innovative, web-based, database-driven peer review and online submission workflow solution
MON2 guides Wntless transport to the Golgi through recycling endosomes
Journal: Cell Structure and Function
Manuscript ID CSF-2020-0012.R1 Manuscript Type:ForFull articlesPeer Review Date Submitted by the 30-Apr-2020 Author:
Complete List of Authors: Zhao, Shen-Bao; Jiangnan University, School of Biotechnology Dean, Neta; Stony Brook University, Department of Biochemistry and Cell Biology Gao, Xiao-Dong; Jiangnan University, School of Biotechnology Fujita, Morihisa; Jiangnan University, School of Biotechnology
Keywords: membrane trafficking, MON2, recycling endosomes, Wntless
Categories: Intracellular traffic and organelles, Membrane traffic and organelles
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 1 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 MON2 guides Wntless transport to the Golgi through recycling endosomes 2 3 Shen-Bao Zhao1, Neta Dean2, Xiao-Dong Gao1, and Morihisa Fujita1, *
4 5 1Key Laboratory of Carbohydrate Chemistry, Ministry of Education, School of 6 Biotechnology, Jiangnan University, Wuxi, Jiangsu 214122, China 7 2Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, 8 NY, 11794-5215, USA 9 10 *Corresponding author: Morihisa Fujita, PhD 11 ForE-mail: Peer [email protected] Review 12 Tel/Fax: +86-510-851-97071 13
14 Keywords: membrane trafficking, MON2, recycling endosomes, Wntless 15
16 Running title: MON2 guides Wntless endocytic transport
17
18 Footnotes:
19 D-KO: DOPEY1 and DOPEY2 double-knockout, EE: early endosomes, HEK293:
20 human embryonic kidney 293, KO: knockout, LE: late endosomes, MCC: Manders
21 correlation coefficients, PCC: Pearson’s correlation coefficient, PM: plasma membrane,
22 RE: recycling endosomes, SNX3: sorting nexin 3, TGN: trans-Golgi network, Wls:
23 Wntless, WT: wild-type.
24
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 2 of 54
1 Abstract
2 Endocytic cargos are transported to recycling endosomes (RE) but how these sorting
3 platforms are generated is not well understood. Here we describe our biochemical and
4 live imaging studies of the conserved MON2-DOPEY complex in RE formation.
5 MON2 mainly co-localized with RE marker RAB4B in peripheral dots and perinuclear
6 region. The peripheral RE approached, interacted with, and separated from sorting
7 nexin 3 (SNX3)-positive early endosomes (EE). Membrane-bound DOPEY2 was
8 recruited to RE dependent upon MON2 expression, and showed binding abilities to 9 kinesin and dynein/dynactinFor motor Peer proteins. Review MON2-knockout impaired segregation of 10 RE from EE and led to a decreased tubular recycling endosomal network, whereas RE
11 was accumulated at perinuclear regions in DOPEY2-knockout cells. MON2 depletion
12 also impaired intracellular transferrin receptor recycling, as well as retrograde transport
13 of Wntless during its passage through RE before delivery from EE to the Golgi.
14 Together, these data suggest that the MON2 drives separation of RE from EE and is
15 required for efficient transport of endocytic cargo molecules.
16 17 18 19
2
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 3 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Introduction
2 A balance between synthesis and degradation of proteins is required to maintain
3 the homeostasis of cellular processes (Cullen and Steinberg, 2018). The endosomal
4 system contributes to this balance through vesicular sorting of proteins for degradation
5 and recycling to various membrane compartments. Mammalian cells contain a complex
6 set of endosomal compartments, including early endosomes (EE), late endosomes (LE),
7 recycling endosomes (RE), and lysosomes (Klumperman and Raposo, 2014). The EE
8 are the first carrier vesicles into which plasma membrane (PM) proteins and lipids enter 9 when internalized (JovicFor et al. ,Peer 2010). EE undergoReview structural and functional maturation 10 to form either LE (Scott et al., 2014), whose cargos are transported to lysosomes for
11 degradation or RE, whose cargos are sorted and transported back to the PM, or the
12 Golgi (Taguchi, 2013). Although RE play pivotal roles in maintaining cellular
13 homeostasis, the mechanism for how they regulate protein and lipid sorting is not well
14 understood.
15 RE are mainly localized at the perinuclear regions as transient vesicular/tubular
16 structures as well as peripheral dot-like puncta (Grant and Donaldson, 2009; Maxfield
17 and McGraw, 2004). The formation and maintenance of endosomal compartments
18 involve a host of different Rab GTPases (Pfeffer, 2013; Pfeffer, 2017) whose GTP-
19 bound state at membranes is required for vesicle formation from the donor or vesicle
20 fusion with the acceptor. RAB4 is found at tubular structures of EE or RE (D'Souza et
21 al., 2014; de Wit et al., 2001; Perrin et al., 2013; Sonnichsen et al., 2000), while RAB11
22 is mainly enriched in RE (Green et al., 1997; Ullrich et al., 1996). To date, several
23 multiprotein complexes have been reported that cooperate to generate and move tubules
24 from endosomes (Gautreau et al., 2014). Rab GTPases and kinesin provide the
25 mechanical force for tubularization and fission of tubular/vesicular structures from the
26 EE membrane (Delevoye et al., 2014; Etoh and Fukuda, 2019; Shakya et al., 2018).
27 Most kinesins mediate transport toward the plus-ends of microtubules (Hirokawa et al.,
28 2009). However, RE are clustered around the microtubule-organizing center (MTOC)
3
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 4 of 54
1 (Maxfield and McGraw, 2004) located at the minus-ends of microtubules (Martin and
2 Akhmanova, 2018). Thus, it is likely that coordination of other factors and motor
3 proteins regulates RE tubular network and movement.
4 Yeast Mon2 is a peripheral membrane protein in the trans-Golgi network (TGN)
5 (Efe et al., 2005) that, with its cytosolic binding partner, Dop1, is implicated in
6 endosome-to-Golgi transport (Gillingham et al., 2006). We recently described a role
7 for yeast Dop1 in retrograde transport from the TGN to the Golgi (Zhao et al., 2019).
8 The yeast TGN is assumed to be functionally equivalent to mammalian EE and RE 9 (Day et al., 2018). Mon2For and PeerDop1 has beenReview highly conserved through evolution. In 10 metazoans, there are two Dop1 orthologues, named DOPEY1 and DOPEY2 (Barbosa
11 et al., 2010; Mahajan et al., 2019; McGough et al., 2018). Even DOPEY1 is monomer
12 and DOPEY2 is self-interacted, both DOPEY1 and DOPEY2 were reported to interact
13 with mammalian MON2 (Mahajan et al., 2019; McGough et al., 2018). DOPEY1
14 interacts with the KLC2, the light chain of kinesin-1 motor protein (Mahajan et al.,
15 2019), suggesting that MON2-DOPEY complex mediates vesicular/tubular movement.
16 Retrograde transport of Wntless (Wls), which is a critical cargo receptor for Wnt
17 secretion (Banziger et al., 2006), from EE to the Golgi requires mammalian MON2-
18 DOPEY2 (McGough et al., 2018). After internalization of Wls from the PM, it is
19 transported to EE, and then transported to the Golgi (Harterink et al., 2011; Port et al.,
20 2008). In Caenorhabditis elegans, Wls is transported from RE to the Golgi (Bai and
21 Grant, 2015). However, it remains unclear whether Wls is directly transported from EE
22 to the Golgi or through RE in mammalian cells. It is because RE are mainly localized
23 at the perinuclear Golgi regions as transient vesicular/tubular structures as well as
24 peripheral dot-like puncta (Grant and Donaldson, 2009; Maxfield and McGraw, 2004).
25 Recent findings suggest that both the TGN and RE are functionally overlapping and RE
26 attach to the trans-side of Golgi stacks under nocodazole treatment (Fujii et al., 2020).
27 It is still not clear how MON2-DOPEY proteins are involved in Wls retrograde
28 trafficking.
4
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 5 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Here, we show that the MON2 mainly localizes at RE in human embryonic kidney
2 293 (HEK293) cells. Membrane-bound DOPEY proteins were recruited to RE
3 dependent upon MON2 expression. MON2 knockout (MON2-KO) impaired the
4 segregation of RE from EE. Wls passed through RE dependent upon MON2 for
5 transport to the Golgi. These findings suggest that the MON2-DOPEY complex
6 regulates cargo transport by regulating RE movement. 7
For Peer Review
5
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 6 of 54
1 Material and methods
2 Cell culture and gene editing by CRISPR/Cas9
3 HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)
4 supplemented with 10% fetal bovine serum. Cells stably expressing 3×FLAG-tagged
5 DOPEY1 or DOPEY2 were obtained by transfection of pME-Hyg-DOPEY1-3FLAG
6 or pME-Hyg-DOPEY2-3FLAG and selection with hygromycin B (400 μg/ml).
7 Transfection of DNA constructs was performed using Lipofectamine 2000 (Thermo
8 Fisher, Waltham, MA) according to the manufacturer’s instructions. To generate 9 MON2, DOPEY1, DOPEY2For Peer and VPS35 Review gene KO cell lines, HEK293 cells were 10 transiently transfected with pX330-EGFP plasmids containing the target sequences.
11 After 48 h, cells with EGFP were sorted by an S3e Cell Sorter (Bio-Rad Laboratories,
12 Hercules, CA). The collected cells were cultured for more than 10 days and subjected
13 to limiting dilution to obtain clonal KO cells. Genomic DNA was extracted from
14 individual clones and subjected to PCR. Clones with no wild-type (WT) allele were
15 selected, and the DNA sequences around the KO targets were analyzed. The DNA
16 sequences of the individual KO cell lines are listed in Supplemental Table. S1.
