DOCSLIB.ORG

Genetic Association Studies of Alcohol Dependence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

MD (Clin.Res.) Thesis – Gregory John Lydall – November 2015 Genetic Association Studies of Alcohol Dependence Gregory John Lydall This thesis is submitted for the degree of Doctor of Medicine (MD) at University College London 2015 2 Statement of Conjoint Work My work was very much part of a team effort. My specific contributions were: 1. UCL alcohol dependence (AD) sample collection recruitment, diagnostic interviewing, blood sampling and data management of 100 alcohol dependent volunteers and 50 control volunteers. 2. UK-wide coordination of AD recruitment through the UK-COGA and the UK Clinical Research Network. This included recruiter training for over 20 NHS collection sites, advice, support and coordination nationwide, and initial UCL alcohol dependence database management, and UK- COGA website development. This effort resulted in over 2000 AD samples at time of writing. 3. DNA preparation - extraction, quantification and plating out for analysis. 4. Marker selection - from literature and using bioinformatic tools. 5. Literature search to build a database of gene and SNP associations with AD and related phenotypes. 6. Statistical analysis of data. 7. Lead author on two linked publications and co-author on a further 7 genetics publications (see Appendix 18.3). 3 AUTHOR NOTE Sources of support: This work was funded by the UK Medical Research Council, The Brain Damage Research Trust, the Neuroscience Research Charitable Trust, the Stanley Foundation and the Stanley Psychiatric Research Center at the Broad Institute. Genotyping was carried out at the Broad Institute. During my training I was employed by Barnet Enfield and Haringey NHS Trust, and the Camden and Islington NHS Foundation Trust who supported my research sessions. 4 ABSTRACT Objectives: Alcohol dependence (AD) commonly co-occurs with bipolar disorder (BP) and schizophrenia (SZ). Together these heritable (and cross-heritable disorders) account for significant morbidity and mortality. The genetic comorbidity between AD, BP, and SZ was investigated to find genetic factors affecting risk for developing AD. Methods: Subjects were from the UCL AD (n=586), BP, and SZ samples and supernormal controls (SNC; up to 603 subjects). The BP and SCZ subjects were further categorized as having comorbid AD (BPALC n=143; SZALC n=77) or without AD comorbidity (BPnonALC n=367; SZnonALC n=384). The following single gene association study or Genome-Wide Association Studies (GWAS) of the above phenotypes were performed: i) Seven SNPs previously associated with AD in the GABRA2 gene were genotyped in the AD cases and SNCs. ii) GWAS of BPALC vs SNC; and BPALC vs BPnonALC. iii) GWAS of SZALC vs SNC; and SZALC vs SZnonALC. iv) Meta-analysis of BPALC and SZALC GWAS data. Single marker tests, and gene-based permutation tests on all SNPs within a 50kb region flanking each gene, were performed. Genes previously implicated with AD and related phenotypes were tested for association in the datasets. Pathways analysis were performed on all genes uncorrected p<0.01. 5 Results: i) None of the GABRA2 SNPs showed association with AD. ii-iv) No GWAS SNP met the genome-wide significance threshold. Several gene wide tests with CNS genes suggested replication of prior AD findings. AD implicated pathways included neuronal generation; inflammation; reaction to inorganic substance; transportation; and tyrosine metabolism. Conclusions: No significant single marker associations were detected in the AD sample or comorbid AD groups. Potential candidate genes were suggestively implicated by gene-based analysis and literature replication. Possible mechanisms for AD susceptibility genes in affective/psychotic disorders are discussed. This exploratory study was underpowered to detect genome wide significance and larger studies are needed. 6 TABLE OF CONTENTS AUTHOR NOTE .......................................................................................................................................... 3 ABSTRACT ................................................................................................................................................. 4 DEDICATION ........................................................................................................................................... 10 ACKNOWLEDGEMENTS .......................................................................................................................... 11 1 CHAPTER 1: INTRODUCTION ................................................................................................................. 12 2 CHAPTER 2: WHAT IS ALCOHOL DEPENDENCE ? ....................................................................................... 16 2.1 Historical perspectives ............................................................................................................... 16 2.2 Physiology of alcohol ................................................................................................................. 18 2.3 Effects of alcohol on the body ................................................................................................... 19 2.4 Diagnostic criteria and classification ......................................................................................... 21 2.5 Epidemiology- why are alcohol use disorders important? ........................................................ 25 2.6 AD as a complex psychiatric disorder ........................................................................................ 27 2.7 Molecular genetic studies ......................................................................................................... 28 2.7.1 Challenges of genetic studies in general ............................................................................... 28 2.7.2 Alcoholism-related endophenotypes .................................................................................... 30 2.7.3 Low response to alcohol ....................................................................................................... 32 2.7.4 MaxDrinks ............................................................................................................................. 32 2.7.5 Electrophysiological phenotypes .......................................................................................... 33 2.7.6 Alcohol expectancies ............................................................................................................. 33 2.7.7 Craving ................................................................................................................................... 33 2.7.8 Personality/temperamental factors ...................................................................................... 34 2.7.9 Psychiatric comorbidity ......................................................................................................... 38 2.8 Conclusions ................................................................................................................................ 38 3 CHAPTER 3: HERITABILITY - IS ALCOHOLISM A “GENETIC” DISORDER? .......................................................... 39 3.1 What is heritability? .................................................................................................................. 39 3.2 Animal studies ........................................................................................................................... 40 3.3 Family studies ............................................................................................................................ 41 3.4 Twin studies ............................................................................................................................... 41 3.5 Adoption studies ........................................................................................................................ 43 3.6 Heritability of co-occurring psychiatric disorders ..................................................................... 45 3.7 Genes and environment ............................................................................................................ 46 3.8 A note on epigenetics ................................................................................................................ 48 4 CHAPTER 4: MAPPING AD & ALCOHOLISM: LINKAGE STUDIES .................................................................... 50 7 4.1 GENETIC MARKERS .................................................................................................................. 50 4.2 Linkage studies .......................................................................................................................... 51 4.2.1 Advantages and disadvantages of linkage studies. ............................................................... 51 4.3 Linkage study findings in AD ...................................................................................................... 52 5 CHAPTER 5: MAPPING ALCOHOLISM: ASSOCIATION STUDIES ..................................................................... 56 5.1 Approach ................................................................................................................................... 56 5.2 Candidate gene study findings in AD ......................................................................................... 57 5.2.1 The GABA system .................................................................................................................. 58 5.2.2 Alcohol metabolism genes ...................................................................................................
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism

