Isolation and Characterization of an Alternatively Spliced Variant of Transcription Factor Islet-1

419 Isolation and characterization of an alternatively spliced variant of transcription factor Islet-1

K Ando1, S Shioda1,2, H Handa1 and K Kataoka1,2 1Frontier Collaborative Research Center, Tokyo Institute of Technology, Yokohama 226-8503, Japan 2Laboratory of Molecular and Developmental Biology, Graduate School of Biological Science, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma 630-0192, Japan

(Requests for offprints should be addressed to K Kataoka; Email: [email protected])

Abstract

The LIM homeodomain protein Islet-1 (Isl1), one of the earliest markers for motor neuron differentiation, is also expressed in all classes of islet cells in the pancreas. Isl1 is known to bind and regulate the promoters of the insulin, glucagon and somatostatin genes. In this study, we describe isolation of a novel isl1 cDNA species from the mouse islet cell line TC6, which arose from the utilization of an alternative splicing acceptor site in the ﬁfth exon. This shorter cDNA encodes an Isl1 isoform (Isl1-) lacking the carboxy-terminal 23 amino acids of the previously reported product Isl1-. Although the level of isl1- mRNA is much lower than that of isl1-, isl1- is preferentially expressed in murine insulinoma cell lines but not in glucagonoma cell line. Upon transient transfection, both Isl1- and Isl1- accumulate in the nuclei of murine insulinoma cells. We found that Isl1- is a relatively more potent transcriptional activator of the insulin promoter than Isl1- and that the Isl1- isoform undergoes phosphorylation. Therefore, the transcriptional activity of Isl1 is potentially regulated by the alternative splicing of its mRNA and by phosphorylation. Journal of Molecular Endocrinology (2003) 31, 419–425

Introduction The Isl1 protein contains two LIM domains (LIM1 and LIM2) at the amino terminus and a Islet-1 (Isl1) was originally isolated as a transcrip- homeodomain (HD) in the central region (see tion factor that binds to an islet cell-specific Fig. 1). The HD is responsible for the binding of enhancer element in the insulin gene (Karlsson et al. Isl1 to target AT-rich DNA sequences, and the 1990). Isl1 is expressed in cells as well as in the LIM domains are zinc-binding motifs that mediate other classes of pancreatic endocrine cells (, and interactions with other proteins such as NLI/Ldb1 cells) (Dong et al. 1991, Thor et al. 1991), and it (Sanchez-Garcia et al. 1993, Jurata et al. 1996). In was also shown to bind and regulate the and contrast, the function of the carboxy-terminal cell-specific hormone genes glucagon (Wang & region is not clearly defined. It is thought to serve Drucker 1995) and somatostatin (Leonard et al. as a transactivator domain, because a truncated 1992) respectively. Isl1 is also expressed in Isl1 product (Isl1–310X) that has been found in developing neurons in the spinal cord, where it type 2 diabetes patients and which lacks the serves as an early marker of motor neuron carboxy-terminal 40 amino acids has been shown differentiation (Ericson et al. 1992, Tsuchida et al. to be a weaker transactivator than wild type Isl1 1994). In accord with its expression profile, (Shimomura et al. 2000). homozygous deletion of the isl1 gene in mice results In this manuscript, we describe the isolation of in the ablation of islets and motor neurons (Pfaff an alternatively spliced isl1 cDNA variant from the et al. 1996, Ahlgren et al. 1997). In addition, mouse pancreatic cell line TC6. Its product, heterozygous nonsense mutations have been found Isl1-, lacks 23 amino acids that are present in the in the isl1 gene in patients with type 2 diabetes carboxy-terminal region (amino acids 256–278) of (Shimomura et al. 2000). the previously reported Isl1 (Isl1-). Unexpectedly,

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access 420 K ANDO and others · An alternatively spliced variant of Islet-1