17
18 Antibodies and reagents
19 The following commercial antibodies were used: mouse anti-FLAG (#F3165;
20 Sigma-Aldrich, St. Louis, MO), rabbit anti-FLAG (#20543-1-AP; Proteintech, Chicago,
21 IL), rabbit anti-HA (#3724; Cell Signaling Technology, Danvers, MA), mouse anti-HA
22 (#H3663; HA-7; Sigma-Aldrich), mouse anti-Golgin97 (#97537; Cell Signaling
23 Technology), rabbit anti-Golgin97 (#13192; Cell Signaling Technology), mouse anti-
24 GM130 (#610823; BD Transduction Laboratories, Franklin Lakes, NJ), mouse anti-β-
25 tubulin (#HC101-01; TransGen Biotech, Beijing, China), mouse anti-LAMP1 (H4A3;
26 Developmental Studies Hybridoma Bank, Iowa City, IA), rabbit anti-VPS35
27 (#ab157220; Abcam), rabbit anti-calnexin (#C4731; Sigma-Aldrich), mouse anti-
28 Giantin (#ab37266; Abcam), rabbit anti-DOPEY1 (#HPA027902; Sigma-Aldrich),
6
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 7 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 rabbit anti-MON2 (#ab206685; Abcam), rabbit anti-tRFP (#AB233; Evrogen,
2 Moscow, Russia), mouse anti-TfnR (#13-6800; Thermo Fisher), rabbit anti-
3 SNX3(#10772-1-AP; Proteintech). Human Transferrin CF™488A (#00081; Biotium,
4 Fremont, CA). Nocodazole (#M1404; Sigma-Aldrich).Anti-rabbit or anti-mouse IgG
5 Alexa Fluor-conjugated secondary antibodies (Thermo Fisher) were used for detection
6 by confocal microscopy. HRP-conjugated anti-mouse IgG (#HS211-01; TransGen
7 Biotech) and anti-rabbit IgG (#HS101-01; TransGen Biotech) were used as secondary
8 antibodies for western blotting. 9 For Peer Review 10 Plasmids
11 The plasmids for target gene KO were constructed as previously described (Liu et
12 al., 2018). Human genes were amplified from cDNAs isolated from HEK293 or HeLa
13 cells. Alternatively, cDNAs from Ultimate™ ORF LITE clones (Thermo Fisher) were
14 used as templates. In-fusion PCR cloning or restriction enzyme digestion followed by
15 ligation was used for plasmid construction. Full-length DOPEY1 was ligated into the
16 XhoI/MluI site of pME-Hyg-3FLAG to generate pME-Hyg-DOPEY1-3FLAG. pME-
17 Hyg-DOPEY2-3FLAG was obtained by in-fusion cloning of full-length DOPEY2 into
18 the EcoRI/MluI site of pME-Hyg-3FLAG. pME-Hyg-DOPEY1-FLAG-EGFP and
19 pME-Hyg-DOPEY2-FLAG-EGFP were obtained by replacement of the 3FLAG
20 fragment in pME-Hyg-DOPEY1-3FLAG or DOPEY2-3FLAG with the FLAG-EGFP
21 fragment, respectively.
22 The plasmid pME-3HA-MON2 was obtained by in-fusion cloning of full-length
23 MON2 into the MluI/NotI site of pME-3HA. pME-EGFP-MON2 and pME-TagRFP-
24 MON2 were obtained by replacement of the 3HA fragment in pME-3HA-MON2 with
25 EGFP or TagRFP, respectively. pME-EGFP-RAB4A, pME-EGFP-RAB4B, pME-
26 EGFP-RAB5, pME-EGFP-RAB7, and pME-EGFP-RAB11 were obtained by in-fusion
27 cloning of each full-length gene into the SalI/NotI site of pME-EGFP. pME-EGFP-
28 RAB5Q79L was obtained by site-directed mutagenesis of pME-EGFP-RAB5. pME-
7
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 8 of 54
1 TagRFP-RAB4B was obtained by in-fusion cloning of full-length RAB4B into the
2 SalI/NotI site of pME-TagRFP. pME-BFP-SNX3 and pME-EGFP-SNX3 were
3 obtained by in-fusion cloning of full-length SNX3 into the SalI/XbaI site of pME-BFP
4 and pME-EGFP, respectively.
5 The plasmid pME-Wls-EGFP was obtained by in-fusion cloning of full-length Wls
6 into the EcoRI/MluI site of pME-EGFP. To construct pME-Hyg-HA-Wls as described
7 previously (Varandas et al., 2016), we inserted the HA fragment into the largest
8 extracellular loop and C-terminus of Wls. The plasmid mScarlet-Giantin was obtained 9 from Addgene (#85048).For The Peer plasmid Review mNeonGreen-Giantin was obtained from 10 Addgene (#98880). pME-KLC2-3HA was obtained by in-fusion cloning of full-length
11 KLC2 into the XhoI/MluI site of pME-3HA. pME-3HA-DCTN1 was obtained by in-
12 fusion cloning of full-length DCTN1 into the MluI/NotI site of pME-3HA. pME-sOGT-
13 3HA was obtained by in-fusion cloning of full-length sOGT into the MluI/NotI site of
14 pME-3HA.
15
16 Confocal microscopy
17 For fixed samples, glass-bottom dishes (#D35-10-1-N; Cellvis, Mountain View,
18 CA) or sterile glass coverslips in culture dishes were coated with 0.1% gelatin (#G7041;
19 Sigma-Aldrich) for 15 min at room temperature, followed by complete removal of
20 excess gelatin. After transfection, cells were seeded into 24-well plates with sterile glass
21 coverslips or into glass-bottom dishes. When the cell density reached about 60%
22 confluence, the cells were fixed with −20°C cold methanol as described previously
23 (Bhattacharyya et al., 2010). Alternatively, the cells were fixed with 4%
24 paraformaldehyde solution (#P0099; Beyotime, Shanghai, China) at room temperature
25 for 20 min, permeabilized with Saponin (#P0095; Beyotime) for 10 min, and blocked
26 with blocking buffer (#P0260; Beyotime) for 1 h at room temperature. The cells were
27 then incubated with primary antibodies diluted in QuickBlock™ Primary Antibody
28 Dilution Buffer (#P0262; Beyotime) overnight at 4°C. After five gentle washes with
8
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 9 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 phosphate-buffered saline (PBS), the cells were incubated with an Alexa Fluor-
2 conjugated secondary antibody (Thermo Fisher) at room temperature for 1 h. Finally,
3 the cells were washed gently eight times with PBS and mounted on slides in Antifade
4 Mounting Medium (#P0126; Beyotime) with or without Hoechst 33258 dye. Images
5 were obtained with a Nikon Eclipse Ti-E inverted confocal microscope equipped with
6 a Plan Apo 100×/1.4 NA oil objective and a C2si scan head camera. NIS-Element AR
7 software (Nikon, Tokyo, Japan) was used to operate the microscope. MCCs were
8 calculated using the JACoP plugin of ImageJ (https://imagej.nih.gov/ij/). We first set 9 the appropriate thresholdFor value Peer of the pixels Review for both color channels (e.g., Red vs Green). 10 The M1 coefficient represented the ratio of the “sum of pixels from the former channel
11 (Red) that colocalizes with the latter channel (Green)” to the “total intensity of pixels
12 in the former channel (Red)”. M2 measured the opposite channel to M1.
13
14 Live-cell microscopy
15 Cells were cultured and replated onto glass-bottom dishes precoated with 0.1%
16 gelatin. When the cell density reached about 60% confluence, the cells were imaged in
17 pre-warmed FluoroBrite™ DMEM (#A1896701; Thermo Fisher) supplemented with
18 10% fetal bovine serum. Images were obtained with a Leica SP8 (Wetzlar, Germany)
19 scanning confocal microscope equipped with a Plan Apo 60×/1.4 NA oil objective and
20 solid-state lasers. We set the frame size to 512512 pixels, the digital zoom to 1.5–2.5 21 for one or two cells, and the pinhole to 1.8 Airy units with bidirectional mode for
22 scanning. The highest sensitivity detector was used for the weaker fluorescence of
23 TagRFP-MON2. All live image videos can be downloaded from:
24 https://drive.google.com/drive/folders/1beD9ONP9k8yKECHoApZhTgk1qomEHxlz?
25 usp=sharing
26
27 Wls internalization assay
28 For internalization of surface-labeled HA-Wls, transfected cells were replated into
9
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 10 of 54
1 24-well plates, rinsed with ice-cold PBS, and incubated with a rabbit anti-HA antibody
2 (#3724; Cell Signaling Technology) diluted 1:250 in OPTI-MEM (#31985062; Thermo
3 Fisher) for 15 min. After a gentle wash with PBS to remove unbound antibody, an
4 internalization assay was performed by placing the cells in normal medium at 37°C.
5 The cells were then fixed with −20°C cold methanol, incubated with a DyLight 405-
6 labeled goat anti-rabbit secondary antibody (#A0605; Beyotime), and imaged.
7
8 Cell fractionation 9 Cells stably expressingFor Peer DOPEY1-3FLAG Review or DOPEY2-3FLAG (1107) were 10 placed in 1 ml of hypotonic buffer (10 mM Tris-HCl, pH 7.4, 1 mM Dithiothreitol, 0.2
11 mM MgCl2, 5 mM KCl, protein inhibitor cocktail, 1 mM PMSF), allowed to swell on 12 ice for 5 min, and lysed by 20 strokes in a Dounce homogenizer. The nuclei were
13 removed from the homogenate by centrifugation at 1000×g for 15 min at 4°C. Sucrose
14 was added to the supernatant to a final concentration of 0.25 M, followed by
15 centrifugation at 10,000×g for 1 h at 4°C. The resulting pellet (P10) containing the PM
16 and endoplasmic reticulum membrane was resuspended in 1 ml of lysis buffer (50 mM
17 Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, protease inhibitor cocktail, 1 mM
18 PMSF, 1% NP-40), and centrifuged at 100,000×g for 1 h at 4°C. The obtained pellet
19 (P100) containing the Golgi, lysosomes, endosomes, and other membrane vesicles was
20 resuspended in 1 ml of lysis buffer. Finally, the supernatant (S100) containing
21 cytoplasmic proteins was adjusted to 1 ml with lysis buffer. Tubulin was used as the
22 control for the fractionation.
23
24 Immunoprecipitation
25 Cells were lysed in lysis buffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM
26 EDTA, protease inhibitor cocktail, 1 mM PMSF, 1% NP-40) on ice for 30 min, and
27 centrifuged at 21,500×g for 10 min to remove any intact cells and cell debris. Anti-
28 FLAG M2 affinity gel (#A2220; Sigma-Aldrich) was added to the supernatant and
10
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 11 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 rotated at 4°C for 1 h. After four gentle washes with PBS, the bound proteins were
2 eluted by FLAG peptide or direct boiling in SDS sample buffer. Samples were analyzed
3 by immunoblotting or silver staining. The bands corresponding to DOPEY2 and MON2
4 were identified by liquid chromatography-tandem mass spectrometry in which
5 performed by Shanghai Applied Protein Technology Co.,Ltd (Shanghai, China).
6
7 SDS-PAGE and immunoblotting
8 Samples were separated in 8% or 4%–20% SDS-PAGE gels, and transferred to 9 PVDF membranes. TheFor membranes Peer were blockedReview in 5% milk in TBST buffer (10 mM 10 Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% (v/v) Tween-20) and probed with appropriate
11 antibodies diluted in QuickBlock™ Primary Antibody Dilution Buffer (#P0256;
12 Beyotime) for 1 h at room temperature or 4°C overnight. After three washes with TBST
13 for 10 min each, the membranes were incubated with HRP-conjugated secondary
14 antibodies diluted in 5% milk in TBST buffer for 1 h at room temperature, and washed
15 three times in TBST buffer. Bound antibodies were detected with ECL Substrate
16 (#1705060; Bio-Rad). For reuse of the membranes to detect the loading control, the
17 membranes were treated with stripping buffer (#P0025N; Beyotime). Images were
18 captured using an Amersham Imager 680 Camera System (GE Healthcare, Princeton,
19 NJ) or Tanon 5200 Automatic Chemiluminescence Image Analysis System (Shanghai,
20 China). The band intensities were quantified using ImageJ.
21
22 Transferrin recycling assay
23 HEK293 WT or MON2-KO cells were incubated with CF™488A -coupled Tfn
24 (40 μg/ml) at 4°C for 1 h, followed by rapid washing with acid wash buffer (50 mM
25 glycine, 100 mM NaCl, pH 3.0) for 2 min. The cells were then incubated with
26 prewarmed medium in the presence of excess Holo-Tfn (100 μg/ml) for specified
27 periods of time at 37°C. At the end of the incubation, the cells were gently washed with
28 PBS and fixed with cold methanol for confocal analysis. The amounts of intracellular
11
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 12 of 54
1 Tfn in six fields were quantified by ImageJ and normalized by the cell number in each
2 field.
