Glyphosate and glyphosate-based herbicide exposure during the peripartum period affects maternal brain plasticity, maternal behaviour and microbiome Julie Dechartres, Jodi L Pawluski, Marie-Madeleine Gueguen, Amin Jablaoui, Emmanuelle Maguin, Moez Rhimi, Thierry D Charlier
To cite this version:
Julie Dechartres, Jodi L Pawluski, Marie-Madeleine Gueguen, Amin Jablaoui, Emmanuelle Maguin, et al.. Glyphosate and glyphosate-based herbicide exposure during the peripartum period affects maternal brain plasticity, maternal behaviour and microbiome. Journal of Neuroendocrinology, Wiley, 2019, 31 (9), pp.e12731. 10.1111/jne.12731. hal-02153623
HAL Id: hal-02153623 https://hal-univ-rennes1.archives-ouvertes.fr/hal-02153623 Submitted on 1 Jul 2019
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.
Distributed under a Creative Commons Attribution| 4.0 International License Bernard, 35000 Rennes, France, Email: [email protected] France,Bernard,[email protected] 35000 Email: Rennes, * France F-35000,Travail), Rennes, 1085, UMR_S a Emmanuelle Maguin DechartresJulie Abbreviated Glyphosate title: maternal affects plasticity,maternal microbiome brain and behavior the peripartum period during Glyphosate-based herbicide exposure Glyphosate and SubmittedParental SI the for Brain Articletype : Original Article PROFESSOR THIERRY CHARLIER (Orcid ID : 0000-0003-2759-6572) JODIDR PAWLUSKI (Orcid ID : 0000-0002-8240-8178) b Corresponding author: Thierry D. Charlier, University of Rennes 1, IRSET, 9 Av Prof Leon Prof Av 9 IRSET, 1, Rennes of University Charlier, D. Thierry author: Corresponding
nv ens Isr, HS, re (nttt e ehrh e Sné Evrneet et Environnement Santé, en Recherche de (Institut Irset EHESP, Inserm, Rennes, Univ AcceptedINRA,Micalis, F-78352, AgroParisTech, UnivParis-Saclay, Article a , Jodi Jodi Pawluski L. b , Moez Rhimi on maternal brain and microbiota on maternalmicrobiota brain and a b , ,
Marie-Madeleine Gueguen Thierry D. CharlierThierry a,* a,*
Jouy- a , en
Amin Jablaoui -Josas, France -Josas, b , The treatments significantly altered licking behavior toward pups between PD2 between by pups toward behavior licking altered significantly treatments The administered were 22. (PD) day postpartum vehicle to 10 (GD) day gestational or from rats Dawley Sprague to equivalent), ingestion Glyphosate of mg/kg/day (5 Roundup® our To mg/kg/d), (5 Glyphosate of action. doses low relatively Here, physiology. and behavior maternal on of mechanisms herbicide in formulation its undefined or Glyphosate effects the through investigated has study no albeit knowledge, behaviors, that altered suggests models in rodent result and communication in neuronal work affect can Recent development during herbicide. herbicides used Glyphosate-based widely most the far by analyzed the datawrote paper. and the AJ, research; the performed . Accepted in and gut mother. microbiota inthe or alone glyphosate that evidence provide neuroplasticity modulates and behavior to maternal affects differentially (Roundup) formulation study first the is This Firmicutes. and significantly is microbiota gut that Bacteroidetes phyla the alterationof significant with pesticides, the here to exposure the alteredby show we clear, not currently is system central nervous the the on in formulation its downregulatedor alone glyphosate and of effect hippocampus, direct a the While gyrus. cingulate of regions CA3 and gyrus dentate ventral and dorsal the in glyphosate upregulatedby was synaptophysin, of expression the addition, In mother. the of hippocampus the of gyrus dentate dorsal the in neurons new immunoreactive doublecortin- of maturation the affected exposure Roundup PD22, at dams the in show also Article Author and JLP contribution: TDC designed Competingauthors interests:competing have the no interests. Glyphosate is found in a large array of non-selective herbicides such as Roundup® and is and Roundup® as such herbicides non-selective of array large a in found is Glyphosate ABSTRACT Neurogenesis;Neuroplasticity, KEYWORDS
EM and MR performed microbiota analysis; JD analysis; microbiota performed MR and EM Hippocampus; gyrus; Cingulate and supervised the research supervised study; the and Gut microbiota Gut microbiota , JLP and TDC TDC and JLP , and PD6. We We PD6. and JD
and MMG and MMG risk assessment difficult for regulatory agencies. Indeed in 2015, Glyphosate forrisk assessmentGlyphosate Indeed regulatory difficult agencies. in2015, human in cancers some to exposure humans and animals . is currently open Glyphosatesafetythe of debateon The reproduction. for genotoxic or mutagen carcinogenic, not is Glyphosate that concluded Cancer Internationalon Research Agencybyfor the 2A)(Group humans” “probably carcinogenicfor Glyphosate of development the to due mostly 2014, in tons 825,000 over to 1994 in sold compound bioactive of tons 50,000 around from increased, significantly has use Glyphosate broad cortex in adult male rats male adult Acceptedin cortex their and levels prefrontal and nigra substantia hippocampus, the as such regions brain several glutamate in metabolites and serotonin norepinephrine, in dopamine, alteration neurotransmitter induced GBH Indeed, properties. mutagenic and carcinogenic potential its of independently behavior, and physiology brain alter could exposure Glyphosate that found physiology and development vertebrate affect ArticleGlyphosate vertebrates, in absent is pathway this Because fungi. and well as inbacteria inplants, as phenylalanine) and acidsaromaticamino tyrosine (tryptophan, pathway shikimate the in techniques application pre-harvest a key(EPSPS), synthaseGlyphosate the5-enolpyruvylenzyme shikimate-3-phophate inhibits and soy and corn modified genetically resistant -spectrum herbicides and is widely used across the world world the across used widely is and herbicides -spectrum Glyphosate (N-phosphonomethyl-glycine) is the active compound found in over 750 750 over in found compound active the is (N-phosphonomethyl-glycine) Glyphosate INTRODUCTION More recently, an increasing number of studies suggest that GBH exposure might might exposure GBH that suggest studies of number increasing an recently, More 11 whi le the European Food Safety Authority Safety Food European the le 14– 17 . 3,5 Hwvr a e suis ik lpoaebsd ebcd (GBH) herbicide Glyphosate-based link studies few a However, . 21,22
3,4 as well as neurotransmitter binding to their cognate receptor receptor cognate their to binding neurotransmitter as well as Ti mtblc aha i rqie fr h boytei of biosynthesis the for required is pathway metabolic This . and Glyphosate-based herbicide in term of carcinogenicityof term in herbicide Glyphosate-based and 1,6 while others do not find any association association any find not do others while 18 – 20 12 . More precisely, several laboratories laboratories several precisely, More . and the European chemical agency chemical European the and 1 I ls ta 2 years, 20 than less In . was considered safe for safe considered was was classified as was as classified 7 – 10 , making , 1,2 23 13 - . . . Accepted the and behavior associated neuroplasticity. maternal affect could Glyphosate how on data no is there knowledge, plasticity and physiology hippocampal affects exposure GBH the suggest anxiety and stress including emotions, of regulation the in involved is part ventral the while general in memory and performance cognitive more functional and cognition spatial and in involved is physiological hippocampus dorsal the present that consensus agreed hippocampus the with the differences, of region dorsal and ventral factors environmental chemical and social to sensitivity its of because and neurogenesis adult including neuroplasticity, of level high persistent its of because attention much received has hippocampus the terminalis, stria the of nucleus bed the and area tegmental ventral the nucleus, preoptic medial the including period, peripartum a environment in Article survival variable and needs offspring’s her during to behavior remodeled her adapt significantly to also lactation and is pregnancy females adult of circuitry neural the However, brain. developing the in neuroplasticity intense the of because period, perinatal the during outcomes neurodevelopmental on environment chemical the of effects of the on majority focus vast studies the general, In treatment. the by affected be could herself dam the how mother’s about the information isno lactating females,there and gestating to exposure the via GBH to exposure perinatal of effect the investigated have exposure Glyphosate following rats female and male and mice male in observed symptoms anxiety-like and depressive- and activity locomotor in deficits of cause the be to likely are neurotransmission in alterations these Consequently, 28– 31 . Amongst the various brain regions remodeled around the the around remodeled regions brain various the Amongst . 24– 27 . Interestingly, while several studies several Interestingly,while . 32– behavior and brain plasticity and and plasticity brain and behavior 34 I sol b add ht the that added be should It . 35,36 22,26,37 . Previous data data Previous . – 39 T our To . microbiota by chemical exposure (including antibiotic, diet, pre or probiotics or pre diet, antibiotic, (including exposure chemical by microbiota for of Modification microbiota. named collectively bacteria), (mostly host microorganisms of billions the is organism invertebrate) (and vertebrate every Interestingly, bacteria. most in present also is pathway enzymatic shikimate the reason, economical clear its for plants in investigated mostly is protein this While EPSPS. on effects best inhibitory direct its for known is Glyphosate above, introduced As defined. well not is/are brain the in stress Glyphosate oxidative and excitotoxicity glutamate to tallowaminethe pesticide such formulation, as thepolyethoxylated . could alsoindirectly themicrobiota. alter but cofactors metallic require usually that cascades enzymatic most of alteration significant investigated poorly outcome the Mg (e.g. cations neuro brain in defect physiology,including organism’s the ofalterations significant to associated be adjuvants some by but itself Glyphosate by triggered not are GBH of effects adverse observed the of some that suggest studies few a as important is This Glyphosate of effects the comparing dose low to exposure of impact studies the investigated of handful a only and Glyphosate-equivalent) mg/kg/day 50 (over GBH of doses Accepted Glyphosate addition, in or depression Alternatively, and anxiety including disorders, health mental in result dysbiosis could as alteration known process a microbiota, gut affect can exposure Article eeomn ad neuroplasticity and development Although it is hypothesized that the effects of Glyphosate in the brain might be linked linked be might brain the in Glyphosate of effects the that hypothesized is it Although It should also be noted that most of these effects were observed with relatively high high relatively with observed were effects these of most that noted be also should It 2+ , Ca , 2+ , Fe , 2+ , Mn , 2+ 50,51 , Cu , alone and in GBH on neural and behavioral outcomes. outcomes. behavioral and neural on GBH in and alone . A reduction of these elements could lead to a a to lead could elements these of reduction A . 2+ 44– oss ceaig rpris n bns divalent binds and properties chelating possess , Zn , 46 Rcnl, fw tde soe ta GBH that showed studies few a Recently, . 2+ ). This chelating effect chelating This ). 40 . Probably as important, there is little work little is there important, as Probably . 21,26,38,43 , or “inert” molecules “inert” or , , the molecular target(s) of of target(s) molecular the , 41,42 . in vivo in 40,47 – 49 … is unclear and unclear is ) is known to known is ) and such an an such and , found in found 24,25 . r n PSD95 and ir (synaptophysin- densities protein post-synaptic and pre- gyrus cingulate the PSD95 In hippocampus. and (synaptophysin-ir densities protein post-synaptic and pre- and ir), . Acceptedminimize animal stress andpain. D35-238 (agreement Agriculture of Ministry French the by Research licensed is facility of animal The v3). APAFlS#5294-2016050412068659 number (authorization Ministry French the of Committee Ethics the by approved were procedures animal All am). 07:00 at on (light cycle light/dark 12:12 a in conditions laboratory standard water tap and chow rat to our access had at They facility. animal arrival upon housed singly and France, Laboratories, Janvier from obtained were affect neuroplasticity inthe dam. to cations several of concentration plasma modulate and/or microbiota gut the affect could formulation in or alone Glyphosate whether investigated we analysis, behavior and Articlebrain to parallel In outcomes. neural adverse to lead and exposure Glyphosate by affected be could to techniques immunohistochemical on (Ki67-immunoreactivit proliferation cell focused investigate we structure, in changes cell measure To and gyrus. neurogenesis cingulate and ventral) and (dorsal hippocampus the on Level” 1:10 mg/kg/day, (5 dose low relatively ) of Glyphosate and GBH on maternal behavior and maternal neuroplasticity, focusing focusing neuroplasticity, maternal and behavior maternal on GBH and Glyphosate of ) Twenty-one adult pregnant (gestational day (GD) 8) Sprague-Dawley rats (239-340 g) g) (239-340 rats Sprague-Dawley 8) (GD) day(gestational pregnant adult Twenty-one Animals METHODS of effects potential the compare to was study present the of aim the Therefore, -ir) were assessed. In addition, we also investigated signaling pathways that that pathways signaling investigated also we addition, In assessed. were -ir)
