderasan et al., 2015) and it has shown a very good performance in relation to tree productivity and latex yield (Nguyen et al., 1997).

Detection of RuBisCO through electrophoresis and immuno-blot analysis presented that, each of the tested samples showed different protein profiles. However, only RRIM 2007 has similar RuBisCO protein profile with RRIM 600. These two clones have four major proteins with high intensity bands at different sizes; ~18.0 kDa, ~28.0 kDa, ~48.0 kDa and ~55.0 kDa, respectively. Meanwhile, only three major bands were detected for RRIM 928 and RRIM 3001. As compared to RRIM 600, RRIM 928 and RRIM 3001 have one missing protein band sized at ~55.0 kDa and ~48.0 kDa, respectively. However, for PB 260, RRIM 2002 and RRIM 2023, only one ingle protein band was detected at ~18.0 kDa by which PB 260 displayed the highest protein intensity as compared to the other two clones. Hypothetically, the age of the leaves might affect the profiling as RuBisCO synthesis mainly occurs during leaf expansion. Over time, it decreases to a very low level until degradation becoming predominant leading to decline in RuBisCO content (Tonouchi et al., 1988).

In addition to that, the polyclonal antibody employed in this experiment possibly recognizes the other proteins of high homology. A new protein family was discovered namely RuBisCO-like proteins (RLPs) which have structural homologs of RuBisCO. In general, RuBisCO family of proteins have been classified into four groups which are; form I, form II, form III and form IV according to amino acid sequence similarities. Only form I, form II and form III are able to catalyze the RuBisCO reaction. Meanwhile, RLPs are categorized under form IV, which unable to carry out CO2/O2 fixation because their sequences contain dissimilar residues at position analogous to RuBisCO’s active-site residues (Tabita et al., 2007, Tabita et al., 2008).

With regard to yield among these clones, RRIM 2007 produced the highest latex with 72.9 gram latex per tree per tapping (g/t/t), followed by RRIM 2023 (58.9 g/t/t), RRIM 3001 (55.0 g/t/t), RRIM 2002 (54.4 g/t/t/), RRIM 928 (53.8 g/t/t) and RRIM PB 260 (50.0 g/t/t) (Nurmi Rohayu et al., 2015). Meanwhile, for RRIM 600 clone produced average yield 46.06 g/t/t (Mohd Noor, 1991). Based on this information, there is no general correlation can be concluded between yield and the presence of RuBisCO protein in rubber tree until further analysis is performed.

331

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Analysis of SDS-PAGE total leave protein and immuno-blot detection of RuBisCO on rubber tree total leave protein. (50 µg/mL protein). (Large RuBisCO (RbcL) 55kDa, small RuBisCO (RbcS) 15kDa). Lane 1: RRIM 600, Lane 2: RRIM 928, Lane 3: PB 260, Lane 4: RRIM 2002, Lane 5: RRIM 2023, Lane 6: RRIM 2007, Lane 7 RRIM 3001.

Conclusions

The Western blot analysis showed that each of selected rubber tree clones has different protein profile of RuBisCO. The output from this preliminary analysis could be exploited to investigate the connection between RuBisCO profile and its activity on the tree performance and latex yield productivity in the rubber tree.

Acknowledgements

The work was supported by Malaysian Rubber Board (MRB) and we would like to thank Mr. V. Mony Rajan and Mr. Saiful Nizam b. Noraini for their technical assistance.

References

Bradford, M.M. 1976. Rapid and sensitive method for quantitation of microgram quantities of protein utilising principle of protein dye binding. Analytical Biochemistry 72: 248-254. Chow, K.S., Wan, K.L., Mohd Noor, M.I., Azlina, B., Tan, S.H., Harikrishna, K. and Yeang, H.Y. 2007. Insight into rubber biosynthesis from transcriptome analysis of Hevea brasiliensis latex. Journal of Experimental Botany 58(10): 2429-2440. Kellogg, E.A. and Juliano, N.D. 1997. The structure and function of RuBisCO and their implications for systematic studies. American Journal of Botany 84(3): 413-428. Laemlli, U.K. 1970. Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 277: 680-685. Lebrun, P. and Chevallier, M.H. 1990. Starch and Polyacrylamide Gel Electrophoresis of Hevea brasiliensis. A Laboratory Manual. Montpellier: 1.R.C.A. - C.1.R.A.D.-Publisher. Malkin, R. and Niyogi, K. 2000. Photosynthesis. In: Buchanan, B.B., Gruissem, W., Jones, R.L. (Eds.), Biochemistry and Molecular Biology of Plants. Rockville, MD: American Society of Plant Physiologists 2000. Pp. 568-628. Makino, A., Mae, T. and Ohira, K. 1988. Differences between wheat and rice in the enzyme properties of ribulose-1,5-bisphosphate carboxylase/ oxygenase and their relationship to photosynthetic gas exchange. Planta 174: 30-38. Manzara, T. and Gruissem, W. 1988. Organization and expression of the genes encoding ribulose-1,5- bisphosphate carboxylase in higher plants. Photosynthesis Research 16: 117-139.

332

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Mohd Noor, A.G. 1991. Performance of some promising Prang Besar Clones, Proceedings RRIM Rubber Growers’ Conference. Nguyen, A.N., Mohd Fauzi, R., Ghandimathi, H., Yeang, H.Y. and Mihdzar, A.K. 1997. Effect of ethephon concentration on yield and some physiological parameters of Hevea brasiliensis latex from controlled upward tapping on clone RRIM 600. IRRDB Workshop on Tapping Panel Dryness in Hevea brasiliensis. Nurmi Rohayu, A.H., Rasyidah, M.R., Zarawi, A.G., Mohd Nasaruddin, M.A., Noorliana, M.Z., Nor Afiqah, M. and Aizat Shamin, N. 2015. MRB Clone Recommendations 2013. Buletin Sains dan Teknologi 13(1): 10-12. Osaki, M., Morikawa, K., Matsumoto, M., Shinano, T., Iyoda, M. and Tadano, T. 1993. Productivity of high yeilding crops: III. Accumulation of ribulose-1,5-bisphosphate carboxylase/ oxygenase and chlorophyll in relation to productivity of high-yielding crops. Soil Science and Plant Nutrition 39 (3): 399-408. Parry, M.A.J., Andralojc, P.J., Scales, J.C., Salvucci, M.E., Carmo-Silva, A.E., Alonso, H. and Whitney, S.M. 2012. RuBisCO activity and regulation as targets for crops improvement. Journal of Experimental Botany, doi:10.1093/jxb/ers336. Sunderasan, E., Norazreen, A.R., Lam, K.L., Yang, K.L. and Ong, M.T. 2015. Proteins of dialysed C- serum supernatant sub-fractions elicit anti-proliferative activity on human cancer-origin cells. Journal of Rubber Research 18(1): 49-59. Tabita, F.R., Hanson, T.E., Li, H., Satagopan, S., Singh, J. and Chan, S. 2007. Function, structure and evolution of the RuBisCO-like proteins and their RuBisCO homologs. Microbiology and Molecular Biology Reviews 71: 576-599. Tabita, F.R., Satagopan, S., Hanson, T.E., Kreel, N.E. and Scott, S.S. 2008. Distinct form I, II, III and IV RuBisCO proteins from three kingdoms of life provide clues about RuBisCO evolution and structure/function relationships. Journal of Experimental Botany 59(7): 1515-1524. Tonouchi, N., Makino, A., Mae, T. and Ohira, K. 1988. Nitrogen flow and changes in the amounts of ribulose-1,5-bisphosphate carboxylase in soybean leaves. Japanese Journal of Soil Science and Plant Nutrition 56: 573-578. Zhu, X.G., Long, S.P. and Ort, D.R. 2010. Improving photosynthesis efficiency for greater yield. Annual Review of Plant Biology 61: 235-261.

333

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effects of Rooting Substrate on Root Development of Hermaphrodite Carica papaya L. cv. Eksotika Produced Through in vitro Mass Propagation

Halimah, H.1,*, Uma Rani, S.1, Rogayah, S.2, Mohd Hakiman, M.1, Mohd Norfaizal, G.3 and Muhammad Najib, O.3 1Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. 2Biotechnology and Nanotechnology Research Centre, Persiaran MARDI-UPM, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. 3Gene Bank and Seed Centre, Persiaran MARDI-UPM, MARDI Headquarters, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Papaya (Carica papaya L.) is one of the major fruit crops in the tropical and subtropical countries. Although mass propagation of papaya can be performed successfully using in vitro technique, it has a problem with root development due to the presence of basal callus which prevents the formation of roots or its connection to the stem, hence resulted in low percentage of acclimatization of rooted plants (Panjaitan et al., 2007). It is also reported that rooting is a crucial and difficult stage in micropropagation of papaya, particularly in obtaining roots with good characteristics (Adigo et al., 2015). Therefore, it is essential to improve plantlet survival rate during acclimatization as well as to enhance shoot proliferation and rooting in vitro. Besides environmental conditions such as humidity and light intensity, the quality of roots which has been determined in vitro before transplanting can markedly affect the survival rate (Keatmetha and Suksa-Ard, 2004). The quality of roots produced plays important role for successful transfer of plantlet during acclimatization.

Although root development usually occur in agar medium in papaya, it was difficult to acclimate the plantlets because they tended to degenerate after being transferred to greenhouse (Suksa-Ard et al., 1998). This may account for the malfunction of the root and debilitating effect on the plantlets. The acclimation of plantlets could be readily achieved with a higher survival rate of plantlets even under ex vitro condition. Therefore, the purpose of this paper was to evaluate the effects of several rooting substrates on root development and anatomical characteristics of C. papaya cv. Eksotika root under in vitro condition.