3
For Peer Review
12
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 13 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Results
2 Both DOPEY1 and DOPEY2 interact with MON2
3 To better understand DOPEY functions, we searched for DOPEY2 interacting
4 proteins. A ~200 kDa protein that specifically immunoprecipitated with 3×FLAG-
5 tagged DOPEY2 (DOPEY2-3FLAG) was identified by mass spectrometry as MON2
6 (Supplemental Figure S1a). Recently, McGough et al. showed that DOPEY2 associates
7 with MON2 (McGough et al., 2018), while Mahajan et al. reported that DOPEY1, but
8 not DOPEY2, binds to MON2 (Mahajan et al., 2019). We confirmed that MON2 9 immunoprecipitated withFor both PeerDOPEY1-3FLAG Review or DOPEY2-3FLAG (Figure 1a, b). 10 To probe their interaction, we analyzed the localization of DOPEY1, DOPEY2
11 and MON2. Subcellular fractionation revealed that, as expected, DOPEY1 and
12 DOPEY2 were mainly associated with membranes (Supplemental Figure S1b). GFP-
13 tagged DOPEY1 (DOPEY1-FLAG-EGFP) showed weak co-localization with a Golgi
14 marker, Giantin, with the majority of DOPEY1 localized in punctate foci throughout
15 the cytoplasm (Figure 1c). In contrast to DOPEY1, DOPEY2 was not detectable at all
16 in the Golgi and was only present in these cytoplasmic foci (Figure 1c). Because both
17 DOPEY1 and DOPEY2 interacted with MON2 in mammalian cells, we monitored
18 DOPEY1-FLAG-EGFP and DOPEY2-FLAG-EGFP localization as a function of
19 MON2 expression (TagRFP-MON2). As shown in Figure 1d, both DOPEY1 and
20 DOPEY2 were strongly recruited to perinuclear structures after co-expression with
21 TagRFP-MON2. These results indicate that MON2 could associate with both DOPEY1
22 and 2 proteins on the membranes.
23
24 Mammalian MON2 mainly localize at RE
25 Since MON2 has been implicated as scaffolding protein that recruits cytosolic
26 DOPEY proteins to the specific membrane structures, we next determined MON2
27 localization in HEK293 cells. GFP-tagged MON2 (EGFP-MON2) almost completely
28 co-localized with TagRFP-tagged MON2 (TagRFP-MON2), suggesting that MON2
13
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 14 of 54
1 localization is the same whether it is tagged with GFP or RFP (Figure 2a). Perinuclear
2 MON2 co-localized with the trans-Golgi/TGN marker Golgin97 and cis-Golgi marker
3 GM130 (Figure 2a). Since endocytic recycling compartments are concentrated between
4 the Golgi ribbon (Saraste and Prydz, 2019) and recent findings revealed that RE attach
5 to the trans-side of Golgi stacks (Fujii et al., 2020), we sought to determine if MON2 is
6 enriched in endosomes rather than the Golgi. To verify where MON2 positions in the
7 Golgi and endosomes, we treated cells with nocodazole to introduce mini-Golgi stacks.
8 After 3 h nocodazole treatment, TagRFP-MON2 was localized to trans-side of mini- 9 Golgi stacks by comparisonFor with Peer GM130 (cis-Golgi)/GiantinReview (medial-Golgi) or Giantin 10 /Golgin97 (trans-Golgi/TGN) (Supplemental Figure S2a, b). In addition, MON2 was
11 separated from Golgin97, suggesting that MON2 is not localized in the trans-
12 Golgi/TGN (Supplemental Figure S2b). To further determine the MON2 localization,
13 we compared MON2 to various endosomal markers, including those for EE, LE, and
14 RE. The small Rab GTPases RAB4A and RAB4B are enriched at the tubular
15 subdomain of EE and RE (D'Souza et al., 2014; Perrin et al., 2013), whereas RAB11 is
16 localized to RE (Green et al., 1997; Ren et al., 1998; Ullrich et al., 1996). The degree
17 with which MON2 and each of these markers co-localized was quantified by Manders
18 correlation coefficients (MCCs), which measures the proportionality of pixel intensity
19 (Bolte and Cordelieres, 2006) (Figure 2b). These analyses demonstrated TagRFP-
20 MON2 predominantly co-localized with RAB4A, RAB4B, or RAB11 in the RE (Figure
21 2a). MON2 co-localized predominantly with RAB4B: M1 of MCC = 0.636±0.039
22 (TagRFP-MON2 overlapping with EGFP-RAB4B) and M2 of MCC = 0.599±0.035
23 (EGFP-RAB4B overlapping with TagRFP-MON2) (n=15 for both, mean±SE),
24 meaning that 63.6% of MON2 overlapped with RAB4B and 59.9% of RAB4B
25 overlapped with MON2. RAB4A and RAB11 also co-localized with MON2, while the
26 M2 values (the percentage of EGFP-RAB4A or RAB11 overlapping with TagRFP-
27 MON2) were slightly lower.
28 We also examined MON2 co-localization with sorting nexin SNX3 as it was
14
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 15 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 reported to interact with MON2 during endosome vesicle/tubule formation (McGough
2 et al., 2018). SNX3 is an EE marker; it specifically binds to phosphatidylinositol-3-
3 phosphate on the membrane of EE and mediates SNX3-retromer complex-dependent
4 vesicular/tubular structure formation (Harterink et al., 2011; McGough et al., 2018; Xu
5 et al., 2001). In comparisons of TagRFP-MON2 with EGFP-SNX3, the M1 of MCC
6 was 0.069±0.009 and the M2 of MCC was 0.082±0.012 (n=19 for both, mean±SE),
7 suggesting MON2 and SNX3 rarely co-localized (Figure 2b and Supplemental Figure
8 S3). A similar lack of co-localization was also observed for other EE and LE markers 9 such as RAB5 and RAB7For (Figure Peer 2b and Supplemental Review Figure S3). Taken together, our 10 results indicate that MON2 is primarily localized to RE.
11
12 RAB4B-positive RE transiently interact with EE
13 To examine the dynamics and interactions of MON2 with endosomes in living
14 cells, we co-expressed EGFP-SNX3 or EGFP-RAB4B with TagRFP-MON2 in
15 HEK293 cells and imaged the cells by confocal microscopy (Figure 3a, b). EEs form
16 ring-like structures in some cell types (Wilson et al., 2000). Similar to RAB5 (Hirota
17 et al., 2007), EEs showed larger ring-like shapes in some cells when EGFP-SNX3 was
18 overexpressed. These SNX3-EE rings advantageously enabled a clearer observation of
19 MON2 contacts with endosomal membranes (Figure 3c and Movie 1, all movies can be
20 downloaded from:
21 https://drive.google.com/drive/folders/1beD9ONP9k8yKECHoApZhTgk1qomEHxlz?
22 usp=sharing). Time-lapse imaging demonstrated MON2-positive RE often approached
23 and transiently contacted the edge of SNX3-positive EE ring. SNX3-positive EE that
24 associated with MON2-positive RE did not fuse; rather, these EE remained segregated
25 and subsequently retreated back to the cytoplasm. RAB4B co-localized with MON2-
26 positive RE and displayed the same bidirectional movement. Notably, this movement
27 was observed in the vesicular/tubular structures (marked by arrowheads in Figure 3d)
28 that approached, made contact with, and separated from the ring-shaped endosomes
15
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 16 of 54
1 (Movie 2). These results indicate that RE transiently interact with EE through
2 bidirectional movement.
3
4 MON2 is required for RE segregation from EE
5 To examine MON2 function on RE trafficking, we examined loss of MON2 or
6 DOPEY function on localization of RE labeled by RAB4B. EE and Golgi were marked
7 by TagBFP-SNX3 and Scarlet-Giantin, respectively. All gene KO in this study were
8 confirmed by genome sequence (Supplemental Table. 1) and immunoblotting with 9 available antibodies againstFor MON2, Peer VPS35, Review and DOPEY1 (Supplemental Figure. S4a). 10 In WT cells, RAB4B-positive RE localized in three places: the perinuclear region near
11 the Golgi ribbon, the tubular/vesicular structures associated with the EE membrane, and
12 the peripheral cytoplasmic dots (Figure 4a). In contrast, RAB4B fluorescence in the
13 Giantin-positive Golgi was almost undetectable in cells deleted for MON2. Instead, in
14 MON2-KO cells, RAB4B co-localized with SNX3, suggesting it was mainly in EE
15 region (Figure 4a). Quantification of RAB4B co-localization with these markers in the
16 perinuclear regions was performed using multiple images (n=12 for WT cells; n=10 for
17 MON2-KO cells) (Figure 4b). The Pearson’s correlation coefficient (PCC) for EGFP-
18 RAB4B versus Scarlet-Giantin changed significantly from 0.691±0.029 in WT cells to
19 0.405±0.037 in MON2-KO cells, suggesting that RAB4B-positive RE near the Golgi
20 region decreased in MON2-KO cells. The re-distribution of RAB4B to the Golgi was
21 rescued by expressing TagRFP-MON2 in MON2-KO cells (Supplemental Figure S4b),
22 demonstrating the functionality of TagRFP-MON2 and that RAB4B mislocalization is
23 caused by MON2 deletion.
24 To determine the contributions of DOPEY proteins to RE distribution, we next
25 analyzed the localization of RAB4B in DOPEY1-KO, DOPEY2-KO, and DOPEY1
26 and DOPEY2 double-KO (D-KO) cells. RAB4B localization was only minimally
27 affected in DOPEY1-KO cells. Unexpectedly, in DOPEY2-KO and D-KO cells,
28 RAB4B localization increased around the Golgi and disappeared in the peripheral dots
16
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 17 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 and around EE membrane (Supplemental Figure S4c). To verify the RAB4B
2 localization more clearly, cells were treated with nocodazole to introduce mini-stacks.
3 After nocodazole treatment, RAB4B was co-localized with Giantin in D-KO cells, but
4 was concentrated in SNX3-positive structures in MON2-KO cells (Supplemental
5 Figure S4d). These results demonstrate that deletion of MON2 and DOPEY have
6 distinct phenotypes on RE localization and therefore suggest a more complex
7 relationship than expected (See Discussion part).
8 In mammalian cells, RE are also present as dense tubular networks (Xie et al., 9 2016). To determine Forif MON2 Peer contributes Reviewto the formation of this tubular network, we 10 compared the localization of RAB4B-positive RE in WT and in MON2-KO cells by
11 live-cell imaging. Reticular-like networks were readily observed and the tubules
12 showed dynamic movement in WT cells (Movie 3). In contrast the dynamic tubular
13 networks were lost in MON2-KO cells. These results indicate that MON2 is required
14 for tubularization of RE at the site of EE and regulates the movement of RE.
