Investigating the Erbb Protein Interactome

INVESTIGATING THE E RB B PROTEIN INTERACTOME

Jasna Curak

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto

Investigating the ErbB Protein Interactome

Jasna Curak Master of Science Graduate Department of Molecular Genetics University of Toronto 2010

ABSTRACT

The er ythroblastoma (ErbB) receptor family consists of four members that are

implicated in many human cancers. To gain insight into their biological function, we

investigated their interacting partners to derive a comprehensive protein interaction

network. Using the membrane yeast two-hybrid (MYTH) system we probed the ErbB2,

ErbB3, and ErbB4 interaction space and validated a subset of interacting partners using the lu minescence-based mammalian inter actome mapping (LUMIER) system. The

integrated use of these two complementary protein interaction technologies generated

high confidence data and identified many novel ErbB binding partners, a subset of

which was supported by co-immunoprecipitation in the breast adenocarcinoma cell line

Sk-Br-3 including the GPCR GPRC5B, the cysteine protease CAPN1, and WIF1, a

secreted protein containing 5 EGF domains that may represent a novel ErbB ligand.

Our systematic approach offers an unbiased systems level view that may identify novel

drug targets and contribute to therapeutic research.

ACKNOWLEDGMENTS

The pages in this thesis are reflective of collaborative efforts. It is more than the sum of its parts and many people contributed significantly to its completion. I offer my sincerest gratitude to my supervisor Igor Stagljar whose support, patience, and knowledge drove the direction of this project. Most importantly, your conviction of my ability truly is appreciated. Continuously, you challenged my abilities and convinced me that ‘impossible was nothing’. I am grateful that you allowed me to explore science by so many avenues. For what it’s worth, it was worth all the while. I would like to express gratitude to my committee members Drs. Corey Nislow, Tony Pawson, and Jeff Wrana. My committee members challenged me and provided insights that guided this work, substantially improving the finished product. I am fortunate that Corey’s lab was adjacent to ours and he, without fail, offered his time, support, and encouragement. Thank-you for always having your door open. Throughout this work, I have collaborated with many researchers whose expertise was invaluable. To Miriam Barrios-Rodiles from the Wrana lab, whose excitement and optimism was contagious, I am grateful for her expertise in LUMIER screening and analysis. Kevin Brown from the Jurisica lab was patient and dedicated to this work. Also, to Dr. Jason Moffat and the Moffat lab members Kim Blakely and Anthony Mak: thank-you for the honorary lab membership and always allowing me to discuss ideas and perform experiments in your lab. Kim, as always, thanks for our talks of life, love, and science. Throughout our years of undergraduate and graduate studies I have always considered you a best friend, and our years have truly shaped me personally. I am indebted to my lab colleagues, both past and present, who always provided an environment where questions are embraced and challenges collectively tackled. Dawn Edmonds, the smooth running of experiments is a testament of her efforts and ordering the ‘I forgot this item but need it now’. You’ve managed to keep my perspectives grounded, and somehow, I always walked away knowing “my life isn’t over”. Jamie Snider, your willingness to help people is only matched by your willingness to help people. I’m so glad that you’ve challenged my EVERY result, my science is better for it. Jing Kittanakom, thank-you for the ‘damage-control’ solutions. I’m fortunate to have such a great friend who doesn’t mind calls at ANY hour for a “quick question”. Anthony Arnoldo, you patiently trained me in the lab and I have always appreciated how you’ve always considered me a colleague, even after listening to my million questions. Lastly, Frank. I never thought I would get along with you, but here we are, a close personal and scientific ally. Thanks for always listening to the drama, both personal and scientific. Thank-you to my family and friends. Throughout my work on “science stuff” you’ve been patient and supportive.

Jasna Curak iii

This thesis is dedicated to my parents Ivica and Nevenka Curak

And to my aunt Davorka Milic.

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENTS ...... iii

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

LIST OF APPENDICES ...... x

LIST OF ABREVIATIONS ...... xi

CHAPTER 1: INTRODUCTION ...... 1

1.1 THE ErbB FAMILY ...... 1

1.12 ErbB RECEPTOR OVERVIEW ...... 2

1.13 THE ErbB FAMILY MEMBERS ...... 2

1.14 ErbB DOMAIN STRUCTURE AND FUNCTION ...... 5

1.15 ACTIVATION AND SIGNALING ...... 8

1.16 ErbB REGULATION ...... 10

1.17 RECEPTOR ENDOCYTOSIS ...... 12

1.18 CLINICAL RELEVANCE ...... 14

1.19 THERAPEUTICS ...... 15

1.2 PROTEIN-PROTEIN INTERACTIONS ...... 17

1.21 PPI DETECTION PLATFORMS ...... 17

1.22 ErbB HIGH-THROUGHPUT PROTEOMIC STUDIES ...... 22

1.3 THESIS RATIONALE ...... 24

CHAPTER 2: METHOD AND MATERIALS ...... 25

2.1 REAGENTS/ANTIBODIES ...... 25

2.2 CELL CULTURE ...... 26

2.3 TRANSFECTION ...... 26

2.4 LENTIVIRUS ...... 26

2.4.1 PRODUCTION ...... 26

2.4.2. DETERMINING THE MULTIPLICITY OF INTFECTION (MOI) ...... 27

2.4.3 INFECTION ...... 27

2.5 LUMIER ...... 27

2.5.1 LUMIER OPTIMIZATION AND LUCIFERASE DETECTION ...... 27

2.5.2 BAIT CONSTRUCTION AND EXPRESSION ...... 28

2.5.3 PREY CONSTRUCTION AND EXPRESSION ...... 28

2.5.4 IMMUNOPRECIPITATION USING HEK 293T LYSATE IN 6-WELL FORMAT ...... 29

2.5.5. LUMIER CONDITIONS ...... 30

2.5.6. LUMIER SCREEN ...... 31

2.5.7 DATA ANALYSIS AND VISUALIZATION OF LUMIER RESULTS ...... 31

2.6 IMMNOPRECIPITATION USING Sk-Br-3 CELL LYSATE ...... 32

2.7 MEMBRANE YEAST TWO HYBRID (MYTH) ...... 33

2.7.1 PLASMIDS ...... 33

2.7.2 MYTH ASSAY ...... 34

2.8 WESTERN BLOT ANALYSIS USING YEAST EXTRACT ...... 34

2.9 VIABILITY ASSAYS ...... 35

2.10 RNA EXTRACTION ...... 35

2.11 QUANTITATIVE RT-PCR (qRT-PCR) ...... 35

2.12 BIOINFORMATIC ANALYSIS ...... 36

CHAPTER 3: RESULTS ...... 37

3.1 ErbB2 AND ErbB4 ARE PHOSPHORYLATED IN YEAST ...... 37

3.2 ErbB2, ErbB3, AND ErbB4 MYTH RESULTS EVALUATED USING BIOINFORMATICS .38

3.3 CONSTUCTION OF BAIT AND PREY EXPRESSION SYSTEM ...... 39

3.4 DETECTION OF PHOSPHO-INDEPENDENT AND DEPENDENT INTERACTIONS USING LUMIER ...... 40

3.4.1 HEK 293T CELLS ARE SENSITIVE TO SERUM STARVATION WITH PBS TREATMENT ...... 40

3.4.2 PERVANADATE PROMOTES CONSTITUTIVE ErbB PHOSPHORYLATION ...... 42

3.5 ErbB RECEPTOR SCREENING USING LUMIER ...... 43

3.5.1 ErbB SCREENS PRIMARILY DETECT PHOSPHO-DEPENDENT PROTEIN INTERACTIONS ...... 44

3.5.2 THE INTEGRAL MEMBRANE PROTEINS GPRC5B AND DDR1 AND THE SECRETED PROTEIN WIF1 INTERACT STRONGLY WITH THE ErbB RECEPTORS ....45

3.5.3 LUMIER SUBSTIANTES MYTH IDENTIFIED INTERACTIONS AND ALSO DETECTS NOVEL PPIs ...... 45

3.7 A SUBSET OF INTERACTIONS ARE VALIDATED BY CO-IMMUNOPRECIPITATION ..47

3.8 NEUREGULIN1 β STIMULATES TRANSCRIPTION OF ErbB-RESPONSIVE GENES ....48

CHAPTER 4: DISCUSSION ...... 50

4.1 ErbB2 AND ErbB4 are PHOSPHORYLATED IN YEAST ...... 50

4.2 ErbB RECEPTOR OVEREXPRESSION DRIVES RECEPTOR ACTIVATION ...... 51

4.3 POOR DETECTECTION OF ErbB PHOSPHO-INDEPENDENT INTERACTIONS ...... 54

4.4 WIF1 IS A NOVEL ErbB INTERACTOR ...... 55

4.5 HDAC6 IS A NOVEL BINDING PARTNER OF THE ErbB RECEPTOR FAMILY ...... 57

4.6 PEPTIDYL PROYL ISOMERASES AND BCL-2 MEMBERS INTERACT WITH ErbB RECEPTORS ...... 58

4.8 PTEN REMAINS A PUTATIVE ErbB2 BINDING PARTNER ...... 62

4.9 THE RTK DDR1 BINDS TO ErbB2, ErbB3, and ErbB4 ...... 63

4.10 OTHER INTERESTING ErbB INTERACTIONS ...... 63

4.11 PROTEOMICS QUALITY CONTROL ...... 64

CHAPTER 5: FUTURE PERSPECTIVES ...... 68

TABLES ...... 71

FIGURES ...... 84

APPENDIX ...... 126

vii

LIST OF TABLES

Table 1. Activating ErbB receptor ligands. Table 2. Plasmids used in this study. Table 3. ErbB library GeneCard summary Table 4. LUMIER control plasmids. Table 5. Genes transcribed in response to ErbB receptor activation. Table 6. Bait and prey primers for qPCR analysis. Table 7.Pearson product-moment correlation coefficient (PMCC) for ErbB LUMIER screens. Table 8. LUMIER hits ranked by frequency detected amongst biological replicates. Table 9. Interactions analyzed by co-immunoprecipitation in Sk-Br-3 cells.

viii

LIST OF FIGURES

Figure1. The ErbB signaling cascade can be divided into the input, signal-processing, and output layer. Figure 2. Two important ErbB signaling pathways are the PI3K-Akt and Ras-Raf- MAPK cascade. Figure 3. The ErbB receptor ectodomain has distinct inactive and active conformations. Figure 4. Intramolecular features of the tyrosine kinase domain. Figure 5. Clathrin-mediated endocytosis of EGFR efficiently terminates signaling. Figure 6. Lu minescence-based mammalian inter actome mapping (LUMER) system. Figure 7. Split-ubiquitin based membrane yeast two-hybrid (MYTH) system. Figure 8. The ErbB2, ErbB3, and ErbB4 protein interactome identified using MYTH. Figure 9. ErbB2 and ErbB4 are phosphorylated in yeast. Figure 10. Bioinformatic analysis reveals many MYTH hits share similar semantics with the ErbB receptors. Figure 11. Project Pipeline. Figure 12. ErbB library expression confirmed by immunofluorescence. Figure 13. ErbB protein expression and extraction optimized for LUMIER analysis. Figure 14. ErbB receptors are partially inactivated by serum starvation followed by PBS- treatment. Figure 15. HEK 293T cells are sensitive to PBS-treatment. Figure 16. Pervanadate induces constitutive phosphorylation of ErbB receptors. Figure 17. LUMIER hits ranked by frequency detected amongst biological replicates. Figure 18. ErbB LUMIER screening primarily detects phospho-dependent interactions. Figure 19. The integral membrane proteins GPRC5B and DDR1 strongly interact with the ErbB receptors. Figure 20. Novel LUMIER-identified interactions are partially detected by MYTH. Figure 21. GPRC5B and RABGGTA co-immunoprecipitate with endogenous ErbB2 in Sk-Br-3 cells. Figure 22. CAPN1, RABGGTA, GPRC5B, and WIF1 co-immunoprecipitate with endogenous ErbB3 in Sk-Br-3 cells. Figure 23. Baits, preys, and ErbB transcriptional targets are expression in HME1 cells. Figure 24. NRG1 β stimulates transcription of a subset of the ErbB responsive genes. Figure 25. Model for ErbB2-induced evasion of apoptosis.

LIST OF APPENDICES

Table 1. ErbB2 MYTH hits and LUMIER NLIR values. Table 2. ErbB3 MYTH hits and LUMIER NLIR values. Table 3. ErbB4 MYTH hits and LUMIER NLIR values. Table 4. Renilla luciferase LUMIER NLIR values.

LIST OF ABREVIATIONS

3-AT 3-aminotriazole A-loop activation loop Cub C-terminal half of ubiquitin CWS canonical Wnt signaling DDR1 discoidin domain receptor 1 ErbB erythroblastoma gene B FBS fetal bovine serum FKBP8 FK506-binding protein, 38 kDa GABARAPL2 GABA(A) receptor-associated protein-like 2 GAP GTPase-activating proteins GEF guanine nucleotide exchange factor GO gene ontology GPCR G-protein coupled receptors Grb2 growth factor receptor bound 2 HER human epidermal growth factor receptor HDAC6 histone deacetylase 6 HTP high-throughput LIR LUMIER intensity ratio LUMIER luminescence-based mammalian interactome mapping MAPK mitogen activated protein kinase MF α yeast mating factor alpha signal sequence mTORC1 mammalian target of rapamycin complex 1 MYTH split-ubiquitin based membrane yeast-two hybrid NCWS non-canonical Wnt signaling NLIR normalized LUMIER intensity ratio NRG1 β neuregulin 1 β Nub N-terminal half of ubiquitin Pin1 protein interaction with NIMA PV pervanadate PI3K phosphatidylinositol-3-kinase PIP2 phosphatidylinosital-4,5-bisphosphate PIP3 phosphatiylinotisal-3,4,5-triphosphate PLC γ phospholipase C gamma P-loop phosphate binding loop PPI protein-protein interactions PPIase peptidyl-prolyl isomerase PTB phosphotyrosine-binding PTEN phosphatase and tensin homolog deleted on chromosome 10 PTM post-translational modifications PTP protein tyrosine phosphatases RTK receptor tyrosine kinases RT-PCR reverse transcriptase-PCR SCM serum-containing media

SFM serum-free media SH2 src homology 2 SOS son of sevenless STAT5 signal transducer and activator of transcription-5 TF transcription factor USP ubiquitin-specific proteases wNAPPA modified version of the nucleic acid programmable protein array WIF1 WNT inhibitory factor 1 YFP yellow fluorescent protein

xii

CHAPTER 1: INTRODUCTION 1.1 THE ErbB FAMILY Since their discovery in the 1980s, the human epidermal growth factor receptors (HER),

also referred to as the er ythroblastoma receptors (ErbB), have been the subject of great scientific interest due to the host of cellular functions which they modulate and the serious health consequences associated with their dysfunction. This family of receptor tyrosine kinases (RTKs) responds to external stimuli and coordinate signaling cascades that maintain cellular homeostasis. As such, receptor mutations are often oncogenic as they can cause aberrant signaling contributing to cell transformation and aggressive metastatic behavior (29,53). The ErbB receptor family is implicated in many human cancers. Indeed, many human tumors are characterized by overexpression and overactivity of the ErbB family and this is correlated with a poor prognosis

(63,67,88,89,140,162).

Driven largely by their oncogenic properties, extensive investigation has been conducted characterizing the ErbB family. Even so, with the advent of powerful new technologies it has become apparent that there is still much to learn about the ErbB family and their role in the development of cancer. And so, through the integrated application of such technologies, this project works toward improving our current knowledge of ErbB signaling and regulation. To this end, we probed the ErbB signaling network, identifying novel ErbB interactions and shedding light on the oncogenic nature of these receptors in hopes that this knowledge will in-part aide future therapeutic advances in the fight against ErbB oncoprotein-driven cancers.

1.12 ErbB RECEPTOR OVERVIEW The ErbB family members - EGFR (ErbB1/HER1), ErbB2 (HER2), ErbB3 (HER3), and

ErbB4 (HER4) - are type I transmembrane growth factor receptors. Canonical signaling events are initiated by ligand binding or high receptor density causing receptor homo- and/or hetero-dimerization. Receptor dimerization induces intracellular transphosphorylation of characteristic tyrosine residues (97). A defining feature of the

ErbB family is that ErbB2 and ErbB3 are functionally incomplete receptors; ErbB2 lacks a ligand binding domain and consequently is constitutively poised to dimerize while

ErbB3 lacks an ATP binding domain and thus its signaling is entirely dependent on its heterodimeric partner (32,161). The phosphorylated ErbB C-terminus serves as a docking site for signal transducers containing Src homology 2 (SH2) or phosphotyrosine-binding (PTB) domains. The binding of signal transducers initiates a

diverse series of signaling cascades resulting in cellular proliferation, cell cycle

progression, and cell motility (Fig 1).

1.13 THE ErbB FAMILY MEMBERS Discovered by Stanley Cohen, the EGF ligand was the first growth factor identified

when it was found to cause premature eyelid opening of new-born mice (39). Soon

afterward, the EGF receptor was isolated and sequenced from a uterine epidermoid

carcinoma that overexpressed the receptor (51). Its sequence was found to be highly

homologous to the v-ErbB oncogene, found in the avian erythroblastosis transforming

retrovirus that causes leukemia of red blood cell precursors (51). Since this discovery,

EGFR has been extensively studied. EGFR knockout mice show it plays an essential role in epithelial cell development; mice die either at mid-gestation, birth, or postnatal

2 day 20 (strain dependent) (109,160,170). Post-natal mice exhibit severe brain defects and alterations in the migration or differentiation of specific epithelial cells. These phenotypes are accounted for by the diverse set of molecular events triggered by

EGFR. EGFR responds to several ligands (Table 1) and form four functional homo- and heterodimers (Fig 1). Following ligand stimulation, tyrosine-based motifs recruit many adapter and effector proteins such as growth-factor-receptor-bound-2 (Grb2) and the

SH2-containing (Shc) protein, activating the Ras-Raf-mitogen activated protein kinase

(MAPK) signaling cascade (Fig 2).

ErbB2 was the second ErbB family member identified. Similar to EGFR, ErbB2 knockout mice are embryonic lethal (95). ErbB2 is unique amongst the receptor family because no ligands have been identified and, until recently, it was believed to be autonomously regulated. This was a widely accepted characteristic for many reasons:

(i) it is the only ErbB receptor whose overexpression is sufficient for cell transformation

(47) (ii) it is the preferred heterodimeric partner of all ErbB receptors (60,65,176) (iii) it does not adopt a tethered configuration as seen with the other ErbB receptors when inactive and accordingly, lacks intramolecular interactions that autoinhibit the remainder of the ErbB family (55). Instead, ErbB2 is in an extended conformation, which is reminiscent of the ligand-activated ErbB receptors (60),(47) (Fig 3). Therefore, it is constitutively poised to interact with other activated ErbB receptors. Recently, its autonomous status has been challenged by Mark Lemmon’s group, who solved the structure of the single Drosophila melanogaster ErbB orthologue (dEGFR) (6).

Evolutionally, ErbB2 was believed to arise from an EGFR gene duplication event, leading to the loss of conserved critical sites within the extracellular domain (165).

Lemmon’s group found that ErbB2 is the closest structural relative of dEGFR. Contrary to the ErbB2 ligandless property, dEGFR is regulated by five ligands, including four agonists (Spitz, Gurken, Keren, and Vein) and one antagonist (Argos). Nevertheless, like ErbB2, dEGFR is in an extended conformation and also lacks the intramolecular autoinhibitory mechanism. This argues that ErbB2 may be ligand-regulated, but these ligands remain elusive.

ErbB2 does have additional autoinhibitory mechanisms that are not found in the other ErbB receptors. While other ErbB kinase domains are activated by tyrosine phosphorylation on their activation loop (Fig 4), ErbB2 is not (55). In fact, phosphorylation of its activation loop does not stimulate its activity. The most important

ErbB2 regulatory feature is the orientation of the αC helix located in the kinase domain.

Within this loop, 5 of the 8 conserved residues differ from EGFR. When all of these

residues were exchanged to match EGFR, ErbB2 kinase activity increased 10-fold,

suggesting this domain is strongly autoinhibited (55). Consistent with this observation,

many ErbB2 gain-of-function mutations are found within this αC helix of the kinase

domain (55).

The third ErbB member, ErbB3, lacks conserved residues within its kinase

domain, rendering it kinase-dead (165). Despite this, ErbB3 knockout mice are lethal

(141), suggesting that functional heterodimers with the other ErbB receptors are

essential. Moreover, ErbB3 is ligand regulated (Table 1), and capable of activating the

PI3K-Akt signaling pathway (Fig 2) since it has six PI3K binding sites, which are not

present on EGFR or ErbB2. This pathway is partly responsible for the acquired drug

resistance of ErbB positive tumors. Targeting ErbB positive tumors using tyrosine

4 kinase inhibitors initiates an Akt feedback loop that causes ErbB3 transcription, driving

PI3K activation (157). This compensates for ErbB inhibition since it restores the PI3K-

Akt signaling cascade. Accordingly, loss of ErbB3 function reduces Akt phosphorylation by 50% and causes tumor regression (96).

The fourth ErbB member is ErbB4, and like all ErbB receptors, ErbB4 knockout mice are embryonic lethal (61). Although ErbB4 shares many features with EGFR including ligand binding specificity (Table 1), this receptor deviates from conventional

ErbB behavior since its activation has been suggested to inhibit cell proliferation and promote apoptosis (84). Alternate mRNA splicing generates several isoforms including a juxtamembrane variant encoding a 23 amino acid insertion that is targeted by the

ADAM metalloproteases family ADAM17/TACE resulting in ectodomain shedding

(116,142). This internalized fragment forms a complex with STATs and translocates to the nucleus to regulate gene expression (116,142). Interestingly, ErbB4 shares the highest sequence similarity to the other ErbB members (EGFR 64%, ErbB2 61%, ErbB3

70%), but still remains poorly understood since both human oncoprotein and tumor suppressor roles have been proposed.

1.14 ErbB DOMAIN STRUCTURE AND FUNCTION The ErbB receptors range in size from 135 to 148 kDa and share 46-55% sequence identity and 61-70% sequence similarity within their extracellular, transmembrane (TM), juxtamembrane, kinase, and the C-terminal domains. The extracellular domain is divided into four subdomains named I, II, III and IV. Inactive, monomeric ErbB receptors adopt a tethered, autoinhibitory conformation (reviewed in (153)) (Fig 3). Extracellular subdomains II and IV are cysteine rich and form strong intramolecular interactions

5 which are necessary to occlude the dimerization arm found in subdomain II, preventing spontaneous receptor signaling in the absence of ligand (20). Ligand binding causes a gross conformational change of the extracellular domains (extended conformation). This relieves the autoinhibitory interactions by disrupting the interaction between subdomains

II and IV, allowing subdomains I and III to bind a single ligand. This interaction exposes the dimerization arm and, as a result, the receptor is primed for homo- or heterodimerization with another activated ErbB receptor (Fig 3).

Interestingly, the ErbB receptor TM domain functions both as a plasma membrane anchor and as a regulator of dimerization. The TM segment contains two dimerization motifs of which only one motif correctly aligns the kinase domains for catalysis (108,112). Indeed, there are a substantial number of inactive dimers at the plasma membrane (35,196). Computational analysis has shown that the transition from an inactive to active dimerization motif requires a 120 degree rotation (112). And so, receptor dimerization is necessary but not solely sufficient for inducing receptor activation.

The juxtamembrane domain is a short region residing at the intracellular face of the plasma membrane that interacts with proteins involved in the regulation of receptor steady-state levels. While this region is not currently associated with many functions, our lab has recently found that Histone Deacetylase 6 (HDAC6) interacts with this domain. Furthermore, functional analysis found that disruption of this interaction led to rapid receptor endocytosis and degradation (46).

The ErbB family kinase domains are highly homologous (59-81%). Upon receptor activation, this domain transfers the γ-phosphate of ATP to tyrosine residues on the

6 heterodimeric receptors’ intracellular domain, which is an essential step for downstream signal transduction. The architecture of kinase domains are very similar, and consist of two adjacent lobes, the N-terminal lobe (N-lobe) and C-terminal lobe (C-lobe) which flank the active site (Fig 4). The N-lobe contains both a phosphate binding loop (P-loop) and the αC helix, while the C-lobe contains the activation loop (A-loop). Mechanistically, the P-loop functions to hold the phosphate-donating ATP in position through a conserved lysine residue, which binds the α- and β- phosphates of ATP. This

interaction is stabilized by ionic interactions with a glutamic acid in the αC helix.

Another conserved region, known as the catalytic loop, resides at the base of the active

site. The A-loop maintains the tyrosine substrate in position to attack the aspartic acid

in the catalytic loop, resulting in the phosphorylation of the tyrosine substrate (reviewed

in (76)).

In addition to its substrate-positioning function, the A-loop acts as a

phosphorylation-dependant regulatory switch: in the inactive ErbB receptor the A-loop is

not phosphorylated and assumes an autoinhibitory conformation, preventing substrate

binding. Subsequent phosphorylation of the A-loop results in a conformational change

which relieves this autoinhibition. This change is accompanied by the conformational

change of the αC helix to a position where it is poised for catalysis.

Transphosphorylation occurs between receptor dimers whose kinase domains are

asymmetrically positioned such that the C-lobe of one monomer contacts the N-lobe of

its interacting partner, promoting the conformational changes necessary to activate its

kinase activity (197).

The transphosphorylation of the C-terminal tail is required for subsequent signaling since it serves as a scaffold for multiple adaptor molecules that activate downstream effectors. This region is the most divergent domain amongst the ErbB receptors (11-25% homology) and it is this divergence which accounts for the difference of downstream effector functions. Taken together, the structural complexity of the ErbB receptors imposes regulatory mechanisms that prevent aberrant receptor activation, and also accounts for the diversity of signaling pathways activated.

1.15 ACTIVATION AND SIGNALING The ErbB receptor family is regarded as the prototypical RTK. Similar to many RTKs, activation by either high receptor density or ligand binding results in receptor homo- and/or hetero-dimerization and initiates canonical signaling events. To date, 13 polypeptide ligands have been identified, all of which contain an EGF-like domain which is sufficient to confer binding specificity (Table 1). Although ErbB2 is ligandless and

ErbB3 is kinase-dead (32,161), the ErbB2-ErbB3 heterodimer generates the most potent signaling events (179). The phosphorylated ErbB receptor C-terminus recruits many signal transducers containing SH2 or PTB domains, initiating a diverse series of signaling cascades resulting in cellular proliferation, cell cycle progression, and cell motility (Fig 1).

The repertoire of ErbB ligands and receptor dimers confers diverse biological responses because it is believed that these factors control phosphorylation patterns on the ErbB C-terminal tail (168). SH2 and PTB phospho-binding motifs that recognize the

ErbB phosphotyrosines are found in many proteins including Shc, Crk, Grb2, Grb7,

PI3K (via p85 regulatory subunit), and the protein tyrosine phosphatases (PTP) SHP1

8 and SHP2. These proteins in turn activate multiple signaling pathways including the

Ras-Raf-MAPK, PI3K-Akt, phospholipase C gamma (PLC γ), STATs, and Src-activated pathways.

The Ras-Raf-MAPK pathway regulates cell proliferation and survival. Activated

ErbB receptors bind Grb2 and Shc and recruit Son of Sevenless (SOS), a guanine nucleotide exchange factor (GEF) which in turn activates Ras GTPase. Active Ras-GTP activates Raf-1 and subsequently the MAPK cascade which terminates in the import of activated Erk1/2 into the nucleus where it phosphorylates transcription factors involved in cell proliferation (reviewed in (195) (Fig 1, 2 ).

Another potent signaling cascade that is also involved in cell growth, apoptosis resistance, invasion, and migration is the PI3K-Akt pathway (Fig 2). As mentioned, PI3K is a lipid kinase that is composed of two subunits, a catalytic subunit p110 and a regulatory subunit p85. The regulatory subunit is recruited to activated ErbB3 and

ErbB4 receptors, relieving basal inhibition of p110 by p85. Activated PI3K converts phosphatidylinosital-4,5-bisphosphate (PIP2) to phosphatiylinotisal-3,4,5-triphosphate

(PIP3) which co-localizes the serine/threonine kinase Akt and the kinase PDK at the plasma membrane. PDK subsequently phosphorylates and thereby activates Akt which regulates a number of well characterized proteins which contribute to cell proliferation.

Although EGFR does not have binding sites for PI3K, it can couple to the PI3K-AKT pathway via cross-talk with the Ras signaling cascade. This pathway is negatively regulated by Phosphatase and TE nsin Homolog (PTEN) which dephosphorylates PIP3

to PIP2. The PI3K-Akt pathway is overactive in many cancers, partially due to mutations

in PTEN which are found in 50% of all human cancers (41) (Fig 2).

PLC γ is a 145-kDa protein that contains two SH2 domains, one SH3 domain, and

two pleckstrin homology (PH) domains. In the PLC γ-dependent signaling pathway,

EGFR binding activates PLC γ which hydrolyzes PIP2. This hydrolysis yields inositol-

1,3,5-triphosphate (ITP) and 1,2-diacylglycerol (DAG), which increases intracellular calcium levels and activates protein kinase C (PKC), respectively. This pathway then signals through canonical MAPK cascade proteins via PKC activation of the MAPKs

(reviewed in (33)).

STAT5a and STAT5b are transcription factors belonging to the STAT family which consists of 7 members (STATs 1, 2, 3, 4, 5a, 5b, and 6). They remain inactive in the cytoplasm until binding to a cytokine or growth factor receptor. STAT5a and STAT5b are both phosphorylated by EGFR and subsequently heterodimerize and translocate into the nucleus to regulate gene transcription (134).

Src is a non-receptor tyrosine kinase that induces cell proliferation, migration, adhesion, and angiogenesis. Src phosphorylates many substrates including the EGFR, focal adhesion kinase (FAK), PI3K, and STATs. Although the ErbB receptors can uniquely and directly activate a subset of these pathways, there is significant cross-talk, redundancy, and most importantly, regulation between the signaling cascades.

1.16 ErbB REGULATION Since the ErbB family regulates a diverse set of signaling pathways, there are multiple layers of control imparted on these receptors. This robustness allows the ErbB receptors to tolerate internal and external perturbations while continuing to maintain cellular homeostasis. The ErbB network is designed with diverse inputs (13 ligands), outputs (gene transcription), and the core which consists of an interactive and

10 connective framework (Fig 1). The core redundancy is managed by various ‘systems control’ mechanisms that ensure accurate signal propagation.

