Process Biochemistry 66 (2018) 183–196

Contents lists available at ScienceDirect

Process Biochemistry

journal homepage: www.elsevier.com/locate/procbio

The structure of the anaerobic thermophilic microbial community for the T bioconversion of the cellulose-containing substrates into biogas ⁎ Elena Tsavkelova , Ljuba Prokudina, Maria Egorova, Maria Leontieva, Dina Malakhova, Alexander Netrusov

Microbiology Department, Faculty of Biology, Lomonosov Moscow State University, 1-12 Lenin’s Hills, 119234, Moscow, Russia

ARTICLE INFO ABSTRACT

Keywords: The structure of the microbial community digesting various waste papers under the thermophilic (55 °C) con- Paper-degrading thermophilic microbial ditions was analyzed by a multilateral approach, comprising the denaturing gradient gel electrophoresis (DGGE) community and the high-throughput sequencing (HTS), supported by the light- and scanning electron microscopy (SEM). Cellulolytic bacteria The most abundant and diverse microbial populations were observed when the office paper, corrugated carton Syntrophic bacteria and the waste paper mixture were used, whereas the poorest communities were detected on the magazine paper Hydrogenotrophic methanogens and newspaper. These results were also confirmed by the DGGE analysis. Within Bacteria, the main groups were DGGE ffi fi High-throughput sequencing (HTS) a liated to Firmicutes (Acetivibrio, Herbinix, Thermoanaerobacterium, Tepidanaerobacter). Bacteria, identi ed as Acetivibrio cellulolyticus, due to the comparative analysis within databases, belong to the genus Ruminiclostridium. Methanothermobacter and Methanosarcina were among the dominant Archaea. The HTS analysis showed the high prevalence of Clostridia (Ruminiclostridium). The representatives of all the trophic groups, needed for an efficient bioconversion of the wastepaper into the biogas, were detected by HTS as well, including diverse hydrolytics and fermentative species. The presence and amount of the syntrophic acetate-oxidizing bacteria Tepidanaerobacter and Thermoanaerobacterium, and their tight association with the hydrogenotrophic methanogens, are discussed concerning the completeness and effectiveness of the bioutilization of different types of non-pretreated papers.

1. Introduction and methanogenic activities. The more complex substrate composition is degraded, the more developed microbial community with a higher The anaerobic fermentation of the various organic substrates, which metabolic diversity is selected [2],[3]. resulted in the biogas production, is one of the most efficient trends in Nowadays, the analysis of the microbial communities is made by a biotechnology to obtain the renewable energy. Biogas mainly consists combination of a number of the molecular approaches, such as nucleic of methane (55–75%) and carbon dioxide (25–45%), which calorific acid-based analytical methods [specific and multiplex-PCR; denaturing value varies within 4700–6000 kcal/m3, depending on the methane and temperature gradient gel electrophoresis (DGGE/TGGE), Real-time content (reviewed in [1]). In addition to the final products, among the quantitative PCR (Rt-PCR), and others], DNA fingerprinting and fluor- advantages of the anaerobic bioconversion, are the total waste reduc- escence in situ hybridization (FISH), restriction fragment length poly- tion, the possibility of low- or ambient-temperature reactor operation, morphism (RFLP) and different types of "-omics” (metagenomics, me- and the processing of the remnant as fertilizer [2]. The methanogenic taproteomics, metatranscriptomics, proteogenoimcs, etc). The culture- community consists of various bacteria and archaea, and their popu- based techniques usually provide limited information, considering the lations differ under psychrophilic, mesophilic, or thermophilic condi- number of barely cultivated or uncultured strains [5]. In the context of tions [3]. Considering that several metabolic processes are involved in the comprehensive understanding of the composition and the dynamics biogas formation, such as organic matter hydrolysis, fermentation of of the microbial populations within the microbial community, the sugars and amino acids, anaerobic oxidation, acetate and methane molecular techniques are considered as much more informative. The formation, the structure of the communities strongly depends on the successful studies, characterizing the structure of the community of an nature of the decomposing substrate [4]. The tight cooperation between activated sludge and paddy field soil, performed with DGGE, were the members is based on the trophic interactions and growth factor made by a group of T. Watanabe and colleagues [6]. Despite that, the exchange [1],[4], determining the prominent hydrolytic, acidogenic accuracy of this method depends on the number of technical factors and

⁎ Corresponding author. E-mail address: [email protected] (E. Tsavkelova). https://doi.org/10.1016/j.procbio.2017.12.006 Received 13 August 2017; Received in revised form 25 November 2017; Accepted 9 December 2017 Available online 15 December 2017 1359-5113/ © 2017 Elsevier Ltd. All rights reserved. E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196 selection of the proper clones [7]. In combination with the metagenome microbial communities (MC) from the various ecological niches, cap- analysis, it allows to study the composition of the bacterial and archaeal able of transforming waste paper into biogas [21,22]. They were se- members of the methanogenic community more precisely. Recent stu- lected for their stability in the cellulose-degrading and СH4 −producing dies report on the application of DGGE and SSCP (single-strand con- activities through five passages (re-inoculation of the MC after they formation polymorphism) techniques in the analysis of a bacterial and/ have reached the maximum biogas production), and the most effective or archaeal biogas community in a mesophilic biogas digester treating communities were than combined together. The total anaerobic mi- pig manure [8], in a digester tank fed with palm oil mill effluent [7], in crobial consortium (Σ4), composed of the communities initially isolated the 200-l biogas reactors with liquid manure [9], and in the full-scale from the cattle manure, pond bottom sediments, zebra and antelope tanks treating a variety of residues from brewery, dairy, and yeast in- manure [21,22], was capable of producing biogas from the paper dustry waste [10]. mixture with about 50% of cumulative methane in it [20]. The main The biogas production usually refers to digestion of sewage sludge aim of the present work was to determine the structure and the com- and different types of industrial, agricultural, municipal or livestock position of this CH4 producing thermophilic Σ4 microbial consortium, organic wastes and wastewater. In recent years, conversion of lig- cultivated on the diverse paper substrates, by performing Scanning nocellulosic biomass (LCB) into biofuel has also gained prominence. Electron Microscopy (SEM), the DGGE analysis, and the High- Cellulose-containing materials are promising for the biogas production, Throughput Sequencing (HTS). During this study, we also compared the but the presence of such a complex compound as lignin with its high tested techniques under the handled conditions for the better char- molecular mass and low solubility, makes the degradation of the LCB acterization of the microbial structure and diversity of the paper-de- slow and incomplete. For better LCB utilization, diverse mechanical, composing anaerobic microbial community. chemical and physico-chemical pretreatment techniques are used [11]. Another more ecologically friendly way to decompose the LCB, is the 2. Materials and methods usage of the lignolytic and cellulolytic microorganisms. Among the lignin-decomposing microorganisms, the white rot fungi are the widely 2.1. Culture conditions and biogas production recognized leaders, such as Pleurotus ostreatus and Phanerochaete chry- sosporium [11]; within the bacterial family, only the aerobic species, In order to study the structure and functional capacity of the mi- such as the strains of the genera Bacillus and Streptomyces are reported crobial communities (MC) for degrading various types of waste papers, as the active lignolytics [12]. There is also a number of aerobic bacteria we took several previously described [21] thermophilic biogas-produ- with cellulolytic activity, belonging to Acidothermus, Bacillus, Caldiba- cing communities, isolated from the different sources, including her- cillus, Cellulomonas, Cellvibrio, Cytophaga, Dyella, Erwinia, Micro- bivorous animal manure, pond bottom sediments, and grape bagasse. monospora, Pseudomonas, Pseudoxanthomonas, Sporocytophaga, Thermo- The microbial community, designated and further described as "Σ4", monospora, Rhodothermus, and Thermobifida (reviewed in [4]). A was composed of the four most active initial MC # 6, 17, 19, and 21, distinct difference in the mechanisms of action of the microbial en- isolated from the cattle manure, pond bottom sediments, zebra and zymes between the aerobic and anaerobic prokaryotes is primarily due antelope manure, respectively [21]. Another "Σ7" community had the to that aerobic cellulose degraders produce multiple extracellular en- additional inocula, originating from the communities isolated from the zymes, including cellulases, whereas typical anaerobic bacteria such as red grape bagasse, pony manure, and black antelope manure (MC #3, Clostridium, Ruminiclostridium and Ruminococcus species, as well as 20, and 22, respectively). After being composed, they were cultivated Acetivibrio cellulolyticus and Bacteroides cellulosolvens, produce a stable on office paper through three subsequent re-inoculations (passages) as complex enzyme system (cellulosomes), tightly attached to the cells described elsewhere [20,21]; each passage lasted for 18 days. Then the [4]. These anaerobic hydrolytics are known pivotal members of the enrichment associations of Σ4 and Σ7 MCs were taken as inoculum complex microbial consortia, where they co-exist with a number of (10%) for the batch culture cultivated in 100 ml vessels with 30 ml of other groups of bacteria and archaea. Clostridia themselves, due to their mineral medium (рН = 7.0), containing yeast extract and peptone (the exceptional substrate diversity, are able to produce a broad spectrum of composition is described earlier [21,22]), and supplemented with a metabolites that can be used as precursors or directly as biofuels and waste paper mixture, composed of the brown corrugated cardboard, industrial chemicals [13]. magazine paper, newspaper (free daily tabloid) and office paper (cel- The alternative bio-methane production provides the ecological and lulose chlorine-free paper 80 g/m2 of “SvetoCopy” and “Snegurochka”) economical importance for the production of biofuel. The strategy of with black printing (Samsung Xpress SL-M2070 laser monochrome using the “energy crops” in biofuels is reconsidered nowadays, since the printer with a compatible Samsung/Xerox universal type JLT-037UP intensive exploitation of arable lands for their cultivation may yield a ink). The Σ4 community was also cultivated on all tested substrates negative impact on the global supply and price of foods [14,15]. In this separately. Either separately or together as a paper mixture, the final context, the wastepaper represents one of the advantageous cellulose- amount of the substrate was 15 g/l; in a combined sample of a paper containing substrates. Amounts of wastes are increasing globally, and mixture, each of the four different papers was taken in an amount of different types of paper are considered as one of the major parts in 3.75 g/l. The papers were preliminary shredded into pieces of 0.5 cm2. municipal solid wastes; the separate waste treatment enables the col- The rubber stoppered, argon-flushed glass vessels were incubated in an lection of the significant waste paper amounts either for further re- incubator BD 115 (Binder, Germany) at 55 °C over three subsequent cycling or biotransformation. The anaerobic degradation of organic passages before the methane yield was measured. Since the performed matter and further biogas production usually takes much less time and study implicated a large screening of the various samples in three re- provides higher methane yield under thermophilic rather than meso- petitions under the conditions of a high temperature (+ 55 °C) in- philic conditions [16,17]. However, the majority of studies on the cubator, the 100 ml vessels with 30 ml of the medium have been chosen biogas production are performed on the mesophilic communities, since to comply with the pivotal concept of the optimal gas-liquid ratio. the number of thermophilic plants is still limited [18]. That is why The content of the gaseous phase (CH4,CO2, and H2 concentrations) information on the composition of thermophilic anaerobic biogas was analyzed using the gas chromatograph Crystal 2000 M (Chromatec, communities, as well as on the trophic networks, is still insufficient. Russia), equipped with a thermal conductivity detector, a micro- In our recent studies [19,20], we showed the effective conversion of capillary analytical column ZB-FFAP (Zebron, USA (15 the cellulose-containing substrates (diverse paper materials and bre- 000 mm × 0.25 mm × 0.25 μm), argon as the carrier gas, 15 ml/min wer's spent grain co-digested with Jerusalem artichoke) into biogas by flow rate. The chromatograms were processed using Chromatec the selected anaerobic communities under the thermophilic conditions. Analytic 2.5 software. The total biogas production was considered as