th of the NOAEL the of y( -ir)), immature neurons (d neurons immature -ir)), , for “No Observable Adverse Effect Adverse Observable “No for , ad libitum ad -19). All efforts were made to to made were efforts All -19). and were kept under under kept were and oublecortin- -ir) in the the in -ir) GD10, and PD1 PD22 on recorded was Weight Glyphosate). 1 Control, (1 euthanized were and parturition during problems had females Two dams. the offspring. but entirety the their in with eaten consistently shared were Cookies not and dam the by ingested completely was biscuit the that ensure to made were Observations wafer. the of portion vanilla the into made were Injections Delacre® fondante, (Crousti cookie wafer . and separation Acceptedmaternal minutes) (~15 short a causing characterized, and handled was litter maternal analyzed the because days, other the fromindependently followingparturition day first the behavioron We behavior. maternal each for spent time of percentage as reported time nursing blanket nursing, passive (ABN), nursing arched-back pups, the licking spent dams the time the scored treatment the to blind observer An sessions. two the between h 1 least at with 16:30) and 14:00 (between afternoon the in and 13:30) and 09:30 (between morning the in place took Scoring animals. the disturbing without cage the in directly day, a twice minutes 5 during scored was behavior maternal PD6, to PD1 Between ratio). sex (balanced Article21 (PD) day postpartum at pups was the of weaning the to Treatment GD9. at salt) isopropylamine biscuits via orally administered glyphosate g/L g/L 229 170 Belgium acid, Dept., glyphosate L&G Europe Monsanto S.A. equivalent, salt isopropylamine glyphosate mg/kg/day 5 (Roundup, 3Plus Roundup® and Germany) GmbH, Ehrenstorfer Dr. salt, isopropylamine glyphosate of mg/kg/day (5 Glyphosate water), sterilized milliQ the dams spent off the nest and the time the dams spent building the nest (NB). Data is Data (NB). nest the building spent dams the time the and nest the off spent dams the Pregnant females were randomly assigned to 3 groups (n = 7/group): Control (vehicle: (vehicle: Control 7/group): = (n groups 3 to assignedrandomly femaleswere Pregnant One day after birth (PD1), litter was weighed, sexed and culled to 10 pups per litter litter per pups 10 to culled and sexed weighed, was litter (PD1), birth after day One Maternal behavior . . Figure 1 provides a timeline oftheFigure study. atimeline 1provides 52 every morning between 8:30 am and 9:30 am from GD10 from am 9:30 and am 8:30 between morning every Blim ijce wt tetet r vehicle or treatment with injected Belgium) , . Females were fed 1/9 fed were Females . th of a vanilla a of . from purified DNA with the primers F343 F343 primers the 250 paired enables with sequencing MiSeq Because species). the on depending varies length exact (the bp were 510 about lengths amplicon The 65°C. of temperature annealing an with cycles amplification DNA R784 30 using (GGAGTTCAGACGTGTGCTCTTCCGATCTTACCAGGGTATCTAATCCT) and purified (CTTTCCCTACACGACGCTCTTCCGATCTACGGRAGGCAGCAG) from sequencing MiSeq for generation amplicon rRNA 16S were pooled. PD22 at differences only and GD9 at groups between differences additional analyses.separatelyfor and aggregated across onPD1 PD2-6 . Accepted (CAAGCAGAAGACGGCATACGAGAT-index- primer of quality The primer instructions. manufacturer the to according cartridge MiSeq Illumina the onto forward the loaded and purified were products PCR using resulting reverse The GTGACTGGAGTTCAGACGTGT). cycles the 12 modified with and PCR second (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC) a during primer R784 the to added was which index, bp 6 home-made a using performed was multiplexing Single region. V3-V4 entire the covering reads full-length quality, high extremely generate Article(PD22 study the of end the at and (GD9) treatment to prior feces the of Analysis analysis. microbiota for tubes ml 1.5 sterile the to transferred and day tweezer following sterilized with collected feces and PD22, and GD19 GD9, on bedding clean Therefore, outcome. behavioral affecting potentially In addition to standard cage changing, the dams were transferred to new cages with cages new to transferred were dams the changing, cage standard to addition In Microbiome Samples from GD19were from notused. Samples -bp reads, the ends of each read overlap and can be stitched together to together stitched be can and overlap read each of ends the reads, -bp aenl eair a investigated was behavior maternal h V-4 ein a amplified was region V3-V4 The ) are reported. No samples samples No reported. are was done. There were no were There done. was . wereat for saline 4°C 24h.Brains in30%sucrose/phosphate-buffered thentransferred use.The until in4%paraformaldehyde80°C brains wereremoved,immersion-fixed quickly at Serum was minutes - g 4°C. 10 storedBlood at at for 2375x samples were centrifuged rapidkept bloodwas onice collectedand Trunk processing decapitation. until 8h. within pentobarbitalwith sodium ( classifier 13-5) (release database Greengenes the using species) to phylum (from levels taxonomic different at it assigned and OTU each for Esprit-tree picked was using sequence reference level identity 97% the at (OTUs) Units Taxonomic Operational UCHIME with removed were Chimera (Mothur) excluded were primers Flash1.6.2 analysis Bioinformatics was assigned sample using toits thepreviously index. integrated sequence pair-end each analysis, further for and PhiX, using internally checked was run the Accepted Core Team, for Foundation Statistical 2015,R Computing, Vienna, Austria). (R R using done analyseswere All OTUs. each for and genus each for applied was procedure same The abundance. of terms in different significantly were that (treatment) combinations correction BH with test Wallis Kruskall family, such each For families. those to assigned OTUs the agglomerating by computed were families Article After rarefaction of all communities to even sampling depths, the abundances of all all of abundances the depths, sampling even to communities all of rarefaction After At PD22 Euthanasia 58 . 53 . PCR primers were removed and sequences with sequencing errors in the the in errors sequencing with sequences and removed were primers PCR . , one day were ofthe afterweaning dams offspring, anaesthetized deeply
eune wr timd o aatr ad sebe with assembled and adaptors for trimmed were Sequences i.p , 150mg/kg Santéby Animale)BW,and Ceva euthanized a 54 100 ed wr rnol slce fr ah sample. each for selected randomly were reads 12000 . 55 and Mothur and 54 software. Reads were clustered into clustered were Reads software. 59 ee efre t dtc the detect to performed were 57 and the RDP RDP the and 56 A . . Accepted and Rhénium Indium, Germanium, Rhodium). Scandium, (Iridium, standards internal and ions) each for points (8 curve calibration a following measured were sample each for triplicate Technical He). (e.g., gas non-reactive a with ions the of collisions or NH3) O2, H2, (e.g., gas remove to cell octopole-containing extra an with equipped Agilent) 8800, (ICP-MSMS instrument ICP-MS quadrupole-based on analysis before water ultra-pure in 1/10 diluted and concentration) final (1% HNO3 with acidified was plasma Briefly, platform. analytical LERES the at ICP/MS/MS by quantified were (Mn) detectable(Bio-rad).a minimum assay concentration The had of 5.3pg/mL. software MPM6 with analyzed and (Bio-rad) reader microplate iMark with read were plates Max (Legend Thetriplicate. in wereanalyzed samples All instructions. providerthe performedto according plates pre-coated with kit ELISA Articlecommercial effectevaluate potentialhepatotoxic to measured were dams in levels transaminases Serum Japan). Tokyo, Optical, (Olympus the Chemistry to according measured were transaminases processing until 80°C (see below). for were- solution 7days ondryfor Brains at before ice. stored cryoprotection snap-freezing nelui 6 (IL-6). 6 Interleukin Cations. analysis. transaminases Serum SerumAnalysis (IFCC) primary reference procedures using Olympus AU2700 Auto-analyser® Auto-analyser® AU2700 Olympus using procedures reference primary (IFCC) Serum levels of calcium (Ca), iron (Fe), magnesium (Mg) and manganese and (Mg) magnesium (Fe), iron (Ca), calcium of levels Serum eu lvl o itrekn (L6 wr dtrie uig a using determined were (IL-6) 6 interleukin of levels Serum
60 . Serum alanine (ALT) and aspartate (AST) (AST) aspartate and (ALT) alanine Serum in terferences nentoa Fdrto o Clinical of Federation International by selective reaction with a reactivea with reaction selective TM Boeed n) and Inc) BioLegend , cover with Permount (Fischer Scientific). and dehydrated Ki67), for (only acetate Violet Cresyl with counterstained overnight, dried Scientific), (Thermo slides Plus SuperFrost on mounted were Sections Laboratories). Vector (SK-4100, kit substrate peroxidase (3,3-diaminobenzidine) DAB using visualized was signal and temperature room at h 2 for Laboratories) Vector 1:1000; kit; Elite ABC (Vectastain® complex peroxydase avidin-biotin-horseradish using performed was amplification Signal antibody. biotinylated secondary in incubated then PBST in rinsed were Sections 1). Table in described as PSD95, synaptophysin, DCX, (Ki67, antibody then primary in was 4°C Tissue at incubated 1. Table in described as min 30 for PSD95) 2%, or synaptophysin 5%, (NGS, goatserumnormal in Doublecortin)orand Ki67 for(PBST), triton ofcontaining 0.1% PBS in 5% Sigma (NDS, serum donkey normal in temperature room at incubated then were H % 0.6 in blocked was activity peroxidase endogenous markers, all For processing. further before PBS in rinsed then for retrieval antigen 80°C at min 10 for 6.0) (pH buffer citrate sodium mM 10 in incubated only, were staining sections PSD95 room For to processing. before brought PBS were in rinsed Sections extensively details). and temperature for 1 Table see PSD95; and Synaptophysin published until solution antifreeze glycol-based ethylene in -16°C immunohistochemical processing. at stored were Sections . Accepted Article Immunohistochemistry. Brains were sliced with a cryostat (Microm HM560) at 40 40 at HM560) (Microm cryostat a with sliced were Brains histology Brain 52,61 – 63 . Briefly, 1 series of sections was used for each marker (Ki67, Doublecortin, (Ki67, marker each for used was sections of series 1 Briefly, . muoitceity a promd s previously as performed was Immunohistochemistry 2 O 2 for 30 min at room temperature. Sections Sections temperature. room at min 30 for m, in series of 10. 