Resistance of Hela Cell Mitochondrial DNA to Mutagenesis by Chemical Carcinogens1

(CANCER RESEARCH 48. 4578-4583, August 15. 1988] Resistance of HeLa Cell Mitochondrial DNA to Mutagenesis by Chemical Carcinogens1

Shiro Mita,2 Raymond J. Monnat, Jr., and Lawrence A. Loeb3

The Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology SM-30, University of Washington, Seattle, Washington 98195

ABSTRACT to isolate mtDNA from mutagen-treated HeLa cells and deter The mutagenic potentials of ethylmethane sulfonate, .V-nu-tliyl-.V'- mine the nucleotide sequence of independent recombinant nitrosoguanidine, and benzo(a)pyrene diol-epoxide in human mitochon clones containing the same portion of the mtDNA genome. We dria were determined by cloning and nucleotide sequencing of mitochon have chosen two adjacent regions of human mtDNA for these studies: the displacement (D-) loop region, a noncoding region dria! (mt) DNA from HeLa cells treated with these mutagens. Mutagen concentrations that reduced cell survival to approximately 0.1% of un containing the origin of replication of the heavy (H-) strand treated cultures were used. Mitochondria! DNA was prepared 2 to 3 and promoters for the transcription of both mtDNA strands weeks after mutagen treatment, at which time the treated cell population (9); and an "uncloneable" fragment that spans nucleotides had regrown to 10 times the starting cell number. In one series of 15,591-16,569 and contains the tRNAThr gene (10, 11). Mu experiments, a portion of the D-loop region of mtDNA from treated or tants within the tRNAThr gene relax the "uncloneable pheno- control HeLa cells was cloned into the bacteriophage vector M13mpl9, type" and render it cloneable (11). Thus, the frequency at which and the nucleotide sequences of 102 independent clones were determined. the "uncloneable" fragment is recovered by cloning after treat Only a single G:C base pair deletion was observed in 1 of 12 clones ment of cells with mutagens provides a sensitive assay for derived from HeLa cells treated 6 times with ethylmethane sulfonate. From benzo(a)pyrene diol-epoxide-treated HeLa cells, G:C base pair nucleotide sequence alterations in this region of the human deletions were found in 14 of 63 clones. All 14 of these G:C deletion mitochondria! genome. After extensive treatment of HeLa cells mutations occurred at the same position in independent clones, however, with known potent mutagens, we observed no enhancement of and thus could be the progeny of a single mutational event. In a second mtDNA mutagenesis using either of these assays. Thus, cova- series of experiments, a method for the selection of mtDNA mutants was lent modifications of mtDNA are infrequently fixed as muta utilized. Mutations in an **uncloneable" fragment of human mtDNA tions in human mtDNA. render the fragment cloneable and thus provide a selection for mutations in this region of human mtDNA. No enhancement in the cloning efficiency of this region of mtDNA was observed after exposure of cells to toxic MATERIALS AND METHODS concentrations of either MNNG or benzo(a)pyrene diol-epoxide. More over, the site and types of nucleotide sequence alterations observed after Materials. HeLa cells were provided by Dr. Jacques Peschon (Uni mutagen treatment were similar to those obtained in the absence of drug versity of Washington). Cell culture media and serum were obtained treatment. The results of both types of experiments suggest that inula- from GIBCO (Grand Island, NY). The M13mpl9 cloning vector, and genesis of human mtDNA is an infrequent event, even after extensive the Escherichia coli host strain JM 101 were gifts of Dr. Joachim treatment of HeLa cells with potent mutagens that can covalently modify Messing, University of Minnesota. EMS and MNNG were obtained mtDNA. from Pfaitz and Bauer (Stamford, CT). [1,3-3H]BPDE (specific activity, 635 mCi/mmol) was obtained from Chemsyn Science Laboratories INTRODUCTION (Lenexa, KA). Restriction endonucleases, T4 DNA ligase, and an M13 17-mer universal sequencing primer were obtained from Bethesda Re It is important to know the types of mutations produced in search Laboratories (Gaithersburg, MD) or new England Biolabs (Bev human somatic cells by environmental mutagens and carcino erly, MA). Deoxy- and dideoxynucleoside triphosphates and ATP were gens, because these mutations may play an important role in products of Pharmacia P-L Biochemicals (Piscataway, NJ). Radioactive the genesis of many human neoplasms (1). In prokaryotes, the deoxynucleotides and Gene Screen Plus were obtained from Du Pont- frequency and spectrum (i.e., the type and site of occurrence) New England Nuclear (Boston, MA). Oligonucleotide probes and primers were synthesized by P. S. H. Chou, Solid Phase Synthesis of mutations in specific genes have been extensively investi Center, Howard Hughes Medical Institute, University of Washington. gated. These data have provided clues to the mechanism by Methods. HeLa cells were maintained in Dulbecco's modified mini which alterations in cellular DNA result in mutagenesis (2, 3). mal essential medium supplemented with 10% fetal calf serum at 37Â°C Similar studies in human cells have been limited by the com in a 5% CO2 atmosphere. For treatment with mutagens, 1.2 x IO7 plexity of the human genome and the lack of powerful genetic HeLa cells were inoculated into three (100-mm-diameter) dishes and techniques for the isolation and analysis of induced mutations. allowed to grow for 2 days in 30 ml of culture medium to a total of We have used recombinant DNA techniques to determine approximately 2 x IO7cells. EMS was added directly to the cell culture the spectrum of mutations produced in human mtDNA4 by the medium followed by incubation at 37Â°Cfor2 h. Two different treatment alkylating agents EMS and MNNG, and by the polycyclic protocols were used: cells were treated twice with 5 mM EMS, or three times each with 5 mM and with 10 mM EMS. In each protocol, the cell aromatic hydrocarbon BPDE which has been reported to dam number was allowed to return to approximately 2x10* before subse age mitochondria! DNA preferentially (4-8). Our strategy was quent mutagen treatment. In other experiments, HeLa cells (4.5 x IO7)