Materials and Methods

Establishment of proliferation culture and preparation of plantlet

Proliferation culture was established using the shoot tips of hermaphrodite C. papaya L. cv. Eksotika as explants. The explants were cultured on shoot induction medium consisting of full strength De Fossard (DF) medium supplemented with 0.5 mg/L 6-benzylamino purine (BAP) and 30 g/L sucrose in pH 5.8. The cultures were kept in light condition at 25±2°C for 6 weeks.

Actively-growing shoot tips about 0.5 to 1.0 cm in length were excised from the proliferating shoot and transferred to the medium supplemented with 0.25 mg/L BAP and 0.1 mg/L of naphthaleneacetic acid (NAA). The culture was incubated at 25±2°C under 16 hour’s photoperiod of white florescence light. The proliferation culture was maintained by dividing the shoot clump, and subculturing every 4 week. After 4 weeks of culture under the same conditions as previously described, uniformly elongated shoots about 3 to 4 cm long were collected and prepared for rooting, the basal leaves were removed and three terminal leaves were left.

334

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Effect of rooting substrate on root development

Individual shoot obtained through shoot proliferation about 3 to 4 cm in height were excised were first cultured on full strength DF solid medium supplemented with 2 mg/L IBA for 4 days in the dark at 25±2°C. After 4 days pretreatment with auxin (IBA), the shoots were transferred to respectively on sterile rooting medium consisting with different substrate viz agar, vermiculite, rock wool, perlite and zeolite were tested in sterile conditions.

A half strength DF solidity medium supplemented with 20 g/L sucrose and 2 g/L agar and 50 mL of medium was dispensed per jam jar. About 50 mL of vermiculite, rock wool, perlite and zeolite was placed in jem jar and moistened with 50 mL of the half strength DF liquid medium containing 20 g/L sucrose in sterile condition. All cultures were likewise kept 25±2°C under a 16 hours photoperiod of white fluorescence light supplied (Figure 1).

Anatomical observation of root

The roots formed in the respective rooting media were collected after 4 weeks. Transverse section of the root a distance of 5 mm from the root tips were stained with 5 g/L safranine and then observed under light microscope.

Statistical analysis

The experiment was arranged in a Completely Randomized Design (CRD). Each treatment was replicated four times and each replication per treatment contained ten explants. The percentage of root, number of root and length of roots were recorded after 4 weeks of culture. Data were analysed using analysis of variance (ANOVA) and Duncan New Multiple Range Test (DNMRT).

Figure 1: Plantlet on root development after 4-week transfer into different rooting medium. (a) Agar, (b) Vermiculite, (c) Rock wool, (d) Perlite and (e) Zeolite.

335

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Results and Discussion

In Malaysia, papaya is commercially cultivated from seed due to non-availability of hermaphrodite planting material. Hermaphrodite plant produces bisexual flower. In papaya, the high productivity and pear-shaped fruits with lower ovarian cavity, hermaphrodite plant and the major type for commercial cultivation in tropical region (Pinto et al., 2013). The female plants are cultivated mainly for papain production (Reddy et al., 2012), while males are impractical for economic purpose (Urasaki et al., 2002). The sex type of a papaya plant can only be identified around 4 to 5 months after planting, when the flowers develop. Moreover, the long waiting time from planting to harvest requires the farmers to identify a productive hermaphrodite plant at early stage. Additionally, propagation by seeds produces non-true-to-type planting materials due to the segregation of offsprings at second filial generation (Saker et al., 1999). The determination of sex type of papaya seedlings prior to the flowering stage would avoid the need for removing undesired sex types (e.g. males and female) from the field, thus saving labour, time and other resources. Clonal propagation of selected hermaphroditic plants of papaya could offer a valuable alternative in field planting. Hence, propagation via tissue culture is a feasible alternative for rapid and large scare production of planting materials. The production of hermaphrodite Eksotika papaya through tissue culture will ensure maximum productivity without unnecessary cost.

Plantlets transferred in vermiculite had the highest rooting rate (97.5%) while zeolite had the lowest rooting rate (58.8%) (Table 1). Plantlets grown in vermiculite had significantly higher rooting percentage, number of roots and root length compared to plantlets grown in other substrates tested. Plantlets grown using zeolite had the lowest rooting percentage while for number of roots, plantlets grown using agar and zeolite recorded the lowest number of roots was observed, and the roots produced were thick, stumpy and vitrified roots. According Kataoka (1994) in the agar medium, the root number and length were lower than the vermiculite medium, while root diameter was much larger and both media, root hair were observed on root surface in papaya in vitro. Gabriel et al. (2002) reported that, shoots of Phyrus ‘Bartlett and OH x F97’ clones did not produce secondary roots in the agar substrate while both clones could be rooted in vermiculite at frequency of 31.07 and 53.61% respectively. Sekeli et al. (2012) also reported that, vermiculite substrate on rooting transgenic papaya shoots showed the higher frequency of rooted plantlets and exhibited better quality comprising of many lateral roots and root hairs. Kirdmanee et al. (1995) also reported that, root system in vermiculite substrate is stronger branches and extensive root hair, also a high-water potential in the leave of plantlets compared to those in agar and gelrite brought high number number of primary root in Eucalyptus.

The anatomical analysis performed in roots of hermaphrodite C. papaya L. cv. Eksotika showed that, the roots formed in agar and zeolite were less branched than vermiculite, perlite and rock wool (Figure 2). The cortex cells of the grown in agar and zeolite were loosely arranged compared to those grown in vermiculite, perlite and rock wool. The root section also observed a severe abnormality of inner structure of the root consisting of hypertrophy of subepidermal cells accompanied by unusual expansion of the intercellular space was revealed. Abnormalities of inner structure were observed in the roots formed in agar and zeolite. On the hand, in vermiculite, rock wool and perlite, no structural abnormalities of the roots appeared. Therefore, it is hypothesized that the poor aeration of these substrates might be the major cause of abnormal development of roots rather than the presence of certain inhibiting substances or the low osmotic potential of the medium. According to Yu et al. (2000), insufficient aeration could be reason for low quality and loss of root functionality. The lack development of root hairs in roots formed in zeolite medium generally made it difficult to get a good functional root system in vitro. The also observed by McClelland et al. (1990) that anaerobic root development without root hair in agar medium induced a lack of vigor of the plantlet after transplanting. Therefore, it is possible that poor aeration of zeolite substrate might be the major cause of root induction. Aeration of the rooting substrate was important factor in the formation of adventitious root. It is assumed that insufficient aeration cloud be aeration the reason for low quality

336

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

and loss of root functionality (Keatmetha and Suksa-Ard, 2004). Hazarika (2006) reported that, roots of plantlets produces in vitro are usually very week without root hairs. Kataoka (1994) suggests that defective water absorption may result from difficulty in the movement of water absorbed by the root hairs to vascular bundles of root rather than reduction in water absorption by the root hairs.

Table 1: Effect of rooting substrate on in vitro rooting of C. papaya L. cv. Eksotika. Rooting substrate Rooting percentage (%) Number of roots Roots length (cm) Agar 67.5c 3.4d 1.81e Vermiculite 97.5a 13.2a 10.36a Rock wool 82.5b 8.18c 5.72c Perlite 85.0b 10.28b 8.52b Zeolite 57.5d 2.53d 3.31d Means with same letters are not significant different at p≤1% level according to DMRT.

Figure 2: Transverse section of papaya root formed in different rooting substrate (a) Agar, (b) Vermiculite, (c) Rock wool, (d) Perlite, (e) Zeolite. Arrows color show: Epidermis; Xylem; Cortex; Root hair; Unusual expansion of intercellular space. Bar indicates 200 µM.

Conclusions

The usage of vermiculite as rooting substrate for in vitro propagation of hermaphrodite C. papaya L. cv. Eksotika is recommended among other substrates tested in this study due to its high rooting percentage and no presence of structural abnormalities in its root’s anatomy.

Acknowledgements

We thank the Universiti Putra Malaysia for support for my research Master. Ours thank to Malaysian Agricultural Research and Development Institute for the research facilities provided in this study.

337

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Adigo, S., Firew, M. and Eyassu, A. 2015. In vitro propagation of papaya (Carica papaya L.). World Journal of Agricultural Sciences 11 (2): 84-88. Gabriel, B.L., Nelson, L.F. and Gérson R.D.L.F. 2002. Use of vermiculite as a substrate and effect of light on in vitro rooting of pears, cv. Bartlett and clone OH´F97. Ciência e Agrotecnologia 26: 977-982. Kataoka, I. 1994. Influence of rooting substrates on the morphology of papaya root formed in vitro. Japanese Journal of Tropical Agriculture 38: 251-257. Keatmetha, W. and Suksa-Ard, P. 2004. Effects of rooting substrates on in vitro rooting of Anthurium andraeanum L. cv. Avanti. Walailak Journal of Science and Technology 1(2): 49-55. Kirdmanee, C., Kitaya, Y. and Kozai, T. 1995. Effects of CO2 enrichment and supporting material on growth, photosynthesis and water potential of Eucalyptus shoots/plantlets cultured photoauto trophically in vitro. Environmental Control in Biology 33: 133-141. McClelland, M.T., Smith, M.A.L. and Carothers, Z.B. 1990. The effects of in vitro and ex vitro root initiation on subsequent microcutting root quality in three woody plants. Plant Cell, Tissue and Organ Culture 23: 115-123. Panjaitan, S.B., Aziz, M.A., Rashid, A.A and Saleh N.M. 2007. In vitro plantlet regeneration from shoot tip of field-grown hermaphrodite papaya (Carica papaya L. cv. Eksotika). International Journal of Agriculture and Biology 9(6): 827-832. Pinto, F.O, Pereira, M.G, Luz, L.N, Cardozo, D.L., Ramos, H.C. and Macedo, C.M.P. 2013. Use of microsatellite markers in molecular analysis of segregating populations of papaya (Carica papaya L.) derived from backcrossing. Genetics and Molecular Research 12: 2248-2259. Reddy, S.R., Krishna, R.B. and Reddy, K.J. 2012. Sex determination of papaya (Carica papaya) at seedling stage through RAPD markers. Research in Biotechnology 3: 21-28. Suksa-Ard, P., Kataoka, I., Fujime, Y., Beppu, K. and Subhadrabandhu, S. 1998. Root development of tissue cultured papaya shoots in several rooting substrats. Environmental Control in Biology 36(2): 115-120. Urasaki, N., Tokumoto, M., Tarora, K., Ban, Y., Kayano, T., Tanaka, H., Oku, H., Chinen, I. and Terauchi, R.A. 2002. Male and hermaphrodite specific RAPD marker for papaya (Carica papaya L.). Theoretical and Applied Genetics 104: 281-285. Yu, T.A., Yeh, S.D., Cheng, Y.H. and Yang, J.S. 2000. Efficient rooting for establishment of papaya plantlets by micropropagation. Plant Cell, Tissue and Organ Culture 61: 29-35.