    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(Methacrylic Acid-Co-Methyl Methacrylate) Beads

    Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(Methacrylic Acid-Co-Methyl Methacrylate) Beads

    Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads by Lindsay Elizabeth Fitzpatrick A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto © Copyright by Lindsay Elizabeth Fitzpatrick 2012 Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads Lindsay Elizabeth Fitzpatrick Doctorate of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto 2012 Abstract Poly(methacrylic acid -co- methyl methacrylate) beads were previously shown to have a therapeutic effect on wound closure through the promotion of angiogenesis. However, it was unclear how this polymer elicited its beneficial properties. The goal of this thesis was to characterize the host response to MAA beads by identifying molecules of interest involved in MAA-mediated angiogenesis (in comparison to poly(methyl methacrylate) beads, PMMA). Using a model of diabetic wound healing and a macrophage-like cell line (dTHP-1), eight molecules of interest were identified in the host response to MAA beads. Gene and/or protein expression analysis showed that MAA beads increased the expression of Shh, IL-1β, IL-6, TNF- α and Spry2, but decreased the expression of CXCL10 and CXCL12, compared to PMMA and no beads. MAA beads also appeared to modulate the expression of OPN. In vivo, the global gene expression of OPN was increased in wounds treated with MAA beads, compared to PMMA and no beads. In contrast, dTHP-1 decreased OPN gene expression compared to PMMA and no beads, but expressed the same amount of secreted OPN, suggesting that the cells decreased the expression of the intracellular isoform of OPN.
  • KCNMB3 (NM 171830) Human Untagged Clone – SC306700