15
16 MON2 is required for recycling of transferrin receptor
17 The requirement of MON2 for maintenance of RE structures prompted us to
18 investigate if MON2 plays a role in endocytic recycling. One of well-known RE marker
19 is transferrin receptor (TfnR), which continuously recycles between PM and endocytic
20 system (Kobayashi and Fukuda, 2013; Maxfield and McGraw, 2004). When endocytic
21 recycling is impaired, the steady state level of TfnR is altered. We analyzed the TfnR
22 level in MON2-KO and VPS35-KO cells. The steady-state levels of TfnR do not
23 depend on VPS35 (Kvainickas et al., 2017). As shown in Figure 5a, the levels of TfnR
24 was unaffected in VPS35-KO cells. In contrast, the steady-state levels of TfnR were
25 increased in MON2-KO cells, suggesting that the MON2 is affected the TfnR recycling.
26 To further investigate this phenotype, fluorescently-labeled transferrin (Tfn-488) was
27 internalized for 1 h at 4C in WT and MON2-KO cells, after which the cells were 28 chased and quantified for their intracellular fluorescence. The intracellular fluorescence
17
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 18 of 54
1 of Tfn-488 decreased more slowly in MON2-KO cells (t1/2 = ~20 min) than in WT cells
2 (t1/2 = ~10 min) (Figure. 5b) suggesting the increased levels of TfnR is due to its 3 increased intracellular retention. We next checked the localization of endogenous TfnR
4 by compared with EE marker SNX3 in WT and MON2-KO cells. In WT cells, TfnR-
5 positive dots were separated from SNX3-positive EE (Figure 5c). In contrast, TfnR was
6 accumulated around EE in MON2-KO cells. Quantitative analysis revealed that the co-
7 localization of TfnR with SNX3 was increased (Figure 5d), suggesting that MON2 is
8 required for efficient recycling of TfnR. 9 For Peer Review 10 Wls passes through RE for retrograde transport to the Golgi
11 Wls is a critical cargo receptor for the secretion of Wnt proteins (Banziger et al.,
12 2006), and undergoes continuous recycling between the PM, EE, and Golgi (Gasnereau
13 et al., 2011; Port et al., 2008). In EE, the SNX3-retromer complex is needed for
14 recognition and enrichment of Wls (Harterink et al., 2011; Zhang et al., 2011). MON2
15 is required for Wls recycling (McGough et al., 2018) but at which specific steps remains
16 to be determined. We hypothesized that the MON2-DOPEY complex mediates
17 abscission of Wls-containing vesicular carriers from EE. To test this hypothesis, we
18 analyzed the steady-state localizations of Wls-EGFP in the Golgi (marked with Scarlet-
19 Giantin), EE (marked with TagBFP-SNX3), and RE (marked with TagRFP-MON2).
20 Wls-EGFP was primarily localized to the Golgi in WT cells. Both SNX3- and MON2-
21 positive endosomes contained Wls-EGFP signals (Supplemental Figure S5).
22 Furthermore, the compartments containing both Wls-EGFP and TagRFP-MON2
23 exhibited co-movement during live-cell imaging (Figure 6a, Movie 4), suggesting that
24 MON2-positive RE contain Wls as cargo molecules.
25 Is endocytosed Wls transported from EE to the Golgi directly, or does it pass
26 through RE? To determine the route of the PM-localized Wls, we took advantage of an
27 HA-tagged Wls construct (HA-Wls), in which an HA-tag was inserted in the first
28 extracellular loop (Varandas et al., 2016). WT cells expressing HA-Wls were labeled
18
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 19 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 with an anti-HA antibody for 15 min, after which the cells were chased in normal
2 medium. HA-Wls accumulated at SNX3-labeled EE after a 15-min chase (data not
3 shown). After a 60-min chase, HA-Wls was mainly co-localized with MON2-positive
4 RE (Figure 6b), suggesting that HA-Wls was transported to RE after its presence in EE.
5 The observation that endocytosed HA-Wls passes through RE prompted us to
6 examine the requirement of MON2 for transport of Wls from EE to the Golgi. After
7 Wls internalization, its localization was examined by microscopy in WT and MON2-
8 KO cells. EGFP-SNX3 and TagRFP-RAB4B were used as an EE and RE marker, 9 respectively. Initially,For HA-Wls Peer was mainly Review localized to the PM and partly at SNX3- 10 positive EE in both WT and MON2-KO cells (Figure 7a). After a 20-min chase, HA-
11 Wls started to appear at both EE and RE, with an almost equal distribution. After an
12 80-min chase, the localization of HA-Wls at SNX3-positive EE was reduced in WT
13 cells, whereas HA-Wls in RAB4B-positive RE remained constant. In MON2-KO cells,
14 however, HA-Wls remained localized at SNX3-positive EE (Figure 7a). Furthermore,
15 the localization of HA-Wls in RAB4B-positive RE continuously increased
16 (Supplemental Figure S6a, b). These results demonstrate that Wls is accumulated at EE
17 and RE in MON2-KO cells.
18 Next, transport of HA-Wls to the Golgi was examined. We labeled RE and the
19 Golgi with EGFP-RAB4B and Scarlet-Giantin, respectively. Notably, RAB4B
20 localization that was predominantly around the Golgi in WT cells was decreased in
21 MON2-KO cells (Figure 4a). After chasing for 60 and 120 min, HA-Wls was
22 predominantly localized to the Golgi in WT cells but remained co-localized with
23 RAB4B-positive compartments and barely appeared in the Giantin-positive Golgi in
24 MON2-KO cells (Figure 7b). Quantitative analysis further revealed that the localization
25 of HA-Wls with Giantin was not increased in MON2-KO cells (Supplemental Figure
26 S6c, d). Taken together, these results indicate that transport of Wls from RE to the Golgi
27 is impaired by MON2 deletion.
28
19
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 20 of 54
1 The steady state of Wls-EGFP is mis-localized to lysosome in MON2-KO cells
2 To analyze where Wls is trafficked in MON2-KO cells, we examined its steady
3 state levels and localization. It is reported that deletion of VPS35 causes Wls mis-
4 localization to lysosomes (Port et al., 2008; Yang et al., 2008). Wls-EGFP localization
5 was analyzed with the endogenous Golgi marker Giantin and lysosome marker LAMP1.
6 In WT cells, Wls-EGFP was mainly localized at the Golgi (Supplemental Figure S7a).
7 In contrast, intracellular punctate fluorescent signals of Wls-EGFP appeared in VPS35-
8 KO and MON2-KO cells. These punctate structures co-localized with the lysosomal 9 marker LAMP1. QuantitativeFor Peeranalysis of Wls-EGFPReview revealed that the co-localization 10 of Wls-GFP with Giantin was significantly reduced in MON2-KO and VPS35-KO cells
11 (Supplemental Figure S7b), while that with LAMP1 was increased (Supplemental
12 Figure S7c). To confirm the result, we analyzed the localization of HA-Wls at 120 min
13 after starting the endocytosis. The localization of HA-Wls was compared with that of
14 LAMP1. In WT cells, HA-Wls was accumulated at Golgi-like structures (Figure 7b),
15 whereas it did not colocalize with LAMP1 (Supplemental Figure S7d). In MON2-KO
16 cells, HA-Wls started to co-localize with LAMP1 partially (Supplemental Figure S7d).
17 Taken together, these results indicate that Wls is missorted to lysosomes when MON2
18 is deleted.
19
20
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 21 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Discussion
2 In the present study, we demonstrate that the MON2 regulates RE distribution and
3 movement, which are required for retrograde transport of Wls from EE to the Golgi
4 (Figure 8). In MON2-KO cells, RAB4B-positive RE were retained around EE. As a
5 consequence, recycling of endocytic cargos like Wls and TfnR, which pass through RE,
6 was impaired.
7 MON2 was first reported to localize at the TGN in HeLa cells (Mahajan et al., 2013),
8 although a subsequent study revealed that endogenous MON2 may reside in both the 9 Golgi and RE (MahajanFor et al., 2019).Peer In the Review present study, we carefully checked MON2 10 localization and found that both EGFP and TagRFP-tagged MON2 localized at
11 perinuclear regions as well as in peripheral dots. The Golgi and perinuclear RE tubules
12 are both concentrated at the MTOC in cells (Saraste and Prydz, 2019). Analysis of mini-
13 stacks introduced by nocodazole revealed that MON2, like RE markers, was localized
14 at trans-side of the stacks (Fujii et al., 2020). Both MON2-positive perinuclear regions
15 and peripheral dots were merged with RE markers, suggesting that MON2 localizes at
16 RE.
17 We found that both DOPEY1 and DOPEY2 interacted with MON2. Furthermore,
18 ectopic MON2 expression shifted the cytoplasmic localization of DOPEY1 and
19 DOPEY2 to RE localization, demonstrating that MON2 recruits both DOPEY1 and
20 DOPEY2 to the RE membrane. Although MON2 forms a complex with both DOPEY1
21 and DOPEY2, the localization of RAB4B differed in each of the deletion cells (Figure
22 4a and Supplemental Figure S4a). One possible explanation for these markedly
23 different phenotypes is that the bidirectional transport of RE. The N-terminal of
24 DOPEY1 interacts with a motor protein, kinesin-1 (Mahajan et al., 2019). Our
25 preliminary experiment also showed that MON2-DOPEY has binding abilities to
26 kinesin and dynein/dynactin motor proteins (Supplemental Figure S8), suggesting that
27 the MON2-DOPEY complex drives the RE movement through motor proteins. In
28 DOPEY-KO cells, pre-existing RE would fail to move toward EE so accumulate at
21
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 22 of 54
1 Golgi. On the other hand, MON2 might regulate DOPEY-motor activity at the site of
2 RE generation on EE. In MON2-KO cells, failure to segregate newly synthesized
3 tubular RE from EE results in Wls accumulation near EE structures (Figure 8).
4 Recycling of Wls was impaired in MON2-KO cells. Wls continually undergoes
5 recycling between the plasma membrane, EE and the Golgi (Harterink et al., 2011; Port
6 et al., 2008), whereas it has remained unclear whether Wls is directly transported from
7 EE to the Golgi or through RE. We showed that endocytic Wls is transported to MON2-
8 and RAB4B-positive RE, indicating that Wls is recycled back to the Golgi through RE. 9 The SNX3-retromer For complex Peer is essential Review for the recognition of Wls and ATP9A is 10 responsible for the membrane deformation that is required for carrier formation
11 (McGough et al., 2018). It has been reported that ATP9A is also localized at RE
12 (Tanaka et al., 2016). The MON2-DOPEY complex associates with ATP9A and SNX3
13 (McGough et al., 2018), and could play roles in carrier transport.
14 On the other hand, knockdown of MON2 accelerates the transport of Furin and CI-
15 M6PR from endosome to TGN (Mahajan et al., 2013). Furin is trafficked to the TGN
16 directly through late endosomes without passing RE compartment (Mallet and Maxfield,
17 1999), and CI-M6PR is a cargo of SNX-BAR carriers (Kvainickas et al., 2017).
18 Compared with the long tubular carriers formed by SNX-BAR, the membrane carriers
19 containing Wls, which are formed by the ATP9A-SNX3-retromer, are vesicular
20 (Harterink et al., 2011). The evidence support that retrograde transport of Furin and CI-
21 M6PR is independent of MON2 function. Depletion of MON2 causes SNX3-retromer
22 blockade and may accelerate the transport of Furin and CI-M6PR to the Golgi due to
23 upregulation of other retrograde pathways such as SNX-BAR.