The control systems governing the ErbB receptors include both positive and negative feedback loops. Positive feedback loops reinforce the propagated signal by allowing the system to recover from local perturbations while negative feedback loops attenuate the signaling cascade. Positive feedback buffering is exemplified by heat- shock protein-90 (HSP90) which refolds mutant proteins enabling normal protein activity and thereby conceals the mutant phenotypes (148). Interestingly, ErbB2 is partially stabilized at the plasma membrane by the activity of HSP90 (110) and HSP90 inhibition causes rapid ErbB2 ubiquitination and degradation (34). Another level of positive regulation observed in ErbB signaling is network redundancy which ensures signal propagation by simultaneously activating parallel pathways. For example, EGFR activates SOS in order to initiate the Ras-Raf-MAPK cascade and can do so by either directly binding Grb2 or Shc which both independently recruit SOS. Alternatively, EGFR may bind to Shc which then interacts with Grb2, recruiting SOS. Furthermore, redundancy can also occur through autocrine signaling. For example, ErbB activation causes transcriptional activity of the ligands TGF α and HB-EGF (152,155). These ligands are subsequently processed to mature ligands which bind and re-activate the

ErbB receptors.

Negative feedback loops are necessary to attenuate signaling. There are many stringent cellular controls that regulate signal amplitude, frequency, and duration. Pre- existing regulators include many PTPs and proteins involved in receptor degradation.

PTPs, such as the density-enhanced phosphatase-1 (DEP1) and protein tyrosine

11 phosphatase-1B (PTP1B), dephosphorylate RTKs and effectively terminate C-terminal docking of signal transducers (68). Other negative regulators are expressed after ligand receptor activation including the suppressor of cytokine signaling (SOCS) family which

promotes EGFR degradation through the recruitment of the E3 ubiquitin ligase complex.

Adaptor proteins such as Sprout (SPRY) inhibits Grb2 levels, thereby terminating the

Ras-Raf-MAPK signaling cascade (69). The mitogen-inducible gene 6 (Mig-6) is a

feedback inhibitor that is transcribed following growth factor stimulation and binds to the

kinase domain of EGFR and ErbB2 (7). Furthermore, there are also several negative

regulators which function to modulate signal intensity. For example, Herstatin is an

ErbB2 splice variant encoding half of the ErbB2 ectodomain and also retains an intron.

It binds to EGFR and ErbB2 monomers and antagonizes receptor dimerization (10).

Similarly, p85-sErbB3A is a ErbB3 splice variant that negatively regulates ErbB2,

ErbB3, and ErbB4 (94). While dephosphorylation and production of receptor antagonists

can effectively fine-tune ErbB signaling, the most drastic termination of signaling is

achieved by receptor endocytosis and degradation.

1.17 RECEPTOR ENDOCYTOSIS Our knowledge of ErbB receptor endocytosis is largely based on our current

understanding of EGFR. The degradation pathways of the other ErbB members are

poorly understood and currently the subject of intense scrutiny.

EGFR is usually found in cholesterol-rich microdomains called caveolae.

Following ligand induction, the receptor is both mono- and poly-ubiquitinated by the

ubiquitin ligase Cbl (48,73,99). Cbl can bind directly or indirectly (mediated by Grb2) to

EGFR and this event is a prerequisite for internalization. Following Cbl binding, the

12 receptor relocates to clathrin-coated pits, undergoes endocytosis into clathrin-coated vesicles and fuses with early endosomes (99) (Fig 5). Upon reaching the early endosomes there are two options: plasma membrane recycling or lysosomal degradation. The ligand-receptor stability at endosomal pH largely influences this decision, and consequently also influences the signal strength and duration. For example, EGFR in complex with TGF α results in increased receptor recycling as TGF α readily dissociates from the receptor at endosomal pH (44). This dissociation is coupled to EGFR dephosphorylation and deubiquitination. Conversely, the EGF-EGFR complex targets the receptor for degradation because the ligand remains bound to the receptor in the endosomal vesicles. When facing lysosomal degradation, EGFR is sorted to multi-vesicular bodies and is subsequently degraded in the lysosome (Fig 5). Evidence of the importance of endocytosis in ErbB signaling is demonstrated by the observation that even though EGF binds EGFR with greater affinity than TGF α, a more potent signal

is generated by TGF α (44,52). This is consistent with the observation that low-affinity

ligands are generally more potent signal inducers than high affinity ligands, possibly due

to the increased receptor concentration at the plasma membrane (98,175,181).

Although comparatively less is known about endocytosis of ErbB2, ErbB3 and

ErbB4, some details have been uncovered. It is generally accepted that ErbB2 avoids

receptor-mediated endocytosis, however, there are conflicting reports regarding its

precise mode of downregulation (104). Researchers have found that it is constitutively

internalized and recycled to the plasma membrane while others show it is rarely

localized to clathrin-coated pits (16,184). It is also possible that it undergoes clathrin-

independent forms of internalization. While even less is known about ErbB3 and ErbB4

13 endocytosis, these receptors have been shown to bind the ubiquitin ligases Nrdp1 and

Itch, respectively. However, while functional overexpression and knockdown of the interacting ubiquitin ligases have demonstrated their role in negatively regulating ErbB3 and ErbB4 receptor levels, the mechanism of action is still under investigation

(133),(120). And so, much remains unknown about the endocytic pathway of ErbB2,

ErbB3, and ErbB4 and further study is warranted.

1.18 CLINICAL RELEVANCE The ErbB signaling cascades can become “re-wired”, resulting in uncontrolled cellular proliferation, transformation and tumorigenesis. Several ErbB network members are proto-oncoproteins that can influence diverse growth signaling pathways and by-pass all systems control mechanisms by ignoring apoptosis cues. In addition, these transformed cells have increased capacity to invade and metastasize to different tissues. This exemplifies the power of cellular miscommunication and the destructive consequence of off-setting homeostasis.

ErbB overexpression or gain-of-function mutations are prognostic biomarkers for several cancers (169). This molecular signature is manifested through tumor phenotypes including chemotherapy resistance, aggressive metastatic behavior, and a decreased disease-free interval (63,67,88,89,140,162). Receptor deregulation can be caused by gain-of-function mutations and genetic insertions or deletions (indels), which lead to aberrant receptor signaling. Indels are frequently found in the ErbB dimerization domain and result in constitutive activation (139). Additionally, deletions within the extracellular domain can alleviate negative regulatory mechanisms (reviewed in (139).

Activating mutations have also been observed within the C-terminal kinase domain, increasing the receptors affinity for ATP, resulting in constitutive activation (53).

ErbB overexpression results in hyperactivation of downstream signaling cascades. EGFR is overexpressed in 80% of all head and neck tumors (57), 88-99% of non-small cell lung cancers (NSCLC) (31), and 40% of gliomas (57),(31). ErbB2 is overexpressed in 25% of breast tumors and high levels are also seen in lung, pancreas, colon, endometrial, and ovarian cancers (145). ErbB2 overexpression causes the most aggressive breast cancer with strong metastatic tendencies. Breast cancer patients with

ErbB2 negative tumors have a mean survival of 6-7 years, in contrast with ErbB2 positive patients who have a mean survival of 3 years (Denis Slamon talk). Moreover,

ErbB2 transgenic mice and mice implanted with human ErbB2 breast cancer xenografts experienced a 200% increase in spontaneous metastasis, and displayed increased chemotherapy resistance (58,132). This flags the ErbB receptors as aggressive proto- oncoproteins, generating a strong pharmaceutical demand for drugs that target and attenuate their activity.

1.19 THERAPEUTICS The pharmaceutical industry has exhaustively searched for molecules that inhibit the

ErbB kinase domain and dimerization arm in an effort to prevent aberrant signaling.

Numerous small-molecule tyrosine kinase inhibitors have been developed which obstruct the nucleotide-binding pocket, preventing ATP binding and catalysis. These include Gefitinib (IressaTM ; AstraZeneca) (12,115,123) and Erlotinib (Tarceva TM ;

Genentech/OSI) (42,71,113,129), which specifically target EGFR and are used to treat

NSCLC. Dual-specificity inhibitors targeting multiple ErbB receptors have also been

15 developed, including Lapatinib (GlaxoSmithKline) (90,146,147), CI-1033 (Pfizer) (5,200) and EKB-569 (Wyeth-Ayerst Research) (117,183,194) which target both ErbB1 and

ErbB2 (188).

Besides small molecule inhibitors, recent advancements in treatment of ErbB- induced cancers have been realized by the development of monoclonal antibodies targeting the ErbB receptor extracellular domain. The efficacy of these treatments results from the antibody-dependant recruitment of cytotoxic lymphocytes, thereby marking the aberrant cells for clearance by the immune system (38). Current antibodies approved for usage include trastuzumab (Herceptin TM ; Genentech)

(14,126,151,162,163)– an ErbB2-targeting antibody used to treat ErbB2-driven breast

cancers, Cetuximab (Erbitux TM , Bristol Myers Squibb(BMS)/ImClone) (74,121,130,131)

– an EGFR-targeting antibody used to treat colorectal cancer, and Pertuzumab

(Omnitarg TM ) (2,3,59,75)– an ErbB2 dimerization-arm-targeting antibody which

obstructs receptor dimerization. These monoclonal antibody treatments have

dramatically improved breast-cancer patient survival rates. While conventional

treatments have demonstrated only a 2% improvement in patient survival rate, ErbB2-

positive patients treated with Herceptin have experienced a 50% increase in disease-

free interval, and a 35% increase in overall survival (Denis Slamon talk).

Ongoing efforts to understand the ErbB receptor family have answered many

fundamental questions regarding ErbB-driven cancers, providing promising new

avenues for the treatment of several human cancers. Despite this, many aspects of

these receptors remain elusive, necessitating a more comprehensive analysis of ErbB

function and the ErbB interactome.

1.2 PROTEIN-PROTEIN INTERACTIONS The maintenance of cellular homeostasis is dependent on the precisely coordinated execution of simultaneous signaling events. Traditionally, efforts have focused on the investigation of specific cellular pathways, providing many significant insights, but also a narrow understanding of cellular function. Recently, our understanding of this complex coordinated process has been dramatically improved by a series of technological developments, allowing for the genome-wide analysis of genetic (171,172) and protein interactions (164). These analyses have been crucial in understanding many aspects of signaling networks, since many features of these networks are more evident at the systems level, and may easily be overlooked when examining the processes with a limited scope. Several comprehensive proteomic studies have examined protein interaction hubs or ‘functional modules’ in an effort to connect modules to function.

Indeed, this has proven effective with the ErbB receptors, which have received much attention due to their role in normal cell growth and disease.

1.21 PPI DETECTION PLATFORMS Protein function can be defined by two distinct parameters: (i) biochemical activity and

(ii) biological function. While biochemical activity may be predicted by examining protein sequences, domains, or structural analysis, understanding a proteins’ biological process is an integrated effort which involves the study of many proteins which, through association, can help define the biological function. Biological functions may be predicted by analysis of identified interacting partners, also commonly known as the guilt-by-association methodology. Deriving a comprehensive protein interaction network requires the identification of all protein interactions within the cell. While this method is

17 effective at deriving putative biological functions for proteins, it is a labour intensive technique requiring the examination of hundreds or thousands of pairwise protein- protein interactions. This labor-intensive requirement has been met with the introduction of high-throughput (HTP) technologies, which complement traditional techniques, allowing for the systematic analysis of a protein. Many innovative protein technologies have been developed to discover protein-protein interactions (PPIs) in a HTP manner; however, membrane proteins have long been difficult to examine due to their hydrophobic nature. This has been addressed with recent strategies that successfully detect membrane protein interactions, including the modified version of the nucleic acid

programmable protein array (wNAPPA) (136), yellow fluorescent protein (YFP) protein

complementation assay (PCA) (118), the lu minescence-based mammalian inter actome

mapping (LUMER) (13), and the split-ubiquitin based membrane yeast-two hybrid

(MYTH) (79,125).

In the wNAPPA system, prey proteins are expressed in situ using immobilized

cDNA templates coupled to an in vitro transcription-translation system (IVTT) in order to generate a protein microarray (136). The query protein is co-expressed with arrayed proteins and PPIs are detected by use of antibodies specific for the query protein, followed by a HRP linked secondary antibody (136). The major drawback with this microtechnology is improper protein folding which is especially apparent when dealing with membrane proteins where folding is context dependent. In the absence of lipid membranes many issues with membrane protein folding arise. Most importantly, the absence of a membrane results in the solvent-exposure of transmembrane regions which radically changes the entropic and enthalpic energies of the folded state, thereby

18 altering the folded conformation (136). Unfortunately, there is no method to evaluate protein conformation in a HTP format. In addition, to exacerbate these issues it is unlikely that the IVTT system preserves post-translational modifications (PTM) such as acetylation and glycosylation, or it may produce non-physiologically relevant modification patterns. Most importantly, protein interactions are detected based on a single conformation of the protein. This static, isolated structure does not reflect the dynamic changes a protein undergoes in the context of the cell, such as side-chain motions that are lost in an in vitro system (25). In light of these concepts, assays that detect PPIs within a cellular environment may yield more promising results.

There have been multiple systems developed that address these limitations including the YFP-PCA assay which is based on split YFP reconstitution. In this system,

YFP fragment 1 (residues 1-158) and fragment 2 (residues 159 – 239) are fused to putative interacting proteins and full-length YFP is reconstituted only if the two proteins interact. The interaction may then either be detected via fluorescence microscopy or cells can be sorted by FACS for subsequent analysis. The advantages of this assay are that PPIs are assessed in living cells and that transient or low-affinity interactions can be detected. This sensitive detection is partially because YFP reconstitution stabilizes the bait and prey interactions and therefore caution must be used for quantification of protein kinetics when using this system.

An alternative technique for PPI analysis is the LUMIER assay. LUMIER is a sensitive assay that allows the semi-quantitative detection of PPIs. It has proven to be sensitive particularly in studying dynamic protein interactions (13). This system is highly amenable to HTP analysis because it is semi-automated and has been downscaled to

96-well format. To conduct LUMIER analysis, bait proteins are fused to the 36 kDa

Renilla reniformis or the 62 kDa Photinus pyralis firefly luciferase protein. This fusion is then transiently co-expressed in mammalian cells along with individual, triple FLAG- tagged prey proteins. Following incubation and subsequent cell lysis, prey proteins are immunoprecipitated with anti-FLAG antibodies. A simple enzymatic assay is then used to detect the presence of the luciferase-tagged bait protein whereby luciferase catalyzes the oxidation of its substrate, resulting in the emission of light which is detected with a luminometer (Fig 6). While transient interactions may be detected due to the overexpression of both bait and prey proteins, complexes are immunoprecipitated and must therefore be relatively stable. Finally, the signal detected by the luminometer is positively correlated with protein interaction affinity if binding stoichiometry is known.

Currently, methods to measure FLAG-tagged prey concentrations are in development so future use of LUMIER may yield quantification of protein kinetics (Barrios-Rodiles,

M., personal communication).

With all the aforementioned techniques it is difficult to be certain if detected interactions are direct. It is plausible that a bait and prey interaction is mediated by an adaptor protein which is endogenously expressed in these systems. To address this limitation, an isolated model system, such as yeast, can be used which limits genetic background thereby limiting co-operative binding. For this purpose, the MYTH assay was developed to detect protein interactions of integral membrane proteins within a yeast genetic background. MYTH allows for the sensitive detection of transient and stable protein interactions and it has been successfully applied to study proteins expressed in the model organism Saccharomyces cerevisiae. This system takes

20 advantage of the molecule ubiquitin, a 76 amino acid protein that is characteristically attached to lysine residues on substrate proteins. Ubiquitin attachment has traditionally been associated with targeting proteins for degradation (polyubiquitination) and more recently, to modulating protein activity and localization (monoubiquitination). Ubiquitin is covalently attached through an amide bond between its C-terminal Gly-76 and the ε-

amino group of a lysine residue on the substrate. This is a reversible reaction where

ubiquitin is removed at Gly76 in an ATP-independent manner by deubiquitinating

enzymes, also called ubiquitin-specific proteases (USP).

In 1994 Alexander Varshavsky’s group demonstrated that ubiquitin may be

separated into two moieties: the C-terminal half of ubiquitin (C ub ) and the N-terminal half

of ubiquitin (N ub ) (80,81) . These two moieties spontaneously re-associate because of

their affinity for one-another. Varshavsky’s group fused these moieties to several

proteins and through a series of elegant experiments they found that introducing the

point mutation N ub I13G prevented pseudo-ubiquitin reconstitution. In fact, the USPs

cleaved at the C ub only when bona fide interacting proteins were fused to the C ub and

Nub . This study provided the first line of evidence that C ub and N ub reconstitution may be

used as an analytical tool to detect PPIs (80,81).

This system has since been optimized for HTP analysis of PPIs. More

specifically, it has been adopted to study integral membrane proteins that have at least

one cytoplasmic tail segment (164). The integral membrane bait protein is fused to a C ub moiety which is linked to an artificial transcription factor (TF) consisting of the

Escherichia coli DNA-binding protein LexA and the herpes simplex virus activation domain VP16 (bait-Cub -TF). Preys are generated by fusion of cDNA or genomic DNA

21 fragments to the N ub G moiety. An interaction between the bait and prey proteins in yeast

reconstitutes full-length pseudo-ubiquitin. This event results in the recruitment of USPs

that release the TF, allowing it to translocate into the nucleus and activate a reporter

gene system (Fig 7). Yeast growth on selective media is indicative of a PPI (79,164).

Notably, the prey cDNA library is generated by oligo-dT and random primers synthesis,

so prey constructs generated by random primers may not be full-length. This may be

beneficial as it could expose protein domains that are usually buried, but it may also

lead to interactions that are not physiologically relevant. Additionally, yeast PTMs are

not fully conserved with mammalian PTM. These issues must be considered when

evaluating results. Despite these limitations, it is an attractive alternative system for the

detection of binary PPIs in an isolated genetic system.

These systematic studies allow for the identification of PPIs in a format where

every human ORF is evaluated. The integrated use of two or more of these systems, as

described here, provides high confidence data that meets the challenge of

understanding the biology of membrane proteins. The Human Genome Project

identified close to 32,000 ORFs (current estimates are approximately 25,000 (92)),

approximately 20% of which encode for proteins involved in signaling events including

520 protein kinases and 130 phosphatases (128,144). With the use of HTP PPI

detection platforms, the current aim of researchers is to investigate each protein’s

molecular role and we undertook the study of the ErbB receptor tyrosine kinase family.

1.22 ErbB HIGH-THROUGHPUT PROTEOMIC STUDIES There have been three HTP studies that examined PPIs of the ErbB receptor family.

Schulze et al. (156) systematically profiled ErbB phosphotyrosine-dependent

22 interactions using a quantitative proteomics approach. In this approach, both established and predicted ErbB phosphorylation-sites were synthesized and incubated with mammalian cell lysates and the synthesized peptides were subsequently affinity purified followed by identification of bound proteins by mass spectrometry. This technique was successful in identifying 10 interacting proteins containing SH2 or PTB domains, but did not detect interactions with 49 of the 89 queried phosphorylation sites.

Blagoev et al . screened the ErbB receptors using stable isotopic amino acids in

cell culture (SILAC) and compared EGF stimulated and unstimulated cells using 13 C-

arginine to differentially label cultures (17). Lysates were pooled and purified over the

Grb2 SH2 domain and bound proteins were identified by mass spectrometry. One of the

key advantages of this study is that by pooling the lysates one can perform

quantification of relative protein levels between the conditions. Collectively they

identified 228 proteins of which 28 were significantly enriched upon EGF stimulation.

Lastly, Jones et al. employed protein microarrays to identify ErbB phospho-

specific interactions. All SH2 and PTB-containing proteins present in the human

proteome were purified and spotted onto microarrays followed by the hybridization of

synthetic ErbB phospho-motifs. Using this method 43 of 65 previously reported

interactions were detected along with several novel interactions (EGFR-32, ErbB2 – 48,

ErbB3 -33, ErbB4 -3). Interestingly, ErbB phospho-peptides bound to multiple proteins

on average where ErbB2 bound the most proteins (17), while the sites on ErbB4 bound

2 proteins on average. This translates into several interactions for each molecule:

EGFR, ErbB2, ErbB3, and ErbB4 bound 54, 59, 37, and 8 proteins, respectively (82).

These groups had screened the receptors to identify novel phospho-dependent protein interactions. More interesting is the fact that each successive group identified novel ErbB interactions which shows that our current understanding of this receptor family is incomplete and that several complementary PPI approaches are needed to provide insight into how these receptors signal in mammals.

1.3 THESIS RATIONALE Three ErbB HTP studies were published in the last 6 years that utilized ErbB receptor fragments, and each study identified many novel protein interactions providing more insight into the dynamic interplay involved in the regulation of this receptor family. This work also shows that we are continuing to learn about the mechanisms of ErbB regulation. It is this reason that prompted our systematic study of the ErbB receptor family to derive a comprehensive interactome map that may serve to evaluate and understand the higher complexity of this system. Importantly, our HTP analysis is the first study to examine protein interactions for the full-length ErbB receptors. Previous students in the lab interrogated the ErbB receptors using MYTH, and my objective is to evaluate and refine a subset of the ErbB2, ErbB3, and ErbB4-MYTH interactions in order to understand their role in biology in hopes of identifying additional targets for therapeutic intervention.

CHAPTER 2: METHOD AND MATERIALS

2.1 REAGENTS/ANTIBODIES Immunoprecipitation of the ErbB receptors was performed using rabbit anti-ErbB2 (Cell

Signaling Technology, New England Biolabs, Pickering, ON) or rabbit anti-ErbB3

(Abcam, Cambridge, MA) antibodies. Expression and localization of FLAG-tagged prey proteins was analyzed by western blotting and immunofluorescence using the anti-

FLAG M2 antibody (Sigma, Oakville, ON). Total ErbB protein expression levels were analyzed by immunoblotting using mouse anti-ErbB2 antibody (Abcam), mouse anti-

ErbB3 antibody (Abcam), or the rabbit ErbB4 antibody (Abcam). The phosphorylation status of the ErbB receptors was determined by western blots using rabbit anti- phospho-ErbB2 (Tyr 877) (Cell Signaling Technology), rabbit anti-phospho-ErbB3 (Tyr

1289) (Cell Signaling Technology), or rabbit anti-phospho-ErbB4 (Tyr 984) (Cell

Signaling Technology) antibodies or a non-specific anti-phosphotyrosine antibody

(Abcam). Western blotting with mouse anti-actin (Abcam) and anti-tubulin (Abcam) was conducted to control for loading of mammalian and yeast lysates, respectively.

Pervanadate 40X stock solution was prepared by mixing 300 µL of 0.1 M sodium vanadate and 50 µL of 30% hydrogen peroxide in 9.5 mL of water on ice. The pervanadate working concentration is 105 µM Na 3VO 4 and 3.77 e -3 % H 2O2. Cells were treated with pervanadate for 15 min before harvest. NRG1 β was purchased from R&D

Systems (Minneapolis, MN). 3-aminotriazole (3-AT) was prepared at 1 mM stock in water and indicated working dilutions were prepared after autoclaving yeast media.

2.2 CELL CULTURE Sk-Br-3 cells are derived from a breast adenocarcinoma and were a kind gift from Dr.

Jason Moffat (University of Toronto, Toronto, ON). The highly transfectable HEK 293T kidney cell line were purchased from the American Type Culture Collection (Cedarlane

Laboratories, Burlington, ON) and the mammary epithelial HME1 cells were kindly provided by Dr. Irene Andrulis (University of Toronto, Toronto, ON). HEK 293T and Sk-

Br-3 were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Multicell, Wisent

Inc., St-Bruno, QC) supplemented with 10% decomplemented fetal bovine serum (iFBS,

Multicell) and 1% penicillin/streptomycin (P/S, Multicell). HME1 cells were maintained in mammary epithelial growth medium (MEGM, Invitrogen, Burlington, ON). All cell lines were incubated at 37ºC with 5% CO 2 in humidified incubator.

2.3 TRANSFECTION Sk-Br-3 cells were transfected using polyfect (Qiagen, Mississauga, ON) as described

by manufacturer. Total amount of DNA for each transfection was normalized with the

pCMV50 plasmid. Cells were harvested 48 h post-transfection.

2.4 LENTIVIRUS 2.4.1 PRODUCTION Lentivirus was produced in HEK 293Ts. Cells were seeded in 6-well dishes in low

antibiotic media (0.1% P/S) and were transfected after 24 h with packaging plasmid

psPAX2 (1.8 µg), envelope plasmid pMG2.G (200 ng) and ErbB4 cDNA (2 µg) (Table 2)

using FuGene 6 transfection reagent (Roche Applied Science) according to

manufacturer’s recommendations. Eighteen hours post-transfection, cells were washed

26 with PBS and cultured in high BSA media (DMEM, 1.1% BSA, 1% P/S). The supernatant containing the viral particles was collected 42 h and 66 h post-transfection and stored at -80 °C.

2.4.2. DETERMINING THE MULTIPLICITY OF INTFECTION (MOI) Lentiviral particles were serially diluted in media with concentrations ranging from 100% to 0.8 percent. Sk-Br-3 cells were seeded in 12-well dish at 100,000 cells/well and viral dilutions were added to 8 wells, with 2 wells serving as growth control (no virus or drug selection) and an additional 2 wells serving as negative control (no virus, with drug selection). Following 24 h of incubation, cDNA integration was selected using 0.6 mg/mL G418 and selective pressure was maintained for 2 weeks. An MOI of 1 suggests one particle infection per cell and is the lowest viral concentration where cell growth is not significantly impaired.

2.4.3 INFECTION Sk-Br-3 cells were seeded at 700,000 cells in T-25 and were infected with lentiviral supernatants at an MOI of one. Twenty-four hours post-infection, stable integrants were selected using G418.

2.5 LUMIER 2.5.1 LUMIER OPTIMIZATION AND LUCIFERASE DETECTION HEK 293T cells were seeded at 250, 000 cells/well in 6-well format and were co- transfected with 0.5 µg of bait and prey plasmids. Two days post-transfection, cells were harvested and preys were immunoprecipitated using anti-Flag M2 monoclonal antibody.

Luciferase activity was analyzed in both the immunoprecipitate and the total fraction

27 using the Renilla luciferase substrate coelenterazine (Promega E2810, Fisher

Scientific, Ottawa, ON) that was prepared as described by manufacturer, and the

Renilla Luciferase Assay System (Promega) . This assay was downscaled to 96-well format using the 96-well round bottom plate (COSTAR, Corning, Fisher Scientific) and the immunoprecipitation procedure was automated. Renilla luciferase activity from immunoprecipitates (25 µL) was measured using the Berthold Luminometer while whole cell extract aliquots (20 µL) were analyzed by the Dual-Glo Luciferase Assay System

(Promega).

2.5.2 BAIT CONSTRUCTION AND EXPRESSION ErbB2, ErbB3, and ErbB4 cDNAs were PCR-amplified with primers introducing flanking attB1 and attB2 sites and the resulting fragment was subsequently cloned into pDONR223 (Invitrogen) via GATEWAY BP reaction (Invitrogen) as described by the manufacturer. All entry clones were confirmed by sequencing. Using the GATEWAY LR reaction (Invitrogen), sequence-verified entry clones were sub-cloned into pFFLUC and pChRLUC destination vectors which harbour Photinus pyralis firefly and Renilla reniformis luciferase genes respectively. HEK 293T cells were transfected with the expression constructs and 48 h post-transfection, cells were lysed using either 0.5 or

1% C 12 E8 or Trition-X-100 for 20 or 40 minutes, and luciferase activity was examined.

2.5.3 PREY CONSTRUCTION AND EXPRESSION All GATEWAY entry clones (Tables 2, 3) were obtained from the human ORFeome

collection, version 5.1, kindly provided by Dr. Corey Nislow (University of Toronto,

Toronto, ON). The respective cDNAs were confirmed through sequencing and

28 subcloned into p1899 (N-terminal 3XFLAG-tag) or p1900 (C-terminal 3XFLAG-tag) plasmids using GATEWAY LR technology (Invitrogen). HEK 293T cells were transfected with the indicated constructs and expression was examined by western blotting and immunofluorescence. Briefly, HEK 293T cells were seeded at 18, 000 cells/well in 96-well format, transiently transfected, and 48 h post-transfection, were washed with 1X PBS, fixed with 4% paraformaldehyde for 10 minutes. Cells were subsequently washed 5X with PBS and permeabilized with 100% methanol for 2 minutes. Cells were next blocked using 10% heat-treated goat-serum (iGS) for 1 h and immunostained with mouse anti-FLAG primary antibody at 10 µg/mL in iGS for 1 hour.

Cultures were washed and incubated with secondary antibody using anti-mouse conjugated to Alexa Fluor 488 (Molecular Probes, Invitrogen) for 1 hour in iGS. Samples were washed 4X and DAPI was added at 1 µg/mL for 5 min followed by two additional washes. Images were acquired using the confocal microscope IN Cell Analyzer 1000 from GE Healthcare Life Sciences. Five micoliter aliquots of FLAG-tagged preys at 0.02

µg/ µL were aliquoted into 96-well plates and stored at –80° C for the LUMIER screens.

2.5.4 IMMUNOPRECIPITATION USING HEK 293T LYSATE IN 6-WELL FORMAT Transfected cells were washed once with PBS and were lysed with lysis buffer (0.5%

Trition-X-100, 400 µM phenylmethylsulfonyl fluoride (PMSF), 10 µM leupeptin, 2.9 mM bestatin, 10 µM pepstatin A, 25 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate, pH 7.4). The cells were lysed for 40 min at 4°C with shaking. Cell extract was subsequently harvested and pelleted for 30 min at 13k rpm for

25 min to remove the insoluble fraction. The supernatant was split into two aliquots, the first for luciferase analysis in whole cell extract and the remainder was incubated with

M2 anti-FLAG antibody for 1 h at 4°C with rotation. Next, 50 µL of ProtG-Sepharose beads (50% dilution) was added to lysates for 1 hour. After incubation, the beads were washed five times with wash buffer (0.1% Trition-X-100, 400 µM PMSF, 10 µM leupeptin, 2.9 mM bestatin, 10 µM pepstatin A, 25 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate, pH 7.4). The beads were resuspended in

150 µL of wash buffer and luciferase activity was detected.