    KCNMB3 (NM 171830) Human Untagged Clone – SC306700

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC306700 KCNMB3 (NM_171830) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: KCNMB3 (NM_171830) Human Untagged Clone Tag: Tag Free Symbol: KCNMB3 Synonyms: BKBETA3; HBETA3; K(VCA)BETA-3; KCNMB2; KCNMBL; SLO-BETA-3; SLOBETA3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_171830, the custom clone sequence may differ by one or more nucleotides ATGTTCCCCCTTCTTTATGAGCTCACTGCAGTATCTCCTTCTCCCTTTCCCCAAAGGACAGCCTTTCCTG CCTCAGGGAAGAAGAGAGAGACAGACTACAGTGATGGAGACCCACTAGATGTGCACAAGAGGCTGCCATC CAGTGCTGGAGAGGACCGAGCCGTGATGCTGGGGTTTGCCATGATGGGCTTCTCAGTCCTAATGTTCTTC TTGCTCGGAACAACCATTCTAAAGCCTTTTATGCTCAGCATTCAGAGAGAAGAATCGACCTGCACTGCCA TCCACACAGATATCATGGACGACTGGCTGGACTGTGCCTTCACCTGTGGTGTGCACTGCCACGGTCAGGG GAAGTACCCGTGTCTTCAGGTGTTTGTGAACCTCAGCCATCCAGGTCAGAAAGCTCTCCTACATTATAAT GAAGAGGCTGTCCAGATAAATCCCAAGTGCTTTTACACACCTAAGTGCCACCAAGATAGAAATGATTTGC TCAACAGTGCTCTGGACATAAAAGAATTCTTCGATCACAAAAATGGAACCCCCTTTTCATGCTTCTACAG TCCAGCCAGCCAATCTGAAGATGTCATTCTTATAAAAAAGTATGACCAAATGGCTATCTTCCACTGTTTA TTTTGGCCTTCACTGACTCTGCTAGGTGGTGCCCTGATTGTTGGCATGGTGAGATTAACACAACACCTGT CCTTACTGTGTGAAAAATATAGCACTGTAGTCAGAGATGAGGTAGGTGGAAAAGTACCTTATATAGAACA GCATCAGTTCAAACTGTGCATTATGAGGAGGAGCAAAGGAAGAGCAGAGAAATCTTAA Restriction Sites: SgfI-MluI ACCN: NM_171830
  • Ion Channels 3 1

    Ion Channels 3 1

    r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia.
  • Stem Cells and Ion Channels

    Stem Cells and Ion Channels

    Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Stem Cells and Ion Channels Stem Cells International Stem Cells and Ion Channels Guest Editors: Stefan Liebau, Alexander Kleger, Michael Levin, and Shan Ping Yu Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “Stem Cells International.” All articles are open access articles distributed under the Creative Com- mons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Editorial Board Nadire N. Ali, UK Joseph Itskovitz-Eldor, Israel Pranela Rameshwar, USA Anthony Atala, USA Pavla Jendelova, Czech Republic Hannele T. Ruohola-Baker, USA Nissim Benvenisty, Israel Arne Jensen, Germany D. S. Sakaguchi, USA Kenneth Boheler, USA Sue Kimber, UK Paul R. Sanberg, USA Dominique Bonnet, UK Mark D. Kirk, USA Paul T. Sharpe, UK B. Bunnell, USA Gary E. Lyons, USA Ashok Shetty, USA Kevin D. Bunting, USA Athanasios Mantalaris, UK Igor Slukvin, USA Richard K. Burt, USA Pilar Martin-Duque, Spain Ann Steele, USA Gerald A. Colvin, USA EvaMezey,USA Alexander Storch, Germany Stephen Dalton, USA Karim Nayernia, UK Marc Turner, UK Leonard M. Eisenberg, USA K. Sue O’Shea, USA Su-Chun Zhang, USA Marina Emborg, USA J. Parent, USA Weian Zhao, USA Josef Fulka, Czech Republic Bruno Peault, USA Joel C. Glover, Norway Stefan Przyborski, UK Contents Stem Cells and Ion Channels, Stefan Liebau,
  • Evolutionary Divergence and Functions of the Human Interleukin (IL) Gene Family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W

    Evolutionary Divergence and Functions of the Human Interleukin (IL) Gene Family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W