10. of series in m, htmcorps n eta dnae yu bem -.6 m o 64 m; n 6 and mm; -6.48 to mm -5.16 bregma gyrus dentate ventral in photomicrographs 9 mm; -5.16 to mm -2.64 bregma region CA3 nine dorsal in photomicrographs dorsal 3 and gyrus, dentate the in Six taken PSD95. were synaptophysin) and and PSD95 synaptophysin for of (respectively photomicrographs density optical the determine to taken were gyrus cingulate the and CA3 dorsal gyrus, dentate ventral and dorsal the in sections . Acceptedandsee3 DCX-positives cells Figure process), Ki67 of photomicrographsrepresentative For cells. DCX-ir total of percentage short a as expressed or process neurons (no post-mitotic or branching) proliferativeno with process (medium either intermediate as categorized and section brain per counted were cells DCX-positive 60 of minimum A sections. ventral 3 and dorsal 2 in of 10)toobtainan estimate inthedentate ofthecells totalgyrus. number analyzed sections out of series by(1 multipliedArticle wascounted10 of cellsnumber The hilus. the in counted also were cells Ki67-positive treatment. experimental the to blind observer an by (GCL/SGZ) gyrus dentate the throughout microscope) optic BX60 (Olympus objective X40 by anmultiplied estimate (10) ofvolume. toderive thesampling interval software ImageJ using measured were extent rostro-caudal gyrus dentate the throughout (GCL/SGZ) zone subgranular and layer cell granular the of Areas (Olympus). software Cell^F with camera digital DP71 a and TRF AX70 Olympus an using yatpyi ad S9 quantification. PSD95 and Synaptophysin volume. Hippocampal Plasticity measures We also quantified and characterized DCX-positive cells based on their morphology their on based cells DCX-positive characterized and quantified also We quantification DCX and Ki67 Cresyl-stained sections were observed under 2X magnification magnification 2X under observed were sections Cresyl-stained A . (Ki67) (Ki67) DCX- and Ki67-positive cells were counted under under counted were cells Ki67-positive and DCX- and 4 A-D and htmcorps rm separate 3 from Photomicrographs (DCX). (DCX). 64 . Areas were summed and summed were Areas . 65,66 iue are Figures . . Accepted Probabilities levels. OTU and genus family, Phylum, at abundance on treatment of effect significant the correction BH comparison with tests Kruskal-Wallis each groups, all between For families. those to the assigned agglomerating (OTUs) Units by Taxonomic computed Operational were families all of abundances the depths, sampling variability.For all statistical individual analysis, natural feature to 2) but (figure graph analysis bar the statistical in presented before are data normalized untransformed were values PD1, on behavior maternal for groups between variance high the to Due necessary. when LSD Fisher using performed were comparisons hoc Post cells. DCX-ir of morphology the for as well as hilus and GCL/SGZ the in cells Ki67-ir on maternal weight, done IL6. measures ANOVAs were cations Repeated and volume, of analysis serum and neurogenesis hippocampal PSD95), (synaptophysin, plasticity synaptic of measures (AST/ALT), toxicity hepatic characteristics, litter PD2-6, across and PD1 on behaviors maternal separate on computed were ANOVAs One-wayArticle 5.03. version after calibration) area interest of the of of andthean background adjacent region level (grey density optical between difference the as calculated was density optical see Figure 5A. density synaptophysin of photomicrographs representative For (Olympus). software Cell^F with camera digital DP71 a and TRF AX70 Olympus a using objective 40X under mm -0.12 to mm 2.76 bregma (CG) gyrus cingulate the in photomicrographs irboe ttsia analysis. statistical Microbiome Prism GraphPad and Inc.) (Dell 13 Statistica software the using analyzed were Data Statistical analysis relative The software. (NIH) ImageJ with quantified were (OD) densities Optical were considered significant when p
< 0.05 was considered significant. considered< significant. 0.05was
Following rarefaction of all communities to even even to communities all of rarefaction Following p
< 0.05. <
59 were carried out to identify to out carried were 52,61 . 67 were taken were = 0.2770, = ( size litter alter not did treatment addition, ( state reproductive and treatment between ( treatment of effect significant no was ( period postpartum the and pregnancy during different significantly was dams the of weight the expected, As Roundup. or Glyphosate . (ABN maternalbehaviors additional ( dams Glyphosate-treated or control to compared offspring licking time more significantly spent dams treated Roundup ( behavior nest building p (ABN PD1 on affected significantly ( significance IL-6 serumlevels (Table ofcations 2). and ( AST on treatment of effects significant no also were There offspring. female to compared offspring male of 3.559, Acceptedpassive 0.66131; = Article p n PD2 On PD1 On Maternal behavior measured were parameters Several General toxicity RESULTS = 0.0526; Table 2), with Roundup treatment showing a slight increase in the number number the in increase slight a showing treatment Roundup with 2), Table 0.0526; = p F = 0.7616; Table 2). A trend toward a change in sex ratio was observed ( observed was ratio sex in change a toward trend A 2). Table 0.7616; = (2,16) F F (2,16) (2,16) , 6 tee a as a infcn mi efc o tetet n u licking pup on treatment of effect main significant a also was there -6, 5.0637, = ramn afce pp ikn bhvo i dm bt hs i nt reach not did this but dams in behavior licking pup affected treatment
F = 0.18884, = (2,16) F 2.9103 (2,16) = 1.857, = = 0.58698, = p’s p , 0098 Fgr 2) wt ps-o tss eeln that revealing tests post-hoc with 2B), Figure 0.01978, = 00) Tee ee o te sgiiat an fet on effects main significant other no were There 0.04). < p p
0.08357 = = 0.82974,Figure 2A). p = 0.1883) or ALT ( ALT or 0.1883) = F F (2,16) (2,16) p = 0.56754; off nest off 0.56754; = F = 1.5988, = = 0.68192, = F (2,16) , Figure 2A). No other maternal behaviors were were behaviors maternal other No 2A). Figure , (2,16) F o eie oeta gnrl oi efcs of effects toxic general potential define to (4,32) F 0.9118, = (2,32) (2,32) = 0.4579, = 2.114, = = 13.24, = p = 0.23281; blanket blanket 0.23281; = p = 0.51975; blanket blanket 0.51975; = F (2,16) p p = 0.6406) or litter weight ( weight litter or 0.6406) = p 041) n nt interaction not and 0.4217) = p 012) n a wih. In weight. dam on 0.1020) = = 1.347, = F < 0.0001; Table 2). But there there But 2). Table 0.0001; < (2,1 6) = 0.77431, = p = 0.2881) or serum or 0.2881) = F (2,16) F (2,16) = 0.62086, = p = 0.47755; = = 0.42441, = F (2,16) F (2,16)
= p
GCL/SGZ and hilus (respectively hilus and GCL/SGZ Therefore, ( gyrus dentate the of volume the on Roundup or building . Acceptedventral( GCL/SVZ ( inthedorsal neurons number DCX-ir ofimmature 0.0941). ( cells proliferative of number the on treatment of effect main significant ( hilus the to compare the GCL/SGZ in ventral found were cells Ki67-ir more significantly hippocampus, dorsal the to Similarly ( area and treatment the between interaction the in GCL/SGZ ( thaninthehilus cells proliferative more significantly were there expected As 3A). Figure 0.8610, Ki-67 of number the on area the and treatmentArticle the between interaction no and treatment of effects significant no were there hilus, and GCL/SGZ the passive 0.54994; = ipcma nuoeei (DCX). neurogenesis Hippocampal (Ki67). proliferation cell Hippocampal volume. Hippocampal Hippocampal Plasticity In the ventral region of the GCL/SGZ, there was strong tendency toward an an toward tendency strong was there GCL/SGZ, the of region ventral the In F
(2,16) total number of cell counts were used throughout. of celltotal number counts were used throughout.
= 0.35596, F F (2,15) (2,16)
= 0.28858, = = 2.0139, p
= 0.70591, Figure 2B). = 0.70591,Figure 2B). F (1, 16) (1, There were no significant effects of treatment by Glyphosate Glyphosate by treatment of effects significant no were There
F = 147.65, p (2, 16) (2,
= 0.1680,Figure 4B). p = 0.75314; off nest off 0.75314; = = 0.=65158, = F p hr ws o fet f h tetet n total on treatment the of effect no was There 1 16) (1,
< 0.0001). F Using repeated-measures ANOVAs between ANOVAs repeated-measures Using 2 16) (2, 383.16, = F F (2,15) 3.6168, = (2,16) p = 0.5345 and 0.5345 =
= 1.0597, 0.2633, = -ir cells in the dorsal region of the of region dorsal the in cells -ir F (2,16) p = 1.9319, = < 0.0001). There was no no was There 0.0001). < p 0009 Fgr 3B). Figure 0.05059, = p
= 0.3711, Figure 4A) or Figure 4A) or 0.3711, = p F = 0.7718, Table 3). 3). Table 0.7718, = (2, 16) (2, F (2, 16) (2, p = 0.17720; nest 0.17720; = = 0.15107, = = 2.7492, = p p
= = = 0.0016). There was also a significant difference in the maturation stages in the dorsal dorsal the in ( GCL/SGZ stages maturation the in difference significant a also was There 0.0016). = ( dams Control the compared to dams inRoundup-treated neurons proportion post-mitotic in ( the cells the and of maturation treatment the between interaction significant a revealed GCL/SGZ dorsal the ventral in or dorsal the in morphology of ( hippocampus terms in quantified cells DCX-ir of number . (respectively dams treated Roundup and Control both to compared density synaptophysin greater significantly having dams Glyphosate-treated with ( gyrus dentate ventral the in density synaptophysin dams (p Controls the to compared Roundup-treated and Glyphosate in synaptophysin of density greater significantly ( gyrus dentate the of region dorsal the in OD 0.001). ( development of stage each at cells of number the between differences significant with ( ( morphologies cell DCX on treatment 1.7504, p ( GCL dorsal the in neurons new the of morphology the on treatment the of effect ( development of stage each at cells of number difference in the distribution of the morphologies ( morphologies the of distribution the in difference F
Accepted(4,30) Article = 1.567, = Synaptophysin. the of effect main significant no also was there hippocampus, ventral the For morphology. cell DCX
= 0.2074). F (2,30) p’s p = 16.7734, = = 0.2086, Figure 4D). Similarly to the dorsal GCL, there was a significant significant a was there GCL, dorsal the to Similarly 4D). Figure 0.2086, = > 0.16). Repeated measures ANOVAs on the morphology of DCX-ir cells cells DCX-ir of morphology the on ANOVAs measures Repeated 0.16). > There was a signific a was There F (4,30)
< 0.02). There was also a significant main effect of treatment on treatment of effect main significant a also was There 0.02). < p = 3.0955, = < 0.0001, Figure 4C) with significant differences between the the between differences significant with 4C) Figure 0.0001, < hr een infcn dfeecs ewe gop i the in groups between differences significant no were There F (2,15) p = 0.0302, Figure 4C) with a significantly higher higher significantly a with 4C) Figure 0.0302, = ant main effect of the treatment on synaptophysin on treatment the of effect main ant = 2.014, = F (2,16) p ’s < 0.04). < ’s F = 9.807, = (2,30) F (2,16) p = 1515.907, = = 0.1680) nor an interaction effect effect interaction an nor 0.1680) = p = 7.064, = = 0.0025 and 0.0121). In the CA3 CA3 the In 0.0121). and 0.0025 = There was no significant main main significant no was There p = 0.0017, Figure 5A) with a a with 5A) Figure 0.0017, = p p = 0.0063, Figure 5B) Figure 0.0063, = < 0.0001, Figure 4D) 4D) Figure 0.0001, < F (2,15) p ’s < < ’s
= p
dentate gyrusdentate region or theCA3 ( (p’sControls < to compared groups Roundup and Glyphosate both in reduced being density synaptophysin . Firmicutes, D ( Firmicutes, show and level family ( Glyphosate and Control the to compared group Roundup in decrease a and increase an respectively with a found We 6). significant (Figure groups between significant level genus several and found family we phylum, PND22, at differences At shown). not (data treatment before i.e GD9, at groups between differences significant display not did microbiota gut the of Composition ( dorsal ( treatment of effect main significant synaptophysin and groupsControl Roundup ( compared density to 5.817, = ( density synaptophysin on treatment of effect main significant a also was there region, p ). Acceptedgroup Roundup in trend a with 0.013), = Article e lo on a infcn efc o te ramn on treatment the of effect significant a found also We We also evaluated the impact of the Glyphosate and Roundup on the gut microbiota. microbiota. gut the on Roundup and Glyphosate the of impact the evaluated also We Microbiome PSD95 a also was there gyrus cingulate the in density synaptophysin at looking When F (2,16) p ef p p = 0.0126, Figure 5C) with Glyphosate dams having a significantly greater greater significantly a having dams Glyphosate with 5C) Figure 0.0126, = p’s = 0.4293, = = 0.033 = fect of the treatment o treatment the of fect = 0.039), which were conversely more abundant in Roundup-treated dams dams Roundup-treated in abundant more conversely were which 0.039), = .