Figure 1 Isolation of the alternatively spliced isoform of Isl1. The previously reported mouse Isl1 protein (Isl1-) and the newly identiﬁed isl1 cDNA product (Isl1-) are schematically shown. LIM1, LIM2 and HD represent the LIM domains 1 and 2 and the HD, respectively. The lower panel shows the genomic structure of the mouse isl1 gene and the splicing patterns of the isl1- and isl1- mRNAs.

the novel Isl1- isoform is a relatively more potent (isl1-R; 5-agaccgcgGTTCCTCATGCCTCAAT transactivator of the insulin promoter than Isl1-, AGGAC-3), which is complementary to the 3 end suggesting a new regulatory role for the carboxy- of isl1 open reading frame. isl1 cDNAs containing terminal region of Isl1. the entire open reading frame were then amplified by PCR using LA-Taq DNA polymerase and 2GC buffer (Takara, Kyoto, Japan). The primers Materials and methods used were isl1-F1 (sense strand; 5-gggaggcCTT ACAGATATGGGAGACATGGG-3), which cor- Cells responds to the region around the first ATG of isl1, MIN6 cells (Miyazaki et al. 1990) were a generous and anti-sense isl1-R primer described above. The gift from Dr Jun-ichi Miyazaki (Osaka University). PCR cycles were 40 cycles of 94 C for 40 s, 55 C TC6 and TC1 clone 9 (hereafter TC1) cells for 40 s and 72 C for 2 min. were purchased from the American Tissue Culture The PCR products were digested by StuI and Collection. MIN6 and TC6 cells were grown in SacII, linked to a double-stranded oligonucleotide Dulbecco’s modified Eagle’s medium supplemented encoding the FLAG-tag sequence (5-ctagtacc with 15% fetal calf serum, and TC1 cells were ATGGATTACAAGGATGACGACGATAAGGG grown in F12K medium supplemented with 10% AGG-3 and 5-CCTCCCTTATCGTCGTCAT fetal calf serum. CCTTGTAATCCATggta-3), and cloned into the SpeI-SacII-digested vector pGEM-T-easy (Promega) to generate pGEM-T-easy/FLAG-isl1- isl1 cDNA isolation and RT-PCR analysis and pGEM-T-easy/FLAG-isl1-. The nucleo- One microgram of total RNA isolated from TC6 tide sequence of isl1- is deposited in GenBank cells using TRIZOL Reagent (Invitrogen) was (accession number AB104633). subjected to a reverse transcription reaction (50 C For isl1 mRNA expression analysis, total RNA for 1 h) using SuperScript II reverse transcrip- (1 µg) was subjected to RT-PCR using the Titan tase (Invitrogen) and a specific anti-sense primer One-Tube RT-PCR System (Roche). The primers

Journal of Molecular Endocrinology (2003) 31, 419–425 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access An alternatively spliced variant of Islet-1 · K ANDO and others 421 were isl1-F2 (sense strand, 5-AAGGAGCAACTA GTGGAGATGACGGG-3), which corresponds to the exon 4 encoding the HD of isl1, and the isl1-R primer described above. The PCR cycles were 40 cycles of 94 C for 40 s, 55 C for 40 s and 72 C for 60 s.