2.5.5. LUMIER CONDITIONS To determine conditions where the ErbB receptors are inactive, proteins that only bind to the receptors once the receptors become active were examined. This includes their heterodimeric partner and, the adaptor protein Grb2 for ErbB2 and ErbB4, while ErbB3 was examined with PI3K. Multiple conditions were analysed via LUMIER in an attempt to lose the respective interaction with the ErbB and Grb2/PI3K/ErbB receptor. HEK

293T cells were transfected with respective bait and prey plasmids and 24 h post- transfection, cells were washed with 1X PBS and either:

(1) serum starved 16 h with DMEM, treated with PBS for 1 h, and incubated with DMEM with 10% iFBS for 1 h

(2) serum starved for 24 h with DMEM, and then incubated with DMEM with 10% iFBS for 1 h

(5) incubated with DMEM with 10% iFBS for 45 min and then treated with pervanadate

(6) incubated with DMEM with 10% iFBS

2.5.6. LUMIER SCREEN LUMIER assays were performed as previously described in detail (13). All conditions were performed in biological triplicates using the ThermoCRS (Burlington, ON) Robotic platform (Jeff Wrana, University of Toronto, ON) which has been previously described

(13). Briefly, HEK 293T cells were seeded 18,000 cells/well in poly-D-lysine coated 96- well plates (COSTAR). The following day, 100 ng of bait and 100 ng prey cDNAs were transiently transfected. Positive controls were transfected with known interacting preys

(Column 12) while negative controls received bait and empty prey vector (Column 1).

The amount of transfected DNA was standardized by pCMV50 (Table 4). Forty-eight hours post-transfection, one set of ErbB plates were treated with pervanadate for 15 min. Cells were lysed and 70% of lysate was used for immunoprecipitation while 10% was used to examine luciferase activity in whole cell extract. Immunoprecipitation was performed using 5 µL of paramagnetic beads (Dynal) coupled to protein G and the

monoclonal M2 anti-FLAG-antibody (Sigma). Lysate was incubated with antibody

complex for 1 h at 4°C shaking and beads were subsequently washed 5 times,

resuspended in 150 µL of wash buffer and luciferase activity was detected.

2.5.7 DATA ANALYSIS AND VISUALIZATION OF LUMIER RESULTS 2.5.7.1 NORMALIZED LUMIER INTENSITY RATIO (NLIR) CALCULATION The LUMIER intensity ratio (LIR) was calculated for both the whole cell extract (LIR-

TOT) and the immunoprecipitated fraction (LIR-IP). The LIR was calculated as the ratio

of sample signal corrected by the negative control and the normalized LIR value (NLIR)

was calculated as the ratio of LIR-IP/LIR-TOT.

To confirm that all observed interactions are with prey protein, and not with luciferase,

all preys were also examined with luciferase alone using LUMIER (Appendix Table 4).

Previous work has shown that an NLIR value ≥ 3 represents a false negative rate ~ 36%

and a false positive rate 20% and is considered an acceptable cutoff to mark a PPI (13).

All experiments were performed in three biological triplicates and NLIR values were

averaged and also ranked as low, medium, or high confidence depending on frequency

of PPI observed amongst biological replicates.

2.5.7.2 VISUALIZATION OF LUMIER RESULTS Kevin Brown from the Jurisica lab generated all LUMIER maps where the nodes are

color-coordinated based on GO terms annotating each protein in SwissProt version

51.5. Mapping was performed using the source databases: the International Protein

Index version 3.36 (IPI, http://www.ebi.ac.uk/IPI/ ), SwissProt version 51.5, Unigene

Hs.208, and Entrez Gene 2007-02-08. Interactions in I 2D are from human curated

sources, high-throughput mammalian experiments, and predicted using orthologs from

model organism protein interaction data sets, as previously described (22,23). All

graphs were produced with Navigator v2.1.13 (24) and Adobe Illustrator.

2.6 IMMNOPRECIPITATION USING Sk-Br-3 CELL LYSATE Sk-Br-3 cells transfected with the indicated constructs were lysed using lysis buffer

(0.5% Trition-X-100, 400 µM PMSF, 10 µM leupeptin, 2.9 mM bestatin, 10 µM pepstatin

A, 25 mM sodium fluoride, 1 mM sodium orthovanadate, 5 mM sodium pyrophosphate,

pH 7.4) for 30 min at 4°C with shaking. Cell extract was subsequently harvested and

pelleted for 30 min at 13k rpm for 20 min. Supernatant was split into two aliquots to

examine total protein levels and the remainder was incubated with antibody for the

indicated ErbB receptor for 1 hour at 4°C with rotation. Protein G-Sepharose beads

32 were first blocked in 5% BSA for 1 h, washed 3X with wash buffer (0.25% Trition-X-100,

400 µM PMSF, 10 µM leupeptin, 2.9 mM bestatin, 10 µM pepstatin A, 25 mM sodium fluoride, 1 mM sodium orthovanadate and 5 mM sodium pyrophosphate, pH 7.4 ) and finally diluted to 50% in wash buffer. Fifty microliters of 50% slurry beads was transferred to cell lysate for 1 hour with rotating. Beads were subsequently washed 5X using wash buffer and bound proteins were eluted using 50 µL of protein sample buffer

(50 mM Tris/HCl, pH 6.8, 2% SDS, 10% glycerol, 0.005% bromophenol blue, 5% β- mercaptoethanol, and 1 mM sodium orthovanadate). Bound proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted using the antibodies shown. Horseradish peroxidase-conjugated secondary antibodies from GE

Healthcare (UK), and SuperSignal West Pico Chemiluminescent Substrate (Pierce

Protein Research Products, Rockford, IL) were used for developing blots. In cases where indicated, membranes were stripped and re-probed with different antibodies.

2.7 MEMBRANE YEAST TWO HYBRID (MYTH) 2.7.1 PLASMIDS Full-length human ErbB2, ErbB3 and ErbB4 baits lacking their endogenous signal sequence had previously been cloned into yeast pAMBV plasmids (Dualsystems

Biotech, Switzerland) where the 3` was tagged with the yeast mating factor alpha signal sequence (MF α) and the 5` was fused with the C-terminal half of ubiquitin (C ub ), LexA

DNA binding domain, and VP16 activation domain (cDNA- Cub -TF). Prey cDNAs were

previously generated and are tagged with the HA epitope and N ub G (Dualsystems

Biotech). All plasmids used in this study are listed in Table 2.

2.7.2 MYTH ASSAY MYTH was performed as previously described in detail (125,164). Briefly, the yeast THY

AP40 [ MATa leu2, ura3, trp1 :: (lexAop-lacZ ) (lexAop)-HIS3 (lexAop)-ADE2 ] reporter strain was transformed with bait plasmid carrying LEU2 and prey plasmid harboring

TRP1 using the standard lithium acetate method (62). Transformants were selected on synthetic dextrose (SD)–WL dropout plates. Three individual clones were diluted in 100

µL of water, and 3 µL of culture was spotted onto selective plates including SD-WL and

SD-WLAH +/- 3-AT. Growth on SD-WLAH +/- 3-AT plates and blue colony color indicates a bait and prey interaction.

2.8 WESTERN BLOT ANALYSIS USING YEAST EXTRACT Yeast strains were transformed with pTMBV-ErbB2, pTMBV-ErbB3, and pTMBV-ErbB4 bait vectors. Cultures were grown in selective liquid media until mid-log phase (~OD 600

0.55). Subsequently, cultures were treated with 10% trichloroacetic acid (TCA, Sigma) for 15 min at room temperature. Cultures were harvested and washed with 1M HEPES, pH 7.5. The pellet was placed in liquid nitrogen for 15 min and transferred to – 80 °C freezer for an additional 30 min. These freeze-thaw cycles promote the disruption of the cell wall. Next, 50 µL of 5x SDS-gel loading buffer and 0.05 g of 0.5 mm glass beads were added to the pellet to further disrupt the cell wall and membrane. Samples were vortexed for 30 sec alternating with 30 sec on ice, six times. An additional 50 µL of 5x

SDS-gel loading buffer was added to each sample. Samples were briefly centrifuged to pellet the glass beads. Bound proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted using the indicated antibodies.

2.9 VIABILITY ASSAYS Transfected HEK 293T cells were trypsinized and collected on ice. Cells were pelleted at 1k rpm for 3 min at 4°C and resuspended with the wash buffer (Hank’s Buffered Salt

Solution (HBSS), 1% BSA, 0.5% EDTA). Ten microliters of Annexin V conjugated to

FITC (Molecular Probes) and 1 uL of propidium iodide (Molecular Probes) was then added to 100 uL of cell suspension. Cultures were incubated for 15 minutes and washed once with wash buffer and analyzed by flow cytometry using the Beckman-

Coulter EPICS Elite Flow Cytometer (Becton Dickinson, Mountain View, CA).

2.10 RNA EXTRACTION HME1 RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) and QIAshredder

(Qiagen) according to the manufacturers’ manual.

2.11 QUANTITATIVE RT-PCR (qRT-PCR) For comparative gene expression analysis, 0.5 or 1 ug of RNA from the HME1 cells was reverse transcribed with an oligo-dT primer using SuperScript III Platinum Two-step qRT-PCR kit with SYBR Green kit (Invitrogen). The cDNA was diluted 2-fold in water and 2 uL was used as a template for PCR amplification. Primer design was done using

GenScript RT-PCR Primer Design. To circumvent problems with genomic sequence amplification, primers were designed spanning two exons when possible, or the amplicon spanned at least two exons. The PCR cycle used to amplify cDNA consisted of an initial 10 min denaturation at 95°C was followed by 40 cycles of 30 s denaturation at 95°C and 30 s annealing at 60°C and extension at 72°C for 30 s (CFX 1000, Biorad).

Expression ratios between two samples were calculated from differences in threshold cycles (Ct) at which exponential increase in reporter fluorescence could be first detected

35 and calculations have been previously described in detail (19). Results of triplicates were averaged and primer sequences can be found in Tables 5 and 6.

2.12 BIOINFORMATIC ANALYSIS Kevin Brown from the Jurisica lab performed the bioinformatics analysis where the domain co-occurrences, protein co-localization, and GO terms were obtained from

Uniprot (SwissProt/Trembl) build 56.2. The gene co-expression was computed as the

Pearson correlation coefficient from the Gene Atlas human data (166) as described previously in detail (22). All graphs were produced with Navigator v2.1.13 (24) and

Adobe Illustrator.

CHAPTER 3: RESULTS 3.1 ErbB2 AND ErbB4 ARE PHOSPHORYLATED IN YEAST Previously, MYTH screens using a fetal brain cDNA library were performed in the

Stagljar Lab in order to identify interactions with the ErbB receptors. The receptors were adapted for yeast studies by the replacement of their endogenous signal sequence with the yeast mating factor α signal sequence (MF α), which promotes proper targeting of

type I plasma membrane proteins. Collectively, MYTH screening identified over 200

proteins that interact with the ErbB receptor family. Of these, 151 bound to ErbB2,

ErbB3, and/or ErbB4 (remainder were specific for EGFR), and these are the focus of

this study (Fig 8).

Most of the identified proteins lack SH2 or PTB domains, suggesting that the

MYTH-identified interactions are phospho-independent. This was expected since

previous studies found EGFR is unphosphorylated and inactive in yeast (46), and this is

consistent with a previous report that found EGFR can only be activated in yeast when

activating mutations are introduced (28). To determine the ErbB phosphorylation status

in yeast, yeast expressing ErbB2, ErbB3, or ErbB4 were examined by western blot

analysis using antibodies that recognize tyrosine residues that are phosphorylated in

response to ErbB activation. Analysis confirmed that ErbB2 is phosphorylated on

Tyr877 and ErbB4 is phosphorylated on Tyr984 (Fig 9A). We did not detect

phosphorylation of ErbB3 Tyr1289, which was expected as ErbB3 is kinase-dead and

requires a heterodimeric partner for transphosphorylation (Fig 9A). Since the ErbB

receptors are also tyrosine kinase substrates, we considered the possibility that an

endogenous yeast kinase may phosphorylate the ErbB3 receptor. Therefore, yeast

lysates were probed using a general phosphotyrosine antibody, however, we observed

37 the identical phosphorylation pattern where ErbB3 is unphosphorylated (Fig 9B). These result shows that ErbB2 and ErbB4 are, at least, partially active in yeast, while the kinase-dead ErbB3 is unphosphorylated and thus inactive.

3.2 ErbB2, ErbB3, AND ErbB4 MYTH RESULTS EVALUATED USING BIOINFORMATICS Analysis of the 151 ErbB2, ErbB3, and ErbB4 MYTH PPIs revealed that signaling cascade proteins were enriched by 10.3-fold (p<0.01) and proteins involved in cell communication were enriched by 3.7-fold (p<0.01). In addition, these interactions were analyzed using various bioinformatics approaches in collaboration with the Jurisica lab.

The proteins comprising the ErbB-MYTH-interactome fall within multiple GeneOntology

(GO) biological function groups including cell fate and organization, metabolism, protein degradation and proteins with no ascribed function (Fig 10). We compared our data with data from other experimental studies and identified significant domain-domain co- occurrences, gene co-expressions, computed functional similarity of interacting protein pairs, and performed data-mining to determine if other experimental studies have inferred the interaction. We used a set of InterPro interaction domain pairs that show significant co-occurrence in known human protein interactions. This provided support for

42 interactions (Fig 10). Using GO (biological process, molecular function, cellular localization), we computed semantic similarity for all PPI pairs, providing further computational validation for 41 interactions. We also identified 6 novel interactions that share similar co-expression profiles, and data-mining the available literature provided support for an additional 9 interactions. This bioinformatics profiling highlighted and

38 refined the ErbB-MYTH dataset that was used for further study using the LUMIER system (Fig 11).

3.3 CONSTUCTION OF BAIT AND PREY EXPRESSION SYSTEM To confirm the computationally validated interactions we sought to recapitulate the interactions in mammalian cells using LUMIER technology in collaboration with the

Wrana lab.

To begin, forty-seven prey cDNAs were obtained from Open Biosystems human

ORF Collection version 5.1, and subcloned into a mammalian expression vector conferring a C-terminal FLAG tag. A Simple Modular Architecture Research Tool

(SMART) search revealed 21 proteins have domains near/at the C-terminus (Table 3).

These proteins were additionally N-terminally tagged to circumvent potential problems associated with tag interference. Expression and localization of the resulting collection of 68 clones – henceforth referred to as the ErbB-LUMIER prey library - was then confirmed in HEK 293T cells by western blotting (data not shown) and immunofluorescent microscopy (Fig 12).

ErbB baits were C-terminally tagged with both Photinus pyralis firefly- and Renilla reniformis- luciferase in order to determine the most suitable luciferase fusion for achieving the highest ErbB expression levels. Optimization of the protein extraction protocol determined that Renilla luciferase fusions solubilised with 1% Triton X-100 produced the highest luciferase signal (Fig 13).

3.4 DETECTION OF PHOSPHO-INDEPENDENT AND DEPENDENT INTERACTIONS USING LUMIER All LUMIER candidate prey proteins were initially identified via MYTH in yeast, where

ErbB3 is inactive, and ErbB2 and ErbB4 are partially active (Fig 9). Consequently, to validate putative interactions in mammalian cells it was necessary to investigate PPIs with inactive ErbB receptors and then determine if the interaction is maintained when the receptors become activated by ligands.

To determine conditions where the receptors are inactive, we examined proteins that only bind to active, phosphorylated ErbB receptors such as their endogenous heterodimeric partner. Additionally, ErbB2 and ErbB4 were analysed with the adaptor protein Grb2 and ErbB3 was examined with the effector protein PI3K. After performing

LUMIER, we examined fold change over the background luciferase in the IP fraction, as well as in the whole cell extract, to derive the normalized LUMIER intensity ratio (NLIR) which is semi-indicative of interaction strength (see Methods 2.5.7.1). Background noise is high at lower NLIR values resulting in high false-positive rates, whereas higher NLIRs denotes high confidence interactions, however transient or low-affinity interactions may be lost. The compromise between these variable was previously defined at an NLIR threshold of 3 that yields a 36% false-negative rate and 20% false-positive rate (13).

Several conditions were evaluated using LUMIER in an attempt to lose the respective interactions, which is representative of the inactive ErbB receptors.

3.4.1 HEK 293T CELLS ARE SENSITIVE TO SERUM STARVATION WITH PBS TREATMENT HEK 293T cells were transiently co-transfected with an ErbB-luciferase fusion and

either their heterodimeric partner, Grb2, or PI3K. Cultures were grown in serum-

40 containing media (SCM) and were subsequently serum-starved for 16 h followed by a 1 h PBS shock and 1 h recovery in SCM. Samples were analyzed pre-starvation, post-

PBS shock, and post-recovery by LUMIER.

During the PBS treatment, the ErbB2-Grb2 interaction dropped from an NLIR of

136 to 6 (Fig 14) and after recovery in SCM increased to 166 (Fig 14). This pattern was also observed with the ErbB3- PI3K interaction whereby following serum-starvation the

NLIR fell from 132 to 40 and after recovery in SCM the NLIR increased to 274. The

ErbB4 and Grb2 initial NLIR was 5 and it dropped to 3 following the starvation, but was recovered to an NLIR of 13. This trend was also observed with the heterodimeric receptors as the preys (Fig 14). Although there was a considerable drop in NLIR during the starvation, it still suggests the proteins interact (i.e. NLIR ≥ 3). However, the substantial NLIR drop between cells cultured in SCM to starvation conditions suggests a population of ErbB receptors are not active. Complete receptor inactivation proved difficult; a longstanding issue in this field is that ErbB overexpression causes sporadic receptor autoactivation (35,196).

The interactions could be recovered by the re-addition of SCM, suggesting the cells are viable after PBS treatment. To directly determine the PBS affect on cell viability, transfected HEK 293T cells were sorted by flow cytometry using the cell viability stain Annexin V which becomes exposed to the outer membrane in the early phases of apoptosis. After analysis it was determined that PBS treatment increased the number of cells undergoing apoptosis (Fig 15A). To substantiate this phenotype, cultures were also examined using propidium iodide (PI), a membrane impermeable

DNA stain that is excluded by viable cells. Consistent with previous observations, PBS-

41 treated cells stained positive compared to cells grown in SCM or even serum-free media

(SFM) (Fig 15B). For these reasons, the inactive ErbB receptors could not be analyzed using the PBS treatment.

3.4.2 PERVANADATE PROMOTES CONSTITUTIVE ErbB PHOSPHORYLATION Unlike the 1 h PBS-shock, culturing HEK 293T cells in SFM did not induce apoptosis as assessed by PI staining (Fig 15B). However, during the serum starvation, the NLIR values were similar to the NLIRs derived from cultures that were continuously grown in

SCM (data not shown). This may be partially attributed to the activity of PTPs that actively dephosphorylate the receptors in response to ErbB activation. Therefore we used the irreversible PTP inhibitor pervanadate. Pervanadate prevents protein dephosphorylation such that the protein would be constitutively active and phosphorylated.

Indeed, pervanadate treatment increased NLIRs of the ErbB phospho-dependent interactions (Fig 16A). We next evaluated the use of pervanadate treatment in conjunction with the 24 h serum starvation to determine optimal conditions where the

ErbB receptors are inactive. HEK 293T cells were transfected with each ErbB luciferase fusion and phospho-dependent binding partner. Cells were either grown continuously in

SCM followed by pervanadate addition or alternatively, cells cultured for 24 h in SFM and 1 h in SCM for recovery. Consistent with previous observations, there was a marginal NLIR difference of the ErbB2-Grb2 and ErbB3-PI3K interaction when cultures were grown in SFM and SCM (Fig. 16B). However, cells cultured in SCM followed by pervanadate treatment resulted in a significant NLIR increase amongst all protein interactions (Fig 16B). For example, the ErbB2-Grb2 interaction in SFM was 6 and it increased to 10 in SCM. Conversely, cultures grown in SCM and then treated with

42 pervanadate had an NLIR increase from 12 to 50. This was similarly seen with the

ErbB3 and PI3K interaction. In SFM the NLIR was 332 which increased to 436 in SCM while pervanadate treatment increased the NLIR from 345 to 606. Notably, the relative

ErbB4-Grb2 NLIR levels were very similar amongst the two sets of conditions. Again, in the absence of pervanadate the phospho-dependent interactions had an NLIR ≥ 3 suggesting a bona fide interaction. However, the NLIR signal difference between the

presence and absence of pervanadate suggests a subpopulation of inactive ErbB

receptors.

Kinase-dead ErbB receptor variants most likely would produce similar

phenotypes since the ErbB receptors are endogenously expressed in HEK 293T cells,

and these endogenous receptors have previously been reported to cross-activate

kinase-dead ErbB variants (174). Therefore, the use of pervanadate is the best-tested

compromise to detect the differential receptor states where its presence was used to

examine the activated form of the receptor and its absence to examine the inactive

ErbB receptors.

3.5 ErbB RECEPTOR SCREENING USING LUMIER The ErbB LUMIER screens were performed in three biological triplicates. Each ErbB

receptor was screened against a common prey plate that contained a selection of ErbB-

MYTH hits both in the presence and absence of pervanadate. The Pearson product-

moment correlation coefficient (PMCC), which measures the strength of the linear

relationship between the screens, demonstrated a strong correlation amongst the

replicates (Table 7). Each identified protein interaction was ranked as low, medium, or

high confidence, depending on the frequency at which it was observed (Table 8, Fig 17)

43 and the confirmation rate of the MYTH-identified interactions for ErbB2, ErbB3, and

ErbB4 was 60%, 40%, and 28%, respectively (Table 8).

3.5.1 ErbB SCREENS PRIMARILY DETECT PHOSPHO-DEPENDENT PROTEIN INTERACTIONS Only a small fraction of interactions were detected with the partially inactive ErbB

population in untreated cultures; frequently pervanadate treatment increased binding

strength of the prey proteins. A NLIR decrease in the presence of pervanadate also

suggests a phospho-independent interaction (i.e. NLIR with pervanadate < NLIR

absence of pervanadate ≥ 3). We found this trend with ErbB2 and GAPDH (Fig 18,

Appendix Table 1) and ErbB4 with CAPN1, FKBP1A and FKBP8 (Appendix Table 3).

Interestingly, contrary to ErbB4, both ErbB2 and ErbB3 exhibited a phospho-dependant interaction with FKBP1A and FKBP8 (Appendix Tables 2, 3).

Overall, most interactions detected in the absence of pervanadate were strengthened by pervanadate treatment suggesting that most interactions are dependent on ErbB phosphorylation. All ErbB receptors bound strongly to the Ser/Thr kinase WNK1 in the presence of pervanadate (Fig 18, Appendix Tables 1-3). Also, pervanadate treatment caused a strong interaction with both ErbB2 and ErbB3 with

TSC22D1 (for transforming growth factor β-stimulated clone 22) which is a candidate

tumor suppressor (185). ErbB2 bound with PIN1 (protein interacting with NIMA), a

peptidyl-prolyl isomerase (PPIase) that catalyzes the cis/trans isomerization of

phospho-Ser/Thr-Pro bonds. In addition, ErbB2 bound the neuronal guanine nucleotide

exchange factor (NGEF) preferentially in the presence of pervanadate. Consistent with

our previous work where we found that HDAC6 binds constitutively with EGFR (46), we

44 found that HDAC6 interacts with ErbB2, ErbB3, and ErbB4 (ErbB4 detected once) in the presence and absence of pervanadate.

3.5.2 THE INTEGRAL MEMBRANE PROTEINS GPRC5B AND DDR1 AND THE SECRETED PROTEIN WIF1 INTERACT STRONGLY WITH THE ErbB RECEPTORS LUMIER analysis provides a semi-quantitative measure of interaction strength as an

increase in NLIR value is positively correlated with interaction strength assuming the

binding stoichiometry is 1:1. The WIF1 (WNT inhibitory factor 1) bound most strongly to

all ErbB receptors (ErbB2, ErbB3, and ErbB4 NLIR values 40, 10, 22, respectively) (Fig

19, Appendix Tables 1-3). This protein consists of a unique WIF domain (WD) (also

found in extracellular domain of the RTK Ryk) and five EGF repeats. Other strong

interactions identified include the orphan G-protein-coupled receptor GPRC5B (ErbB2,

ErbB3, and ErbB4 NLIR values 33, 13, 15) and the RTK DDR1 (Discoidin Domain

Receptor 1) (ErbB2, ErbB3, and ErbB4 NLIR values 36, 13, 22). To date, ErbB dimerization with other RTKs has not been shown. FKBP8 (immunophilin FK506- binding protein, 38 kDa) also bound strongly to all ErbB receptors. This protein is an inactive PPIase belonging to the FK506-binding protein family.

3.5.3 LUMIER SUBSTIANTES MYTH IDENTIFIED INTERACTIONS AND ALSO DETECTS NOVEL PPIs While we assessed MYTH-identified PPIs by LUMIER, we also considered the

possibility that a specific prey may interact with the entire ErbB family. The MYTH-

identified prey proteins were on a common plate for LUMIER analysis, allowing us to

examine this possibility (Fig 12).

Many interactions identified by MYTH were confirmed by LUMIER (Fig 17, dashed edges), while many remained undetected (Fig 17, black edges). Interestingly, many interactions that had not been identified by MYTH were detected by LUMIER analysis (Fig 17 red, green, blue solid edges). These LUMIER–identified interactions raised an important question: did high-throughput MYTH analysis fail to identify the interaction or can the interaction not be detected by MYTH? To distinguish between these possibilities, a subset of PPIs detected by MYTH screening, LUMIER or both systems was analyzed by low-throughput MYTH analysis.

To ensure the ErbB bait proteins were expressed and were not self-activating the reporter system, the NubG/NubI test was performed. The WT Nub isoform (NubI) has high affinity for the Cub. These two moieties spontaneously re-associate in vivo because of their affinity for one-another independent of proteins fused to them (in this case Fur4 and Ost1). This NubI/Cub re-association activates the MYTH reporter system. Yeast were transformed with ErbB baits and control prey plasmids and transformants were spotted on non-selective media (SD-WL, transformation control) as well as selective media (SD-WLAH + X-galactoside +/- 3-AT). Yeast harbouring the bait and Fur4-NubI or Ost1-NubI displayed robust growth and blue coloration on selective media indicating the bait proteins are expressed in yeast (Fig 20A). Introducing the point mutation Nub I13G prevents the spontaneous NubG/Cub association, the split ubiquitin moieties reconstitute only when proteins that are fused to the Cub and NubG interact, unless the bait protein is self-activating (i.e. activating the MYTH reporter system in the absence of a bona fide protein interaction). The absence of growth with ErbB2, ErbB3,

46 or ErbB4 and Fur4- and Ost1-NubG chimeras shows that they do not self-activate in yeast which confirms they are amenable for MYTH analysis (Fig 20A).

Next, yeast harbouring the ErbB baits were transformed with several prey proteins fused to NubG that were either uniquely identified by MYTH, LUMIER, or detected by both techniques. Transformants were spotted in parallel onto non-selective media and selective media and our findings support both positions: some interactions were confirmed by MYTH while other interactions were not detected in yeast (Fig 20B).

These novel LUMIER-identified interactions that were afterward detected by low- throughout MYTH analysis suggests that during MYTH screening, the clone was poorly represented in MYTH library (low abundance) or alternatively, the ORF was out-of- frame. For example, WIF1 was originally identified bound to ErbB3 by the MYTH screens. LUMIER analysis found WIF1 interacts with all ErbB receptors and this was confirmed by low through-put MYTH analysis (Fig 20B). Conversely, MYTH screening identified SQSTM bound to ErbB3, yet LUMIER detected a specific interaction with

ErbB2 and SQSTM. We were unable to confirm this interaction via low through-put

MYTH analysis (Fig 20B). Importantly, this shows the power and limitations of each method for the detection of PPIs. In light of this concept, we decided to further analyze

PPIs that were identified either by MYTH, LUMIER, or both systems (Table 9).

3.7 A SUBSET OF INTERACTIONS ARE VALIDATED BY CO- IMMUNOPRECIPITATION The refined set of protein-protein interactions was further investigated by co- immunoprecipitation in Sk-Br-3 cells, a breast adenocarcinoma cell line that has been shown to express all ErbB receptors. Only ErbB2 and ErbB3 were detectable in this cell

47 line. As a result, I focused my efforts on the interactions with ErbB2 and ErbB3 and, in addition, generated a stable Sk-Br-3 cell line that expresses ErbB4.

Sk-Br-3 cells were transfected with various FLAG-tagged prey proteins. The endogenous ErbB receptor was immunoprecipitated, and bound proteins were identified by western blot analysis. Analysis confirmed that ErbB2 binds to GPRC5B and

RABGGTA, but not CAPN1, Bcl-xL, NGEF, FKBP8, WIF1, BNIP3L, OXSR1, and DDR1

(Fig 21). Similarly, ErbB3 was found to interact with CAPN1, RABGGTA, GPRC5B, and

WIF1, but not FKBP8 and DDR1 (Fig 22). Although we confirmed a subset of proteins interact with the endogenous ErbB receptors, many remained undetected which may reflect that specific PPIs are cell line-specific, do not occur, or alternatively, the immunoprecipitation procedure requires optimization for each specific interaction.

3.8 NEUREGULIN1β STIMULATES TRANSCRIPTION OF ErbB-RESPONSIVE GENES Activation of the ErbB-linked signaling cascades initiates a transcriptional program that has been recently investigated by several groups using cDNA microarrays or by low- throughput studies (8,107)(Table 5). Reasoning that proteins which interact with the

ErbB receptors may act as negative or positive regulators, we sought to analyze if overexpression of the interacting prey proteins alters the activated-ErbB transcriptional program by use of qPCR.

We first confirmed that all genes-of-interest are transcribed in non-tumorigenic mammary epithelial cell line HME1 by reverse-transcriptase-PCR (RT-PCR) coupled to qPCR (Table 5, 6, Fig 23). The ErbB receptors and all tested preys were transcribed in

HME1 cells and the majority of the selected ErbB-responsive genes were also

48 transcribed including MYC, VEGF, PEA3, PPARG, UCHL1, RRAS, ESX, VIM, GATA4, and PIM2.

Next, we attempted to confirm previous published observations that the selected genes are transcribed in response to ErbB activation. HME1 cells were serum starved for 24 h, followed by the addition of the ErbB3 and ErbB4 ligand Neuregulin 1 β

(NRG1 β) at 12 ng/mL, 24 ng/mL, or 48 ng/mL for 15 or 30 minutes. Next, cells were harvested and RNA was reverse transcribed to generate cDNA. The cDNA was amplified with primers specific for the ErbB-responsive genes and relative mRNA quantities were calculated (Fig 24). With the exception of RRAS , the ErbB-responsive genes follow a similar trend with increasing transcript levels in an NRG1 β dose-

dependent manner. However, large error bars resulted in only a few conditions to be

considered statistically significant (Fig 24). Furthermore, some transcribed genes are

not positively correlated with increased NRG1 β concentrations and hence further work

is necessary to confirm these observations. Notably, our inability to confirm that RRAS

is downregulated in response to ErbB activation may be accounted by the differences

amongst cell sub-types. That is, Alaoui-Jamali et al. detected RRAS downregulation in human mammary cancer cells while this study employed the non-tumorigenic mammary epithelial cell lines HME1.