Received 12/18/87; revised 3/23/88; accepted 5/19/88. were treated with a single dose of BPDE or MNNG by replacing the The costs of publication of this article were defrayed in part by the payment cell culture medium with 2 ml of serum free medium and then adding of page charges. This article must therefore be hereby marked advertisement in the desired concentration of mutagen dissolved in dimethyl sulfoxide. accordance with 18 U.S.C. Section 1734 solely to indicate this fact. After the addition of BPDE or MNNG, cells were incubated at 37Â°C 1This work was supported by the NIH (R35-CA-39903, AG-07151) and the United States Environmental Protection Agency (R809-623-010). for 2 h, washed twice with phosphate buffered saline, trypsinized, and 2 Present address: Santen Pharmaceutical Co., Ltd., Osaka. Japan. replated for the determination of cytotoxicity or regrown to 4 x IO8 3To whom requests for reprints should be addressed. 4 The abbreviations used are: mtDNA, mitochondria! DNA; EMS, ethyl- cells. methane sulfonate; MNNG, iV-methyl-/V'-nitrosoguanidine; BPDE, (Â±)-r-7,f-8- Isolation of mtDNA and Nuclear DNA. Covalently closed circular dihydroxy-i-9,10-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (benzo(a)pyrene mtDNA was isolated by a modification of the technique of Bogenhagen diol-epoxide]. and Clayton (12, 13) from treated HeLa cells that had been allowed to 4578

regrow to 2 x IO8 cells after mutagen treatment or from 2 x 10* mtDNA cells is shown in Fig. \A. mtDNA was isolated from untreated control HeLa cells. Mitochondria were isolated by differential untreated control HeLa cells or from HeLa cells treated with sedimentation, and mtDNA was purified by CsCl-ethidium bromide EMS or BPDE. Purified HeLa mtDNA was digested into 29 density gradient centrifugation. Nuclear DNA was isolated by resus- fragments using the restriction endonuclease Taql. The result pending the nuclear pellet obtained during mtDNA isolation in 10 HIM Tris-HCl (pH 7.5)-l mM EDTA-0.5% sodium dodecyl sulfate and then ing fragments were separated on a low melting temperature agarose gel. The 2828-base pair Taql fragment of mtDNA adding proteinase K to a final concentration of 100 Mg/ml. After incubation for l h at 37Â°C,the mixture was extracted with an equal containing the D-loop region was isolated and then digested volume of phenol equilibrated with 50 mM Tris-HCl, pH 7.5, followed sequentially with the restriction endonucleases Kpnl and Sstl. by extraction with an equal volume of chloroform:isoamyl alcohol (24:1, Only one of the four resulting fragments, the 476-base pair v/v). Nucleic acids were precipitated with ethanol and then digested fragment spanning mtDNA nucleotide positions 16,134 to 41, sequentially for l h at 37Â°Cwith 100 Mg/m' RNase A and for l h with has both a Kpnl and an Sstl end, allowing efficient ligation into 100 i!g/ml proteinase K in 10 mM Tris-HCl (pH 7.8) and 1 mM EDTA. the cloning vector, M13mpl9 replicative fragment DNA, that The digestion mixture was extracted twice with an equal volume of had been digested with Kpnl and Sstl. Single stranded recom- buffer equilibrated phenol and once with an equal volume of chloro- fornrisoamyl alcohol. DNA was precipitated by the addition of ethanol.