338

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Sensitive Detection of Pyricularia oryzae using Loop Mediated Isothermal Amplification (LAMP)

Lau, H.Y.*, Faridah, S. and Sohana, R. Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Rice (Oryza sativa L.) is an important crop globally due to its vast consumption as a primary source of energy and protein (Abed-Ashtiani et al., 2012). The rice production of Malaysia in 2016 was 1.77 million metric tons which increased from 1.68 million metric tons in 2013 (The Statista Portal, 2017). Although the rice production is significantly increased annually, but there are numerous of rice diseases have leaded to a huge loss in rice yield up to 80% of total rice production (Nasruddin and Amin, 2013). One of the most harmful rice fungal diseases is rice blast disease caused by Pyricularia oryzae. Rice blast causes lesions on leaves, stems, peduncles, panicles, seeds and roots of paddy. This disease has been reported as the most important plant diseases (TeBeest et al., 2007).

Traditionally, the rice blast is identified by experienced plant pathologists with the observation of typical disease symptoms and culturing the pathogen in specialized media (Park et al., 2009). This method is accurate but it is time consuming and therefore not suitable for rapid disease management practices. Immunoassays have hence been widely used for plant pathogen detection since the 1980s to address the limitations of symptomatic diagnosis. Antibody of P. oryzae was produced in 1992 and its specificity has been studied in further research using enzyme-linked immunosorbent assay (ELISA) (Xia et al., 1992). Although the antibody-based methods are showing high sensitivity, but antibody- based methods are prone to have cross reactivity with closely related pathogen species having similar epitopes for antibody recognition (Franken et al., 1992). DNA-based molecular diagnostic methods have been proposed to increase the reliability, sensitivity and specificity of P. oryzae detection. The polymerase chain reaction (PCR) is currently the most popular and reliable molecular technique used in P. oryzae diagnostic assays. However, to avoid the instrumentational limitations of PCR, isothermal approaches such as the Loop Mediated Amplification (LAMP) which uses low constant temperature to achieve the DNA amplification have been developed.

LAMP is an isothermal nucleic acid amplification technique which offers various advantages in diagnostic researches. It has been widely used due to its high sensitivity, specificity, quickness and cost effectiveness. The major advantage of LAMP is it can be carried out at a low constant temperature with short reaction time. This makes it perfect technique for plant pathogens detection especially for on-site applications. Besides, it has very high amplification efficiency to generate large amounts of amplicon with low amount of DNA template. Furthermore, this method is relatively cost effective as it only requires simple equipment such as mini incubator to perform the assay (Wee et al., 2014).

Herein, we demonstrate a method which entails a simple and rapid protocol to detect P. oryzae using LAMP. Sensitivity and specificity of the designed LAMP primers were identified in this study. The method was ﬁrst tested on P. oryzae pathotype 1, 7, 9 and 15 causing rice blast disease in Malaysia.

339

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Pathogen materials

Pyricularia oryzae (Pathotype 1, 7, 9 and 15), Rhizoctonia solani, Helminthosporium oryzae and Sarocladium oryzae were obtained from MARDI Seberang Perai. A small agar block containing P. oryzae, H. oryzae or S. oryzae hyphae was placed on a Potato Dextrose Agar (PDA) plate (1000 mL media consists of 300 g fresh potato, 2 g Na2HPO4.2H2O, 0.5 g Ca(NH3)2.4H2O, 5 g Bacto-peptone and 20 g sucrose) and incubated at room temperature (25°C) for 7-10 days until the hyphae were visible. However, R. solani was cultured on PDA plate at 28°C for 7 days.

DNA extraction

The GeneAll Plant Genomic DNA prep kit was used for genomic DNA extraction of all the fungi as recommended by the manufacturer (http://geneall.com) with minor modification. A culture plate containing the fungi hyphae was added with 300 µL of Complete Lysis (CL) buffer and scrapped the mycelium out from the media surface. The 300 µL of CL with mycelium was transferred into a microcentrifuge tube. The DNA extraction method was then continued with the protocol provided by the manufacturer.

LAMP reaction

A LAMP Primer Mix was prepared with all 6 primers (Table 1) which containing 40 µM FIP, 40 µM BIP, 5 µM F3, 5 µM B3, 10 µM LoopF, 10 µM LoopB. Briefly 25 μL reactions (1X ThermoPol Buffer, 6 mM MgSO4, 1.4 mM each dNTP, 8U Bst DNA polymerase, 3 µL of primer mix) were performed at 65°C for 40 min using 1 μL of the extracted nucleic acid (concentration of gDNA was depended on the experimental design). Following amplification, 3 μL of the LAMP reaction was verified by gel electrophoresis (1.5% agarose gel).

Results and Discussion

The sequence of the transposon Pot2 is unique for P. oryzae (Harmon et al., 2003). This locus was used to develop LAMP primers that amplify all pathotypes of P.oryzae. Primers were designed based on the unique sequence using PrimerExplorer software (Eiken Chemical Company; https://primerexplorer.jp/e/) and synthesized by Sigma-Aldrich. Six primers (external primers F3 and B3; internal primers FIP and BIP; Loop primers LoopF and LoopB) were designed for the assay. All oligonucleotide sequences are listed in Table 1.

Table 1: Oligonucleotide sequences used in this study. Primer name Sequence (5´ to 3´) FIP GCCGTTTGGTTATTTGTCCACCACGGATTTAAGCCCTTTCG BIP ACCCAACCTTTAACCCCTGAAAATTCGTCCGTTATATGTGATCC F3 GTACAACAACAATGGTTTCCC B3 AATGGTTGAAGAACGTGTGA LoopF CGGTTGCATGAAATTGCCA LoopB GCGGTTATTAGTTTTGGATGGC

The specificity of the assay was assessed by detecting P. oryzae, R. solani, H. oryzae and S. oryzae (Figure 1). Genomic DNA was extracted from pure fungi cultures on PDA media. Replicate assays containing 5 ng of purified genomic DNA from four different fungi as mentioned above were performed with LAMP. As expected, only gDNA from P. oryzae (Pathotype 1, 7, 9 and 15) were amplified successfully. This indicated that the primers are very specific on P. oryzae.

340

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: Specificity test of the assay. Gel electrophoresis images of corresponding LAMP reactions performed on different sample (P1.0 = P.oryzae Pathotype 1.0, P7.0 = P. oryzae Pathotype 7.0, P9.0 = P. oryzae Pathotype 9.0, P15.0 = P.oryzae Pathotype 15.0, R = R. solani, H = H. oryzae, S = S. Oryzae, -ve = No template control). Each lane is a representative of at least 3 experimental replicates.

To determine the sensitivity of the assay (Figure 2), gDNA concentration ranging from 0.0001 ng to 1 ng were used to perform LAMP. From the picture of gel electrophoresis, successful amplified DNA was observed in gDNA sample 0.0005 ng and higher DNA concentration samples. No bands were observed when the amount of input gDNA was below 0.0005 ng which was same as the control reaction containing no genomic DNA.

Figure 2: Sensitivity test of the assay. Gel electrophoresis images of corresponding LAMP reactions performed on different concentration of P. oryzae gDNA sample (1 ng, 0.1 ng, 0.01 ng, 0.001 ng, 0.0005 ng, 0.0001 ng). Each lane is a representative of at least 3 experimental replicates.

Conclusion

In conclusion, the LAMP primers are specific for P. oryzae detection. This assay is a potential diagnostic method for on-site application in the future because of it offers rapid, sensitive, requires minimal equipment and less skilled labours.

341

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Abed-Ashtiani, F., Kadir, J., Selamat, A.B., Mohd-Hanif, A., and Nasehi, A., 2012. Effect of foliar and root application of silicon against rice blast fungus in MR 219 rice variety. The Plant Pathology Journal 28: 164-171. Franken, A.A.J.M., Zilverentant, J.F., Boonekamp, P.M. and Schots, A. Neth. 1992. Specificity of polyclonal and monoclonal antibodies for the identification of Xanthomonas campestris pv. campestris. Journal of Plant Pathology 98: 81-94. Nasruddin, A. and Amin, N. 2013. Effects of cultivar, planting period, and fungicide usage on rice blast infection levels and crop yield. The Journal of Agricultural Science 5(1): 160-167. Park, J., Jin, J., Lee, Y., Kang, S. and Lee, Y. 2009. Rice blast fungus (Magnaporthe oryzae) infects Arabidopsis via a mechanism distinct from that required for the infection of rice. Plant Physiology 149(1): 474-486, DOI: 10.1104/pp.108.129536. TeBeest, D.O., Guerber, C. and Ditmore, M. 2007. Rice blast. The plant health instructor. DOI: 10.1094/PHI-I-2007-0313-07. Reviewed 2012. The Statista Portal. 2017. Production of rice in Malaysia from 2013 to 2016 (in million metric tons). https://www.statista.com/statistics/794700/rice-production-volume-malaysia/. Wee, E.J.H., Lau, H.Y., Botella, J.R. and Trau, M. 2015. Re-purposing bridging flocculation for on- site, rapid, qualitative DNA detection in resource-poor settings. Chemical Communications 51: 5828-5831. Xia, J.O., Lee, F.N., Scott, H.A. and Raymond, L.R. 1992. Development of monoclonal antibodies specific for Pyricularia grisea, the rice blast pathogen. Mycological Research 96 (10): 867- 873.