0.03). < 0.04; Figure 6 Figure 0.04; < There was no significant effects of the treatment on PSD95 density in the the in density PSD95 on treatment the of effects significant no was There ) which were less abundant in Roundup compared to Glyphosate dams dams Glyphosate to compared Roundup in abundant less were which ) ed p a significant effect of the treatment on treatment the of effect significant a = 0.6582, Table 4) or ventral ( ventral or 4) Table 0.6582, = F B). We further analyzed the gut microbiota variation at the at variation microbiota gut the analyzed further We B). (2,16) n Bacteroidetes ( Bacteroidetes
= 1.701, F (2,15) compared to Control ( Control to compared 4.908, = p = 0.2140,Table 4). p = 0.009) and Firmicutes ( Firmicutes and 0.009) = F (2,16) p 002, iue D with 5D) Figure 0.0229, = = 0.9545, = Erysipelotrichaceae p’s < (Phylum: (Phylum: Lachnospiraceae p = 0.065; Figure 6C and 6C Figure 0.065; =
0.02). 0.02). p = 0.4059, Table 4) Table 0.4059, = p (Phylum: (Phylum: = 0.006) = F (2,16) , Roundup compared to Control group ( group Control to compared Roundup Erysipelotrichaceae (Family: Butyricicoccus on treatment the of effect . perinatal the in as well as hippocampus, Roundup the of CA3 and gyrus dentate ventral and and dorsal in exposure Glyphosate following affected. not modified were was neurons synaptophysin immature Moreover, of number total the and proliferation cell dams, while Roundup of gyrus dentate dorsal the in neurons immature post-mitotic more were there Indeed, postpartum. brain maternal the in neurogenesis of aspects affected formulation in or alone Glyphosate that showed also we behavior, the to addition In behavior. maternal Roundup the of characteristics or other affecting without Glyphosate behavior licking maternal to altered significantly exposure perinatal that showed we specifically, More rats. affectGlyphosate neuroplasticity orRoundupmaternal behavior, dam in and dysbiosis induce Glyphosate andRoundup Moreover, ( groups Roundup and Control to comparatively group Glyphosate in ( Glyphosate to compared Roundup-treateddams ( groups Glyphosate and Control 0.04 ( Glyphosate to compared Accepted Article (p Controls to and Main findings of the present study show that peripartum exposure to a low dose of dose low a to exposure peripartum that show study present the of findings Main DISCUSSION p 0.039). = Ruminococcaceae C-1 gns ee significant were genus UCG-013 Ruminococcaceae = 0.056; Figure 6C and D). At the genus level, there was a significant main main significant a was there level, genus the At D). and 6C Figure 0.056; = (Family: (Family: , Phylum: Firmicutes) abundancy (respectively abundancy Firmicutes) Phylum: , Alloprevotella Clostridiaceae groups compared to Control groupscompared toControl p Alloprevotella = 0.017), and with a strong tendency in Roundup dams compared compared dams Roundup in tendency strong a with and 0.017), = Pyu: imcts and Firmicutes) Phylum: , p’s < 0.05; Figure 6 Figure 0.05; < ee oe ersne i te onu cmae to compared Roundup the in represented more were p = 0.056). In contrast contrast In 0.056). = Pyu: Firmicutes), Phylum: , (Family: p = 0.017), and there was strong tendency in strongtendency was there and 0.017), = Prevotellaceae E). E). ( p’s Turicibacter < 0.04; Figure 6E). Pyu: Bacteroidetes) Phylum: , p Turicibacter ly = 0.03, 0.03, = p’s were more abundant in in abundant more were decreased < 0.04; Figure 6E). 6E). Figure 0.04; < genus decreased decreased genus p = 0.021, 0.021, = (Family: n both in p = , . to important is It days. following the these reduced in significantly Accepted was licking dams spent Control time untreated and groups between different not were behaviors maternal Roundu or Glyphosate to pups onthe more licking their time tospend damstended Control In thepresent study, compared parturition, following day ALTcirculating levels and AST in mg/kg increase significant a 500 to led dose highest and the only where Glyphosate, 50 of BW/day 5, to weeks 5 for exposed rats male adult in obtained those with line two ALT, and aggression liver upon AST system vascular the of in released transaminases levels plasma low the by reflected level, biochemical dams in BW/d) exposure mg/kg 1000 peripartum and (500 rat pregnant in or juvenile in weight reduce to found were characteristics pregnancy during weight dams investigated that studies recent with Articleagreement in is observation This treatment. the by altered not were ratio sex weight, length, as such characteristics litter the Similarly, period. postpartum the and pregnancy throughout weight thesecould within formulations belinkedtoadjuvants formulations of effects the that observations previous confirming different, significantly also following were (Roundup) formulation outcomes the to or (Glyphosate) physiological alone compound active and the to exposure behavioral the that is here It highlight interest. of to region important the on depending profiles different with albeit gyrus, cingulate Glyphosate and maternal behaviors. Glyphosate and dam on effect significant no had Roundup and Glyphosate study, present the In Absence ofgeneral toxicity. 18,38,68 following exposure to relatively low dose of GBH. Only higher doses higher Only GBH. of dose low relatively to exposure following 69 . 68 . We also confirm the absence of visible toxicity at the the at toxicity visible of absence the confirm also We . 41,42 . p -treated animals. Additional animals. -treated 60 . These results are in are results These . 18,27 and litter and hepatic hepatic ite s nw aot h otoe n h mte ad h udryn pyilg. t is, It physiology. underlying the and however, mother the on outcome the about known is little offspring the on isolation pup of consequences long-term and short- the on focused have studies of number large a While pups. the with reuniting upon behavior licking in increase therefore, . It study. present the in Acceptedobserved as licking of amounts different in result could Roundup or important more ultrasonic and usuall is offspring male their toward dam the groomingfrom and licking turn, in and mother cues, the with contact olfactory initiate to likely more contact, is male the tactile rodents, in example direct For vocalizations. through mother the by given as effect the suggested colleaguesand by Mesnage for responsible be might formulation Roundup the in present tallowamine, from polyethoxylated as such damsadjuvant, the of one that be to could It groups. Glyphosate and Control compared behavior licking in increase an with 6, to PD2 between animal anxiety behavior depressive-like willresult or with associated environment social the of interpretation altered the that speculate can we rodents in behavior depression-like and anxiety increases herbicide based Glyphosate- to exposure adult or early that suggests work previous Interestingly, mother. Articlethe mother their with pups the of reintroduction the following groomingbehaviors and licking in increase an with associated being changes most with behaviors, maternal basal disrupts parturition after isolation or handling pup that show studies Previous litter. the cull and characteristics offspring record to minutes 10 to up for mother their from separated and handled were offspring the parturition following day the on that here highlight It is also interesting to note that the offspring influences the amount of parental care care parental of amount the influences offspring the that note to interesting also is It Rather surprisingly, the maternal behavior was later affected in the Roundup-treated Roundup-treated the in affected later was behavior maternal the surprisingly, Rather likely that separation causes some form of anxiety, not only for the pup, but also for also but pup, the onlyforanxiety, ofnot form causessome separation likelythat ugs ta Gyhst- n Roundu and Glyphosate- that suggest 80 – 82 . A misinterpretation of these cues by the mother exposed to Glyphosate to exposed mother the by cues these of misinterpretation A . 41,42,79 , but hypothesisthis be tested. remains to in modificationcare. inmaternal p tetd as do dams -treated not present this normal normal this present not 70 – 75 . Our observations, Our . 24,27,78 . Therefore, 76,77 y , Controls. The effect of Glyphosate alone on this parameter was not statistically significant significant statistically not was parameter this on to alone Glyphosate compared of effect dams The Controls. Roundup-treated of layer cell granule dorsal the doublecor in mature) neurons (more positive post-mitotic of number the in increase significant a found environment chemical the by affected strongly is hippocampus the in neurogenesis and neuroplasticity that shown also has rodents in period postpartum the and pregnancy during modulated strongly adulthood throughout neurons new of number large a produce to known are hippocampus the of gyrus dentate the in zone granular givingparts onoffspringand of investigatethemother/offspring outcomes both dyad. gi maternalcare- on effects their to part, in due, be may outcomesoffspring on manysubstances experiments cross-fostering by confirmed as exposed, were offspring and mother the both when behavior maternal affected 77 PCB congener biphenyl polychlorinated the Indeed, pups. the and mother the between feedback constant and interaction the from results behavior the mother), (the dyad mother/offspring would alter by thehypothesis butthis be care investigated. themother remains provided to pups by emitted vocalization ultrasonic the affected significantly lindane or chlorpyryfos as such offspring the by emittedcues . thatmind in kept be should Accepted care- maternal of importance the acknowledge to needs research Future behaviors. ving Article 84,85 w ban ein, h sbvnrclr oe f h ltrl etils n te sub- the and ventricles lateral the of zone sub-ventricular the regions, brain Two dentate the thehippocampus. Neurogenesis in gyrusof Glyphosate plasticity the and in maternal brain the of part one only investigated one, present the including studies, most While . The modification of the pup behavior following behavior pup the of modification The in utero in 83 . For example, perinatal exposure to organochloride pesticidesorganochloride to exposure perinatal Forexample, . 96 – 99 exposure of the offspring could have affected the sensory sensory the affected havethecould offspring of exposure nldn medication including 86 87– . This is an important reminder that the effects of effects the that reminder important an is This . 90 Ipraty hpoapl ergnss is neurogenesis hippocampal Importantly, . 66,100,101 in utero in I te rsn wr we work present the In . exposure to Glyphosate to exposure 33,91 – 95 . Research . tin - as well as synaptic vesicle recycling recycling vesicle synaptic as well as . Accepted that suggestbinding calcium in studies involved is but synaptophysin clear not still is system protein nervous this of central function precise the the within knowledge, neurons most in found be can and Roundu effectsand Glyphosate of specific region suggests This hippocampus. the of regions CA3 both and gyrus in dentate ventral expression synaptophysin increased alone Glyphosate cortex. the prefrontal of areamedial an gyrus, cingulate the in expression synaptophysin decreased interestingly, and gyrus dentate the of region dorsal the in expression synaptophysin increased Roundup consequences remain tobeinvestigated. behavioral the and region this within plasticity stronger to leads Articletherefore might neurons doublecortin postmitotic in increase present The interneurons. GABAergic gyrus dentate the to plasticity synaptic to contribute hippocampus the of gyrus dentate the in neurons new the for rather but se per Indeed, the information. new of contextualization spatiotemporal of learning plasticity and modulation for needed not is neurogenesis adult that suggested is it but known not are increase this of consequences The survive. stage this of cells period longer a or neurons these of maturation faster a relatedto several mechanisms of combination a of result a likely is treatment Roundup with hippocampus dorsal the in cells post-mitotic of number the of upregulation The proliferation. cell of measures in or hippocampus ventral the in evident were effects treatment No observed. also was increase an toward trend a but Synaptophysin is an membrane protein expressed at the surface of synaptic vesicles vesicles synaptic of surface the at expressed protein membrane an is Synaptophysin and Glyphosate to exposure peripartum that show also study present the of Findings in plasticity Synaptic the hippocampus 102– 104 while other surrounding neurons are usually inhibited by local local by inhibited usually are neurons surrounding other while p onsynaptic throughout proteins 112 . The change in synaptophysin expression following expression synaptophysin in change The . 