Cloning the D-Loop Region. mtDNA was digested to completion with D loop region the restriction endonuclease Taql, and the resulting fragments were ""\ f 'uoctonable' fragment l2SrRNA fractionated by electrophoresis through a 0.7% low melting temperature gens agarose gel (SeaPlaque; FMC Corp., Rockland, ME) in Tris-acetate :yl b gene buffer (14). A 2828-base pair fragment containing the human mtDNA D-loop region was recovered from the gel by cutting out the region containing the fragment and then mincing the gel slices in an equal volume of phenol equilibrated with 50 mM Tris-HCl, pH 7.5. The resulting mixture was frozen at â€”80Â°Cfor20 min and then centrifuged at 12,800 x g at room temperature for 5 min. The aqueous phase was reextracted twice with equal volumes of phenol equilibrated with Tris-

HCl, pH 7.5, and then precipitated by the addition of ethanol. The Kpn I (K) - Xho I (X) resulting 2828-base pair D-loop fragment was digested sequentially digestion with the restriction endonucleases Kpnl and .Vsrland ligated into the Agarose gel double stranded replicative form of M13mpl9 DNA that had been Purification digested previously with the restriction endonucleases Kpnl and Sstl. Restriction endonuclease digestions, ligations, JM 101 transformation, and the nucleotide sequence determination of independently isolated Moot Ml3 clones containing the mitochondria! D-loop fragment were per formed as described previously (15, 16). m Cloning the "Uncloneable" Fragment. The region of the human Further Restriction Enzyme Digestion t t t mtDNA adjacent to the D-loop was first shown by Drouin (10) to be Kpn I Uncloneable Xhol underrepresented in collections of human mtDNA-pBR322 recombi Fragment nant clones. We subsequently observed that mutations in this region relax the "uncloneable" phenotype and render this fragment cloneable (11). The "uncloneable" region of HeLa mtDNA was obtained by digesting mtDNA to completion with the restriction endonucleases Kpnl and Xhol. The resulting fragments were fractionated by electro phoresis through a 0.7% low melting temperature agarose gel in Tris- Cloning in acetate buffer and the fragment containing the uncloneable fragment M13mp19 was recovered by gel extraction. After digestion with Mbol, the resulting fragments were ligated into the double-stranded replicative form of M13mpl8 or M13mpl9 DNA that had been previously digested with the restriction endonucleases Kpnl and BamHl. Ligated DNA was transformed into competent cells prepared from E. coli strain JM101 (17). Colorless colonies containing different mtDNA inserts were iden tified by dot hybridization using four radiolabeled synthetic oligonucleotide probes as described previously (11). Oligonucleotide hybridization probes were radiolabeled using [7-"P]ATP and T4 polynucleotide kinase (14). The DNA sequence of the L-strand of M13 clones contain DNA ing the uncloneable fragment was determined with either a universal Sequencing 17-mer M13 primer (New England Biolabs) (15) or one of five synthetic primers used in the direct sequence analysis of the "uncloneable" A) D-loop B) Uncloneable fragment (11). Fragment Fig. 1. Structure and cloning of HeLa mtDNA: A. For studies of the D-loop region, mtDNA was digested with Taql and the 2828-base pair DNA fragment RESULTS (human mitochondria! nucleotides. 14,957-1,216) containing the D-loop region was purified by agarose gel electrophoresis. This fragment was further digested In order to analyze the types of mutations produced in the with Kpnl and Ssll and cloned into M13mpl9. The nucleotide numbering and position of segments is given in Ref. 9. DNA sequence determination on inde mtDNA of human cells after exposure to mutagens, we deter pendently isolated clones was carried out as previously described (12, 13). lÃ¬.For mined the nucleotide sequence of multiple independently iso studies on the "uncloneable" fragment, mtDNA was digested with Kpnl and Xhol. lated recombinant DNA clones containing the same segment The 1097-base pair fragment was isolated on agarose gels, digested with Mbo\, and ligated to Ml 3mp 19 that had been digested previously with Kpnl and /(Â«mill of human mtDNA. The strategy used to isolate and determine Clones containing the Kpnl-Mbol fragment were identified by dot hybridization the nucleotide sequence of a portion of the D-loop region of and sequenced (see "Materials and Methods"), cyt, cytochrome. 4579