342

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Development of Early Detection of Dieback Disease (Erwinia mallotivora) by using Lateral Flow Immunoassay (LFIA) Technique

Adlin Azlina, A.K.*, Noriha, A. and Erna Mutiara, M. Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Papaya fruit is of considerable economic importance in Malaysia accounting for 21% of the global export market in 2004 (Chan and Baharuddin, 2010). However since 2005, papaya production in Malaysia faced a major threat from Papaya dieback disease which caused rapid decline in production. The disease affects all popular export varieties such as Eksotika, Solo and Sekaki and is characterized by leaf spot as well as greasy spot and water soaked lesions in all of the plant parts including leaves, fruits and stem. Later, dieback of the infected shoot occurs, leading to the destruction of the papaya trees (Noriha et al., 2011). In 2009, the disease has destroyed nearly one million trees or about 800 ha out of 2100 ha papaya growing areas. Total yield loss was estimated 200,000 tons, equivalent to USD 60 millions (Chan and Baharuddin, 2010). The causal agent of papaya dieback disease was first reported as Pantoea agglomerans in 2005 (Mohamed and Wan Kelthom, 2005) and later as Erwinia papayae in 2008 (Maktar et al., 2008). Recently the disease was confirmed to be caused by Erwinia mallotivora based on phenotypic observations, biochemical analysis and genetic studies (Noriha et al., 2011). Early detection of the disease symptoms and destroying the affected plants seems to be the best control strategies at the moment.

Current detection and quantification methods for microorganisms are labor-intensive, costly and/or inaccurate (López et al., 2009). Polymerase chain reaction (PCR) has been the commonly practiced method for detecting of microorganisms which can detect extremely low levels of the bacteria. However, PCR is labor-intensive and generally requires users with advanced knowledge of the methods. Traditionally, enzyme-linked immunosorbent assay (ELISA) is one of the most sensitive and frequently used methods for estimation of pathogens (i.e. bacteria) and lipopolysaccharide (LPS) molecules (Freudenberg et al., 1989). Antibodies (Ab) have historically proven to be excellent diagnostic and therapeutic tools due to their small size, ability to withstand high temperatures and ability to remain stable in aqueous solutions. Animal immunization has provided a wealth of valuable antisera and antibodies as research agents (Jobling et al., 2003).

Therefore, accurate and rapid identification of dieback disease is essential for effective disease control. Lateral flow immunoassay (LFIA), widely employed in the diagnosis of plant pathogens, is considered as an efficient tool used for `point-of-care' or ìn-field' pathogen detection (Boonham et al., 2008). An LFIA typically consists of a nitrocellulose membrane strip on which pathogen-specific antibodies are immobilized. These specific antibodies are bound to nanoparticles that are often made of colloidal gold, latex or silica to facilitate visual detection (Posthuma-Trumpie et al., 2009; De Boer et al., 2012). Lateral-flow immuno chromatographic assays (dip-stick format) have simplified and expedited end-user available diagnostics in human health, food safety, and more recently in plant protection (Posthuma-Trumpie et al., 2009). This project will focus on the development of a simple, rapid and reliable test for diagnostic laboratories and enabling onsite dieback diagnosis in the field.

343

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Materials and Methods

Bacterial strains and culture condition

Erwinia mallotivora were grown in Luria Bertani (LB) agar and grow in room temperature (24-25oC) or 28-30oC, 48 hours and were then grow in broth medium at room temperature in shaker incubator 48 hours. After centrifugation of culture media, sedimented bacteria were harvested and used as an antigen for antibody production.

Preparation of polyclonal antibody (IgG) against E. mallotivora

Two New Zealand white rabbits (NZW; female, 2.8-3.0 kg, 11-13 weeks old) were used for the immunizations. The first injection was an emulsion of live cells with complete freund adjuvant (CFA) in 1:1 mixture (v/v), while for the booster injections; the live cells was mixed with incomplete freund’s adjuvant (IFA). The immunogen was subcutaneously injected with maximum injection of 1.5 mL per route and followed by three booster injections at two weeks interval. Test bleed was carried out after 10 days each booster immunization in order to check the ability of rabbit immune system. The first bleed serum was obtained after two weeks of third booster injection. Total rabbit IgG was determined by quantitative ELISA prior to antibody purification. Protein A chromatography is used for the purification of polyclonal antibodies. Prior to chromatography run, the serum sample (from terminal bleeding of rabbits) is purified through Protein A chromatography by using AKTA Explorer System 100 (GE life Sciences).

Preparation of gold-polyclonal antibody (IgG) conjugate

Colloidal gold nanoparticles sizes of 40 nm were conjugated with polyclonal antibody were purchased from Kestrel BioSciences (Thailand) following standard protocol. Resulted conjugate was filtered through 0.45 μM filter to clean the conjugate from any of free antibody and BSA and stored at 4ᴏC. Prior to use for coating the resulted conjugate solution was mixed with 10% (w/v) sucrose and 5% (w/v) trehalose and must be coated on conjugate pad within 1 week only.

Lateral flow immunoassay (LFA) strip

The LFIA consisted of a sample pad, conjugate pad, immobilized nitrocellulose membrane, and absorbent pad. A schematic diagram of the LFIA is shown in Figure 1A.

1A 1B

Figure 1: Design of the lateral flow immunoassay strip. (A) Schematic diagram. The conjugate pad was dispensed with gold-polyclonal anti- E. mallotivora. At the test line and control line position, anti-E. mallotivora and goat anti-rabbit IgG were immobilized, respectively. Lateral flow immunoassay system (B) Interpretation of the results. i, negative (only the control line area shows a red band) and ii, positive (2 red bands at the readout zone).

344

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Detection principle and test procedure

The lateral flow immunostrip which consists of sample pad, conjugate pad (containing the conjugated pAb-AuNPs), membrane pad and adsorbent pad was constructed and assembled. The gold-polyclonal conjugate in PDB was coated on conjugate pad (Whatman GF33, Kestrel BioSciences) manually using micropipette and dry at 37oC for 2 h. To prepare 1 mg/mL of control line (C), 250 μL of 2 mg/mL goat anti-rabbit IgG (Pierce) was added onto 250 μL of 0.02 M phosphate buffered (PB). Goat anti-rabbit IgG were then applied on test pad (Milipore) manually and dry at 37oC for 2 h. For test line (T), 2 mg/mL of anti- E. mallotivora IgG in 0.02 M PB with 1 % (w/v) sucrose was used. Anti- E. mallotivora IgG was applied on test pad manually and dry at 37oC for 2 h.

Specificity and sensitivity of lateral flow immunoassay strip

Plants pathogenic (E. papayae, Erwinia pyrifoliae, Pseudomonas spp., Pantoea agloomerans and Erwinia chrysanthemi of the pure cultures bacteria were used to examine the specificity of the LFIA. During the test, the sample solution was pipetted onto the sample pad. For a positive sample, the anti E. mallotivora IgG reacted with the (Au)-antibody conjugate to form a complex when the sample flows through the conjugate pad. Then, the complex was captured by anti-E. mallotivora, forming a red band at the test line. Otherwise, no signal could be seen in the test line when a negative sample was used. Excess (Au)-antibody conjugate binds to the goat anti rabbit IgG in the control line, forming another red band (Figure 1B). Therefore, for the LFIA developed in this study, the appearance of two red bands in the read-out zone indicates a positive test and only one red band in the control line indicates a negative test (Figure 1B). In practical terms, the LFIA is laid on a flat bench and 100 μL of samples is added to the sample hole. The result is available in 15 min.

Sensitivity test was determined using serial 10-fold dilutions of PBS suspensions of pure cultures of E. mallotivora at a range of concentrations from 10 to 108 CFU mL-1. Tests with LFIA were performed as described above, and the limit of detection was determined as the lowest concentration that produced a visible positive test line. Samples were tested by LFIA in triplicate.

Results and Discussion

Papaya dieback disease is a very serious disease for papaya plants. E. mallotivora species was identified as disease agent for dieback disease. Antibody produced against E. mallotivora is very useful for development of immunodiagnostic technology that can be used as a diagnostic tool for early detection of dieback disease outbreak in papaya industry in Malaysia. To address the problem, the development of simple, rapid, sensitive and accurate diagnostic methods for dieback disease has become an urgent focus.

Specificity test

The specificity test of the developed LFIA for detection of E. mallotivora was tested with other plant pathogen bacteria. The result showed in Figure 2 showed that the developed LFIA only gave positive result when tested with E. mallotivora while other pathogen gave negative results indicating that the developed LFIA was specific to E. mallotivora.

Sensitivity test

The sensitivity test of the strip is measured by the minimum detectable concentration of E. mallotivora that caused the colour of the test line (T) to become obviously invisible than the control line (C). The sensitivity test for the test strips was carried out by testing different concentrations of E. mallotivora ranging from 1x101 to 1x 108 CFU mL-1. Results in Figure 3 showed that the sensitivity test of the developed LFIA kit was at 1 x 105 CFU mL-1.