107 , chanel formation chanel , the brain. the brain. 108,109 , exocytosis , 105,106 T our To . 110,111 , . herbicides Glyphosate-based or Glyphosate to exposure after brain rat have studies several the of regions as various in metabolism and release surprising neurotransmitter in change a demonstrated not perhaps is Glyphosate to exposure peripartum theyaffect outcomes. may behavioral how and relationships these of complexities the understand to needed is period postpartum the and pregnancy during brain female the in changes normative the with interacts herbicide hippocampus the in plasticity affect both period postpartum the and pregnancy that shows research Previous determined. be to remain motherhood to unique are in the hippocampus followingGlyphosate-based herbicide exposure to and striatum Glyphosate 26,38 to cortex, exposure perinatal a prefrontal after offspring adult the female and male in of hippocampus inhibited is transmission, synaptic terminate to cleft synaptic the in acetylcholine of breakdown the for responsible enzyme the esterase, offspring the toward care maternal proper alter can only region brain this within activity of modulation and behavior maternal of aspect motivation the in involved region brain fundamental a is accumbens nucleus the that noted the in Glyphosate to exposed rats binding Sprague-Dawley male adult in accumbens nucleus receptor specific D1-dopamine in reduction the to associated be also can 24 expression hydroxylase tyrosine of reduction the to related be to likely is dopamine changein hippocampus and cortex prefrontal in turnover dopamine in and hypothalamus and striatum the in turnover and release serotonin in increase an to lead Glyphosate of doses high Accepted Article levels dopamine of modulation The synthesis. dopamine for responsible enzyme key the , . Extracellular glutamate concentration and the reuptake of amino acids are also hindered hindered also are acids amino of reuptake the and concentration glutamate Extracellular . Whether or not the effects of glyphosate on the maternal brain reported in this study this in reported brain maternal the on glyphosate of effects the not or Whether 113 – 115 . In addition to monoamines, acetylcholine monoamines, to addition In . 33 . How exposure to this to exposure How . 21– 21,26 23,26,27 . 23 . For example, For . . It should be It should . 22 . The . . Acceptedbacteria soil on based mostly studies, glyphosate few A or surprise. complete a glyphosate not is of population bacterial effect on herbicide The phyla. 2 the on impact no having alone phylum the Round following in Firmicutes of increase reduction a an and Bacteroidetes showed we Indeed, manner. formulation-specific in albeit herbicide, glyphosate-based and glyphosate by affected is microbiota gut that demonstrate resulting the and disorders psychiatric to susceptibility system increased to behavior,leading nervous central the affect significantly to known is dysbiosis, dopamine and noradrenaline, GABA, including neurotransmitters synthesize and acids fatty as such metabolites bioactive provide to system, immune the modulate to ability its through system nervous central the influences anxiety and sociability as such behaviors, complex modulation the in resulting few, a name to neurogenesis and neurotransmission, axes, stress the of activation neuroinflammation, on influence major exert to known is system microbiota digestive precisely, the in More present processes. physiological key on influence profound a Article exert they and microbiota as collectively known bacteria, of speciesof hundreds with arecolonized organisms Multicellular bacteria. of that also but plants, of survival and growth the impacts suggested targetGlyphosate. direct for molecular have studies of handful a Only vertebrates. in Glyphosate the of target molecular the about question asked rarelyphysiology the animalGlyphosateopen on of effects to pointingreports are vertebrates of number increased the that However, herbicides. Glyphosate-based to exposed suggests if safe relatively action of mode This bacteria. and plants in found enzyme s nrdcd ale, h mlclr agt f lpoae s h poen PP, an EPSPS, protein the is Glyphosate of target molecular the earlier, introduced As MolecularGlyphosate target of First, as mentioned in the introduction, the inhibition of the enzyme EPSPS not only only not EPSPS enzyme the of inhibition the introduction, the in mentioned as First, 124 bt lo n nml pce, rm insects from species, animal in also but , 121,122 Ay yrglto o te u mcoim, or microbiome, gut the of dysregulation Any . 48,125 o reptiles to up exposure, the Glyphosate Glyphosate the exposure, 120,123 126 116 n mammals and – 120 . Our results clearly results .Our Gt microbiota Gut . 127,128 , NMDA receptors, with lower stability of Glyphosate binding at glycine binding pocked pocked binding glycine at binding Glyphosate of stability lower of with cavities receptors, NMDA glycine and glutamate to bind may Glyphosate that demonstrates simulation Colleagues and Cattani by suggested receptor, NMDA mightthat this bethe case toxicity vertebrate for collaborators and microbio the affecting be could themselves by adjuvants Round to linked are study present the in microbiome the on effects pronounced most the that note to interesting is Indeed, it organisms. the adjuvants,impactmight with combination in oralone Glyphosate, how understand to detail more in investigated be to deserve ecosystem, microbiota complex the on as well as bacteria, of species various on herbicide Glyphosate-based or Glyphosate correlation only are studies these that note Prevotellaceae of family the of population reduced and disease Alzheimer’s and Parkinson between association an found have studies while study, exposure in changes similar Bacteroide report bees, in also but rats in studies, other findings, our support To autism including disorders, health mental to associated is populations Firmicutes or Bacteroidetes of dysregulation a that suggested have studies few a understood, from farknowledge, our to is, physiology brain for phyla bacteria these of each . Accepted less in result could glyphosate of organisms target the within penetration the increase to formulation the to added adjuvants undefined, Article ecology. microorganism on pesticide the of effect the investigated scn mlclr agt f lpoae s h drc atvto o glutamatergic of activation direct the is Glyphosate of target molecular second A 40,48,127,128 te s and/or Firmicutes following Glyphosate or Glyphosate-based herbicide herbicide Glyphosate-based or Glyphosate following Firmicutes and/or s . Similarly, the population of the genera Alloprevotella is increased in our in increased is Alloprevotella genera the of population the Similarly, . consequences for the potential targeted organisms. Alternatively, these these Alternatively, organisms. targeted potential the for consequences up treatment. One hypothesis is the presence of multiple, yet mostly mostly yet multiple, of presence the is hypothesis One treatment. up 124 138,139 . Thisdifferential beinvestigated. should effect . A low penetration of glyphosate in the absence of adjuvant of absence the in glyphosate of penetration low A . 41,42,79 al and the precise consequences of the impact of of impact the of consequences precise the and . A very few studies, on soil bacteria suggest bacteria soil on studies, few very A . 129 26 ta 134 Ide, hi mlclr dynamic molecular their Indeed, . – population, as suggested Mesnage Mesnage suggested as population, 131 – 137 and Alzheimer's disease disease Alzheimer's and t s biul motn to important obviously is It . While the precise role of of role precise the While 132,133 . Glyphosate. Mg of increase significant rat male adult in dependent-way dose a in kidney and spleen Zn of levels altered Glyphosate of mg/kg) (500 doses high or mg/kg) (50 medium mg/kg), (5 low that revealed colleagues and Tang vertebrate. in concentrations ion on Glyphosate of effect the investigated study one only knowledge, our To treatments. Ca of levels plasma study present the In organism. the for effects adverse major to lead therefore would elements these (Ca communication (Fe cellulartransport oxygen and formation bone including functions, physiological Mg Ca including cations, divalent of presence The cations. divalent with particularly . the in changes to related causally are brain maternal Accepted the in changes how investigate to be would present study importance Of inthe offspring. and particular thesethe mother effectson of extent the determine to needed is research much the acknowledge we However, behavior. whetherchangescould physiology theobserved lead inthe organism. toalter define and cations divalent on Glyphosate of effect potential this investigate should studies Article the and Glyphosate-basedkidney liver herbicides following orvarious exposure toGlyphosate the as such tissues, other in observed also was activation, receptor NMDA of independently stress, oxidative that out pointed be should It experimentally. tested be to damage oxidative and dysfunction mitochondrial triggering Ca neuronal the increase likely would interaction This one. glutamate with compared 2+ s f udmna iprac fr h ognss s hy atcpt i various in participate they as organisms the for importance fundamental of is This is the f the is This FutureDirections hr yohssfrmlclrtre steceaigrl f Glyphosate of role chelating the is target molecular for hypothesis third A hr ws o nomto aot h pam lvl. t s la ta additional that clear is It levels. plasma the about information no was There irst study to investigate how glyphosate may affect the maternal brain and and brain maternal the affect may glyphosate how investigate to study irst 2+ ) and enzyme cofactors (Ca cofactors enzyme and ) 2+ in the brain following exposure for 35 days to 50 and 500 mg/kg 500 and 50 to days 35 for exposure following brain the in 2+ Fe , 2+ Mn , 2+ n Mg and 2+ 2+ , Mg , ee uniid u nt fetd by affected not but quantified were 2+ ) to name a few. An alteration of alteration An few. a name to ) 26 . This direct interaction remains interaction direct This . 69 I adto, hy on a found they addition, In . 2+ n Fe and 140 2+ 2+ – n liver, in , Fe , 50,144 143 2+ entry, . 2+ – 2+ 146 or ), , . experimental Most mother. on have can chemicals environmental that the role to points important work this together, Taken Glyphosate. and adjuvants the of interaction the to or adjuvants of action direct a to due potentially outcomes, different have can the formulation to or Glyphosate of compound mother. active the the to exposure in that show dysbiosis also we gut Importantly, induces and plasticity neuronal behavior, maternal alters NOAEL, accepted currently the of tenth a at (Roundup), formulation in or alone Glyphosate Glyphosate can and impact Roundup endocrine to linked be could anddisruption, future will investigate work possibility. this present the in observed glyphosate of effects behavioral activity secretion steroid disrupt can formulation in cell lines, human on research Previous mother. the in hormones adrenal and gonadal of actions central of exposureonneurobehavioral this outcomes. extent the determine to valuable be would offspring and mother the both on doses of range a (0.5 Union European the in or mg/kg/bw/day ≥ peak,is atits earlypostpartum period. in the care-giving the time the at MPOA) e. (i. behaviors care-giving maternal in role key a playing areas in changes brain investigating from benefit would work future but weaning, of time the at plasticity hippocampal on focused we study present the In behaviors. care-giving maternal Accepted Article 50 mg/kg/day) but high compared to authorized daily intake (ADI) in the USA (1.75 (1.75 USA the in (ADI) intake daily authorized to compared high but mg/kg/day) Our work adds to a growing body of research highlighting that low doses of of doses low that highlighting research of body growing a to adds work Our Conclusion and peripheral alters Roundup or Glyphosate whether determined be to remains It (usually studies other most to compared dose low relatively a used study present The 151 let h eat ehnss ean t determined to remains mechanisms exact the albeit human breast cancer cells cells cancer human breast and rodents and rodents vertebrate physiology. In physiology.vertebrate showthat thepresentwe study mg/kg/bw/day). Further research investigating investigating research Further mg/kg/bw/day). 