CHAPTER 4: DISCUSSION In this study we investigated the ErbB2, ErbB3 and ErbB4 protein interactome to identify novel interactors, and also previously uncharacterized functions, through guilt-by- association logic that has long been considered a valuable method for the elucidation of protein function. We derived a comprehensive protein interaction network where we interrogated potential interactions from the human genome using the MYTH technology, which allows for the systematic analysis of human membrane proteins in a genetically isolated system. This approach provided both a global and unbiased perspective of protein interactions. We proceeded to validate observed interactions via LUMIER analysis under two conditions; one enriching for phospho-dependent interactions representative of activated ErbB receptors and a second enriched in partially inactive, dephosphorylated receptors. And so, the integrated use of different PPI detection platforms provided data of high confidence, which was then further confirmed through low-throughput analysis. Focusing on the ErbB2 and ErbB3 receptors, we confirmed a subset of protein interactions by co-immunoprecipitation using endogenous ErbB receptors in Sk-Br-3 cells and further work is necessary to determine the functional importance of these novel ErbB interactions.

4.1 ErbB2 AND ErbB4 are PHOSPHORYLATED IN YEAST Although phospho-dependent interactions can be detected using YTH technologies

(21), two recent studies show EGFR is not active in yeast. One study found that EGFR is not phosphorylated in yeast (46), and a second found that overexpressed EGFR in yeast was phosphorylated only when activating mutations were introduced (28). In sharp contrast to previous observations, we found that ErbB2 and ErbB4 are

50 phosphorylated in yeast (Fig 9). We assessed their phosphorylation status using antibodies specific for tyrosines that are characteristically phosphorylated by receptor transactivation (Fig 9A) as well as a general phosphotyrosine antibody reasoning that the ErbB3 receptor may be a yeast kinase substrate and thus may be phosphorylated on uncharacteristic residues (Fig 9B). Although yeast are devoid of tyrosine kinases, they are known to contain many serine/threonine kinases which have the ability to phosphorylate tyrosine residues. Such dual specificity kinases, including the MEK kinase Ste11p and Yak1 are supported by studies that found 39 phosphotyrosine sites in yeast (64,66). However, unlike ErbB2 and ErbB4, we were unable to detect Erbb3 phosphorylation in yeast suggesting the identified interacting prey proteins represent phospho-independent interactions. However, our LUMIER analysis found that the majority of protein interactions are strengthened in the presence of pervanadate, suggesting the ErbB receptors are phosphorylated in yeast. In view of this fact, we cannot eliminate the possibility that the basal level of phosphorylation may be below the detectable limit of the antibody.

4.2 ErbB RECEPTOR OVEREXPRESSION DRIVES RECEPTOR ACTIVATION Our LUMIER analysis required the transient transfection of bait and preys plasmids in

HEK 293T cells, resulting in their overexpression. This overexpression has proven beneficial for the detection of low-affinity and transient protein interactions; however, relative protein levels play crucial roles in the cell. This is exemplified by GEFs and

GTPase-activating proteins (GAPs) that regulate G-proteins. GEF/GAP relative levels dictate many cellular events such as activation of diverse signaling pathways, transcriptional activity and nuclear import/export. Similarly, ErbB receptor

51 overexpression can induce autoactivation, also known as receptor autonomy, such that they have a reduced dependency for exogenous growth factors. In an attempt to control

ErbB activation and thus their phosphorylation state, we examined proteins that only bind to the receptors when they are phosphorylated, reasoning that the loss of the interaction is indicative of inactive, unphosphorylated receptors.

Cells transfected with the ErbB baits and the respective phospho-dependent interactors, Grb2 and PI3KR2, continuously interacted with the ErbB receptors when grown for 24 h in SFM, which lacks mitogens, but contains all amino acids, vitamins, and high glucose levels (NLIR ≥ 3) (Fig 16B). Thus, SFM was sufficient to support continual cell growth and we considered that the complete removal of supplements from the medium (i.e. using PBS) may force cells to stop unnecessary metabolic activity such as pro-growth pathways. We found that when cells were transfected with the ErbB baits along with the phospho-dependent interactors and grown in SFM followed by a PBS shock, we could effectively impair phospho-dependent interactions (NLIR decrease)

(Fig 14). However, since PBS treatment also caused a significant population of cells to undergo apoptosis (Fig 15) we discarded this strategy and investigated different approaches.

ErbB activation in the absence of exogenously supplemented growth factors may be possible by two means: (i) ligand autocrine loops or (ii) ligand-independent receptor dimers. Autocrine loops have commonly been observed in many cancers that overexpress the ErbB receptors resulting in the transcription of their ligand precursors such as EGF and TGF α (152,155) which can then be processed to mature ligands and consequently perpetuate ErbB signaling. Alternatively, high ErbB expression levels can

52 induce ligand-independent receptor dimers (35,196). The characterized inactive ErbB receptors are in a closed, tethered conformation, whereas activated, phosphorylated receptors are in an open conformation. This concept is appropriate for the majority of

ErbB receptors at the cell surface, but importantly, at wild type protein levels. Proteins are continuously undergoing dynamic changes in the cell between different energy states, and so, in the absence of a ligand, a snapshot of the cell surface would find the majority of receptors adopt a closed conformation, while a minority is in an extended, open conformation. Ligand binding enriches the population of receptors that then adopt the extended conformation. This dynamic equilibrium between multiple inactive and active conformations is determined by the most energetically favored state; however, high receptor levels increases the probability of random collisions at the plasma membrane and as the receptors are undergoing interconversions, the receptors may become stabilized in their extended conformation, leading to kinase activity (36,83).

Consistent with this idea, higher order EGFR clusters have been observed in the absence of ligands in many tumors that overexpress the ErbB receptors. These ligand- independent receptor clusters can be disrupted by kinase inhibitors providing a link between kinase activity and receptor association (35). These findings are not entirely unexpected, Zhu et al. found increasing EGFR expression increases ligand- independent EGFR phosphorylation and kinase activity in a non-linear manner (199).

The model that explains these observations is that protein overexpression leads to more ligand-free dimers that continuously interconvert between active and inactive conformations. These higher order oligomers have also been seen with unliganded

ErbB2 and ErbB3 (83,114).

In light of this concept, and our difficultly in isolating inactive receptors, we decided to investigate the differential ErbB phospho-status by use of the PTP inhibitor pervanadate. Pervanadate is an extremely potent, irreversible PTP inhibitor (77) which is the combination of hydrogen peroxide and vanadate, targeting the PTP conserved cysteine residue. More specifically, pervanadate oxidizes the cysteine thiol, thereby inhibiting enzyme activity and resulting in the constitutive phosphorylation of a protein

(77), and it has been used extensively to analyze phosphoproteins (18,56,122).

Pervanadate treatment significantly increased ErbB phospho-dependent interactions compared with untreated cultures (Fig 16). The NLIR difference between these conditions suggests that in the absence of pervanadate there is a population of

ErbB receptors that are unphosphorylated and thus inactive. On the basis of these results, we performed the ErbB2, ErbB3, and ErbB4 LUMIER screens in the presence and absence of pervanadate.

4.3 POOR DETECTECTION OF ErbB PHOSPHO-INDEPENDENT INTERACTIONS We were unable to detect protein interactions that occurred exclusively in the absence of pervanadate (Fig 18, Appendix Tables 1-3). Specific phospho-independent interactions may have produced an insufficient luciferase signal (registered below the

NLIR threshold of three) because a subset of the ErbB receptors remained active. We did, however, detect interesting PPIs that had a greater NLIR in the absence of pervanadate compared to its presence including ErbB2 and GAPDH and also ErbB4 and the peptidyl proyl isomerases (PPIase) FKBP1A and FKBP8, and also ErbB4 and

CAPN1 (discussed below).

4.4 WIF1 IS A NOVEL ErbB INTERACTOR We found that the secreted peptide WIF1 binds to ErbB2, ErbB3, and ErbB4 (Figs 8, 19,

20, 22). In fact, this was the strongest interaction detected by LUMIER, with NLIR values ranging from 8 to 31.7 for the three ErbB receptors (Fig 19, Appendix Tables 1-

3). Interestingly, changes in NLIR value following pervanadate treatment were receptor- specific. We observed that the ErbB3 and ErbB4 NLIR values increased following treatment while ErbB2 values decreased (for instance, 41 to 30 - first screen, 33 to 17 - second screen). The reason for this trend remains unclear and is currently under investigation.

WIF1 was recently discovered as a secreted 42 kDa protein that contains 5 EGF domains and 1 WIF domain (72). The presence of an EGF domain is sufficient and necessary for binding to the extracellular region of the ErbB receptors and accordingly, is present in all ErbB ligands. Given that WIF1 had 5 EGF domains and is a secreted peptide, it is tempting to speculate that WIF1 may be an ErbB ligand.

WIF1 is a characterized antagonist of canonical Wnt signaling (CWS). CWS is initiated by the binding of Wnt ligand to the Frizzled family of receptors and the low density lipoprotein receptor-related protein co-receptors 5 (LRP5) or 6 (LRP6). Non- canonical Wnt signaling (NCWS) is activated when Wnt ligands bind a single receptor such as Frizzled, RYK, or ROR2, whereas the binding of Wnt to co-receptors is necessary to initiate the CWS pathway (37). Wnt binding to the RYK (for related to tyrosine kinase) antagonizes CWS and initiates NCWS (173) which is implicated in cell movement and planar-cell polarity, although the molecular events leading to these phenotypes are not well defined. WIF1 inhibits CWS by binding and sequestering Wnt ligand through its WIF domain (124,189). Interestingly, only WIF1 and the RTK RYK

55 contain this WIF domain within the human genome. Evidence suggests that Wnt binds to RYK and activates the non-receptor tyrosine kinase Src, a downstream ErbB effector and activator.

Supporting the possibility of WIF1 as an ErbB ligand, certain observations have been made associating WIF1 with ErbB signaling. Epigenetic studies on various tumors show WIF1 is silenced by promoter methylation, which effectively represses its transcription (4,167). Furthermore, restoring WIF1 expression inhibits tumor growth, suggesting WIF1 acts as a tumor-suppressor (87). In an attempt to understand the antitumor effects of WIF1, Ohigashi et al. overexpressed WIF1 and monitored Akt activity, a downstream target of ErbB3 signaling (119) (Fig 2). They found that WIF1 expression decreased Akt activity in PTEN null cells (119). This observation is of particular interest as PTEN negatively regulates the Akt pathway. Taken together with our finding that

WIF1 directly interacts with the ErbB receptor family, these data suggest that the observed WIF1 inhibition of Akt activity may be mediated ErbB receptor antagonism.

While it remains to be shown if WIF1 directly binds to the extracellular region of a receptor, our identification of WIF1 as a strong ErbB interactor presents us with a framework of thought where WIF1, as a secreted protein, may directly bind the ErbB receptors and inhibit their activity. This is consistent with its documented anti-tumor and

Akt-inhibiting activities. Additionally, while WIF1 binds to Wnt peptides via its WIF1 domain, no roles have been identified for its 5 EGF domains, which are sufficient and necessary for ErbB receptor binding. Taken together, the structure and biology of WIF1 along with our interaction data suggest that it may negatively regulate ErbB activity; however, further study is required to substantiate this claim.

4.5 HDAC6 IS A NOVEL BINDING PARTNER OF THE ErbB RECEPTOR FAMILY Previously, we found that EGFR binds to HDAC6, a cytoplasmic lysine deacetylase

(46). HDAC6 belongs to a large family of histone deacetylases but is unique amongst all

18 family members as it has a full duplication of its deacetylase domain and is characterized to regulate microtubule dynamics by α-tubulin deacetylation (43). Through a series of experiments, Deribe et al . established that HDAC6 constitutively binds to and

negatively regulates EGFR endocytosis and degradation (see 1.3 Receptor

Endocytosis). Mechanistically, when HDAC6 is in complex with inactive EGFR, it

actively deacetylates α-tubulin which effectively maintains the receptor at the plasma

membrane. Upon ligand binding, EGFR phosphorylates HDAC6 which inhibits its

activity resulting in microtubule hyperacetylation and recruitment of the motor proteins

kinesin and dynein (49,138). This complex then drives the speed and processivity of

EGFR-containing vesicles through the endocytic pathway, ultimately resulting in

receptor degradation within the lysosome. This mechanism is consistent with the

observation that HDAC6 knockdown accelerates EGFR degradation while

overexpression stabilizes receptor levels. This study identifies protein acetylation as a

previously unknown regulator of receptor endocytosis which appears to be conserved

amongst ErbB family members. In addition to EGFR, we identified HDAC6 as an

interacting partner for ErbB2, ErbB3, and ErbB4 by MYTH and LUMIER (Fig 8,

Appendix Tables 1-3). Members of our lab are currently investigating these interactions

and our preliminary data supports the EGFR-HDAC6 model.

4.6 PEPTIDYL PROYL ISOMERASES AND BCL-2 MEMBERS INTERACT WITH ErbB RECEPTORS The unique proline stereochemistry of the ErbB receptors allows them to adopt two conformational states, either cis or trans , with the interconversion between these states catalyzed by peptidyl proyl isomerases (PPIase). These cis/trans conformational changes influence several protein properties such as protein activity, interactions, localization, turnover rate, and de-phosphorylation, since phosphatases can only act on trans conformations (150,186,187,190,198). Interestingly, our ErbB-MYTH screens identified 5 PPIases, including Protein interaction with NIMA (Pin1), Pin4, FK506 binding protein 8 (FKBP8), FKBP4, and FKBP1A (Fig 8) (46).

Pin1 and Pin4 are unique PPIases as they catalyze cis/trans conversions on phosphorylated Ser/Thr-Pro motifs (106) by binding through their WW domains.

Consequently, proteins in cis conformation cannot be regulated by dephosphorylation, strongly influencing signaling strength and duration. Our MYTH and LUMIER screens identified Pin1 as an ErbB2 interactor (Fig 8, 19), which is corroborated by a growing body of evidence. Firstly, Wulf et al. found that Pin1 knockout mice were highly resistant to tumor formation by oncogenic ErbB2 or v-ras, a downstream effector of ErbB activation (Fig 2). In this study, 100% of v-Ras and >90% of oncogenic ErbB2 transgenic mice developed one or more mammary carcinomas in a WT PIN1 background, whereas over 85% of transgenic mice in a Pin1-/- background remained cancer-free within the 75 week observation. This identified Pin1 as an oncoprotein

(186). Consistent with these observations, PIN1 is overexpressed in 62% of all ErbB2 positive breast cancers (187) and its transcription is controlled by E2F transcription factors which are activated in response to ErbB2 signaling (149). Very recently, Lam et

58 al. integrated all lines of evidence with their discovery of Pin1 in complex with ErbB2 and ubiquitin, stabilizing the ErbB2 receptor and preventing its degradation (91); however, the mechanism by which it prevents ErbB2 degradation remains an open question.

Another PPIase class indentified in the ErbB-MYTH screens was the FK506 binding proteins (Fig 8, 19) which are characterized by their ability to bind the immunosuppressants FK506 and rapamycin (102,154). In the absence of immunosuppressants, FKBP1A interacts with intracellular signal transduction proteins including the serine/threonine growth factor receptor TGF-β receptor type I ( TβRI), preventing the docking of signal transducers and thereby inhibiting the signaling

cascade (180). Similarly, FKBP1A inhibits EGFR kinase activity in a PPIase dependent

manner (105); however, the precise mechanism-of-action remains unknown.

FKBP8 is unique amongst the family because it has no affinity for FK506, lacks

conserved PPIase residues necessary for catalysis and contains a transmembrane

motif that is absent in other FKBP proteins. FKBP8 binds to and negatively regulates

mTORC1, a protein-complex known to induce cell proliferation, growth, motility, and

protein synthesis (11). This inhibition is relieved by diverse environmental cues

including growth factor stimulation, which activates the Ras-like GTPase Rheb, which

binds FKBP8 and dissociates the FKBP8-mTORC1 interaction (11). Our MYTH analysis

identified FKBP8 as a binding partner for EGFR, ErbB2, ErbB3, and ErbB4 (Fig 8, 20)

and LUMIER analysis confirmed an interaction with all ErbB receptors tested (Fig 19).

Indeed, it is possible that FKBP8 may regulate the ErbB receptor function in a similar

59 manner to the FKBP1A-TβRI mechanism; however, it may also employ a unique mode

of action as suggested by its involvement with anti-apoptotic proteins.

In addition to its role in MTORC1 signaling, FKBP8 also promotes anti-apoptotic

activity by binding and localizing anti-apoptotic proteins, such as Bcl-xL and Bcl-2, to the

mitochondrial membrane (159). In fact, evidence suggests that FKBP8 stabilizes the

anti-apoptotic proteins since FKBP8 knock-down decreases Bcl-2 protein levels (159).

Bcl-2 family members are regulators of apoptosis and are subdivided into 3 groups

based on the number of Bcl-2 homology (BH) domains: the anti-apoptotic proteins have

4 BH domains (BH1-4) while pro-apoptotic proteins either have 3 BH domains (BH1-3)

or a single BH3 domain. BH3 domain proteins recognize apoptotic stimuli and promote

apoptosis. The mechanism in which they promote apoptosis is an intensely debated

issue which is summarized by two models: in the first model, BH3 only proteins bind to

anti-apoptotic proteins via their BH3 domains and inhibit their anti-apoptotic function,

while the second model postulates that BH3 members directly activate BH1-3 pro-

apoptotic members such as BAX and BAK. These activated pro-apoptotic proteins are

trafficked to the outer mitochondrial membrane where they oligomerize and promote the

release of cytochrome c into the cytosol leading to cell death. Anti-apoptotic proteins

attempt to counteract these events by two means: either by preventing BAX and BAK

oligomerization at the mitochondrial outer membrane or by binding and sequestering

BH3 proteins (reviewed in (26,27,103)).

Interestingly, we discovered that FKBP8’s binding partner, Bcl-xL, interacted with

ErbB2 (Fig 8, 19). Moreover, we also detected an interaction between ErbB2 and the

pro-apoptotic BH3 domain only protein BNIP3L (Fig 8, 19). As described, the BH3 only

60 protein BNIP3L activates other pro-apoptotic members and also binds the anti-apoptotic protein Bcl-xL via its transmembrane segment, thereby inhibiting BNIP3L function

(78,137). BNIP3L shares 56% sequence similarity to BNIP3, and is believed to function in a similar manner (30). Interestingly, BNIP3L and its homolog BNIP3 bind to Rheb, the

GTPase which inhibits FKBP8 binding to mTORC1. It has been demonstrated that Rheb binding to BNIP3 precludes Rheb binding to FKBP8 and ultimately prevents mTORC1 function although the precise affect of Rheb on BNIP3L is still unknown (100).

Combining the interaction information gained from this study with previously characterized functions, we envision a regulatory scenario mediated by activated ErbB2 in complex with FKBP8, Bcl-xL, and BNIP3L (Fig 25). In this model, activated ErbB2 may recruit Bcl-xL and BNIP3L to the plasma membrane where Bcl-xL could bind to

BNIP3L, inhibiting its function and preventing its binding to Rheb. Activated Rheb could then bind FKBP8, preventing its inhibitory function on mTORC1. Moreover, activated

ErbB2 could prompt free FKBP8 to traffic Bcl-xL to the mitochondrial outer membrane preventing Bak-Bax oligomerization, thereby inhibiting apoptosis. Taken together,

ErbB2 may promote the evasion of apoptosis by the dual recruitment of apoptotic members to the plasma membrane. Alternatively, ErbB2 may phosphorylate and thereby inactivate BNIP3L, which is known to be phosphorylated, but the context of phosphorylation is unclear. In the absence of growth factor signaling, BNIP3L and

BNIP3 bind active Rheb, preventing its inhibitory binding to FKBP8, and allowing

FKBP8 to bind mTOCR1, thereby inhibiting cell proliferation. At the same time, BNIP3L may bind and inhibit Bcl-xL, preventing its localization to the mitochondrial outer membrane, and allow for the activation of the apoptotic program (Fig 25).

4.8 PTEN REMAINS A PUTATIVE ErbB2 BINDING PARTNER Our HTP MYTH analysis revealed that ErbB2 interacts with the lipid phosphatase PTEN

(Fig 8), which negatively regulates the PI3K-Akt pathway. Interestingly, the PI3K-Akt pathway is activated by ErbB3, which preferentially heterodimerizes with ErbB2. ErbB3 activation recruits PI3K to its cytoplasmic tail, activating its phospholipid kinase activity.

Activated PI3K then converts PIP2 to PIP3 resulting in the dual recruitment of the Akt and PDK1 kinases (Fig 2), initiating the Akt pathway. In contrast, the conversion of PIP3 to PIP2 partially prevents Akt activation and this is mediated by PTEN (review in (54)).

PTEN is mutated in 50% of all cancers (41). Dourdin et al . found that mammary- specific deletion of PTEN alleles increased ErbB2 tumor development and increased the occurrence of lung metastasis (50). In this study they examined transgenic ErbB2 mice with heterozygous or homozygous PTEN deletes and found PTEN +/- and PTEN -

/- accelerated ErbB2 induced tumor progression. This is not entirely unexpected considering that PTEN negatively regulates Akt signaling, and thus a PTEN deletion would drive ErbB induced cell proliferation. Importantly, Dourdin et al . discovered that

ErbB2 protein levels were significantly enhanced in PTEN nulls and not because of the commonly observed ErbB2 DNA amplification event. This suggests that PTEN may negatively regulate ErbB2 directly. Although the ErbB2-PTEN interaction was detected by MYTH, we were unable to confirm the interaction by LUMIER or by co- immunoprecipitation. Our inability to confirm the interaction does not necessarily indicate PTEN is a false-positive, but it may suggest that it is a transient interaction which hinders its immunoprecipitation.

4.9 THE RTK DDR1 BINDS TO ErbB2, ErbB3, and ErbB4 MYTH and LUMIER screening identified that the RTK discoidin domain receptor (DDR1) bound to ErbB2, ErbB3, and ErbB4 (Fig 9, 19). DDR1 is overexpressed in many cancers including breast, ovarian, brain, and lung (45,70,135). Similar to the ErbB receptors, DDR1 contains an ectodomain, a juxtamembrane region and a tyrosine kinase domain. Unlike the ErbB receptors, it is not activated by soluble growth factors but rather by collagens I-VI and VIII, yet homodimerizes both in the presence and absence of ligand (1). In the presence of ligand, DDR1 is cleaved from a 62 kDa to 54 kDa unit, releasing the ectodomain and activating the STAT5 and PI3K pathways resulting in cell migration, extracellular matrix remodeling, differentiation, and cell cycle progression (177). Although the ErbB receptors are not known to bind to RTKs outside their family, other RTKs such as the fibroblast growth factor receptor (FGFR) and EphA have demonstrated this property (193). This suggests the ErbB receptors may bind to and transactivate DDR1, and this is currently under investigation in our lab.

4.10 OTHER INTERESTING ErbB INTERACTIONS Our HTP MYTH studies identified the calpain, CAPN1, binding to ErbB2 (Fig 8).

LUMIER analysis identified CAPN1 as an interactor for all of the ErbB receptors tested

(Fig 19), and we confirmed the ErbB3-CAPN1 interaction by co-immunoprecipitation in

Sk-Br-3 cells (Fig 22). Calpains are calcium-activated, non-lysosomal, cysteine proteases that have been implicated in various processes such as cytoskeletal organization, cell proliferation, apoptosis, and cell motility. CAPN1 binding to calcium causes its relocalization to the plasma membrane where it negatively regulates distinct signaling pathways including the ErbB initiated MAPKs (ERK, p38, and JNK, c-Raf,

MEK1/2, MAPK kinase 3/6 (MKK3/6)) and the PI3K/Akt pathway (86). Interestingly,

CAPN1 knockout mice have reduced tyrosine phosphorylation of several proteins (9),

but the molecular events causing this phenotype remain to be characterized.

GPRC5B is an uncharacterized orphan GPCR, characterized by 7-

transmembrane segments. It was identified by sequence homology searches to the

metabotropic glutamate GPCR from Caenorhabditis elegans (143). We have confirmed

GPRC5B binds to ErbB2, ErbB3, and ErbB4 via MYTH (Fig 8), LUMIER (Fig 19), and it

co-immunoprecipitated with the ErbB2 and ErbB3 receptors (Figs 21, 22), substantiating

this interaction. Although many GPCRs are known to indirectly activate the ErbB

receptors, no direct interactions have been shown. The GPRC5B sequence places the

receptor in the GPCR class C, but unlike class C members, GPRC5B has a short N-

terminal domain. We are currently investigating the biological significance of this

interaction.

4.11 PROTEOMICS QUALITY CONTROL Recently, HTP proteomic studies have elucidated the function of many proteins by

identifying their interacting partners. A rapid method to validate a HTP dataset is by use

of alternative techniques that supports observed interactions, as described in this study.

In this study, we sought to define ErbB interacting partners through the use of both

MYTH and LUMIER in an effort to generate a high-confidence dataset. We found

multiple interactions which were identified by both MYTH and LUMIER. Collectively, the

interactome overlap was 60% for ErbB2, 40% for ErbB3 and 28% for ErbB4 (Fig 17,

Table 8). While the interactome overlap between the two distinctly different technologies

was relatively high, we were curious as to whether interactions uniquely identified in

64 either MYTH or LUMIER were true false positives. To this end we decided to investigate novel LUMIER interactions via low-throughput MYTH analysis. Interestingly, MYTH analysis confirmed a subset of the novel LUMIER interactions; however, many remained unconfirmed (Fig 20).

The presence of overlapping datasets increases our confidence of bona fide interacting partners; however, the absence of an overlap should not dismiss potential interactions as false-positives and negatives as our HTP analyses were stringently controlled. The ErbB receptors passed the NubG/NubI test, proving the receptors were not self-activating in yeast, and furthermore, each screening hit was tested using the bait dependency test which eliminates non-specific ErbB interactions. Moreover, the

LUMIER-prey library was screened against Renilla luciferase alone to eliminate the possibility of interactions occurring with the luciferase protein (Appendix Table 4) and each LUMIER screen included a positive reference set (Table 4).

HTP data sets have been scrutinized for high false positive and negative rates, which has led to more stringent quality control and stricter parameters to denote a ‘hit’.

Quality control within a data set may be sub-divided into (i) quality of the data set as a whole (i.e. coefficient correlation) (ii) quality of individual interactions (i.e. similar semantics) (21) whereby indentified interactions may be substantiated by use of these controls. Alternatively, different techniques may be used to evaluate HTP data and confirm observed interactions. Even so, there is no ‘gold standard’ for the detection of

PPIs as all assays contain inherent limitations and there may be underlying biological reasons explaining the absence of an interaction or a bias for specific interactions. For example, the method of protein entrapment may be dependent on factors such as

65 protein stability, PTMs, proper folding, context-specific, or the method may have not reached saturation. This needs to be considered when examining overlap amongst data sets. Take for instance yeast protein data sets: there are over 80,000 interactions documented that have been detected by different methods, yet only 2,400 interactions are supported by more than one method (178). This poor overlap between interactome maps is often regarded as false-negative interactions rather than differential abilities of different techniques to detect an interaction.

Recently, a study systematically and experimentally evaluated the performance of complementary techniques to examine their coverage and accuracy (21). Using a high confidence reference set (positive reference set, PRS, i.e. annotated PPIs) and a negative reference set (random reference set, RRS, i.e. randomly chosen proteins) they examined the performance and overlap of techniques such as LUMIER, YTH, YFP-

PCA, and wNAPPA. They demonstrated the tradeoffs between false positive and false negative rates that inversely change as a function of stringency. Amongst the assays,

LUMIER proved to be most sensitive where 36% of the PRS was detected, but also 4% of the RRS. The conventional YTH indentified 25% of the PRS and while no false positive were detected. Surprisingly, the use of different yeast strains affected the detection of PPIs and decreased the overlap of the search space. YFP-PCA scored

23% with the PRS and 2% of the RRS while wNAPPA assay performed poorly with a sensitivity rate of 21% with the PRS, and 3% detection of the RRS. Most surprisingly,

59% of the PRS was detected by one or more techniques. As mentioned, assays have a bias for or against specific interactions. Methods based on purified complexes were poor in detecting proteins involved in transport, while YTH methods failed to detect PPIs

66 involved in translation (178). Thus, integrated approaches do increase confidence of observed PPIs, but caution must be used when evaluating overlapping data sets. In light of this concept, our MYTH-LUMIER overlap data represents high-confidence interactions amongst the ErbB family members. Our inability to confirm all subset of these interactors by co-immunoprecipitation does not suggest the proteins do not interact since often co-immunoprecipitation requires optimization for each unique interaction. It is becoming increasing clear that these gaps between techniques must be bridged such that limitations can be identified and may become predicted.

Taken together, this study continues to show the complexity of the ErbB receptors. We investigated their interacting partners to derive a comprehensive protein interaction network using MYTH, which allows for the systematic analysis of human membrane proteins in a genetically isolated system. A subset of the MYTH-identified interactors was validated by LUMIER analysis, and selective interactions were further confirmed by co-immunoprecipitation using the endogenous ErbB receptors in Sk-Br-3 cells. These results provided the first lines of evidence of many novel ErbB protein interactions such as the GPCR, GPRC5B, CAPN1, and WIF1, a secreted protein containing 5 EGF domains, present in all ErbB receptor ligands, and may represent a novel ErbB ligand. Our systematic study may serve to understand the higher complexity of the ErbB receptors and given their aggressive proto-oncoprotein properties, our results may contribute to modes to target and attenuate their activity.

CHAPTER 5: FUTURE PERSPECTIVES In this study we interrogated the ErbB2, ErbB3, and ErbB4 receptors to derive a comprehensive protein interaction network in order to gain insight into their biological function. The MYTH systematic analysis coupled to LUMIER offered an unbiased, systems level view that led to the discovery of many novel ErbB interacting partners such as the GPCR GPC5B, WIF1, FKBP8, and the apoptotic proteins BNIP3L and Bcl- xL. Further work is necessary to provide insight into the regulatory role of the identified

ErbB interactors.

Primarily, we will continue to confirm PPIs (Table 9) with the endogenous ErbB receptors in Sk-Br-3 cells, which will require further optimization of the immunoprecipitation protocol. Also, we will continue to optimize the ErbB-responsive genes that are transcribed in response to NRG1 β. Subsequently, we will investigate

whether overexpression or down-regulation of preys alters the activated-ErbB

transcriptional program by qPCR, suggesting the preys act as negative or positive ErbB

regulators. Moreover, we will determine if prey overexpression or knock-down affects

the ErbB receptor stability, turnover levels, proteolysis (ex. calpain CAPN1). This will be

valuable to assess if observed transcriptional responses are due to decreased protein

levels, or alternatively positive/negative allostery.