345

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

The LFIA developed in this study provides an alternative diagnostic test that combines the advantages of enough specificity and sensitivity, low cost, and rapid and simple operation, which make it especially appropriate for on-site analysis. An inexpensive, user-friendly paper-based detection and quantification tool could allow growers to act immediately in controlling the harmful pathogen and to make decisions if further control measures are necessary (i.e., chemical, biological, or cultural). This would reduce the risk of the harmful bacteria and in turn lower the environmental impact, by allowing growers to use preventative measures only when necessary.

1 2 3 4 5

Figure 2: Specificity test of developed LFIA strips tested with other plant pathogens. 1: E. mallotivora, 2: Erwinia pyrifoliae, 3: Erwinia chrysanthemi, 4: Pantoea agloomerans and 5: Pseudomonas spp. Each figure is a representative of at least 3 experimental replicates.

1 2 3 4 5 6 7 8 8

Figure 3: Sensitivity test of the developed LFIA strips with different E. mallotivora concentration; 1:101 cfu/mL, 2 : 102 cfu/mL, 3: 103 cfu/mL, 4: 104 cfu/mL, 5: 105 cfu/mL - 106 cfu/mL, 7: 107 cfu/mL, 8: 108 cfu/mL E. mallotivora.

Conclusion

Lateral flow immunoassay kit for detection of dieback disease in papaya was successfully developed and tested. This kit was developed based on immunoassay platform with the use of nanogold conjugated polyclonal antibody against E. mallotivora. The developed strip is able to detect the presence of E. mallotivora as low as 105 pfu/mL. The specificity of this strip also was evaluated by performing cross reaction test with plant pathogenic bacterial. Cross reactivity against other bacteria such as Erwinia pyrifoliae, Erwinia chrysanthemi, Pantoea agloomerans and Pseudomonas spp. yielded negative results.

346

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

References

Boonham, N., Glover, R., Tomlinson, J. and Mumford, R. 2008. Exploiting generic platform technologies for the detection and identification of plant pathogens. European Journal of Plant Pathology 121: 355-363. Chan, Y.K. and Baharuddin, A.G. 2010. Proceedings of IInd IS on Papaya. Pp.37-40. De Boer, S.H. and LoÂpez, M.M. 2012. New grower-friendly methods for plant pathogen monitoring. Annual Review of Phytopathology 50: 197-218. Freudenberg, M.A., Fomsgard, A., Mitov, I. and Galanos, C. 1989. ELISA for antibodies to lipid A, lipopolysaccharides and other hydropobic antigens. Infection 17: 322-328. Jobling, S.A., Jarman, C., Teh, M.M., Holmberg, N., Blake, C. and Verhoeyen, M.E. 2003. Immunomodulation of enzyme function in plants by single-domain antibody fragments. Nature Biotechnology 21: 77-80. López, M.M., Llop, P., Olmos, A., Marco-Noales, E., Cambra, M. and Bertolini, E. 2009. Are molecular tools solving the challenges posed by detection of plant pathogenic bacteria and viruses? Current Issues in Molecular Biology 11: 13-46. Maktar, N.H., Kamis, S., Mohd Yusof, F.Z. and Hussain, N.H. 2008. Erwinia papayae causing papaya dieback in Malaysia. New Disease Reports 17, 4. The British Society for Plant Pathology. Mohamed, M.S. and Wan Kelthom, W.H. 2005. Papaya ringspot virus and bacterial dieback, the industry threatening diseases of Malaysia. First International Symposium on Papaya. 22-24 November 2005, Genting Highlands, Malaysia. MARDI-ISHS-ISAAA-TFnet. Noriha, M.A., Hamidun, B., Rohaiza, A.R. and Indu Bala, J. 2011. Erwinia mallotivora sp., a New Pathogen of Papaya (Carica papaya) in Peninsular Malaysia. International Journal of Molecular Sciences 12(1): 39-45. Posthuma-Trumpie, G.A., Korf, J. and van Amerongen, A. 2009. Lateral flow (immuno) assay: Its strengths, weaknesses, opportunities and threats. A literature survey. Analytical and Bioanalytical Chemistry 393: 569-582.

347

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

DNA Extraction and Amplification of rbcL from Bee Breads Collected by Malaysian Stingless Bees (Heterotrigona itama)

Amin Asyraf, T.1,*, Muhammad Faris, M.R.1, Mohd Azwan, J.1, Mohd Norfaizal, G.2 and Noriha, M.A.1 1Agri-omics and Bioinformatics Programme, Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI) Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 2Resource Utilisation and Agrobiodiversity Conservation Programme (BE2), Biodiversity and Environmental Research Centre, Malaysian Agricultural Research and Development Institute (MARDI) Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Stingless bees forage pollen grains from various plant sources and store them in specialised containers (known as pollen pots) to be fermented of which later will be used to feed young larvae. These pollens are compacted and over the time they turn sour due to the fermentation - now regarded as bee bread (Kieliszek et al., 2018). Thanks to biotechnology advancement, the bee bread can be used to assess the plant species visited by the worker bees and this information will aid researchers and farmers to better understand the ecological need of stingless bees, hence, improve stingless bee keeping. DNA technology can be used to analyse pollen botanical sources of the bee breads through nucleotide sequencing and metabarcoding approach. DNA barcoding (or DNA metabarcoding) is one of recent platforms to study species diversity and interestingly it can be applied to access complex botanical sources of pollen collected by pollinators (Bell et al., 2016). This approach is regarded as having better accuracy, comprehensiveness and species resolution in determining plant-pollinator relationship network compared to the conventional method of microscopic plant-pollen characterization (Bell et al., 2016) and direct observation (Figure 1).

Figure 1: Heterotrigona itama workers observed to be visiting different flowers including a) Bidens pilosa (Spanish needle), b) Melastoma sp. (Senduduk), c) Durio zibethinus (durian) and d) Dendrobium crumenatum (Dove orchid). Pollens are collected on their hind legs and later stored in pollen pots inside their hives.

348

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

However, the success of sequencing species-specific DNA barcode, such as rbcL, from stored pollen (or bee bread) is highly dependent on the retrievability of DNA from the pollen materials. In this study, we managed to extract total DNA from bee breads accumulated by stingless bees (Heterotrigona itama) and successfully amplified rbcL partial region in all extracted DNA samples. Here we showed that DNA is recoverable from bee bread thus giving access to subsequent study on plant-pollinator relationship via molecular approach.

Materials and Methods

Bee bread sampling

A dedicated plot of stingless bee hives was established near a gene bank forest reserve at MARDI Serdang, Selangor, Malaysia. All bee bread samples were harvested from healthy colonies at this plot in July 2018 (Figure 2) and the main flower season at this time could not be accurately determined since the forest nearby was comprised of multiple species of trees and shrubs. These samples were stored in 4oC and used for extraction within a week of storage.

DNA extraction and purification

100 gram of bee bread from each colony was prepared prior to DNA extraction. Mechanical disruption was done using two methods; grinding using mortar and pestle followed by disruption using glass bead beater (Figure 2). For DNA extraction and purification, two kits were used - FavorPrepTM Plant Genomic DNA Extraction Mini Kit (Favorgen) and DNeasy Plant Mini Kit (Qiagen). All steps were carried out using each manufacturer’s protocol with a slight modification by adding proteinase K to aid protein digestion since bee breads are rich in protein (Kaplan et al., 2016). rbcL partial gene amplification from pollen DNA

Primers targeting rbcL region were designed based on Pornon et al (2017) with an expected amplicons size of ~500 bp (rbcLaf: 5’-ATGTCACCACAAACAGAGACTAAAGC; rbcLr506: 5’ AGGGGACGACCATACTTGTTCA). The PCR was performed on Peltier Thermal Cycler 200 (MJ Research) and the temperature cycle parameters were set up as follows: initial denaturation at 95°C for 2 min, denaturation at 95°C for 30 s, annealing at 50°C for 1 min 30 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min (Figure 3).

Figure 2: Bee bread (compacted pollens) samples were collected from active stingless bee colonies (5 hives) at the research plot in the morning. The bee breads were brought to the lab and ground in liquid nitrogen using mortar and pestle. Disruption using glass beads were also employed.

349

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 3: Quantification and quality analysis of DNA was done using NanodropTM spectrophotemetre. Annealing temperature (Ta) of rbcL primers and PCR steps were investigated and optimized.

Results and Discussion

In this part of study, we had successfully extracted DNA from bee bread (Table 1) and the barcode region rbcL was able to be amplified in all samples (Figure 4) even in less pure samples (sample 1 and 3). The retrievability of DNA and amplificability of rbcL is the two main aspects to be considered before the samples can proceed for subsequent metabarcoding sequencing. There were several factors that might affect the DNA purity in this study and it was most highly due to high phenolic compounds and other secondary metabolites contained in the pollens (Sahu et al., 2012; Lucchetti et al., 2018).

Downstream procedure could have been employed to increase the DNA purity but the greater aim of this particular activity was to amplify the target rbcl partial gene region from bee bread samples which had been successfully achieved. With these rbcl amplicons (Figure 4), construction of rbcL library of the bee bread samples and subsequent metabarcoding sequencing now can be carried out. The results of this activity signify our first successful attempt of DNA extraction and rbcL PCR- amplification from Malaysian H. itama bee breads or pollens.

Table 1: DNA extraction using FavorPrepTM Plant Genomic DNA Extraction Mini Kit (Favorgen) yields better results when compared to DNeasy Plant Mini Kit (not shown) in terms of DNA purity based on 260/230 and 260/280 ratios. Sample no. Sample ID Sample mass (g) ng/uL 260/230 260/280 Kit brand 1 Colony 1 100 54.52 1.5 1.8 Favorgen 2 Colony 2 100 163.57 1.78 1.92 Favorgen 3 Colony 3 100 97.47 1.48 1.88 Favorgen 4 Colony 4 100 305.38 1.85 2.04 Favorgen 5 Colony 5 100 229.64 2.05 2.04 Favorgen

350

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 4: Successful amplification of rbcL region (570 bp) from five bee bread samples (1 to 5). “-ve” is no-template control (water to replace DNA template). “+ve” is positive control (Plant gDNA template, 10 ng, according to fluorometric quantification). Only 1 uL of PCR product was run on 1.7% TAE agarose gel at 100V, 65 min.