We reported on the isolation of several (24) enrichment anaerobic the sum of produced individual gases (CH4,CO2,H2) at the time

184 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196 interval within 20 days of incubation, and the gas concentrations were GGG GCG GGG GCA CGG GGG GCA GCA GCC GCG GTA ATA C − 3′), measured every 3 days over the whole experimental period. The con- and archaeal Arch344F-GC (5′-CGC CCG CCG CGC GCG GCG GGC GGG centration of the individual gases in the mixture and % of methane GC GGG GGC ACG GGG GGA CGG GGY GCA GCA GGC GCG A-3′)[24]. content in the biogas was determined immediately after sampling under In order to compare the different approaches during the DGGE the standard temperature and pressure conditions, as previously de- analysis, we also performed a one-step amplification with Bact907R scribed [21]. The pressure in the vessels was measured before the and GC-clamp containing Com1GC primers. Amplification was per- sampling; after the biogas mixture was analyzed, the gas was released. formed by using the thermocycler “GeneAmp PCR System 9700” The data on methane content, estimated by the gas chromatography, (Applied Biosystem, Germany). Two polymerases were used: 5U/μl Taq were performed as a calculation of the mean values of three repeti- DNA polymerase (Eurogen, Russia) and Phusion High Fidelity DNA tions ± standard error. polymerase (Thermo Scientific). The PCR mixture (25 μl) contained the following components (for Taq/Phusion, respectively): 2.5 μl10×/

2.2. Microscopy 5.0 μl5×buffer, 2.5 mM/2.5 mM MgCl2, 0.25 mM/0.2 mM each dNTP, 0.2 μM/0.4 μM each primer, 0.06 U/μl Taq/0.02 U/μl Phusion DNA To visualize the microbial diversity of the tested Σ4 and Σ7 MCs polymerase), and 5–10 ng of DNA. The PCR amplification conditions for after the second passage of their cultivation on different paper sub- the primer sets were as follows (for Taq/Phusion, respectively): dena- strates, the light microscope (Nikon Eclipse E100, Japan) was used turation was performed at 94 °C for 5 min/98 °C for 1 min, followed by according to the previously described technique [21]. For the Scanning 25 cycles of 30s/10 s denaturation at 94 °C/98 °C, 30 s primer annealing Electron Microscope (SEM) analysis, the cultures of the third passage, according to Table 1 temperature, followed with 1 min chain elongation tested for the biogas production, were studied. The aliquot of the sus- at 72 °C and 7 min final elongation at 72 °C. For the one step PCR am- pension after 3 and 10 days of incubation (a combined average sample plification, the touchdown PCR protocol was used; the annealing tem- from three repetitions) was smeared on the coverslip glass surface, air perature (indicated in Table 1B) was increased by 10 °C, which was dried and fixed with a 2.5% solution of glutaraldehyde in phosphate then gradually decreased by 1 °C every second cycle; 10 additional buffered saline for 12 h, rinsed in water and then dehydrated in ethanol annealing and extension cycles were carried out. Amplification of the solutions of increasing concentrations. After the final dehydration in reaction mixtures containing no DNA served as a negative control. The absolute ethanol and overnight soaking in 100% acetone, the samples PCR products were checked in electrophoresis in a 1% agarose gel and were dried by critical point using an HCP-2 device (Hitachi, Japan), visualized under UV light as described above. coated with Au–Pd (Eiko IB-3 Ion Coater, Hitachi, Japan), and ex- amined with an JSM-6380LA (Jeol, Japan). 2.5. Denaturing gradient gel electrophoresis (DGGE)

2.3. DNA extraction The DGGE analysis was carried out according to the protocol pub- lished earlier [25] in the TV400-DGGE chamber (SCIE-PLAS, Great о In order to study the structure of the MC, we performed Denaturing Britain) for 18 h at 70 V and 60 С by using 6% acrylamide-bisacryla- Gradient Gel Electrophoresis (DGGE). For this analysis, we compared mide gel and denaturing agents [7 M urea (Helicon) and 40% for- the structure of the Σ4 MC, cultivated on the different paper substrates mamide (Amresco)] with a gradient of 40–65% in 0.5 × TAE buffer and and Σ7 MC, cultivated on the paper mixture only, after the third pas- a non-denaturing 8% polyacrylamide top-up after the denaturing layer sage of the incubation. To get an average sample, the biomass (1 ml) was poured. After the electrophoresis, the gels were rinsed in MQ water was taken after 3, 10, and 20 days of incubation from three repetitions, and stained with SYBR Green I (BioDye, Russia) for 40 min in the dark. and combined together. For the DNA isolation, 9 ml of the culture The bands were visualized with blue light (470 nm), excised with sterile suspension were centrifuged 10 min at 12000g, the sediment was stored pipette tips, and incubated in 50 μl of MQ water overnight at 4 °C to о at −20 С until nucleic acid extraction; then 500 μl of TNE buffer elute the DNA. The template was then re-amplified with the relevant (100 mM Tris-HCl, 150 mM NaCl, 100 mM EDTA, pH = 8) and 200 mg primers, visualized in 1.5% agarose gel, and purified with a Cleanup of the glass beads (0.1 mm in diameter, Sigma, USA) were added, and Standard kit (Evrogen, Russia). The partial 16S rRNA gene was se- the suspension was mulled in the Mini beadbeater-1 (BioSpec Products, quenced directly on an ABI 3730 automated DNA sequencer (Applied USA) for 3 min for cell disruption and homogenization. The mixture Biosystems Inc., United States) using a BigDye 126 Terminator v3.1 was supplemented with 20% SDS (10 μl per 100 ml of the sample), Cycle Sequencing Kit according to the manufacturer protocol. The vortexed and incubated for 40 min at 50 °C and then for 10 min at 65 °C. partial 16S rRNA gene sequences were compared to those from Gen- о After centrifugation at 6000g at 4 С for 5 min, DNA was extracted Bank using the BLAST database [NCBI (National Center for Bio- according to FastDNA SPIN Kit for Soil (MP) protocol. The purified DNA technology Information website; http://www.ncbi.nlm.nih.gov/blast)]. was quantified with a Drop Sense-96 spectrophotometer (Trinean, Belgium), and stored at −20 °C before use. For electrophoresis in a 1% 2.6. Illumina library construction and sequencing agarose gel with TAE 1х buffer at 80 V for 30 min, 5 μl of DNA and the ladder (GeneRulerTM 100 bp DNA Ladder and Lambda DNA/ Total DNA was isolated from the third passage of the Σ4 MC, as the EcoRI + HindIII, Fermentas) were used. The DNA bands were visua- most active one, cultivated on the office paper; the V3–V4 region of 16S lized at 310 nm after staining in SYBR Green I intercalating dye. rRNA genes was amplified and libraries were prepared as previously described [26]. The composition of the forward and reverse primers, as 2.4. PCR conditions well as the conditions for the amplification, was as described previously [27]. Each sample was amplified in two replicates, which were then Genomic DNA was used as a template for PCR reactions. Primers pooled together into a single volume and ran on a 2% agarose gel. A used in this study were selected as universal and specific to bacteria or Standard Cleanup Gel Extraction Kit (Evrogen, Russia) was used for archaea (Table 1A). For the nested PCR, a pair of primers amplifying extraction of the amplicons from the gel. To measure DNA amount, a nearly full-length of 16S ribosomal DNA were used: 63F-1387R for Qubit 2.0 Fluorometer was used with a dsDNA HS (High Sensitivity) bacteria and 38–1381 for archaea. To enable the separation of the Assay Kit (Life Technologies, USA). Prior to sequencing, equal amounts fragments using DGGE, the GC clamp was included on the 5 end of the of amplicon DNA from each sample were combined to create a single following forward primers: Univ518F-GC (5′- CGC CCG CCG CGC CCC library pool, which was then diluted to a concentration of 4 nM ac- GCG CCC GTC CCG CCG CCC CCG CCC GGT GBC AGC MGC CGC GGT cording to the Illumina Sample Preparation Guide. Library denaturation AA − 3′)[23] and Com1GC [24](5′-CGC CCG CCG CGC GCG GCG GGC and sample loading were performed according to the Illumina Sample

185 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Table 1 Primers used in this study (A) and specific PCR conditions (B).

A

Primer Position 5′-3′ Specificity Reference

Bact 907R 907–926 CCGTCAATTCMTTTGAGTTT Bacterial 16S rRNA [25] Univ515F 515–533 GTGBCAGCMGCCGCGGTAA Universal 16S rRNA [23] Com1 519–536 CAGCAGCCGCGGTAATAC Universal 16S rRNA [47] Arch915R 934–915 GTGCTCCCCCGCCAATTCCT Archaeal 16S rRNA [48] 63F 63–83 CAGGCCTAACACATGCAAGTC Bacterial 16S rRNA [49] 1387R 1404–1387 GGGCGGWGTGTACAAGGC Bacterial 16S rRNA [49] Arch338F 338–359 GGCCCTAYGGGGYGCASCAGGC Archaeal 16S rRNA [23] Arch1381R 1381–1402 GCGGTGTGTGCAAGGRGCAGGG Archaeal 16S rRNA [23] Arch344F 344–363 ACGGGGYGCAGCAGGCGCGA Archaeal 16S rRNA [24]

B

Primer set Annealing temperature, °C (Taq/Phusion polymerases) Elongation time, s (Taq/Phusion polymerases)

Univ515F–Bact907R 55/n.u.a 30/n.u. Univ515F–Arch915R 65/n.u 30/n.u. Com1–Bact907R 50/60 30/30 63F–1387R 56/65 60/30 Arch338F–Arch1381R 62/72 45/30 Arch344F–Arch915R 60/70 40/30 Univ518F-GC–Bact907R 55/n.u. 30/n.u. Com1GC–Bact907R 50/60 30/30 Univ515F-GC–Arch915R 55/n.u. 30/n.u. Arch344F–Arch915R 60/70 40/30

a n.u. − not used.