24 It is well established that several mechanisms including actin-driven, dynein-driven,
25 and ER-endosome contact site-driven processes are involved in the fission of SNX-
26 BAR tubules from LE (Daly and Cullen, 2018). However, less is known about how the
27 SNX3-retromer complex carriers are excised from EE. Under live-cell imaging, we
28 observed that peripheral MON2-positive RE approached SNX3-labeled EE, displayed
22
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 23 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 a transient interaction, and then separated from them. This behavior is similar to the
2 ‘hug-and-kiss’ model proposed for receipt of COPII vesicles by the cis-Golgi at the
3 endoplasmic reticulum exit sites (Kurokawa et al., 2014). One model that our data
4 support is that pre-existing RE interacts with newly synthesized RE at the tubular EE
5 through the bidirectional movement on microtubules, and Wls may be incorporated
6 from EE to RE. Once Wls has been transported to RE, it is delivered to the TGN. These
7 possibilities will be addressed in future investigations. 8 For Peer Review
23
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 24 of 54
1 Acknowledgment
2 We thank Drs Hideki Nakanishi (Jiangnan University) and Yasuyuki Suda (University
3 of Tsukuba) for their critical reading of the manuscript and comments. This work was
4 supported by grants-in-aid from the National Natural Science Foundation of China
5 (31770853, 21778023), the Young Thousand Program (to M. Fujita), the Program of
6 Introducing Talents of Discipline to Universities (111-2-06), National first-class
7 discipline program of Light Industry Technology and Engineering (LITE2018-015),
8 Top-notch Academic Programs Project of Jiangsu Higher Education Institutions, and 9 the International JointFor Research Peer Laboratory Review for Investigation of Glycoprotein 10 Biosynthesis at Jiangnan University.
11 12 Conflict of interest 13 The authors declare that they have no conflicts of interest with the contents of this
14 article. 15
24
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 25 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Reference 2 Bai, Z. and Grant, B.D. 2015. A TOCA/CDC-42/PAR/WAVE functional module 3 required for retrograde endocytic recycling. Proc Natl Acad Sci U S A, 112: E1443- 4 1452. 5 Banziger, C., Soldini, D., Schutt, C., Zipperlen, P., Hausmann, G., and Basler, K. 2006. 6 Wntless, a conserved membrane protein dedicated to the secretion of Wnt proteins 7 from signaling cells. Cell, 125: 509-522. 8 Barbosa, S., Pratte, D., Schwarz, H., Pipkorn, R., and Singer-Kruger, B. 2010. 9 Oligomeric Dop1p is part of the endosomal Neo1p-Ysl2p-Arl1p membrane 10 remodeling complex. Traffic, 11: 1092-1106. 11 Bhattacharyya, D., Hammond, A.T., and Glick, B.S. 2010. High-quality 12 immunofluorescence of cultured cells. Methods Mol Biol, 619: 403-410. 13 Bolte, S. and Cordelieres,For F.P. Peer 2006. A Review guided tour into subcellular colocalization 14 analysis in light microscopy. J Microsc, 224: 213-232. 15 Cullen, P.J. and Steinberg, F. 2018. To degrade or not to degrade: mechanisms and 16 significance of endocytic recycling. Nat Rev Mol Cell Biol, 19: 679-696. 17 D'Souza, R.S., Semus, R., Billings, E.A., Meyer, C.B., Conger, K., and Casanova, J.E. 18 2014. Rab4 orchestrates a small GTPase cascade for recruitment of adaptor proteins 19 to early endosomes. Curr Biol, 24: 1187-1198. 20 Daly, J.L. and Cullen, P.J. 2018. Endoplasmic Reticulum-Endosome Contact Sites: 21 Specialized Interfaces for Orchestrating Endosomal Tubule Fission? Biochemistry, 22 57: 6738-6740. 23 Day, K.J., Casler, J.C., and Glick, B.S. 2018. Budding Yeast Has a Minimal 24 Endomembrane System. Dev Cell, 44: 56-72 e54. 25 de Wit, H., Lichtenstein, Y., Kelly, R.B., Geuze, H.J., Klumperman, J., and van der 26 Sluijs, P. 2001. Rab4 regulates formation of synaptic-like microvesicles from early 27 endosomes in PC12 cells. Mol Biol Cell, 12: 3703-3715. 28 Delevoye, C., Miserey-Lenkei, S., Montagnac, G., Gilles-Marsens, F., Paul-Gilloteaux, 29 P., Giordano, F., Waharte, F., Marks, M.S., Goud, B., and Raposo, G. 2014. 30 Recycling endosome tubule morphogenesis from sorting endosomes requires the 31 kinesin motor KIF13A. Cell Rep, 6: 445-454. 32 Efe, J.A., Plattner, F., Hulo, N., Kressler, D., Emr, S.D., and Deloche, O. 2005. Yeast 33 Mon2p is a highly conserved protein that functions in the cytoplasm-to-vacuole 34 transport pathway and is required for Golgi homeostasis. J Cell Sci, 118: 4751-4764. 35 Etoh, K. and Fukuda, M. 2019. Rab10 regulates tubular endosome formation through 36 KIF13A and KIF13B motors. J Cell Sci, 132. 37 Fujii, S., Kurokawa, K., Inaba, R., Hiramatsu, N., Tago, T., Nakamura, Y., Nakano, A., 38 Satoh, T., and Satoh, A.K. 2020. Recycling endosomes attach to the trans-side of 39 Golgi stacks in Drosophila and mammalian cells. J Cell Sci. 40 Gasnereau, I., Herr, P., Chia, P.Z., Basler, K., and Gleeson, P.A. 2011. Identification 41 of an endocytosis motif in an intracellular loop of Wntless protein, essential for its 42 recycling and the control of Wnt protein signaling. J Biol Chem, 286: 43324-43333.
25
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 26 of 54
1 Gautreau, A., Oguievetskaia, K., and Ungermann, C. 2014. Function and regulation of 2 the endosomal fusion and fission machineries. Cold Spring Harb Perspect Biol, 6. 3 Gillingham, A.K., Whyte, J.R., Panic, B., and Munro, S. 2006. Mon2, a relative of large 4 Arf exchange factors, recruits Dop1 to the Golgi apparatus. J Biol Chem, 281: 2273- 5 2280. 6 Grant, B.D. and Donaldson, J.G. 2009. Pathways and mechanisms of endocytic 7 recycling. Nat Rev Mol Cell Biol, 10: 597-608. 8 Green, E.G., Ramm, E., Riley, N.M., Spiro, D.J., Goldenring, J.R., and Wessling- 9 Resnick, M. 1997. Rab11 is associated with transferrin-containing recycling 10 compartments in K562 cells. Biochem Biophys Res Commun, 239: 612-616. 11 Harterink, M., Port, F., Lorenowicz, M.J., McGough, I.J., Silhankova, M., Betist, M.C., 12 van Weering, J.R.T., van Heesbeen, R., Middelkoop, T.C., Basler, K., Cullen, P.J., 13 and Korswagen, H.C. 2011. A SNX3-dependent retromer pathway mediates 14 retrograde transportFor of the PeerWnt sorting Review receptor Wntless and is required for Wnt 15 secretion. Nat Cell Biol, 13: 914-923. 16 Hirokawa, N., Noda, Y., Tanaka, Y., and Niwa, S. 2009. Kinesin superfamily motor 17 proteins and intracellular transport. Nat Rev Mol Cell Biol, 10: 682-696. 18 Hirota, Y., Kuronita, T., Fujita, H., and Tanaka, Y. 2007. A role for Rab5 activity in 19 the biogenesis of endosomal and lysosomal compartments. Biochem Biophys Res 20 Commun, 364: 40-47. 21 Jovic, M., Sharma, M., Rahajeng, J., and Caplan, S. 2010. The early endosome: a busy 22 sorting station for proteins at the crossroads. Histol Histopathol, 25: 99-112. 23 Klumperman, J. and Raposo, G. 2014. The complex ultrastructure of the endolysosomal 24 system. Cold Spring Harb Perspect Biol, 6: a016857. 25 Kobayashi, H. and Fukuda, M. 2013. Arf6, Rab11 and transferrin receptor define 26 distinct populations of recycling endosomes. Commun Integr Biol, 6: e25036. 27 Kurokawa, K., Okamoto, M., and Nakano, A. 2014. Contact of cis-Golgi with ER exit 28 sites executes cargo capture and delivery from the ER. Nat Commun, 5: 3653. 29 Kvainickas, A., Jimenez-Orgaz, A., Nagele, H., Hu, Z., Dengjel, J., and Steinberg, F. 30 2017. Cargo-selective SNX-BAR proteins mediate retromer trimer independent 31 retrograde transport. J Cell Biol, 216: 3677-3693. 32 Liu, Y.S., Guo, X.Y., Hirata, T., Rong, Y., Motooka, D., Kitajima, T., Murakami, Y., 33 Gao, X.D., Nakamura, S., Kinoshita, T., and Fujita, M. 2018. N-Glycan-dependent 34 protein folding and endoplasmic reticulum retention regulate GPI-anchor processing. 35 J Cell Biol, 217: 585-599. 36 Mahajan, D., Boh, B.K., Zhou, Y., Chen, L., Cornvik, T.C., Hong, W., and Lu, L. 2013. 37 Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no 38 guanine nucleotide exchange activity toward Arl1 GTPase. Sci Rep, 3: 3362. 39 Mahajan, D., Tie, H.C., Chen, B., and Lu, L. 2019. Dopey1-Mon2 complex binds to 40 dual-lipids and recruits kinesin-1 for membrane trafficking. Nat Commun, 10: 3218. 41 Mallet, W.G. and Maxfield, F.R. 1999. Chimeric forms of furin and TGN38 are 42 transported with the plasma membrane in the trans-Golgi network via distinct
26
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 27 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 endosomal pathways. J Cell Biol, 146: 345-359. 2 Martin, M. and Akhmanova, A. 2018. Coming into Focus: Mechanisms of Microtubule 3 Minus-End Organization. Trends Cell Biol, 28: 574-588. 4 Maxfield, F.R. and McGraw, T.E. 2004. Endocytic recycling. Nat Rev Mol Cell Biol, 5 5: 121-132. 6 McGough, I.J., de Groot, R.E.A., Jellett, A.P., Betist, M.C., Varandas, K.C., Danson, 7 C.M., Heesom, K.J., Korswagen, H.C., and Cullen, P.J. 2018. SNX3-retromer 8 requires an evolutionary conserved MON2:DOPEY2:ATP9A complex to mediate 9 Wntless sorting and Wnt secretion. Nat Commun, 9: 3737. 10 Perrin, L., Lacas-Gervais, S., Gilleron, J., Ceppo, F., Prodon, F., Benmerah, A., Tanti, 11 J.F., and Cormont, M. 2013. Rab4b controls an early endosome sorting event by 12 interacting with the gamma-subunit of the clathrin adaptor complex 1. J Cell Sci, 13 126: 4950-4962. 14 Pfeffer, S.R. 2013. RabFor GTPase Peer regulation Review of membrane identity. Curr Opin Cell Biol, 15 25: 414-419. 16 Pfeffer, S.R. 2017. Rab GTPases: master regulators that establish the secretory and 17 endocytic pathways. Mol Biol Cell, 28: 712-715. 18 Port, F., Kuster, M., Herr, P., Furger, E., Banziger, C., Hausmann, G., and Basler, K. 19 2008. Wingless secretion promotes and requires retromer-dependent cycling of 20 Wntless. Nat Cell Biol, 10: 178-185. 21 Purushothaman, L.K. and Ungermann, C. 2018. Cargo induces retromer-mediated 22 membrane remodeling on membranes. Mol Biol Cell, 29: 2709-2719. 23 Ren, M., Xu, G., Zeng, J., De Lemos-Chiarandini, C., Adesnik, M., and Sabatini, D.D. 24 1998. Hydrolysis of GTP on rab11 is required for the direct delivery of transferrin 25 from the pericentriolar recycling compartment to the cell surface but not from sorting 26 endosomes. Proc Natl Acad Sci U S A, 95: 6187-6192. 27 Saraste, J. and Prydz, K. 2019. A New Look at the Functional Organization of the Golgi 28 Ribbon. Front Cell Dev Biol, 7: 171. 29 Scott, C.C., Vacca, F., and Gruenberg, J. 2014. Endosome maturation, transport and 30 functions. Semin Cell Dev Biol, 31: 2-10. 31 Shakya, S., Sharma, P., Bhatt, A.M., Jani, R.A., Delevoye, C., and Setty, S.R. 2018. 32 Rab22A recruits BLOC-1 and BLOC-2 to promote the biogenesis of recycling 33 endosomes. EMBO Rep, 19. 34 Sonnichsen, B., De Renzis, S., Nielsen, E., Rietdorf, J., and Zerial, M. 2000. Distinct 35 membrane domains on endosomes in the recycling pathway visualized by multicolor 36 imaging of Rab4, Rab5, and Rab11. J Cell Biol, 149: 901-914. 37 Taguchi, T. 2013. Emerging roles of recycling endosomes. J Biochem, 153: 505-510. 38 Tanaka, Y., Ono, N., Shima, T., Tanaka, G., Katoh, Y., Nakayama, K., Takatsu, H., and 39 Shin, H.W. 2016. The phospholipid flippase ATP9A is required for the recycling 40 pathway from the endosomes to the plasma membrane. Mol Biol Cell, 27: 3883-3893. 41 Ullrich, O., Reinsch, S., Urbe, S., Zerial, M., and Parton, R.G. 1996. Rab11 regulates 42 recycling through the pericentriolar recycling endosome. J Cell Biol, 135: 913-924.