Immunofluorescence staining Figure 2 Expression of isl1 isoforms in pancreatic endocrine cell lines. Total RNA (1 µg) isolated from Isl1- and Isl1- expression plasmids were con- TC1, TC6 and MIN6 cells grown in the presence of structed by inserting partially digested NotI 1 mM (−) or 20 mM (+) glucose for 24 h was subjected fragments excised from pGEM-T-easy/FLAG- to RT-PCR analysis with isl1-specific primers. isl1- and pGEM-T-easy/FLAG-isl1- into the Amplification products were resolved by PAGE and mammalian expression vector pHygEF2. MIN6 visualized by ethidium bromide staining. The 433 and 364 bp products are derived from the isl1- and isl1- cells grown on collagen-coated cover slides (Iwaki, mRNAs, respectively. Tokyo) were transfected with 3·2 µg of plasmids (pHygEF2/FLAG-isl1- or pHygEF2/FLAG-isl1-) using 8 µl Lipofectamine 2000 reagent (Invitrogen). followed by transfer onto an Immobilon membrane Twenty-four hours after transfection, the cells were (Millipore). The membrane was stained with the fixed with PBS containing 3% formaldehyde at anti-FLAG (M2) antibody, biotinylated anti-mouse room temperature for 15 min and treated with IgG serum and streptavidin-horseradish peroxidase 0·25% Triton X-100 in PBS for an additional conjugate (Amersham Pharmacia). 15 min. The cells were then stained with anti- For calf intestinal alkaline phosphatase (CIAP) FLAG (M2) monoclonal antibody and Alexa Fluor treatment, nuclear extracts were prepared from 488-labeled anti-mouse IgG serum (Molecular transfected NIH3T3 cells as described in the Probes) and 4,6-diamidino-2-phenylindole. literature (Schreiber et al. 1989). Briefly, cells grown in a 35 mm dish were washed with PBS, and were ff Luciferase assay added with 200 µl ice-cold bu er A (10 mM Hepes pH 7·9, 10 mM KCl, 1·5 mM MgCl2,1mM The reporter plasmid h-ins-p-luc, containing the EDTA, 1 mM dithiothreitol, 0·1% Nonidet P40 human insulin promoter region, was described and protease inhibitors). The cells were scraped, previously (Kataoka et al. 2002). NIH3T3 cells transferred into a microtube, and centrifuged at grown in a 35 mm dish were transfected with a 2500 g for 1 min at 4 C. The pellet was total of 1·5 µg of plasmids (0·4 µg luciferase re-suspended in 20 µl buffer B (20 mM Hepes, pH plasmid, 1·0 µg expression plasmid and 0·1 µg 7·9, 400 mM NaCl, 1 mM EDTA, 1 mM dithioth- pEF-Rluc (Kataoka et al. 2001)) using 10 µl reitol, 20% glycerol and protease inhibitors) and PolyFect reagent (Qiagen). Cells were harvested incubated on ice for 10 min. After centrifugation at 24 h after transfection by 200 µl of Passive Lysis 15 000 g for 10 min, the supernatant (nuclear Buffer (Promega). The firefly and Renilla luciferase extract) was collected. Four microliters of the activities were measured using the Dual Luciferase extract were diluted to final concentration of Assay System (Promega). 25 mM Tris (pH 7·9), 100 mM NaCl, 5 mM MgCl2 and 8 mM dithiothreitol, added with 20 Western analysis units CIAP (Takara), incubated at 30 C for 1 h, and then subjected to Western analysis. Twelve microliters of cell extracts used for the luciferase assay, which had been dissolved in the Passive Lysis Buffer (Promega), were added with Results 4 µl of SDS sample buffer (200 mM Tris pH 6·8, 8% SDS, 400 mM dithiothreitol, 0·2% bromophe- Isolation of an alternatively spliced variant of nol blue and 40% glycerol), and boiled for 5 min. isl1 cDNA The samples were then subjected to 8% SDS- We molecularly cloned isl1 cDNAs from total RNA PAGE under reducing and denatured conditions, prepared from the murine insulinoma cell line www.endocrinology.org Journal of Molecular Endocrinology (2003) 31, 419–425

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access 422 K ANDO and others · An alternatively spliced variant of Islet-1

Figure 3 Nuclear localization of Isl1 isoforms in MIN6 cells. Expression vectors encoding FLAG-tagged Isl1- and Isl1- were transfected into MIN6 cells. The cells were ﬁxed and stained with anti-FLAG antibody and Alexa Fluor 488-labeled anti-mouse IgG antiserum (upper panels) and with 4,6-diamidino-2-phenylindole (DAPI) (lower panels).