Preparation Guide using a MiSeq Reagent Kit v3 (600 cycles) (Illu- short bacilli and coccobacilli with round ends, single or clumped (Fig. mina). The sequencing of the library was performed with the Illumina S1). The corineforms, club-shaped rods and cocci, single or in short MiSeq platform. The data analysis was performed with QIIME (version chains, were also observed. Both microbial communities (Σ4 and Σ7) 1.9.1) and SILVA online data analysis service for the ribosomal data- contained a large number of the spores and spore-forming rods, in- base SILVA. cluding club-shaped cells, initiating spore-formation. These results speak well for the presence of Clostridium-like bacteria, which are 2.7. Nucleotide sequence accession numbers usually widespread in the anaerobic environment as the leading de- composers and hydrolytics. As expected, the minimal diversity of the All sequences have been deposited in the NCBI databases. The se- cell types and shapes was observed on the newsprint and magazine quences of the isolated DGGE bands of partial 16S rRNA gene were paper (Fig. S1C, E). The largest cell amount and variety were noticed on deposited in GenBank under accession numbers KY780546 − the corrugated carton and the waste paper mixture (Fig. S1 B, D), where KY780575; Illumina metagenomic dataset was deposited in the NCBI the numerous cells embedded in the extracellular matrix were attached fi Sequence Read Archive (SRA) database. to the substrate bers and particles that enable the better hydrolysis in the proximity of the decomposed substrates. The SEM-based analysis confirmed the results of the light micro- 3. Results scopy (Fig. 1); barely degraded magazine and newsprint paper (MP, NP) were significantly less populated after 3 days of incubation; the mi- 3.1. The biogas production and the microscopic analysis of the anaerobic crobial spores were almost the only detected cells in the MP sample, microbial communities even after 10 days of cultivation. On the contrary, the most intensive formation of the microbial populations and biofilms were noticed on The biogas formation by the combined Σ4 and Σ7 microbial con- the easily degradable substrates, such as office paper (OP) and corru- sortia differed, depending on the type of waste paper (Table 2). The gated cardboard (CC), as well as on the paper mixture. The active co- maximum methane production was observed in the MCs cultivated on lonization of the substrate surface was observed already after 3 days of the office paper, and comprised 62–63% within 20 days of the in- the cultivation, and among the dominant morphotypes, there were long cubation. The most effective bioconversion with 228.9 ml of CH per g 4 rods with flat ends, short thick rods, and long filamentous rods. The of the substrate was noticed for the Σ4 MC; the total volume of pro- round coccolite like circles, observed in the samples, are originated duced biogas was also the highest (201 ml). The newspaper and ma- from coccolithophores species, which are the group of chalk forming gazine paper alone appeared to be the worst substrates for the bio- plankton; the chalk was added to the medium for the pH stabilization. conversion with only 26.2% and 39.2% of cumulative CH4 content, and 58.1 ml and 59.1 ml of produced biogas, respectively (Σ4 MC). On the contrary, the mixture of all the tested papers promoted their total 3.2. The composition of the dominant populations of bacteria and archaea bioconversion by both communities, returning the methane yield to the analyzed by DGGE level of up to 184.6 and 104.2 ml CH4/g, and the volume of 188.3 ml and 175.7 ml of produced biogas by Σ4 and Σ7 MCs, respectively. For the determination of the dominant bacterial populations and for In order to show the differences in the composition of the microbial the analysis of the differences in the structure of the microbial com- populations, we used the light and scanning electron microscopy. When munities, we performed DGGE analysis, where the first one was made the samples were studied under the light microscope (Fig. S1), the with two-step PCR using the specific bacterial primers, Bact907R and variety of the morphotypes was noticed with domination of long and Univ515F, and Bact907R and Univ518F-GC, respectively (Fig. 2A).

186 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Table 2 The maximal methane yield produced by thermophilic Σ4 and Σ7 microbial consortia, cultivated on the different paper wastes.

Substrate MC # Cumulative methane content, % in biogasa Methane yield The total volume of biogas (ml)

ml/g substrateb mmol/l biogas

office paper Σ4 62.5 ± 3.7c 228.9 ± 16.0 149.6 ± 16.1 201.1 ± 5.2 Σ7 63.4 ± 2.8 154.3 ± 7.8 104.8 ± 3.1 135.2 ± 8.7 corrugated cardboard Σ4 57.9 ± 3.0 107.2 ± 4.2 71.8 ± 2.5 233.0 ± 10.8 Σ7 49.5 ± 4.7 96.2 ± 3.2 63.0 ± 1.9 110.47 ± 3.7 newsprint Σ4 26.2 ± 4.6 48.5 ± 1.9 32.5 ± 0.5 58.1 ± 1.2 Σ7 40.4 ± 2.2 74.9 ± 5.7 47.3 ± 0.9 90.3 ± 2.9 paper mixture Σ4 52.7 ± 1.8 184.6 ± 3.9 123.1 ± 1.2 188.3 ± 3.4 Σ7 56.4 ± 3.4 104.2 ± 7.1 69.8 ± 2.4 175,7 ± 5.2 magazine paper Σ4 39.2 ± 2.2 70.9 ± 3.6 48.6 ± 0.4 59.1 ± 1.5 Σ7 46.0 ± 3.6 85.6 ± 6.8 59.8 ± 0.8 64.7 ± 5.1 a the methane content is a cumulative СH4 percentage amount in produced biogas per 20 days of cultivation; gas concentrations and % were determined under standard temperature and pressure (STP), as previously described [19], as А =(ΣVgas/ΣVmixture) × 100, where ΣVgas is a total volume of individual gases (CH4,CO2,H2), and ΣVmixture is a total volume of biogas.

Vgas was determined as Vgas =(PVvialTstandarda)/(PstandardT × 100), where a is the gas concentration, measured by chromatography (%), P is the pressure in the vial (bar), Pstandard and

Tstandard are the standard pressure and temperature. Vvial is the gas volume within the vial. ν = Vgas/22.4, according to the Avogadro’s law that 1 mol of a gas occupies at STP 22.4 l volume. b the methane yield is a total volume of produced CH4 formed during the cultivation period, adjusted to P = 101 325 Pa (1 atm) and T = 273.15 K (STP). The methane yield was expressed as ml of produced CH4 per g of substrate (constant weight; oven-dried at 105 °C), or as mmol of produced СH4 per volume (l) of produced biogas. cthe experiments were repeated three times. The values are the mean of three replicates ± standard error.

Although we could detect quite a few bands on the gel, when they were elevated temperatures, secreting tens of glycoside hydrolases belonging excised and sequenced, in total, only 10 good-quality sequences were to 15 different families [28]. produced (Table 3). The “bacterial” DGGE profile confirmed the results By using the specific primer pair (Com1-GC and Bact907R), PHF of the microscopy analysis, and revealed the minimal presence of mi- polymerase and the one-step PCR, we performed the third DGGE ana- croorganisms on the newspaper and magazine paper substrates, lysis, where we got only five but clear bands (Fig. 2C). The usage of PHF whereas the largest variety was detected on the office paper and paper polymerase allowed us to get the sequences with 98–99% of similarity mixture. In comparison between the two communities (Σ4 and Σ7) with the closest relative (Table 2). Such approach provides more reli- cultivated on the paper mixture, the number of distinguishable bands able results than the nested PCR, since it helps to avoid the amplifica- was less variable and less clear in the Σ7 community. The most varied tion of the non-specific bands. The results of the DGGE analysis con- bacterial diversity was observed on the office paper (OP) that is con- firmed the largest bacterial diversity in the Σ4 MC cultivated on the sidered as one of the easiest biodegradable cellulose-containing sub- paper mixture. The dominant bands in the OP and MP samples (303), strates, but also on the paper mixture, containing all the tested waste together with another one (305), belonged to the genus Clostridium, papers, such as OP, CC, NP, and MP. The dominant phylum within the while the band identified as Acetivibrio cellulolyticus (302) was twice less identified Bacteria was Firmicutes with the five species of Acetivibrio, thick than that in the Σ4 community cultivated on the corrugated Thermoanaerobacteraceae, Defluviitalea, Tepidanaerobacter, and Herbinex; cardboard and magazine paper. As in the previous DGGE analysis and the other belonged to Thermotogae and Bacteroidetes phyla. One of (Fig. 2B), C. cellulosi (303) has been detected only in the Σ4 MC on the the thick bands corresponded to Herbinix hemicellulosilytica (band 105), OP and paper mixture, clearly demonstrating its importance for the and was only clearly detected in the MC cultivated on corrugated cellulose-degrading step. The NP community was still the poorest with cardboard; it was less visualized on the paper mixture, and it was ab- the only clearly seen band identified as Thermoanaerobacterium ther- sent in the MCs cultivated on the OP, MP, and NP. Petrimonas sp. (band mosaccharolyticum. On the office paper, T. thermosaccharolyticum and 103) was also scarcely seen on the OP, and vice versa, pronounced on Clostridium cellulosi bands were the most intensive, whereas those for A. the paper mixture substrate. Acetivibrio cellulolyticus was revealed in all cellulolyticus were hardly detected. Unlike the DGGE fingerprinting the tested substrates, whereas Defluviitoga tunisiensis was not detected obtained with the nested PCR, no bands for Tepidanaerobacter sp. were on MP, and it was hardly detected on the CC. Nevertheless, since we did noticed. Thus, by performing the first DGGE profiling, we could dis- not identify among the sequenced bands the representatives of the tinguish the presence of the Bacteroidetes, Thermotogae, and Firmicutes as genus Clostridium, most likely due to poor quality of the sequences of the dominant phyla; the bacterial sequences of two other DGGEs were some of the excised bands, we tested another approach for the DGGE only clustered to Firmicutes. The use of PHF polymerase seems to pro- profiling, such as nested PCR, where the first fragment was amplified vide a more accurate DNA sequence during the amplification, and one- with the primer pair 63F-1387R, followed by Сom1GC-Bact907R am- step PCR with the GC-clamped specific bacterial primers (Com1-GC and plification. In total, we got seven sequenced bands (Fig. 2B, Table 3), Bact907R) avoid the non-specific amplification. On the other hand, where the dominant species were identified as closest to the Thermo- these approaches may not catch the entire microbial diversity of the anaerobacterium thermosaccharolyticum, Acetivibrio cellulolyticus and Te- microbial consortium. Thus, we assume that both techniques should be pidanaerobacter sp. In contrast to the first DGGE profile (Fig. 2A), the used to get a complete picture of bacterial diversity when the DGGE second DGGE analysis resulted in lower microbial diversity (according analysis is applied. to the number of the bands). Although the band patterns showed good The sequences of Archaea obtained with the primer set Univ515F- resolution, the sequences of the fragments that migrated to the same Arch915R and Univ518F-GC-Arch915R were mainly assigned to genera position were identical, and the percentage of the similarity was up to Methanoculleus, Methanothermobacter, and Methanosarcina (Table. 3;