This study identified many interesting ErbB interacting partners such as WIF1,

which was found to interact with ErbB2, ErbB3, and ErbB4. An outstanding question

remains the precise ErbB binding site of WIF1 and whether WIF1 is a bona fide ligand

of the ErbB receptors. The construction of ErbB truncation mutants will map the WIF1-

ErbB interaction site using MYTH and can be substantiated by co-immunoprecipitation

68 in mammalian cells. A direct method to investigate WIF1 binding to the ErbB ectodomain is by surface plasmon resonance (SPR). This optical biosensor detects immobilized receptors binding to interacting analytes in solution such as ligands, small- molecules, or antibodies. Ligand binding to immobilized receptors changes the optical properties of the medium near a metal surface, owing to a change in mass at the surface, indicative of an interaction. Monitoring this change in real time allows the detection of (i) amount of bound ligand (ii) affinity (iii) association and dissociation kinetics (reviewed in (40)). Full-length or receptor extracellular domains can be immobilized by affinity tags or non-specific chemical coupling using amines. Purified full- length receptors can be reconstituted in a membrane environment using lipid/detergent micelles, followed by subsequent detergent elution (85).

An alternative strategy for detection of ligand-receptor interaction is using cell lines that do not endogenously express the ERBB1-4 receptors nor ErbB-specific

ligands such as the 32D murine hematopietic progenitor cell line (127,158). Cells can be

transfected individually with the ErbB receptors followed by the addition of radiolabeled

ligand and ligand binding can be assessed using a geiger counter. The biological

activity of the ligand can be assessed by examining the ErbB phosphorylation status

and examining if it behaves similar to other ErbB ligands that induce cell proliferation.

This can be determined using 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium

bromide which reduces to purple formazan in living cells due to increased mitochondrial

activity.

The aforementioned experiments will provide crucial information regarding the

newly identified ErbB interactors, but importantly, this study presents the first line of

69 evidence that many novel proteins interact with the ErbB receptor such as the first- identified ErbB interacting RTK, DDR1, the GPCR, GPRC5B, and the secreted protein

WIF1. Given that the ErbB receptors were discovered in the 1980s, we have already learnt a substantial amount about this receptor family through ongoing research.

Despite this, our results continue to show the complexity of these receptors, and it is highly apparent that there is still much to learn about the ErbB family and their role in the development of cancer. Through the integrated application of MYTH, LUMIER, and co-immunoprecipitation, this project uncovered unique interactions and further functional analysis will work towards understanding their precise molecular function with regard to the ErbB receptors. This will improve our current knowledge of ErbB signaling and regulation in hopes that this knowledge will in-part aid future therapeutic advances in the fight against ErbB-driven cancers.

TABLES

Table 1. Activating ErbB receptor ligands. EGFR ErbB 2 ErbB3 ErbB4 Amphiregulin Betacellulin EGF Epigen Epiregulin Heparin- binding-EGF (HB-EGF) Neuregulin-1α Neuregulin-1β Neuregulin-2α Neuregulin-2β Neuregulin-3 Neuregulin-4 TGF α

Table 2. Plasmids used in this study. Plasmid feature Promoter Resistance Ref marker psPAX2 Lentiviral,Packaging, chicken β actin AMP R (111) HIV-1 gag, pol, RRE (CAG) pMD2.G HIV-1 rev cytomegalovirus AMP R (111) Vesicular Stomatitis Virus G (CMV) glycoprotein (VSV-G) pLD-NCVM-ErbB4 Lentiviral vector, ErbB2 C- elongation factor Neo, AMP R This study terminal fusion to V5-MYC 1 ( α EF1 α) pFFLUC-ErbB2 ErbB2 C-terminal fusion to CMV AMP R This study firefly Luciferase pFFLUC-ErbB3 ErbB3 C-terminal fusion to CMV AMP R This study firefly Luciferase pFFLUC -ErbB4 ErbB4 C-terminal fusion to CMV AMP R This study firefly Luciferase pChRLUC-ErbB2 ErbB2 C-terminal fusion to CMV AMP R This study Renilla Luciferase pChRLUC-ErbB3 ErbB3 C-terminal fusion to CMV AMP R This study Renilla Luciferase pChRLUC-ErbB4 ErbB4 C-terminal fusion to CMV AMP R This study Renilla Luciferase pChRLUC-TβII TGF βRII N-terminal fusion to CMV AMP R This study Renilla Luciferase pAMBV-ErbB2 MF α-ErbB2 C-terminal fusion to Alcohol Leu, KAN R Schmidt Cub-TF dehydrogenase (ADH) pAMBV-ErbB3 MF α-ErbB3 C-terminal fusion to ADH Leu, KAN R Schmidt Cub-TF

71 pAMBV-ErbB4 MF α-ErbB4 C-terminal fusion to ADH Leu, KAN R Schmidt Cub-TF pPR3G-FUR4 Fur4-HA-NubG ADH TRP1, DSB* AMP R pPR3I-FUR4 Fur4-HA-NubI ADH TRP1, DSB AMP R pPR3-Ost1 Ost1-HA-NubG ADH TRP1, DSB AMP R pPR3I-Ost1 Ost1-HA-NubI ADH TRP1, DSB AMP R pPR3-SYT5 NubG-HA-SYT5 ADH TRP1, DSB AMP R pPR3-IFIT5 NubG-HA-IFIT5 ADH TRP1, DSB AMP R pPR3-WIF1 NubG-HA-WIF1 ADH TRP1, DSB AMP R pPR3-MYCBP2 NubG-HA-MYCBP2 ADH TRP1, DSB AMP R pPR3-SQSTM NubG-HA-SQSTM ADH TRP1, DSB AMP R pPR3-FKBP8 NubG-HA-FKBP8 ADH TRP1, DSB AMP R pPR3-GPC5B NubG-HA-GPC5B ADH TRP1, DSB AMP R pPR3-SH3L1 NubG-HA-SH3L1 ADH TRP1, DSB AMP R p1899-GAPDH 3XFLAG-GAPDH CMV AMP R This study p1899-HDAC6 3XFLAG-HDAC6 CMV AMP R This study p1899-PLP1 3XFLAG-PLP1 CMV AMP R This study p1899-FKBP1A 3XFLAG-FKBP1A CMV AMP R This study p1899-TBCA 3XFLAG-TBCA CMV AMP R This study p1899-VIME 3XFLAG-VIME CMV AMP R This study p1899-CAN1 3XFLAG-CAN1 CMV AMP R This study p1899-MATR3 3XFLAG-MATR3 CMV AMP R This study p1899-SH3L1 3XFLAG-SH3L1 CMV AMP R This study p1899-T22D1 3XFLAG-T22D1 CMV AMP R This study p1899-PGTA 3XFLAG-PGTA CMV AMP R This study p1899-NGEF 3XFLAG-NGEF CMV AMP R This study p1899-FKBP8 3XFLAG-FKBP8 CMV AMP R This study p1899-AR6P1 3XFLAG-AR691 CMV AMP R This study p1899-COF1 3XFLAG-COF1 CMV AMP R This study p1899-NP25 3XFLAG-NP25 CMV AMP R This study p1899-1F4H 3XFLAG-1F4H CMV AMP R This study p1899-GPC5B 3XFLAG-GPC5B CMV AMP R This study p1899-MYCBP 3XFLAG-MYCBP CMV AMP R This study p1899-PTEN 3XFLAG-PTEN CMV AMP R This study p1899-HIP1 3XFLAG-HIP1 CMV AMP R This study p1899-CALM1 3XFLAG-CALM1 CMV AMP R This study p1900-TBCA TBCA-3XFLAG CMV AMP R This study p1900-PP2CB PP2CB-3XFLAG CMV AMP R This study p1900-PSAT PSAT-3XFLAG CMV AMP R This study p1900-SQSTM SQSTM-3XFLAG CMV AMP R This study p1900-VIME VIME-3XFLAG CMV AMP R This study p1900-IFIT5 IFIT5-3XFLAG CMV AMP R This study

72 p1900-CTNA1 CTNA1-3XFLAG CMV AMP R This study p1900-CH60 CH60-3XFLAG CMV AMP R This study p1900-CAN1 CAN1-3XFLAG CMV AMP R This study p1900-MATR3 MATR3-3XFLAG CMV AMP R This study p1900-SH3L1 SH3L1-3XFLAG CMV AMP R This study p1900-PCNP PCNP-3XFLAG CMV AMP R This study p1900-STMN1 STMN1-3XFLAG CMV AMP R This study p1900-T22D1 T22D1-3XFLAG CMV AMP R This study p1900-PRAF3 PRAF3-3XFLAG CMV AMP R This study p1900-BCLX BCLX-3XFLAG CMV AMP R This study p1900-PGTA PGTA-3XFLAG CMV AMP R This study p1900-NGEF NGEF-3XFLAG CMV AMP R This study p1900-ENSA ENSA-3XFLAG CMV AMP R This study p1900-FKBP8 FKBP8-3XFLAG CMV AMP R This study p1900-WIF1 WIF1-3XFLAG CMV AMP R This study p1900-PPID PPID-3XFLAG CMV AMP R This study p1900-AR6P1 AR6P1-3XFLAG CMV AMP R This study p1900-GBRL2 GBRL2-3XFLAG CMV AMP R This study p1900-COF1 COF1-3XFLAG CMV AMP R This study p1900-PEBP1 PEBP1-3XFLAG CMV AMP R This study p1900-NP25 NP25-3XFLAG CMV AMP R This study p1900-1F4H 1F4H -3XFLAG CMV AMP R This study p1900-BNI3L BNI3L-3XFLAG CMV AMP R This study p1900-UCHL1 UCHL1-3XFLAG CMV AMP R This study p1900-PTEN PTEN-3XFLAG CMV AMP R This study p1900-PSAT PSAT-3XFLAG CMV AMP R This study p1900-GPC5B GPC5B-3XFLAG CMV AMP R This study p1900-PIN1 PIN1-3XFLAG CMV AMP R This study p1900-OXSR1 OXSR1-3XFLAG CMV AMP R This study p1900-MYCBP MYCBP-3XFLAG CMV AMP R This study p1900-MYPR MYPR-3XFLAG CMV AMP R This study p1900-APLP1 APLP1-3XFLAG CMV AMP R This study p1900-SYT5 SYT5-3XFLAG CMV AMP R This study p1900-ENSA ENSA-3XFLAG CMV AMP R This study p1900-DDR1 DDR1-3XFLAG CMV AMP R This study p1900-WNK1 WNK1-3XFLAG CMV AMP R This study p1900-ALDOA ALDOA-3XFLAG CMV AMP R This study p1900-KCNAB2 KCNAB2-3XFLAG CMV AMP R This study p1900-SH3BGRL2 SH3BGRL2-3XFLAG CMV AMP R This study p1900-HIP1 HIP1-3XFLAG CMV AMP R This study p1900-CALM1 CALM1-3XFLAG CMV AMP R This study p1900-HDAC6 HDAC6-3XFLAG CMV AMP R This study p1900-SMAD1 SMAD1-3XFLAG CMV AMP R This study p1900-BCAR1 BCAR1-3XFLAG CMV AMP R This study p1900-GRB2 GRB2-3XFLAG CMV AMP R This study p1900-JAK2 JAK2-3XFLAG CMV AMP R This study p1900-PIK3R2 PIKR3R2-XFLAG CMV AMP R This study p1900-MAP3K7 MAP3K7-3XFLAG CMV AMP R This study p1900-PPP1CA PP1CA-3XFLAG CMV AMP R This study p1900-NWASP NWAP-3XFLAG CMV AMP R This study * DSB – Dual System Biotech

Table 3. ErbB library GENECARD summary. Gene a UniProt Protein SMART annotation GENECARD summary b ID domains GAPDH* P04406 Gp_dh_N Glyceraldehyde 3-phosphate Glyceraldehyde-3-phosphate dehydrogenase, NAD binding dehydrogenase. Catalyzes an important domain energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3- phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). TBCA* O75347 ------Tubulin folding cofactor A, the product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded β-tubulin from folding intermediates. PPP2CB P62714 PP2Ac Protein phosphatase 2A Protein phosphatase 2 catalytic subunit, β homologues catalytic domain isoform. One of the four major Ser/Thr phosphatases and it is implicated in the negative control of cell growth and division. PSAT Q9Y617 ------Phosphoserine aminotransferase 1. Likely a phosphoserine aminotransferase, based on similarity to proteins in mouse, rabbit, and Drosophila. SQSTM1 Q13501 PB1, Phox and Bem1p domain, Sequestosome 1. Multifunctional protein ZnF_Z, present in many eukaryotic that binds ubiquitin and regulates activation UBA cytoplasmic signaling proteins. of the nuclear factor kappa-B (NF-kB) The domain adopts a beta- signaling pathway. The protein functions as grasp fold, similar to that found a scaffolding/adaptor protein in concert with in ubiquitin and Ras-binding TNF receptor-associated factor 6 to domains. Zinc-binding domain, mediate activation of NF-kB in Ubiquitin associated domain response to upstream signals. VIM* Q96ML2 ------Vimentin. Along with the microfilaments (actins) and microtubules (tubulins), the intermediate filaments represent a third class of well-characterized cytoskeletal elements. IFIT5 Q13325 5 TPR Tetratricopeptide repeats, Interferon-induced protein with repeats present in 4 or more tetratricopeptide repeats 5 copies in proteins. CTNA1 P35221 ------α -E-catenin. Associates with the cytoplasmic domain of a variety of cadherins. The association of catenins to cadherins complex is linked to the actin filament network, primary importance for cadherins cell-adhesion properties. May play a crucial role in cell differentiation. CH60 P10809 ------HSP60. Implicated in mitochondrial protein (HSPD1) import and macromolecular assembly. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. CAN1 * P07384 CysPc, Calpain-like thiol protease Calcium-activated neutral proteinase 1. calpain_III family. Calcium activated Nonlysosomal, intracellular cysteine , 3x EFh neutral protease. EF-hands proteases. are calcium-binding motifs that occur at least in pairs. EF- hands undergo a conformational change upon binding calcium ions.

MATR3* P43243 ZnF_C2H Zinc finger. RNA recognition Matrin 3. Localized in the nuclear matrix. It 2, 2X rrm, motif- known to bind single- may play a role in transcription or may ZnF_U1 stranded RNAs. U1-like zinc interact with other nuclear matrix proteins to finger- U1 small nuclear form the internal fibrogranular network. ribonucleoprotein C and other RNA-binding proteins. SH3L1* O75368 ------SH3 domain binding glutamic acid-rich (SH3BGRL) protein like. PCNP Q8WW1 ------PEST proteolytic signal containing nuclear 2 protein. STMN1 P16949 ------Stathmin 1/oncoprotein 18. A ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals. It prevents assembly and promotes disassembly of microtubules. T22D1* Q15714 ------Transforming growth factor beta-stimulated (TSC22D1) protein TSC-22. Transcriptional repressor. Acts on the C-type natriuretic peptide (CNP) promoter. PRAF3* O75915 ------ADP-ribosylation factor-like protein 6- (ARL6IP5) interacting protein 5. May be associated with the cytoskeleton. BCLX Q07817 BH4, BCL BH4 Bcl-2 homology region 4. Apoptosis regulator Bcl-xL. Belongs to the (BCL2L1) BCL (B-Cell lymphoma) BCL-2 protein family that form hetero- or contains BH1, BH2 regions. homodimers and act as anti- or pro- apoptotic regulators. Located at the outer mitochondrial membrane and have been shown to regulate outer mitochondrial membrane channel VDAC opening. VDAC regulates mitochondrial membrane potential, and thus controls the production of reactive oxygen species and release of cytochrome C by mitochondria, both of which are the potent inducers of cell apoptosis. Two alternatively spliced transcript variants, which encode distinct isoforms, have been reported. The longer isoform acts as an apoptotic inhibitor and the shorter form acts as an apoptotic activator. PGTA* Q92696 2X LRR Leucine-rich repeats Rab geranyl-geranyltransferase subunit (RABGGTA alpha. Catalyzes the transfer of a geranyl- ) geranyl moiety from geranyl-geranyl pyrophosphate to both cysteines in Rab proteins with an -XXCC, -XCXC and -CCXX C-terminal, such as RAB1A, RAB3A and RAB5A respectively. NGEF* Q8N5V2 RhoGEF, Guanine nucleotide exchange Neuronal guanine nucleotide exchange PH, SH3 factor for Rho/Rac/Cdc42-like factor. Acts as GEF which differentially GTPases. Pleckstrin homology activates the GTPases RHOA, RAC1 and domain found in signaling CDC42. Upon activation by ephrin through proteins. Src homology 3 EPHA4, the GEF activity switches toward domain. RHOA resulting in its activation. ENSA Q6VUC7 ------Endosulfine alpha. Belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein is an an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane.

FKBP8* Q14318 ------FK506 binding protein 8 (38kD). Constitutively inactive PPiase, which becomes active when bound to calmodulin and calcium. Acts as a BCL2 chaperone, targets it to the mitochondria and modulates its phosphorylation state. The BCL2/FKBP8/calmodulin/calcium complex probably interferes with the binding of BCL2 to its targets. The active form of FKBP8 may therefore play a role in the regulation of apoptosis. WIF1 Q9Y5W5 WIF, 5X Wnt-inhibitory factor-1 like. WNT proteins are extracellular signaling EGF Occurs as extracellular domain molecules involved in the control of in Ryk receptor tyrosine embryonic development. This gene kinases. Epidermal growth encodes a secreted protein, which binds factor-like domain. WNT proteins and inhibits their activities. PPID Q08752 3X TPR Tetratricopeptide repeats- Peptidylprolyl isomerase D. A peptidyl- Repeats present in 4 or more prolyl cis-trans isomerase (PPIase). copies in proteins. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. Can bind to the immunosuppressant cyclosporin A. AR6P1 Q9NYB9 SH3 Src homology 3 domains Arg protein tyrosine kinase-binding protein. (ABI2 ) May act in regulation of cell growth and transformation by interacting with nonreceptor tyrosine kinases ABL1 and/or ABL2. May be involved in cytoskeletal reorganization. Regulates ABL1/c-Abl- mediated phosphorylation of MENA GB RL2 P60520 ------GABA(A) receptor-associated protein-like (GABARAP 2. Involved in intra-Golgi traffic. Modulates L2 ) intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1. COF1* P23528 ADF Actin depolymerisation Cofilin is a widely distributed intracellular factor/cofilin –like- Severs actin actin-modulating protein that binds and filaments and binds to actin depolymerizes filamentous F-actin and monomers inhibits the polymerization of monomeric G- actin in a pH-dependent manner. PEBP1 P30086 ------Raf kinase inhibitor protein. May be involved in the function of the presynaptic cholinergic neurons of the central nervous system. It increases the production of choline acetyltransferase but not acetylcholinesterase. Seems to be mediated by a specific receptor. NP25* Q9UI15 CH Calponin homology- Actin Neuronal protein NP25 (TAGLN3) binding domains present in duplicate at the N-termini of spectrin-like proteins. IF4H* Q15056 RRM RNA recognition motif Eukaryotic translation initiation factor 4H. This gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. BNI3L O60238 ------BCL2/adenovirus E1B 19 kDa protein- interacting protein 3A. Induces apoptosis. Interacts with viral and cellular anti-

apoptosis proteins. Can overcome the suppressors BCL-2 and BCL-XL, although high levels of BCL-XL expression will inhibit apoptosis. May function as a tumor suppressor. UCHL1 P09936 ------Ubiquitin carboxyl-terminal esterase L1. UCHL1 is a member of a gene family whose products hydrolyze small C-terminal adducts of ubiquitin to generate the ubiquitin monomer. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. Also binds to free monoubiquitin and may prevent its degradation in lysosomes. PTEN* P60484 PTPc_DS Protein tyrosine phosphatase, Phosphatase and tensin homolog. Acts as Pc catalytic domain, undefined a dual-specificity protein phosphatase, specificity. dephosphorylating tyrosine-, serine- and threonine-phosphorylated proteins. Also acts as a lipid phosphatase. The lipid phosphatase activity is critical for its tumor suppressor function. Antagonizes the PI3K- AKT/PKB signaling pathway by dephosphorylating phosphoinositides and thereby modulating cell cycle progression and cell survival. PSAT1 Q9Y617 ------Phosphoserine aminotransferase 1. The protein encoded by this gene is likely a phosphoserine aminotransferase, based on similarity to proteins in mouse, rabbit, and Drosophila . Alternative splicing of this gene results in two transcript variants encoding different isoforms. GPRC5B* Q9NZH0 ------G protein-coupled receptor, family C, group 1. member B. This protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. PIN1 Q13526 WW Domain with 2 conserved Trp Peptidyl-prolyl cis/trans isomerase, NIMA- (W) residues- binds proline- interacting. Essential PPIase that regulates rich polypeptides mitosis presumably by interacting with NIMA and attenuating its mitosis-promoting activity. Displays a preference for an acidic residue N-terminal to the isomerized proline bond. Catalyzing pSer/Thr-Pro cis/trans isomerizations. OXSR1 O95747 S_TKc Serine/Threonine protein Oxidative-stress responsive 1. Belongs to kinases, catalytic domain the Ser/Thr protein kinase family of proteins. It regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. MYCBP* Q99417 ------c-myc binding protein. Binds to the N- terminal region of MYC and stimulates the activation of E box-dependent transcription by MYC. MYPR P60201 PLP Myelin proteolipid protein Proteolipid protein 1. A transmembrane proteolipid protein that is the predominant myelin protein present in the central nervous system. It may play a role in the compaction, stabilization, and maintenance of myelin sheaths, as well as in

oligodendrocyte development and axonal survival. APLP1* P51693 A4_EXTR Amyloid A4- amyloid A4 Amyloid-like protein 1. A membrane- A precursor of Alzheimers associated glycoprotein that is cleaved by disease secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. SYT5 O00445 2x C2 Protein kinase C conserved Synaptotagmin V. May be involved in region 2 (CalB)-Ca2+-binding Ca(2+)-dependent exocytosis of secretory motif present in vesicles through Ca(2+) and phospholipid phospholipases. Some do not binding to the C2 domain or may serve as appear to contain Ca2+- Ca(2+) sensors in the process of vesicular binding sites. Particular C2s trafficking and exocytosis. Required for appear to bind phospholipids, export from the endocytic recycling inositol polyphosphates, and compartment to the cell surface. intracellular proteins. DDR1 Q5ST12 FA58C, Coagulation factor 5/8 C- Discoidin receptor tyrosine kinase. TyrKc terminal domain, discoidin Activated by various types of collagen. This domain. Tyrosine kinase, protein belongs to a subfamily of tyrosine catalytic domain kinase receptors with a homology region to the Dictyostelium discoideum protein discoidin I in their extracellular domain. Its autophosphorylation is achieved by all collagens so far tested (type I to type VI). Significantly overexpressed in several human tumors from breast, ovarian, esophageal, and pediatric brain. WNK1 Q9H4A3 STYKc. Protein kinase; unclassified Protein kinase with no lysine 1. WNK1 specificity. encodes a cytoplasmic serine-threonine kinase. Controls sodium and chloride ion transport by inhibiting the activity of WNK4, potentially by either phosphorylating the kinase or via an interaction between WNK4 and the autoinhibitory domain of WNK1. WNK4 regulates the activity of the thiazide- sensitive Na-Cl cotransporter, SLC12A3, by phosphorylation. WNK1 may also play a role in actin cytoskeletal reorganization. ALDOA P04075 ------Aldolase A, fructose-bisphosphate. A glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6- bisphosphate to glyceraldehyde 3- phosphate and dihydroxyacetone phosphate. KCNAB2 Q13303 ------K+ channel beta-2 subunit. Voltage-gated potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. HIP1* O00291 ENTH, Epsin N-terminal homology Huntingtin interacting protein 1. Plays a role ILWEQ (ENTH) domain. I/LWEQ in clathrin-mediated endocytosis and domain- thought to possess an trafficking. May act as a proapoptotic F-actin binding function protein that induces cell death by acting through the intrinsic apoptosis pathway. Binds 3-phosphoinositides and may act to

promote cell survival by stabilizing receptor tyrosine kinases following ligand-induced endocytosis. May play a functional role in the cell filament networks. May be required for differentiation, proliferation, and/or survival of somatic cells. HD AC6* Q9UBN7 ZnF_UBP Ubiquitin Carboxyl-terminal Histone deacetylase 6. Class II of the Hydrolase-like zinc finger histone deacetylase family. It contains an internal duplication of two catalytic domains which appear to function independently of each other. This protein possesses histone deacetylase activity and represses transcription. a all C-terminally tagged b EntrezGene or UniProtKB/Swiss-Prot summary *also N-terminally tagged

Table 4. LUMIER control plasmids. ErbB2 ErbB3 ErbB4 Column1 pChRLUC-ErbB2 + pChRLUC-ErbB3 + pCMV50 pChRLUC-ErbB4 + (negative pCMV50 pCMV50 control)

Column 8 pChRLUC-ErbB2 + p1900- pChRLUC-ErbB2 + pCMV50 pChRLUC-ErbB4 + p1900- Row A-D Grb2 Grb2 (positive control)

Column 8 pChRLUC-ErbB2 + p1900- pChRLUC-ErbB4 + p1900- pChRLUC-ErbB2 + Row E-F Grb2 Grb2 pCMV50 (positive control)

Column 8 pChRLUC-ErbB2 + p1900- pChRLUC-ErbB3 + p1900- pChRLUC-ErbB2 + p1900- Row G-H Grb2 PI3KR2 Grb2 (positive control)

Table 5. Genes transcribed in response to ErbB receptor activation. Ge ne Primers Amplicon Initiated by Upregulated/ ref downregualted PEA3 F- AGAAACCTCTGCGACCATTC 72 ErbB2 UP (93) R- CCTGCTTGATGTCTCCTTCA

VEGF F-CCTCCGAAACCATGAACTTT 132 ErbB2 UP (191) R-CCACTTCGTGATGATTCTGC

PPAR γ F-CATAATGCCATCAGGTTTGG 91 ErbB2 UP (107) R-CTGGATTCAGCTGGTCGATA

VIM F-CCTGCAATCTTTCAGACAGG 130 ErbB2 UP (107) R-CAGCTCCTGGATTTCCTCTT

NDRG1 F-GAGGGCCTTGTCCTTATCAA 137 ErbB2 UP (107) R-CTCTGCATTTCTTCCTTCCC

MYC F-CTCGGATTCTCTGCTCTCCT 111 ErbB2 UP (8) R-CTTGTTCCTCCAGAGTCGCT

RRAS F-ATTAACGACCGGCAGAGTTT 118 ErbB3 DOWN (8) R-GTGACTCCAGATCTGCCTTG

PIM2 F-AGGTGGCCATCAAAGTGATT 98 ErbB3/ErbB4 UP (182) R-TTTCCATAGCAGTGCGACTT

UCHL1 F-TCGGGTAGATGACAAGGTGA 86 ErbB2 UP (182) R-AAGGCATTCGTCCATCAAGT

GAPDH F-CTCCTCCTGTTCGACAGTCA 105 control R-CAATACGACCAAATCCGTTG

Table 6. Bait and prey primers for qPCR analysis. Bait/Prey Ensembl Prote in ID Primers Amplicon ErbB2 ENSP00000269571 F-AGTACACGATGCGGAGACTG 132 R-ATCCAAGCACCTTCACCTTC

ErbB3 ENSP00000267101 F-GGGAACCTTGAGATTGTGCT 70 R-TCACTTCTCGAATCCACTGC

ErbB4 ENSP00000342235 F-TTTGGGCTAGCCAGACTCTT 125 R-ACGTCACTCTGATGGGTGAA

WIF1 ENSP00000286574 F-CCCACCTGGATTCTATGGAG 107 R-GTCCTGGAGGGCAAATACAT

CAPN1 ENSP00000259755 F-ACATGGAGATCAGCGTGAAG 129 R-CATCACGATCCATGAGGTTC

BCL -xL ENSP00000405563 F-GGATGGCCACTTACCTGAAT 96 R-CTGCTGCATTGTTCCCATAG

FKBP8 ENSP00000222308 F-ATGGTCACTGCTGACTCCAA 101 R-GTCTTCAGGGTCACCTCCAG

PTEN ENSP00000361021 F-TGGCACTGTTGTTTCACAAG 92 R-CTTTAGCTGGCAGACCACAA

Table 7. The Pearson product-moment correlation coefficient (PMCC) for ErbB LUMIER screens. ErbB2 ErbB2 ErbB3 ErbB3 ErbB4 ErbB4 Pervanadate (+/-) - + - + - + Screen1 - 0.906 0.732 0.922 0.973 0.987 0.982 Screen2 Screen2 - 0.914 0.929 0.922 0.965 0.965 0.952 Screen3 Screen3 - 0.872 0.728 0.820 0.948 0.952 0.933 Screen1

Table 8. LUMIER hits ranked by frequency detected amongst biological replicates. ErbB2 ErbB3 ErbB4 MYTH HITS 25 15 18 LOW 2 1 2 MEDIUM 4 1 0 HIGH 9 4 3 CONFIRMATION 60 % 40 % 28 % RATE (%)

Table 9. ErbB receptor interactions analyzed by co-immunoprecipitation in Sk-Br-3 cells.

LUMIER MYTH HITS (average)

ErbB2 ErbB3 ErbB4 ErbB2 ErbB2 ErbB3 ErbB3 ErbB4 ErbB4 pervanadate - + - + - +

CAPN1 BCL-xL RABGGTA NGEF FKBP8 WIF1 BNIP3L PTEN GPRC5B DDR1

FIGURES

Figure 1. The ErbB signaling cascade can be divided into the input, signal-processing, and output layer. a. The input layer consists of many ligands and 9 active receptor dimer pairs. For simplicity, only EGF and NRG4 are linked to receptor pairs. Ligand binding causes receptor homo- or heterodimerization and transphosphorylation. An ErbB2 ligand has not been identified and ErbB3 is kinase dead. b. The signal-processing layer depicts the major players that bind to activated ErbB receptors and transmit the mitogenic signal. For simplicity, only EGFR homodimers and the ErbB2-ErbB3 heterodimer are linked to pathways. c. The signaling events initiate a transcriptional profile that ultimately causes the evasion of apoptosis, cell migration, cell growth, and differentiation. Adapted from (192).