TC6 by using an RT-PCR strategy. Among four The isl1- isoform is preferentially expressed clones analyzed by nucleotide sequencing, one in murine insulinoma cell lines clone was found to contain an internal in-frame deletion of 69 nucleotides compared with the We examined the mRNA expression profile of the previously reported isl1 cDNA. As schematically two isl1 isoforms. Total RNAs were isolated from shown in Fig. 1 (upper panel), this cDNA encodes a mouse glucagonoma (TC1 clone 6) and insuli- protein that lacks 23 amino acids that correspond noma (TC6 and MIN6) cell lines grown in the to amino acids 256–278 of the previously described presence of low (1 mM) or high (20 mM) Isl1. Hereafter, we call this shorter Isl1 isoform concentrations of glucose and were analyzed by Isl1- (GenBank accession number AB104633), RT-PCR using specific primer pairs. As shown in and refer to the previously described isoform as Fig. 2, both the isl1- and isl1- isoforms are Isl1-. A comparison of the nucleotide sequences of expressed in TC6 and MIN6 cells, and isl1- is the isl1- and isl1- cDNAs with the corresponding abundant. In contrast, the isl1- isoform is barely mouse genomic sequence revealed that these two detectable in TC1 cells, suggesting that it is pref- mRNA species were generated by the usage of an erentially expressed in insulinoma cells. Although a alternative splicing acceptor site in the fifth exon high concentration of glucose activates transcrip- (Fig. 1, lower panel). tion of the insulin gene in these insulinoma cell

Journal of Molecular Endocrinology (2003) 31, 419–425 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access An alternatively spliced variant of Islet-1 · K ANDO and others 423

Figure 4 Activation of the insulin promoter by Isl1- and Isl1-. (A) A luciferase reporter plasmid (0·4 µg) driven by the human insulin promoter was transfected into NIH3T3 cells with varying amounts (0·2, 0·5, 1·0 µg) of FLAG-tagged Isl1- or Isl1- expression plasmids. Data are normalized to basal luciferase activity. (B) Levels of expression of FLAG-Isl1- and FLAG-Isl1-. Extracts prepared from cells used for the luciferase assay were subjected to SDS-PAGE followed by Western analysis using the anti-FLAG antibody. The FLAG-Isl1- and FLAG-Isl1- proteins are indicated by arrows. lines, the level of glucose in the culture medium transactivation by Isl1- to a reproducibly greater had no effect on the levels of expression and on the extent than by Isl1-. We confirmed the levels of relative amounts of the two isl1 isoforms. expression of Isl1- and Isl1- by Western blot analysis (Fig. 4B). Although Isl1- accumulated at slightly higher levels than Isl1-, Isl1- appeared to Isl1- is a more potent transactivator be a relatively stronger transactivator of the insulin than Isl1- gene promoter than Isl1- (for example, compare We next tested whether the two Isl1 isoforms Isl1- 1·0 µg and Isl1- 0·5 µg, Fig. 4A and B, lanes are functionally different. For this purpose, we 4 and 6). Thus, the transactivation activity of Isl1- constructed mammalian expression vectors encod- is relatively higher than that of Isl1-. ing FLAG-tagged Isl1- and Isl1-. MIN6 cells transfected with these constructs were stained with The Isl1- isoform is phosphorylated anti-FLAG antibody. Both Isl1- and Isl1- were observed to predominantly localize in the nucleus We noticed that FLAG-tagged Isl1- but not Isl1- (Fig. 3). migrated as a doublet, as shown by Western blot We then transfected both expression vectors into analysis (see Fig. 4B, lane 4). One plausible NIH3T3 fibroblast cells together with an insulin explanation for this observation is that Isl1- is promoter-luciferase reporter plasmid. In accord modified, most likely by phosphorylation. To test with previous data demonstrating that the transac- this hypothesis, we prepared nuclear extracts from tivation potential of Isl1- is modest (German et al. NIH3T3 cells transfected with Isl1- and Isl1-. 1992, Shimomura et al. 2000), we observed a The extracts were treated with CIAP and subjected marginal but significant activation of the insulin to SDS-PAGE/Western blot analysis. As shown in promoter by Isl1- in a dose-dependent manner Fig. 5, treatment with CIAP caused the more (Fig. 4A). We also observed dose-dependent slowly migrating form of Isl1- to disappear and www.endocrinology.org Journal of Molecular Endocrinology (2003) 31, 419–425