27
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 28 of 54
1 Varandas, K.C., Irannejad, R., and von Zastrow, M. 2016. Retromer Endosome Exit 2 Domains Serve Multiple Trafficking Destinations and Regulate Local G Protein 3 Activation by GPCRs. Curr Biol, 26: 3129-3142. 4 Wilson, J.M., de Hoop, M., Zorzi, N., Toh, B.H., Dotti, C.G., and Parton, R.G. 2000. 5 EEA1, a tethering protein of the early sorting endosome, shows a polarized 6 distribution in hippocampal neurons, epithelial cells, and fibroblasts. Mol Biol Cell, 7 11: 2657-2671. 8 Xie, S., Bahl, K., Reinecke, J.B., Hammond, G.R., Naslavsky, N., and Caplan, S. 2016. 9 The endocytic recycling compartment maintains cargo segregation acquired upon 10 exit from the sorting endosome. Mol Biol Cell, 27: 108-126. 11 Xu, Y., Hortsman, H., Seet, L., Wong, S.H., and Hong, W. 2001. SNX3 regulates 12 endosomal function through its PX-domain-mediated interaction with PtdIns(3)P. 13 Nat Cell Biol, 3: 658-666. 14 Yang, P.T., Lorenowicz,For M.J., Peer Silhankova, Review M., Coudreuse, D.Y., Betist, M.C., and 15 Korswagen, H.C. 2008. Wnt signaling requires retromer-dependent recycling of 16 MIG-14/Wntless in Wnt-producing cells. Dev Cell, 14: 140-147. 17 Zhang, P., Wu, Y., Belenkaya, T.Y., and Lin, X. 2011. SNX3 controls Wingless/Wnt 18 secretion through regulating retromer-dependent recycling of Wntless. Cell Res, 21: 19 1677-1690. 20 Zhao, S.B., Suda, Y., Nakanishi, H., Wang, N., Yoko, O.T., Gao, X.D., and Fujita, M. 21 2019. Yeast Dop1 is required for glycosyltransferase retrieval from the trans-Golgi 22 network. Biochim Biophys Acta Gen Subj, 1863: 1147-1157. 23
24
28
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 29 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Figure legends 2 Figure 1. MON2 associates with both DOPEY1 and DOPEY2.
3 a and b, HEK293 cells stably expressing DOPEY1-3FLAG (a) or DOPEY2-3FLAG (b)
4 were transiently transfected with 3HA-sOGT or 3HA-MON2. Cell lysates were
5 incubated with anti-FLAG beads, and precipitates were immunoblotted with the
6 indicated antibodies. 3HA-sOGT was used as a negative control.
7 c and d, Representative confocal images of EGFP-tagged DOPEY1 (c) and DOPEY2
8 (d). HEK293 cells were transiently transfected with the indicated constructs.
9 Endogenous Giantin was immunostained as a Golgi marker. The enlarged images show
10 magnified views of theFor boxed Peerareas. Scale Reviewbars, 10 μm.
11
12 Figure 2. Subcellular localization of MON2.
13 a, Representative confocal images of MON2. HEK293 cells were transiently
14 transfected with constructs for expression of fluorescent-tagged proteins. Endogenous
15 Golgin97 and GM130 were immunostained as Golgi markers. Enlarged images show
16 magnified views of the boxed areas. Scale bars, 10 μm.
17 b, Quantitative analysis of protein co-localization. MCCs between two proteins were
18 calculated using the ImageJ plugin JACoP. M1 represents the fraction of the red
19 channel that overlapped with the green channel. M2 represents the fraction of the green
20 channel that overlapped with the red channel. The data represent means ± SE of the
21 measurements. The numbers of cells used in the calculations are indicated in the
22 parentheses.
23
24 Figure 3. Transient contact between the MON2-positive compartment and an SNX3-
25 labeled EE.
26 a and b, Representative images from time-lapse videos (Movies 1 and 2,
27 https://drive.google.com/drive/folders/1beD9ONP9k8yKECHoApZhTgk1qomEHxlz?
28 usp=sharing) of HEK293 cells co-expressing TagRFP-MON2 and EGFP-SNX3 (a) or
29 EGFP-RAB4B (b). Scale bars, 10 μm.
29
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 30 of 54
1 c, Time-lapse images of the area shown in (a) at the indicated time points. The
2 arrowheads indicate a representative TagRFP-MON2-labeled structure approaching
3 and making contact with an EGFP-SNX3-labeled endosome.
4 d, Time-lapse images of the area shown in (b) at the indicated time points. The
5 arrowheads and arrows indicate movement of a compartment labeled by TagRFP-
6 MON2 and EGFP-RAB4B that approached, made contact with, and separated from a
7 ring-shaped endosome marked by the asterisk.
8 9 Figure 4. LocalizationFor of RE inPeer WT and MON2-KO Review cells 10 a, Representative merged confocal images of RAB4B-positive RE. HEK293 WT or
11 MON2-KO cells were transiently transfected with TagBFP-SNX3, EGFP-RAB4B, and
12 Scarlet-Giantin. Enlarged images show magnified views of the boxed areas. Scale bars,
13 10 μm.
14 b, Quantitative analysis of co-localization between TagBFP-SNX3, EGFP-RAB4B,
15 and Scarlet-Giantin in the perinuclear region. PCCs between two proteins were
16 calculated using the ImageJ plugin JACoP. The data represent means ± SE of the
17 measurements (N=12 for WT cells; N=10 for MON2-KO cells). ***, P < 0.001 (two-
18 tailed Student’s t test).
19
20 Figure 5. MON2 is required for optimal TfnR recycling
21 a, Immunoblotting of endogenous TfnR in HEK293 (WT), VPS35-KO and MON2-KO
22 cells (left). Tubulin was used as a loading control. Quantification of TfnR in indicated
23 cells (right). Data represent means ± SE (n = 3, **, P < 0.01).
24 b, HEK293 (WT) or MON2-KO cells were incubated with CF488A-Tfn at 4°C for 1 h,
25 and then chased at 37°C. Data represent means ± SE, with normalization by the cell
26 number in each field. *, P < 0.05; **, P < 0.01, compared with control cells.
27 c, Endogenous TfnR and SNX3 were immunostained in HEK293 (WT) and MON2-
28 KO cells. Scale bars, 10 μm.
30
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 31 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 d, Quantification of co-localization of TfnR with SNX3 by PCC. Data represent means
2 ± SE, ***, P < 0.001 (two-tailed Student’s t test).
3
4 Figure 6. Endocytic Wls passes through RE
5 a, Time-lapse images from a video (Movie 4) of a cell co-expressing TagRFP-MON2
6 and Wls-EGFP. The arrowheads and arrows indicate Wls migrating with MON2. Scale
7 bar, 5 μm.
8 b, Representative confocal images of HA-Wls, EGFP-SNX3, and TagRFP-MON2 in 9 HEK293 cells. The enlargedFor imagesPeer show Reviewmagnified views of the boxed areas. After a 10 60-min chase, the localization of surface-labeled HA-Wls was observed. The
11 arrowheads indicate HA-Wls that localized at MON2-positive endosomes, in which
12 SNX3-labeled EEs were absent. Scale bar, 10 μm.
13
14 Figure 7. Retrograde transport of Wls to the Golgi is impaired in MON2-KO cells
15 a, Representative confocal images of HA-Wls, EGFP-SNX3, and TagRFP-RAB4B in
16 HEK293 WT or MON2-KO cells. Enlarged images show magnified views of the boxed
17 areas. Images were taken at the indicated times after chasing of surface-labeled HA-
18 Wls. Scale bars, 10 μm. See Supplemental Figure S6a and b for quantitative analyses.
19 b, Representative confocal images of HA-Wls, EGFP-RAB4B, and Scarlet-Giantin in
20 HEK293 WT or MON2-KO cells. The enlarged images show magnified views of the
21 boxed areas. Images were taken at the indicated times after chasing of surfaced-labeled
22 HA-Wls. Scale bars, 10 μm. See Supplemental Figure S6c and d for quantitative
23 analyses.
24
25 Figure 8. Summary model that MON2-DOPEY complex guides Wls transport to the
26 Golgi through RE.
27 At EE, cargoes such as Wls were incorporated to the carrier formed through SNX3 and
28 ATP9A function (McGough et al., 2018). Pre-existing RE approach and contact with
31
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 32 of 54
1 the EE to take newly synthesized RE tubules through the DOPEY protein function, then
2 separate from EE through bidirectional movement mediated by MON2-DOPEY
3 complex. 4
For Peer Review
32
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 33 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Supplemental Figure S1. Membrane association of DOPEY1 and DOPEY2
2 a, DOPEY2-3FLAG was stably expressed in HEK293 cells. Cell lysates were subjected
3 to IP with anti-FLAG beads and the precipitates eluted with FLAG peptide. Precipitated
4 proteins were detected by silver staining. The upper and lower bands indicated by the
5 arrowhead and arrow, and that are absent in HEK293 controls were identified as
6 DOPEY2 and MON2, respectively, by liquid chromatography-tandem mass
7 spectrometry.