Figure 2. Two important ErbB signaling pathways are the PI3K-Akt and Ras-Raf- MAPK cascade. Grb2 binding to activated ErbB receptors recruits the guanine nucleotide exchange factor SOS which drives the activation of the GTPase Ras. This initiates the Raf- MAPK signaling cascade. PI3K consists of two subunits – p85 and p110. p85 binding to the ErbB receptors activates PI3K that converts PIP2 to PIP3. PIP3 recruits the serine/threonine kinase Akt and PDK1, and PDK1 phosphorylates Akt which has a large repertoire of substrates. A major negative regulator of PI3K-Akt pathway is PTEN. It dephosphorylation of PIP3 to PIP2 which prevents Akt activation. Each pathway has unique targets, but there is also cross-talk between the pathways. Common targets are the mTOR complex 1 (mTORC1) and the BH3 family of proteins that regulate apoptosis including BAD (BCL2-associated agonist of cell death) and BIM (BCL2-interacting mediator of cell death). These pathways synergistically promote the evasion of apoptosis, cell-cycle progression, and cell proliferation.

Figure 3. The ErbB receptor ectodomain has distinct inactive and active conformations. a. The ErbB ectodomain is divided into four subdivisions: I-IV. Inactive EGFR, ERBB3, and ERBB4 receptors are in a tethered ('closed') conformation with their dimerization arm (yellow- subdomain II) obstructed, preventing receptor dimerization. The ligand binding subdomains, I and III, are driven apart by the intramolecular contacts of subdomain II (dimerization arm) and IV. ErbB2 is constitutuvely in an open, extended conformation poised to bind other activated ErbB receptors with its dimerization arm available for binding. b. Ligand (green) binding causes ectodomain rearrangement which exposes the dimerization arm. The kinase domains of two dimerized receptors is asymmetrically positioned. Adapted from (15). c. ErbB crystal structures. EGFR in complex with ligand EGF, 2:2 ratio (PDB:1IVO), with Fab fragment of cetuximab (PDB: 1YY9), inactive TKD in complex with AMP-PNP (PDB: 2GS7), and active TKD (PDB: 2GS2). ErbB2 ECD complexed with Herceptin Fab (PDB: 1N8Z) and unliganded ECD 1-3 (PDB: 2A91). ErbB3 inactive ECD (PDB: 1M6B) and catalytically inactive TKD (PDB: 3KEX). ErbB4 ECD (PDB: 2AHX), active (PDB: 3BCE) and inactive TKD (PDB: 3BBW). ECD - extracellular domain, TKD – tyrosine kinase domain.

Figure 4. Intramolecular features of the tyrosine kinase domain. All protein kinase domains share strutucal similarity. The kinase domain can be divided into the N- and C- lobe. The active site resides inbetween the lobes. The N-lobe harbors a conserved lysine residue. This residue anchors the triphosphates of ATP. Within the catalytic loop is an aspartate residue that catalyzes the phosphotransfer to the substrate reviever. The activation loop can inhibit catalysis; this inhibiton is relieved by its phosphorylation which promotes ATP binding and proper orientation of the αC-helix in the N-lobe that form intramolecular interactions with the glutamate and the conserved lysine in the N-lobe. This schematic based is based on insulin receptor tyrosine kinase adapted from Huse and Kuriyan (76).

Figure 5. Clathrin-mediated endocytosis of EGFR efficiently terminates signaling. Following ligand induction (purple), the receptor is phosphorylated (red, P) and both mono- and poly-ubiquitinated (yellow, ub). EGFR relocates to clathrin-coated pits and undergoes endocytosis into clathrin-coated vesicles and fuses with the early endosome. Upon reaching the early endosomes, EGFR can be recycled to the plasma membrane or sorted to the multi- vesicular bodies (MVB) which is dependent on the ligand-receptor stability at endosomal pH. EGFR complexes targeted for degradation are subsequently degraded in the lysosome.

Figure 6. Lu minescence-based mammalian inter actome mapping (LUMIER) system. a. The bait (blue) is fused to the Renilla luciferase (yellow) and prey proteins that are 3xflagged- tagged (red) are expressed in HEK 293T. b. Following 48 h incubation, cells are lysed and proteins are solubilized by detergent. c. The prey is immunoprecipitated using anti-flag antibodies. d. The presence of the bait in the IP fraction is detected by an enzymatic assay where luciferase catalyzes the oxidation of its substrate, coelenterazine to coelenteramide, resulting in the emission of light that is detected using a luminometer.

Figure 7. Split-ubiquitin based membrane yeast two-hybrid (MYTH) system. The membrane protein-of-interest (bait) is fused to the C-terminal half of yeast ubiquitin (C Ub ), conjugated to a transcription factor (TF). Using a cDNA library, each protein encoded by the library (prey) is fused to the corresponding N-terminal of the ubiquitin moiety (N Ub G). If the two proteins do not interact, the transcription factor remains at the membrane interface (left panel). However, if the proteins interact, the two ubiquitin moieties join, resulting in TF cleavage by ubiquitin specific proteases. Cleavage releases the transcription factor, resulting in expression of reporter genes (right panel).

Figure 8. The ErbB2, ErbB3, and ErbB4 protein interactome identified using MYTH. Nodes are color-coordinated based on GO terms annotating each protein in SwissProt version 51.5 and were mapped to one of 11 categories as shown in the key and edges represent physical protein-protein interactions. Edge color corresponds to source of interaction: red edges represent MYTH interactions and blue edges correspond to interactions from I 2D. Mapping was done using the source databases: the International Protein Index version 3.36 (IPI, http://www.ebi.ac.uk/IPI/ ), SwissProt version 51.5, Unigene Hs.208, and Entrez Gene 2007-02-08. Interactions in I 2D are from human curated sources, high- throughput mammalian experiments, and predicted using orthologs from model organism protein interaction data sets, as previously described (22,23). Dashed edges are interactions that are phospho- dependent. Triangular nodes represent proteins which are predicted to be phosphorylated by ErbB2, ErbB3, or ErbB4 derived from NetworKIN predictions (101) whereas inverted triangular nodes represent phosphorylated targets of EGFR derived from SwissProt.

Figure 9. ErbB2 and ErbB4 are phosphorylated in yeast. AP40 yeast expressing MF α- ErbB2-Cub-TF, MF α-ErbB3-Cub-TF, or MF α-ErbB4-Cub-TF were analyzed by western blot analysis. a. Blots were probed using phospho-ErbB2 Tyr877, phospho-ErbB3 1289, or phospho- ErbB4 Tyr984 antibodies with higher exposure shown in blot below. Blots were also probed with anti-VP16, detecting the TF moiety, and tubulin was used as the loading control. b. Blots were probed using a general phosphotyrosine antibody, anti-VP16, or anti –tubulin antibody. A cross- reacting band was detected using the phosphotyrosine antibody, however ErbB2 and ErbB4 signals are higher than background indicating that ErbB2 and ErbB4 are phosphorylated in yeast.

Figure 10. Bioinformatic analysis reveals many MYTH hits share similar semantics, expression, and localization with the ErbB receptors. All proteins from MYTH screen were mapped into SwissProt identifiers. Using a set of InterPro interaction domain pairs that show significant co-occurrence in known human protein interactions provided support for 42 interactions. Using GeneOntology (biological process, molecular function, cellular localization) and semantic similarity provided further computational validation for 41 interactions. This map depicts only the MYTH preys that were selected for LUMIER analysis based on bioinformatics profiling results.

Figure 11. Project Pipeline. To confirm MYTH-identified ErbB interactions by LUMIER first requires the construction and optimization of the bait and prey expression system. Next, LUMIER conditions will be optimized so both phospho- dependent and independent interactions can be detected. A subset of these LUMIER-identified interactions will be investigated by co- immunoprecipitation. Lastly, the ErbB induced transcriptional response will be monitored to gain insight into the biological role of the identified ErbB binding partner.

1 2 3 4 5 6 7 8 9 10 11 12 A pCMV5 GAPDH HDAC6 PLP1 FKBP1A TBCA VIME CAN1 MATR3 SH3L1 T22D1 pCMV5 B pCMV5 PGTA NGEF FKBP8 AR6P1 COF1 NP25 1F4H GPC5B MYCBP PTEN pCMV5 C FOXH1 HIP1 CALM1 TBCA PP2CB PSAT SQSTM VIME IFIT5 CTNA1 CH60 FOXH1 D FOXH1 CAN1 MATR3 SH3L1 PCNP STMN1 T22D1 PRAF3 BCLX PGTA NGEF FOXH1 E GSC ENSA FKBP8 WIF1 PPID AR6P1 GBRL2 COF1 PEBP1 NP25 1F4H GSC F GSC BNI3PL UCHL1 PTEN PSAT GPC5B PIN1 OXSR1 MYCBP MYPR APLP1 GSC G KLC4 SYT5 ENSA DDR1 WNK1 WNK12 ALDOA KCNAB2 SH3BGRL2 HIP1 CALM1 KLC4 H KLC4 HDAC6 SMAD1 BCAR1 GRB2 JAK2 PIK3R2 MAP3K7 PPP1CA NWASP TBRII KLC4

Figure 12. ErbB library expression confirmed by immunofluorescence. HEK 293T cells were transiently transfected with indicated prey plasmids (upper table) and expression levels were visualized using mouse anti-FLAG primary antibody and the anti-mouse conjugated to Alexa Fluor 488. Nuclei were stained using DAPI. Images were acquired using the confocal microscope IN Cell Analyzer 1000 (lower panel). Twelve fields were examined per well and a snapshot of a single field is shown. Negative controls (light green), positive controls (pink), N- terminally tagged ErbB collection (beige), and C-terminally tagged ErbB preys (dark green) are shown. MATR3 (A9), GPC5B (B9), CALM1 (C3, G11), IF4H (E11) are poorly expressed and expression was either detected in different fields of view (lower panel) or through western blotting.

Figure 13. ErbB protein expression and extraction optimized for LUMIER analysis. HEK 293T cells were transiently transfected with ErbB2-, ErbB3-, or ErbB4- Photinus pyralis firefly luciferase or the Renilla reniformis luciferase. The luciferase signal was measured with their respective substrates. Protein expression profiles were optimized by modifications in protein extraction protocols: cell were harvested, lysed with 0.5 % or 1 % with C 12 E8 or Triton X-100 for 20 or 40 minutes. FF, firefly luciferase; RL, Renilla luciferase; TX, Triton X-100.

Figure 14. ErbB receptors are partially inactivated by serum starvation followed by PBS- treatment. HEK 293T cells were transiently transfected with each ErbB luciferase fusion and the indicated prey plasmid. Cultures were either grown in serum containing media (SCM) or serum-starved for 16 h, followed by a 1 h PBS shock to inactivate the receptor and lose the interactions with either the ErbB heterodimeric partner, or the phospho-dependent interactions with Grb2 or PI3K. Cultures were subsequently recovered for 1 h in SCM. SFM, serum-free media.

Figure 15. HEK 293T cells are sensitive to PBS-treatment. HEK 293T cell were transfected with ErbB3 and grown 16 h in serum-free media (SFM), followed by a 1 h PBS shock. a. Cultures were stained with Annexin V and sorted via flow-cytometry. There was an increased number of cells undergoing apoptosis with the PBS treated culture. b. Cultures were stained with propidium iodide (PI) and analyzed using a flow cytometer. A greater proportion of PBS- treated cells stained positive with PI (middle panel), relative to cultures grown in SCM (left panel) or SFM (right panel).

100

Figure 16. Pervanadate induces constitutive phosphorylation of ErbB receptors . a. HEK 293T cells were transfected in 96-well format with each ErbB luciferase fusion and indicated phospho-dependent binding partner. Cells were either grown in SCM (black bars) or SCM and then treated with pervanadate (grey bars) b. Comparison of pervanadate treatment versus a 24h serum starvation in 6-well format. Transfected cells were treated with vehicle (black bar) or pervanadate (grey bar) or alternatively, cells cultured were serum-starved for 24 h (green bar) and subsequently were recovered in serum-containing media (SCM) (dark green bar).

101

Figure 17. LUMIER hits ranked by frequency detected amongst biological replicates. Protein interactions detected by LUMIER were ranked as low (edge colour blue), medium (green), or high (red) depending on the frequency they were detected amongst the three biological replicates. Dashed lines represent interactions that were both detected by MYTH and LUMIER. Nodes are color-coordinated based on GO terms annotating each protein in SwissProt version 51.5 and were mapped to one of 11 categories as shown in the key.

102

Figure 18. ErbB LUMIER screening primarily detects phospho-dependent interactions. Node colour corresponds to the GO function as shown in legend. Diamond nodes represent cytoplasmic proteins, diamond-blue halo nodes represent membrane-associated proteins while circular-blue halo nodes represent integral membrane proteins as defined by GO "Cellular Component" terms and SwissProt keywords. Edge colour and width represents difference of NLIR value between pervanadate treated and untreated cultures. Most protein interactions detected by LUMIER were in the presence of pervanadate.

103

Figure 19. The integral membrane proteins GPRC5B and DDR1 and the secreted protein WIF1 strongly interact with the ErbB receptors. Node colour corresponds to the GO function as shown in legend. Diamond nodes represent cytoplasmic proteins, diamond-blue halo nodes represent membrane-associated proteins while circular-blue halo nodes represent integral membrane proteins as defined by GO "Cellular Component" terms and SwissProt keywords. Edge colour and width represents the average LUMIER NLIR value, which is semi-indicative of the strongest interaction with the respective ErbB receptor.

104

Figure 20. Novel LUMIER-identified interactions are partially detected by MYTH. a. NubG/NubI test. THY.AP40 yeast expressing MF α-ErbB2-Cub-TF, MF α-ErbB3-Cub-TF, or MF α-ErbB4-Cub-TF were transformed with Fur4-NubG and Ost1-NubG (negative control) or Fur4-NubI and Ost1-NubI (positive control). Yeast growth was assayed on SD-Trp-Leu (transformation control) and SD-Trp-Leu-Ade-His + 50 mM 3-AT + X-gal plates (selective media). b. THY.AP40 yeast expressing MF α-ErbB2-Cub-TF, MF α-ErbB3-Cub-TF, or MF α- ErbB4-Cub-TF were transformed with SYT5-, IFIT5-, WIF1-, MYCBP2-, SQSTM-, FKBP8-, GPC5B-, or SH3L1-NubG prey plasmids. Transformants were spotted on SD-Trp-Leu and selective media. Red stars indicate interactions that were detected by LUMIER and yeast cartoon represents interaction that was identified through high-throughput MYTH screening.

105

Figure 21. GPRC5B and RABGGTA co-immunoprecipitate with endogenous ErbB2 in Sk- Br-3 cells. Sk-Br-3 cells were transfected with indicated prey plasmids. The endogenous ErbB2 receptor was immunoprecipitated using rabbit anti-ErbB2 antibody and bound proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted using mouse anti-FLAG antibody. * indicates transfected Sk-Br-3 cells where rabbit anti-HA was used, instead of anti–ErbB2, acting as negative control.

106

Figure 22. CAPN1, RABGGTA, GPRC5B, and WIF1 co-immunoprecipitate with endogenous ErbB3 in Sk-Br-3 cells. Sk-Br-3 cells were transfected with indicated prey plasmids. The endogenous ErbB3 receptor was immunoprecipitated using rabbit anti-ErbB3 antibody and bound proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and immunoblotted using mouse anti-FLAG antibody. * indicates transfected Sk- Br-3 cells where rabbit anti-HA was used, instead of anti–ErbB3, acting as negative control.

107

Figure 23. Baits, preys, and ErbB transcriptional targets are expression in HME1 cells. One microgram of RNA from HME1 cells was reverse transcribed to generate cDNA. The cDNA was amplified with indicated primers. Products were analyzed on a 2.5% agarose via gel electrophoresis. a. ErbB receptors and all tested preys are transcribed in HME1 cells. b. Most ErbB responsive genes are transcribed in HME1 cells. The selected transcriptional targets used for further analysis include MYC, VEGF, PEA3, PPARG, UCHL1, RRAS, ESX, VIM, GATA4, and PIM2, since the remainder are not expressed or there is non-linear amplification. Experiments were performed in biological duplicates, each in three technical replicates.

108

Figure 24. NRG1 β stimulates transcription of target genes. HME1 cells were serum-starved for 24 h and stimulated with various concentrations of NRG1 β for 15 or 30 minutes. Cells were collected, RNA was extracted, and 0.5 ug of RNA was reverse transcribed to generate cDNA. cDNA was amplified using primers for each indicated gene. The low gene expression for GATA4 and ESX, prevented their analysis since their cDNA quantities did not exceed the detection threshold (i.e. Ct value remained undetermined). Experiments were performed in biological duplicates, each in three technical replicates. * indicates statistically significant, p < 0.05.

109

Figure 25. Model for ErbB2-induced evasion of apoptosis. a. In the absence of growth factor signaling, BNIP3L and BNIP3 bind active GTPase Rheb and BNIP3 binding prevents its inhibitory binding to FKBP8. FKBP8 is free to bind and inhibit mTOCR1 function, preventing cell proliferation. BNIP3L may both bind and inhibit anti-apoptotic function by sequestering Bcl-xL, and Bcl-2, and can localize to the mitochondrial membrane where it drives the opening of the mitochondrial permeability transition pore complex, and subsequent cytochrome c release. b. activated ErbB2 may promote the evasion of apoptosis by the dual recruitment of apoptotic members Bcl-xL and BNIP3L. Bcl-xL can bind to BNIP3L, inhibiting its function and preventing its binding to Rheb. Activate GTPase Rheb can then bind FKBP8, preventing its inhibitory function on mTORC1. This complex can then transmit proliferative signals. Moreover, free FKBP8 is known to traffic Bcl-xL to the mitochondrial outer membrane preventing Bak-Bax oligomerization, causing the evasion of apoptosis.

110

Reference List

1. Abdulhussein, R., D. H. Koo, and W. F. Vogel . 2008. Identification of disulfide-linked dimers of the receptor tyrosine kinase DDR1. J. Biol. Chem. 283 :12026-12033.

2. Adams, C. W., D. E. Allison, K. Flagella, L. Presta, J. Clarke, N. Dybdal, K. McKeever, and M. X. Sliwkowski . 2006. Humanization of a recombinant monoclonal antibody to produce a therapeutic HER dimerization inhibitor, pertuzumab. Cancer Immunol. Immunother. 55 :717-727.

3. Agus, D. B., M. S. Gordon, C. Taylor, R. B. Natale, B. Karlan, D. S. Mendelson, M. F. Press, D. E. Allison, M. X. Sliwkowski, G. Lieberman, S. M. Kelsey, and G. Fyfe . 2005. Phase I clinical study of pertuzumab, a novel HER dimerization inhibitor, in patients with advanced cancer. J. Clin. Oncol. 23 :2534-2543.

4. Ai, L., Q. Tao, S. Zhong, C. R. Fields, W. J. Kim, M. W. Lee, Y. Cui, K. D. Brown, and K. D. Robertson . 2006. Inactivation of Wnt inhibitory factor-1 (WIF1) expression by epigenetic silencing is a common event in breast cancer. Carcinogenesis 27 :1341-1348.

5. Ako, E., Y. Yamashita, M. Ohira, M. Yamazaki, T. Hori, N. Kubo, T. Sawada, and K. Hirakawa . 2007. The pan-erbB tyrosine kinase inhibitor CI-1033 inhibits human esophageal cancer cells in vitro and in vivo. Oncol. Rep. 17 :887-893.

6. Alvarado, D., D. E. Klein, and M. A. Lemmon . 2009. ErbB2 resembles an autoinhibited invertebrate epidermal growth factor receptor. Nature 461 :287-291.

7. Anastasi, S., L. Fiorentino, M. Fiorini, R. Fraioli, G. Sala, L. Castellani, S. Alema, M. Alimandi, and O. Segatto . 2003. Feedback inhibition by RALT controls signal output by the ErbB network. Oncogene 22 :4221-4234.

8. aoui-Jamali, M. A., D. J. Song, N. Benlimame, L. Yen, X. Deng, M. Hernandez-Perez, and T. Wang . 2003. Regulation of multiple tumor microenvironment markers by overexpression of single or paired combinations of ErbB receptors. Cancer Res. 63 :3764-3774.

9. Azam, M., S. S. Andrabi, K. E. Sahr, L. Kamath, A. Kuliopulos, and A. H. Chishti . 2001. Disruption of the mouse mu-calpain gene reveals an essential role in platelet function. Mol. Cell Biol. 21 :2213-2220.

10. Azios, N. G., F. J. Romero, M. C. Denton, J. K. Doherty, and G. M. Clinton . 2001. Expression of herstatin, an autoinhibitor of HER-2/neu, inhibits transactivation of HER-3 by HER-2 and blocks EGF activation of the EGF receptor. Oncogene 20 :5199-5209.

11. Bai, X., D. Ma, A. Liu, X. Shen, Q. J. Wang, Y. Liu, and Y. Jiang . 2007. Rheb activates mTOR by antagonizing its endogenous inhibitor, FKBP38. Science 318 :977-980.

12. Balak, M. N., Y. Gong, G. J. Riely, R. Somwar, A. R. Li, M. F. Zakowski, A. Chiang, G. Yang, O. Ouerfelli, M. G. Kris, M. Ladanyi, V. A. Miller, and W. Pao . 2006. Novel D761Y and common secondary T790M mutations in epidermal growth factor receptor-mutant lung adenocarcinomas with acquired resistance to kinase inhibitors. Clin. Cancer Res. 12 :6494-6501.

13. Barrios-Rodiles, M., K. R. Brown, B. Ozdamar, R. Bose, Z. Liu, R. S. Donovan, F. Shinjo, Y. Liu, J. Dembowy, I. W. Taylor, V. Luga, N. Przulj, M. Robinson, H. Suzuki, Y. Hayashizaki, I. Jurisica, and J. L. Wrana . 2005. High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307 :1621-1625.

111

14. Baselga, J., L. Norton, J. Albanell, Y. M. Kim, and J. Mendelsohn . 1998. Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res. 58 :2825-2831.

15. Baselga, J. and S. M. Swain . 2009. Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat. Rev. Cancer 9:463-475.

16. Baulida, J., M. H. Kraus, M. Alimandi, P. P. Di Fiore, and G. Carpenter . 1996. All ErbB receptors other than the epidermal growth factor receptor are endocytosis impaired. J. Biol. Chem. 271 :5251-5257.

17. Blagoev, B., I. Kratchmarova, S. E. Ong, M. Nielsen, L. J. Foster, and M. Mann . 2003. A proteomics strategy to elucidate functional protein-protein interactions applied to EGF signaling. Nat. Biotechnol. 21 :315-318.

18. Boeri, E. E., R. Matthiesen, J. Bunkenborg, W. X. Schulze, S. P. Di, S. Cabodi, G. Tarone, P. Defilippi, and O. N. Jensen . 2007. Quantitation of multisite EGF receptor phosphorylation using mass spectrometry and a novel normalization approach. J. Proteome. Res. 6:2768-2785.

19. Bookout, A. L. and D. J. Mangelsdorf . 2003. Quantitative real-time PCR protocol for analysis of nuclear receptor signaling pathways. Nucl. Recept. Signal. 1:e012.

20. Bouyain, S., P. A. Longo, S. Li, K. M. Ferguson, and D. J. Leahy . 2005. The extracellular region of ErbB4 adopts a tethered conformation in the absence of ligand. Proc. Natl. Acad. Sci. U. S. A 102 :15024-15029.

21. Braun, P., M. Tasan, M. Dreze, M. Barrios-Rodiles, I. Lemmens, H. Yu, J. M. Sahalie, R. R. Murray, L. Roncari, A. S. de Smet, K. Venkatesan, J. F. Rual, J. Vandenhaute, M. E. Cusick, T. Pawson, D. E. Hill, J. Tavernier, J. L. Wrana, F. P. Roth, and M. Vidal . 2009. An experimentally derived confidence score for binary protein-protein interactions. Nat. Methods 6:91-97.

22. Brown, K. R. and I. Jurisica . 2005. Online predicted human interaction database. Bioinformatics. 21 :2076-2082.

23. Brown, K. R. and I. Jurisica . 2007. Unequal evolutionary conservation of human protein interactions in interologous networks. Genome Biol. 8:R95.

24. Brown, K. R., D. Otasek, M. Ali, M. J. McGuffin, W. Xie, B. Devani, I. L. Toch, and I. Jurisica . 2009. NAViGaTOR: Network Analysis, Visualization and Graphing Toronto. Bioinformatics. 25 :3327-3329.

25. Brown, S. P. and P. J. Hajduk . 2006. Effects of conformational dynamics on predicted protein druggability. ChemMedChem. 1:70-72.

26. Brunelle, J. K. and A. Letai . 2009. Control of mitochondrial apoptosis by the Bcl-2 family. J. Cell Sci. 122 :437-441.

27. Burton, T. R. and S. B. Gibson . 2009. The role of Bcl-2 family member BNIP3 in cell death and disease: NIPping at the heels of cell death. Cell Death. Differ. 16 :515-523.

28. Busti, S., E. Sacco, E. Martegani, and M. Vanoni . 2008. Functional coupling of the mammalian EGF receptor to the Ras/cAMP pathway in the yeast Saccharomyces cerevisiae. Curr. Genet. 53 :153-162.

112

29. Chazin, V. R., M. Kaleko, A. D. Miller, and D. J. Slamon . 1992. Transformation mediated by the human HER-2 gene independent of the epidermal growth factor receptor. Oncogene 7:1859- 1866.

30. Chen, G., J. Cizeau, V. C. Vande, J. H. Park, G. Bozek, J. Bolton, L. Shi, D. Dubik, and A. Greenberg . 1999. Nix and Nip3 form a subfamily of pro-apoptotic mitochondrial proteins. J. Biol. Chem. 274 :7-10.

31. Chen, Y. R., Y. N. Fu, C. H. Lin, S. T. Yang, S. F. Hu, Y. T. Chen, S. F. Tsai, and S. F. Huang . 2006. Distinctive activation patterns in constitutively active and gefitinib-sensitive EGFR mutants. Oncogene 25 :1205-1215.

32. Cho, H. S., K. Mason, K. X. Ramyar, A. M. Stanley, S. B. Gabelli, D. W. Denney, Jr., and D. J. Leahy . 2003. Structure of the extracellular region of HER2 alone and in complex with the Herceptin Fab. Nature 421 :756-760.

33. Choi, J. H., S. H. Ryu, and P. G. Suh . 2007. On/off-regulation of phospholipase C-gamma 1- mediated signal transduction. Adv. Enzyme Regul. 47 :104-116.

34. Citri, A., B. S. Kochupurakkal, and Y. Yarden . 2004. The achilles heel of ErbB-2/HER2: regulation by the Hsp90 chaperone machine and potential for pharmacological intervention. Cell Cycle 3:51-60.

35. Clayton, A. H., M. L. Tavarnesi, and T. G. Johns . 2007. Unligated epidermal growth factor receptor forms higher order oligomers within microclusters on A431 cells that are sensitive to tyrosine kinase inhibitor binding. Biochemistry 46 :4589-4597.

36. Clayton, A. H., F. Walker, S. G. Orchard, C. Henderson, D. Fuchs, J. Rothacker, E. C. Nice, and A. W. Burgess . 2005. Ligand-induced dimer-tetramer transition during the activation of the cell surface epidermal growth factor receptor-A multidimensional microscopy analysis. J. Biol. Chem. 280 :30392-30399.

37. Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease. Cell 127 :469-480.

38. Clynes, R. A., T. L. Towers, L. G. Presta, and J. V. Ravetch . 2000. Inhibitory Fc receptors modulate in vivo cytoxicity against tumor targets. Nat. Med. 6:443-446.

39. COHEN, S. 1962. Isolation of a mouse submaxillary gland protein accelerating incisor eruption and eyelid opening in the new-born animal. J. Biol. Chem. 237 :1555-1562.

40. Cooper, M. A. 2002. Optical biosensors in drug discovery. Nat. Rev. Drug Discov. 1:515-528.

41. Dahia, P. L. 2000. PTEN, a unique tumor suppressor gene. Endocr. Relat Cancer 7:115-129.

42. Dai, Q., Y. H. Ling, M. Lia, Y. Y. Zou, G. Kroog, K. K. Iwata, and R. Perez-Soler . 2005. Enhanced sensitivity to the HER1/epidermal growth factor receptor tyrosine kinase inhibitor erlotinib hydrochloride in chemotherapy-resistant tumor cell lines. Clin. Cancer Res. 11 :1572- 1578.

43. de Ruijter, A. J., A. H. van Gennip, H. N. Caron, S. Kemp, and A. B. van Kuilenburg . 2003. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem. J. 370 :737-749.

113

44. Decker, S. J. 1990. Epidermal growth factor and transforming growth factor-alpha induce differential processing of the epidermal growth factor receptor. Biochem. Biophys. Res. Commun. 166 :615-621.

45. Dejmek, J., K. Leandersson, J. Manjer, A. Bjartell, S. O. Emdin, W. F. Vogel, G. Landberg, and T. Andersson . 2005. Expression and signaling activity of Wnt-5a/discoidin domain receptor- 1 and Syk plays distinct but decisive roles in breast cancer patient survival. Clin. Cancer Res. 11 :520-528.

46. Deribe, Y. L., P. Wild, A. Chandrashaker, J. Curak, M. H. Schmidt, Y. Kalaidzidis, N. Milutinovic, I. Kratchmarova, L. Buerkle, M. J. Fetchko, P. Schmidt, S. Kittanakom, K. R. Brown, I. Jurisica, B. Blagoev, M. Zerial, I. Stagljar, and I. Dikic . 2009. Regulation of epidermal growth factor receptor trafficking by lysine deacetylase HDAC6. Sci. Signal. 2:ra84.

47. Di Fiore, P. P., J. H. Pierce, M. H. Kraus, O. Segatto, C. R. King, and S. A. Aaronson . 1987. erbB-2 is a potent oncogene when overexpressed in NIH/3T3 cells. Science 237 :178-182.

48. Dikic, I., I. Szymkiewicz, and P. Soubeyran . 2003. Cbl signaling networks in the regulation of cell function. Cell Mol. Life Sci. 60 :1805-1827.

49. Dompierre, J. P., J. D. Godin, B. C. Charrin, F. P. Cordelieres, S. J. King, S. Humbert, and F. Saudou . 2007. Histone deacetylase 6 inhibition compensates for the transport deficit in Huntington's disease by increasing tubulin acetylation. J. Neurosci. 27 :3571-3583.

50. Dourdin, N., B. Schade, R. Lesurf, M. Hallett, R. J. Munn, R. D. Cardiff, and W. J. Muller . 2008. Phosphatase and tensin homologue deleted on chromosome 10 deficiency accelerates tumor induction in a mouse model of ErbB-2 mammary tumorigenesis. Cancer Res. 68 :2122- 2131.