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access 424 K ANDO and others · An alternatively spliced variant of Islet-1

regulate the phosphorylation of other sites of the protein. Furthermore, we cannot exclude the possibility that Isl1- is phosphorylated in a manner that does not affect protein mobility with respect to SDS-PAGE. Although the role of phosphorylation in Isl1 activity is not clear at present, this modification possibly affects the transactivation properties of Isl1, because Isl1- is a relatively more potent transactivator than Isl1-. One possible explanation for this is that the transactivation function of Isl1- is negatively regulated by phosphorylation and that Isl1- escapes this regulation. Previous work has demonstrated that the carboxy terminus (amino acids 310–349) serves as a transactivator Figure 5 Phosphorylation of Isl1-. Nuclear extracts domain (Shimomura et al. 2000). The 23 amino were prepared from NIH3T3 cells transfected with acid region present in Isl1- but not Isl1- (amino expression plasmids encoding FLAG-tagged Isl1- or acids 256–278) is adjacent to this transactivator Isl1-. Extracts were treated with CIAP and subjected domain and may thus exert a negative regulatory to SDS-PAGE followed by Western analysis using effect on it. Therefore, Isl1 transactivation activity anti-FLAG serum. Arrows indicate Isl1-, Isl1- and the phosphorylated form of Isl1- (Pi-Isl1-). may be regulated in two ways, by alternative splicing and by phosphorylation. However, as far as we have tested, the isl1- isoform represents only the more rapidly migrating form to accumulate, a small portion of total isl1 mRNA in murine indicating that Isl1- is phosphorylated. In insulinoma cell lines. A more detailed expression contrast, the mobility of Isl1- was not affected profile of the two isoforms in pancreatic endocrine by CIAP treatment. These results indicate that cell types, as well as in neuronal tissues, awaits the Isl1- undergoes phosphorylation that can be availability of isoform-specific antibodies, which in distinguished by mobility on SDS-PAGE. turn will clarify the physiological relevance of the isl1- isoform.

Discussion Acknowledgements We isolated a novel splicing variant of isl1 cDNA and analyzed the function of its product, Isl1-,in We thank Dr Jun-ichi Miyazaki (Osaka University) comparison with the previously reported Isl1-. for the generous gift of the MIN6 cell line. This Although the isl1- isoform represents only a small work was supported by Grants-in-Aid for Scientific portion of total isl1 mRNA, it was specifically Research on Priority Areas, for Encouragement of detected in murine insulinoma cell lines but not Young Scientists, and of the 21st Century COE glucagonoma cell line, suggestive of a cell Program from the Ministry of Education, Culture, lineage-specific regulation of Isl1 splicing. Sports, Science and Technology in Japan, and a We demonstrated here that Isl1- is phos- grant from the Ministry of Health, Labor and phorylated. The 23 amino acid region contains two Welfare in Japan to K K. threonine and one serine residues, two of which (Thr263 and Ser269) are each followed by a References proline residue and may be targets for MAP kinase family members (Davis 1993). However, from our Ahlgren U, Pfaff SL, Jessell TM, Edlund T & Edlund H 1997 analysis using CIAP, we cannot conclude that these Independent requirement for ISL1 in formation of pancreatic amino acid residues in the 23 amino acid region mesenchyme and islet cells. Nature 385 257–260. Davis RJ 1993 The mitogen-activated protein kinase signal are phosphorylated, because there remains a transduction pathway. Journal of Biological Chemistry 286 possibility that this region is just required to 14553–14556.