Conclusion

In this study, we have demonstrated that DNA is retrievable from bee bread (fermented pollen grains) from Malaysian stingless bees H. itama and the PCR-based amplification of cytochrome oxidase subunit 1 (CO1) barcode gene is obtainable. This step is very critical before any samples can be used for DNA sequencing and metabarcoding analysis in determining botanical sources of the bee bread.

References

Bell, K.L., de Vere, N., Keller, A., Richardson, R.T., Gous, A., Burgess, K.S. and Brosi, B.J. 2016. Pollen DNA barcoding: Current applications and future prospects. Genome 59(9): 629-640. Kaplan, M., Karaoglu, O., Eroglu, N. and Silici, S. 2016. Fatty acid and proximate composition of bee bread. Food Technology and Biotechnology 54(4): 497-504. Kieliszek, M., Piwowarek, K., Kot, A.M., Błażejak, S., Chlebowska-Śmigiel, A. and Wolska, I. 2018. Pollen and bee bread as new health-oriented products: A review. Trends in Food Science and Technology 71: 170-180. Lucchetti, M.A., Kilchenmann, V., Glauser, G., Praz, C. and Kast, C. 2018. Nursing protects honeybee larvae from secondary metabolites of pollen. Proceedings of Royal Society B, 285: doi.org/10.1098/rspb.2017.2849. Pornon, A., Andalo, C., Burrus, M. and Escaravage, N. 2017. DNA metabarcoding data unveils invisible pollination networks. Scientific Reports 7: 16828. Sahu, S.K., Thangaraj, M. and Kathiresan, K. 2012. DNA extraction protocol for plants with high levels of secondary metabolites and polysaccharides without using liquid nitrogen and phenol. ISRN Molecular Biology Volume 2012, Article ID 205049, 6 pages, doi:10.5402/2012/205049.

351

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Micro-biocontrol of Garlic Skin (Allium sativum) and Peanut Skin (Arachis hypogaea) Extract on Apple Snail (Pomacea caniculata)

Khalisanni, K.1,*, Mohd Nor, M.R.1, Noor Azlina, M.1, Zamri, I.1, Asfaliza, R.2, Hanisa, H.2, Kayathri, K. 1,3 and Maizatulnisa, O.4 1Biotechnology and Nanotechnology Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 2Rice and Paddy Research Centre, Malaysian Agricultural Research and Development Institute (MARDI), MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 3Faculty of Food and Agriculture Sciences, University Putra Malaysia, Bintulu Campus, 97008, Bintulu Sarawak, Malaysia. 4Department of Manufacturing and Material Engineering, Kuliyyah of Engineering, International Islamic University Malaysia, PO BOX 10, 50728 Kuala Lumpur, Malaysia. *E-mail: [email protected]

Introduction

Composting organic waste materials such as peanut and garlic skins is a managed process which utilizes microorganisms naturally present in organic matter and soil to decompose organic material. Even though the route of managing the waste is persist, a novel method to convert these waste-to- wealth is needed especially to curb the woes in the presence paddy dilemma- apple snails (Pomacea spp) (Halwart, 1994; Litsinger & Estano, 1993).

Apple snail is an aquaculture pest for paddy industries (Teo, 2001). It inhibits the paddy field in selected areas of Peninsular Malaysia especially Kedah, Kelantan, Perak and the borders of Penang- Perak states of Malaysia. Many approaches have been done to combat the problem of apple snail such as chemical and biological approaches. However, the problem is still persist and ongoing (Arrighetti et al, 2018). Moreover, long term effect on the accumulation of chemical fate residues in rice along the value chain has not been studied (Huang et al, 2018).

Realizing the needs to combat the problem of apple snails through biological approach, garlic and peanut skin has been selected as raw materials to produce a biological control for this invasive pest. The selection of these materials are based on certain prospects; an abundance of the waste materials in Malaysia; availability of the waste for extraction; the presence of saponin in garlic and peanut skin (saponin has been successfully proven by previous study to biologically control the apple snails) (Brito et al., 2018). Due to the above-mentioned parenthesis, this experiment was carried out to study the effects of garlic skin and peanut skin extracts on apple snail. The aggregations of extracts were also studied to determine the formation of colloidal materials in the natural occurrence.

Material and Methods

Extraction of garlic skin on apple snail

5 g of garlic skin in 300 mL of distilled water were heated. The solution was heated until decreased to 200 mL. The solution was kept cooled. The apple snail was put into the beaker. The reaction with garlic skin extract and the apple snail was observed.

352

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Extraction of peanut skin on apple snail

10 g of peanut skin in 300 mL of distilled water were heated. The solution was heated until decreased to 200 mL. The solution was kept cooled. The apple snail was put into the beaker. The reaction with peanut skin extract and the apple snail was observed.

Particle size analysis

The dynamic light scattering (DLS-Omnibrook) technique has been used to determine the size of the colloidal aggregates. Samples such as peanut and garlic skin extract was put inside the cuvette, respectively. The particle solution software was run to analyze the particle size of sample extract.

Results and Discussion

Table 1 shows the reaction of garlic skin extract on apple snails. Based on the result, garlic skin extract showed cidal effect towards apple snail. The duration of survival was around 8±1 minute for apple snail to react with garlic skin extracts.

Table 1: Reaction with garlic skin extract. Durationa Observation After a few seconds Apple snail comes out from shell After 2 minutes It has movement After 5 minutes The shell move downwards and stick inside After 8 minutes The extract showed cidal effect to apple snail aThe duration of observation is based on the average time taken.

Table 2 shows reaction of peanut skin extracts on apple snails. Based on findings, peanut skin extracts showed cidal effect towards apple snail. The duration of survival of apple snail was 5±2 minutes for peanut skin extracts.

Table 2: Reaction with peanut skin extracts. Durationa Observation After a few seconds Apple snail was not come out from shell After 2 minutes It moves rapidly in the container After 5 minutes The extracts showed cidal effect to apple snail aThe duration of observation is based on the average time taken.

The apple snail shows cidal effects for peanut and garlic skins, respectively. The cidal effects of peanut and garlic skins can be observed through the immobility/ dormant of apple snail movement and the operculum has been exposed (opened) as shown in Figure 1.

353

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Figure 1: The overview picture of the apple snail anatomy.

The influence of garlic and peanut skin extracts on apple snail has shown different time frame of cidal effects. Based on the observations, the cidal effect of peanut skin extract is better than garlic skin at 3 minutes time interval. Hypothetically, the saponic contents of peanut skins are higher than garlic skins (Duncan et al., 2006). However, this statement needs further investigation and research.

Based on Table 3, the particle size of peanut skin was smaller than particle size of garlic skin. Hence, the colloidal aggregates of peanut skins extract comprising saponic compound are able to penetrate into apple snails system effectively compared to the garlic skin extract. The size of the particle plays an important role for the penetration proses into the snail (Kojima et al., 2018). The penetration process into the snails; either infusion or diffusion are proven to give a cidal effect to the snails body system at the biopesticide particle size of micro meter level.

Table 3: Particle size analysis. Extracts Size (μm) Garlic skin 1.381±0.312 Peanut skin 1.114±0.215

Conclusion

In a summary, the reaction between apple snail with the extracts of garlic and peanut skin increase the mortality rate of the pest, respectively. Reaction with the extracts of peanut skin in the form of smaller size 1.381±0.312 μm is more cidal than garlic skin extracts (1.114±0.215 μm).

Acknowledgment

The author(s) would like to thank Mohammad Rejab Ismail (BT MARDI), Mohd Irwani Hafiz Sahid (PB MARDI), Erwan Shah Shari (RI MARDI) and others for their help and idea.

References

Arrighetti, F., Ambrosio, E., Astiz, M., Capítulo, A.R. and Lavarías, S. 2018. Differential response between histological and biochemical biomarkers in the apple snail Pomacea canaliculata (Gasteropoda: Amullariidae) exposed to cypermethrin. Aquatic Toxicology 194: 140-151.

354

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Brito, F.C.D., Gosmann, G. and Oliveira, G.T. 2018. Extracts of the unripe fruit of Ilex paraguariensis as a potential chemical control against the golden apple snail Pomacea canaliculata (Gastropoda, Ampullariidae). Natural Product Research 1-4. Duncan, C.E., Gorbet, D.W. and Talcott, S.T. 2006. Phytochemical content and antioxidant capacity of water-soluble isolates from peanuts (Arachis hypogaea L.). Food Research International 39: 898-904. Halwart, M. 1994. The golden apple snail Pomacea canaliculata in Asian rice farming systems: present impact and future threat. International Journal of Pest Management 40(2): 199-206. Huang, F., Peng, L., Zhang, J., Lin, W. and Chen, S. 2018. Cadmium bioaccumulation and antioxidant enzyme activity in hepatopancreas, kidney, and stomach of invasive apple snail Pomacea canaliculata. Environmental Science and Pollution Research 1-11. Kojima, K., Westich, R. and Huang, H. 2018. U.S. Patent Application No. 15/562,747. Litsinger, J.A. and Estano, D.B. 1993. Management of the golden apple snail Pomacea canaliculata (Lamarck) in rice. Crop Protection 12(5): 363-370. Teo, S.S. 2001. Evaluation of different duck varieties for the control of the golden apple snail (Pomacea canaliculata) in transplanted and direct seeded rice. Crop Protection 20(7): 599- 604.