147 have shown that glypho that shown have – 149 etoe receptors estrogen , . h pyilgcl and physiological The sate-based herbicides sate-based 150 n aromatase and previous version ofarticle. this the on comments useful extremely their for reviewers anonymous 2 the thank also to like We would work. this to contribution technical their for Pontais Claire Florence Nmezu, and Niece Montmasson Renoult, Charlène thank also We analysis. for assistance their for LERES the and Samson Michel and Rennes CHU du Biochimie of Department the thank We ACKNOWLEDGEMENTS publication. for article the submit to decision the in and report, the of writing the in data, of interpretation 2018). Emergents (Défis 1 Rennes of University the and Métropole Rennes (SAD), Bretagne Région La by supported was TDC FUNDING herbicides. . Accepted design, study in involvement no had sources Funding Articlefléchée UR1). Glyphosate and Glyphosate to exposure following outcomes the evaluate better can agencies regulatory that so needed is area this in research Further investigated. never almost are behavior and brain dam’s the on effects potential surprisingly, rather and, development offspring on compounds various of toxicity investigate to developed been have paradigms JD is funded from the University of Rennes 1 (Bourse (Bourse 1 Rennes of University the from funded is JD n h cleto, nlss and analysis collection, the in -based . Williams GM,Kroes R,Munro IC. Safety Evaluation and Risk Assessment of the Herbicide 5. Herrmann KM,Weaver LM. ShikimateThe Pathway. 3. . Accepted Portier CJ, Clausing P.Re: Tarazona et al. (2017): Glyphosate toxicity andcarcinogenicity: a 14. ECHA. Committee Riskfor Assessment RAC. Opinion proposing harmonised classification 13. European FoodSafety Authority (EFSA). Conclusion reviewon the peer of pesticidethe risk 12. IARC. Monographs, volume 112: some organophosphate insecticides and herbicides: 11. Mink PJ, Mandel Sceurman JS, al. et Epidemiologic BK, studies glyphosate of and cancer: A 10. LeeWJ, Lijinsky W,Heineman Agricultural al. EF,et pesticide use and adenocarcinomas of 9. De RoosAJ, Blair A, Rusiecki Cancer JA, et al. incidence among glyphosate-exposed 8. 7. Article Guyton KZ, Loomis D,GrosseY,et al. Carcinogenicity tetrachlorvinphos, of parathion, 6. Steinrücken HC, Amrhein N. The herbicide glyphosate is a potent inhibitor of 5- 4. Benbrook CM. Trends glyphosate in herbicide use thein United States and globally. 2. Myers Antoniou JP, MN, Blumberg al. B, et Concerns over of use glyphosate-based herbicides 1. REFERENCES 1999;50:473 2000;31:117 Roundup and Its Active Ingredient, Glyphosate, Humans.for 54. EurSci doi: doi: 10.1007/s00204-017-1962-5. ArchToxicol review of the scientific basis of Europeanthe Union assessment and its differences with IARC. 5ca1-31d6- 8967-Sf124f1ab7ae (2017, accessed 16 June 2017). and labelling EU at level of glyphosate., https://echa.europa.eu/documents/10162/2d3a87cc- 2015. DOI: 10.2903/j.efsa.2015.4302. assessment of the active substance glyphosate. risks- march 2015,https://monographs.iarc.fr/iarc-monographs-on-the-evaluation-of-carcinogenic- tetrachlorvinphos, parathion, malathion,diazinon and glyphosate. Iarc working group. 3 review. stomachthe and oesophagus. pesticide applicators thein Agricultural Health Study. Agricultural Health Study. An malathion, diazinon, and glyphosate. 1980;94:1207 enolpyruvylshikimic acid-3-phosphate synthase. and risks associated with exposures: aconsensus statement. dreotti G, Koutros S, Hofmann et al. JN, Glyphosate Use andCancer Incidence thein to ;28. Epubahead of Decemberprint 2016.DOI: 10.1186/s12302-016-0070 -humans-4/ accessed (2015, 5December 2018). Regul Toxicol Pharmacol – – 165. 503. – 1212. JNCI JNatl Cancer Inst Occup Environ Med . 2012;63:440 Lancet Oncol EFSA J . 2017;91:3195 – 452. Biochem Biophys Res Commun . 2004;61:743 . 2015;16:490 . 2018;110:509 Annu Rev Plant Physiol Plant BiolMol Environ Health Perspect ;13. Epub;13. ahead of print November Environ Health Regul ToxicolRegul Pharmacol – 3197. – – 749. 491. – 516. . 2016;15:19. . 2005;113:49 . -0. Environ . –10 – . 9 Paganelli A, Gnazzo Acosta V, H, et Glyphosate-basedal. herbicides produce teratogenic 19. . Accepted Bridges RS. Long-term alterations in neural and endocrine processes induced by motherhood 28. Gallegos CE, Bartos M, Bras C, et al. Exposure to a glyphosate-based herbicide during 27. CattaniD, Cesconetto PA, MK, Tavares Developmental et al. exposure to glyphosate-based 26. Y, Aitbali Ba- 25. Bali Ait Y, Ba-Mhamed S,Bennis M. Behavioral and Immunohistochemical Study the of 24. Hernández-Plata I, Giordano M,Díaz-Muñoz M,et al. The herbicide glyphosate causes 23. Martínez M-A, I, Ares al. Rodríguez et Neurotransmitter J-L, changes in rat brain regions 22. CattaniD, de Liz Oliveira Cavalli HeinzVL, CE, al. et Rieg Mechanisms underlying the 21. Article Zhang J,Kuang S,Xu X, et Biological al. impacts of glyphosate on morphology, embryo 20. Dallegrave E, Mantese FD, Oliveira RT, et al. and Pre- postnatal toxicity commercial the of 18. Tarazona Court-MarquesJV, D, TiramaniResponse M, et al. to the reply by C.Portier J. and 17. Tarazona Court-MarquesJV, D, TiramaniGlyphosate M, et al. toxicity andcarcinogenicity: a 16. 15. effects onvertebrates by impairing retinoic acid signaling. 1595. in mammals.in 2016;53:20 pregnancy and lactation induces neurobehavioral alterations in rat offspring. excitotoxicity andoxidative stress. herbicide and depressive-like behaviorin adult offspring:Implication glutamateof 49. microbiota, anxiety anddepression-like behaviors mice.in Epub ahead of print 8August 2017. DOI: 10.3389/fnbeh.2017.00146. Effects Subchronic of and Chronic Exposure Glyphosate to in Mice. NeuroToxicology behavioral changes and alterations in dopaminergic markers in male Sprague-Dawley rat. following glyphosate exposure. Involvement glutamate of excitotoxicity. neurotoxicity induced by glyphosate-based herbicide in immature rathippocampus: 280. biomechanics and larval behavior in zebrafish (Danio rerio). glyphosate formulation in Wistar rats. Toxicol scientific basis of the European Union assessment and its differences with IARC’. P. Clausing, concerning our review Arch Toxicol review of the scientific basis of Europeanthe Union assessment and its differences with IARC. differences with IARC. doi: 10.1007/s00204-017-1962- carcinogenicity: areview of the scientific basis of the European Union assessment and its Portier CJ, Clausing P.Update ‘Re:to Tarazona et al. (2017): glyphosate toxicity and . 2017;91:3199 – 28. . 2017;91:2723 Horm Behav M’hamed S,ElhidarN, al.et . 2015;46:79 – 3203. . 2016;77:193 – 2743. – 91. Environ Res Toxicology ‘Glyphosate toxicity andcarcinogenicity: areview of the Arch Toxicol – 203. Toxicology Glyphosate based- herbicide exposure affects gut . 2018;161:212 . 2017;387:67 . 2007;81:665 . 2014;320:34 5’. 5’. Chem Res Toxicol Arch Toxicol Neurotoxicol Teratol – – 219. Chemosphere 80. – – 673. 45. Front Behav Neurosci . 2018;92:1341. . 2017;181:270 NeuroToxicology . 2010;23:1586 . 2018;67:44 Arch – ;11. – – . 5 Fanselow MS,Dong H-W. Arethe Dorsal and Ventral Hippocampus Functionally Distinct 35. Pereira M.Structural andFunctional Plasticity the in Maternal Brain Circuitry. 34. Slattery DA, Hillerer KM. The maternal brain under stress: Consequences for adaptive 31. Lévy F.Neuroendocrine control of maternal behavior in non-human human and mammals. 30. . Sherwin E,Dinan CryanTG, Recent developmentsJF. understandingin the role of gut the 44. Bonvallot N, Canlet C, Blas-Y-Estrada F, et Metabolomeal. disruption of pregnant rats and 43. Mesnage R,Bernay B, Séralini G-E. Ethoxylated adjuvants glyphosate-basedof herbicides are 42. Defarge N, E,Takács Lozano VL, et Co-Formulantsal. Glyphosate-Based in Herbicides 41. Lozano Defarge VL, N,Rocque L-M, al.Sex-dependent et impact of Roundup on the rat gut 40. Yu N, Tong Y, ZhangCircular D,al. et RNA expression profiles hippocampusin frommice 39. Gallegos CE, Baier CJ, Bartos M, et al. Perinatal Glyphosate-Based Herbicide Exposure in 38. Coullery RP, Ferrari ME, RossoSB. Neuronal development growth andaxon are altered by 37. Moser MB, Moser EI. differentiation Functional thein hippocampus. 36. Leuner B, Sabihi S. The birth of new neurons in the maternal brain: Hormonal regulation and 32. Kohl Autry J, AE, Dulac C. The neurobiology parenting: of A neural circuit perspective. 29. Accepted Article Pawluski Lambert JL, KG, Kinsley CH. Neuroplasticity maternal the in hippocampus: Relation 33. Structures? Adolesc Dev 2016;41:114 peripartum plasticity andits potential functional implications. Ann Endocrinol 1998;8:608 microbiota in brain health and disease. DOI: 10.1371/journal.pone.0198448. environmental contamination Brittany. in offspringtheir resulting from exposure repeated to a pesticide mixture representative of active principles of human toxicity. cell Health Disrupt Aromatase Activity Human in CellsLevels. below Toxic microbiome. perinatalwith glyphosate exposure. Recognition Memory. AltersRats Brain Antioxidant Status, Glutamate and Acetylcholine Metabolism Affects and 161. glyphosate through a WNT non-canonical signaling pathway. functional implications. BioEssays News Rev Mol Cell Dev Biol to cognitionto and effects of repeated stress. . 2016;13:264. – Neuron . 2016;2016:23 – 619. Toxicol Rep 128. . 2016;77:114 . 2010;65:7 Neurotox ResNeurotox Front Neuroendocrinol . 2018;5:96 – 46. – – 125. 19. Biochem Biophys Res Commun . 2018;34:363 – 107. Ann N AcadY Sci . 2017;39:1 Toxicology PLoS ONE;13. Epubahead printof 20 2018.June Horm Behav . 2016;41:99– – – 374. . 2013;313:122 11. . 2016;77:86– . 2018;1420:5 113. NeuroToxicology Front Neuroendocrinol Int JEnviron Res Public – . 2018;501:838 128. 97. Hippocampus – 25. New Dir Child . 2016;52:150 – . 845. . – 2 Pawluski van JL, Donkelaar E,Abrams Z, al. et Fluoxetine Dose Administration and Method 52. Samsel A, Seneff S.Glyphosate, pathways modern to diseases III: Manganese, neurological 51. Mertens Höss M, S,Neumann G,et Glyphosate,al. a chelating agent 50. Shehata AA, Schrödl W,Aldin AA, et al. EffectThe of Glyphosate onPotential Pathogens and 49. Wang AR, Ran C,Ringø al. E,et Progress in fish gastrointestinal microbiota research. 46. . Accepted Amacher DE. Serum transaminase elevations as indicators hepatic of injury following the 60. Hochberg Y, Benjamini Y. More powerful procedures multiplefor significance testing. 59. Wang Q, Garrity GM, Tiedje etNaiveJM, al. Bayesian Classifier for Rapid Assignment of 58. DeSantis TZ, Hugenholtz P, Larsen N,et al. Greengenes, Chimera-Checked a 16SrRNA Gene 57. SunY, Y, Cai Huse SM, et Aal. large-scale benchmark study existing of algorithms for 56. Edgar RC, Haas BJ, Clemente UCHIME JC, et al. improves sensitivity and speed chimeraof 55. Schloss PD, Westcott SL, Ryabin T, et Introducingal. mothur: Open-Source, Platform- 54. 