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1988 American Association for Cancer Research. MITOCHONDRIA!. DNA MUTAGENESIS binant M13 DNA was prepared from independent, plaque cells) between each treatment. Only 1 of 12 D-loop clones purified recombinant clones and used as a template for nucleo- isolated from HeLa cells treated 6 times with EMS contained tidc sequence determination by the chain termination method a mutation, the deletion of a G:C base pair at mtDNA nucleo of Sanger Ã©tal.(18). tide position 16,488. Studies with BPDE. The effect of adding increasing amounts Mutations in the D-Loop Region of BPDE to exponentially growing HeLa cells is shown in Fig. 3. Treatment with 0.5 MMBPDE for 2 h reduced cell survival Studies with Kthylmethane Sulfonate. The effect of adding to 37% ofthat observed in untreated HeLa cell cultures. Treat increasing amounts of the direct acting mutagen EMS to cul ment with 10 /Â¿MBPDE for 2 h reduced cell survival to tures of exponentially growing HeLa cells is shown in Fig. 2. approximately 0.1%. The covalent binding of BPDE to nuclear After exposure to 1.2 mM EMS for 2 h, cell survival was reduced and mtDNA was determined after treatment of HeLa cells with to 37%. Exposure to 5 mM EMS reduced cell survival to \OfiM BPDE for 2 h, followed by the isolation of circular approximately 0.1%. In an initial attempt to produce mtDNA mutations, 2 x IO7 cells were treated three times sequentially mtDNA. The amount of bound BPDE (specific activity, 635 mCi/mmol) was 2075 dprn/^g of mtDNA and 485 dpm/^g of with 5 mivi EMS for 2 h; the treated starting cell population nuclear DNA. Thus, the extent of binding to mtDNA was 4.3- was allowed to regrow to 2 x 10" cells between each treatment. fold greater than to nuclear DNA; these levels of binding The nucleotide sequence of the L-strand of the mitochondria! correspond to an average of 1 BPDE adduci per 1029 base D-loop inserts from EMS-treated HeLa cells was determined pairs of mtDNA or 16.1 adducts per mtDNA molecule. from the Sstl site. No nucleotide sequence changes were ob In two separate experiments, we determined the nucleotide served in 635 nucleotides of sequence information derived from sequence of M13 clones containing a portion of the D-loop 5 independently isolated clones containing the D-loop region region of mtDNA from HeLa cells treated with 10 /*MBPDE (Table 1). (Table 2). A total of 10,809 nucleotides of sequence information A more extensive procedure for mutagenesis yielded only a was determined from 75 independent D-loop clones. In 1 of 2 single alteration in DNA sequence (Table 1, EMS x 6). Cells BPDE mutagenesis experiments, 14 of 63 D-loop clones con were treated three times with 5 mM EMS for 2 h followed by tained the deletion of 1 G:C base pair from mtDNA positions three treatments with 10 mM EMS for 2 h. The treated cells 34-36. The nucleotide sequence of positions 34-36 in control were allowed to regrow to the starting cell number (2 x IO7 HeLa cell mtDNA clones consisted of three G:C base pairs. Thus it is not possible to state which of the three G:C base pairs is deleted or whether the G:C base pair deleted in 14 of 100c 63 D-loop clones from BPDE-treated HeLa cells represents the deletion of the same base pair in each clone. No mutations were identified in 12 clones obtained from a second experiment.

10 100

'>> k_ 10 co

w 1 _ 0.1 CO 1234 EMS (mM) 0.1 Fig. 2. Toxicity of EMS to HeLa cells. The cells were treated with EMS as described in "Materials and Methods" and trypsinized, and aliquots of 102-104 cells were inoculated into 60-mm-diameter plastic dishes. After growing for 10 days, the resulting colonies were fixed and stained with crystal violet. Cell survival 0.01 is expressed as a percentage of the plating efficiency of untreated HeLa cells. The 10 plating efficiency of control HeLa cells was 94%. BPDE (pM) Table 1 Sequencing of mtDNA D-loop region from EMS-treated HeLa cells Fig. 3. Toxicity of BPDE to HeLa cells. The cells were treated with BPDE as described in the legend to Fig. 2. The plating efficiency of control HeLa cells was HeLa cells were treated twice with 5 mM EMS (EMS x 2) or three times with 94%. 5 mM and 10 mM (EMS x 6) for 2 h. The treated cell populations were regrown to the starting cell number (EMS x 6) or to lOx the starting cell number (EMS x 2) prior to subsequent treatment with mutagen. Table 2 Sequence analysis of mtDNA D-loop region from BPDE-treated Procedures for cloning and sequencing of mtDNA are given in "Materials and HeLa cells Methods." Cells were treated with a single dose of 10 jiM BPDE, as described in "Materials and Methods." changesL-strandsequence of nu changesL-strandsequence clones cleotides of mu of of nu TreatmentUntreatedEMSx2examined10 sequenced1306position16.488TypetationNone clones1 clones cleotides of ofclones14 examined6312Totalsequenced9009position34TypemutationG:C 512Total 6351784Nucleotide None Experiment 1 deletionNoneNo. EMSX6No. G:C deletionNo. Experiment 2No. 1800Nucleotide 4580