Journal of Molecular Endocrinology (2003) 31, 419–425 www.endocrinology.org

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access An alternatively spliced variant of Islet-1 · K ANDO and others 425

Dong J, Asa SL & Drucker DJ 1991 Islet cell and extrapancreatic cell line that retains glucose-inducible insulin secretion: special expression of the LIM domain homeobox gene isl-1. Molecular reference to expression of glucose transporter isoforms. Endocrinology 5 1633–1641. Endocrinology 127 126–132. Ericson J, Thor S, Edlund T, Jessell TM & Yamada T 1992 Early Pfaff SL, Mendelsohn M, Stewart CL, Edlund T & Jessell TM 1996 stages of motor neuron differentiation revealed by expression of Requirement for LIM homeobox gene Isl1 in motor neuron homeobox gene Islet-1. Science 256 1555–1560 generation reveals a motor neuron-dependent step in interneuron German MS, Wang J, Chadwick RB & Rutter WJ 1992 Synergistic differentiation. Cell 84 309–320. activation of the insulin gene by a LIM-homeo domain protein Sanchez-Garcia I, Osada H, ForsterA&Rabbitts TH 1993 The and a basic helix-loop-helix protein: building a functional insulin cysteine-rich LIM domains inhibit DNA binding by the associated minienhancer complex. Genes and Development 6 2165–2176. homeodomain in Isl-1. EMBO Journal 12 4243–4250. ff Jurata LW, Kenny DA & Gill GN 1996 Nuclear LIM interactor, a Schreiber E, Matthias P, Muller MM & Scha ner W 1989 Rapid rhombotin and LIM homeodomain interacting protein, is detection of octamer binding proteins with ‘mini-extracts’, expressed early in neuronal development. PNAS 93 11693–11698. prepared from a small number of cells. Nucleic Acids Research 17 6419. Karlsson O, Thor S, Norberg T, OhlssonH&EdlundT1990 Shimomura H, Sanke T, Hanabusa T, Tsunoda K, Furuta H & Insulin gene enhancer binding protein Isl-1 is a member of a Nanjo K 2000 Nonsense mutation of islet-1 gene (Q310X) found novel class of proteins containing both a homeo- and a Cys-His in a type 2 diabetic patient with a strong family history. Diabetes domain. Nature 344 879–882. 49 1597–1600. Kataoka K, Yoshitomo-Nakagawa K, ShiodaS&Nishizawa M Thor S, Ericson J, BrannstromT&Edlund T 1991 The 2001 A set of Hox proteins interact with the Maf oncoprotein to homeodomain LIM protein Isl-1 is expressed in subsets of neurons inhibit its DNA binding, transactivation, and transforming and endocrine cells in the adult rat. Neuron 7 881–889. Journal of Biological Chemistry activities. 276 819–826. Tsuchida T, Ensini M, Morton SB, Baldassare M, Edlund T, Jessell Kataoka K, Han SI, Shioda S, Hirai M, Nishizawa M & Handa H TM & Pfaff SL 1994 Topographic organization of embryonic 2002 MafA is a glucose-regulated and pancreatic beta-cell-specific motor neurons defined by expression of LIM homeobox genes. transcriptional activator for the insulin gene. Journal of Biological Cell 79 957–970. Chemistry 277 49903–49910. Wang M & Drucker DJ 1995 The LIM domain homeobox gene Leonard J, Serup P, Gonzalez G, Edlund T & Montminy M 1992 isl-1 is a positive regulator of islet cell-specific proglucagon gene The LIM family transcription factor Isl-1 requires cAMP response transcription. Journal of Biological Chemistry 270 12646–12652. element binding protein to promote somatostatin expression in pancreatic islet cells. PNAS 89 6247–6251. Received 9 June 2003 Miyazaki J, Araki K, Yamato E, Ikegami H, Asano T, Shibasaki Y, Accepted 20 August 2003 OkaY&YamamuraK1990Establishment of a pancreatic beta

www.endocrinology.org Journal of Molecular Endocrinology (2003) 31, 419–425

Downloaded from Bioscientifica.com at 09/27/2021 01:42:42PM via free access