53. Article Motta EVS, Raymann K, Moran NA. Glyphosate perturbs the gut microbiota of honey bees. 48. Ackermann Coenen W, M, Schrödl W, Influence et al. The of Glyphosate on the Microbiota 47. Tognini P.Gut Microbiota: A Potential Regulator Neurodevelopment. of 45. Aquac Differentially Affect Hippocampal Plasticity Adult in Female Rats. DOI: 10.4103/2152-7806.153876. diseases, and associated pathologies. risk assessment? Beneficial Members of Poultry Microbiota In Vitro. ahead ahead printof 2014. DOI: 10.1155/2014/123026. Neurosci administration drugs.of Med 5267. rRNA Sequences into the New Bacterial Taxonomy. 5072. Database and Workbench Compatible with ARB. taxonomy-independent microbial community analysis. detection. Communities. Independent, Community-Supported Software for Describing andComparing Microbial assemblies. Magoč SalzbergT, SL. FLASH: fastlength adjustment of short reads to improve genome Proc Natl Acad Sci and Production Botulinumof During Neurotoxin Ruminal Fermentation. 2015;70:374 . 1990;9:811 . 2018;10:626 ;11. Epub;11. ahead of 2017. print DOI: 10.3389/fncel.2017.00025. Bioinformatics Bioinformatics – 382. Appl Environ Microbiol – Environ Sci Pollut Res 818. . 2018;115:10305 – 640. Regul Toxicol Pharmacol RTP . 2011;27:2194 . 2011;27:2957 – Surg Neurol Int 10310. . 2009;75:7537 . 2018;25:5298 – 2200. – 2963. Appl Environ Microbiol Curr Microbiol ;6. Epub ahead of print 24 March 2015. Appl EnvironAppl Microbiol – – 7541. Brief Bioinform . 2012;13:107 . 1998;27:119– 5317. Neural Plasticity . 2013;66:350 —relevant for ecological 130. Curr Microbiol Front Cell . 2006;72:5069 . 2007;73:5261 – 358. . Epub – 121. Rev Stat . – – 68. Paxinos G,Watson C. brain The rat stereotaxicin coordinates. 5th edition. 67. Plümpe Ehninger T, D, Steiner B, et al. Variability doublecortin-associated of dendrite 65. Schneider CA, Rasband WS, Eliceiri KW. NIHImage ImageJ: to 25years of image analysis. 64. Pawluski Császár E,JL, Savage Effects al. E,et of stress early gestation in on hippocampal 63. Pawluski van JL, den Hove DLA, RayenI, Stress al. et andthe pregnant female: Impact on 62. . Giachino C, Canalia N,Capone F,etMaternal al. deprivation and early handling affect density 76. Pryce CR, Bettschen D,Feldon Comparison J. of the effects of early handling and early 75. LiuD,Diorio J, TannenbaumMaternal al. B, care, et hippocampal glucocorticoid receptors, 73. LeeMHS, Williams DI. Changes in licking behaviour rat motherof following handling of 72. Kosten TA, Kehoe P.Immediate and enduring effects of neonatal isolation on maternal 71. BarnettSA, Burn Early J. Stimulation and Maternal Behaviour. 70. TangHu P,LiJ, Y, etIon al. Imbalance IsInvolved the in Mechanisms Liver Oxidative of 69. Workman Gobinath JL, AR, Kitay NF, et Parityal. modifies the effects of fluoxetine and 66. Gemmel M,Hazlett M, Bögi al. E,et Perinatal fluoxetine effects on social play, HPA the 61. Accepted Marmendal M,Roman E,Eriksson CJP, et al. Maternal separation alters maternal has care, but 74. Article aruich irulnikJ, F, proliferation.cell maturation in adult hippocampal neurogenesis is independent of the regulation of precursor Nat Methods 2015;290:379 neurogenesis and glucocorticoid receptor density pregnant in rats. 580. hippocampal cell proliferation, but not affective-like behaviors. Activity Pregnant in Rats and Their Fetuses. behavior periadolescentin rats. calciumof binding protein-containing neurons in selected brain regions and emotional deprivation onmaternal care in the rat. and hypothalamic-pituitary-adrenal responses to stress. young. AnimBehav behavior in rats. 2017. DOI: 10.3389/fphys.2017.01083. Damage Rats in Exposed to Glyphosate. Neuropharmacology corticosterone onbehavior, stress reactivity, andhippocampal neurogenesis. pre-gestational maternal stress. system, andhippocampal plasticity pre-adolescent in male and female rats: Interactions with 2004;45:140 minor effects on behavior and brain opioid peptides in adult offspring. – . 2012;9:671 – 152. 388. Int J Dev Neurosci BMC Neuros . 1974;22:679 . 2016;105:443 Sof Sof – a Gimenez M 675. ci Psychoneuroendocrinology Neuroscience . 2006;7:77. – 681. . 2010;28:53 – 453. Dev Psychobiol . Effect of. Effect the Herbicide Glyphosate on Enzymatic Front Physiol Environ Res . 2007;145:568 – 61. ;8. Epubahead of print 19December . 2001;38:239– Science . 2001;85:226 . 2017;84:159 – 578. . 1997;277:1659 Horm Behav Nature Neuroscience 251. Dev Psychobiol . 1967;213:150 – 231. – 171. . 2011;59:572 – . 1662. – . 152. – 4 Rivera S,Sanfeliu C, García et al.Increase M, in rat pup ultrasonic isolation calls induced by 84. Zimmerberg B, Rosenthal StarkAJ, AC. Neonatal social isolation alters maternalboth and pup 83. S, Porrini Belloni SetaV, EarlyDD, al. et exposure to alowdose of bisphenol A affects socio- 82. . Hillerer NeumannKM, ID, Couillard-Despres S,et al. Lactation-induced reduction in 93. LAM, Galea Leuner B, Slattery DA. Hippocampal Plasticity the during Peripartum Period: 92. Darnaudéry M,Perez-Martin M,Del Favero F, Early et al. motherhood in rats is associated 91. Zhao C,Deng W,Gage Mechanisms FH. Functional and Implications Adult of Neurogenesis. 90. Ming G, Song H. Neurogenesis Adult thein Mammalian Brain: Significant Answers and 89. Migaud M, Batailler M, SeguraEmerging S,et al. newsites for adult neurogenesis the in 88. Venerosi A, Ricceri L,Scattoni ML, et al. Prenatal chlorpyrifos exposure alters motor behavior 85. Moore CL. Maternal contributions theto development masculineof sexual behavior in 81. Della Seta D,Minder I, Dessì-Fulgheri F, al.et Bisphenol-A exposure during pregnancy and 80. Mesnage R,Antoniou MN. Ignoring Adjuvant Toxicity Falsifies the Safety Profile of 79. Baier CJ, Gallegos CE, Raisman-Vozari R, et al.Behavioral impairments following repeated 78. Veenema AH. Early life stress, developmentthe of aggression and neuroendocrine and 77. Accepted Lim DA, Alvarez-Buylla A.Adult neural stem stake cells Trends ground. Neurosci their 87. Cummings Nunez JA, AA, Clemens LG. A cross-fostering analysis of the effects PCBof 77 86. Article lindane. behaviors in rats. se 2014;24:673 hippocampal neurogenesis is reversed by repeated stress exposure. Influence of SexSteroids, andStress Ageing. amodificationwith of hippocampal function. Cell Significant Questions. zones. mammalian brain: acomparative study between the hypothalamus and the classical neurogenic and ultrasonic vocalization cd-1in mouse Environ pups. Health laboratory rats. lactation affects maternal behavior rats.in 10.3389/fpubh.2017.00361. Commercial Pesticides. 2017;64:63 intranasal glyphosate-based herbicide administration in mice. 2009;30:497 neurobiological correlates: What we can learn frommodels? animal 2014;37:563 maternalon the behavior of rats. xual behavior of juvenile female rats. . 2008;132:645 Eur JNeurosci Neurotoxicology – 72. – – – 683. 571. 518. Dev Psychobiol Dev Psychobiol – 660. . 2010;32:2042 Neuron. 2011;70:687 Front Public Health . 1992;13:235 . 1984;17:347 Physiol Behav . 2003;42:52 – 2052. – Brain ResBull 239. Brain Res Bull – ;5. Epub;5. ahead printof 22 January 2018. DOI: – 702. J Neuroendocrinol Psychoneuroendocrinology – 356. 63. . 2005;85:83– . 2005;65:261 . 2005;65:255 – 91. Neurotoxicol Teratol . 2009;8:12. . 2014;26:641 Hippocampus Front Neuroendocrinol – 266. 260. . 2007;32:803 – 648. . . – . 812. . 0. Gemmel M,Harmeyer D, Bögi al. E,et Perinatal fluoxetine increases hippocampal 100. Wang L,Ohishi AkaneT, H, al. et Reversible effect of developmental exposure to chlorpyrifos 99. Mishra D, Tiwari SK, Agarwal S,et al. Prenatal Carbofuran Exposure Inhibits Hippocampal 97. Hossain MM, DiCicco-Bloom E,Richardson HippocampalJR. ER Stress andLearning 96. . Accepted Thomas L,Hartung K, Langosch D,al. et Identification synaptophysin of a as hexameric 109. Sudhof LottspeichTC, F, Greengard P, et Aal. synaptic vesicle protein with anovel 108. Rehm H, Wiedenmann B,Betz H. Molecular characterization of synaptophysin, a major 107. Wiedenmann B,Franke WW. Identification and localization of synaptophysin, an integral 106. Navone R, F,Jahn Gioia GD, al. et Protein p38: an integral membrane protein specific for 105. Schmidt-Hieber C, P,Jonas Bischofberger Enhanced J. synaptic plasticitygenerated in newly 104. Marín-Burgin A, Mongiat LA, Pardi MB,etUnique al. Processing During aPeriod High of 103. Ge S,Yang C, Hsu al. K, et A Critical Period for Enhanced Synaptic Plasticity in Newly 102. Pawluski Charlier JL, TD, Fillet M,et al. Chronic fluoxetine treatment and maternal adversit 101. Article Pizzurro DM, Dao CostaK, LG. Diazinon and diazoxon impair the ability astrocytes of to 98. Pawluski Galea JL, LAM. Reproductive experience alters hippocampal neurogenesis during 95. Leuner B, Mirescu C, Noiman al. L,et Maternal experience inhibits productionthe of 94. but notbut onmaternal behavior, in the ratdam. neurogenesis and reverses the lasting effects of pre-gestational stress onserum corticosterone, Toxicol on late-stage neurogenesis inhippocampal the dentate gyrus mouse in offspring. 2012;127:84 Neurogenesis and Causes Learning andMemory in Deficits Offspring. Deficits Following Repeated Pyrethroid Exposure. 168. differentially alter neurobehavioral outcomes in the rat dam. channel protein of the synaptic vesicle membrane. cytoplasmic domain and four transmembrane regions. calcium-binding protein of synapticthe vesicle membrane. 1985;41:1017 membrane glycoprotein of 38,000Mr characteristic of presynaptic vesicles. small vesicles neuronsof and neuroendocrine cells. granule ofcells adultthe hippocampus. Excitation/Inhibition Balance Adult-Born in Neurons. Generated Neurons of the Brain.Adult 2014;274:372 foster neurite outgrowth in primary hippocampal neurons. postpartumthe period in the dam. adrenal steroids. immature neurons in the hippocampus during the postpartum period through elevations in . 2013;38:25 – 100. – – 382. 1028. Hippocampus – 36. . 2007;17:434 Neuroscience Neuron Nature – Behav Brain Res 4 . 2004;429:184 . 2007;54:559 42. . 2007;149:53 Science Toxicol Sci J BiolCell Science Science . 1988;242:1050 Toxicol Appl Pharmacol EMBO J Behav Brain Res – – . 2018;339:222 – 566. . 1987;238:1142 . 2012;1214956. . 2015;143:220 . 1986;103:2511 67. 187. . 1986;5:535 Toxicol Sci – 1053. Cell – – . 2012;228:159 231. – 228. – 1144. 2527. . – Reprod 541. . . – y 1. Forsythe P, Kunze WA. Voices from gut within: and microbes the CNS. 116. Numan Stolzenberg M, DS. Medial preoptic area interactions with dopamine neural systems in 114. Numan Motivational M. systems and neuralthe circuitry maternal of behavior thein rat. 113. Evans Cousin GJO, MA. Tyrosine phosphorylation of synaptophysin in synaptic vesicle 112. Mullany PM,Lynch MA. Evidence for a role for synaptophysin expressionin of long-term 111. . RP, Kittle McDermid KJ, Muehlstein L,et al. Effects glyphosateof herbicide on the 126. DaiP,Yan Z, S, Ma et The Herbicideal. Glyphosate Negatively Affects Midgut Bacterial 125. Dinan CryanTG, JF. The impact gut of microbiota brain and on behaviour: implications for 121. Sherwin E,Sandhu KV, Dinan etTG, al. May the Force BeWith You: The Light and Dark 120. Sampson Mazmanian TR, Control SK. of Brain Development, Function, and Behavior by the 119. Mayer EA, R,Knight Mazmanian SK, al.et Gut Microbes and the Brain: Paradigm in Shift 118. Foster LyteJA, M, Meyer al.E, et Gut Microbiota and Brain Function: An Evolving in Field 117. Stolzenberg DS, McKenna JB, Keough et Dopamineal. S, D1receptor stimulation of the 115. Alder J, Xie Z-P, Valtorta Antibodies al.F, et to synaptophysin interfere with transmitter 110. 2. Dinan StillingTG, RM, Stanton C, et al. Collective unconscious: How gut microbes shape 122. Accepted Banks Kennedy ML, AC, Kremer RJ, et Soilal. microbial community response to surfactants 124. Moos WH, Faller DV, Harpp DN, al. et Microbiota and Neurological Disorders: A Gut 123. Article 2013;70:55 2009;30:46 controlthe of onsetthe and maintenance of maternal behavior in rats. Psychobiol recycling. potentiation rat in dentate gyrus. Bull gastrointestinal microflora Hawaiianof green turtles (Chelonia mydas) Linnaeus. 2018;66:7786 Communities and Survival Honeyof Bee during Larvae Reared in Vitro. psychiatry. Sides of the Microbiota Microbiome. Neuroscience. 