Mutations in the "Uncloneable" Fragment. In order to in no changes were observed in the spectrum of nucleotide se crease the sensitivity for scoring mutations in human mtDNA, quence alterations in this fragment after exposure of HeLa cells we utilized a selective assay. The frequency of recovery of to either MNNG (Fig. 4C) or BPDE (Fig. 4D). recombinant clones containing the DNA fragment that spans human mtDNA positions 15,591-16,053 is less than 1% of DISCUSSION clones containing other human mtDNA fragments of similar size (10, 11). Mutations in the mt tRNAThr gene relax the We have analyzed the frequency and spectrum of mutations "uncloneable" phenotype and allow the efficient recovery of in two regions of human mtDNA after exposing cells to agents recombinant clones containing this fragment (11). The strategy that covalently modify DNA. The first region of the human for detecting mutations in the "uncloneable" fragment of hu mtDNA genome we have studied is the noncoding D-loop man mtDNA is shown in Fig. IB. mtDNA was isolated from region. Previous restriction endonuclease mapping and DNA control HeLa cells or from HeLa cells treated with MNNG or sequence studies have revealed considerable nucleotide se BPDE. A Kpnl-Xhol fragment was isolated and then digested quence variability between the D-loop regions of unrelated with Mbol. The Kpnl-Mbol fragments were ligated into individuals (15, 16, 19, 20). In contrast, very low levels of M13mpl9 that was predigested with Kpnl and Baml. Recom nucleotide sequence variability exist within the D-loop of binant clones were screened for the presence of the "unclonea mtDNA isolated from single individuals or from different tis ble" fragment by dot hybridization with an oligonucleotide sues within an individual (15, 16). Thus mtDNA D-loop mu probe, homologous to a portion of the "uncloneable" fragment. tations induced in HeLa cells by treatment with mutagens The frequency of recovery of the "uncloneable" fragment was would be easy to detect against the low background of sponta compared to that of a nearby mtDNA fragment for both un neous mutations in this region of mtDNA within an individual. treated HeLa cells and for HeLa cells treated with MNNG or Extensive between-individual variability of the D-loop region BPDE. In separate reactions, fragments with Mbol-Xhol ter of human mtDNA also suggests that the D-loop region could mini were ligated to M13mpl9 that was previously digested tolerate a greater number of induced mutations than the highly with Baml-Sall. After transfection into E. coli JM101, the conserved protein coding regions of human mtDNA. number of recombinant clones containing the different frag The mutagens used for studies on the D-loop, EMS and ments was identified by dot hybridization with fragment-spe BPDE, are direct acting and do not require metabolic activation cific oligonucleotide probes. The recovery of fragment A (con to form covalent addition products on DNA. EMS is a potent taining the "uncloneable" region) from untreated HeLa cell mutagen and weak carcinogen that alkylates DNA by forming mtDNA was approximately 1% of that observed for a nearby adducts primarily at the N-7 position of guanine and, to a lesser extent, at the 06 position of guanine and the N-3 position of control fragment (B), thus confirming the reduced cloning efficiency of this region of the human mt genome (Table 3) (10, adenine (3). Because of the small size of EMS adducts and the 11). MNNG treatment failed to increase the recovery of recom diversity of addition products, replication of mtDNA altered by binant clones containing the "uncloneable" fragment, suggest EMS could produce a broad spectrum of mutagenic alterations. ing a lack of mtDNA mutation induction despite the decrease BPDE is the most potent mutagenic and carcinogenic metabo in cell survival (Table 3). lite of benzo(a)pyrene (3,21 ). BPDE binds covalently to cellular The nucleotide sequence of the "uncloneable" Kpnl-Mbol DNA. The major stable adduct formed is linkage of position fragment of mtDNA obtained from control and mutagen- 10 of the benzo(a)pyrene ring to the 2-amino group of guanine residues (3, 22). BPDE-DNA adducts are persistent in vivo (23) treated HeLa cells is shown in Fig. 4. As previously reported and prevent DNA synthesis in vivo and in vitro (24, 25). In E. (11) with mtDNA from control HeLa cells, all recovered clones coli, BPDE specifically induces G:C â€”Â»T:Atransversions, and, contained one or more nucleotide sequence differences within the tRNAThr gene of the "uncloneable" fragment (Fig. 4A). The to a lesser extent, A:T â€”Â»T:Atransversions (26). Yang et al. (27, 28) introduced into human cells a shuttle vector containing majority of nucleotide sequence alterations were clustered in two "hotspot" regions of the mt tRNAThr gene (Fig. 4B). One covalently bound BPDE residues. The resulting mutations were predominantly single-base substitutions, of which 45 of 61 were region was a hexamer at H-strand positions 15,924-15,919 encoding the anticodon loop of the human mt-tRNAThr. The G:C â€”Â»T:Atransversions. These combined results are in accord other was a pentamer at positions 15,900-15,896 encoding a with the notion that BPDE mutagenesis occurs predominantly at deoxyguanosine residues and involves either infrequent by portion of the tRNAThr D-stem. Each clone contained at least pass of a blocking adduct (25) or depurination at the N7 position one mutation within one of these two regions. Most important, followed by incorporation of deoxyadenosine (29). Table 3 Recovery of mtDNA fragments from untreated and MNNG-treated Backer and Weinstein (5, 7) have reported that, after treat HeLa cells ment of cells with BPDE, the extent of covalent modification The Kpnl-Xhol fragment of mtDNA containing the "uncloneable" fragment of mtDNA was greater than that of nuclear DNA. They attrib and an adjacent control fragment was isolated from untreated and MNNG-treated cells, respectively. After digestion with Mbol to produce the "uncloneable" and uted this preferential attack of BPDE on mtDNA to the high solubility of hydrophobic aromatic hydrocarbons in the lipid- control fragments, 5 ng of the digest were ligated with 200 ng of M13mpl8 replicative form DNA cut with Kpnl and BamHl and 1 ng of the digest with 40 rich environment presented by mitochondria. Our results con ng of M13mpl9 replicative form DNA cut with Sail and liumlll. After transfec tion into /;'. coli .IM 101 cells, aliquots of the resultant colorless colonies were firm the observation of Backer and Weinstein and extend their screened by dot hybridization with fragment-specific oligonucleotides. Values observation to human cells. represent the number of "uncloneable" fragment-containing and control colonies In light of the ability of BPDE, and presumably EMS, to obtained from 1 ng of Kpnl-Xhol fragment. form covalent adducts with human mtDNA, it is surprising that No. of colonies con so few mutations were identified in the D-loop of mtDNA of taining Kpnl-Mbol "un No. of colonies con cloneable" fragment taining Xhol-Mbol Ratio HeLa cells after mutagen treatment. The few mutations iden (A) control fragment (B) (A/B) tified must represent the progeny of exceptionally rare events Untreated in light of the extensive mutagenesis protocols that were used. MNNG-treated220 10017,400 14,8000.012 0.007 In experiments with EMS, HeLa cells were treated repeatedly 4581