355

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Optimization of Normal Root Culture Production in Kesum

Mohd Azhar, H.1,*, Ismanizan, I.2, Ahmad Hafiz, B.1, Muhammad Shafie, M.S.1 and Mohamad Zulkiffely, A.R.1 1MARDI Headquarters, Persiaran MARDI-UPM, 43400 Serdang, Selangor, Malaysia. 2Institute of Systems Biology (INBIOSIS), Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia. *E-mail: [email protected]

Introduction

Most of the metabolite compounds are still extracted from the entire plant, resulting in low yields with high cost (Ee et al., 2013). Several studies suggested that the production of plant secondary metabolites can be improved using tissue culture technique (Bourgaud et al., 2001; Luczkiewicz et al., 2002). Shukor et al. (2013) has identified 12 chemical compounds in P. minus leaf cell culture where these compounds do not exist in real plants. An alternative method to obtain secondary metabolites is through plant in vitro culture such as root culture. Root culture is one of the less studied part of a plant compared to shoot. Majority of biotechnology research focuses more towards hairy root culture which exhibits a rapid growth rate, high productivity and genetic stability. Most observations reported that hairy root culture displayed high productivity of secondary metabolites such as in Plantago lanceolata, Datura stramonium and Scutellaria baicalensis (Baiza et al., 1998; Fons et al., 1999; Tiwari et al., 2008). However, contradiction was observed in the normal root culture of Coluria geoides which produced higher concentration of eugenol than in the hairy root culture (Olszowska et al., 1996).

Plant growth regulators are a major factor in controlling growth, morphogenesis in differentiation and metabolic activity of cultured tissue (Ramawat and Sonie, 1999). Auxin is responsible for cell enlargement, cell wall synthesis and enhancement of rooting (Tamas et al., 1992). Auxin such as NAA, IBA and IAA are widely used in promoting of rooting (Ugraiah et al., 2013; Yusuf et al., 2013). IBA and NAA are common auxin used to determine their ability to improve normal rooting (Copes and Mandel, 2000). Some authors have reported that the IBA is a better root inducer than NAA (Mackay et al., 1995; Mhatre et al., 2000; Leonardi et al., 2001). Root of Cercis canadenis var. Mexicana formed in the presence of NAA is thick and non-branching while finer and branching in the presence of IBA (Mackay et al., 1995). High concentration of auxin is capable in producing callus (Ndoye et al., 2004) and short root formation in few plant species (Thiem, 2003).

Kesum or Polygonum minus (P. minus) is a popular aroma herb derived from the Polygonaceae family. However, no further studies were conducted to determine the optimum culture media content for producing P. minus normal root. Therefore, this study was carried out with the aim to determine the optimal conditions for P. minus normal root formation by focusing on the types and concentrations of plant growth regulators together with the forms and positions of media.

Materials and Methods

Normal root induction was performed by placing 2.0 cm sterile nodal explants on the MS liquid media containing different types and concentrations of auxin, which were NAA (0.5, 1.0, 1.5 and 2.0 mg/L) and IBA (0.5, 1.0, 1.5 and 2.0 mg/L). Each bottle jar was placed with three nodal explants. Liquid and solid MS media without plant growth regulators were used as control treatments in the experiment. All these treatment and control cultures were grown in static or shake condition on an orbital shaker in a culture room at 25±2ºC under 16-hour photoperiod pendaflour light. This study utilised a randomised complete block design (RCBD) with 3 replications where each replication contains 5 jar bottles per treatment. Experimental design is shown in Table 1. Data for root length (cm), root weight

356

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

(g) and normal root quality were recorded after the explant reached 2 months old. Statistical analysis was determined by one-way Analysis of Variance (ANOVA) using Statistic Analysis Software 9.4 programme (SAS 9.4). Analysis was carried out using Duncan's Multiple Range Test (DMRT).

Table 1: Experimental design for normal root induction study of Polygonum minus. Code Plant growth regulator (mg/L) Media form Media position NAA IBA T1 0.5 0 Liquid Shake T2 1.0 0 Liquid Shake T3 1.5 0 Liquid Shake T4 2.0 0 Liquid Shake T5 0 0.5 Liquid Shake T6 0 1.0 Liquid Shake T7 0 1.5 Liquid Shake T8 0 2.0 Liquid Shake T9 0.5 0 Liquid Static T10 1.0 0 Liquid Static T11 1.5 0 Liquid Static T12 2.0 0 Liquid Static T13 0 0.5 Liquid Static T14 0 1.0 Liquid Static T15 0 1.5 Liquid Static T16 0 2.0 Liquid Static C1 0 0 Liquid Shake C2 0 0 Liquid Static C3 0 0 Solid Static

Results and Discussion

The fresh weight of normal root produced by the explant is influenced by the type and concentration of plant growth regulators (PGR) used in media. For instance, fresh weight of normal root for nodal explants in liquid MS media supplemented with 0.5 mg/L NAA and shaken demonstrated the highest yield value (0.38 g) compared to other treatments including controls (Figure 1). Similar results have been reported in the Kaempferia galanga and Kaempferia rotunda (Geetha et al., 1997).

Figure 1: Fresh weight of Polygonum minus normal root in different treatments.

357

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Like NAA, IBA also showed the highest fresh weight of normal root in the concentration of 0.5 mg/L on shaking media condition, which was 0.34 g. However, its fresh weight value was lower than that of NAA. The same result also recorded on IBA with 1.0 mg/L concentration. According to Hartmann et al. (2007), IBA is the strongest, stable and less toxic of auxin that is widely used as a root booster hormone for most species including Panax bipinnatifidus (Thach et al., 2014), Clinacanthus nutans (Chen et al., 2015) and Wattakaka volubilis (Vinothkumar and Senthilkumar, 2015). However, for some plant species such as Citrus tangerina (Nwe et al., 2014), NAA is stated to be the most suitable auxin for normal rooting of nodal explants including P. minus. There were also some species showing the same rooting response to NAA and IBA like Punica granatum where MS media at full strength containing 0.5 mg/L NAA and 0.5 mg/L IBA showed the best rooting results, respectively (Singth et al., 2014). The combination of both NAA and IBA hormones is very successful for some species in normal root production; for example, on the rooting of Eriobotrya japonica (Abbasi et al., 2013).

Normal weight of fresh roots that decreased when the NAA concentration increases from 0.5 to 2.0 mg/L indicates that the effect of inhibition from using high concentration of plant growth regulator. This phenomenon has been also reported in Mentha piperita (Ghanti et al., 2004) and Citrus tangerine (Nwe et al., 2014). Observation by Rai et al. (2009) suggested that auxin at high concentration causes the production of degradative metabolites to increase and inhibit root growth processes.

The liquid media position at static or shaking condition affects the normal root production of nodal explants. This was evidenced by the production of low normal fresh root weight in the liquid media, which was static rather than shaking for each NAA and IBA concentration used in this experiment including the control treatment. IBA showed a significant decrease in root weight for media that are in a static condition rather than shaking for each concentration used. Mehrotra et al. (2007) stated that growth rate of shoot and root can be enhanced via forced aeration in liquid culture media that are continuously shaken. Continuous shaking on liquid media can produce enough oxygen supply and distribute nutrient evenly until it finally affects the fast and plentiful growth.

Control treatment, which is a liquid MS media without any plant growth regulator placed in a shaking position (C1) produced the highest fresh weight of normal root (0.26 g) compared to other two control treatments (C2 and C3). There were only two treatments in this study that produced fresh weight of normal root higher and significantly different compared to C1, which were T1 and T5 with the weights of 0.38 g and 0.34 g, respectively. Treatments that produced a weight of normal roots that is not significant or lower than C1 were considered unsuitable as treatments of normal root production for P. minus nodal explant due to loss of cost, time and energy. Data of normal root fresh weight for C3 control treatments was lower compared to C1 and C2 proving that the normal root production of P. minus nodal explant was more suitable in liquid rather than solid media. Liquid media allows a closer relationship between media and tissue in which it can stimulate and facilitate nutrient and hormone uptake resulting in improved shoot and root growth (Sandal et al., 2001).

Table 2 illustrates that normal root length was not the only factor contributing to the fresh weight of the normal root produced. For instance, the C3 control treatment produced the longest normal root of 13.8 cm compared to the other treatments, but the fresh weight of its normal root was recorded among the lowest. Although T1 treatment produced a relatively moderate normal root length of 7.6 cm compared to the other treatments, the fresh weight of the normal root recorded was the highest among the others. This proved that other factors such as the number and thickness of the normal root produced can give an impact on the fresh weight of the normal root recorded. The root elongation phase is highly responsive to auxin concentration where it can inhibit root elongation at high concentration (Hu and Wang, 1983) resulted from ethylene production within the root zone that acts as an inhibitor agent (Chang et al. 2013). Situation in the treatment of T3 and T4 also occurred in Mentha piperita where the resulting root length decreased when the NAA concentrations used exceeds 1.0 mg/L (Ghanti et al., 2004).

358

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Table 2: Means from DMRT for length and fresh weight of normal root and of Polygonum minus in different treatments with types and concentrations of plant growth regulators on static and shaking position. Treatment Score Code Plant growth regulator Media Media Mean of normal Mean of normal (mg/L) form position root fresh weight root length (g) (cm) NAA IBA T1 0.5 0 Liquid Shake 0.38a 7.60f T2 1.0 0 Liquid Shake 0.28c 8.20ef T3 1.5 0 Liquid Shake 0.24cde 5.57g T4 2.0 0 Liquid Shake 0.18fg 5.07g T5 0 0.5 Liquid Shake 0.34b 10.87bc T6 0 1.0 Liquid Shake 0.21ef 10.67c T7 0 1.5 Liquid Shake 0.25cd 11.73b T8 0 2.0 Liquid Shake 0.17g 9.40d T9 0.5 0 Liquid Static 0.21ef 4.77g T10 1.0 0 Liquid Static 0.22de 7.73f T11 1.5 0 Liquid Static 0.17g 5.10g T12 2.0 0 Liquid Static 0.13hi 4.77g T13 0 0.5 Liquid Static 0.07j 2.63hi T14 0 1.0 Liquid Static 0.08j 3.20hi T15 0 1.5 Liquid Static 0.07j 3.53h T16 0 2.0 Liquid Static 0.03k 2.43i C1 0 0 Liquid Shake 0.26cd 7.47f C2 0 0 Liquid Static 0.16gh 8.77de C3 0 0 Solid Static 0.10ij 13.80a Means within a column with the same letters are not significantly different (p<0.0001) according to DMRT.