99%; this approach also revealed the appearance of the non-specific Fig. 2D), the most active players in CH4 formation at elevated tem- bands (such as 204 and 206, belonging to Acetivibrio cellulolyticus). In- peratures. Although nested PCR did not reveal any of Methanoculleus terestingly, among the tested substrates, only in OP and MP samples we strains, we confirmed the presence of Methanosarcina thermophila (with could identify Clostridium cellulosi (band 203). The absence of this hy- 99% match to Methanosarcina thermophila CHTI-55, complete genome). drolytic bacterium within the microbial communities, cultivated on the The other two bands were identified as Methanothermobacter thermau- other substrates, could dramatically reduce their total cellulolytic ac- totrophicus with 99% and 96%, respectively, showing the non-specific tivity. C. cellulosi is a known active hydrolytic of lignocellulose at amplification. All of the identified Archaea belonged to the phylum

187 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Fig. 1. Scanning electron micrographs of the thermophilic anaerobic microbial communities (Σ4 and Σ7), cultivated for 3 and 10 days on different waste papers: office paper (OP), corrugated cardboard (CC), magazine paper (MP), paper mixture, and newspaper (NP).

Euryarchaeota and were assigned to Methanobacteriales with the hy- 3.3. Microbial community analysis by high-throughput sequencing of 16S drogenotrophic methanogens Methanoculleus thermophilus and Metha- rRNA gene fragments nothermobacter thermautotrophicus, and Methanomicrobiales with hydro- genotrophic/acetoclastic Methanosarcina thermophila specie. In addition to the DGGE, MC Σ4 cultivated on the office paper was also taken for analysis on the Illumina MiSeq system. After the sequence

188 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Fig. 2. DGGE profile of Bacteira (A-C) and Archaea (D, E) obtained with Bact907R − Univ515F (A); with the nested PCR (B) (first primer pair is 63F − 1387R, and the second primer pair is Сom1-GC − Bact907); with the one-step PCR (C) by using the primer pair Сom1-GC − Bact907R. The archael profiles were obtained by using the primer set Univ518F − Arch915R followed by Univ515F-GC − Arch915R (D), and the primer pairs Arch338F − Arch1381R and Arch344F-GC − Arch915R (E). The primers and the PCR conditions are described in Materials and Methods (2.3–2.5). The cultivation of the microbial communities (Σ4 and Σ7) is described in Materials and Methods (2.1). The waste papers tested as cellulose-containing substrates were: OP − office paper, CC − corrugated cardboard, MP − magazine paper, mixt − paper mixture, and NP − newspaper; 101-111; 201–207; 301–305; 401–408 − band identifier (relevant 16S rRNA sequences are detailed in Table 2).

quality filtering, we received ∼ 24 960 sequences for the tested sample, 97%. Firmicutes appeared to be the principle phylum with the class using operational taxonomic units (OTUs), which were created using a Clostridia accounting for 97% of Firmicutes, 85% of Bacteria, and 83% of 0.98 similarity threshold that enabled the identification of all the major all the sequences. Bacteria of the genus Ruminiclostridium (Clostridiales) groups. The Archaea/Bacteria ratio constituted 2/98 with the total dominates in the sample with more than 66% sequences, indicating number of OTUs; the OTUs (318) were clustered on taxonomic ranks their primary role in bacterial hydrolytic community. The next most from phylum to genus level. The microbial diversity based on the frequent bacteria in MC were identified as the representatives of Ha- phylogenetically closest matched microorganisms is listed in Table 3 loplasma (9%) belonging to Tenericutes phylum, a unique class of bac- and Fig. 3. The vast majority of taxa was assigned to the bacterial do- teria that lack a cell wall (Table 5). Several other representatives of main with ∼ 98%, while Archaea had a share of ∼2% according to the Clostridiales contributed up to 6% for Mobilitalea, up to 3% (each group) SILVA database. OTUs were matched to the closest related known se- for Tepidimicrobium, Tepidanaerobacter, and Anaerobaculum, and up to quences deposited in the database at a similarity index of more than 2% for Defluviitalea (Table 4, Fig. 3). There was another group of as-yet-

189 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Table 3 The structure of the bacterial and archaeal components of the cellulolytic thermophilic microbial communities, profiled with DGGE and followed with16S rDNA sequences.

PCR primers Band ID − GenBank Closest relative according to the NCBI database Identity, % Phylum acc.no (NCBI)

Two-step PCR: First step: Univ515F and Bact907R; Second 101 − KY780546 Defluviitoga tunisiensis strain AS22 16S (KT274708.1) 95 Thermotogae step: Univ518F-GC and Bact907R 102 − KY780547 Uncultured bacterium clone ATB_CK_926_89 90 NI (KP151051.1) 103 − KY780548 Uncultured Petrimonas sp. clone B50-1 16S (KC555215.1) 95 Bacteroidetes 104 − KY780549 Uncultured Thermotogae bacterium (CU924187.1) 88 Thermotogae 105 − KY780550 Herbinix hemicellulosilytica strain T3/55T (LN626355.1) 93 Firmicutes 106 − KY780551 Uncultured bacterium clone ATB_CK_926_77 97 NIa (KP151039.1) 107 − KY780552 Tepidanaerobacter sp. AS46 (KT274715.1) 96 Firmicutes 108 − KY780553 Defluviitalea sp. GRX3 (LN881573.1) 92 Firmicutes 109 − KY780554 Acetivibrio cellulolyticus strain HL-2 (KM036187.1) 93 Firmicutes 110 − KY780555 Uncultured Thermoanaerobacteraceae bacterium 91 Firmicutes (KJ626484.1)

Two-step nested PCR: First step: 63F-1387R; Second step: 201 − KY780556 Thermoanaerobacterium thermosaccharolyticum strain DSM 99 Firmicutes Com1-GC and Bact907R 571 (NR_074419.1) 202 − KY780557 Acetivibrio cellulolyticus strain HL-2 (KM036187.1) 98 Firmicutes 203 − KY780558 [Clostridium] cellulosi, isolate DG5 (LN881577.1) 98 Firmicutes 204 − KY780559 Acetivibrio cellulolyticus strain HL-2 (KM036187.1) 96 Firmicutes 205 − KY780560 Uncultured bacterium clone OTU_51 (KP859675.1) 97 Firmicutes 206 − KY780561 Acetivibrio cellulolyticus strain HL-2 (KM036187.1) 96 Firmicutes 207 − KY780562 Tepidanaerobacter sp. AS46 (KT274715.1) 99 Firmicutes

One-step PCR: Com1-GC and Bact907R 301 − KY780563 Thermoanaerobacterium thermosaccharolyticum strain 99 Firmicutes Gluc4 (KT274717.1) 302 − KY780564 Acetivibrio cellulolyticus strain HL-2 (KM036187.1) 96 Firmicutes 303 − KY780565 [Clostridium] cellulosi, isolate DG5 (LN881577.1) 99 Firmicutes 304 − KY780566 Uncultured Clostridiales bacterium (LN851753.1) 90 Firmicutes 305 − KY780567 Clostridium sp. 6–16 (FJ808609) 98 Firmicutes

Two-step PCR: First step: Univ515F −Arch915R; Second 401 − KY780568 Methanoculleus thermophilus strain V2.8 (KT368947.1) 99 Methanomicrobia step: Univ518F-GC − Arch915R 402 − KY780570 Uncultured Methanothermobacter sp. (KU293537) 99 Methanomicrobia 403 − KY780571 Methanothermobacter wolfeii strain JZYS 16S 99 Methanomicrobia (EF118905.1) 404 − KY780572 Methanosarcina thermophila CHTI-55 (CP009502.1) 99 Methanomicrobia

Two-step nested PCR: First step: Arch338F- Arch1381R; 406 − KY780573 Uncultured Methanothermobacter sp. clone H20 99 Methanobacteria Second step: Arch344F-GC −Arch915R (HQ271192.1) 407 − KY780574 Uncultured Methanothermobacter sp. clone H11 96 Methanomicrobia (KY077238.1) 408 − KY780575 Methanosarcina thermophila CHTI-55 (CP009502.1) 99 Methanomicrobia

a NI − not identified.

Fig. 3. The relative abundance of the taxonomic groups of prokar- yotes (Bacteria and Archaea) in the Σ4 microbial community cultivated on the waste office paper.

190 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Table 4 The number of the taxonomic groups (percentage) based on 16S rRNA gene sequences composing the Σ4 microbial community.