D-LOOPtRNAProIRNAThrCyt b

TTGTCCTTGGAAAAGGTTTTCATCTCCGGTTTACAAGACTGGTGTATTAGTTTATACTACAAGGAC -G 16053 15950 15930 15910 15890 115800I

C CC*CJ 88ceceC CÂ©CCÂ©CCÂ©CCÂ©C

CCÂ©CÂ©B)

CG UNTREATEDGÂ©Â©C CG Â©C Â©CCi ; GjÃ¨>Â© Â©CC-ACA -"7r '-ACA

C C C C C C C C C C C)IMNNGI?? C T T TACA-A IGiAAÂ©C 1-ATACTÂ©Câ€¢~T~ '

-A - A CQT-AOc(C)

C C CCC C C C D)BPDE1 CfiTTT G?A Â®

1? iC AC AG 4TArT -iâ€”C-~

-T

I+TGGTGTATTAGTTTAT)

Fig. 4. Spectrum of DNA sequence changes in the "uncloneable" fragment of HeLa mtDNA. The site and type of base substitution mutations are indicated above and the site and extent of deletion mutations below the horizontal line. Circles indicate that at least one additional sequence alteration was present in a clone containing the circled mutation. with concentrations of EMS that reduced cell survival to ap one mtDNA molecule lacking BPDE adducts are able to divide. proximately 0.1%. In one experiment in which HeLa cells were If BPDE adducts are randomly distributed in the 2 x IO7 cells treated sequentially 6 times with EMS, only I of 12 D-loop initially exposed to BPDE, each containing approximately 8000 clones was found to contain a DNA sequence alteration. This mtDNA molecules (12), then on the basis of Poisson statistics nucleotide sequence alteration consisted of the deletion of a only 1 in IO4cells would contain at least one mtDNA molecule G:C basepair at nucleotide position 16,488. A similar low level without a BPDE adduct. This value correlates closely, though of D-loop mutagenesis was observed in experiments with perhaps fortuitously, with cell survival observed after BPDE BPDE. HeLa cells were treated once with 10 nM BPDE to treatment. Avian cells containing few, or perhaps only one, reduce cell survival to less than 0.1%. This level of cell survival mtDNA molecule per cell are able to grow and divide (30). corresponded to the production of an average of 1 BPDE adduct Thus the mtDNA mutations we observed after BPDE treatment per 1029 base pairs or an average of 16.1 BPDE adducts per could have arisen from preexisting mutations in unmodified mtDNA molecule. Fourteen of 63 D-loop clones isolated from mtDNA molecules that were amplified following BPDE treat the BPDE treated cells contained a G:C base pair deletion in ment. the G:C triplet at nucleotide positions 34-36 of HeLa cell We have used a second, more sensitive assay to detect and mtDNA. However, the 14 D-loop clones containing the deletion analyze mtDNA mutations induced by mutagens. This assay could be progeny of a single mutational event. uses a portion of mtDNA that overlaps with the D-loop region It is conceivable that BPDE adducts (of mtDNA) completely as a target for mutagenesis. We have previously shown that block DNA replication and that only cells containing at least mutations in this region of human mtDNA relax its "unclone- 4582