8 b, Membrane fractions were prepared from cells stably expressing DOPEY1-3FLAG 9 or DOPEY2-3FLAG.For Proteins Peer were separated Review by SDS-PAGE and immunoblotted with 10 anti-FLAG (DOPEY1-3FLAG or DOPEY2-3FLAG), anti-CANX (endoplasmic
11 reticulum), and anti-β-tubulin (cytosol) antibodies.
12
13 Supplemental Figure S2. Localization of TagRFP-MON2 under nocodazole treatment.
14 a and b, HEK293 cells were transiently transfected with TagRFP-MON2 and
15 mNeonGreen-Giantin. After treatment with 33 μM nocodazole for 3 h, cells were fixed
16 and stained with GM130 (a) or Golgin97 (b). The enlarged images show magnified
17 views of mini-stacks. Scale bars, 10 μm.
18
19 Supplemental Figure S3. Localization of TagRFP-MON2 with EE or LE markers.
20 HEK293 cells were transiently transfected with TagRFP-MON2 and EGFP-tagged
21 RAB5, SNX3, RAB7, RAB5 Q79L as endosome markers, or with TagRFP-RAB4B
22 and EGFP-SNX3. The enlarged images show magnified views of the boxed areas. Scale
23 bars, 10 μm.
24
25 Supplemental Figure S4. Localization of RAB4B in MON2-KO and DOPEY-KO cells.
26 a, Immunoblotting of endogenous DOPEY1, MON2, and VPS35 in HEK293 WT,
27 VPS35-KO, MON2-KO, and DOPEY1/DOPEY2 (D-KO) cells. Tubulin was used as a
28 loading control.
33
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 34 of 54
1 b, Representative merged confocal images of RAB4B-positive RE in MON2-KO and
2 rescued cells. HEK293 or MON2-KO cells were transiently transfected with TagBFP-
3 SNX3 and EGFP-RAB4B with/without TagRFP-MON2. The Golgi apparatus was
4 stained with anti-GM130. The enlarged images show magnified views of the boxed
5 areas. Scale bars, 10 μm.
6 c, Representative merged confocal images of RAB4B-positive RE in DOPEY-KO cells.
7 HEK293 WT, DOPEY1-KO, DOPEY2-KO, and DOPEY1/DOPEY2-double KO (D-
8 KO) cells were transiently transfected with TagBFP-SNX3, EGFP-RAB4B, and 9 Scarlet-Giantin. The Forenlarged Peerimages show Review magnified views of the boxed areas. Scale 10 bars, 10 μm.
11 d, Representative merged confocal images of RAB4B-positive RE in WT, D-KO and
12 MON2-KO cells. TagBFP-SNX3, EGFP-RAB4B, and Scarlet-Giantin were transiently
13 transfected into indicated cells then treated with 33 μ M nocodazole for 3 h. The
14 enlarged images show magnified views of mini-stacks. Scale bars, 10 μm.
15
16 Supplemental Figure S5. Localization of Wls at steady state condition.
17 Representative confocal images of Wls-EGFP with mScarlet-Giantin, TagBFP-SNX3
18 or TagRFP-MON2 in HEK293 cells. The enlarged images show magnified views of
19 the boxed areas. Wls-EGFP was mainly localized at Golgi at the steady state when the
20 construct was expressed. When Wls-EGFP was co-expressed with SNX3, Wls-EGFP
21 localized at the dot-like structures becomes obvious as well as the Golgi-like
22 localization, fractions of which were merged with SNX3. When Wls-EGFP was co-
23 expressed with MON2, it was localized at dot-like structures and the Golgi, most of
24 which were colocalized with MON2. Since Wls is a cargo for SNX3-Retromer
25 (Harterink et al., 2011) and MON2 is involved in the transport, co-expressing Wls with
26 SNX3 or MON2 may induce the formation of the carriers (Purushothaman and
27 Ungermann, 2018). Scale bars, 10 μm.
28
34
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 35 of 54 innovative, web-based, database-driven peer review and online submission workflow solution
1 Supplemental Figure S6. Quantitation of HA-Wls co-localization with EE, RE or Golgi
2 markers.
3 a and b, Quantification of co-localization of HA-Wls with EGFP-SNX3 or TagRFP-
4 RAB4B by MCCs. M1 represents the fraction of HA-Wls overlapping with EGFP-
5 SNX3 or TagRFP-RAB4B. The data represent means ± SE of the measurements. The
6 numbers of cells used in the calculations are indicated in the bars.
7 c and d, Quantification of co-localization of HA-Wls with EGFP-RAB4B or Scarlet-
8 Giantin by MCCs. M1 represents the fraction of HA-Wls overlapping with EGFP- 9 RAB4B or Scarlet-Giantin.For The Peer data represent Review means ± SE of the measurements. The 10 numbers of cells used in the calculations are indicated in the bars. 11 12 Supplemental Figure S7. Wls-EGFP is missorted and degraded in lysosomes in MON2-
13 KO cells.
14 a, Representative confocal images of Wls-EGFP in HEK293 WT, MON2-KO, and
15 VPS35-KO cells. Endogenous Giantin and LAMP1 were immunostained as markers
16 for the Golgi and lysosomes, respectively. Scale bars, 10 μm.
17 b and c, Quantification of co-localization of Wls-EGFP with Giantin or LAMP1 by
18 MCCs. M1 represents the fraction of Wls-EGFP overlapping with Giantin or LAMP1,
19 while M2 represents the fraction of Giantin or LAMP1 overlapping with Wls-EGFP.
20 The data represent means ± SE of the measurements. The numbers of cells used in the
21 calculations are indicated. ***, P < 0.001 (two-tailed Student’s t test).
22 d, Representative confocal images of HA-Wls and LAMP1 in HEK293 WT or MON2-
23 KO cells. The enlarged images show magnified views of the boxed areas. Images were
24 taken at the 120 min after chasing of surfaced-labeled HA-Wls. Scale bars, 10 μm.
25
26 Supplemental Figure S8. The MON2-DOPEY complex interacts with kinesin and
27 dynactin
28 HEK293 cells stably expressing DOPEY1-3FLAG or DOPEY2-3FLAG were
29 transiently co-transfected with TagRFP-MON2 and HA-tagged sOGT, KLC2, or
35
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) innovative, web-based, database-driven peer review and online submission workflow solution Page 36 of 54
1 DCTN1. Cell lysates were incubated with anti-FLAG beads and precipitates
2 immunoblotted with the indicated antibodies. Numbers below each lane are the relative
3 levels of HA-tagged proteins, normalized to sOGT-HA, and were quantified by ImageJ.
4
5 Supplemental Table S1. Genomic DNA sequences of WT and CRISPR-Cas9 KO target
6 genes.
7
8 Movie legends 9 Movie 1, InteractionFor of TagRFP-MON2 Peer Review with EGFP-SNX3-positive EE. TagRFP- 10 MON2 and EGFP-SNX3 were co-expressed in HEK293 cells. Images were obtained
11 with a Leica SP8.
12 Movie 2, Movement of EGFP-RAB4B and TagRFP-MON2. HEK293 cells co-
13 expressing TagRFP-MON2 and EGFP-RAB4B were analyzed. Images were obtained
14 with a Leica SP8.
15 Movie 3, Tubular network of EGFP-RAB4B-positive RE. HEK293 (WT, left) and
16 MON2-KO (right) cells expressing EGFP-RAB4B were analyzed. Image intensity was
17 enhanced to observe the tubules clearly as described in materials and methods.