51. Downward, J., Y. Yarden, E. Mayes, G. Scrace, N. Totty, P. Stockwell, A. Ullrich, J. Schlessinger, and M. D. Waterfield . 1984. Close similarity of epidermal growth factor receptor and v-erb-B oncogene protein sequences. Nature 307 :521-527.

52. Ebner, R. and R. Derynck . 1991. Epidermal growth factor and transforming growth factor-alpha: differential intracellular routing and processing of ligand-receptor complexes. Cell Regul. 2:599- 612.

53. Ekstrand, A. J., N. Sugawa, C. D. James, and V. P. Collins . 1992. Amplified and rearranged epidermal growth factor receptor genes in human glioblastomas reveal deletions of sequences encoding portions of the N- and/or C-terminal tails. Proc. Natl. Acad. Sci. U. S. A 89 :4309-4313.

54. Engelman, J. A. 2009. Targeting PI3K signalling in cancer: opportunities, challenges and limitations. Nat. Rev. Cancer 9:550-562.

55. Fan, Y. X., L. Wong, J. Ding, N. A. Spiridonov, R. C. Johnson, and G. R. Johnson . 2008. Mutational activation of ErbB2 reveals a new protein kinase autoinhibition mechanism. J. Biol. Chem. 283 :1588-1596.

56. Firaguay, G. and J. A. Nunes . 2009. Analysis of signaling events by dynamic phosphoflow cytometry. Sci. Signal. 2:l3.

57. Ford, A. C. and J. R. Grandis . 2003. Targeting epidermal growth factor receptor in head and neck cancer. Head Neck 25 :67-73.

114

58. Francia, G., U. Emmenegger, C. R. Lee, Y. Shaked, C. Folkins, M. Mossoba, J. A. Medin, S. Man, Z. Zhu, L. Witte, and R. S. Kerbel . 2008. Long-term progression and therapeutic response of visceral metastatic disease non-invasively monitored in mouse urine using beta-human choriogonadotropin secreting tumor cell lines. Mol. Cancer Ther. 7:3452-3459.

59. Franklin, M. C., K. D. Carey, F. F. Vajdos, D. J. Leahy, A. M. de Vos, and M. X. Sliwkowski . 2004. Insights into ErbB signaling from the structure of the ErbB2-pertuzumab complex. Cancer Cell 5:317-328.

60. Garrett, T. P., N. M. McKern, M. Lou, T. C. Elleman, T. E. Adams, G. O. Lovrecz, M. Kofler, R. N. Jorissen, E. C. Nice, A. W. Burgess, and C. W. Ward . 2003. The crystal structure of a truncated ErbB2 ectodomain reveals an active conformation, poised to interact with other ErbB receptors. Mol. Cell 11 :495-505.

61. Gassmann, M., F. Casagranda, D. Orioli, H. Simon, C. Lai, R. Klein, and G. Lemke . 1995. Aberrant neural and cardiac development in mice lacking the ErbB4 neuregulin receptor. Nature 378 :390-394.

62. Gietz, R. D. and R. A. Woods . 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350 :87-96.

63. Giltnane, J. M., C. B. Moeder, R. L. Camp, and D. L. Rimm . 2009. Quantitative multiplexed analysis of ErbB family coexpression for primary breast cancer prognosis in a large retrospective cohort. Cancer 115 :2400-2409.

64. Gnad, F., L. M. de Godoy, J. Cox, N. Neuhauser, S. Ren, J. V. Olsen, and M. Mann . 2009. High-accuracy identification and bioinformatic analysis of in vivo protein phosphorylation sites in yeast. Proteomics. 9:4642-4652.

65. Graus-Porta, D., R. R. Beerli, J. M. Daly, and N. E. Hynes . 1997. ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. EMBO J. 16 :1647-1655.

66. Gruhler, A., J. V. Olsen, S. Mohammed, P. Mortensen, N. J. Faergeman, M. Mann, and O. N. Jensen . 2005. Quantitative phosphoproteomics applied to the yeast pheromone signaling pathway. Mol. Cell Proteomics. 4:310-327.

67. Gullick, W. J., M. S. Berger, P. L. Bennett, J. B. Rothbard, and M. D. Waterfield . 1987. Expression of the c-erbB-2 protein in normal and transformed cells. Int. J. Cancer 40 :246-254.

68. Haj, F. G., P. J. Verveer, A. Squire, B. G. Neel, and P. I. Bastiaens . 2002. Imaging sites of receptor dephosphorylation by PTP1B on the surface of the endoplasmic reticulum. Science 295 :1708-1711.

69. Hanafusa, H., S. Torii, T. Yasunaga, and E. Nishida. 2002. Sprouty1 and Sprouty2 provide a control mechanism for the Ras/MAPK signalling pathway. Nat. Cell Biol. 4:850-858.

70. Heinzelmann-Schwarz, V. A., M. Gardiner-Garden, S. M. Henshall, J. Scurry, R. A. Scolyer, M. J. Davies, M. Heinzelmann, L. H. Kalish, A. Bali, J. G. Kench, L. S. Edwards, P. M. Vanden Bergh, N. F. Hacker, R. L. Sutherland, and P. M. O'Brien . 2004. Overexpression of the cell adhesion molecules DDR1, Claudin 3, and Ep-CAM in metaplastic ovarian epithelium and ovarian cancer. Clin. Cancer Res. 10 :4427-4436.

71. Hidalgo, M., L. L. Siu, J. Nemunaitis, J. Rizzo, L. A. Hammond, C. Takimoto, S. G. Eckhardt, A. Tolcher, C. D. Britten, L. Denis, K. Ferrante, D. D. Von Hoff, S. Silberman, and E. K.

115

Rowinsky . 2001. Phase I and pharmacologic study of OSI-774, an epidermal growth factor receptor tyrosine kinase inhibitor, in patients with advanced solid malignancies. J. Clin. Oncol. 19 :3267-3279.

72. Hsieh, J. C., L. Kodjabachian, M. L. Rebbert, A. Rattner, P. M. Smallwood, C. H. Samos, R. Nusse, I. B. Dawid, and J. Nathans . 1999. A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 398 :431-436.

73. Huang, F., D. Kirkpatrick, X. Jiang, S. Gygi, and A. Sorkin . 2006. Differential regulation of EGF receptor internalization and degradation by multiubiquitination within the kinase domain. Mol. Cell 21 :737-748.

74. Huang, S. M., J. M. Bock, and P. M. Harari . 1999. Epidermal growth factor receptor blockade with C225 modulates proliferation, apoptosis, and radiosensitivity in squamous cell carcinomas of the head and neck. Cancer Res. 59 :1935-1940.

75. Hughes, J. B., C. Berger, M. S. Rodland, M. Hasmann, E. Stang, and I. H. Madshus . 2009. Pertuzumab increases epidermal growth factor receptor down-regulation by counteracting epidermal growth factor receptor-ErbB2 heterodimerization. Mol. Cancer Ther. 8:1885-1892.

76. Huse, M. and J. Kuriyan . 2002. The conformational plasticity of protein kinases. Cell 109 :275- 282.

77. Huyer, G., S. Liu, J. Kelly, J. Moffat, P. Payette, B. Kennedy, G. Tsaprailis, M. J. Gresser, and C. Ramachandran . 1997. Mechanism of inhibition of protein-tyrosine phosphatases by vanadate and pervanadate. J. Biol. Chem. 272 :843-851.

78. Imazu, T., S. Shimizu, S. Tagami, M. Matsushima, Y. Nakamura, T. Miki, A. Okuyama, and Y. Tsujimoto . 1999. Bcl-2/E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl- 2/Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene 18 :4523-4529.

79. Iyer, K., L. Burkle, D. Auerbach, S. Thaminy, M. Dinkel, K. Engels, and I. Stagljar . 2005. Utilizing the split-ubiquitin membrane yeast two-hybrid system to identify protein-protein interactions of integral membrane proteins. Sci. STKE. 2005 :l3.

80. Johnsson, N. and A. Varshavsky . 1994. Split ubiquitin as a sensor of protein interactions in vivo. Proc. Natl. Acad. Sci. U. S. A 91 :10340-10344.

81. Johnsson, N. and A. Varshavsky . 1994. Ubiquitin-assisted dissection of protein transport across membranes. EMBO J. 13 :2686-2698.

82. Jones, R. B., A. Gordus, J. A. Krall, and G. MacBeath . 2006. A quantitative protein interaction network for the ErbB receptors using protein microarrays. Nature 439 :168-174.

83. Kani, K., C. M. Warren, C. S. Kaddis, J. A. Loo, and R. Landgraf . 2005. Oligomers of ERBB3 have two distinct interfaces that differ in their sensitivity to disruption by heregulin. J. Biol. Chem. 280 :8238-8247.

84. Karamouzis, M. V., F. A. Badra, and A. G. Papavassiliou . 2007. Breast cancer: the upgraded role of HER-3 and HER-4. Int. J. Biochem. Cell Biol. 39 :851-856.

85. Karlsson, O. P. and S. Lofas . 2002. Flow-mediated on-surface reconstitution of G-protein coupled receptors for applications in surface plasmon resonance biosensors. Anal. Biochem. 300 :132-138.

116

86. Katsube, M., T. Kato, M. Kitagawa, H. Noma, H. Fujita, and S. Kitagawa . 2008. Calpain- mediated regulation of the distinct signaling pathways and cell migration in human neutrophils. J. Leukoc. Biol. 84 :255-263.

87. Kawakami, K., H. Hirata, S. Yamamura, N. Kikuno, S. Saini, S. Majid, Y. Tanaka, K. Kawamoto, H. Enokida, M. Nakagawa, and R. Dahiya . 2009. Functional significance of Wnt inhibitory factor-1 gene in kidney cancer. Cancer Res. 69 :8603-8610.

88. Kedrin, D., J. Wyckoff, P. J. Boimel, S. J. Coniglio, N. E. Hynes, C. L. Arteaga, and J. E. Segall . 2009. ERBB1 and ERBB2 have distinct functions in tumor cell invasion and intravasation. Clin. Cancer Res. 15 :3733-3739.

89. King, C. R., M. H. Kraus, and S. A. Aaronson . 1985. Amplification of a novel v-erbB-related gene in a human mammary carcinoma. Science 229 :974-976.

90. Konecny, G. E., M. D. Pegram, N. Venkatesan, R. Finn, G. Yang, M. Rahmeh, M. Untch, D. W. Rusnak, G. Spehar, R. J. Mullin, B. R. Keith, T. M. Gilmer, M. Berger, K. C. Podratz, and D. J. Slamon . 2006. Activity of the dual kinase inhibitor lapatinib (GW572016) against HER-2- overexpressing and trastuzumab-treated breast cancer cells. Cancer Res. 66 :1630-1639.

91. Lam, P. B., L. N. Burga, B. P. Wu, E. W. Hofstatter, K. P. Lu, and G. M. Wulf . 2008. Prolyl isomerase Pin1 is highly expressed in Her2-positive breast cancer and regulates erbB2 protein stability. Mol. Cancer 7:91.

92. Lamesch, P., N. Li, S. Milstein, C. Fan, T. Hao, G. Szabo, Z. Hu, K. Venkatesan, G. Bethel, P. Martin, J. Rogers, S. Lawlor, S. McLaren, A. Dricot, H. Borick, M. E. Cusick, J. Vandenhaute, I. Dunham, D. E. Hill, and M. Vidal . 2007. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics 89 :307-315.

93. Laughner, E., P. Taghavi, K. Chiles, P. C. Mahon, and G. L. Semenza . 2001. HER2 (neu) signaling increases the rate of hypoxia-inducible factor 1alpha (HIF-1alpha) synthesis: novel mechanism for HIF-1-mediated vascular endothelial growth factor expression. Mol. Cell Biol. 21 :3995-4004.

94. Lee, H., R. W. Akita, M. X. Sliwkowski, and N. J. Maihle . 2001. A naturally occurring secreted human ErbB3 receptor isoform inhibits heregulin-stimulated activation of ErbB2, ErbB3, and ErbB4. Cancer Res. 61 :4467-4473.

95. Lee, K. F., H. Simon, H. Chen, B. Bates, M. C. Hung, and C. Hauser . 1995. Requirement for neuregulin receptor erbB2 in neural and cardiac development. Nature 378 :394-398.

96. Lee-Hoeflich, S. T., L. Crocker, E. Yao, T. Pham, X. Munroe, K. P. Hoeflich, M. X. Sliwkowski, and H. M. Stern . 2008. A central role for HER3 in HER2-amplified breast cancer: implications for targeted therapy. Cancer Res. 68 :5878-5887.

97. Lemmon, M. A. and J. Schlessinger . 1994. Regulation of signal transduction and signal diversity by receptor oligomerization. Trends Biochem. Sci. 19 :459-463.

98. Lenferink, A. E., R. Pinkas-Kramarski, M. L. van de Poll, M. J. van Vugt, L. N. Klapper, E. Tzahar, H. Waterman, M. Sela, E. J. van Zoelen, and Y. Yarden . 1998. Differential endocytic routing of homo- and hetero-dimeric ErbB tyrosine kinases confers signaling superiority to receptor heterodimers. EMBO J. 17 :3385-3397.

99. Levkowitz, G., H. Waterman, S. A. Ettenberg, M. Katz, A. Y. Tsygankov, I. Alroy, S. Lavi, K. Iwai, Y. Reiss, A. Ciechanover, S. Lipkowitz, and Y. Yarden . 1999. Ubiquitin ligase activity and

117

tyrosine phosphorylation underlie suppression of growth factor signaling by c-Cbl/Sli-1. Mol. Cell 4:1029-1040.

100. Li, Y., Y. Wang, E. Kim, P. Beemiller, C. Y. Wang, J. Swanson, M. You, and K. L. Guan . 2007. Bnip3 mediates the hypoxia-induced inhibition on mammalian target of rapamycin by interacting with Rheb. J. Biol. Chem. 282 :35803-35813.

101. Linding, R., L. J. Jensen, A. Pasculescu, M. Olhovsky, K. Colwill, P. Bork, M. B. Yaffe, and T. Pawson . 2008. NetworKIN: a resource for exploring cellular phosphorylation networks. Nucleic Acids Res. 36 :D695-D699.

102. Liu, J., J. D. Farmer, Jr., W. S. Lane, J. Friedman, I. Weissman, and S. L. Schreiber . 1991. Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 66 :807-815.

103. Lomonosova, E. and G. Chinnadurai . 2008. BH3-only proteins in apoptosis and beyond: an overview. Oncogene 27 Suppl 1 :S2-19.

104. Longva, K. E., N. M. Pedersen, C. Haslekas, E. Stang, and I. H. Madshus . 2005. Herceptin- induced inhibition of ErbB2 signaling involves reduced phosphorylation of Akt but not endocytic down-regulation of ErbB2. Int. J. Cancer 116 :359-367.

105. Lopez-Ilasaca, M., C. Schiene, G. Kullertz, T. Tradler, G. Fischer, and R. Wetzker . 1998. Effects of FK506-binding protein 12 and FK506 on autophosphorylation of epidermal growth factor receptor. J. Biol. Chem. 273 :9430-9434.

106. Lu, K. P., Y. C. Liou, and X. Z. Zhou . 2002. Pinning down proline-directed phosphorylation signaling. Trends Cell Biol. 12 :164-172.

107. Mackay, A., C. Jones, T. Dexter, R. L. Silva, K. Bulmer, A. Jones, P. Simpson, R. A. Harris, P. S. Jat, A. M. Neville, L. F. Reis, S. R. Lakhani, and M. J. O'Hare . 2003. cDNA microarray analysis of genes associated with ERBB2 (HER2/neu) overexpression in human mammary luminal epithelial cells. Oncogene 22 :2680-2688.

108. Mendrola, J. M., M. B. Berger, M. C. King, and M. A. Lemmon . 2002. The single transmembrane domains of ErbB receptors self-associate in cell membranes. J. Biol. Chem. 277 :4704-4712.

109. Miettinen, P. J., J. E. Berger, J. Meneses, Y. Phung, R. A. Pedersen, Z. Werb, and R. Derynck . 1995. Epithelial immaturity and multiorgan failure in mice lacking epidermal growth factor receptor. Nature 376 :337-341.

110. Mimnaugh, E. G., C. Chavany, and L. Neckers . 1996. Polyubiquitination and proteasomal degradation of the p185c-erbB-2 receptor protein-tyrosine kinase induced by geldanamycin. J. Biol. Chem. 271 :22796-22801.

111. Moffat, J., D. A. Grueneberg, X. Yang, S. Y. Kim, A. M. Kloepfer, G. Hinkle, B. Piqani, T. M. Eisenhaure, B. Luo, J. K. Grenier, A. E. Carpenter, S. Y. Foo, S. A. Stewart, B. R. Stockwell, N. Hacohen, W. C. Hahn, E. S. Lander, D. M. Sabatini, and D. E. Root . 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124:1283-1298.

112. Moriki, T., H. Maruyama, and I. N. Maruyama . 2001. Activation of preformed EGF receptor dimers by ligand-induced rotation of the transmembrane domain. J. Mol. Biol. 311 :1011-1026.

118

113. Moyer, J. D., E. G. Barbacci, K. K. Iwata, L. Arnold, B. Boman, A. Cunningham, C. DiOrio, J. Doty, M. J. Morin, M. P. Moyer, M. Neveu, V. A. Pollack, L. R. Pustilnik, M. M. Reynolds, D. Sloan, A. Theleman, and P. Miller . 1997. Induction of apoptosis and cell cycle arrest by CP- 358,774, an inhibitor of epidermal growth factor receptor tyrosine kinase. Cancer Res. 57 :4838- 4848.

114. Nagy, P., A. Jenei, A. K. Kirsch, J. Szollosi, S. Damjanovich, and T. M. Jovin . 1999. Activation-dependent clustering of the erbB2 receptor tyrosine kinase detected by scanning near- field optical microscopy. J. Cell Sci. 112 ( Pt 11) :1733-1741.

115. Nakagawa, K., T. Tamura, S. Negoro, S. Kudoh, N. Yamamoto, N. Yamamoto, K. Takeda, H. Swaisland, I. Nakatani, M. Hirose, R. P. Dong, and M. Fukuoka . 2003. Phase I pharmacokinetic trial of the selective oral epidermal growth factor receptor tyrosine kinase inhibitor gefitinib ('Iressa', ZD1839) in Japanese patients with solid malignant tumors. Ann. Oncol. 14 :922-930.

116. Ni, C. Y., M. P. Murphy, T. E. Golde, and G. Carpenter . 2001. gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294 :2179-2181.

117. Nunes, M., C. Shi, and L. M. Greenberger . 2004. Phosphorylation of extracellular signal- regulated kinase 1 and 2, protein kinase B, and signal transducer and activator of transcription 3 are differently inhibited by an epidermal growth factor receptor inhibitor, EKB-569, in tumor cells and normal human keratinocytes. Mol. Cancer Ther. 3:21-27.

118. Nyfeler, B., S. W. Michnick, and H. P. Hauri . 2005. Capturing protein interactions in the secretory pathway of living cells. Proc. Natl. Acad. Sci. U. S. A 102 :6350-6355.

119. Ohigashi, T., R. Mizuno, J. Nakashima, K. Marumo, and M. Murai . 2005. Inhibition of Wnt signaling downregulates Akt activity and induces chemosensitivity in PTEN-mutated prostate cancer cells. Prostate 62 :61-68.

120. Omerovic, J., L. Santangelo, E. M. Puggioni, J. Marrocco, C. Dall'Armi, C. Palumbo, F. Belleudi, M. L. Di, L. Frati, M. R. Torrisi, G. Cesareni, A. Gulino, and M. Alimandi . 2007. The E3 ligase Aip4/Itch ubiquitinates and targets ErbB-4 for degradation. FASEB J. 21 :2849-2862.

121. Overholser, J. P., M. C. Prewett, A. T. Hooper, H. W. Waksal, and D. J. Hicklin . 2000. Epidermal growth factor receptor blockade by antibody IMC-C225 inhibits growth of a human pancreatic carcinoma xenograft in nude mice. Cancer 89 :74-82.

122. Pan, C., F. Gnad, J. V. Olsen, and M. Mann . 2008. Quantitative phosphoproteome analysis of a mouse liver cell line reveals specificity of phosphatase inhibitors. Proteomics. 8:4534-4546.

123. Pao, W., V. Miller, M. Zakowski, J. Doherty, K. Politi, I. Sarkaria, B. Singh, R. Heelan, V. Rusch, L. Fulton, E. Mardis, D. Kupfer, R. Wilson, M. Kris, and H. Varmus . 2004. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc. Natl. Acad. Sci. U. S. A 101 :13306- 13311.

124. Patthy, L. 2000. The WIF module. Trends Biochem. Sci. 25 :12-13.

125. Paumi, C. M., J. Menendez, A. Arnoldo, K. Engels, K. R. Iyer, S. Thaminy, O. Georgiev, Y. Barral, S. Michaelis, and I. Stagljar . 2007. Mapping protein-protein interactions for the yeast ABC transporter Ycf1p by integrated split-ubiquitin membrane yeast two-hybrid analysis. Mol. Cell 26 :15-25.

119

126. Pegram, M. D., A. Lipton, D. F. Hayes, B. L. Weber, J. M. Baselga, D. Tripathy, D. Baly, S. A. Baughman, T. Twaddell, J. A. Glaspy, and D. J. Slamon . 1998. Phase II study of receptor- enhanced chemosensitivity using recombinant humanized anti-p185HER2/neu monoclonal antibody plus cisplatin in patients with HER2/neu-overexpressing metastatic breast cancer refractory to chemotherapy treatment. J. Clin. Oncol. 16 :2659-2671.

127. Pinkas-Kramarski, R., L. Soussan, H. Waterman, G. Levkowitz, I. Alroy, L. Klapper, S. Lavi, R. Seger, B. J. Ratzkin, M. Sela, and Y. Yarden . 1996. Diversification of Neu differentiation factor and epidermal growth factor signaling by combinatorial receptor interactions. EMBO J. 15 :2452-2467.

128. Plowman, G. D., S. Sudarsanam, J. Bingham, D. Whyte, and T. Hunter . 1999. The protein kinases of Caenorhabditis elegans: a model for signal transduction in multicellular organisms. Proc. Natl. Acad. Sci. U. S. A 96 :13603-13610.

129. Pollack, V. A., D. M. Savage, D. A. Baker, K. E. Tsaparikos, D. E. Sloan, J. D. Moyer, E. G. Barbacci, L. R. Pustilnik, T. A. Smolarek, J. A. Davis, M. P. Vaidya, L. D. Arnold, J. L. Doty, K. K. Iwata, and M. J. Morin . 1999. Inhibition of epidermal growth factor receptor-associated tyrosine phosphorylation in human carcinomas with CP-358,774: dynamics of receptor inhibition in situ and antitumor effects in athymic mice. J. Pharmacol. Exp. Ther. 291 :739-748.

130. Prewett, M., P. Rockwell, R. F. Rockwell, N. A. Giorgio, J. Mendelsohn, H. I. Scher, and N. I. Goldstein . 1996. The biologic effects of C225, a chimeric monoclonal antibody to the EGFR, on human prostate carcinoma. J. Immunother. Emphasis. Tumor Immunol. 19 :419-427.

131. Prewett, M., M. Rothman, H. Waksal, M. Feldman, N. H. Bander, and D. J. Hicklin . 1998. Mouse-human chimeric anti-epidermal growth factor receptor antibody C225 inhibits the growth of human renal cell carcinoma xenografts in nude mice. Clin. Cancer Res. 4:2957-2966.

132. Provinciali, M., F. Re, A. Donnini, F. Orlando, B. Bartozzi, S. G. Di, and A. Smorlesi . 2005. Effect of resveratrol on the development of spontaneous mammary tumors in HER-2/neu transgenic mice. Int. J. Cancer 115 :36-45.

133. Qiu, X. B. and A. L. Goldberg . 2002. Nrdp1/FLRF is a ubiquitin ligase promoting ubiquitination and degradation of the epidermal growth factor receptor family member, ErbB3. Proc. Natl. Acad. Sci. U. S. A 99 :14843-14848.

134. Quesnelle, K. M., A. L. Boehm, and J. R. Grandis . 2007. STAT-mediated EGFR signaling in cancer. J. Cell Biochem. 102 :311-319.

135. Ram, R., G. Lorente, K. Nikolich, R. Urfer, E. Foehr, and U. Nagavarapu . 2006. Discoidin domain receptor-1a (DDR1a) promotes glioma cell invasion and adhesion in association with matrix metalloproteinase-2. J. Neurooncol. 76 :239-248.

136. Ramachandran, N., J. V. Raphael, E. Hainsworth, G. Demirkan, M. G. Fuentes, A. Rolfs, Y. Hu, and J. LaBaer . 2008. Next-generation high-density self-assembling functional protein arrays. Nat. Methods 5:535-538.

137. Ray, R., G. Chen, V. C. Vande, J. Cizeau, J. H. Park, J. C. Reed, R. D. Gietz, and A. H. Greenberg . 2000. BNIP3 heterodimerizes with Bcl-2/Bcl-X(L) and induces cell death independent of a Bcl-2 homology 3 (BH3) domain at both mitochondrial and nonmitochondrial sites. J. Biol. Chem. 275 :1439-1448.

138. Reed, N. A., D. Cai, T. L. Blasius, G. T. Jih, E. Meyhofer, J. Gaertig, and K. J. Verhey . 2006. Microtubule acetylation promotes kinesin-1 binding and transport. Curr. Biol. 16 :2166-2172.

120

139. Riese, D. J., R. M. Gallo, and J. Settleman . 2007. Mutational activation of ErbB family receptor tyrosine kinases: insights into mechanisms of signal transduction and tumorigenesis. Bioessays 29 :558-565.

140. Riese, D. J., T. M. van Raaij, G. D. Plowman, G. C. Andrews, and D. F. Stern . 1995. The cellular response to neuregulins is governed by complex interactions of the erbB receptor family. Mol. Cell Biol. 15 :5770-5776.

141. Riethmacher, D., E. Sonnenberg-Riethmacher, V. Brinkmann, T. Yamaai, G. R. Lewin, and C. Birchmeier . 1997. Severe neuropathies in mice with targeted mutations in the ErbB3 receptor. Nature 389 :725-730.

142. Rio, C., J. D. Buxbaum, J. J. Peschon, and G. Corfas . 2000. Tumor necrosis factor-alpha- converting enzyme is required for cleavage of erbB4/HER4. J. Biol. Chem. 275 :10379-10387.

143. Robbins, M. J., D. Michalovich, J. Hill, A. R. Calver, A. D. Medhurst, I. Gloger, M. Sims, D. N. Middlemiss, and M. N. Pangalos . 2000. Molecular cloning and characterization of two novel retinoic acid-inducible orphan G-protein-coupled receptors (GPRC5B and GPRC5C). Genomics 67 :8-18.

144. Robinson, D. R., Y. M. Wu, and S. F. Lin . 2000. The protein tyrosine kinase family of the human genome. Oncogene 19 :5548-5557.

145. Ross, J. S., J. A. Fletcher, G. P. Linette, J. Stec, E. Clark, M. Ayers, W. F. Symmans, L. Pusztai, and K. J. Bloom . 2003. The Her-2/neu gene and protein in breast cancer 2003: biomarker and target of therapy. Oncologist. 8:307-325.

146. Rusnak, D. W., K. J. Alligood, R. J. Mullin, G. M. Spehar, C. renas-Elliott, A. M. Martin, Y. Degenhardt, S. K. Rudolph, T. F. Haws, Jr., B. L. Hudson-Curtis, and T. M. Gilmer . 2007. Assessment of epidermal growth factor receptor (EGFR, ErbB1) and HER2 (ErbB2) protein expression levels and response to lapatinib (Tykerb, GW572016) in an expanded panel of human normal and tumour cell lines. Cell Prolif. 40 :580-594.

147. Rusnak, D. W., K. Lackey, K. Affleck, E. R. Wood, K. J. Alligood, N. Rhodes, B. R. Keith, D. M. Murray, W. B. Knight, R. J. Mullin, and T. M. Gilmer . 2001. The effects of the novel, reversible epidermal growth factor receptor/ErbB-2 tyrosine kinase inhibitor, GW2016, on the growth of human normal and tumor-derived cell lines in vitro and in vivo. Mol. Cancer Ther. 1:85- 94.

148. Rutherford, S. L. and S. Lindquist . 1998. Hsp90 as a capacitor for morphological evolution. Nature 396 :336-342.

149. Ryo, A., Y. C. Liou, G. Wulf, M. Nakamura, S. W. Lee, and K. P. Lu . 2002. PIN1 is an E2F target gene essential for Neu/Ras-induced transformation of mammary epithelial cells. Mol. Cell Biol. 22 :5281-5295.

150. Ryo, A., F. Suizu, Y. Yoshida, K. Perrem, Y. C. Liou, G. Wulf, R. Rottapel, S. Yamaoka, and K. P. Lu . 2003. Regulation of NF-kappaB signaling by Pin1-dependent prolyl isomerization and ubiquitin-mediated proteolysis of p65/RelA. Mol. Cell 12 :1413-1426.

151. Sarup, J. C., R. M. Johnson, K. L. King, B. M. Fendly, M. T. Lipari, M. A. Napier, A. Ullrich, and H. M. Shepard . 1991. Characterization of an anti-p185HER2 monoclonal antibody that stimulates receptor function and inhibits tumor cell growth. Growth Regul. 1:72-82.

121

152. Schafer, B., A. Gschwind, and A. Ullrich . 2004. Multiple G-protein-coupled receptor signals converge on the epidermal growth factor receptor to promote migration and invasion. Oncogene 23 :991-999.

153. Schlessinger, J. 2002. Ligand-induced, receptor-mediated dimerization and activation of EGF receptor. Cell 110 :669-672.

154. Schreiber, S. L. and G. R. Crabtree . 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today 13 :136-142.

155. Schulze, A., K. Lehmann, H. B. Jefferies, M. McMahon, and J. Downward . 2001. Analysis of the transcriptional program induced by Raf in epithelial cells. Genes Dev. 15 :981-994.

156. Schulze, W. X., L. Deng, and M. Mann . 2005. Phosphotyrosine interactome of the ErbB-receptor kinase family. Mol. Syst. Biol. 1:2005.

157. Sergina, N. V., M. Rausch, D. Wang, J. Blair, B. Hann, K. M. Shokat, and M. M. Moasser . 2007. Escape from HER-family tyrosine kinase inhibitor therapy by the kinase-inactive HER3. Nature 445 :437-441.