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1988 American Association for Cancer Research. MITOCHONDRIA!. DNA MUTAGENESIS able" phenotype and thus provide a selection for mutations organization of the human mitochondrial genome. Nature (Lond.), 290: 457-465, 1981. occurring in this region of human mtDNA (11). The results 10. Drouin, J. Cloning of human mitochondrial DNA in Escherichia coli. J. Mol. shown in Table 3 indicate that, after treatment of HeLa cells Biol., 140: 15-34, 1980. 11. Mita, S., Monnat, R. J., Jr., and Loeb, L. A. Direct selection of mutations with MNNG, there is no increase in the frequency of mutations in the human mitochondrial tRNA11" gene: reversion of an "uncloneable" that relax the "uncloneable" phenotype. Our previous studies phenotype. MutÃ¢t.Res., 799: 183-190, 1988. (11) indicated that relaxation of the "uncloneable" phenotype 12. Bogenhagen, D., and Clayton, D. A. The number of mitochondrial deoxyri bonucleic acid genomes in mouse L and human HeLa cells. J. Biol. Chem., is invariably associated with at least one mutation in one of two 249:7991-7995, 1974. regions of the tRNAThr gene that encodes the mt tRNAThr 13. Tapper, D. P., Van Etten, R. A., and Clayton, D. A. Isolation of mammalian anticodon loop (15,924-15,919) and D-stem (15,900-15,896). mitochondrial DNA and RNA and cloning of the mitochondrial genome. Methods. Enzymol.. 97:426-434, 1983. The DNA sequence of mutants obtained after treatment of 14. Maniatis, T., Fritsch, E. F., and Sambrook, J. Molecular Cloning: A Labo HeLa cells with either MNNG or BPDE are in accord with ratory Manual, pp. 156-162. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1982. these findings (Fig. 4). Even though mutations were observed 15. Monnat, R. J., Jr., and Loeb, L. A. Nucleotide sequence preservation of after treatment with MNNG (positions 16,017, 16,000, and human mitochondrial DNA. Proc. Nati. Acad. Sci. USA, 82: 2895-2899, 15,941) and BPDE (positions 16,000 and 15,844) that have not 1985. 16. Monnat, R. J., Jr., and Reay, D. T. Nucleotide sequence identity of mito been reported in untreated cells, there is no evidence that these chondrial DNA from different human tissues. Gene, 43: 205-211, 1986. are induced by the mutagens. 17. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol., 166: 557-580, 1983. Our studies suggest that covalent modifications of human 18. Sanger. F., Nicklen, S., and Coulson. A. R. DNA sequencing with chain- mtDNA are infrequently fixed as mutations. The apparent lack terminating inhibitors. Proc. Nati. Acad. Sci. USA, 74: 5463-5467, 1977. of mechanisms in mammalian cells for repair of bulky adducts 19. Greenberg, B. D., Newbold, J. E., and Sugino, A. Intraspecific nucleotide sequence variability surrounding the origin of replication in human mito in mtDNA and for mtDNA recombination (31, 32) suggests chondrial DNA. Gene, 21: 33-49, 1983. that mitochondrial DNA modifications are not excised. Fur 20. Cann, R. L., Brown, W. M., and Wilson, A. C. Polymorphic sites and the thermore, the retardation of replication of mtDNA following mechanism of evolution in human mitochondrial DNA. Genetics, 106:479- 499, 1984. treatment of mammalian cells with UV suggests that bulky 21. Yang, S. K., McCourt, D. W., Roller. P. P., and Gelboin, H. V. Enzymatic adducts might prevent mtDNA replication. Thus, mitochondria conversion of benzo[a]pyrene leading predominantly to the diol-epoxide r- 7,/-8-dihydroxy-/-9,10-epoxy-7,8,9,10-tetrahydrobenzo|a]pyrene through a with unrepaired DNA damage might not replicate with each single enantiomer of r-7,/-8-dihydroxy-7,8-dihydrobenzo[a|pyrene. Proc. cell division. An inducible mtDNAse could selectively degrade Nati. Acad. Sci. USA, 73: 2594-2598, 1976. damaged mtDNA molecules prior to replication. Mammalian 22. King, H. W. S., Osborne, M. R., and Brookes, P. The in vitro and in vivo reaction at the .V position of guanine of the ultimate carcinogen derived mitochondrial nucleases that could provide this type of suicide from benzo[a]pyrene. Chem.-Biol. Interact., 24: 345-353, 1979. mechanism have been identified and purified (33, 34). 