    UPDATE ON GENE COMPLETIONS AND ANNOTATIONS Evolutionary divergence and functions of the human interleukin (IL) gene family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W. Nebert3* and Vasilis Vasiliou1 1Molecular Toxicology and Environmental Health Sciences Program, Department of Pharmaceutical Sciences, University of Colorado Denver, Aurora, CO 80045, USA 2Department of Clinical Pharmacy, University of Colorado Denver, Aurora, CO 80045, USA 3Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, OH 45267–0056, USA *Correspondence to: Tel: þ1 513 821 4664; Fax: þ1 513 558 0925; E-mail: [email protected]; [email protected] Date received (in revised form): 22nd September 2010 Abstract Cytokines play a very important role in nearly all aspects of inflammation and immunity. The term ‘interleukin’ (IL) has been used to describe a group of cytokines with complex immunomodulatory functions — including cell proliferation, maturation, migration and adhesion. These cytokines also play an important role in immune cell differentiation and activation. Determining the exact function of a particular cytokine is complicated by the influence of the producing cell type, the responding cell type and the phase of the immune response. ILs can also have pro- and anti-inflammatory effects, further complicating their characterisation. These molecules are under constant pressure to evolve due to continual competition between the host’s immune system and infecting organisms; as such, ILs have undergone significant evolution. This has resulted in little amino acid conservation between orthologous proteins, which further complicates the gene family organisation. Within the literature there are a number of overlapping nomenclature and classification systems derived from biological function, receptor-binding properties and originating cell type.
  • The Β4-Subunit of the Large-Conductance Potassium Ion Channel Kca1.1 Regulates Outflow Facility in Mice

    The Β4-Subunit of the Large-Conductance Potassium Ion Channel Kca1.1 Regulates Outflow Facility in Mice

    Glaucoma The β4-Subunit of the Large-Conductance Potassium Ion Channel KCa1.1 Regulates Outflow Facility in Mice Jacques A. Bertrand,1 Martin Schicht,2 W. Daniel Stamer,3 David Baker,4 Joseph M. Sherwood,1 Elke Lütjen-Drecoll,2 David L. Selwood,5 and Darryl R. Overby1 1Department of Bioengineering, Imperial College London, London, United Kingdom 2Department of Anatomy II, University of Erlangen-Nürnberg, Erlangen, Germany 3Department of Ophthalmology, Duke University, Durham, North Carolina, United States 4Department of Neuroinflammation, University College London Institute of Neurology, University College London, London, United Kingdom 5Department of Medicinal Chemistry, Wolfson Institute for Biomedical Research, University College London, London, United Kingdom Correspondence: Darryl R. Overby, PURPOSE. The large-conductance calcium-activated potassium channel KCa1.1 (BKCa,maxi- Department of Bioengineering, K) influences aqueous humor outflow facility, but the contribution of auxiliary β-subunits Imperial College London, London to KCa1.1 activity in the outflow pathway is unknown. SW7 2AZ, United Kingdom; [email protected]. METHODS. Using quantitative polymerase chain reaction, we measured expression of β-subunit genes in anterior segments of C57BL/6J mice (Kcnmb1-4) and in cultured Received: August 20, 2019 human trabecular meshwork (TM) and Schlemm’s canal (SC) cells (KCNMB1-4). We also Accepted: January 9, 2020 α Published: March 23, 2020 measured expression of Kcnma1/KCNMA1 that encodes the pore-forming -subunit. Using confocal immunofluorescence, we visualized the distribution of β4 in the conven- Citation: Bertrand JA, Schicht M, tional outflow pathway of mice. Using iPerfusion, we measured outflow facility in enucle- β Stamer WD, et al.
  • Dual Separable Feedback Systems Govern Firing Rate Homeostasis Yelena Kulik1†, Ryan Jones1†, Armen J Moughamian2, Jenna Whippen1, Graeme W Davis1*

    Dual Separable Feedback Systems Govern Firing Rate Homeostasis Yelena Kulik1†, Ryan Jones1†, Armen J Moughamian2, Jenna Whippen1, Graeme W Davis1*