18 Movie 4, Movement of Wls-EGFP and TagRFP-MON2. HEK293 cells co-expressing
19 TagRFP-MON2 and Wls-EGFP were analyzed. Images were obtained with a Leica SP8.
20
36
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Page 37 of 54 innovative, web-based, database-driven peer review and online submission workflow solution Figure 1 Total IP:FLAG Total IP:FLAG DOPEY1-3FLAG DOPEY1-3FLAG DOPEY2-3FLAG DOPEY2-3FLAG
a DOPEY1 b DOPEY2- -3FLAG 250 3FLAG 250 250 250 3HA-MON2 3HA-MON2 150 150
100 100
75 75 For Peer3HA-sOGT Review 3HA-sOGT
Giantin DOPEY1-FLAG- Merge EnlargedEnlarge c EGFP
Giantin DOPEY2-FLAG- Merge EnlargedEnlarge EGFP
TagRFP-MON2 DOPEY1-FLAG- Merge Enlarged d EGFP
TagRFP-MON2 DOPEY2-FLAG- Merge Enlarged EGFP
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Figure innovative,2 web-based, database-driven peer review and online submission workflow solution Page 38 of 54 a Enlarged Enlarged TagRFP-MON2/EGFP-MON2 Golgin97/EGFP-MON2 DAPI EGFP-MON2 DAPI EGFP-MON2
TagRFP-MON2 Merge Golgin97 Merge
GM130/EGFP-MON2 TagRFP-MON2/EGFP-RAB4A DAPI EGFP-MON2 DAPI EGFP-RAB4A B For Peer Review
GM130 Merge TagRFP-MON2 Merge
TagRFP-MON2/EGFP-RAB4B TagRFP-MON2/EGFP-RAB11 DAPI EGFP-RAB4B DAPI EGFP-RAB11
TagRFP-MON2 Merge TagRFP-MON2 Merge
0.8 b M1 0.7 M2 0.6
0.5
coefficients 0.4
0.3
0.2 Manders 0.1
0 MON2 Golgin97 vs EGFP-MON2 EGFP-SNX3 EGFP-RAB5 EGFP-RAB7 EGFP-MON2 vs EGFP-SNX3 EGFP-RAB11 EGFP-RAB4B EGFP-RAB4A Japan Science and Technology Information Aggregator, Electronic (J-STAGE) TagRFP-RAB4B GM130 vs EGFP- TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 vs TagRFP-MON2 TagRFP-MON2 vs TagRFP-MON2 EGFP-RAB5Q70L (N=21) (N=13) (N=14) (N=15) (N=15) (N=15) (N=19) (N=16) (N=18) (N=10) (N=24) FigurePage 39 of 54 innovative,3 web-based, database-driven peer review and online submission workflow solution
a EGFP-SNX3/TagRFP-MON2 b EGFP-RAB4B/TagRFP-MON2
For Peer Review
c
47 s 63 s
65 s 81 s
83 s 99 s
10 s 26 s d * * * * * * * * *
28 s 44 s * * * * * * * * *
46 s 62 s
* * * * * * * * *
64 s 80 s
* * *
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Figure innovative,4 web-based, database-driven peer review and online submission workflow solution Page 40 of 54 Enlarged
a TagBFP-SNX3/EGFP- TagBFP-SNX3 EGFP-RAB4B RAB4B/Scarlet-Giantin
WT Scarlet-Giantin Merge
For Peer Review
TagBFP-SNX3/EGFP- TagBFP-SNX3 EGFP-RAB4B RAB4B/Scarlet-Giantin
MON2 -KO Scarlet-Giantin Merge
b 0.8 *** 0.7 WT 0.6 MON2-KO 0.5
0.4
0.3 perinuclear region perinuclear
0.2
0.1 PCC of PCC Japan0 Science and Technology Information Aggregator, Electronic (J-STAGE) BFP-SNX3 vs BFP-SNX3 vs EGFP-RAB4B vs EGFP-RAB4B Scarlet-Giantin Scarlet-Giantin FigurePage 41 of 54 innovative,5 web-based, database-driven peer review and online submission workflow solution
1.2 a b WT MON2-KO 1 * 1.6 KO KO ** - - 1.4 Tfn 0.8 ** 1.2 levels WT VPS35 MON2 1 0.6 ** 100 0.8 TfnR TfnR 75 0.6 0.4 * 0.4 For Peer Review Intracellular Tubulin 50 Relative 0.2 0.2 (Normalized (Normalized intensity) 0 KO KO WT 0 - - 5 min 10 min 15 min 20 min 30 min VPS35 MON2 c d TfnR SNX3 Merge WT 0.5 ***
0.4
0.3 and SNX3
TfnR 0.2 MON2-KO
PCC of 0.1
0
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Figure innovative,6 web-based, database-driven peer review and online submission workflow solution Page 42 of 54
a 10.36 s 34.04 s Wls- For Peer Review EGFP/ 45.88 s 81.4 s TagRFP-
MON2 85.84 s 119.88 s
b HA-Wls/EGFP- HA-Wls EGFP-SNX3 SNX3/TagRFP-MON2
TagRFP-MON2 Merge
60 min
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) FigurePage 43 of 54 innovative,7 web-based, database-driven peer review and online submission workflow solution a WT MON2-KO HA-Wls/EGFP- Enlarged Enlarged HA-Wls/EGFP- SNX3/TagRFP-RAB4B SNX3/TagRFP-RAB4B HA-Wls EGFP-SNX3 HA-Wls EGFP-SNX3
0 min TagRFP-RAB4B Merge TagRFP-RAB4B Merge
HA-Wls EGFP-SNX3 HA-Wls EGFP-SNX3
20 For Peer Review min TagRFP-RAB4B Merge TagRFP-RAB4B Merge
HA-Wls EGFP-SNX3 HA-Wls EGFP-SNX3
80 min TagRFP-RAB4B Merge TagRFP-RAB4B Merge
WT MON2-KO b HA-Wls/EGFP- Enlarged Enlarged HA-Wls/EGFP- RAB4B/Scarlet-Giantin RAB4B/Scarlet-Giantin HA-Wls EGFP-RAB4B HA-Wls EGFP-RAB4B
60 min Scarlet-Giantin Merge Scarlet-Giantin Merge
HA-Wls EGFP-RAB4B HA-Wls EGFP-RAB4B
120 min Scarlet-Giantin Merge Scarlet-Giantin Merge Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Figure innovative,8 web-based, database-driven peer review and online submission workflow solution Page 44 of 54
For Peer Review
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) SupplementalPage 45 of 54 innovative, web-based, Figure database-driven S1 peer review and online submission workflow solution
a
DOPEY2 240 For MON2Peer Review 140
115
80
b Total S100 P10 P100 Total S100 P10 P100
DOPEY1 DOPEY2 -3FLAG 270 -3FLAG 270
-Tubulin 50 -Tubulin 50
100 100 CANX CANX 80 80
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Supplementalinnovative, web-based, Figure database-driven S2 peer review and online submission workflow solution Page 46 of 54
TagRFP-MON2/mNeonGreen- a Giantin/GM130 3h nocodazole
For Peer Review
TagRFP-MON2/mNeonGreen- b Giantin/Golgin97 3h nocodazole
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) SupplementalPage 47 of 54 innovative, web-based, Figure database-driven S3 peer review and online submission workflow solution
TagRFP-MON2 EGFP-RAB5 Merge Enlarged
TagRFP-MON2 EGFP-SNX3 Merge Enlarged For Peer Review
TagRFP-MON2 EGFP-RAB7 Merge Enlarged
TagRFP-MON2 EGFP-RAB5Q79L Merge Enlarged
TagRFP-RAB4B EGFP-SNX3 Merge Enlarged
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Supplementalinnovative, web-based, Figure database-driven S4 peer review and online submission workflow solution Page 48 of 54 KO KO - - KO -
a WT VPS35 MON2 D
DOPEY1 250 250 MON2 150 100 VPS35 70
Tubulin For Peer Review 50
b MON2-KO+ MON2-KO TagRFP-MON2 Enlarged GM130/EGFP- Enlarged GM130/EGFP-RAB4B RAB4B/TagRFP-MON2 GM130 EGFP-RAB4B GM130 EGFP-RAB4B
Empty Merge TagRFP-MON2 Merge
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) SupplementalPage 49 of 54 innovative, web-based, Figure database-driven S4 peer review and online submission workflow solution c Enlarged Enlarged
HEK293 TagBFP-SNX3 EGFP-RAB4B DOPEY2-KO TagBFP-SNX3 EGFP-RAB4B
Scarlet-Giantin Merge Scarlet-Giantin Merge
DOPEY1-KO TagBFP-SNX3 EGFP-RAB4B D-KO TagBFP-SNX3 EGFP-RAB4B For Peer Review Scarlet-Giantin Merge Scarlet-Giantin Merge
d BFP-SNX3/EGFP-RAB4B/Scarlet-Giantin 3h nocodazole
HEK293 MON2-KO D-KO
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Supplementalinnovative, web-based, Figure database-driven S5 peer review and online submission workflow solution Page 50 of 54
mScarlet-Giantin Wls-EGFP Merge Enlarged
For Peer Review
TagBFP-SNX3 Wls-EGFP Merge Enlarged
TagRFP-MON2 Wls-EGFP Merge Enlarged
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) SupplementalPage 51 of 54 innovative, web-based, Figure database-driven S6 peer review and online submission workflow solution
a M1 of HA-Wls vs EGFP-SNX3 b M1 of HA-Wls vs TagRFP-RAB4B 0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3 coefficients coefficients
0.2 For Peer Review0.2 Manders Manders 0.1 0.1
0 N=12 N=9 N=8 N=6 N=5 N=8 0 N=12 N=9 N=8 N=6 N=5 N=8 WT MON2 KO WT MON2 KO 0 min 20 min 80 min 0 min 20 min 80 min
c M1 of HA-Wls vs EGFP-RAB4B d M1 of HA-Wls vs Scarlet-Giantin 0.7 0.7
0.6 0.6
0.5 0.5
0.4 0.4
coefficients 0.3 coefficients 0.3
0.2 0.2 Manders Manders 0.1 0.1
0 N=13 N=18 N=8 N=16 0 N=13 N=18 N=8 N=16 WT MON2 KO WT MON2 KO 60min 120min 60min 120min
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Supplementalinnovative, web-based, Figure database-driven S7 peer review and online submission workflow solution Page 52 of 54 Wls-EGFP Giantin Merge Wls-EGFP LAMP1 Merge a
WT
VPS35 -KO
MON2 For Peer Review -KO
b Wls-EGFP vs Giantin c Wls-EGFP vs LAMP1 *** *** 0.7 *** 0.7 *** 0.6 M1 0.6 M1 0.5 M2 0.5 M2
0.4 0.4
coefficients 0.3 coefficients 0.3
0.2 0.2
Manders 0.1 Manders 0.1
0 0 WT VPS35 KO MON2 KO WT VPS35 KO MON2 KO N=31 N=26 N=42 N=23 N=19 N=21
LAMP1 HA-Wls Merge Enlarged 1 Enlarged 2 d WT 2
1
MON2-KO
1
120 min endocyticmin 120 Japan Science and Technology Information Aggregator, Electronic (J-STAGE)
2 SupplementalPage 53 of 54 innovative, web-based, Figure database-driven S8 peer review and online submission workflow solution
Total IP:FLAG Total IP:FLAG DOPEY1-3FLAG DOPEY1-3FLAG DOPEY2-3FLAG DOPEY2-3FLAG
DOPEY1- DOPEY2- 3FLAG For Peer250 Review3FLAG 250 TagRFP- TagRFP- MON2 MON2 150 150
150 150
100 100 Anti:HA Anti:HA 75 75
1 2.5 1.1 1 8.9 10.5 1 3.6 0.6 1 17.3 12.1
Japan Science and Technology Information Aggregator, Electronic (J-STAGE) Supplementalinnovative, web-based, Table database-driven S1 peer review and online submission workflow solution Page 54 of 54
>MON2-WT aaaccacagtggctacgagctgttgcggtggaatcaa >MON2-KO type1(ΔGC) aaaccacagtggctacgagctgtt..ggtggaatcaa >MON2-KO type2(+A) aaaccacagtggctacgagctgttgAcggtggaatcaa >VPS35-WT acatcagtgattccatggattttgtactgctcaactttgcagaaatgaacaagctctgggtgcgaatgcagcatcaggg acatagccgagatagagaaaaaagagaacgagaaagacaagaactgagaattttagtgggaacaaatttggtgcgcctc agtcagttggaaggtgtaaatgtggaacgtt >VPS35-KO type1(Δ147bp) acatcagtgattccatgga...... ggaaggtgtaaatgtggaacgtt For Peer Review >DOPEY1-KO(WT） AAACGCCTAGCTCAATGTCTACATCCAGCATTACCAGGTGGAGTTCATCGGAAGGCGCTTGAAACATATGAAATTATCT TCAAAATAATTGGACCTAAGCGACTTGCCAAAGATCTTTTT >DOPEY1-KO(Δ87bp) AAACGCCTAGCT...... CGACTTGCCAAAGATCTTTTT
>DOPEY2-KO (WT) CCTCTCCTGGCACACGCGGCGGTGTCGGTGAGGCCGGTGCTGCTCACCCTGTACGAGAAGTACTTCCTCCCACTGCAGA >DOPEY2-KO (Δ31bp) CCTCTCCTGGCACACGCGGCGG...... CGAGAAGTACTTCCTCCCACTGCAGA
>DOPEY1 in D-KO(WT） AAACGCCTAGCTCAATGTCTACATCCAGCATTACCAGGTGGAGTTCATCGGAAGGCGCTTGAAACATATGAAATTATCT TCAAAATAATTGGACCTAAGCGACTTGCCAAAGATCTTTTT >DOPEY1-KO in D-KO type1(Δ87bp) AAACGCCTAGCT...... CGACTTGCCAAAGATCTTTTT >DOPEY1-KO in D-KO type2(Δ88bp) AAACGCCTAGC...... CGACTTGCCAAAGATCTTTTT
>DOPEY2 in D-KO(WT) CCTCTCCTGGCACACGCGGCGGTGTCGGTGAGGCCGGTGCTGCTCACCCTGTACGAGAAGTACTTCCTCCCACTGCAGA >DOPEY2-KO in D-KO (Δ31bp) CCTCTCCTGGCACACGCGGCGG...... CGAGAAGTACTTCCTCCCACTGCAGA
Japan Science and Technology Information Aggregator, Electronic (J-STAGE)