23. Feldman, G., Remsen, J., Shinohara, K., and Cerutti, P. Excisability and persistence of benzo(u)pyrene DNA adducts in epithelioid human lung cells. Nature (Lond.), 274: 796-798. 1978. ACKNOWLEDGMENTS 24. Hsu, W. T., Lin, E. J. S., Harvey, R. G., and Weiss, S. B. Mechanism of phage 0X174 DNA inactivation by benzo[a|pyrene-7,8-dihydrodiol-9,10- We thank Chris Bjarke and Bruce Zellus for help with DNA sequence epoxide. Proc. Nati. Acad. Sci. USA, 74: 3335-3339, 1977. 25. Larson, K. L., and Strauss, B. S. Influence of template strandedness on in determinations and Mary Whiting for help with preparation of the vitro replication of mutagen-damaged DNA. Biochemistry, 26: 2471-2479, manuscript. 1987. 26. Eisenstadt, E., Warren, A. J.. Porter, J., Atkins, D., and Miller, J. H. Carcinogenic epoxides of benzo[a]pyrene and cyclopenta[ro']pyrene induce REFERENCES base substitutions via specific transversions. Proc. Nati. Acad. Sci. USA, 79: 1945-1949,1982. 1. Monnat. R. M., Jr., and Loeb, L. A. Mechanisms of neoplastic transforma 27. Yang, J., MÃ¤her,V. M., and McCormick, J. M. Kinds of mutations formed tion. Cancer Invest., /: 175-183, 1983. when a shuttle vector containing adducts of (Â±)-7/3,8a-dihydroxy-9a,10a- 2. Walker, G. C. Mutagenesis and inducible responses to deoxyribonucleic acid epoxy-7,8,9,10-tetrahydrobenz[a)pyrene replicating in human cells. Proc. damage in Escherichia coli. Microbiol. Rev., 48:60-93. 1984. Nati. Acad. Sci. USA, 84: 3787-3791, 1987. 3. Singer, B., and Grunberger, D. Molecular Biology of Mutagens and Carcin 28. Yang, J., MÃ¤her,V. M., and McCormick, J. M. Kinds of mutations formed ogens. New York: Plenum Publishing Corp., 1983. when a shuttle vector containing adducts of benz[a]pyrene-7,8-diol-9,10- 4. Wunderlich, V., Schutt, M., Bottger, M., and Graffi, A. Preferential alkyla- epoxide replicates in Cos7 cells. Mol. Cell. Biol., 7: 1267-1270, 1987. tion of mitochondrial deoxyribonucleic acid by /V-methyl-A'-nitrosourea. 29. Schaaper, R. M., Kunkel. T. A., and Loeb, L. A. Infidelity of DNA synthesis Biochem. J., 118: 99-109, 1970. associated with bypass of apurinic sites. Proc. Nati. Acad. Sci. USA, 80: 5. Backer, J. M., and Weinstein, I. B. Mitochondrial DNA is a major cellular 487-491, 1983. target for a dihydrodiol-epoxide derivative of benzo[a]pyrene. Science (Wash. 30. Desjardins, P., Frost, E., and MorÃ¡is,R. Ethidium bromide-induced loss of DC), 209: 297-299, 1980. mitochondrial DNA from primary chicken embryo fibroblasts. Mol. Cell. 6. Allen, J. A., and Coombs, M. M. Covalent binding of polycyclic aromatic Biol., 5: 1163-1169, 1985. compounds to mitochondrial and nuclear DNA. Nature (Lond.), 287: 244- 31. Clayton, D. A., Doda, J. N., and Friedberg, E. C. The absence of a pyrimidine 245. 1980. dimer repair mechanism in mammalian mitochondria. Proc. Nati. Acad. Sci. 7. Backer, J. M., and Weinstein, I. B. Interaction of benzo[a]pyrene and its USA, 71: 2777-2781, 1974. dihydrodiol-epoxide derivative with nuclear and mitochondrial DNA in 32. Clayton, D. A. Replication of animal mitochondrial DNA. Cell, 28: 693- C3H10T/2 cell cultures. Cancer Res., 42: 2764-2769, 1982. 705, 1982. 8. Niranjan, B. G., Bhat, N. K., and Avadhani, N. G. Preferential attack of 33. Durphy, M., Manley, P. N., and Friedberg, E. C. A demonstration of several mitochondrial DNA by aflatoxin lÃ¬,during hepatocarcinogenesis. Science deoxyribonuclease activities in mammalian cell mitochondria. J. Cell Biol., (Wash. DC), 215: 73-75, 1982. Â«2:695-706, 1974. 9. Anderson. S., Bankier, A. T., Barrell. B. G., de Bruijn, M. H. L., Coulson, 34. Cummings, O. W., King, T. C, Holden, J. A., and Low, R. L. Purification A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., and characterization of the potent endonuclease in extracts of bovine heart Schreier, P. H., Smith, A. J. H., Staden, R., and Young, 1. G. Sequence and mitochondria. J. Biol. Chem., 262: 2005-2015, 1987.

4583

Shiro Mita, Raymond J. Monnat, Jr. and Lawrence A. Loeb

Cancer Res 1988;48:4578-4583.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/48/16/4578

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/48/16/4578. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.