Kingdom; Phylum; Class; Order; Family; Genus; Species % in total community

Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 66 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae;Ruminiclostridium 1 0.6 Bacteria;Firmicutes;Clostridia; Clostridiales; D8A-2 uncultured bacterium 0.5 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae;Cellulosibacter 0.4 Bacteria;Firmicutes;Clostridia;Clostridiales; Eubacteriaceae; Garciella 0.2 Bacteria;Firmicutes;Clostridia;Clostridiales; Proteiniborus 0.1 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae; Clostridium sensu stricto 0.1 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae; Clostridium sensu stricto 7 0.1 Bacteria;Firmicutes;Clostridia;Clostridiales; Peptococcaceae; uncultured 0.1 Bacteria;Firmicutes;Clostridia;Clostridiales;Ruminococcaceae, uncultured 0.07 Bacteria;Firmicutes;Clostridia;Clostridiales;Lachnospiraceae;Mobilitalea 6 Bacteria;Firmicutes;Clostridia;Clostridiales;Family XI;Tepidimicrobium 3 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Family III;Tepidanaerobacter 3 Bacteria;Firmicutes;Clostridia;Thermoanaerobacterales;Family III;Thermoanaerobacterium 0.2 Bacteria;Firmicutes;OPB54 3 Bacteria;Tenericutes;Mollicutes;Haloplasmatales;Haloplasmataceae;Haloplasma 9 Bacteria;Tenericutes;Mollicutes;Haloplasmatales;Haloplasmataceae; NB1-n 0.2 Bacteria;Synergistetes;Synergistia;Synergistales;Synergistaceae;Anaerobaculum 3 Bacteria;Firmicutes;Clostridia;Clostridiales;Defluviitaleaceae;Defluviitalea 2 Bacteria;Proteobacteria;Gammaproteobacteria 0.07 Archaea;Euryarchaeota;Methanobacteria;Methanobacteriales;Methanobacteriaceae; Methanothermobacter 2 Archaea;Euryarchaeota;Methanomicrobia;Methanosarcinales;Methanosarcinaceae; Methanosarcina 0.08 unidentified taxon at the order- or class- level (OPB54) within the newspaper and magazine paper, together with more easily hydrolyzed phylum Firmicutes, OPB54, which was first detected in a Yellowstone office paper and corrugated cardboard. As it is known, the content of Park hot spring [29]. The methanogenic part of the community is cellulose, hemicelluloses, and lignin in the different type of papers is mainly represented by Methanothermobacter, with 98% of sequences varied: while the office paper consists of up to 99–100% of cellulose, Archaea, and Methanosarcina with only 2%, respectively; both species the newspaper may consist of only 40–58% of cellulose with 17–26% of belong to Euryarchaeota phylum. The characterization of the metabolic hemicellulose, and a relatively high lignin content of 11–20% [11,30]. activity of the defined members of the biogas-producing Σ4 community The lignin presence makes the treated substrate recalcitrant to the ef- is summarized in Table 5. According to the published sources, the fective microbial hydrolysis by blocking the access of cellulases to taxonomic profile of the tested microbial community, which was cellulose, particularly due to irreversible binding of the hydrolitic en- identified based on the results of the DGGE and HTS analysis, was zymes [4,11]. compared to the correlated metabolic functions of the known isolated However, the negative effect on the microbial growth may also be cultures. The composition of the biogas-producing community is mainly caused due to the biocides using in the paper-making process or most represented by hydrolytics, which play the primary role in decom- likely due to a variety of chemicals used either in paper production or in posing the complex cellulose substrates and their fermentation. The the printing process, including synthetic additives (chelating agents, majority of the identified microorganisms belong to Clostridia of Fir- driers, surfactants, defoamers, etc.), glues, inks and dyes [31]. The soot micutes phylum, including Ruminiclostridium, Acetivibrio, Herbinix (black carbon) and carbon blacks are used commercially in rubber and hemicellulosilytica, [Clostridium] cellulosi, Clostridium sensu stricto, and in printing and painting industries as black inks. Carbon nanoparticles Cellulosibacter. Syntrophic microorganisms that usually convert the isolated from kitchen soot were found to be effective against bacterial monomers such as alcohol, propionate, other short-chain fatty acids, strains of Proteus refrigere, Pseudomonas aeruginosa, Staphylococcus some amino acids, and aromatic compounds to acetate, carbon dioxide, aureus, and Streptococcus haemolyticus [32]. The recent study of Hussey and hydrogen, are represented in the community by Peptococcaceae, and co-authors [33] on black carbon (as a major component of air Tepidimicrobium, Tepidanaerobacter, Defluviitalea, Anaerobaculum, De- pollution), showed that it altered surface colonization of Streptococcus fluviitoga, and presumably, Petrimonas. The presence of numerous and pneumoniae and S. aureus, particularly by changing the structure and diverse producers of hydrogen, as the end-product, forces the microbial functions in biofilm formation. The SEM results of this study could also community to select its active consumers, which are represented by the be considered as evidence for an inhibitory effect of the chemicals, hydrogenotrophic methanogenes with the dominating species of Me- since the microbial cells showed significantly low adhesion to the NP thanothermobacter and Methanoculleus. and MP with non-colonized areas and a big number of spores (inactive microbial cells). Nevertheless, the negative effect of these factors (ei- 4. Discussion ther the lignin content or the impact of the chemicals) was smoothened, when the waste papers were taken as a mixture, where all the tested In our previous studies, we showed the effectiveness of using was- papers (OP, CC, MP, and NP) were taken in a less amount (3,75 g in- tepaper in the thermophilic biogas production [20–22]. The selected stead of 15 g). Hence, the possible inhibitory influence was lower, thus microbial communities were able to produce a methane content of allowing the microbial community to develop. around 55–60%, when they were cultivated on filter paper [21,22]. We consider the primary role of the composition of the microbial Composed of the four most active communities, the total Σ4 microbial communities in the efficiency of the substrate bioconversion. MC Σ4 Σ ff consortium produced 52.3% of the cumulative CH4 from the waste and 7di ered in their methane production (Table 2) from the MP and paper mixture, which was preliminarily treated with Trichoderma viride NP, however, the general tendency was similar for both of them, either [20]. Here, we confirmed the stable activity of the composed MCs and regarding the reduction of the microbial growth and the capacity to the bioconversion of the office paper into biogas with more than 60% of degrade MP and NP substrates, or vice versa, the retention of the biogas the cumulative methane content (Table 2). We also showed that the producing activity, when the waste paper mixture was used. bioconversion of the wastepaper mixture into biogas could be an ef- In order to elucidate the structure of the tested biogas-producing fective strategy for the simultaneous utilization of the barely degraded community, we analyzed it by different approaches of the light and

191 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

Table 5 The metabolic activity of the archaeal and bacterial components of the biogas-producing Σ4 microbial community, cultivated on the office paper.

Assumed taxonomic affiliation Type of the Metabolic function analysis

Archaea Euryarchaeota Methanobacteria Methanothermobacter HTS, DGGE Hydrogenotrophic methanogenesis Methanomicrobia Methanosarcina HTS, DGGE Aceticlastic ⁄Hydrogenotrophic methanogenesis Methanoculleus DGGE Hydrogenotrophic methanogenesis Bacteria Firmicutes Clostridia Ruminiclostridium HTS Cellulose, cellobiose, and lignocellulose saccharification by R. thermocellum [50]. Acetivibrio DGGE A. cellulolyticus grows on cellulose and cellobiose producing acetic

acid, H2,CO2 and traces of propanol and butanol [38]. [Clostridium] cellulosi DGGE Cellulolytic, growth on cellulose and cellobiose; fermentation of gluose, xylose, fructose and a broad range of carbon sources. The

major end products are H2,CO2, ethanol, and acetic acid [51]. Cellulosibacter HTS Cellulolytic-xylanolytic activity by C. alkalithermophilus [52]. Garciella HTS Cellobiose and carbohydrates degradation by G. nitratireducens [53]

with production of lactate, acetate, butyrate, H2 and CO2. Proteiniborus HTS Acetic, propionic and butiric acid formtion from amino acids by P. ethanoligenes [54]. Clostridium sensu stricto (rRNA cluster I) HTS Cellulolytic Clostridium sensu stricto 7 HTS Cellulolytic Herbinix hemicellulosilytica DGGE Produce acetate, ethanol, and propionic acid as major end products from cellulose metabolism, including cellulose, cellobiose, glucose [37]. Tepidimicrobium HTS Organotrophical growth on a number of proteinaceous substrates. Carbohydrates may (T. xylanilyticum) or may not (T. ferriphilum)be used [55,56]. Acetogenesis. Tepidanaerobacter HTS, DGGE Syntrophic alcohol, butyrate, lactate degradation by T. syntrophicus JLT [57,58], and acetate oxydation by T. acetatoxydans Re1 [59]. Thermoanaerobacterium HTS DGGE Hydrolisis of cellobiose or xylose with lower ethanol and higher lactate as the end-products by T. thermohydrosulfuricus WC1 [60]. Hydrogen production from the carbohydrates by T. thermosaccharolyticum KKU-ED1 [61], and acetic, butyric and lactic acid production [54]. Defluviitalea HTS, DGGE Acetogenesis from lactate, succinate, or am mixture of amino acids by D. tunisiensis [18]. Ethanol production from mannitol, glucose, and alginate by D. phaphyphila Alg1 [62]. D. saccharophila use cellobiose, glucose, mannose, maltose, mannitol, sucrose and xylose as electron donors The main fermentation products from glucose metabolism were acetate, formate, butyrate and isobutyrate [63].

Peptococcaceae, uncultured HTS Nonfermentative growth style; CO2 assimilation by uncultured Peptococcaceae [64]. Syntrophic interactions [65]. Tenericutes Mollicutes Haloplasma HTS Strictly organotrophic halophilic strain of the H. contractile isolated from the deep-sea anoxic brine lake [66]. Synergistetes Synergistia Anaerobaculum HTS Fermentation of the organic acids and a limited number of

carbohydrates to acetate, H2 and CO2 by A. thermoterrenum [67]. Thermotogae Thermotogae Defluviitoga DGGE D. tunisiensis utilize a large variety of complex carbohydrates, such as

cellobiose, xylan and xylose with ethanol, acetate, H2, and CO2 as end-products [18,54].

Bacteroidetes Bacteroidia Petrimonas DGGE Fermentative acidogenic bacteria producing acetate, H2 and CO2 during glucose fermentation [68].

scanning electron microscopy, as well as by the molecular culture-in- and Archaea, performing different trophic needs and metabolic path- dependent techniques, such as DGGE and HTS. In this study, the mi- ways for the effective biotransformation of the complex substrates to croscopy was performed in the beginning of the selective process, when biogas. In this study, the prevalence of the two functional groups, such the microbial communities were cultivated on the various sources of as hydrolytic cellulolytic and acetogenic bacteria that belong mainly to waste paper. The visual differences in the microbial diversity between Firmicutes phylum, was confirmed both by DGGE and HTS analysis. the tested substrates confirmed the abundance of the microorganisms, However, apart from the widely known representatives of when the communities were cultivated on the office paper, corrugated Ruminiclostridium, Acetivibrio, Herbinix, Defluviitalea or Cellulosibacter, cardboard, and the paper mixture, revealing also their high coloniza- the up-to-now insufficiently characterized species were also detected, tion capacity (Fig. S1, Fig. 1). Since the lignocellulose decomposition is such as Proteiniborus or Haloplasma. The recent metagenome and me- the rate-limiting step in the biotransformation of the organic wastes tatranscriptome analysis of the thermophilic biogas plant, loaded with into biogas, the solubilisation rate is strongly affected by the capacity of the substrate mixture of maize silage, barley, cattle and pig manure, has the hydrolytics to colonize the substrate surface [34]. Most anaerobic also revealed the same tendency [18]; the representatives of De- cellulolytic bacteria grow optimally on cellulose only when they are fluviitoga, Halocella, Clostridium sensu stricto, Clostridium cluster III, and attached to it; for a few species such an adhesion it appears to be ob- Tepidimicrobium were the dominant ones, but only 18–25% of 16S rRNA ligate [4]. gene or gene-transcript sequences were classified at genus level, in- An active methanogenic community consists of a number of Bacteria dicating the presence of currently unknown microorganisms [18].