    RESEARCH ARTICLE Dual separable feedback systems govern firing rate homeostasis Yelena Kulik1†, Ryan Jones1†, Armen J Moughamian2, Jenna Whippen1, Graeme W Davis1* 1Department of Biochemistry and Biophysics, Kavli Institute for Fundamental Neuroscience, University of California, San Francisco, San Francisco, United States; 2Department of Neurology, University of California, San Francisco, San Francisco, United States Abstract Firing rate homeostasis (FRH) stabilizes neural activity. A pervasive and intuitive theory argues that a single variable, calcium, is detected and stabilized through regulatory feedback. A prediction is that ion channel gene mutations with equivalent effects on neuronal excitability should invoke the same homeostatic response. In agreement, we demonstrate robust FRH following either elimination of Kv4/Shal protein or elimination of the Kv4/Shal conductance. However, the underlying homeostatic signaling mechanisms are distinct. Eliminating Shal protein invokes Kru¨ppel-dependent rebalancing of ion channel gene expression including enhanced slo, Shab, and Shaker. By contrast, expression of these genes remains unchanged in animals harboring a CRISPR- engineered, Shal pore-blocking mutation where compensation is achieved by enhanced IKDR. These different homeostatic processes have distinct effects on homeostatic synaptic plasticity and animal behavior. We propose that FRH includes mechanisms of proteostatic feedback that act in parallel with activity-driven feedback, with implications for the pathophysiology of human channelopathies. DOI: https://doi.org/10.7554/eLife.45717.001 *For correspondence: [email protected] Introduction †These authors contributed Firing Rate Homeostasis (FRH) is a form of homeostatic control that stabilizes spike rate and informa- equally to this work tion coding when neurons are confronted by pharmacological, genetic or environmental perturba- tion (Davis, 2013; O’Leary et al., 2014).
  • Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy

    Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy

    Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Vernau, Karen M., Jonathan A. Runstadler, Emily A. Brown, et al. Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy. Gerard Roel Rutteman, ed. PLoS ONE 8(3): e57195, 2013. As Published http://dx.doi.org/10.1371/journal.pone.0057195 Publisher Public Library of Science Version Final published version Citable link http://hdl.handle.net/1721.1/78615 Terms of Use Creative Commons Attribution Detailed Terms http://creativecommons.org/licenses/by/2.5/ Genome-Wide Association Analysis Identifies a Mutation in the Thiamine Transporter 2 (SLC19A3) Gene Associated with Alaskan Husky Encephalopathy Karen M. Vernau1*, Jonathan A. Runstadler2¤, Emily A. Brown1, Jessie M. Cameron3, Heather J. Huson2, Robert J. Higgins2, Cameron Ackerley3, Beverly K. Sturges1, Peter J. Dickinson1, Birgit Puschner1, Cecilia Giulivi1, G. Diane Shelton4, Brian H. Robinson3, Salvatore DiMauro5, Andrew W. Bollen6, Danika L. Bannasch1 1 University of California Davis, Davis, California, United States of America, 2 University of Alaska Fairbanks, Fairbanks, Alaska, United States of America, 3 Research Institute, The Hospital for Sick Children, Toronto, Ontario, Canada, 4 Department of Pathology, University of California San Diego, La Jolla, California, United States of America, 5 Department of Neurology, Columbia University Medical Center, New York, New York, United States of America, 6 Department of Pathology, School of Medicine, University of California San Francisco, San Francisco, California, United States of America Abstract Alaskan Husky Encephalopathy (AHE) has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS).
  • Transporters

    Transporters

    Alexander, S. P. H., Kelly, E., Mathie, A., Peters, J. A., Veale, E. L., Armstrong, J. F., Faccenda, E., Harding, S. D., Pawson, A. J., Sharman, J. L., Southan, C., Davies, J. A., & CGTP Collaborators (2019). The Concise Guide to Pharmacology 2019/20: Transporters. British Journal of Pharmacology, 176(S1), S397-S493. https://doi.org/10.1111/bph.14753 Publisher's PDF, also known as Version of record License (if available): CC BY Link to published version (if available): 10.1111/bph.14753 Link to publication record in Explore Bristol Research PDF-document This is the final published version of the article (version of record). It first appeared online via Wiley at https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14753. Please refer to any applicable terms of use of the publisher. University of Bristol - Explore Bristol Research General rights This document is made available in accordance with publisher policies. Please cite only the published version using the reference above. Full terms of use are available: http://www.bristol.ac.uk/red/research-policy/pure/user-guides/ebr-terms/ S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Transporters. British Journal of Pharmacology (2019) 176, S397–S493 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Transporters Stephen PH Alexander1 , Eamonn Kelly2, Alistair Mathie3 ,JohnAPeters4 , Emma L Veale3 , Jane F Armstrong5 , Elena Faccenda5 ,SimonDHarding5 ,AdamJPawson5 , Joanna L Sharman5 , Christopher Southan5 , Jamie A Davies5 and CGTP Collaborators 1School of Life Sciences,