158. Shelly, M., R. Pinkas-Kramarski, B. C. Guarino, H. Waterman, L. M. Wang, L. Lyass, M. Alimandi, A. Kuo, S. S. Bacus, J. H. Pierce, G. C. Andrews, and Y. Yarden . 1998. Epiregulin is a potent pan-ErbB ligand that preferentially activates heterodimeric receptor complexes. J. Biol. Chem. 273 :10496-10505.

159. Shirane, M. and K. I. Nakayama . 2003. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria and inhibits apoptosis. Nat. Cell Biol. 5:28-37.

160. Sibilia, M. and E. F. Wagner . 1995. Strain-dependent epithelial defects in mice lacking the EGF receptor. Science 269 :234-238.

161. Sierke, S. L., K. Cheng, H. H. Kim, and J. G. Koland . 1997. Biochemical characterization of the protein tyrosine kinase homology domain of the ErbB3 (HER3) receptor protein. Biochem. J. 322 ( Pt 3) :757-763.

162. Slamon, D. J., G. M. Clark, S. G. Wong, W. J. Levin, A. Ullrich, and W. L. McGuire . 1987. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235 :177-182.

163. Slamon, D. J., W. Godolphin, L. A. Jones, J. A. Holt, S. G. Wong, D. E. Keith, W. J. Levin, S. G. Stuart, J. Udove, A. Ullrich, and . 1989. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244 :707-712.

164. Stagljar, I., C. Korostensky, N. Johnsson, and H. S. te . 1998. A genetic system based on split- ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc. Natl. Acad. Sci. U. S. A 95 :5187-5192.

165. Stein, R. A. and J. V. Staros . 2000. Evolutionary analysis of the ErbB receptor and ligand families. J. Mol. Evol. 50 :397-412.

166. Su, A. I., T. Wiltshire, S. Batalov, H. Lapp, K. A. Ching, D. Block, J. Zhang, R. Soden, M. Hayakawa, G. Kreiman, M. P. Cooke, J. R. Walker, and J. B. Hogenesch . 2004. A gene atlas of the mouse and human protein-encoding transcriptomes. Proc. Natl. Acad. Sci. U. S. A 101 :6062-6067.

122

167. Suzuki, H., M. Toyota, H. Carraway, E. Gabrielson, T. Ohmura, T. Fujikane, N. Nishikawa, Y. Sogabe, M. Nojima, T. Sonoda, M. Mori, K. Hirata, K. Imai, Y. Shinomura, S. B. Baylin, and T. Tokino . 2008. Frequent epigenetic inactivation of Wnt antagonist genes in breast cancer. Br. J. Cancer 98 :1147-1156.

168. Sweeney, C., C. Lai, D. J. Riese, A. J. Diamonti, L. C. Cantley, and K. L. Carraway, III . 2000. Ligand discrimination in signaling through an ErbB4 receptor homodimer. J. Biol. Chem. 275 :19803-19807.

169. Tateishi, M., T. Ishida, T. Mitsudomi, S. Kaneko, and K. Sugimachi . 1990. Immunohistochemical evidence of autocrine growth factors in adenocarcinoma of the human lung. Cancer Res. 50 :7077-7080.

170. Threadgill, D. W., A. A. Dlugosz, L. A. Hansen, T. Tennenbaum, U. Lichti, D. Yee, C. LaMantia, T. Mourton, K. Herrup, R. C. Harris, and . 1995. Targeted disruption of mouse EGF receptor: effect of genetic background on mutant phenotype. Science 269 :230-234.

171. Tong, A. H., M. Evangelista, A. B. Parsons, H. Xu, G. D. Bader, N. Page, M. Robinson, S. Raghibizadeh, C. W. Hogue, H. Bussey, B. Andrews, M. Tyers, and C. Boone . 2001. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294 :2364- 2368.

172. Tong, A. H., G. Lesage, G. D. Bader, H. Ding, H. Xu, X. Xin, J. Young, G. F. Berriz, R. L. Brost, M. Chang, Y. Chen, X. Cheng, G. Chua, H. Friesen, D. S. Goldberg, J. Haynes, C. Humphries, G. He, S. Hussein, L. Ke, N. Krogan, Z. Li, J. N. Levinson, H. Lu, P. Menard, C. Munyana, A. B. Parsons, O. Ryan, R. Tonikian, T. Roberts, A. M. Sdicu, J. Shapiro, B. Sheikh, B. Suter, S. L. Wong, L. V. Zhang, H. Zhu, C. G. Burd, S. Munro, C. Sander, J. Rine, J. Greenblatt, M. Peter, A. Bretscher, G. Bell, F. P. Roth, G. W. Brown, B. Andrews, H. Bussey, and C. Boone . 2004. Global mapping of the yeast genetic interaction network. Science 303 :808-813.

173. Torres, M. A., J. A. Yang-Snyder, S. M. Purcell, A. A. DeMarais, L. L. McGrew, and R. T. Moon . 1996. Activities of the Wnt-1 class of secreted signaling factors are antagonized by the Wnt-5A class and by a dominant negative cadherin in early Xenopus development. J. Cell Biol. 133 :1123-1137.

174. Tvorogov, D., M. Sundvall, K. Kurppa, M. Hollmen, S. Repo, M. S. Johnson, and K. Elenius . 2009. Somatic mutations of ErbB4: selective loss-of-function phenotype affecting signal transduction pathways in cancer. J. Biol. Chem. 284 :5582-5591.

175. Tzahar, E., J. D. Moyer, H. Waterman, E. G. Barbacci, J. Bao, G. Levkowitz, M. Shelly, S. Strano, R. Pinkas-Kramarski, J. H. Pierce, G. C. Andrews, and Y. Yarden . 1998. Pathogenic poxviruses reveal viral strategies to exploit the ErbB signaling network. EMBO J. 17 :5948-5963.

176. Tzahar, E., H. Waterman, X. Chen, G. Levkowitz, D. Karunagaran, S. Lavi, B. J. Ratzkin, and Y. Yarden . 1996. A hierarchical network of interreceptor interactions determines signal transduction by Neu differentiation factor/neuregulin and epidermal growth factor. Mol. Cell Biol. 16 :5276-5287.

177. Vogel, W. F. 2002. Ligand-induced shedding of discoidin domain receptor 1. FEBS Lett. 514 :175- 180.

178. von, M. C., R. Krause, B. Snel, M. Cornell, S. G. Oliver, S. Fields, and P. Bork . 2002. Comparative assessment of large-scale data sets of protein-protein interactions. Nature 417 :399- 403.

123

179. Wallasch, C., F. U. Weiss, G. Niederfellner, B. Jallal, W. Issing, and A. Ullrich . 1995. Heregulin-dependent regulation of HER2/neu oncogenic signaling by heterodimerization with HER3. EMBO J. 14 :4267-4275.

180. Wang, T., P. K. Donahoe, and A. S. Zervos . 1994. Specific interaction of type I receptors of the TGF-beta family with the immunophilin FKBP-12. Science 265 :674-676.

181. Waterman, H., I. Sabanai, B. Geiger, and Y. Yarden . 1998. Alternative intracellular routing of ErbB receptors may determine signaling potency. J. Biol. Chem. 273 :13819-13827.

182. White, S. L., S. Gharbi, M. F. Bertani, H. L. Chan, M. D. Waterfield, and J. F. Timms . 2004. Cellular responses to ErbB-2 overexpression in human mammary luminal epithelial cells: comparison of mRNA and protein expression. Br. J. Cancer 90 :173-181.

183. Wissner, A., E. Overbeek, M. F. Reich, M. B. Floyd, B. D. Johnson, N. Mamuya, E. C. Rosfjord, C. Discafani, R. Davis, X. Shi, S. K. Rabindran, B. C. Gruber, F. Ye, W. A. Hallett, R. Nilakantan, R. Shen, Y. F. Wang, L. M. Greenberger, and H. R. Tsou . 2003. Synthesis and structure-activity relationships of 6,7-disubstituted 4-anilinoquinoline-3-carbonitriles. The design of an orally active, irreversible inhibitor of the tyrosine kinase activity of the epidermal growth factor receptor (EGFR) and the human epidermal growth factor receptor-2 (HER-2). J. Med. Chem. 46 :49-63.

184. Worthylake, R., L. K. Opresko, and H. S. Wiley . 1999. ErbB-2 amplification inhibits down- regulation and induces constitutive activation of both ErbB-2 and epidermal growth factor receptors. J. Biol. Chem. 274 :8865-8874.

185. Wu, X., M. Yamada-Mabuchi, E. J. Morris, P. S. Tanwar, L. Dobens, S. Gluderer, S. Khan, J. Cao, H. Stocker, E. Hafen, N. J. Dyson, and L. A. Raftery . 2008. The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc. Natl. Acad. Sci. U. S. A 105 :5414-5419.

186. Wulf, G., P. Garg, Y. C. Liou, D. Iglehart, and K. P. Lu . 2004. Modeling breast cancer in vivo and ex vivo reveals an essential role of Pin1 in tumorigenesis. EMBO J. 23 :3397-3407.

187. Wulf, G. M., A. Ryo, G. G. Wulf, S. W. Lee, T. Niu, V. Petkova, and K. P. Lu . 2001. Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1. EMBO J. 20 :3459-3472.

188. Xia, W., R. J. Mullin, B. R. Keith, L. H. Liu, H. Ma, D. W. Rusnak, G. Owens, K. J. Alligood, and N. L. Spector . 2002. Anti-tumor activity of GW572016: a dual tyrosine kinase inhibitor blocks EGF activation of EGFR/erbB2 and downstream Erk1/2 and AKT pathways. Oncogene 21 :6255- 6263.

189. Xu, Y. K. and R. Nusse . 1998. The Frizzled CRD domain is conserved in diverse proteins including several receptor tyrosine kinases. Curr. Biol. 8:R405-R406.

190. Yaffe, M. B., M. Schutkowski, M. Shen, X. Z. Zhou, P. T. Stukenberg, J. U. Rahfeld, J. Xu, J. Kuang, M. W. Kirschner, G. Fischer, L. C. Cantley, and K. P. Lu . 1997. Sequence-specific and phosphorylation-dependent proline isomerization: a potential mitotic regulatory mechanism. Science 278 :1957-1960.

191. Yang, Z., R. Bagheri-Yarmand, S. Balasenthil, G. Hortobagyi, A. A. Sahin, C. J. Barnes, and R. Kumar . 2003. HER2 regulation of peroxisome proliferator-activated receptor gamma (PPARgamma) expression and sensitivity of breast cancer cells to PPARgamma ligand therapy. Clin. Cancer Res. 9:3198-3203.

124

192. Yarden, Y. and M. X. Sliwkowski . 2001. Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2:127-137.

193. Yokote, H., K. Fujita, X. Jing, T. Sawada, S. Liang, L. Yao, X. Yan, Y. Zhang, J. Schlessinger, and K. Sakaguchi . 2005. Trans-activation of EphA4 and FGF receptors mediated by direct interactions between their cytoplasmic domains. Proc. Natl. Acad. Sci. U. S. A 102 :18866-18871.

194. Yoshimura, N., S. Kudoh, T. Kimura, S. Mitsuoka, K. Matsuura, K. Hirata, K. Matsui, S. Negoro, K. Nakagawa, and M. Fukuoka . 2006. EKB-569, a new irreversible epidermal growth factor receptor tyrosine kinase inhibitor, with clinical activity in patients with non-small cell lung cancer with acquired resistance to gefitinib. Lung Cancer 51 :363-368.

195. Young, A., J. Lyons, A. L. Miller, V. T. Phan, I. R. Alarcon, and F. McCormick . 2009. Ras signaling and therapies. Adv. Cancer Res. 102 :1-17.

196. Yu, X., K. D. Sharma, T. Takahashi, R. Iwamoto, and E. Mekada . 2002. Ligand-independent dimer formation of epidermal growth factor receptor (EGFR) is a step separable from ligand- induced EGFR signaling. Mol. Biol. Cell 13 :2547-2557.

197. Zhang, X., J. Gureasko, K. Shen, P. A. Cole, and J. Kuriyan . 2006. An allosteric mechanism for activation of the kinase domain of epidermal growth factor receptor. Cell 125 :1137-1149.

198. Zhou, X. Z., O. Kops, A. Werner, P. J. Lu, M. Shen, G. Stoller, G. Kullertz, M. Stark, G. Fischer, and K. P. Lu . 2000. Pin1-dependent prolyl isomerization regulates dephosphorylation of Cdc25C and tau proteins. Mol. Cell 6:873-883.

199. Zhu, H. J., J. Iaria, S. Orchard, F. Walker, and A. W. Burgess . 2003. Epidermal growth factor receptor: association of extracellular domain negatively regulates intracellular kinase activation in the absence of ligand. Growth Factors 21 :15-30.

200. Zinner, R. G., J. Nemunaitis, I. Eiseman, H. J. Shin, S. C. Olson, J. Christensen, X. Huang, P. F. Lenehan, N. J. Donato, and D. M. Shin . 2007. Phase I clinical and pharmacodynamic evaluation of oral CI-1033 in patients with refractory cancer. Clin. Cancer Res. 13 :3006-3014.

125

APPENDIX

126

Table 1. ErbB2 MYTH hits and LUMIER NLIR values.

LUMIER MYTH HITS SCREEN ErbB2 ErbB2 ErbB3 ErbB4 Screen1 Screen2 Screen3 PV (+/-) - + - + - + GAPDH 0.41 0.62 0.38 0.57 9.93 0.31 HDAC6 1.44 2.29 2.39 3.55 3.80 2.90 PLP1 0.88 1.83 1.00 2.14 1.08 0.85 FKBP1A 2.90 11.71 5.31 18.10 8.06 5.97 TBCA 0.69 0.67 0.86 0.64 0.53 0.30 VIME 0.73 0.86 0.60 0.76 0.99 0.62 CAN1 2.15 10.89 5.15 36.07 7.32 15.24 MATR3 0.68 0.59 0.42 0.76 0.48 0.42 SH3L1 1.17 1.17 3.47 4.83 1.03 0.68 T22D1 4.07 17.40 4.98 26.05 6.57 14.21 PGTA 3.91 9.66 8.38 30.28 9.86 14.00 NGEF 1.75 4.61 3.33 4.67 2.26 4.58 FKBP8 10.00 44.59 19.29 33.71 9.93 13.17 AR6P1 1.01 0.79 1.67 5.76 0.51 0.42 COF1 1.17 1.11 0.81 0.73 0.50 0.43 NP25 1.23 1.08 0.98 0.78 0.45 0.45 1F4H 1.84 9.61 3.16 18.03 3.30 12.20 GPC5B 0.37 0.52 0.58 1.07 0.44 0.52 MYCBP 1.17 1.01 1.02 1.00 0.53 0.62 PTEN 0.49 1.01 0.80 2.40 0.67 1.50 HIP1 1.67 1.84 1.41 2.32 0.86 1.06 TBCA 1.17 0.99 0.53 0.51 0.41 0.34 PP2CB 1.77 2.02 2.96 9.67 4.36 5.01 PSAT 0.64 0.72 1.05 0.85 0.62 0.52 SQSTM 5.45 6.80 2.85 3.00 2.35 1.37 VIME 0.84 1.24 0.81 1.08 0.63 0.56 IFIT5 1.56 1.05 1.73 7.26 0.99 2.07 CTNA1 1.40 0.98 0.89 0.62 0.37 0.21 CH60 1.88 1.21 1.06 1.99 1.47 1.28 CAN1 2.87 8.95 9.22 34.98 11.72 20.14 MATR3 9.07 0.93 0.56 0.56 1.63 2.26 SH3L1 0.81 1.01 1.00 0.86 0.93 1.33 PCNP 1.34 1.21 1.12 1.11 0.75 0.71 STMN1 1.54 2.16 1.22 0.86 0.59 0.49 T22D1 5.50 16.51 4.77 23.98 10.54 8.56

127

PRAF3 1.91 2.80 2.26 2.43 2.51 1.54 BCLX 3.70 4.35 6.62 8.00 6.06 4.02 PGTA 2.31 6.21 4.02 17.53 10.90 10.76 NGEF 1.37 2.22 1.80 2.01 1.35 1.30 ENSA 3.74 8.75 2.02 10.46 5.97 7.78 FKBP8 4.68 7.26 10.17 25.48 13.68 14.81 WIF1 21.00 24.19 40.91 29.48 33.21 16.69 PPID 1.12 0.95 1.07 2.30 1.27 1.53 AR6P1 1.81 2.75 1.67 5.76 2.76 3.73 GBRL2 1.20 0.86 1.18 3.25 3.48 2.32 COF1 2.38 2.13 1.94 1.10 0.88 0.54 PEBP1 1.16 1.02 0.55 0.65 0.39 0.35 NP25 1.38 1.26 0.74 0.46 0.60 0.32 1F4H 1.05 1.25 0.76 0.96 0.32 0.45 BNI3L 1.20 1.51 1.29 3.33 3.34 2.39 UCHL1 2.71 4.18 1.60 1.43 1.21 1.42 PTEN 1.45 1.71 1.19 2.17 1.37 1.71 PSAT 0.81 1.63 0.82 1.05 0.91 0.57 GPC5B 12.72 26.88 14.59 32.60 22.68 18.35 PIN1 1.00 2.56 1.68 5.11 3.28 2.93 OXSR1 1.76 5.50 3.20 9.80 1.65 3.94 MYCBP 1.30 1.10 0.85 0.76 0.54 0.40 MYPR 1.33 1.51 1.48 3.26 2.09 1.82 APLP1 2.20 2.18 2.34 6.21 5.85 5.00 SYT5 3.53 6.46 7.50 25.94 12.23 15.44 ENSA 1.16 1.51 1.07 0.73 0.96 0.69 DDR1 14.51 35.82 21.11 21.55 27.49 29.21 WNK1 4.03 16.44 7.93 47.71 8.96 36.17 ALDOA 1.65 1.79 1.79 1.66 0.84 0.78 KCNAB2 4.18 6.54 3.27 2.92 1.41 1.27 HIP1 3.46 6.73 2.75 6.50 4.08 3.67 HDAC6 4.16 8.50 4.32 8.00 4.16 5.00

128

Table 2. ErbB3 MYTH hits and LUMIER NLIR values.

MYTH HITS ErbB3 ErbB2 ErbB3 ErbB4 Screen1 Screen2 Screen3 PV (+/-) - + - + - + GAPDH 0.37 0.46 0.25 0.41 0.36 0.36 HDAC6 0.86 1.35 1.21 1.52 1.17 1.80 PLP1 1.23 1.08 0.91 1.19 0.93 1.05 FKBP1A 1.95 4.86 3.00 4.80 5.31 5.72 TBCA 1.05 0.66 0.67 0.63 0.34 0.45 VIME 0.78 0.56 0.55 0.53 0.42 0.46 CAN1 1.94 3.34 2.40 3.93 3.49 4.68 MATR3 0.40 0.40 0.19 0.39 0.32 0.33 SH3L1 1.54 1.45 1.00 1.19 0.33 0.43 T22D1 1.20 2.34 1.13 3.00 1.92 2.98 PGTA 1.60 6.05 3.40 6.19 4.99 8.46 NGEF 0.72 0.96 0.89 1.09 0.96 1.20 FKBP8 3.22 4.51 4.91 7.68 5.20 7.27 AR6P1 0.68 0.54 0.48 0.78 0.42 0.27 COF1 0.75 0.62 0.50 0.49 0.39 0.57 NP25 0.80 0.65 0.42 0.52 0.65 0.56 1F4H 0.75 0.96 0.62 1.15 0.92 1.08 GPC5B 0.28 0.33 0.20 0.36 0.39 0.38 MYCBP 0.67 0.56 0.60 0.57 0.57 0.50 PTEN 0.85 0.59 0.49 0.66 0.67 0.79 HIP1 0.81 0.79 0.81 1.11 0.57 0.77 TBCA 0.81 0.55 0.61 0.50 0.37 0.49 PP2CB 1.15 1.88 1.27 2.16 2.16 2.83 PSAT 0.76 0.72 0.47 0.52 0.48 0.53 SQSTM 1.20 1.25 1.02 1.22 0.92 1.30 VIME 0.89 0.94 0.76 0.78 0.51 0.55 IFIT5 1.15 1.30 0.75 1.03 0.48 0.58 CTNA1 0.82 0.70 0.65 0.51 0.45 0.46 CH60 0.97 0.68 0.56 0.58 0.38 0.46 CAN1 2.82 5.82 3.72 7.05 4.00 6.12 MATR3 0.76 0.69 0.46 0.43 0.67 1.01 SH3L1 1.52 0.94 0.85 0.73 0.50 4.62 PCNP 1.36 1.25 1.09 1.16 0.98 1.01 STMN1 1.54 1.19 1.07 0.89 0.36 0.48 T22D1 0.76 1.47 0.81 1.49 1.28 1.65 PRAF3 1.65 2.99 2.18 3.00 2.48 3.17

129

BCLX 1.71 2.10 1.81 1.81 1.96 1.92 PGTA 1.35 3.02 1.51 3.66 4.35 6.35 NGEF 1.07 1.09 0.67 0.94 0.70 0.92 ENSA 1.73 1.49 0.84 1.55 1.06 1.59 FKBP8 1.98 5.96 3.41 5.13 4.27 5.74 WIF1 5.72 11.57 10.32 8.88 7.82 9.46 PPID 1.05 0.72 0.52 0.61 0.39 0.53 AR6P1 0.70 0.78 0.48 0.78 0.84 1.12 GBRL2 0.73 0.73 0.47 0.54 0.64 0.71 COF1 1.63 1.25 1.08 1.04 0.67 0.64 PEBP1 0.62 0.61 0.58 0.49 0.47 0.52 NP25 1.63 0.65 0.68 0.55 0.56 0.48 1F4H 0.76 0.55 0.59 0.57 0.44 0.40 BNI3L 0.94 1.05 0.82 0.77 0.87 1.05 UCHL1 1.12 1.57 1.15 1.29 1.20 1.35 PTEN 0.66 0.96 0.71 0.79 0.53 0.72 PSAT 0.92 1.00 0.72 0.81 0.35 0.60 GPC5B 3.26 11.19 7.27 13.27 6.69 12.03 PIN1 1.09 0.82 0.48 0.81 0.68 0.93 OXSR1 1.23 1.65 1.55 1.59 0.85 1.05 MYCBP 0.86 0.67 0.78 0.59 0.46 0.52 MYPR 0.79 1.06 0.60 0.92 1.01 1.28 APLP1 1.95 1.52 1.30 1.34 0.94 1.33 SYT5 0.78 2.92 1.48 2.80 2.38 3.63 ENSA 1.58 1.13 1.03 1.14 0.76 0.86 DDR1 3.17 12.64 6.59 13.71 6.29 15.09 WNK1 2.30 8.52 3.59 7.60 2.94 6.73 ALDOA 1.11 1.16 1.09 1.01 0.62 0.83 KCNAB2 2.01 1.98 1.76 2.35 1.53 1.93 HIP1 1.24 1.13 0.81 0.96 0.64 1.28 HDAC6 2.92 4.48 2.78 4.29 3.26 5.38

130

Table 3. ErbB4 MYTH hits and LUMIER NLIR values.

MYTH HITS ErbB4 ErbB2 ErbB3 ErbB4 Screen1 Screen2 Screen3 PV (+/-) - + - + - + GAPDH 0.48 0.47 0.31 0.44 0.49 0.36 HDAC6 1.07 1.12 0.75 0.92 0.85 0.68 PLP1 1.02 1.01 0.85 1.22 0.91 1.13 FKBP1A 3.27 3.04 1.94 2.84 3.39 2.62 TBCA 0.85 0.61 0.74 0.56 0.49 0.38 VIME 0.67 0.57 0.55 0.56 0.54 0.44 CAN1 2.74 2.87 1.58 2.19 3.31 2.58 MATR3 0.43 0.62 0.40 0.58 0.36 0.26 SH3L1 1.15 0.97 1.15 1.08 0.46 0.41 T22D1 1.34 1.62 0.86 1.80 1.50 1.67 PGTA 5.74 4.57 2.76 3.11 5.01 3.24 NGEF 1.31 2.06 1.00 1.44 1.13 1.28 FKBP8 4.75 4.52 2.78 3.46 3.58 2.75 AR6P1 0.64 0.53 0.46 0.61 0.46 0.38 COF1 0.63 0.68 0.58 0.77 0.63 0.53 NP25 0.65 0.59 0.51 0.48 0.64 0.44 1F4H 0.85 1.70 0.72 1.74 1.01 1.49 GPC5B 0.37 0.41 0.19 0.40 0.44 0.30 MYCBP 0.56 0.56 0.68 0.51 0.52 0.49 PTEN 0.51 0.61 0.54 0.58 0.55 0.62 HIP1 0.73 0.71 0.57 1.05 0.73 0.52 TBCA 0.78 0.64 0.53 0.45 0.52 0.31 PP2CB 1.26 1.54 0.91 1.23 1.52 1.52 PSAT 0.51 0.62 0.57 0.53 0.52 0.43 SQSTM 2.28 2.92 1.22 1.95 1.78 1.99 VIME 0.58 0.45 0.48 0.59 0.49 0.52 IFIT5 0.92 0.92 0.62 0.82 0.54 0.45 CTNA1 0.57 0.51 0.50 0.52 0.47 0.51 CH60 0.79 0.57 0.43 0.64 0.66 0.45 CAN1 3.38 3.50 2.26 3.37 2.69 2.78 MATR3 0.62 0.44 0.51 0.44 0.65 0.65 SH3L1 0.97 0.65 0.86 0.70 2.43 5.70 PCNP 0.93 0.92 0.85 0.73 0.71 0.73 STMN1 0.99 0.77 1.10 0.89 0.57 0.49 T22D1 0.60 0.96 0.58 1.10 0.82 0.87 PRAF3 1.23 1.39 1.06 1.05 2.00 1.36

131

BCLX 2.23 1.88 1.46 1.57 1.69 1.02 PGTA 1.44 2.10 1.10 1.92 3.83 3.00 NGEF 0.97 1.13 0.73 0.95 0.83 1.08 ENSA 0.80 0.77 0.63 0.77 0.75 0.83 FKBP8 4.42 5.39 2.94 4.12 4.31 3.53 WIF1 30.14 36.57 20.24 22.09 24.39 17.35 PPID 0.74 0.60 0.57 0.63 0.46 0.53 AR6P1 0.67 0.80 0.46 0.61 0.65 0.80 GBRL2 0.66 0.72 0.53 0.61 0.74 0.62 COF1 1.10 0.82 1.53 1.11 0.62 0.70 PEBP1 0.61 0.43 0.67 0.47 0.60 0.44 NP25 0.67 0.51 0.63 0.60 0.61 0.65 1F4H 0.69 0.52 0.61 0.50 0.53 0.49 BNI3L 0.93 0.89 0.82 0.63 1.01 0.77 UCHL1 1.23 1.07 0.93 0.86 1.25 0.91 PTEN 0.94 0.67 0.79 0.66 0.78 0.61 PSAT 0.90 0.77 0.73 0.67 0.61 0.60 GPC5B 10.19 16.31 8.77 14.85 8.31 8.71 PIN1 1.67 2.24 0.57 1.28 1.25 1.55 OXSR1 1.17 1.18 0.94 1.02 0.94 0.97 MYCBP 0.69 0.64 0.59 0.64 0.55 0.53 MYPR 0.85 1.14 0.64 0.91 1.02 0.96 APLP1 1.10 1.24 1.09 1.13 1.28 0.95 SYT5 1.63 2.23 1.07 1.75 1.96 2.04 ENSA 1.05 0.86 0.74 0.96 1.04 0.99 DDR1 11.45 22.17 9.78 18.01 18.17 19.42 WNK1 2.50 5.01 3.29 4.64 3.88 4.31 ALDOA 0.84 0.77 0.83 0.73 0.82 0.61 KCNAB2 1.65 1.33 1.38 1.16 1.66 1.29 HIP1 1.15 1.74 1.00 1.30 1.43 1.79 HDAC6 2.49 2.14 2.53 2.20 2.62 3.08

132

Table 4. Renilla luciferase LUMIER NLIR values.

PV - + GAPDH 0.04551 0.04059 HDAC6 0.09588 0.05177 PLP1 0.23478 0.06255 FKBP1A 0.14256 0.05743 TBCA 0.17557 0.08321 VIME 0.1078 0.05807 CAN1 0.14076 0.08744 MATR3 0.03527 0.07896 SH3L1 0.22236 0.14605 T22D1 0.12511 0.08571 PGTA 0.12388 0.06461 NGEF 0.11862 0.03468 FKBP8 0.1986 0.07852 AR6P1 0.11979 0.05515 COF1 0.07087 0.0781 NP25 0.12165 0.06191 1F4H 0.09938 0.07488 GPC5B 0.02324 0.03412 MYCBP 0.08711 0.07288 PTEN 0.11946 0.06148 HIP1 0.04165 0.06009 TBCA 0.17305 0.04942 PP2CB 0.09965 0.03614 PSAT 0.10216 0.07548 SQSTM 0.14249 0.08362 VIME 0.12437 0.08003 IFIT5 0.1914 0.11343 CTNA1 0.13144 0.07762 CH60 0.13679 0.07272 CAN1 0.2583 0.10664 MATR3 0.1297 0.04159 SH3L1 0.28999 0.06702 PCNP 0.44257 0.2777 STMN1 0.37238 0.12598 T22D1 0.05753 0.05123 PRAF3 0.16344 0.17189 BCLX 0.24518 0.13749 PGTA 0.14528 0.09046

133

NGEF 0.09293 0.06299 ENSA 0.12907 0.05484 FKBP8 0.70288 0.24169 WIF1 0.23249 0.06987 PPID 0.14683 0.06901 AR6P1 0.04553 0.06084 GBRL2 0.11646 0.05515 COF1 0.46681 0.13428 PEBP1 0.15117 0.07766 NP25 0.20606 0.08524 1F4H 0.12713 0.07375 BNI3L 0.22719 0.06546 UCHL1 0.20642 0.08384 PTEN 0.24086 0.05883 PSAT 0.26581 0.06765 GPC5B 1.4269 0.61305 PIN1 0.24583 0.11468 OXSR1 0.19714 0.07829 MYCBP 0.15369 0.08125 MYPR 0.11146 0.08474 APLP1 0.40198 0.16616 SYT5 0.16791 0.06156 ENSA 0.41696 0.11233 DDR1 0.30962 0.12503 WNK1 0.59503 0.22707 ALDOA 0.2646 0.09992 KCNAB2 0.26803 0.09779 HIP1 0.17077 0.06017 HDAC6 0.67894 0.17424

134