192 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

We revealed the prevalence of the hydrolitic species in the microbial was affiliated to the genus Mobilitalea (Lachnospiraceae). Mobilitalea si- community cultivated on the office paper and the mixture of papers, birica is absent in the LSU database, and only present in SSU dataset thus confirming the pivotal role of the cellulolytic Bacteria, mainly af- under a self-titled genus name Mobilitalea (Lachnospiraceae). Thus, such filiated to Clostridium. These microorganisms are known to produce a discrepancies within the known databases make the proper strain variety of the enzymes to degrade cellulose, which form a multi-enzyme identification and determination of the microbial composition through complex, cellulosomes, rigidly anchored on the bacterial cell wall (re- metagenomic analysis quite sophisticated, particularly when the re- viewed in [1,[4],35]). Hyperthermophiles of the genus Thermotoga, the classification of the previously described species is an ongoing process. representatives of which were identified in this study, are known to In the microbial community, the products of the lignocellulolose produce highly thermostable cellulases [4]. In addition to cellulases, hydrolysis, such as soluble sugars, alcohol and organic acids, mainly (endoglucanases and exoglucanases), this multifunctional complexes of short chain volatile fatty acids, are further metabolized into acetic acid, Clostridium (Ruminiclostridium) thermocellum may contain mannanases, molecular hydrogen, and carbon dioxide. The syntrophic microorgan- xylanases, chitinases, and lichenases [35]. Although, the recent genome isms are also capable of acetate oxidation into these gaseous products, sequence showed that in contrast to R. thermocellum BC1 another spe- although only in the case of low H2 partial pressure. Since the free cies, capable to grow on cellulose and cellodextrins, R. cellulosi DG5, hydrogen should be constantly removed, the most efficient hydrogen does not contain genes encoding cellulosome components [36]. utilization and bioconversion in the biogas community happens during The strain of H. hemicellulosilytica T3/55T that was recently de- the hydrogenotrophic methanogenesis. According to the HTS analysis, scribed, harbouring a cellulolytic system that consists of one en- the majority of the methanogens in the tested community are re- doglucanase and two cellobiohydrolases [18,37], showed the best presented by the hydrogenotrophic strains of Methanothermobacter match to the band 105, identified during the first DGGE analysis (96%) and only 4% contributes to Methanosarcina, which is capable of (Fig. 2A) in the Σ4 MC, cultivated on the corrugated carton and the using both acetoclastic and hydrogenotrophic pathways for the me- paper mixture, although not on the OP. Another of the brightest and thane production. Although the microorganisms, similar by their mor- thickest bands, which was detected in all the tested DGGE profiles and phology to the filament-like cells of Methanosaeta, were detected by the MCs, corresponded, according to the NCBI database, to Acetivibrio cel- light microscopy (Fig. S1), no traces of this acetotrophic methanogen lulolyticus strain HL-2 (Table 3). However, A. cellulolyticus is a meso- were identified by DGGE or HTS analysis. Interestingly, but only one of philic microorganism with an optimum growth temperature between the DGGE profiles of the archaeal community corresponded to the HTS 35 and 37 °C [38], and scarcely could be one of the dominant popula- results; the presence of Methanothermobacter and Methanosarcina strains tions within the thermophilic microbial community. When this HL-2 were detected when the primer pairs of Arch338F-Arch1381R followed strain (accession number KM036187) was checked by the ribosomal by Arch344F-GC-Arch915R were used, whereas the usage of Univ515F SILVA database, it was classified exactly to the family Ruminococcaceae, −Arch915R primers revealed an additional representative (according within a genus Ruminiclostridium that was the most frequent in the Σ4 to the NCBI database) of Methanoculleus thermophilus that also performs MC, according to the HTS (ribosomal database SILVA) analysis. The a hydrogenotrophic type of methanogenesis. The selection of the hy- comparative analysis between these two databases, as well as the drogenotrophic methanogens over aceticlastic methanogens under the physiological characteristics of A. cellulolyticus (optimum growth tem- extreme-thermophilic (70 °C) conditions was also shown by F.Zhang perature), and the fact that the genus Ruminiclostridium was recently and colleagues [41] with the presence of mainly Methanothermobacter [39] proposed for all Clostridium cluster III members, including C. thermautotrophicus and Methanobacterium thermoaggregans as 98% of thermocellum and C. cellulolyticum, gives us confidence to say that the Archaea. identified during the DGGE analysis A. cellulolyticus strain (KM036187) Although the acetate-oxidizing reactions are energetically un- is more likely assigned to the Ruminiclostridium genus. favourable in comparison to the acetoclastic way of the acetate de- The other dominant microbial groups [according to the DGGE per- gradation [42], they were shown to be efficient during the waste-paper formed with two different pair of primers (Bact907R-Univ515F; bioconversion into biomethane, due to the strong relations between the Univ518F-GC − Bact907R and 63F-1387R; Com1GC − Bact907R, re- syntrophic acetate-oxydizing bacteria (SAOB) and methanogenic Ar- spectively] were Thermoanaerobacterium and Tepidanaerobacter that chaea. SAOB are known to use H2/CO2 to produce acetate, as well as were also detected during the HTS, although with only 3% and 0.2% of vice versa, to utilize acetate reversibly [42]. Other authors [43] also presence, respectively (Table 4). In comparison to the results of the reported that in the thermophilic (50–55 °C) anaerobic plug-flow re- HTS, the DGGE profiling with Bact907R-Univ515F and Univ518F-GC − actor, treating municipal waste under saline conditions, Clostridia Bact907R primers revealed several microorganisms close to Defluviitoga (> 92%) were still dominating among bacteria, and Methanoculleus tunisiensis strain AS22, uncultured Petrimonas sp., uncultured Thermo- (> 90%) prevailed among Archaea. The prevalence of Methanoculleus togae, and Herbinix hemicellulosilytica T3/55T, none of which were over the other hydrogenotrophic methanogens, including Metha- identified during the HTS analysis according to the SILVA database (to nothermobacter thermautotrophicus that was also identified in some the moment of writing). Nevertheless, the presence of Herbinix (Lach- samples, could be related to its tolerance to the high salt concentra- nospiraceae) seems to be more plausible in comparison to the related tions. Nevertheless, the absence of the known acetoclastic methanogens species of the same family, Mobilitalea, that was identified by the HTS of Methanosarcina and Methanosaeta supported the idea that syntrophic analysis, and representing one of the largest bacterial groups with up to acetate-oxidizing pathway was the only way for methanogenesis [43]. 6% of abundance (Table 4, Fig. 3). Mobilitalea sibirica was recently Among the known associations of the SAOB with hydrogenotrophic described by O.A. Podosokorskaya and colleagues [40] as a mesophilic methanogens, the bacterial species belonging to the genera of strictly anaerobic microorganism, which growth occurs between 25 °C Tepidanaerobacter, Thermoacetogenium, Acetobacterium, Syntrophaceticus, and 47 °C, whereas the temperature carried out in this study was 55 °C. and Thermotoga, together with the archaeal partners of Methanoculleus On the contrary, Herbinix hemicellulosilytica (strain T3/55T), a closest sp. and/or Methanothermobacter, were recently described [18,42]. In relative of Mobilitalea sibirica, was described as a novel genus and this study, the 16S rRNA gene sequence indicated the presence of SAOB species by D.E. Koeck and colleagues [37]. This thermophilic non- closely related to Tepidanaerobacter and Thermoanaerobacterium with sporulating rod-shaped bacterium was isolated from a thermophilic their relative abundance of 3 and 0.2%, respectively (Fig. 3, Table 4). biogas plant with an optimal growth at 55 °C. Nevertheless, whereas H. They were also detected as the major microbial groups during the DGGE hemicellulosilytica T3/55T is registered in the SILVA database both in analysis (bands 107 and 110, respectively, Fig. 2). Moreover, the results the data sets of aligned small (SSU) and large (LSU) subunits, at the of the DGGE profiling correlated to the HTS, since the DGGE bands time of writing, its a ffiliation according to the LSU database belonged to corresponding to Tepidanaerobacter were clearer, wider, and brighter the genus Herbinix (Lachnospiraceae), while within the SSU database, it than those, corresponding to Thermoanaerobacterium. Nevertheless,