10.1093/ijnp/pyv114. Neuroscience. pregnancy-terminated rats. nucleus accumbens or the medial preoptic area promotes onsetthe of maternal behavior in secretion neuromuscularat synapses. human behavior. and herbicides two in soils. Feeling. . 2018;127:170 BioResearch Open Access Biochem SocTrans . 2007;49:12– – – Curr Opin Clin Nutr Metab Care 69. 64. Cell HostCell Microbe – J Neurosci Int JNeuropsychopharmacol 7793. J Psychiatr Res – 174. – Gut 21. . 2014;34:15490 Behav Neurosci Appl Soil Ecol – Brain Axis Neuropsychiatry.in . 2005;33:1350 . 2015;17:565 . 2015;63:1 NeuroReport . 2016;5:137 Neuron – . 2014;74:12 15496. . 2007;121:907 ;19. Epub;19. ahead printof 1 May 2016. DOI: – . 2015;18:552. – . 1992;9:759 9. . 1998;9:2489. – 1353. 576. – 145. – 20. – – 768. 919. CNS Drugs Front Neuroendocrinol Cell Mol Life Sci . 2016;30:1019 J Agric Food Chem Mar PollutMar – Dev 1041. . . . 3. Bäuerl C, Collado MC,Cuevas AD, al. et Shifts gutin microbiota composition in an 132. Tomova A, Husarova Lakatosova V, S,et Gastrointestinalal. microbiota in children with 131. de CGM,Theije Wopereis H, RamadanAltered M,et al. gut microbiota and activity a in 130. F, Strati Cavalieri D, Albanese D,etNew al. evidences onthe altered gut microbiota in autism 129. . Larsen K, Najle R,LifschitzEffects A,al. et of sub-lethal exposure of rats to the herbicide 142. 141. Beuret CJ, Zirulnik F,Giménez MS.Effect of the herbicide glyphosate on liver 140. dosSantos JB, Ferreira EA, Kasuya MCM, al.Toleranceet of Bradyrhizobium strains to 139. Travlos I, Cheimona N, Bilalis D.Glyphosate Efficacy Different of Salt Formulations and 138. Kang D-W, Ilhan Park JG, ZE, Reduced al. et Incidence Prevotella of and Other Fermenters in 134. Park J-Y, Lee Choi J, Y,etMetagenome al. Analysis of Bodily Microbiota in aMouse Model 133. Nielsen LN, Roager HM, Casas ME, et al. Glyphosate limitedhas short-term on effects 128. Q, Mao Manservisi F,Panzacchi S,et al. RamazziniThe Institute 13-week study pilot on 127. Accepted137. Qiao Y, Wu M,Feng Y, et Alterationsal. of oral microbiota distinguish with children autism 136. Krajmalnik-Brown R, Lozupone C, Kang D-W, al. Gut et bacteria in children with autism 135. Article Microbiol APP/PSS1 transgenic mouse model autism Slovakia. in murine model autism of spectrum disorders. spectrum disorders. Pharmacol glutathione and lipid peroxidation in liver, kidneys and small intestine. glyphosate in drinking water: Glutathione transferase enzyme levels of reduced activities, ingredient glyphosate. El lipoperoxidation pregnantin rats and their fetuses. glyphosate formulations. Adjuvant Additives on Various Weeds. Intestinal Microflora of Autistic Children. 2017;26:369 Alzheimerof Disease Using Bacteria-derived Membrane Vesicles Blood.in amino acid levels. commensal bacterial community composition in gutthe environment due sufficientto aromatic 10.1186/s12940-018-0394-x. effects on microbiome.the glyphosate and Roundup administered at human-equivalent dose Sprague to Dawley rats: and clinical phenotype. Scheperjans F,Aho V, Pereira PAB, al. et Gut microbiota are related to Parkinson’s disease spectrum disorders from healthy controls. a complex disease. spectrum disorders: challenges andpromise of studying how acomplex community influences -Shenawy NS. Oxidative stress responses of rats exposed and Roundup to its active . 2018;66:464 . 2012;34:811 – 379. Environ Pollut Microb HealthEcol Dis Physiol Behav Microbiome Environ Toxicol Pharmacol Mov Disord – – 471. Crop Prot 818. Environ Health . 2017;5:24. . 2018;233:364 . 2015;138:179 . . 2015;30:350 of Alzheimer’sof disease during lifespan. 2005;24:543 Agronomy Sci Rep PLOS ONE . 2013;8:e68322. ;17. Epub;17. ahead of print December 2018. DOI: . 2015;26:26914. Brain Behav Immun – – – – 376. . 2018;8:1597. . 2017;7:60. 187. . 2009;28:379 547. Reprod Toxicol 358. – . 2014;37:197 385. . 2005;19:501 Environ Toxicol Lett Appl Exp Neurobiol – 206. – 504. . 4. Swarthout JT, Bleeke MS, Vicini Comments JL. for Mertens al.et (2018), Glyphosate, a 146. . Accepted Gasnier C, Dumont C, Benachour N, et al. Glyphosate-based herbicides are toxic and 151. Thongprakaisang S, Thiantanawat A, Rangkadilok N,al. et Glyphosate induces human breast 150. Romano MA, Romano RM,Santos LD, etGlyphosate al. impairs male offspring reproductive 149. Article Pham Derian TH, L, Kervarrec C,et al. Perinatal exposure glyphosateto and aglyphosate- 148. Manservisi Lesseur F, C, Panzacchi S, et Ramazzini al. The Institute 13-week study pilot 147. Mertens Höss M, S,Neumann G,et Replyal. to the letter to the editor by Swarthout et al. 145. Freuze I, Jadas-Hecart A, Royer A,al. et Influence of complexation phenomena with 144. Modesto KA, Martinez CBR. Roundup® causes oxidative stress liverin and inhibits 143. 2018;25:27662 chelating agent endocrine disruptors humanin lines. cell Assoc cancer cells growth via estrogen receptors. development by disrupting gonadotropin expression. 20Februaryprint DOI: 2019. 10.1093/toxsci/kfz039. based herbicide affect spermatogenesis in mice. 2019;18:15. effects ondevelopment and endocrine system. glyphosate-based herbicides administered at human-equivalent dose to Sprague Dawley rats: ecological risk assessment? (2018): Comments for Mertens et al. (2018), Glyphosate, chelating a for agent-relevant Chromatogr A.2007;1175:197 multivalent cations on the analysis glyphosateof and aminomethyl phosphonic acid J water. in 2010;78:294 acetylcholinesterase muscle in and brain of the fish Prochilodus lineatus. . 2013;59:129 – 299. – — 27663. relevant for ecological risk assessment? – 136. Environ Sci Pollut Res Int – 206. Toxicology Food Chem Toxicol Int J Publ Br BiolInd Res Environ Health Glob Access Sci Source Toxicol Sci Off JSoc Toxicol . 2009;262:184 Arch Toxicol . 2018;25:27664 Environ Sci Pollut Res . 2012;86:663 – 191. – 27666. Chemosphere . Epub ahead of – . 673. . . ABN= Arched-back nursing, NB= building. Nest significance< 0.05). (p day. day. PD=postpartum . morphology GCLcells inthe dorsal H: percentage morphology ofdoublecortin-ir and inthe cellsnumberGCL, intheventral (X10) cells doublecortin-ir G:percentage ofdoublecortin-ir thedorsaltotal number (X10) in cells granule layerF: cell doublecortin-ir total (GCL), proliferative, objective. stages Mean at40x intermediate and E: C: (+SEM) D:post-mitotic of Figure 4. Ki67 showntheGCL SGZ=granular cell subgranularzone. Arrows =Scale is20µm. layer, bar on theinteraction effectbetweenarea treatmentinthe andventralhippocampus. effect oftheGCL/SGZ with regions havingnumber higher ofproliferativecells and a trend B:gyrus dorsal dentate the andC:ventral was hippocampus. and There asignificant of hilus cells)subgranular inthe number (GCL/SGZ). zone ofproliferativeof Mean (+SEM) (Ki67-ir Figure 3. postpartumUntransformed day B:(PD) are to6. 1and data duringPD2 presented percentageFigure 2.Meanmaternal in (+SEM) spent (%) oftotaltime behavior A: during behavior PD1- was observed on Figure 1. FIGURE LEGENDS FIGURELEGENDS Accepted Article -ir cells. -ir cells. Representative intheGCLphotomicrographswith B: cells doublecortin-ir ofA: granuleRepresentative cellsphotomicrographs cell inthe Ki67-ir layerand ofA: Timeline of the present study. Dams were treated from GD10-PD22. Maternal presentTimeline ofthe treated Damsfrom study. were GD10-PD22. PD 6 and brains22 were collectedonPD . GD=gestational. * denotes . respectively).OTU=Operational Units. Taxonomic plots. DataSignificant are presented as difference box p (* groups.genera of bacterialeach Ethevarious group :OTU among rats. each in sample of the different ineach bacterial families sampleamongand Glyphosate theControl, Roundup OTUabundance). percentage abundanceD, Cand of gene D:C, of16SrRNA and sequences threegroups.: PhylaB different significantly affectedby (OTU Glyphosate or Roundup ofabundantsequencing.phyla bacterial A:composition of identified the inthe microbiota Figure 6. =mPFC medial prefrontal cortex gyrushippocampuscingulate and E:thedenotes (CG). significance 0.05). *(p < the dentateC: ventral region gyrus D:the CA3 ofthe dorsal hippocampus; ofthe (+SEM) synaptophysin density gyrus of (OD) inB: (DG) hippocampus; thedorsal the dentate Figure 5. dorsal GCL.(p< significance bar 0.05). *denotes Scale is20µm. There morphology asignificantcell the was betweenin and interaction the thetreatment significantthe proportionand bothdorsal ventral differenceofthe onmorphologiesfor GCL. ventral Groups GCL. letters thedifferent sharing areThere significantly different. a was Accepted Article Analysis of the effectsAnalysis ofthe gut by on gene microbiota rRNA 16S high-throughput Representativephotomicrographssynaptophysin-ir inthe GCL/SGZ. Mean ofA: . < 0.05 and ** p < 0.05and **p < 0.01, . Serum,NDS NGS = =Normal Normal CG=gyrus. Serum, Donkey Goat cingulate 1.SummaryTable immunohistochemistryprocessing. of TABLES al PSD95 (Gemmel Pawluski (Gemmel Hippocampus Synaptophysin 2017) Gemmel 2015; DCX (Pawluski 2015) 2011; Pawluski ki67 (Pawluski ., 2017) ., Accepted Article (primary Marker antibody) et al et et al et ., 2014) ., ., 2017, ., et al et et al. et et al et et al et et et ., ., ., ., , ., ., NDS, Sigma5% NDS, Sigma5% NDS, NGS, Sigma Sigma NGS, Sigma NGS, Blocking Blocking 2% 5% synaptophysi goat anti goat mouse anti rabbit anti rabbit anti rabbit antibody antibody Primary Primary PSD95 ki67 - DCX - - - n Sant Cruz sc Cruz Sant Laboratories Laboratories sigma S5768 sigma and catalog and Company Company VP ab18258 number number abcam abcam Vector 8066 Primary antibody antibody Primary - RM04 - Dilution 1/1000 1/500 1/300 1/250 Incubation 12 h 12 h 12 h 48 h Donkey anti Donkey anti Donkey biotinylated biotinylated biotinylated biotinylated biotinylated Secondary Secondary Goat anti Goat anti Goat antibody antibody antibody antibody antibody antibody mouse rabbit rabbit rabbit goat goat - - - - ImmunoResearch ImmunoResearch ImmunoResearch Compa Jackson Jackson DAKO DAKO Secondary antibody Secondary ny hippocampus hippocampus 1/400 for CG 1/400 for 1/500 for Di 1/1000 1/200 1/500 lution Incubation 2 h 2 h 2 h 2 h . magnesium and Mn postpartumalanine day,gestationGD== Ca aspartateAST = transaminase, transaminase, AST= day,PD 2.MeanTable measures (±SEM) and of weight ALT), toxicity serum litter (AST, of characteristics and analysis. Sex ratioSex Number femaleof pup Number of pupsmale ina litter Litter weight(g) at Interleukin Mn² Mg² Fe² Ca² (UI/L)ALT AST(UI/ Weight(g) dams at PD2 Weight(g) dams at Weight(g) dams at GD10 Accepted Article + + + + (µmol/L) (nmol/L) (mmol/L) (nmol/L) L) - 6 (pg/mL) PD1 PD1 PD1 2+ s = manganese. 2 in a litter 304.67 ± 11.76 297.71 343.20 ± 9.76 93.67 4.49± 105.6 5.38± 83.57 4.38± 40.17 2.02± 47.83 5.62± 1.07 ± 1.07 ± 0.13 6.00 ± 0.68 6.00 ± 0.26 2.66 ± 2.48 1.07 ± 0.02 2.77 ± 0.08 Control ± 8.77 305.30 ± 14.61 309.50 ± 13.89 294.14 109.2 12.77± 90.13 10.53± 64.00 11.82± 90.50 5.93± 41.33 3.91± Glyphosate 0.89 ± 0.89 ± 0.20 6.33 ± 6.33 ± 0.56 5.17 ± 0.95 3.44 ± 3.44 0.92 ± 0.06 2.58 ± 0.06 ± 7.50 321.90 ± 12.59 291.43 ± 11.52 286.29 118.9 10.21± 95.57 4.26± 88.24 9.30± 46.00 1.99± 45.86 1.9± 1.58 ± 1.58 ± 0 5.14 ± 0.70 7.43 ± 0.53 9.10 ± 6.31 1.06 ± 0.04 2.70 ± 0.04 Roundup ± 9.61 .22 7 F F F F F F F F F F F F (2,16) (2,16) (2,16) (2,16) (2,16) (2,16) (2,16) ( F statistics (2,16) (2, 16)(2, 2,1 (2,16) (2,16) 8 ) = 3.559= 0.277= 3.499= 2.216= 1.347= 1.857= 2.171= = =0.595 =0.595 = 0.146= = 0.591= 0.489= 0.454 2+ = calcium, Fe p value 0.0526 0.7616 0.5656 0.6219 0.0549 0.8649 0.1414 0.2881 0.1883 0.1465 0.5633 0. 6417 2+ = iron,Mg = 2+ = . regions. Mean (OD) the density gyrusCA3Table3. hippocampal dentate (DG)in (±SEM) of hippocampal and PSD95 volume and optical PSD95 PSD95 CA3 VentralPSD95 DG PSD95 Dorsal DG Hippocampal volume(mm Accepted Article 3 ) 0.00922 ± 0.0036 0.01028 ± 0.0046 0.0244 ± 0.0035 11.38 0.61± Control 0.0105 ± 0.0055 0.0309 ± 0.0052 0.0095 ± 0.0030 11.10 0.54± Glyphosate 0.0206 ± 0.0052 0.0335 ± 0.0053 0.0142 ± 0.00 11.60 0.36± Roundup 40 F F F F (2,16) (2,16) F statistics (2,16) (2,16) = 0.2 = = 1.701 = 0.429 = = 0.954= 6 3 p value 0.2140 0.4059 0.6582 0.7718 . Accepted Article . Accepted Article . Accepted Article . Accepted Article . Accepted Article . Accepted Article