The results in Table 3 displays that the normal roots characters in all treatments media including control in shacking position were thick, long and dark in colour (Figure 2A) except for the treatment of T3 and T4 where the root condition was clump (Figure 2B). When in static position, the normal roots formed for all treatments media were thin, short and bright in colour (Figure 2C) except for treatment T12 where the root condition was clump. According to Davies and Joiner (1980), high concentration of NAA can affect the quality and shape of the normal root produced.

Table 3: Normal root characters of Polygonum minus in different treatments with types and concentrations of plant growth regulators on static and shaking position. Treatment T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 Root character Thick Thick Thick and Thick and Thick Thick Thick Thick Thin Thin clump clump

Treatment T11 T12 T13 T14 T15 T16 C1 C2 C3 Root character Thin Thin and Thin Thin Thin Thin Thick Thin Thin clump

359

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

A B C

Figure 2: Normal root characters of Polygonum minus: A) Thick, long and dark colour; B) Clump; C) Thin, short and bright colour.

Conclusions

The fresh weight of P. minus normal root for nodal explant in shaking MS liquid media supplemented with 0.5 mg/L NAA had the highest outcome value (0.38 g) compared to other treatments including the controls. This proved that the fresh weight of normal root produced from the explant is influenced by the type and concentration of plant growth regulator used together with the form and position of media.

References

Abbasi, N.A., Pervaiz, T., Hafiz, I.A., Yaseen, M. and Hussain, A. 2013. Assessing the response of indigenous loquat cultivar Mardan to phytohormones for in vitro shoot proliferation and rooting. Journal of Zhejiang University Science B 14(9): 774-784. Baíza, A.M., Quiroz, A., Ruíz, J.A. and Maldonado-Mendoza, I. 1998. Growth patterns and alkaloid accumulation in hairy root and untransformed root cultures of Datura stramonium. Plant Cell, Tissue and Organ Culture 54(2): 123-130. Bourgaud, F., Gravot, A., Milesi, S. and Gontier, E. 2001. Production of plant secondary metabolites: A historical perspective. Plant Science 161(5): 839-851. Chang, L., Ramireddy, E. and Schmülling, T. 2013. Lateral root formation and growth of Arabidopsis is redundantly regulated by cytokinin metabolism and signalling genes. Journal of Experimental Botany 64(16): 5021-5032. Chen, B., Zhang, J., Zhang, W., Zhang, C. and Xiao, Y. 2015. The rapid propagation technique of the medicinal plant Clinacanthus nutans by tissue culture. New York Science Journal 8: 23-27. Copes, D. and Mandel, N. 2000. Effects of IBA and NAA treatments on rooting Douglas-fir stem cuttings. New Forests 20(3): 249-257. Davies, F.T. and Joiner, J.N. 1980. Growth regulator effects on adventitious root formation in leaf bud cuttings of juvenile and mature Ficus pumila. Journal of the American Society for Horticultural Science 105(0): 91-95. Ee, S.F., Oh, J.M., Noor, N.M., Kwon, T.R., Mohamed-Hussein, Z.A., Ismail, I. and Zainal, Z. 2013. Transcriptome profiling of genes induced by salicylic acid and methyl jasmonate in Polygonum minus. Molecular Biology Reports 40(3): 2231-2241. Fons, F., Tousch, D., Rapior, S., Gueiffier, A., Roussel, J.L., Gargadennec, A. and Andary, C. 1999. Phenolic profiles of untransformed and hairy root cultures of Plantago lanceolata. Plant Physiology and Biochemistry 37(4): 291-296. Geetha, S.P., Manjula, C., John, C.Z., Minoo, D., Babu, K.N. and Ravindran, P.N. 1997. Micropropagation of Kaempferia spp. (K. galanga L. and K. rotunda L.). Journal of Spices and Aromatic Crops 6(2): 129-135.

360

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Ghanti, K., Kaviraj, C.P., Venugopal, R.B., Jabeen, F.T.Z. and Rao, S. 2004. Rapid regeneration of Mentha piperita L. from shoot tip and nodal explants. Indian Journal of Biotechnology 3: 594-598 Hartmann, H.T., Kester, D.E., Davies, J.F.T. and Geneve, R.L. 2007. Plant hormones. In: Plant propagation: Principles and practices, p. 292-320. 7th Ed. Prentice-Hall. Hu, C.Y. and Wang, P.J. 1983. Meristem, shoot tip and bud cultures. In: Handbook of Plant Cell Culture, p. 177-277. New York: MacMillan. Łuczkiewicz, M., Zárate, R., Dembińska-Migas, W., Migas, P. and Verpoorte, R. 2002. Production of pulchelin E in hairy roots, callus and suspension cultures of Rudbeckia hirta L. Plant Science 163(1): 91-100. Mackay, W.A., Tipton, J.L. and Thompson, G.A. 1995. Micropropagation of Mexican redbud, Cercis canadensis var. Mexicana. Plant Cell, Tissue and Organ Culture 43(3): 295-299. Mehrotra, S., Goel, M.K., Kukreja, A.K. and Mishra, B.N. 2007. Efficiency of liquid culture systems over conventional micropropagation: A progress towards commercialization. African Journal of Biotechnology 6(13): 1484-1492. Mhatre, M., Salunkhe, C. and Rao, P. 2000. Micropropagation of Vitis vinifera L: Towards an improved protocol. Scientia Horticulturae 84(3): 357-363. Ndoye, M., Diallo, I. and Gassama, Y.K. 2004. In vitro multiplication of the semi-arid forest tree, Balanites aegyptiaca (L.) Del. African Journal of Biotechnology 2(11): 421-424. Nwe, Y.Y., Myint, K.T., Mochizuki, Y., Vazirzanjani, M., Okayasu, K., Suzuki, S. and Ogiwara, I. 2014. In vitro regeneration through direct shoot organogenesis in Honey Orange (Citrus tangerina). Plant Biotechnology 31(4): 341-344. Olszowska, O., Alfermann, A. and Furmanowa, M. 1996. Eugenol from normal and transformed root Cultures of Coluria geoides. Plant Cell, Tissue and Organ Culture 45(3): 273-276. Rai, M.K., Jaiswal, V.S. and Jaiswal, U. 2009. Shoot multiplication and plant regeneration of guava (Psidium guajava L.) from nodal explants of in vitro raised plantlets. Journal of Fruit and Ornamental Plant Research 17(1): 29-38. Ramawat, K. and Sonie, K. 1999. Production under stress. Biotechnology Secondary Metabolites 177- 187. Sandal, I., Bhattacharya, A. and Ahuja, P.S. 2001. An efficient liquid culture system for tea shoot proliferation. Plant Cell, Tissue and Organ Culture 65: 75-80. Shukor, M.F.A., Ismail, I., Zainal, Z. and Noor, N.M. 2013. Development of a Polygonum minus cell suspension culture system and analysis of secondary metabolites enhanced by elicitation. Acta Physiologiae Plantarum 35(5): 1675-1689. Singh, J., Gupta, S. and Khoshe, P. (2014). In vitro regeneration of pomegranate (Punicagranatum L.) from nodal explant. International Journal of Advances in Pharmacy, Biology and Chemistry 3(3): 734-736. Tamas, I., Langridge, W., Abel, S., Crawford, S., Randall, J., Schell, J. and Szalay, A. 1992. Hormonal control of apical dominance. Studies in tobacco transformed with bacterial luciferase and Agrobacterium rol genes. Progress in Plant Growth Regulation 418-430. Thach, B.D., Linh, L.T., Van, N.T., Ben, T.T., Truong, M. and Ho, N.H. 2014. A study on the formation and development of Panax bipinnatifidus Seem. adventitious root. Journal of Developmental Biology and Tissue Engineering 6(1): 1-7. Thiem, B. 2003. In vitro propagation of isoflavone-producing Pueraria lobata (Willd.) Ohwi. Plant Science 165(5): 1123-1128. Tiwari, R., Trivedi, M., Guang, Z.C., Guo, G.Q. and Zheng, G.C. 2008. Agrobacterium rhizogenes mediated transformation of Scutellaria baicalensis and production of flavonoids in hairy roots. Biologia Plantarum 52(1): 26-35. Ugraiah, A., Sreelatha, V.R., Reddy, P.K., Rajasekhar, K., Rani, S.S., Karuppusamy, S. and Pullaiah, T. 2013. In vitro shoot multiplication and conservation of Caralluma bhupenderiana Sarkaria - An endangered medicinal plant from South India. African Journal of Biotechnology 10(46): 9328-9336.

361

eISSN 2600-9595 Trans. Malaysian Soc. Plant Physiol. 26 First Published, 2019

Vinothkumar, D. and Senthilkumar, M. 2015. In vitro callus induction and plants from leaf explants of Wattakaka volubilis L. (Staf. Arn) - A vulnerable medicinal plant. European Journal of Biotechnology and Bioscience 3(6): 12-16. Yusuf, N.A., Annuar, M.S. and Khalid, N. 2013. Rapid micropropagation of Boesenbergia rotunda (L.) Mansf. Kulturpfl. (a valuable medicinal plant) from shoot bud explants. African Journal of Biotechnology 10(7): 1194-1199.

362