193 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196 both bands were detected in the microbial communities that were Authors’ contributions cultivated on the OP, paper mixture, and CC substrates, whereas they were almost not seen when the newspaper and the magazine paper ET and AN contributed to the design and conception of the study. ET were used. Despite the presence of the cellulolytic bacteria related to and ME carried out the study and drafted the manuscript. LP, DM, and Defluviitoga tunisiensis and “Acetivibrio cellulolyticus” (bands 101 and ML collected, analyzed and interpreted the data under the supervision 109, respectively), the absence of an important SAOB group makes the of ET and ME. AN critically revised the manuscript. All authors have bioconversion of the NP and MP into biogas not functional. On the read and approved the manuscript for publication. contrary, the usage of the easily biodegradable office paper and cor- rugated carton is characterized by the presence of all needed microbial Funding groups that are capable of efficient biotransformation of the substrates into biogas. This work was supported in part by the Russian Scientific Fund In this study, we have observed by SEM and the light microscopy the (grant # 16-14-00098). microbial cell abundance when the paper mixture was used, contrary to the separately treated NP or MP substrates (Fig. S1, Fig. 1). Further Competing interests DGGE analysis confirmed this, since all three DGGE profiles showed no decreased microbial diversity on the paper mixture, as when the office The authors declare that they have no competing interests. paper was used for the Σ4 community cultivation (Fig. 2). This data supports our assumption that the mixture of different types of paper Acknowledgements improves the efficiency of their total biodegradation. It is known for many aerobic cellulolytic microorganisms that a mixture of cellulases The authors acknowledge Dr. Alexander Merkel for the valuable exhibits greater collective activity than the sum of the activities of in- technical assistance and support in HTS and bioinformatics. We also dividual components [4,44], where the synergism between en- thank Mr. Paul Girling for grammatically editing the manuscript. doglucanases and exoglucanases is both the most studied, and most quantitatively important for cellulose decomposition. The mesophilic Appendix A. Supplementary data anaerobic bacteria, namely within the genera Clostridium, Acetivibrio, Bacteroides, and Ruminococcus, possess a multi-enzyme cellulosome Supplementary data associated with this article can be found, in the structure, a complex, which also displays intra-molecule sinergism online version, at https://doi.org/10.1016/j.procbio.2017.12.006. [35]. Additionally, some anaerobic bacteria are reported to produce both cellulosomes and free cellulases [45,46]. Moreover, the exact C. References cellulosi that we identified within the MC cultivated on the office paper and paper mixture, has been previously reported on synergic degrada- [1] E.A. Tsavkelova, A.I. Netrusov, Biogas production from cellulose-containing sub- tion of cellulose by a cocktail of different individual enzymes [28]. strates (a review), Appl. Biochem. Microbiol. 48 (2012) 421–433. [2] S. McHugh, M. Carton, T. Mahony, V. O'Flaherty, Methanogenic population struc- Considering that the microbial community consists of various hydrolitic ture in a variety of anaerobic bioreactors, FEMS Microbiol. Lett. 219 (2003) bacteria with a different set of cellulolytic enzymes, we can suggest a 297–304. similar approach, when the total amount of produced cellulases dis- [3] L. Levén, A.R.B. Eriksson, A. Schnürer, Effect of process temperature on bacterial and archaeal communities in two methanogenic bioreactors treating organic plays a synergy in the cellulose hydrolysis, facilitating the bioconver- household waste, FEMS Microbiol. Ecol. 59 (2007) 683–693. sion of the barely degradable substrates. The more important aspect for [4] L.R. Lynd, P.J. Weimer, W.H. van Zyl, I.S. Pretorius, Microbial cellulose utilization: the waste paper anaerobic bioconversion might be the inhibition of fundamentals and biotechnol, Microbiol. Mol. Biol. Rev. 66 (2002) 506–577. growth of such “synergetic” hydrolitics. However, to the best of our [5] M.R. Rondon, P.R. August, A.D. Bettermann, S.F. Brady, T.H. Grossman, M.R. Liles, K.A. Loiacono, B.A. Lynch, I.A. MacNeil, C. Minor, C.L. Tiong, M. Gilman, knowledge, neither the antimicrobial properties of the chemicals or M.S. Osburne, J. Clardy, J. Handelsman, R.M. Goodman, Cloning the soil meta- additives used in the printing industry, nor the synergy of the cellulo- genome: a strategy for accessing the genetic and functional diversity of uncultured – lytic enzymes produced under the anaerobic conditions by microbial microorganisms, Appl. Environ. Microbiol. 66 (2000) 2541 2547. [6] T. Watanabe, S. Asakawa, A. Nakamura, K. Nagaoka, M. Kimura, DGGE method for communities, have been thoroughly studied so far. Thus, new in- analyzing 16S rDNA of methanogenic archaeal community in paddy field soil, FEMS vestigations are needed to provide more profound and detailed insights Microbiol. Lett. 232 (2004) 153–163. into the mechanisms of this problem. [7] M. Tabatabaei, M.R. Zakaria, R.A. Rahim, A.D.G. Wright, Y. Shirai, N. Abdullah, K. Sakai, S. Ikeno, M. Mori, IPCR-based DGGE and FISH analysis of methanogens in In this study, we reported on the composition of the thermophilic an anaerobic closed digester tank for treating palm oil mill effluent, Electron. J. microbial community producing biogas from waste paper. By using a Biotech. 12 (2009) 0717–3458. complex approach of metagenomic analysis in combination with the [8] F.H. Liu, S.B. Wang, J.S. Zhang, J. Zhang, X. Yan, H.K. Zhou, G.P. Zhao, Z.H. Zhou, fi The structure of the bacterial and archaeal community in a biogas digester as re- DGGE pro ling of the major microbial populations, we could char- vealed by denaturing gradient gel electrophoresis and 16S rDNA sequencing ana- acterize the microbial diversity and the relative abundance of the dif- lysis, J. Appl. Microbiol. 106 (2011) 952–966. ferent functional groups of Bacteria and Archaea. Although, we should [9] K. Kampmann, S. Rtering, I. Kramer, M. Schmidt, W. Zerr, S. Schnell, Unexpected stability of Bacteroidetes and Firmicutes communities in laboratory biogas reactors notice that for the proper characterization of the diversity and func- fed with different defined substrates, Appl. Environ. Microbiol. 78 (2012) tional activity of the microorganisms composing the microbial com- 2106–2119. munity, the comparative analysis of different techniques (e.g. HTS and [10] L. Regueiro, P. Veiga, M. Figueroa, J. Alonso-Gutierreza, A.J.M. Stams, J.M. Lema, DGGE), as well as of different approaches (e.g. different PCR programs M. Carballa, Relationship between microbial activity and microbial community structure in six full-scale anaerobic digesters, Microbiol. Res. 167 (2012) 581–589. for the DGGE profiling) should be performed. In this study, we con- [11] Y. Sun, J. Cheng, Hydrolysis of lignocellulosic materials for ethanol production: a firmed the presence and thus, the prominent role of the syntrophic review, Biores. Technol. 83 (2002) 1–11. acetate-oxidizing bacteria in their cooperative interactions with the [12] F. Asina, I. Brzonova, K. Voeller, E. Kozliak, A. Kubátová, B. Yao, Y. Ji, ffi Biodegradation of lignin by fungi, bacteria and laccases, Bioresour. Technol. 220 hydrogenotrophic methanogens that provide a stable and e cient (2016) 414–424. functioning of the microbial community. The usage of the waste paper [13] B.P. Tracy, S.W. Jones, A.G. Fast, D.C. Indurthi, T. Papoutsakis, Clostridia: the mixture, consisting of the biodegradable and barely decomposed ma- importance of their exceptional substrate and metabolite diversity for biofuel and biore finery applications, Curr. Opin. Biotechnol. 23 (2012) 364–381. terials, optimizes the structure of the microbial community for the [14] D. Johansson, C.A. Azar, A scenario based analysis of land competition between bioconversion of the cellulose-containing substrates into biofuel.

194 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

food and bioenergy production in the US, Clim. Change 82 (2007) 267–291. acetate production in extreme-thermophilic (70 °C) mixed culture fermentation by [15] M. Dębowski, M. Zieliński, A. Grala, M. Dudek, Algae biomass as an alternative selective enrichment of hydrogenotrophic methanogens, Sci. Rep. 4 (2014) 5268, substrate in biogas production technologies −review, Ren. Sustain. Energy Rev. 27 http://dx.doi.org/10.1038/srep05268. (2013) 596–604. [42] S. Hattori, Syntrophic acetate-oxidizing microbes in methanogenic environments, [16] C. Gallert, J. Winter, Mesophilic and thermophilic anaerobic digestion of source- Microbes Environ. 23 (2008) 118–127. sorted organic wastes: effect of ammonia on glucose degradation and methane [43] M. Goberna, H. Insam, I.H. Franke-Whittle, Effect of biowaste sludge maturation on production, Appl. Microbiol. Biotechnol. J. 48 (1997) 405–410. the diversity of thermophilic bacteria and archaea in an anaerobic reactor, Appl. [17] Á.J. Kardos, G. Palkó, J. Oláh, K. Barkács, G. Záray, Comparing of mesophilic and Environ. Microbiol. 75 (2009) 2566–2572. thermophilic anaerobic fermented sewage sludge based on chemical and bio- [44] Yi-H.P. Zhang, L.R. Lynd, Toward an aggregated understanding of enzymatic hy- chemical tests, Appl. Ecol. Environ. Res. 9 (2011) 293–302. drolysis of cellulose: noncomplexed cellulase systems, Biotech. Bioing. 88 (2004) [18] I. Maus, D.E. Koeck, K.G. Cibis, S. Hahnke, Y.S. Kim, T. Langer, J. Kreubel, 797–824. M. Erhard, A Bremges et al. Unraveling the microbiome of a thermophilic biogas [45] R. Doi, A. Kosugi, Cellulosomes: plant-cell-wall-degrading enzyme complexes, Nat. plant by metagenome and metatranscriptome analysis complemented by char- Rev. Microbiol. 2 (2004) 541–551. acterization of bacterial and archaeal isolates, Biotechnol. Biofuel. 9 (2016) 171. [46] E. Berger, D. Zhang, V.V. Zverlov, W.H. Schwarz, Two noncellulosomal cellulases of [19] D.V. Malakhova, M.A. Egorova, L.I. Prokudina, A.I. Netrusov, E.A. Tsavkelova, The Clostridium thermocellum, Cel9I and Cel48Y, hydrolyse crystalline cellulose sy- biotransformation of brewer’s spent grain into biogas by anaerobic microbial nergistically, FEMS Microbiol. Lett. 268 (2007) 194–201. communities, WJMB 31 (2015) 2015–2023. [47] D.J. Lane, B. Pace, G.J. Olson, D.A. Stahl, M.L. Sagin, N.R. Pace, Rapid determi- [20] L.I. Prokudina, A.A. Osmolovskiy, M.A. Egorova, D.V. Malakhova, A.I. Netrusov, nation of 16S ribosomal RNA sequences for phylogenetic analysis, Proc. Nat. Acad. E.A. Tsavkelova, Biodegradation of cellulose-containing substrates by micromycetes Sci. USA 82 (1985) 6955–6959. followed by bioconversion into biogas, Appl. Biochem. Microbiol. 52 (2016) [48] D.A. Stahl, R. Amann, Development and application of nucleic acid probes, in: 190–198. E. Stackebrandt, M. Goodfellow (Eds.), Nucleic Acid Techniques in Bacterial [21] E.A. Tsavkelova, M.A. Egorova, E.V. Petrova, A.I. Netrusov, Thermophilic anaerobic Systematics, John Wiley and Sons Ltd, Chichester, UK, 1991, pp. 205–248. microbial communities that transform cellulose into methane (biogas), Moscow [49] J.R. Marchesi, T. Sato, A.J. Weightman, T.A. Martin, J.C. Fry, S.J. Hiom, Univ, Biol. Sci. Bull. 67 (2012) 75–81. W.C. Wade, Design and evaluation of useful bacterium-specific PCR primers that [22] E.A. Tsavkelova, M.A. Egorova, E.V. Petrova, A.I. Netrusov, Biogas production by amplify genes coding for bacterial 16S rRNA, Appl. Environ. Microbiol. 64 (1998) microbial communities via decomposition of cellulose and food waste, Appl. 795–799. Biochem. Microbiol. 48 (2012) 77–384. [50] T. Sheng, L. Zhao, L.-F. Gao, W.-Z. Liu, M.-H. Cui, Z.-C. Guo, X.-D. Ma, S.-H. Ho, A.- [23] I.V. Kublanov, A.A. Perevalova, G.B. Slobodkina, A.V. Lebedinsky, S.K. Bidzhieva, J. Wang, Lignocellulosic saccharification by a newly isolated bacterium, T.V. Kolganova, E.N. Kaliberda, L.D. Rumsh, T. Haertlé, E.A. Bonch-Osmolovskaya, Ruminiclostridium thermocellum M3 and cellular cellulase activities for high ratio of Biodiversity of thermophilic prokaryotes with hydrolytic activities in hot springs of glucose to cellobiose, Biotechnol. Biofuel. 9 (2016) 172. Uzon Caldera, Kamchatka (Russia), Appl. Environ. Microbiol. 75 (2009) 286–291. [51] H. Yanling, D. Youfang, L. Yanquan, Two cellulolytic Clostridium species: Clostridium [24] L. Raskin, J. Stromley, B. Rittmann, D. Stahl. Group-specific 16S rRNA hybridiza- cellulosi sp. nov. and Clostridium cellulofermentans sp. nov, Int. J. Syst. Bacteriol. 41 tion probes to describe natural communities of methanogens, Appl. Environ. (1991) 306–309. Microbiol. 60 (1994) 1232–1240. [52] A. Watthanalamloet, C. Tachaapaikoon, Y.S. Lee, A. Kosugi, Y. Mori, [25] G. Muyzer, K. Smalla, Application of denaturing gradient gel electrophoresis S. Tanasupawat, K.L. Kyu, K. Ratanakhanokchai, Cellulosibacter alkalithermophilus (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology, gen. nov. sp. nov., an anaerobic alkalithermophilic, cellulolytic-xylanolytic bac- Antonie van Leeuwenhoek 73 (1998) 127–141. terium isolated from soil of a coconut garden, Int. J. Syst. Evol. Microbiol. 62 (2012) [26] D.W. Fadrosh, B. Ma, P. Gajer, N. Sengamalay, S. Ott, R.M. Brotman, J. Ravel, An 2330–2335. improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on [53] E. Miranda-Tello, M.-L. Fardeau, J. Sepúlveda, L. Fernández, J.-L. Cayol1, the Illumina MiSeq platform, Microbiome 2 (2014) 6, http://dx.doi.org/10.1186/ P. Thomas, B. Ollivier, Garciella nitratireducens gen. nov. sp. nov., an anaerobic, 2049-2618-2-6. thermophilic, nitrate- and thiosulfate-reducing bacterium isolated from an oilfield [27] A.Yu. Merkel, N.V. Pimenov, I.I. Rusanov, A.I. Slobodkin, G.B. Slobodkina, separator in the Gulf of Mexico, Int. J. Syst. Evol. Microbiol. 53 (2003) 1509–1514. I.Yu. Tarnovetckii, E.N. Frolov, A.V. Dubin, A.A. Perevalova, E.A. Bonch- [54] K.G. Сibis, A. Gneipel, H. König, Isolation of acetic, propionic and butyric acid- Osmolovskaya, Microbial diversity and autotrophic activity in Kamchatka hot forming bacteria from biogas plants, J. Biotechnol. 220 (2016) 51–63. springs, Extermophiles 21 (2016) 307–317. [55] A.I. Slobodkin, T.N. Tourova, N.A. Kostrikina, A.M. Lysenko, K.E. German, [28] M. Yang, K.-D. Zhang, P.-Y. Zhang, X. Zhou, X.-Q. Ma XQ, F.-L. Li, Synergistic E.A. Bonch-Osmolovskaya, N.K. Birkelan, Tepidimicrobium ferriphilum gen. nov. sp. cellulose hydrolysis dominated by a multi-modular processive endoglucanas from nov., a novel moderately thermophilic, Fe(III)-reducing bacterium of the order Clostridium cellulosi, Front. Microbiol. 7 (932) (2016) 1–8. Clostridiales, Int. J. Syst. Evol. Microbiol. 56 (2006) 369–372. [29] P. Hugenholtz, C. Pitulle, K.L. Hershberger, N.R. Pace, Novel division level bacterial [56] L. Niu, L. Song, X. Liu, X. Dong, Tepidimicrobium xylanilyticum sp. nov. an anaerobic diversity in a Yellowstone Hot Spring, J. Bacteriol. 180 (1998) 366–376. xylanolytic bacterium, and emended description of the genus Tepidimicrobium, Int. [30] H. Chen, Q. Han, R.A. Venditti, H. Jameel, Enzymatic hydrolysis of pretreated J. Syst. Evol. Microbiol. 59 (2009) 2698–2701. newspaper having high lignin content for bioethanol production, BioResources 10 [57] N. Matsuura, A. Ohashi, D.M. Tourlousse, Y. Sekiguchi, Draft genome sequence of (2015) 4077–4098. the syntrophic lactate-degrading bacterium Tepidanaerobacter syntrophicus JLT, [31] K. Pivnenko, E. Eriksson, T.F. Astrup, Waste paper for recycling: overview and Genome Announc. 4 (2016), http://dx.doi.org/10.1128/genomeA.01712-15. identification of potentially critical substances, Waste Manag. 45 (2015) 134–142. [58] Y. Sekiguchi, H. Imachi, A. Susilorukmi, M. Muramatsu, A. Ohashi, H. Harada, [32] S. Varghese, S. Kuriakose, S. Jose, Antimicrobial activity of carbon nanoparticles S. Hanada, Y. Kamagata, Tepidanaerobacter syntrophicus gen. nov. sp. nov., an isolated from natural sources against pathogenic Gram-negative and Gram-positive anaerobic, moderately thermophilic, syntrophic alcohol- and lactate-degrading bacteria, J. Nanosci. 457865 (2013) 1–5. bacterium isolated from thermophilic digested sludges, Int. J. Syst. Evol. Microbiol. [33] S.J.K. Hussey, J. Purves, N. Allcock, V.E. Fernandes, P.S. Monks, J.M. Ketley, 56 (2006) 1621–1629. P.W. Andrew, J.A. Morrissey, Air pollution alters Staphylococcus aureus and [59] S. Manzoor, E. Bongcam-Rudloff, A. Schnürer, B. Müller, First genome sequence of a Streptococcus pneumoniae biofilms, antibiotic tolerance and colonisation, Environ. syntrophic acetate-oxidizing vacterium, Tepidanaerobacter acetatoxydans strain Re1, Microbiol. 19 (2017) 1868–1880. Genome Announc. 1 (2013) 12–0213, http://dx.doi.org/10.1128/genomeA. [34] C.A. O'Sallivan, P.C. Burrell, W.P. Clarke, L.L. Blackall, Structure of a cellulose 00213-12. degrading bacterial community during anaerobic digestion, Biotech. Bioing. 92 [60] T.J. Verbeke, V. Spicer, O.V. Krokhin, X. Zhang, J.J. Schellenberg, B. Fristensky, (2003) 871–878. J.A. Wilkins, D.B. Levine, R. Sparling, Thermoanaerobacter thermohydrosulfuricus [35] W.H. Schwarz, The cellulosome and cellulose degradation by anaerobic bacteria, WC1 shows protein complement stability during fermentation of key lignocellulose- Appl. Microbiol. Biotechnol. 56 (2001) 634–649. derived substrates, Appl. Environ. Microbiol. 80 (2014) 1602–1615. [36] D.E. Koeck, D. Wibberg, I. Maus, A. Winkler, A. Albersmeier, V.V. Zverlov, W. Liebl, [61] S. Khamtib, A. Reungsang, Biohydrogen production from xylose by A. Pühler, W.H. Schwarz, A. Schlüter, Complete genome sequence of the cellulolytic Thermoanaerobacterium thermosaccharolyticum KKU19 isolated from hot spring se- thermophile Ruminoclostridium cellulosi wild-type strain DG5 isolated from a ther- diment, Int. J. Hydr. Energy. 37 (2012) 12219–12228. mophilic biogas plant, J. Biotechnol. 188 (2014) 136–137. [62] S.Q. Ji, B. Wang, M. Lu, F.-L. Li, Defluviitalea phaphyphila sp. nov., a novel ther- [37] D.E. Koeck, W. Ludwig, G. Wanner, V.V. Zverlov, W. Liebl, W.H. Schwarz, Herbinix mophilic bacterium that degrades brown algae, Appl. Environ. Microbiol. 82 (2016) hemicellulosilytica, gen. nov., sp. nov., a thermophilic cellulose-degrading bacterium 868–877. isolated from a thermophilic biogas reactor, Int, J. Syst. Evol. Microbiol. 65 (2015) [63] L. Jabari, H. Gannoun, J.-L. Cayol1, M. Hamdi, G. Fauque, B. Ollivier, M.- 2365–2371. L. Fardeau, Characterization of Defluviitalea saccharophila gen. nov. sp. nov., a [38] G.B. Patel, A.W. Khan, B.J. Agnew, J.R. Colvin, Isolation and characterization of an thermophilic bacterium isolated from an upflow anaerobic filter treating abattoir anaerobic cellulolytic microorganism, Acetivibrio cellulolyticus, gen. nov., sp. nov, J. wastewaters, and proposal of Defluviitaleaceae fam. nov, Int. J. Syst. Evol. Microbiol. Syst. Bacteriol. 30 (1980) 179–185. 62 (2012) 550–555.

[39] N. Yutin, M.Y. Galperin, A genomic update on clostridial phylogeny: gram-negative [64] F. Liu, R. Conrad, Chemolithotrophic acetogenic H2/CO2 utilization in Italian rice spore formers and other misplaced clostridia, Environ. Microbiol. 15 (2013) field soil, The ISME J. 5 (2011) 1526–1539. 2631–2641. [65] B.M. van der Zaan, F.T. Saia, A.J.M. Stams, C.M. Plugge, W.M. de Vos, H. Smidt, [40] O.A. Podosokorskaya, E.A. Bonch-Osmolovskaya, A.V. Beskorovaynyy, A.A.M. Langenhoff, J. Gerritse, Anaerobic benzene degradation under denitrifying S.V. Toshchakov, T.V. Kolganova, I.V. Kublanov, Mobilitalea sibirica gen. nov. sp. conditions: Peptococcaceae as dominant benzene degraders and evidence for a nov., a halotolerant polysaccharide-degrading bacterium, Int. J. Syst. Evol. syntrophic process, Env. Microbiol. 14 (2012) 1171–1181. Microbiol. 64 (2014) 2657–2661. [66] C.T. Skennerton, M.H. Haroon, A. Briegel, J. Shi, G.J. Jensen, G.W. Tyson, [41] F. Zhang, Y. Zhang, J. Ding, K. Dai, M.C.M. van Loosdrecht, R.J. Zeng, Stable V.J. Orphan, Phylogenomic analysis of Candidatus ‘Izimaplasma’ species: free-living

195 E. Tsavkelova et al. Process Biochemistry 66 (2018) 183–196

representatives from a Tenericutes clade found in methane seeps, The ISME J. 10 Syst. Bacteriol. 47 (1997) 150–154. (2016) 2679–2692. [68] A. Grabowski, B.J. Tindall, V. Bardin, D. Blanchet, C. Jeanthon, Petrimonas sulfur- [67] G.N. Rees, B.K.C. Patel, G.S. Grassia, A.J. Sheehy, Anaerobaculum thermoterrenum iphila gen. nov. sp. nov., a mesophilic fermentative bacterium isolated from a bio- gen. nov., sp. nov., a novel, thermophilic bacterium which ferments citrate, Int. J. degraded oil reservoir, Int. J. Syst. Evol. Microbiol. 55 (2005) 1113–1121.

196